WorldWideScience

Sample records for tiempo real rt

  1. Sistemas de tiempo real y sistemas distribuidos de tiempo real

    OpenAIRE

    Pesado, Patricia Mabel; Ramón, Hugo Dionisio; Boracchia, Marcos; Pasini, Ariel C.; De Vito, María Cecilia; Osella Massa, Germán Leandro; Estrebou, César Armando

    2006-01-01

    El proyecto de investigación y desarrollo en Sistemas de Software Distribuido, abarca aspectos que van desde los fundamentos del desarrollo (Técnicas de Ingeniería de Requerimientos, Metodologías de Gestión y Desarrollo de Proyectos, Técnicas de Planificación, Métricas, Normas de Calidad, Web-Systems) hasta la concepción de aplicaciones específicas orientadas a los procesos industriales (Sistemas de Planeamiento de Producción, Control Industrial en tiempo real), procesos de E-government (Voto...

  2. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  3. Detección mediante RT-PCR en tiempo real del virus vacunal en cerdos inmunizados con la vacuna cubana contra la peste porcina clásica

    Directory of Open Access Journals (Sweden)

    Tania Campos-Cuello

    2016-08-01

    Full Text Available La peste porcina clásica (PPC es una enfermedad viral infectocontagiosa, producida por un virus ARN del género Pestivirus, familia Flaviviridae. En la actualidad es una de las causas de pérdidas económicas en la industria porcina a nivel mundial. En su prevención se han utilizado vacunas vivas atenuadas, empleando la cepa China lapinizada. La Reacción en Cadena de la Polimerasa Reverso Transcriptasa (RT-PCR ha sido uno de los métodos más sensibles aplicado en Medicina Veterinaria para la detección de virus ARN. En el caso del virus de la PPC es muy útil porque el ácido nucleico se puede detectar desde muy temprano en la infección y en periodos más largos en aquellos animales que se recuperan. El objetivo de este estudio fue aplicar la técnica de RT-PCR en tiempo real para la detección de la cepa China lapinizada de la vacuna cubana contra la PPC. Las tonsilas de los cerdos vacunados fueron el órgano más positivo en la detección del ARN del virus vacunal. Los resultados obtenidos evidenciaron una interferencia del virus vacunal en el diagnóstico, siendo el día 12 posvacunación en el que se obtiene una emisión umbral de fluorescencia más bajo.

  4. Módulo Distribuido de Subasta Java sobre CORBA de Tiempo Real

    Directory of Open Access Journals (Sweden)

    P. Basanta-Val

    2012-10-01

    Full Text Available Resumen: El uso de infraestructuras middleware que permitan intercomunicar diferentes nodos de un sistema puede aliviar aspectos importantes relacionados con el coste de desarrollo y mantenimiento de dichos sistemas en entornos flexibles. En este contexto el artículo presenta una arquitectura desarrollada dentro del contexto de los sistemas de subasta distribuidos que tienen ciertos requisitos de tiempo real que han de ser satisfechos. Dicha arquitectura implementa un sistema de puja doble (CDA para un sistema de tiempo real industriales. El artículo presenta tanto la arquitectura del sistema con sus diferentes actores así como una evaluación en una plataforma real utilizando middleware de tiempo real ya existente. Abstract: Using middleware infrastructures that enable communication among different nodes in a system may alleviate aspects related to management and development cost in flexible environments. In that context the article presents an auction architecture with certain real-time requirements that have to be satisfied. The architecture implements a continuous double action (CDA algorithm for a real-time middleware. The article describes the architecture (actors and goals and the results obtained by using common-off-the-shelf real-time middleware. Palabras clave: Sistema de Subasta, Informática Industrial, Middleware, Tiempo Real, RT-CORBA, Real-time Java, Keywords: Action Systems, Real-time, Middleware, Industrial informatics, RT-CORBA, Real-time Java

  5. Detección mediante RT-PCR en tiempo real del virus vacunal en cerdos inmunizados con la vacuna cubana contra la peste porcina clásica

    OpenAIRE

    Tania Campos-Cuello; Laura Coroas-González; Livany Martínez-Rodríguez

    2016-01-01

    La peste porcina clásica (PPC) es una enfermedad viral infectocontagiosa, producida por un virus ARN del género Pestivirus, familia Flaviviridae. En la actualidad es una de las causas de pérdidas económicas en la industria porcina a nivel mundial. En su prevención se han utilizado vacunas vivas atenuadas, empleando la cepa China lapinizada. La Reacción en Cadena de la Polimerasa Reverso Transcriptasa (RT-PCR) ha sido uno de los métodos más sensibles aplicado en Medicina Veterinaria para la de...

  6. Alternativas eficientes para procesamiento y comunicaciones en sistemas de tiempo real

    OpenAIRE

    Romero, Fernando; Méndez, Mariano; Encinas, Diego; De Giusti, Armando Eduardo; Tinetti, Fernando Gustavo; Medina, Santiago; Pi Puig, Martín; Paniego, Juan Manuel; Dell'Oso, Matías

    2017-01-01

    El objetivo de esta línea de investigación es el estudio y desarrollo de Sistemas de Tiempo Real (STR), en particular, la planificación de tareas y la comunicación en Sistemas Distribuidos de Tiempo Real (SDTR), experimentando con microcontroladores y simulaciones para la adquisición y control de las variables del sistema.

  7. Evaluación de sistemas operativos de tiempo real sobre microcontroladores

    OpenAIRE

    Medina, Santiago; Pi Puig, Martín; Paniego, Juan Manuel; Dell'Oso, Matías; Romero, Fernando; De Giusti, Armando Eduardo; Tinetti, Fernando Gustavo

    2015-01-01

    En el presente trabajo se presentan mediciones sobre diferentes sistemas operativos que soportan las características de tiempo real, instalados sobre un sistema de microcontrolador. Dichas evaluaciones caracterizan los posibles tiempos de respuesta, es decir, un límite que determina el tipo de aplicación en la cual pueden ser utilizados, dentro del marco del desarrollo de aplicaciones de Sistemas Embebidos de Tiempo Real. Una de las principales métricas es el tiempo de latencia, el cual repre...

  8. Reconstrucción de la dinámica de los tiempos de ejecución de tareas en tiempo real empleando filtrado digital difuso

    Directory of Open Access Journals (Sweden)

    Jorge Salvador Valdez Martínez

    2014-01-01

    Full Text Available Los sistemas en tiempo real (STR procesan sus actividades a través de tareas que a su vez están formadas por un conjunto de instancias, las cuales tienen seis restricciones temporales: tiempo de arribo, tiempo de inicio, tiempo de ejecución, tiempo de finalizado, tiempo excedente y plazo. De estas seis restricciones, el tiempo de ejecución depende directamente del software y hardware de la computadora, originando que la variación de esta restricción temporal esté vinculada con diversos factores externos e internos, esta variación puede ocasionar que algunas instancias no cumplan su plazo; por este motivo es importante proponer un modelo para reconstruir el comportamiento de los tiempos de ejecución, con el fin de: dimensionar de manera correcta el sistema en tiempo real, proponer técnicas adecuadas de tolerancia a fallos y mejorar sus módulos de operación. Por lo cual en este trabajo, se propone un modelo para reconstruir los tiempos de ejecución obtenidos de la medición hecha a un algoritmo de programación elaborado en el sistema operativo en tiempo real QNX Neutrino 6.5. Dicha reconstrucción se hace a través de un modelo tipo autoregresivo de promedios móviles integrado con un estimador de parámetros construido con un procedimiento de filtrado digital difuso (FDD. Se usa el error cuadrático medio para validar la reconstrucción, el cual converge a una región cercana a cero y permite concluir que la reconstrucción es buena.

  9. Ingeniería de software de sistemas distribuidos de tiempo real modelización y evaluación de las restricciones de tiempo

    OpenAIRE

    De Giusti, Armando Eduardo; Ramón, Hugo Dionisio; Fernández, Pamela; Artime, Andrea

    1998-01-01

    Se presenta un análisis de las extensiones en la metodología clásica de análisis y diseño de software, orientada a sistemas distribuidos de tiempo real (SDTR). En particular se discute el modo de modelizar y verificar las restricciones de tiempo, utilizando Redes de Petri extendidas. A modo de ejemplo concreto de aplicación se analiza el desarrollo de un sistema de software que detecta en tiempo real el corte de cables telefónicos troncales y utiliza información de GIS para alertar a ...

  10. Utilización de memorias cache con bloqueo en sistemas de tiempo real.

    OpenAIRE

    Martí Campoy, Antonio

    2015-01-01

    Los procesadores actuales ofrecen una relación precio prestaciones muy interesante, además de otras cualidades como la garantía de funcionamiento o la gran disponibilidad de herramientas de desarrollo. Este conjunto de virtudes los hace muy atractivos para el desarrollo de cualquier sistema informático, incluidos los sistemas de tiempo real (STR). Sin embargo, los sistemas de tiempo real necesitan verificar no sólo la corrección de los cálculos y operaciones que realizan, sino que también ...

  11. SISTEMA DE ADQUISICION DE DATOS PARA SIMULACION EN TIEMPO REAL DE PROTECCIONES DIGITALES

    Directory of Open Access Journals (Sweden)

    Antonio A Martinez García

    2011-03-01

    Full Text Available En el presente trabajo se explica el desarrollo de un sistema de adquisición de datos y el software relacionado que permite modelar en tiempo real, a nivel de laboratorio decente de protecciones, el trabajo de diferentes protecciones digitales. Se relacionan los resultados del caso de la protección de sobrecorriente tiempo inverso.  The present paper describes an algorithm used in the location of faults in high voltage power lines, when only measurements of one local end are presented. A discussion of the results and accuracy are also presented.

  12. Gestión del tiempo ocioso dinámico para ajustar el consumo de energía en tareas de tiempo real integrando control multifrecuencia

    Directory of Open Access Journals (Sweden)

    Alfonso Salvador Alfonsi Sebastiani

    2014-11-01

    Full Text Available Este trabajo tiene como objetivo ajustar la energía consumida por tareas de tiempo real críticas, producto de la variabilidad de sus tiempos de cómputo usando la integración del control multifrecuencia y la planificación realimentada. Se adaptaron e integraron técnicas dinámicas que manejan el tiempo ocioso debido al tiempo de ejecución en el peor caso, al factor de carga del procesador y el aprovechamiento del tiempo ocioso por estiramiento a la(s próxima(s activación(es, en una Técnica Dinámica Multifrecuencia para el Manejo del Tiempo Ocioso, alojada en un planificador realimentado para el ahorro de energía, dirigido a procesadores que varían el voltaje de alimentación y frecuencia de operación. Además se tomó ventaja de las técnicas de control multifrecuencia dado que la gestión de recursos es formulada como un problema de control de sistemas de cómputo que especifica a cada tarea por un lazo de control que trabaja a su propio periodo de activación, diferentes a los requeridos en la referencia y respuesta del sistema (factor de carga total del procesador.Los resultados arrojan que el tiempo ocioso debido a variabilidad de los tiempos de cómputo se distribuye de forma natural por los lazos de control multifrecuencia, global y localmente, pudiendo llegar a un ahorro de energía del 61,04%, dando un valor agregado Intra e InterTarea. Además, sugiere un buen desempeño al contrastarlo con otras estrategias.

  13. Datos en tiempo real: una aplicación a la regla de Taylor en Colombia

    OpenAIRE

    Bernal Nisperuza, Gloria Lucía; Táutiva Pradere, Johanna

    2011-01-01

    Los datos de variables macroeconómicas usados por los agentes y hacedores de política para la toma de decisiones y aquellos usados por los investigadores para la evaluación de dichas decisiones podrían no ser comparables, pues estos últimos son revisados y actualizados continuamente por las entidades estadísticas. Este trabajo construye una base de datos en tiempo real del PIB real de Colombia y estima una regla de Taylor usando dichos datos versus datos revisados. Se encuentra que el coefici...

  14. Sistema de adquisición de datos meteorológicos en tiempo real.

    OpenAIRE

    Guzmán Luna, Ricardo

    2014-01-01

    El objetivo de este trabajo fue desarrollar un sistema de adquisición de datos meteorológicos en tiempo real utilizando un controlador lógico programable (PLC) como una alternativa dentro de las estaciones meteorológicas comerciales. Para sensar la: temperatura del aire, humedad relativa, radiación solar, precipitación, velocidad y dirección del viento, se usaron sensores comerciales, durante el periodo comprendido entre el 23 de Mayo al 3 de Junio de 2013, para probar la estación, en la esta...

  15. Femtoquímica: reacciones en tiempo real, ?`Posibles aplicaciones en Astrofísica?

    Science.gov (United States)

    Douhal, Abderrazzak

    En esta conferencia, se mostrarán resultados de medidas en escala del femtosegundo por la primera vez obtenidos en España. Los sistemas elegidos muestran dinámicas que varían de 50 fs a centenas de picosegundo. La técnica usada (sumación de frecuencia) permite ver como ocurren las reacciones químicas y biológicas en tiempo real de reacciones. Su aplicación al estudio de las reacciones fotónicas en el espacio es evidente.

  16. Simulación en tiempo real de un MPC utilizando herramientas de software libre

    Directory of Open Access Journals (Sweden)

    Rafael F. Tanda Martínez

    2011-05-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} En este trabajo se implementa un controlador predictivo basado en modelos ARX en forma de bloque para el CACSD Scicos. El controlador es simulado sobre una plataforma RCP basada en herramientas de código abierto y libre distribución, como Scicoslab/Scicos, RTAI-LAB y el sistema operativo de tiempo real Linux/RTAI. Para la validación de esta estrategia de control se utiliza un proceso de segundo orden con un retardo considerablemente grande. La visualización y recolección de los datos, así como el ajuste de los parámetros de la tarea de tiempo real en ejecución se hacen mediante un osciloscopio virtual llamado Qrtailab.

  17. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various ...

  18. Detección de fraude bancario en tiempo real utilizando tecnologías de procesamiento distribuido

    OpenAIRE

    Mansilla Montero, Javier

    2016-01-01

    En este Trabajo de Fin de Máster se desarrollará un sistema de detección de fraude en pagos con tarjeta de crédito en tiempo real utilizando tecnologías de procesamiento distribuido. Concretamente se considerarán dos tecnologías: TIBCO, un conjunto de herramientas comerciales diseñadas para el procesamiento de eventos complejos, y Apache Spark, un sistema abierto para el procesamiento de datos en tiempo real. Además de implementar el sistema utilizando las dos tecnologías propuestas, un objet...

  19. 17th IEEE NPSS Real Time Conference – RT-2010

    CERN Multimedia

    Carlos Varandas

    2010-01-01

    Congress Centre of “Instituto Superior Técnico”, Lisboa, Portugal, 24-28 May, 2010 ABSTRACT SUBMISSION OPEN Abstract Submission Deadline: March 1st, 2010 Dear Sir/Madam, We are pleased to announce that abstract submission for the 17th IEEE NPSS Real Time Conference is now open on our web site. The deadline for submitting an abstract is 1st March 2010. Full conference details General Chairman

  20. Analyzer of neutron flux in real time; Analizador de flujo neutronico en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Rojas S, A.S.; Carrillo M, R.A.; Balderas, E.G. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1999-07-01

    With base in the study of the real signals of neutron flux of instability events occurred in the Laguna Verde nuclear power plant where the nucleus oscillation phenomena of the reactor are in the 0 to 2.5 Hz range, it has been seen the possibility about the development a surveillance and diagnostic equipment capable to analyze in real time the behavior of nucleus in this frequencies range. An important method for surveillance the stability of the reactor nucleus is the use of the Power spectral density which allows to determine the frequencies and amplitudes contained in the signals. It is used an instrument carried out by LabVIEW graphic programming with a data acquisition card of 16 channels which works at Windows 95/98 environment. (Author)

  1. Monitor of dynamic parameters in real time; Monitor de parametros dinamicos en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Rojas S, A.S.; Ruiz E, J.A. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)

    2008-07-01

    In the complex physical systems exist parameters that are necessary for monitoring in real time. In the nuclear industry, particularly in a reactor this surveillance is important, where the times of the reactions are almost instantaneous. Although many of these parameters are monitored, given the advance of the computer systems the monitoring could either be enlarged direct or indirect of other parameters. The analysis of the neutron noise in the nuclear reactors, plays an important role, the noise signal it contains information about the operation conditions of a system, when analyzing it with analysis methodologies of analogical signals to provide important information for the early detection of possible flaws and to indicate the permissible operation levels. To show the characteristics of the operation of the system of Monitoring of Dynamic Parameters in Real Time, oscillations of neutron noise of the TRIGA Mark III of the ININ were analyzed, these were caused with the control bar to a power of 10 Watts, the oscillations were carried out to a frequency of 1Hz, signal of low frequency. In this work a virtual instrument that allows by means of the spectral analysis method in frequency point by point is presented, to indicate in real time periodic variations that could be presented in the neutron noise signal, visualizing in advance the dynamic behavior of the system or nuclear plant. Another of the tests of the monitoring system presented is that of the oscillatory event happened in the reactor of Laguna Verde Nucleo electric Central, would be convenient to have an instrument of surveillance for monitoring through the neutron noise signal the behavior of some important parameter to predict and to indicate in an immediate way an abnormal condition in the reactor operation or in the plant system. These parameters can be the power, the recirculation water flow, etc. The monitor is based on a personal computer (PC), a data acquisition card (ADC) and a computer program

  2. Modelización formal y verificación automática de sistemas de tiempo real

    OpenAIRE

    Olivero, Alfredo; Gaudiani, Adriana; Maidana, Gabriela

    2000-01-01

    Los sistemas de tiempo-real son sistemas en los cuales el tiempo juega un rol fundamental. Ejemplos de estos sistemas son los controles automáticos de navegación de aviones, los protocolos de comunicación, los procesos industriales automatizados, cajeros automáticos, controladores de radar, etc. El carácter crítico, en más de un sentido, de esta clase de sistemas ha evidenciado la necesidad de proveer métodos formales para su especificación y posterior verificación. Además, su creciente compl...

  3. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  5. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas....... METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...... rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1...

  6. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  7. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR

    Czech Academy of Sciences Publication Activity Database

    Fajfr, M.; Neubauerová, V.; Pajer, P.; Kubíčková, P.; Růžek, Daniel

    2014-01-01

    Roč. 63, č. 3 (2014), s. 232-238 ISSN 1210-7913 Institutional support: RVO:60077344 Keywords : hemorrhagic fever * filovirus * arenavirus * real-time * RT-PCR – detection Subject RIV: EE - Microbiology, Virology Impact factor: 0.353, year: 2014

  8. AmbientRT - real time system software support for data centric sensor networks

    NARCIS (Netherlands)

    Hofmeijer, T.J.; Dulman, S.O.; Jansen, P.G.; Havinga, Paul J.M.

    We present the architecture and design of a real time operating system for mobile wireless sensor networks. AmbientRT is being developed for environments with very limited resources in order to relieve the burden of the developer and to efficiently use the resources of the node. This paper presents

  9. AmbientRT - real time system software support for data centric sensor networks

    NARCIS (Netherlands)

    Hofmeijer, T.J.; Dulman, S.O.; Jansen, P.G.; Havinga, Paul J.M.

    2004-01-01

    We present the architecture and design of a real time operating system for mobile wireless sensor networks. AmbientRT is being developed for environments with very limited resources in order to relieve the burden of the developer and to efficiently use the resources of the node. This paper presents

  10. Ese desconocido llamado tiempo

    OpenAIRE

    Bedoya Urrego, Isaura Esther

    2009-01-01

    ¿Qué es el tiempo? ¿Es real? ¿Es construcción humana, cultural? La reflexión en torno al tiempo se ha dado a través de la historia.  En ella se concentra el tiempo en el ser, el hacer y el pensar del hombre como individuo y en su grupo social, con signos, símbolos y significaciones propias del imaginario colectivo; entonces se evidencia que el tiempo individual conforma el tiempo social: alter y ego comparten sensaciones, miedos y acontecimientos en un espacio de manera dialógica: tu tiempo y...

  11. La diástasis del tiempo real, entre el mito, la praxis y el éskhaton

    Directory of Open Access Journals (Sweden)

    Cencillo, Luis

    2004-06-01

    Full Text Available Unlike physical time, which is what docks measure, living time is multidimensional because it concerns the very being of the living. For the living human being, time is existing; his experiencing time is his experiencing the active rhythm of his existing. This experiencing varies as it is either individual or collective, subjectal or socially committed in a praxis that produces «a world.» There are several modes, levels or rhythms of time (e. g., existential, junctural, terminal, as there are several —personally lived— experiences in time, such as that of anticipation, rush, changing (developmentally or abruptly or aging. Mythical time is not an historical time, yet it is not unreal: explains the origins of a people and their institutions or a regular phenomenon. Lived real time is the active dynamics of joining a past that remains as the effect of «past» (but operative causes, unfolding toward a future that begins to appear before our eyes —sometimes against our will—, with a present that is tension and sudden movement for a project that is still unreal. Existing is an organic and structured totality (Gestalt, which will terminate because of its very nature as an articulated process.

    A diferencia del tiempo físico, que es el que miden los relojes, el tiempo vital es múltiple, porque se trata del ser mismo del viviente. En el ser humano es el existir y su vivencia de tiempo es la vivencia de su ritmo vivo existiendo. Esta vivencia se diversifica en cuanto individual o en cuanto colectiva, en cuanto subjetal y en cuanto socialmente comprometida en una praxis productora de "mundo". Se pueden distinguir varias modalidades, niveles y ritmos de tiempo (v. g., un tiempo existencial, un tiempo coyuntural, un tiempo terminal, así como diversas experiencias personalmente vividas en el tiempo, como de anticipación, o de prisa, o de estar cambiando (evolutiva o abruptamente, o de envejecimiento. El tiempo mítico es un tiempo

  12. Marco de Componentes con soporte para reemplazo dinámico y seguro en sistemas de tiempo real

    Directory of Open Access Journals (Sweden)

    Julio Cano

    2014-01-01

    Full Text Available Resumen: En las últimas décadas se han aportado soluciones para el desarrollo de sistemas de tiempo real basados en componentes como base para aumentar la productividad y la fiabilidad de su desarrollo así como su posterior mantenimiento. De modo más reciente están apareciendo soluciones que permiten cierta flexibilidad en estos sistemas con miras a soportar ejecución dinámica a través de reemplazos de componentes en tiempo de ejecución. Para ello se adaptan los modelos de componentes intentando minimizar los conflictos que aparecen al integrar tiempo real y comportamiento dinámico y conseguir reemplazos de componentes en un tiempo acotado. Uno de los principales retos para esto es el cálculo de los tiempos requeridos por las diferentes operaciones necesarias para realizar un reemplazo de componente. El otro gran obstáculo es conocer los tiempos de operación de los componentes del sistema cuando la implementación de éstos puede cambiar durante la vida del sistema. En este trabajo se describe la implementación de un marco de componentes que aporta una solución parcial a estos problemas. Se proporciona un modelo de componentes junto con sus correspondientes algoritmos para asegurar que los componentes pueden ser cargados y reemplazados en tiempo de ejecución sin interferir en el cumplimiento de sus plazos de ejecución. El modelo está diseñado para evitar fallos en los reemplazos de componente. Finalmente se aporta la validación de los conceptos presentados. Abstract: In the last decades solutions have been provided for the real- time component-based systems development as a base to increase productivity and reliability of their development as well as their maintenance. Solutions are increasingly appearing that allow controlled flexibility in these systems, aiming to support dynamic execution through the component replacement at run-time. So, component models are adapted trying to minimize conflicts integrating real-time and

  13. Datos en tiempo real:una aplicación a la regla de taylor en Colombia

    OpenAIRE

    Gloria Lucía Bernal Nisperuza; Johanna Táutiva Pradere

    2011-01-01

    Los datos de variables macroeconómicas usados por los agentes y hacedores de política para la toma de decisiones y aquellos usados por los investigadores para la evaluación de dichas decisiones podrían no ser comparables, pues estos últimos son revisados y actualizados continuamente por las entidades estadísticas. Este trabajo construye una base de datos en tiempo real del PIB real de Colombia y estima una regla de Taylor usando dichos datos versus datos revisados. Se encuentra que el coefici...

  14. Real-Time-Simulation of IEEE-5-Bus Network on OPAL-RT-OP4510 Simulator

    Science.gov (United States)

    Atul Bhandakkar, Anjali; Mathew, Lini, Dr.

    2018-03-01

    The Real-Time Simulator tools have high computing technologies, improved performance. They are widely used for design and improvement of electrical systems. The advancement of the software tools like MATLAB/SIMULINK with its Real-Time Workshop (RTW) and Real-Time Windows Target (RTWT), real-time simulators are used extensively in many engineering fields, such as industry, education, and research institutions. OPAL-RT-OP4510 is a Real-Time Simulator which is used in both industry and academia. In this paper, the real-time simulation of IEEE-5-Bus network is carried out by means of OPAL-RT-OP4510 with CRO and other hardware. The performance of the network is observed with the introduction of fault at various locations. The waveforms of voltage, current, active and reactive power are observed in the MATLAB simulation environment and on the CRO. Also, Load Flow Analysis (LFA) of IEEE-5-Bus network is computed using MATLAB/Simulink power-gui load flow tool.

  15. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    Table 1. Real-time qRT-PCR verification of eight DEGS. Gene ID. Gene description. Gene expression RNA-seq comparisons log2(FC) Up/down. Primer sequence. (5' → 3'). Up. Up. Up. Up F: G. BMK.10019 Uncharacterized protein LOC100777071. JL2 vs YZ9253. 1.63. Up. F: TCTGGТGCTTATCGТССТ. JL2 vs JL7. 2.26.

  16. OR.NET RT: how service-oriented medical device architecture meets real-time communication.

    Science.gov (United States)

    Pfeiffer, Jonas H; Kasparick, Martin; Strathen, Benjamin; Dietz, Christian; Dingler, Max E; Lueth, Tim C; Timmermann, Dirk; Radermacher, Klaus; Golatowski, Frank

    2018-02-23

    Today's landscape of medical devices is dominated by stand-alone systems and proprietary interfaces lacking cross-vendor interoperability. This complicates or even impedes the innovation of novel, intelligent assistance systems relying on the collaboration of medical devices. Emerging approaches use the service-oriented architecture (SOA) paradigm based on Internet protocol (IP) to enable communication between medical devices. While this works well for scenarios with no or only soft timing constraints, the underlying best-effort communication scheme is insufficient for time critical data. Real-time (RT) networks are able to reliably guarantee fixed latency boundaries, for example, by using time division multiple access (TDMA) communication patterns. However, deterministic RT networks come with their own limitations such as tedious, inflexible configuration and a more restricted bandwidth allocation. In this contribution we overcome the drawbacks of both approaches by describing and implementing mechanisms that allow the two networks to interact. We introduce the first implementation of a medical device network that offers hard RT guarantees for control and sensor data and integrates into SOA networks. Based on two application examples we show how the flexibility of SOA networks and the reliability of RT networks can be combined to achieve an open network infrastructure for medical devices in the operating room (OR).

  17. Robot autónomo de vigilancia con procesamiento de imágenes en tiempo real

    OpenAIRE

    Reina Rodríguez, José Manuel

    2013-01-01

    El proyecto consiste en la realización de un robot terrestre autónomo móvil destinado a mejorar los servicios de vigilancia en recintos cerrados. Este robot es capaz de llevar a cabo un procesamiento de las imágenes adquiridas por la cámara en tiempo real, que junto con información recibida de sensores instalados en él, puede tomar decisiones respecto a su movimiento y lograr detectar en el entorno algún elemento en particular establecido previamente. Será controlado a través de una red Wi-Fi...

  18. Monitorización de la calidad del aire en tiempo real mediante el procesamiento de eventos complejos

    OpenAIRE

    Fernández de la Rosa, Iván

    2015-01-01

    El pilar fundamental de este TFG girará entorno a la monitorización de la calidad del aire en tiempo real, en el que se apoyará el objetivo principal, el cual consiste en la constante información y adecuación de dicha calidad del aire a determinados grupos de riesgo mediante el uso de tecnología aplicada al hogar. Para poder llevar acabo dicho propósito, se ideará una arquitectura que integre tanto Service-Oriented Architecture (SOA) como Complex Event Processing (CEP) cuyas principales fu...

  19. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  20. Meloidogyne javanica Chorismate Mutase Transcript Expression Profile Using Real-Time Quantitative RT-PCR

    OpenAIRE

    Painter, Janet E.; Lambert, Kris N.

    2003-01-01

    A developmental expression profile of the Meloidodgyne javanica esophageal gland gene chorismate mutase-1 (Mj-cm-1) could suggest when in the lifecycle of the nematode the Mj-cm-1 product is functional. This study used real-time quantitative RT-PCR to examine the variation in Mj-cm-1 transcript levels over six timepoints in the nematode lifecycle: egg, infective second-stage juveniles (Inf-J2), 2-day post-inoculation (pi), 7-day pi, 14-day pi, and adult. The Mj-cm-1 mRNA levels peaked at 2-da...

  1. Development of a Web application for a real time information system; Desarrollo de una aplicacion web para un sistema de informacion en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa R, Alfredo; Silva F, Brisa M; Quintero R, Agustin [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2007-07-01

    In this article its is described a technique for the development of a Web application for a real time information system that allows the remote and concurrent connection of different equipment to the network historical data base of the system, without the need of the installation of any software component in the remote equipment of the user who makes the consultation. It defines and establishes the software architecture that allows the development of the Web application, the analysis stages, the operation of the technology to be used, as well as the design, development and implementation of the application. Finally, the accomplishments obtained with the development of the Web application for a real time information system are described. [Spanish] En este articulo se describe una tecnica para el desarrollo de una aplicacion web para un sistema de informacion en tiempo real, que permita la conexion remota y concurrente de diferentes equipos en la red a la base de datos historica del sistema, sin necesidad de que se instale ningun componente de software en el equipo remoto del usuario que realiza la consulta. Se define y establece la arquitectura de software que permite el desarrollo de la aplicacion web, las etapas de analisis, el funcionamiento de la tecnologia a utilizar, asi como el diseno, desarrollo e implementacion de la aplicacion. Finalmente, se describen los logros obtenidos con el desarrollo de la aplicacion web para un sistema de informacion en tiempo real.

  2. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  3. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis.

    Science.gov (United States)

    Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B

    2017-01-01

    Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological

  6. Evaluation of potential reference genes in real-time RT-PCR studies of Atlantic salmon

    Directory of Open Access Journals (Sweden)

    Nilsen Tom O

    2005-11-01

    Full Text Available Abstract Background Salmonid fishes are among the most widely studied model fish species but reports on systematic evaluation of reference genes in qRT-PCR studies is lacking. Results The stability of six potential reference genes was examined in eight tissues of Atlantic salmon (Salmo salar, to determine the most suitable genes to be used in quantitative real-time RT-PCR analyses. The relative transcription levels of genes encoding 18S rRNA, S20 ribosomal protein, β-actin, glyceraldehyde-3P-dehydrogenase (GAPDH, and two paralog genes encoding elongation factor 1A (EF1AA and EF1AB were quantified in gills, liver, head kidney, spleen, thymus, brain, muscle, and posterior intestine in six untreated adult fish, in addition to a group of individuals that went through smoltification. Based on calculations performed with the geNorm VBA applet, which determines the most stable genes from a set of tested genes in a given cDNA sample, the ranking of the examined genes in adult Atlantic salmon was EF1AB>EF1AA>β-actin>18S rRNA>S20>GAPDH. When the same calculations were done on a total of 24 individuals from four stages in the smoltification process (presmolt, smolt, smoltified seawater and desmoltified freshwater, the gene ranking was EF1AB>EF1AA>S20>β-actin>18S rRNA>GAPDH. Conclusion Overall, this work suggests that the EF1AA and EF1AB genes can be useful as reference genes in qRT-PCR examination of gene expression in the Atlantic salmon.

  7. Exploring valid reference genes for quantitative real - time rt - pce studies of hydrogenperoxide signaling in arabidopsis

    International Nuclear Information System (INIS)

    Zhou, H.; Han, B.; Xie, Y.; Zhang, J.; Shen, W.

    2015-01-01

    Hydrogen peroxide (H/sub 2/O/sub 2/ ) acts as a signaling molecule modulating the expression of various genes in plants. However, the reference gene(s) used for gene expression analysis of H/sub 2/O/sub 2/ signaling is still arbitrary. A reliable result obtained by quantitative real-time RT-PCR (RT-qPCR) highly depends on accurate transcript normalization using stably expressed reference genes, whereas the inaccurate normalization could easily lead to the false conclusions. In this report, by using geNorm and NormFinder algorithms, 12 candidate reference genes were evaluated and compared in root and shoot tissues of Arabidopsis upon different doses of H/sub 2/O/sub 2/. The results revealed that, in our experimental conditions, three novel reference genes (TIP41-like, UKN, and UBC21) were identified and validated as suitable reference genes for RT-qPCR normalization in both root and shoot tissues under oxidative stress. This conclusion was further confirmed by publicly available microarray data of methyl viologen and drought stress. In comparison with a single reference gene (EF-1a), the expression pattern of ZAT12 modulated by H/sub 2/O/sub 2/, when using TIP41-like, UKN, and UBC21 as multiple reference gene(s), was similar with the previous reports by using northern blotting. Thus, we proposed that these three reference genes might be good candidates for other researchers to include in their reference gene validation in gene expression studies under H/sub 2/O/sub 2/ related oxidative stress. (author)

  8. Optimización en Tiempo Real utilizando la Metodología de Adaptación de Modificadores

    Directory of Open Access Journals (Sweden)

    T. Rodríguez-Blanco

    2018-03-01

    Full Text Available La gestión óptima de las plantas de proceso normalmente se lleva a cabo en una capa de optimización en tiempo real (Real Time Optimization, RTO que actúa sobre la capa de control y que toma decisiones considerando objetivos económicos en base a un  modelo del proceso, normalmente estacionario. Sin embargo, dicha operación óptima no está garantizada debido a la presencia de incertidumbre entre el modelo usado para la toma de decisiones y el proceso real. Con la idea de conducir el proceso a su punto de operación óptimo usando un modelo que se sabe incierto o erróneo, surge la metodología de adaptación de modificadores (Modifier Adaptation o MA. En dicha metodología, el problema de optimización económica de la capa RTO es modificado mediante unos términos correctores, conocidos como modificadores, estimados a partir de medidas de la planta, con el objetivo de conducir el proceso a su punto de operación óptimo. El presente artículo hace una revisión de las técnicas desarrolladas hasta el momento dentro de la metodología MA analizando sus características y modos de implementación.

  9. The development of a qualitative real-time RT-PCR assay for the detection of hepatitis C virus

    NARCIS (Netherlands)

    Clancy, A.; Crowley, B.; Niesters, H.; Herra, C.

    2008-01-01

    Real-time polymerase chain reaction (PCR) represents a favourable option for the detection of hepatitis C virus (HCV). A real-time reverse transcriptase PCR (RT-PCR) assay was developed as a qualitative diagnostic screening method for the detection of HCV using the ABI PRISM 7500 Sequence Detection

  10. Evaluation of real-time RT-PCR assays for detection and quantification of norovirus genogroups I and II.

    Science.gov (United States)

    Rupprom, Kitwadee; Chavalitshewinkoon-Petmitr, Porntip; Diraphat, Pornphan; Kittigul, Leera

    2017-04-01

    Noroviruses are the leading cause of acute gastroenteritis in humans. Real-time reverse transcription-polymerase chain reaction (real-time RT-PCR) is a promising molecular method for the detection of noroviruses. In this study, the performance of three TaqMan real-time RT-PCR assays was assessed, which were one commercially available real-time RT-PCR kit (assay A: Norovirus Real Time RT-PCR kit) and two in-house real-time RT-PCR assays (assay B: LightCycler RNA Master Hybprobe and assay C: RealTime ready RNA Virus Master). Assays A and B showed higher sensitivity than assay C for norovirus GI, while they all had the same sensitivity (10 3 DNA copies/mL) for GII DNA standard controls. Assay B had the highest efficiency for both genogroups. No cross-reactivity was observed among GI and GII noroviruses, rotavirus, hepatitis A virus, and poliovirus. The detection rates of these assays in GI and GII norovirus-positive fecal samples were not significantly different. However, the mean quantification cycle (Cq) value of assay B for GII was lower than assays A and C with statistical significance (P-value, 0.000). All three real-time RT-PCR assays could detect a variety of noroviruses including GI.2, GII.2, GII.3, GII.4, GII.6, GII.12, GII.17, and GII.21. This study suggests assay B as a suitable assay for the detection and quantification of noroviruses GI and GII due to good analytical sensitivity and higher performance to amplify norovirus on DNA standard controls and clinical samples.

  11. Reconfiguración Dinámica de Sistemas Distribuidos en Tiempo-Real Basada en Agentes

    Directory of Open Access Journals (Sweden)

    O. Esquivel-Flores

    2012-07-01

    Full Text Available Resumen: Actualmente los sistemas distribuidos están presentes en diversas aplicaciones dentro de la industria e investigación. Este tipo de sistemas está restringido al cumplimiento de condiciones temporales lo que los convierte en sistemas de tiempo crítico que ante la presencia de fallas es necesario tomar decisiones que eviten la pérdida de plazos, disminución de desempeñno, inestabilidad o la suspensión total del sistema. Una estrategia para lograr lo anterior es la reconfiguración dinámica de la estructura del sistema con el objetivo de contrarrestar el efecto de las fallas. En este artículo se presenta una propuesta de reconfiguración dinámica y distribuida que se basa en considerar a cada elemento del sistema distribuido como un agente con capacidad comunicación y cooperación que decida en conjunto con otros agentes una acción de reconfiguración. Se propone la modificación de periodos de muestreo de los agentes que sensan los estados del sistema, la disminución de la actividad de los agentes con falla y/o la utilización de algoritmos de voto. Para alguna posible falla en el sistema se hace corresponder un tipo particular de reconfiguración con base en el intercambio de información entre agentes para tomar un acuerdo consensado. El esquema de reconfiguración dinámico que se propone es implementado en el control de vuelo de un prototipo de helicóptero de dos hélices en el que se incluye un sistema distribuido que utiliza un medio de comunicación común entre sus componentes para forma el lazo cerrado de control de un sistema. La respuesta del sistema reconfigurado es explorada por medio de simulaciones numéricas realizadas en Matlab y Simulink utilizando TrueTime como herramienta de simulación de tiempo real. Abstract: Currently distributed systems are present in several applications in industry and research, such systems are restricted to time conditions. The presence of failures in these time critical systems

  12. Tiempo y sociedad, en el Real Seminario de Minería, 1792-1821

    Directory of Open Access Journals (Sweden)

    Eduardo Flores Clai

    2012-02-01

    Full Text Available La industria de metales preciosos, oro y plata, a finales del siglo XVIII, recibió un gran impulso de la corona española. Para ello, intentó modernizar el sistema productivo de la minería con el fin de aumentar la recaudación fiscal. El Real Seminario de Minería (RSM fue un engranaje más de esta maquinaria que tenía como objetivos difundir los conocimientos científicos, instruir a la juventud novohispana en las técnicas más modernas de explotación y refinación de minerales. En esta historia queremos llamar la atención sobre la vida académica. Abstract At the end on the 18th century, the precious metal industry, gold and silver, received a great impulse from the Spanish crown. For this, it needed to modernize the productive system of the mining with the purpose to increase the fiscal collection. The Real Seminary of Mineração (RSM was a strategy that had objectives to spread out the scientific knowledge, to instruct new Hispanic youth in the most modern techniques of exploration and mineral refinement. It is on this history that we want to call the attention of the academy. Keywords Modern School; History; Industrialization; Youth; Modernization

  13. Algoritmo genético permutacional para el despliegue y la planificación de sistemas de tiempo real distribuidos

    Directory of Open Access Journals (Sweden)

    Ekain Azketa

    2013-07-01

    Full Text Available Resumen: El despliegue y la planificación de tareas y mensajes en sistemas de tiempo real distribuidos son problemas NP-difíciles (NP- hard, por lo que no existen métodos óptimos para solucionarlos en tiempo polinómico. En consecuencia, estos problemas son adecuados para abordarse mediante algoritmos genéricos de búsqueda y optimización. En este artículo se propone un algoritmo genético multiobjetivo basado en una codificación permutacional de las soluciones para abordar el despliegue y la planificación de sistemas de tiempo real distribuidos. Además de desplegar tareas en computadores y de planificar tareas y mensajes, este algoritmo puede minimizar el número de computadores utilizados, la cantidad de recursos computacionales y de comunicaciones empleados y el tiempo de respuesta de peor caso medio de las aplicaciones. Los resultados experimentales muestran que este algoritmo genético permutacional puede desplegar y planificar sistemas de tiempo real distribuidos de forma satisfactoria y en tiempos razonables. Abstract: The deployment and scheduling of tasks and messages in distributed real-time systems are NP-hard problems, so there are no optimal methods to solve them in polynomial time. Consequently, these problems are suitable to be approached with generic search and optimisation algorithms. In this paper we propose a multi-objective genetic algorithm based on a permutational solution encoding for the deployment and scheduling of distributed real-time systems. Besides deploying and scheduling tasks and messages, the algorithm can minimize the number of the used computers, the utilization of computing and networking resources and the average worst-case response times of the applications. The experiments show that this genetic algorithm can successfully synthesize complex distributed real-time systems in reasonable times. Palabras clave: Sistemas de tiempo real, Algoritmos de planificaci

  14. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  15. Automated extraction of avian influenza virus for rapid detection using real-time RT-PCR.

    Science.gov (United States)

    Tewari, Deepanker; Zellers, Corey; Acland, Helen; Pedersen, Janice C

    2007-10-01

    Highly pathogenic H5N1 avian influenza (AI) poses a grave risk to human health. An important aspect of influenza control is rapid diagnosis. This study describes the efficiency of AI-RNA extraction utilizing silica-based magnetic beads with robotics and its detection with an influenza A matrix gene real-time RT-PCR from tracheal swabs, and compares it to virus isolation and manual spin column extractions. Analytical sensitivity was assessed by performing dilution analysis and detection of H2N2 AI viral RNA. Diagnostic sensitivity and specificity was assessed by analyzing tracheal swabs collected from H7N2 infected and uninfected chickens. Both manual and robotic extractions detected AI virus at 1log(10)EID(50)/ml. Diagnostic sensitivity and specificity of matrix gene detection with the automated extraction method for chicken tracheal swab specimens was similar to that of virus isolation and the manual extraction method. There were only three discordant results among 212 tested specimens. The main advantages of automated robotic viral nucleic acid extraction are high throughput processing; hands-free operation; and reduction in human and technical error. This study demonstrates successful detection of influenza A virus with magnetic beads utilizing the Qiagen MagAttract cell kit on a BioRobot M48 platform.

  16. Expression patterns of Doppel gene in golden hamster: quantification using real-time RT-PCR.

    Science.gov (United States)

    Li, Y R; Li, Q; Yang, J M; Zhou, X M; Yin, X M; Zhao, D M

    2008-08-01

    Doppel (prion-like protein, Dpl) may act as a useful molecular marker in tumor diagnosis and in tumor grade definition, as over-expression of Dpl protein has been found in tumors with different histologic origin. Accordingly, the quantitative analysis of the expression of Dpl in different tissues is essential for understanding its role in tumor progression and cancer diagnostic. Herein we report Dpl mRNA quantification in golden hamster by calibrated highly sensitive externally standardized real-time RT-PCR with LightCycler instrument. Total RNA was isolated from nine different organs of golden hamster in different stages of development: from neonatal to adult golden hamster. Highest level of Dpl mRNA was detected in the testis, and lower levels of Dpl mRNA were detected in the following tissues: spleen, heart, bone marrow, skeletal muscles and neocortex (only in neonatal hamster). The expression of Dpl was not detected in kidney, liver and lung. This is the first study to report the expression of Dpl in bone marrow of murine and the difference of expression levels of Dpl in testis between adult and neonatal hamsters.

  17. Electrogramas intracardíacos en tiempo real en el diagnóstico de fallas de marcapasos Real time intracardiac electrograms for the diagnosis of pacemaker malfunction

    Directory of Open Access Journals (Sweden)

    Adrián Baranchuk

    2008-02-01

    Full Text Available El desplazamiento crónico del catéter ventricular es una complicación infrecuente del implante de marcapasos. Es infrecuente que un catéter desplazado sense y capture en una cámara donde no fue implantado originalmente. Se presenta el caso de un paciente con marcapasos doble cámara en el que el catéter ventricular se desplazó hacia la aurícula derecha. El catéter desplazado permite sensar y capturar la aurícula. El diagnóstico inicial se realizó mediante el análisis deductivo conjunto de los electrogramas en tiempo real y los eventos en los canales de registro ("marker channel". La radiografía de tórax confirmó el diagnóstico presuntivo.Chronic ventricular lead dislodgement is an infrequent complication of pacemaker implantation. Occasionally, the dislodged lead may sense and capture a chamber in which the lead was not originally positioned. Intracardiac real time electrograms and channel markers are useful tools for the diagnosis of pacemaker malfunction. We present the case of a patient with a ventricular lead dislodgement into the atrium. The ventricular lead was able to sense and capture the atrium. Initial diagnosis was performed based on the deductive analysis of intracardiac real time electrograms and channel markers and confirmed by chest X-ray.

  18. Comparison and evaluation of conventional RT-PCR, SYBR green I and TaqMan real-time RT-PCR assays for the detection of porcine epidemic diarrhea virus.

    Science.gov (United States)

    Zhou, Xinrong; Zhang, Tiansheng; Song, Deping; Huang, Tao; Peng, Qi; Chen, Yanjun; Li, Anqi; Zhang, Fanfan; Wu, Qiong; Ye, Yu; Tang, Yuxin

    2017-06-01

    Porcine epidemic diarrhea (PED) caused by porcine epidemic diarrhea virus (PEDV) is a highly contagious intestinal disease, resulting in substantial economic losses to the swine industry worldwide. In this study, three assays, namely a conventional reverse transcription-polymerase chain reaction (RT-PCR), a SYBR Green I real-time RT-PCR and a TaqMan real-time RT-PCR targeting the highly conserved M gene of PEDV, were developed and evaluated. Then, the analytical specificity, sensitivity and reproducibility of these assays were determined and compared. The TaqMan real-time RT-PCR was 100-fold and 10,000-fold more sensitive than that of the SYBR Green I real-time RT-PCR and the conventional RT-PCR, respectively. The analytical sensitivity of TaqMan real-time RT-PCR was 10 copies/μl of target gene and no cross amplification with other viruses tested was observed. With the features of high specificity, sensitivity, and reproducibility, the TaqMan real-time RT-PCR established in this study could be a useful tool for clinical diagnosis, epidemiological surveys and outbreak investigations of PED. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Measurement of bacterial gene expression in vivo by laser capture microdissection and quantitative real-time RT-PCR

    DEFF Research Database (Denmark)

    Schou, Kirstine Klitgaard; Jensen, Tim Kåre; Angen, Øystein

    2007-01-01

    Due to the relative small number of bacterial pathogens present in an infected host, exploration of pathogen gene expression in vivo is challenging. This study reports the development of a protocol for quantifying bacterial gene expression in vivo in Actinobacillus pleuropneumoniae using laser ca...... capture microdissection and real-time quantitative RT-PCR....

  20. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 90; Issue 2. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1, mBCR-ABL and MLL-AF4 fusion gene transcripts in de novo B-lineage acute lymphoblastic leukaemia patients in south India. Natarajan Sudhakar Kamalalayam Raghavan Rajalekshmy Thangarajan ...

  1. Direct sample preparation methods for the detection of Plum pox virus by real-time RT-PCR.

    Science.gov (United States)

    Capote, Nieves; Bertolini, Edson; Olmos, Antonio; Vidal, Eduardo; Martínez, Maria Carmen; Cambra, Mariano

    2009-03-01

    Direct systems to process plant materials allowed high-throughput testing of Plum pox virus (PPV) by real-time reverse transcription (RT)-PCR without nucleic acids purification. Crude plant extracts were diluted in buffer or spotted on membranes to be used as templates. Alternatively, immobilized PPV targets were amplified from fresh sections of plant tissues printed or squashed onto the same supports, without extract preparation. Spot real-time RT-PCR was validated as a PPV diagnostic method in samples collected during the dormancy period and showed high sensitivity (93.6%), specificity (98.0%), and post-test probability (97.9%) towards sharka disease. In an analysis of 2919 Prunus samples by spot real-time RT-PCR and DASI-ELISA 90.8% of the results coincided, demonstrating high agreement (k = 0.77 +/- 0.01) between the two techniques. These results validate the use of immobilized PPV targets and spot real-time RT-PCR as screening method for largescale analyses.

  2. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  3. Detection of ROS1 gene rearrangement in lung adenocarcinoma: comparison of IHC, FISH and real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ling Shan

    Full Text Available To compare fluorescence in situ hybridization (FISH, immunohistochemistry (IHC and quantitative real-time reverse transcription-PCR (qRT-PCR assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC patients.Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay.Among 60 cases, 16 (26.7%, 13 (21.7% and 20 (33.3% cases were ROS1 positive revealed by IHC, FISH and qRT-PCR, respectively. Using FISH as a standard method for ROS1 fusion detection, the sensitivity and specificity of IHC were 100% and 93.6%, respectively. Three IHC-positive cases, which showed FISH negative, were demonstrated with ROS1 fusion by qRT-PCR analysis. The sensitivity and specificity of qRT-PCR for detection for ROS1 fusion were 100% and 85.1%, respectively. The total concordance rate between IHC and qRT-PCR were 93.3%.IHC is a reliable and rapid screening tool in routine pathologic laboratories for the identification of suitable candidates for ROS1-targeted therapy. Some ROS1 IHC-positive but FISH-negative cases did harbor the translocation events and may benefit from crizotinib.

  4. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  5. TRMM (TMPA-RT) Near Real-Time Precipitation L3 3 hour 0.25 degree x 0.25 degree V7 (TRMM_3B42RT) at GES DISC

    Data.gov (United States)

    National Aeronautics and Space Administration — These data are output from the TRMM Multi-satellite Precipitation Analysis (TMPA), the Near Real-Time (RT) processing stream. The latency is about seven hours from...

  6. TRMM (TMPA-RT) Near Real-Time Microwave precipitation estimate L3 3 hour 0.25 degree x 0.25 degree V7 (TRMM_3B40RT) at GES DISC

    Data.gov (United States)

    National Aeronautics and Space Administration — These data are output from the TRMM Multi-satellite Precipitation Analysis (TMPA), the Near Real-Time (RT) processing stream. The latency is about seven hours from...

  7. TRMM (TMPA-RT) Near Real-Time Precipitation L3 1 day 0.25 degree x 0.25 degree V7 (TRMM_3B42RT_Daily) at GES DISC

    Data.gov (United States)

    National Aeronautics and Space Administration — This daily accumulated precipitation product is generated from the Near Real-Time 3-hourly TRMM Multi-Satellite Precipitation Analysis TMPA (3B42RT). It is produced...

  8. TRMM (TMPA-RT) Near Real-Time IR precipitation estimate L3 1-hour 0.25 degree x 0.25 degree V7 (TRMM_3B41RT) at GES DISC

    Data.gov (United States)

    National Aeronautics and Space Administration — These data are output from the TRMM Multi-satellite Precipitation Analysis (TMPA), the Near Real-Time (RT) processing stream. The latency is about seven hours from...

  9. Review: Algoritmos de planificación para la transmisión de datos en tiempo real con IEEE 802.15.4

    Directory of Open Access Journals (Sweden)

    Sixto Enrique Campaña Bastidas

    2015-10-01

    Full Text Available Las redes de sensores inalámbricas (WSN se están extendiendo a muchos campos de aplicación, tales como ciudades inteligentes, ambientes inteligentes, internet de las cosas, entre otras tecnologías. Para muchasde estas tendencias es esencial establecer métodos para la entrega de paquetes, sobre todo aquellos que presenten garantías de tiempo real. En este trabajo se presenta un estudio de los avances recientes publicadosen la literatura científica, considerando principalmente las técnicas de acceso al medio y la planificación de transmisión de datos con garantías de tiempo real en WSN basadas en el estándar IEEE 802.15.4. Este estudiopresenta las características más importantes, así como las principales diferencias entre las distintas técnicas. Al final se presentan algunas conclusiones y se proponen futuras líneas de investigación que buscan con interés la aplicación de WSN en ambientes con restricciones de tiempo real.

  10. Análisis de la implementación software de un conformador de señales ultrasónicas para tiempo real

    Directory of Open Access Journals (Sweden)

    D. Romero-Laorden

    2016-10-01

    Full Text Available Resumen: Este trabajo analiza la implementación software en un sistema de imagen ultrasónica del Total Focusing Method para la compensación dinámica en tiempo real de los tiempos de vuelo para emisión y recepción de todos los puntos de la imagen. Para ello, haciendo uso de técnicas GPGPU, se analizan dos diferentes alternativas de implementación, mostrando como una planificación adecuada de acceso a los datos permite mejorar los tiempos de ejecución del algoritmo. Abstract: This paper studies the software implementation in an ultrasonic imaging system of Total Focusing Method. In order to accomplish real-time requirements parallel programming techniques have been used. Then, using GPGPU techniques, two different implementation alternatives are analysed, showing how proper planning of access to data improves the performance of the algorithm. Palabras clave: Imagen Ultrasónica, Procesamiento de Señal, Computación Paralela, GPU, CUDA, Keywords: Ultrasonic imaging GPU Signal Processing Parallel computing CUDA

  11. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  12. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. La información en tiempo real: Una herramienta necesaria en vigilancia epidemiológica Real time information: A necessary tool in epidemiological surveillance

    Directory of Open Access Journals (Sweden)

    Francisco González Morán

    2008-04-01

    Full Text Available Desde el año 2004 se está desarrollando un sistema electrónico para la vigilancia epidemiológica en la Comunidad Valenciana y su análisis (AVE, que permite recoger en tiempo real los datos de las enfermedades de declaración obligatoria (EDO, de los brotes, y de las alertas, su análisis y la difusión de la información a los usuarios de forma automatizada. Dentro del territorio de la Comunidad Valenciana, las actividades de vigilancia se llevan a cabo en 17 Unidades de Vigilancia, de acuerdo con la desagregación sanitaria de la comunidad, que actúan como primer nivel especializado de la vigilancia. El sistema de vigilancia electrónico es operativo para todas esas unidades e igualmente cubre a los facultativos de atención primaria y especializada, capacitándoles para completar la información clínica de los casos de enfermedades, que son detectados a partir de los datos sociodemográficos del Sistema de Información Ambulatoria (SIA. La incorporación de los resultados microbiológicos se realiza automáticamente, a través de la Red de Vigilancia Microbiológica de la Comunidad Valenciana. El análisis de los casos, los brotes y las alertas se lleva a cabo por medio de una serie de algoritmos que permite la creación de avisos dirigidos al epidemiólogo. Desde los servicios centrales se tiene acceso a todo el sistema para el análisis de la información y el control de la calidad del sistema de vigilancia epidemiológica. La aplicación ha conseguido disminuir el tiempo de declaración de los datos y aumentar la exhaustividad de esa declaración de manera significativa.Since 2004 an electronic epidemiological surveillance system (AVE has been developed and implemented for infectious diseases in the autonomous region of Valencia that allows data collection from notifiable diseases in real time concerning outbreaks and alerts, as well as analysis and dissemination of the information. Within the autonomous region of Valencia, the

  14. Comparison of real time RT-PCR and flow cytometry methods for evaluation of biological activity of recombinant human erythropoietin

    Directory of Open Access Journals (Sweden)

    Sepehrizadeh Z

    2008-05-01

    Full Text Available Background: Evaluation of bioactivity of recombinant erythropoietin is essential for pharmaceutical industry, quality control authorities and researchers. The purpose of this study was to compare real time RT-PCR and flow cytometry for the assay of biological activity of recombinant erythropoietin. Methods: Three concentrations of recombinant erythropoietin BRP (80, 40 and 20 IU/ml were injected subcutaneously to mice. After 4 days the blood was collected and used for reticulocyte counts by flow cytometry and also for the RNA extraction. Real time RT-PCR amplification was carried out for β-globin. Results and conclusion: There was a significant correlation between the total RNA amounts (R2= 0.9995, relative quantity of β-globin mRNA (R2= 0.984 and reticulocyte counts (R2= 0.9742 with rhEpo concentrations. Total RNA and quantitative RT-PCR showed significant dose dependent results as well the reticulocyte counts by flow cytometry for the biological activity assay of rhEpo and so these methods could be considered as alternatives for flow cytometry.

  15. Development of a multiplex real-time RT-PCR assay for simultaneous detection of dengue and chikungunya viruses.

    Science.gov (United States)

    Cecilia, D; Kakade, M; Alagarasu, K; Patil, J; Salunke, A; Parashar, D; Shah, P S

    2015-01-01

    Dengue and chikungunya viruses co-circulate and cause infections that start with similar symptoms but progress to radically different outcomes. Therefore, an early diagnostic test that can differentiate between the two is needed. A single-step multiplex real-time RT-PCR assay was developed that can simultaneously detect and quantitate RNA of all dengue virus (DENV) serotypes and chikungunya virus (CHIKV). The sensitivity was 100 % for DENV and 95.8 % for CHIKV, whilst the specificity was 100 % for both viruses when compared with conventional RT-PCR. The detection limit ranged from 1 to 50 plaque-forming units. The assay was successfully used for differential diagnosis of dengue and chikungunya in Pune, where the viruses co-circulate.

  16. Los tiempos de El Tiempo

    Directory of Open Access Journals (Sweden)

    José Eduardo Rueda Enciso

    2012-01-01

    Full Text Available Exclusión, discriminación y abuso de poder en El Tiempo del Frente Nacional. Una aproximación desde el análisis crítico del discurso (ACD. César Augusto Ayala Diago. Universidad Nacional de Colombia, Bogotá, 2008, 363 págs.

  17. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  18. Quantitative real-time RT-PCR in sentinel lymph nodes from melanoma patients. Detection of melanocytic mRNA predicts disease-free survival

    DEFF Research Database (Denmark)

    Riber-Hansen, Rikke; Abrahamsen, Helene Nortvig; Sorensen, Boe Sandahl

    2008-01-01

    Quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR) for specific melanoma markers is more sensitive than histology for detecting cells of melanocytic origin in sentinel lymph nodes (SLNs) in cutaneous melanoma. The clinical significance of a positive qRT-PCR analysis...... that the presence of submicroscopic metastases may influence prognosis, indicating that RT-PCR detection of melanocytic cells in SLNs may be an important diagnostic marker....

  19. Real-Time Integrated Navigation System for Planetary Exploration (RT-INSPEX), Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — For supporting NASA's efforts in enhancing robotic autonomy and off-loading work from operators and astronauts, American GNC Corporation has developed the "Real-Time...

  20. Adquisición, registro y transmisión en tiempo real de señales sismológicas bajo TCP/IP

    Directory of Open Access Journals (Sweden)

    Vargas-jiménez Carlos A.

    2001-08-01

    Full Text Available

    The constant evolution of network technologies has made possible the development of applications facilitating the real time access to the information. This way, it is possible the implementation of remote monitoring systems that using PCs achieves efficient transmission of signals through computer networks. In this work, the procedures system design and implementation procedures are explain in Client/Server environment that, based on TCP/lP, transmits in real time 16 seismological signals over LAN network and the Internet. The server is a PC endowed with an acquisition data card and it is the one in charge of carrying out the signal Analog/Digital conversion, to store in files those that correspond to seismic events and, at the same time, to assist the applications of the different clients. The client's software allows the users to view in real time the signals that the server is acquiring and to carry out a basicn processing to the signals that have been registered in the server.

    Se presenta el desarrollo de un sistema de monitoreo de variables sísmicas, que incluye la adquisición y adecuación de 16 canales simultáneos, el preproceso, la grabación y la transmisión sobre redes IP en tiempo real. EI sistema esta orientado al sistema Windows, para lo cual se emplearon librerías dinámicas orientadas al acceso de dispositivos en tiempo real. Así mismo, el acceso de datos al PC se realiza vfa DMA, para implementar el proceso múltiple de señales en tiempo real. La arquitectura de la red IP de monitoreo sísmico es cliente/servidor, en la cual se tome como servidor un PC dotado de una tarjeta de adquisición de datos, encargado de realizar la conversión an

  1. Detection and absolute quantitation of Tomato torrado virus (ToTV) by real time RT-PCR.

    Science.gov (United States)

    Herrera-Vásquez, José Angel; Rubio, Luis; Alfaro-Fernández, Ana; Debreczeni, Diana Elvira; Font-San-Ambrosio, Isabel; Falk, Bryce W; Ferriol, Inmaculada

    2015-09-01

    Tomato torrado virus (ToTV) causes serious damage to the tomato industry and significant economic losses. A quantitative real-time reverse-transcription polymerase chain reaction (RT-qPCR) method using primers and a specific TaqMan(®) MGB probe for ToTV was developed for sensitive detection and quantitation of different ToTV isolates. A standard curve using RNA transcripts enabled absolute quantitation, with a dynamic range from 10(4) to 10(10) ToTV RNA copies/ng of total RNA. The specificity of the RT-qPCR was tested with twenty-three ToTV isolates from tomato (Solanum lycopersicum L.), and black nightshade (Solanum nigrum L.) collected in Spain, Australia, Hungary and France, which covered the genetic variation range of this virus. This new RT-qPCR assay enables a reproducible, sensitive and specific detection and quantitation of ToTV, which can be a valuable tool in disease management programs and epidemiological studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Plataforma de desarrollo para el control en tiempo real de estructuras cinemáticas con realimentación visual//Platform to develop real time visual servoing control in kinematics systems

    Directory of Open Access Journals (Sweden)

    René González-Rodríguez

    2012-09-01

    Full Text Available En este trabajo se presenta una plataforma de desarrollo para el control en tiempo real de estructuras cinemáticas con realimentación visual. Se ha diseñado una configuración genérica que permite la implementación de cualquier variante de control visual. Para el procesamiento de la imagen se ha propuesto una estrategia que permite el uso de diferentes herramientas comerciales o algoritmos propiospara la captura y extracción de características de la imagen. El uso de Real Time Work Shop y Real Time Windows Target en el lazo de control interno brinda la posibilidad de implementar algoritmos de control servovisual en tiempo real. Al final del trabajo se presentan los resultados de un esquema de controlservovisual aplicado en un manipulador industrial. La plataforma propuesta constituye una herramienta de desarrollo para aplicaciones industriales de control servovisual y sirve de apoyo a la enseñanza de la mecatrónica en pregrado y postgrado.Palabras claves: control servovisual, control en tiempo real, estructuras cinemáticas._______________________________________________________________________________AbstractIn this work we propose a platform to develop visual servoing control systems. The platform has a generic design with the possibility to implement direct or look and move visual servoing systems. For the image processing we present a generic design allowing the use of any image processing library like Matrox MIL,Intel IPP, OpenCV or any algorithms for image capture and target characteristics extraction. The uses of Real Time Work Shop and Real Time Windows Target in the internal loop permits modify the control structure in SIMULINK very easy.Key words: visual servoing, real time control, kinematics systems.

  3. Analysis on the arcelin expression in bruchid pest resistant wild pulses using real time RT-qPCR.

    Science.gov (United States)

    Sakthivelkumar, Shanmugavel; Veeramani, Velayutham; Hilda, Karuppiah; Arumugam, Munusamy; Janarthanan, Sundaram

    2014-12-01

    Arcelin, the antimetabolic protein from wild pulses is a known natural insecticidal molecule. Wild pulses with high arcelin content could serve as potential source to. increase the levels of insect resistance in cultivated pulse crops. In this study, arcelin (Arl) gene expression was screened in seven stored product insect pest resistant wild pulse varieties using real time RT-qPCR. Arcelin gene specific real time PCR primers were synthesized from arcelin mRNA sequence of the wild pulse variety, Lablab purpureus. The results revealed different levels of arcelin gene expression in the tested varieties. Canavalia virosa registered significantly high content indicating its suitability for utilization of arcelin gene in developing stored product insect pest resistance with other cultivated pulses.

  4. Citotoxicidad del 1-O-undecilglicerol sobre células de mama humanas mediante análisis de células en tiempo real

    Directory of Open Access Journals (Sweden)

    Marian Hernández-Colina

    Full Text Available Objetivos: Estudiar el efecto del 1-O-undecilglicerol sobre la proliferación de células de cáncer de mama MCF-7 y de mama normales 184B5. Métodos: Se realizó seguimiento a tiempo real de la viabilidad de ambas líneas celulares, con empleo del analizador de células en tiempo real. Se determinó la densidad celular apropiada para el estudio, y se trataron las células con dos concentraciones de 1-O-undecilglicerol durante 48 horas. Se compararon las pendientes del índice celular en cada experimento. Resultados: El 1-O-undecilglicerol redujo significativamente la proliferación de las células MCF-7, mientras que fue poco citotóxico sobre las células 184B5 hasta 75µM. A la concentración de 150µM fue citotóxico para ambas líneas, pero invirtió la pendiente del índice celular de las células de cáncer de mama. Conclusiones: El 1-O-undecilglicerol podría ser candidato para futuros estudios en modelos in vivo de cáncer de mama, así como para la profundización en el mecanismo involucrado en este efecto.

  5. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  6. Sistema de detección de fugas en tiempo real en presas de materiales sueltos mediante sensores distribuidos en fibra óptica

    Directory of Open Access Journals (Sweden)

    O. Muñoz

    2016-04-01

    Full Text Available El presente trabajo pretende analizar el uso de fibra óptica como sensor de temperatura distribuido para la detección de posibles fugas en presas de materiales sueltos. El uso de esta técnica permite complementar los sistemas de auscultación  normalmente utilizados mejorando la monitorización de las zonas críticas de la infraestructura. Este tipo de sistema de monitorización en tiempo real ha sido implementado en dos casos reales, (presa de Soto-Terroba y recrecimiento de la presa de Yesa. Finalmente este trabajo quiere proporcionar una visión práctica sobre esta nueva técnica implementada y en particular sobre los criterios de selección de materiales y las precauciones necesarias a la hora del despliegue del elemento sensor.

  7. RT-Symmetric Laplace Operators on Star Graphs: Real Spectrum and Self-Adjointness

    Directory of Open Access Journals (Sweden)

    Maria Astudillo

    2015-01-01

    Full Text Available How ideas of PT-symmetric quantum mechanics can be applied to quantum graphs is analyzed, in particular to the star graph. The class of rotationally symmetric vertex conditions is analyzed. It is shown that all such conditions can effectively be described by circulant matrices: real in the case of odd number of edges and complex having particular block structure in the even case. Spectral properties of the corresponding operators are discussed.

  8. Development and Preliminary Evaluation of a New Real-Time RT-PCR Assay For Detection of Peste des petits Ruminants Virus Genome.

    Science.gov (United States)

    Polci, A; Cosseddu, G M; Ancora, M; Pinoni, C; El Harrak, M; Sebhatu, T T; Ghebremeskel, E; Sghaier, S; Lelli, R; Monaco, F

    2015-06-01

    A duplex real-time reverse transcription-polymerase chain reaction (qRT-PCR) assay was developed for a simple and rapid diagnosis of Peste des petits ruminants (PPR). qRT-PCR primers and TaqMan probe were designed on a conserved region of nucleocapsid protein (Np) of PPR virus (PPRV) genome. An in vitro transcript of the target region was constructed and tested to determine analytical sensitivity. Commercial heterologous Armored RNA(®) was used as an internal positive control (IPC) for either RNA isolation or RT-PCR steps. The detection limit of the newly designed duplex real-time RT-PCR (qRT-PCR PPR_Np) was approximately 20 copies/μl with a 95% probability. No amplification signals were recorded when the qRT-PCR PPR_Np was applied to viruses closely related or clinically similar to PPRV- or to PPR-negative blood samples. A preliminary evaluation of the diagnostic performance was carried out by testing a group of 43 clinical specimens collected from distinct geographic areas of Africa and Middle East. qRT-PCR PPR_Np showed higher sensitivity than the conventional gel-based RT-PCR assays, which have been used as reference standards. Internal positive control made it possible to identify the occurrence of 5 false-negative results caused by the amplification failure, thus improving the accuracy of PPRV detection. © 2013 Blackwell Verlag GmbH.

  9. Cuantificación de citocinas caninas mediante reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real

    Directory of Open Access Journals (Sweden)

    Omar A. Saldarriaga

    2006-10-01

    Full Text Available Introducción. Los caninos son el principal reservorio domestico de la leishmaniasis visceral en el Nuevo y Viejo mundo. La reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real para la medición de citocinas caninas no ha sido implementada para el estudio de la leishmaniasis visceral. Objetivo. Estandarizar la cuantificación relativa de IFN-g, IL-4, IL-10, IL-12p40 y IL-12p35 caninas utilizando reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real. Materiales y métodos. Células mononucleares de sangre periférica de perros Fox-Hound fueron estimuladas con ConA, LPS y extracto de Staphylococcus aureus. El ARN fue utilizado en la reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real de un solo paso para optimizar las concentraciones de iniciadores y sondas especificas de cada citocina, generar curvas estándar, confirmar la eficiencia de amplificación de las citocinas y del normalizador (18S ARNr y cuantificar la expresión de ARN. El método comparativo Ct fue utilizado para determinar los niveles relativos de expresión de ARN en las muestras, expresado como el incremento en el número de veces comparado con los controles. Resultados. El coeficiente de regresión para las curvas estándar y las eficiencias de amplificación de las citocinas y el normalizador, indicaron que la cuantificación fue confiable en un amplio rango de concentraciones de ARN. La activación de células mononucleares de sangre periférica resultó en un incremento en la expresión de IFN-g (132, IL-4 (8.8, IL-10 (7,2, y IL-12p40 (275, relativo a células control. La expresión basal de IL-12p35 fue también detectada. Conclusión. Esta metodología, comparada con los métodos convencionales disponibles para la medición de citocinas, ofrece varias ventajas y podría ser utilizada en estudios sobre inmunopatogenia e inmunidad en leishmaniasis visceral canina.

  10. Quantitative one-step real-time RT-PCR for the fast detection of the four genotypes of PPRV.

    Science.gov (United States)

    Kwiatek, Olivier; Keita, Djénéba; Gil, Patricia; Fernández-Pinero, Jovita; Jimenez Clavero, Miguel Angel; Albina, Emmanuel; Libeau, Genevieve

    2010-05-01

    A one-step real-time Taqman RT-PCR assay (RRT-PCR) for peste des petits ruminants virus (PPRV) was developed to detect the four lineages of PPRV by targeting the nucleoprotein (N) gene of the virus. This new assay was compared to a conventional RT-PCR on reference strains and field materials. Quantitation was performed against a standard based on a synthetic transcript of the NPPR gene for which a minimum of 32 copies per reaction were detected with a corresponding C(t) value of 39. Depending on the lineage involved, the detection limit of RRT-PCR was decreased by one to three log copies relative to the conventional method. The lower stringency occurred with lineage III because of minor nucleotide mismatches within the probe region. The assay did not detect phylogenetically or symptomatically related viruses of ruminants (such as rinderpest, bluetongue, and bovine viral diarrhea viruses). However, it was capable of detecting 20% more positive field samples with low viral RNA loads compared to the conventional PCR method. When compared on a proficiency panel to the method developed by Bao et al. (2008), the sensitivity of the in-house assay was slightly improved on lineage II. It proved significantly faster to perform and hence better adapted for monitoring large numbers of at risk or diseased animals. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Simultaneous detection of five notifiable viral diseases of cattle by single-tube multiplex real-time RT-PCR.

    Science.gov (United States)

    Wernike, Kerstin; Hoffmann, Bernd; Beer, Martin

    2015-06-01

    Multiplexed real-time PCR (qPCR) assays enable the detection of several target genes in a single reaction, which is applicable for simultaneous testing for the most important viral diseases in samples obtained from ruminants with unspecific clinical symptoms. Here, reverse transcription qPCR (RT-qPCR) systems for the detection of bovine viral diarrhoea virus (BVDV) and bluetongue virus (BTV) were combined with an internal control system based on the beta-actin gene. Additionally, a background screening for three further major pathogens of cloven-hoofed animals reportable to the World Organisation for Animal Health, namely foot-and-mouth disease virus, epizootic haemorrhagic disease virus, and Rift Valley fever virus, was integrated using the identical fluorophore for the respective RT-qPCR assays. Every pathogen-specific assay had an analytical sensitivity of at least 100 genome copies per reaction within the multiplex approach, and a series of reference samples and clinical specimens obtained from cattle, but also from small ruminants, were detected reliably. The qPCR systems integrated in the background screening were even not influenced by the simultaneous amplification of very high BVDV and BTV genome copy numbers. The newly developed multiplex qPCR allows the specific and sensitive detection of five of the most important diseases of ruminants and could be used in the context of monitoring programs or for differential diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Improvement of Barley yellow dwarf virus-PAV detection in single aphids using a fluorescent real time RT-PCR.

    Science.gov (United States)

    Fabre, Frédéric; Kervarrec, Christine; Mieuzet, Lucie; Riault, Gérard; Vialatte, Aude; Jacquot, Emmanuel

    2003-06-09

    One of the major factors determining the incidence of Barley yellow dwarf virus (BYDV) on autumn-sown cereals is the viruliferous state of immigrant winged aphids. This variable is assessed routinely using the enzyme-linked immunosorbant assay (ELISA). However, the threshold for virus detection by ELISA can lead to false negative results for aphids carrying less than 10(6) particles. Although molecular detection techniques enabling the detection of lower virus quantities in samples are available, the relatively laborious sample preparation and data analysis have restricted their use in routine applications. A gel-free real-time one-step reverse transcription polymerase chain reaction (RT-PCR) protocol is described for specific detection and quantitation of BYDV-PAV, the most widespread BYDV species in Western Europe. This new assay, based on TaqMan technology, detects and quantifies from 10(2) to 10(8) BYDV-PAV RNA copies. This test is 10 and 10(3) times more sensitive than the standard RT-PCR and ELISA assays published previously for BYDV-PAV detection and significantly improves virus detection in single aphids. Extraction of nucleic acids from aphids using either phenol/chloroform or chelatin resin-based protocols allow the use of pooled samples or of a small part (up to 1/1600th) of a single aphid extract for efficient BYDV-PAV detection.

  14. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  15. Generación Automática de Software para Sistemas de Tiempo Real: Un Enfoque basado en Componentes, Modelos y Frameworks

    Directory of Open Access Journals (Sweden)

    Diego Alonso

    2012-04-01

    Full Text Available Resumen: Los Sistemas de Tiempo-Real poseen características que los hacen particularmente sensibles a las decisiones arquitectónicas que se adopten. El uso de Frameworks y Componentes ha demostrado ser eficaz en la mejora de la productividad y calidad del software, sobre todo si se combina con enfoques de Líneas de Productos. Sin embargo, los resultados en cuanto a reutilización y estandarización dejan patente la ausencia de portabilidad tanto de los diseños como las implementaciones basadas en componentes. Este artículo, fundamentado en el Desarrollo de Software Dirigido por Modelos, presenta un enfoque que separa la descripción de aplicaciones de tiempo–real basadas en componentes de sus posibles implementaciones para distintas plataformas. Esta separación viene soportada por la integración automática del código obtenido a partir de los modelos de entrada en frameworks implementados usando tecnología orientada a objetos. Asimismo, se detallan las decisiones arquitectónicas adoptadas en la implementación de uno de estos frameworks, que se utilizará como caso de estudio para ilustrar los beneficios derivados del enfoque propuesto. Por último, se realiza una comparativa en términos de coste de desarrollo con otros enfoques alternativos. Abstract: Real-Time Systems have some characteristics that make them particularly sensitive to architectural decisions. The use of Frameworks and Components has proven effective in improving productivity and software quality, especially when combined with Software Product Line approaches. However, the results in terms of software reuse and standardization make the lack of portability of both the design and componentbased implementations clear. This article, based on the Model- Driven Software Development paradigm, presents an approach that separates the component-based description of real-time applications from their possible implementations on different

  16. PCR en tiempo real para el sexaje y análisis citológico de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis niloticus

    OpenAIRE

    Zulita Prieto; Monica Arqueros; Linda Sánchez - Tuesta; David Salirrosas

    2017-01-01

    El objetivo de la presente investigación fue dar a conocer nuevos marcadores moleculares para la PCR en tiempo real asociados a los cromosomas sexuales y el análisis de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis nil oticus . Se diseñaron cuatro pares de cebadores y se pusieron a prueba por PCR punto final y por PCR en tiempo real utilizando el fluorescente SYBR® Green en muestras de ADN de hembras XX, machos XY y s...

  17. Identification of housekeeping genes as references for quantitative real-time RT-PCR analysis in Misgurnus anguillicaudatus.

    Science.gov (United States)

    Xia, Xiaohua; Huo, Weiran; Wan, Ruyan; Xia, Xiaopei; Du, Qiyan; Chang, Zhongjie

    2017-12-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a well-known method to quantify gene expression by comparing with the reference genes. Generally, housekeeping genes were set as references, as for their stable expression in varying conditions. Here, we try to evaluate few of such genes to identify suitable housekeeping genes as references for qRT-PCR analysis of gene expression in Misgurnus anguillicaudatus. This study evaluated the expression of four commonly used housekeeping genes, i.e. b-actin (ACTB), elongation factor 1 alpha (EF-1a), glyceraldehyde-3-phosphate (GAPDH) and 18S ribosomal RNA (18S rRNA), in gender difference, effects of tissue type, different developmental stages, chemical treatment of embryos/larvae with commonly used vehicles for administration and agents that represent known environmental toxicant. Rank ordering of expression stability was done using geNorm, NormFinder and BestKeeper algorithms. Results suggested that in the qRTPCR test, in all the experimental conditions, EF-1a could be selected as reference gene when analysing a target gene. For the study of different development stages, ACTB could be a candidate as reference gene. For the studies associated with different gender and tissue types, EF-1a would be better targeted as reference gene. Meanwhile, in toxicant treatment, expression of EF-1a seems to be more stable than others and could be considered as reference gene. This study could provide useful guidelines that can be expected to aid M. anguillicaudatus researchers in their initial choice of housekeeping genes for future studies and enable more accurate normalization of gene expression data.

  18. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  20. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation <3.1%. 439 clinical samples were evaluated by both duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR

    Directory of Open Access Journals (Sweden)

    Lou Sai

    2011-07-01

    Full Text Available Abstract Background Bovine viral diarrhea virus (BVDV is a worldwide pathogen in cattle and acts as a surrogate model for hepatitis C virus (HCV. One-step real-time fluorogenic quantitative reverse transcription polymerase chain reaction (RT-PCR assay based on SYBR Green I dye has not been established for BVDV detection. This study aims to develop a quantitative one-step RT-PCR assay to detect BVDV type-1 in cell culture. Results One-step quantitative SYBR Green I RT-PCR was developed by amplifying cDNA template from viral RNA and using in vitro transcribed BVDV RNA to establish a standard curve. The assay had a detection limit as low as 100 copies/ml of BVDV RNA, a reaction efficiency of 103.2%, a correlation coefficient (R2 of 0.995, and a maximum intra-assay CV of 2.63%. It was 10-fold more sensitive than conventional RT-PCR and can quantitatively detect BVDV RNA levels from 10-fold serial dilutions of titrated viruses containing a titer from 10-1 to 10-5 TCID50, without non-specific amplification. Melting curve analysis showed no primer-dimers and non-specific products. Conclusions The one-step SYBR Green I RT-PCR is specific, sensitive and reproducible for the quantification of BVDV in cell culture. This one-step SYBR Green I RT-PCR strategy may be further optimized as a reliable assay for diagnosing and monitoring BVDV infection in animals. It may also be applied to evaluate candidate agents against HCV using BVDV cell culture model.

  2. LabVIEW aplicado al diagnóstico de estado en tiempo real de transformadores de potencia; LabVIEW apply to diagnostic that assess the condition in real time of the power transfor

    Directory of Open Access Journals (Sweden)

    Eliezer Fernández Padrón

    2014-04-01

    Full Text Available Este trabajo está dirigido al rediseño del Sistema de Adquisición y Procesamiento de Datos de la Estación para el Diagnóstico de Estado en Tiempo Real del Autotransformador de Potencia No. 2 de 100MVA, de la Subestación Barquisimeto de Venezuela, a partir de controladores embebidos en tiempo real de la familia cRIO de National Instruments y las técnicas de programación que ofrece la plataforma NI LabVIEW, con la finalidad de integrar un sistema único (software-hardware que permita aumentar la calidad en las mediciones, el procesamiento de los datos, la interface hombre-máquina, su capacidad de expansión y reproducibilidad. El mismo puede ser accedido mediante navegadores Web de Internet y transferir datos en tiempo real a través de la red, además es capaz de trabajar autónomo presentando respaldo en comunicación y alimentación de energía eléctrica, logrando un mejor servicio de diagnóstico continuo en dicho autotransformador.  This work is focused on the redesign of the Acquisition System and Processing Data of the Station for the Diagnostic that Assess the Condition in Real Time of the 100MVA Power Autotransformer No. 2 of the Substation Barquisimeto from Venezuela with the embedded controllers in real time of the cRIO technology of the National Instruments and the programming techniques supported by the NI LabVIEW platform with the purpose of integrating an unique system (hardware-software that allows to improve the quality in the measurements, the processing data, the man-machine interface, its expansion capability and reproduction. This system can be obtained by the internet web browser and it can transfer data in real time through the network, it is also able to work autonomous having a back in communicating and electrical energy feeding, getting a better continuous diagnostic service and the autotransformer.

  3. LabVIEW aplicado al diagnóstico de estado en tiempo real de transformadores de potencia LabVIEW apply to diagnostic that assess the condition in real time of the power transformers

    Directory of Open Access Journals (Sweden)

    Eliezer Fernández Padrón

    2012-02-01

    Full Text Available Este trabajo está dirigido al rediseño del Sistema de Adquisición y Procesamiento de Datos de la Estación para el Diagnóstico de Estado en Tiempo Real del Autotransformador de Potencia No. 2 de 100MVA, de la Subestación Barquisimeto de Venezuela, a partir de controladores embebidos en tiempo real de la familia cRIO de National Instruments y las técnicas de programación que ofrece la plataforma NI LabVIEW, con la finalidad de integrar un sistema único (software-hardware que permita aumentar la calidad en las mediciones, el procesamiento de los datos, la interface hombre-máquina, su capacidad de expansión y reproducibilidad. El mismo puede ser accedido mediante navegadores Web de Internet y transferir datos en tiempo real a través de la red, además es capaz de trabajar autónomo presentando respaldo en comunicación y alimentación de energía eléctrica, logrando un mejor servicio de diagnóstico continuo en dicho autotransformador.This work is focused on the redesign of the Acquisition System and Processing Data of the Station for the Diagnostic that Assess the Condition in Real Time of the 100MVA Power Autotransformer No. 2 of the Substation Barquisimeto from Venezuela with the embedded controllers in real time of the cRIO technology of the National Instruments and the programming techniques supported by the NI LabVIEW platform with the purpose of integrating an unique system (hardware-software that allows to improve the quality in the measurements, the processing data, the man-machine interface, its expansion capability and reproduction. This system can be obtained by the internet web browser and it can transfer data in real time through the network, it is also able to work autonomous having a back in communicating and electrical energy feeding, getting a better continuous diagnostic service and the autotransformer.

  4. Estrogen receptors alpha and beta in rat placenta: detection by RT-PCR, real time PCR and Western blotting

    Directory of Open Access Journals (Sweden)

    Al-Bader Maie D

    2006-03-01

    Full Text Available Abstract Background High levels of estrogens during pregnancy not only retard placental and fetal growth but can lead to reproductive tract abnormalities in male progeny. Estrogens act through estrogen receptors (ER to modulate the transcription of target genes. These ER exist in two isoforms, ER alpha and ER beta and recently several variants of these isoforms have been identified. Methods The expressions of ER isoforms and variants have been studied in rat placenta at 16, 19 and 21 days gestation (dg. Gene expression was assessed using RT-PCR and real time PCR while protein expression was studied using Western blotting followed by immunodetection. Placental homogenates were probed with: a monoclonal antibody raised against the steroid binding domain of the ER alpha (ER alpha -S, a monoclonal antibody raised against the hinge region of ER alpha (ER alpha -H and a polyclonal antibody raised against the amino terminus of ER beta. Results ER alpha and ER beta mRNA and protein were detected from as early as 16 dg. Two PCR products were detected for ER alpha, one for the wild type ER alpha, and a smaller variant. Real time PCR results suggested the presence of a single product for ER beta. The antibodies used for detection of ER alpha protein both identified a single 67 kDa isoform; however a second 54 kDa band, which may be an ER alpha variant, was identified when using the ER alpha -H antibody. The abundance of both ER alpha bands decreased significantly between 16 and 19 dg. As for ER beta, four bands (76, 59, 54 and 41 kDa were detected. The abundance of the 59 and 54 kDa bands decreased significantly between 16 and 19 dg. Conclusion This study shows that both ER protein isoforms and their variants are present in rat placenta. The decrease in their expression near parturition suggests that the placenta may be relatively unresponsive to estrogens at this stage.

  5. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  7. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  8. Enhanced control of dorsolateral prefrontal cortex neurophysiology with real-time functional magnetic resonance imaging (rt-fMRI) neurofeedback training and working memory practice.

    Science.gov (United States)

    Sherwood, Matthew S; Kane, Jessica H; Weisend, Michael P; Parker, Jason G

    2016-01-01

    Real-time functional magnetic resonance imaging (rt-fMRI) neurofeedback can be used to train localized, conscious regulation of blood oxygen level-dependent (BOLD) signals. As a therapeutic technique, rt-fMRI neurofeedback reduces the symptoms of a variety of neurologic disorders. To date, few studies have investigated the use of self-regulation training using rt-fMRI neurofeedback to enhance cognitive performance. This work investigates the utility of rt-fMRI neurofeedback as a tool to enhance human cognition by training healthy individuals to consciously control activity in the left dorsolateral prefrontal cortex (DLPFC). A cohort of 18 healthy participants in the experimental group underwent rt-fMRI neurofeedback from the left DLPFC in five training sessions across two weeks while 7 participants in the control group underwent similar training outside the MRI and without rt-fMRI neurofeedback. Working memory (WM) performance was evaluated on two testing days separated by the five rt-fMRI neurofeedback sessions using two computerized tests. We investigated the ability to control the BOLD signal across training sessions and WM performance across the two testing days. The group with rt-fMRI neurofeedback demonstrated a significant increase in the ability to self-regulate the BOLD signal in the left DLPFC across sessions. WM performance showed differential improvement between testing days one and two across the groups with the highest increases observed in the rt-fMRI neurofeedback group. These results provide evidence that individuals can quickly gain the ability to consciously control the left DLPFC, and this training results in improvements of WM performance beyond that of training alone. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Strand-specific real-time RT-PCR quantitation of Maize fine streak virus genomic and positive-sense RNAs using high temperature reverse transcription

    Science.gov (United States)

    Efforts to analyze the replicative RNA produced by Maize fine streak virus (MVSF) within maize tissue was complicated by the lack of specificity during cDNA generation using standard reverse transcriptase protocols. Real-time qRT-PCR using cDNA generated by priming with random hexamers does not dist...

  10. Use of automated real-time reverse transcription-polymerase chain reaction (RT-PCR) to monitor experimental swine vesicular disease virus infection in pigs

    DEFF Research Database (Denmark)

    Reid, S.M.; Paton, D.J.; Wilsden, G.

    2004-01-01

    Automated real-time RT-PCR was evaluated as a diagnostic tool for swine vesicular disease virus (SVDV) infection on a range of samples (vesicular epithelium, serum, nasal swabs, faeces) from four inoculated and three in-contact pigs over a period of 28 days. Traditional diagnostic procedures (vir...

  11. Expansion of the Real-Time SPoRT-Land Information System for NOAA/National Weather Service Situational Awareness and Local Modeling Applications

    Science.gov (United States)

    Case, Jonathan L; White, Kristopher D.

    2014-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center in Huntsville, AL is running a real-time configuration of the Noah land surface model (LSM) within the NASA Land Information System (LIS) framework (hereafter referred to as the "SPoRT-LIS"). Output from the real-time SPoRT-LIS is used for (1) initializing land surface variables for local modeling applications, and (2) displaying in decision support systems for situational awareness and drought monitoring at select NOAA/National Weather Service (NWS) partner offices. The experimental CONUS run incorporates hourly quantitative precipitation estimation (QPE) from the National Severe Storms Laboratory Multi- Radar Multi-Sensor (MRMS) which will be transitioned into operations at the National Centers for Environmental Prediction (NCEP) in Fall 2014.This paper describes the current and experimental SPoRT-LIS configurations, and documents some of the limitations still remaining through the advent of MRMS precipitation analyses in the SPoRT-LIS land surface model (LSM) simulations.

  12. Uso de la metodología GAIA para modelar el comportamiento de personajes en un juego de estrategia en tiempo real

    Directory of Open Access Journals (Sweden)

    Norman Muñoz

    2010-01-01

    Full Text Available Los juegos modernos en su permanente búsqueda por capturar más la atención de sus jugadores, requieren de técnicas de Inteligencia Artificial que les permita a los personajes asumir comportamientos más cercanos o parecidos a la realidad. Para lograr esto, existen muchas técnicas que se pueden utilizar, pero en los últimos años el uso de agentes inteligentes ha tomado gran importancia, ya que las propiedades de los personajes encajan perfectamente con la definición de dicha técnica. En este artículo, se presentan los principales resultados de investigación y la forma como se usó la metodología GAIA para el modelamiento del comportamiento de los personajes en un juego de estrategia de tiempo real llamado Independencia (basado en la Revolución de los Comuneros de la Independencia de Colombia.

  13. Redes Inalámbricas para el Monitoreo y Control en tiempo real de Sistemas de Calentamiento de agua con Colectores Solares

    Directory of Open Access Journals (Sweden)

    Alfredo Pino Escalona

    2011-05-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 Tecnología inalámbrica ZigBee para monitorear en tiempo real un sistema de calentamiento de agua  instalado en el hotel Las América en Santiago de Cuba con energía solar. Se analiza el flujo tecnológico de la instalación y las principales características del estándar IEEE 802.15.4 y la pila desarrollada por Microchip. El diseño del sistema incluye dos módulos y se controla la temperatura del agua para las habitaciones  manipulando el caudal que recircula entre los calentadores solares y el tanque de almacenamiento. El diseño e implementación del controlador se realiza utilizando microcontroladores PICs  y un sistema supervisorio  programado en LabWindowsTM/CVITM 9.0

  14. Puesta a punto del método de PCR en tiempo real para la cuantificación de Aspergillus carbonarius en uvas Vitis vinifera cv. Tannat

    Directory of Open Access Journals (Sweden)

    Gustavo Garmendia

    2011-12-01

    Full Text Available La ocratoxina A (OTA es una micotoxina que ha sido detectada en uvas y vinos. Es producida por Aspergillus ochraceus, Penicillium verrucosum, Aspergillus carbonarius y especies pertenecientes al agregado Aspergillus niger. En los últimos años se ha descrito la presencia de Aspergillus aculeatus y Aspergillus japonicus en la superficie de uvas y su capacidad de producir OTA. A pesar de que la concentración detectada de cepas pertenecientes a la Sección Nigri fue < 100/g de uva, se han aislado, identificado y caracterizado 56 cepas de Aspergillus pertenecientes a la Sección Nigri. El 51 % fue identificado como A. niger, el 39 % como A. japonicus, 5 % como A. tubingensis -like y 5 % como A. foetidus. Ninguna cepa de A. carbonarius fue aislada. Debido a que esta especie ha sido descrita como la principal responsable de la presencia de OTA en uvas y vinos por su capacidad de producir altas concentraciones de OTA, se requiere un método más sensible que los métodos convencionales para detectar y cuantificar la presencia de A. carbonarius en uva. En este trabajo se optimizó la técnica de PCR en tiempo real para la detección y cuantificación de esta especie en uvas d e la variedad Tannat.

  15. Rapid detection and subtyping of European swine influenza viruses in porcine clinical samples by haemagglutinin- and neuraminidase-specific tetra- and triplex real-time RT-PCRs

    DEFF Research Database (Denmark)

    Henritzi, Dinah; Zhao, Na; Starick, Elke

    2016-01-01

    diagnostic methods which allow for cost-effective large-scale analysis. Methods New SIV haemagglutinin (HA) and neuraminidase (NA) subtype- and lineage-specific multiplex real-time RT-PCRs (RT-qPCR) have been developed and validated with reference virus isolates and clinical samples. Results A diagnostic...... algorithm is proposed for the combined detection in clinical samples and subtyping of SIV strains currently circulating in Europe that is based on a generic, M-gene-specific influenza A virus RT-qPCR. In a second step, positive samples are examined by tetraplex HA- and triplex NA-specific RT-qPCRs...... to differentiate the porcine subtypes H1, H3, N1 and N2. Within the HA subtype H1, lineages “av” (European avian-derived), “hu” (European human-derived) and “pdm” (human pandemic A/H1N1, 2009) are distinguished by RT-qPCRs, and within the NA subtype N1, lineage “pdm” is differentiated. An RT-PCR amplicon Sanger...

  16. Optimization of one-step duplex real-time RT-PCR for detection of influenza and respiratory syncytial virus in nasopharyngeal aspirates.

    Science.gov (United States)

    de-Paris, Fernanda; Beck, Caroline; Machado, Alice Beatriz Mombach Pinheiro; Paiva, Rodrigo Minuto; da Silva Menezes, Denise; de Souza Nunes, Luciana; Kuchenbecker, Ricardo; Barth, Afonso Luís

    2012-12-01

    Viruses are major contributors to acute respiratory infection-related morbidity and mortality worldwide. The influenza (IF) viruses and human respiratory syncytial virus (RSV) play a particularly important role in the etiology of acute respiratory infections. This study sought to standardize a one-step duplex real-time RT-PCR technique to optimize diagnosis of IFA/IFB and RSVA/RSVB infection. Viral RNA was extracted with the commercially available QIAamp Mini Kit according to manufacturer instructions. RT-PCR was performed with primers to the matrix protein gene of IFA, the hemagglutinin gene of IFB and the N gene of RSVA and RSVB. The limits of detection were 1 copy/μL for IFA, 10 copies/μL for IFB, 5 copies/μL for RSVA, and 250 copies/μL for RSVB. The specificity of RT-PCR was determined by comparison against a panel of several respiratory pathogens. RT-PCR and indirect immunofluorescence (IIF) were compared in a sample of 250 nasopharyngeal aspirates (NPAs) collected during the year 2010. RT-PCR was more sensitive than IIF and able to detect viral co-infections. In summary, RT-PCR optimized for IFA/IFB and RSVA/RSVB is sensitive and specific for these viral agents and is therefore useful for assessment of the etiology of respiratory infections, whether for clinical or epidemiological purposes. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  18. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  19. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...... to detect FMDV in materials from both cattle and buffalo. When compared to traditional virus cultivation the virus detection sensitivity was similar but the RT-PCR method can provide a laboratory result much faster than virus cultivation. The real-time PCR method confirms the identity of the amplicon...... by melting point analysis for added specificity and at the same time allows the detection of mutations in the probe region. As such, the described new method is suitable for the robust real-time detection of index cases caused by any serotype of FMDV....

  20. Factors Affecting Detection of Hepatitis E Virus on Canadian Retail Pork Chops and Pork Livers Assayed Using Real-Time RT-PCR.

    Science.gov (United States)

    Wilhelm, B J; Leblanc, D; Avery, B; Pearl, D L; Houde, A; Rajić, A; McEwen, S A

    2016-03-01

    We collected 599 Canadian retail pork chops and 283 pork livers routinely (usually weekly) from April 2011 to March 2012 using the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) retail sampling platform. Samples were assayed using validated real-time (q) reverse transcriptase polymerase chain reaction (RT-PCR) and nested classical RT-PCR for the detection of hepatitis E virus (HEV), porcine enteric calicivirus (PEC) and rotavirus (RV). The presence of Escherichia coli, Salmonella spp. and Campylobacter spp. was measured on a subset of our samples. Exact logistic regression models were fitted for predictors for HEV detection, for each assay. For both assays, sample type (pork chop versus liver) was a significant predictor for HEV RNA detection. For nested classical RT-PCR but not qRT-PCR, region of sample collection was a significant predictor (P = 0.008) of HEV detection. Odds of HEV detection were greatest in spring relative to other seasons. E. coli was a significant predictor for HEV RNA detection using the qRT-PCR (P = 0.03). Overall, the prevalence of E. coli, Salmonella spp. and Campylobacter spp. was significantly greater than HEV, PEC or RV on our retail pork samples. Our sparse data set for the detection of PEC and RV precluded modelling of risk factors for the detection of these viruses. © 2015 Zoonoses and Public Health © 2015 Her Majesty the Queen in Right of Canada Reproduced with the permission of the Minister of the Public Health Agency of Canada.

  1. Analytical and Clinical Performance of the CDC Real Time RT-PCR Assay for Detection and Typing of Dengue Virus

    Science.gov (United States)

    Santiago, Gilberto A.; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F.; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L.

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1–4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1–4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1–4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1–4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases. PMID:23875046

  2. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  3. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  4. Neuropatía por virus BK post trasplante renal diagnostico y seguimiento por PCR en tiempo real BK virus nephropathy after renal transplantation: Diagnosis and prognosis by real time PCR

    Directory of Open Access Journals (Sweden)

    Marcela Echavarria

    2007-12-01

    Full Text Available La nefropatía producida por el virus BK puede llevar a la pérdida del trasplante renal. El diagnóstico etiológico es importante debido a que la clínica no permite diferenciar entre nefropatía por virus BK y rechazo agudo, en donde los tratamientos de estas dos entidades son diametralmente opuestos. El desarrollo reciente de métodos moleculares muy sensibles y específicos como PCR y PCR en tiempo real para virus BK permiten un diagnóstico de certeza en forma rápida y cuantificar la carga viral presente. El diagnóstico de nefropatía por virus BK se realiza por inmunohistoquímica en una biopsia renal, pero dada la naturaleza multifocal de las lesiones, la sensibilidad no siempre es del 100%. Los nuevos métodos de PCR para detectar virus BK en sangre y orina contribuyen al diagnóstico de nefropatía de una manera más normatizada y menos invasiva. Más aún, la cuantificación del virus BK en sangre por PCR en tiempo real, ha demostrado ser útil en el diagnóstico y monitoreo de esta enfermedad. En este trabajo se presenta el caso de una paciente transplantada renal con nefropatía por virus BK y el desarrollo de un método de PCR en tiempo real para la detección de virus BK en sangre y orina. Esta nueva metodología confirmó el diagnóstico de nefropatía por virus BK lo que permitió un cambio en el esquema de inmunosupresión y la instauración de un tratamiento que pudo ser monitorizado utilizando la carga viral.BK virus nephropathy may lead to kidney transplant failure. BK infection and acute rejection are clinically undistinguishable, therefore diagnosis of these entities is critical to establish the correct treatment. The new molecular methods using PCR and real time PCR have significantly contributed to the rapid and sensitive diagnosis of BK virus. Furthermore, viral load determination in plasma has significantly been associated with BK virus nephropathy. Definite diagnosis of nephropathy requires renal biopsy, although

  5. PCR en tiempo real para el sexaje y análisis citológico de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Zulita Prieto

    2017-01-01

    Full Text Available El objetivo de la presente investigación fue dar a conocer nuevos marcadores moleculares para la PCR en tiempo real asociados a los cromosomas sexuales y el análisis de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis nil oticus . Se diseñaron cuatro pares de cebadores y se pusieron a prueba por PCR punto final y por PCR en tiempo real utilizando el fluorescente SYBR® Green en muestras de ADN de hembras XX, machos XY y supermachos YY. Los tamaños de los fragmentos amplificad os por PCR punto final fueron concordantes a los valores esperados y por PCR en tiempo real se demostró igual especificidad pero con ventaja en rapidez en la detección de amplificación de marcadores asociados a los cromosoma X y Y, de acuerdo con las condi ciones de la PCR establecidas. Las diferencias genéticas entre las regiones de los cromosomas X y Y demostradas con los marcadores específicos no fueron perceptibles citológicamente en los espermatocitos en paquiteno de O. niloticus XY. En base a las difer encias y homologías de las secuencias de ADN entre las accesiones KC710223 y KC710224 de los cromosomas X y Y se propone un modelo de sinapsis del bivalente XY.

  6. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3.

    Science.gov (United States)

    Thonur, Leenadevi; Maley, Madeleine; Gilray, Janice; Crook, Tara; Laming, Ellie; Turnbull, Dylan; Nath, Mintu; Willoughby, Kim

    2012-03-28

    Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD) is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR) to detect the viruses commonly implicated in BRD. A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV), bovine herpes virus type 1 (BoHV-1) and bovine parainfluenza virus type 3 (BPI3 i & ii) nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI) and/or indirect fluorescent antibody test (IFAT). The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA), minor groove binding (MGB) and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  7. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  8. Supervisory system for real time monitoring of transient thermal stresses in turbines rotors; Sistema supervisorio para el monitoreo en tiempo real de esfuerzos termicos transitorios en rotores de turbinas

    Energy Technology Data Exchange (ETDEWEB)

    Urquiza Beltran, Gustavo; Rios Miranda, Edmundo; Venegas Guzman, Ricardo; Alvarez Garcia, Gabriela [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1991-12-31

    This article presents a supervisory system that, as its main functions, assists the operator on base of the thermal stresses, monitoring in real time the high pressure (HP) and intermediate pressure rotors (IP) of a steam turbine during the start, shut down and/or sudden load changes. The system is based on a thermal model uni-dimensional integrated to the SIMPER (Information System for the Predictive Maintenance of Rotating Equipment), tested in a 300 MW unit of Comision Federal de Electricidad (CFE). [Espanol] En este articulo se presenta un sistema supervisorio que, como funciones principales, asiste al operador con base en el monitoreo de esfuerzos termicos en tiempo real en los rotores de presion alta (PA) y presion intermedia (PI) de una turbina de vapor durante un arranque, paro y/o variaciones bruscas de carga. El sistema esta basado en un modelo termico unidimensional integrado al SIMPER (sistema informatico para el mantenimiento predictivo de equipo rotatorio), experimentado en una unidad de 300 MW de la Comision Federal de Electricidad (CFE).

  9. Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus

    Science.gov (United States)

    2017-03-21

    dispersion via migrating birds . This sequence diversity negatively impacts existing 21 molecular diagnostic assays, leading to false negative diagnostic...Announcement). Briefly, the S segment of each virus was amplified using the 83 SuperScript III One-Step RT-PCR system with Platinum Taq DNA Polymerase High...generated using the Nextera XT DNA Library Kit (Illumina) according to the 86 manufacturer’s instructions. Libraries were pooled and sequenced on the MiSeq

  10. Simultaneous detection and differentiation of three Potyviridae viruses in sweet potato by a multiplex TaqMan real time RT-PCR assay.

    Science.gov (United States)

    Lan, Pingxiu; Li, Fan; Abad, Jorge; Pu, Lingling; Li, Ruhui

    2018-02-01

    A multiplex TaqMan real time RT-PCR was developed for detection and differentiation of Sweet potato virus G, Sweet potato latent virus and Sweet potato mild mottle virus in one tube. Amplification and detection of a fluorogenic cytochrome oxidase gene was included as an internal control. The assay was compared with a multiplex RT-PCR developed in the initial study for the detection and differentiation of the three viruses and host 18S rRNA. Primers and/or probes of the two assays were designed from conserved regions of each virus. The two assays were optimized for primers/probes and primer concentrations and thermal cycling conditions. Sensitivity and specificity of the assays were compared each other and with other assay. Both assays were evaluated by 74 field samples original from five different provinces of China. showed that the TaqMan real time RT-PCR offered rapid, sensitive, effective and reliable for the simultaneous detection and differentiation of the three viruses in sweet potato plants. The assay will be useful to quarantine and certification programs and virus surveys when large numbers of samples are tested. Copyright © 2017. Published by Elsevier B.V.

  11. Diagnóstico molecular de tuberculosis extrapulmonar y sensibilidad a rifampicina con un método automatizado en tiempo real

    Directory of Open Access Journals (Sweden)

    Adrián Peñata

    2016-04-01

    Conclusión. La prueba Xpert® MTB/RIF tuvo un buen desempeño en muestras de diferentes tejidos y líquidos, y constituye un avance significativo como apoyo para el diagnóstico de la tuberculosis extrapulmonar en términos de tiempo y porcentaje de positividad.

  12. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  14. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  15. Location and Classification of Moving Fruits in Real Time with a Single Color Camera Localización y Clasificación de Frutas Móviles en Tiempo Real con una Cámara Individual a Color

    Directory of Open Access Journals (Sweden)

    José F Reyes

    2009-06-01

    Full Text Available Quality control of fruits to satisfy increasingly competitive food markets requires the implementation of automatic servovisual systems in fruit processing operations to cope with market challenges. A new and fast method for identifying and classifying moving fruits by processing single color images from a static camera in real time was developed and tested. Two algorithms were combined to classify and track moving fruits on image plane using representative color features. The method allows classifying the fruit by color segmentation and estimating its position on the image plane, which provides a reliable algorithm to be implemented in robotic manipulation of fruits. To evaluate the methodology an experimental real time system simulating a conveyor belt and real fruit was used. Testing of the system indicates that with natural lighting conditions and proper calibration of the system a minimum error of 2% in classification of fruits is feasible. The methodology allows for very simple implementation, and although operational results are promising, even higher accuracy may be possible if structured illumination is used.El control de calidad en frutas y hortalizas para satisfacer mercados cada vez mas exigentes, requiere la implementación de sistemas automáticos servo visuales en operaciones de de procesamiento de frutas para responder a estos desafíos de mercado. En está trabajo se desarrollo y evaluó un nuevo método para identificar y clasificar frutas en movimiento mediante el procesamiento en tiempo real imágenes a color capturadas por una cámara individual estática. Se combinaron dos algoritmos para clasificar y rastrear frutas en movimiento en el plano de imagen utilizando aspectos representativos de color. El método permite clasificar las frutas en base a segmentación de color y estimar su posición en el plano de imagen, lo cual proporciona un algoritmo confiable para ser implementado en un brazo robótico.de manipulación de

  16. Molecular detection of a novel human influenza (H1N1) of pandemic potential by conventional and real-time quantitative RT-PCR assays.

    Science.gov (United States)

    Poon, Leo L M; Chan, K H; Smith, G J; Leung, C S W; Guan, Y; Yuen, K Y; Peiris, J S M

    2009-08-01

    Influenza A viruses are medically important viral pathogens that cause significant mortality and morbidity throughout the world. The recent emergence of a novel human influenza A virus (H1N1) poses a serious health threat. Molecular tests for rapid detection of this virus are urgently needed. We developed a conventional 1-step RT-PCR assay and a 1-step quantitative real-time RT-PCR assay to detect the novel H1N1 virus, but not the seasonal H1N1 viruses. We also developed an additional real-time RT-PCR that can discriminate the novel H1N1 from other swine and human H1 subtype viruses. All of the assays had detection limits for the positive control in the range of 1.0 x 10(-4) to 2.0 x 10(-3) of the median tissue culture infective dose. Assay specificities were high, and for the conventional and real-time assays, all negative control samples were negative, including 7 human seasonal H1N1 viruses, 1 human H2N2 virus, 2 human seasonal H3N2 viruses, 1 human H5N1 virus, 7 avian influenza viruses (HA subtypes 4, 5, 7, 8, 9, and 10), and 48 nasopharyngeal aspirates (NPAs) from patients with noninfluenza respiratory diseases; for the assay that discriminates the novel H1N1 from other swine and human H1 subtype viruses, all negative controls were also negative, including 20 control NPAs, 2 seasonal human H1N1 viruses, 2 seasonal human H3N2 viruses, and 2 human H5N1 viruses. These assays appear useful for the rapid diagnosis of cases with the novel H1N1 virus, thereby allowing better pandemic preparedness.

  17. Rapid detection of the pandemic 2009 H1N1 virus M gene by real?time and gel?based RT?PCR assays

    OpenAIRE

    Ma, Wenjun; Oberst, Richard; Li, Xi; Clouser, Deborah; Hesse, Richard; Rowland, Raymond; Richt, Juergen A.

    2010-01-01

    Please cite this paper as: Ma et?al. (2010) Rapid detection of the pandemic 2009 H1N1 virus M gene by real?time and gel?based RT?PCR assays. Influenza and Other Respiratory Viruses 4(6), 397?403. Background? Since the first pandemic 2009 H1N1 (pH1N1) virus was isolated from humans, it has also been detected in other mammalian (pigs, cats, dogs, ferrets) and avian (turkey) species, most likely because of cross?species transmission from humans. The pH1N1 contains six genes derived from swine in...

  18. Field Evaluation of a Deployable RT-PCR Assay System for Real-Time Identification of Dengue Virus

    National Research Council Canada - National Science Library

    McAvin, James C; Blow, Jamie A; Putnam, John L; Swaby, James A

    2004-01-01

    ..., real-time, fluorimetric thermocycler. Nucleic acid extract isolated from DEN1-4 inoculated Aedes aegypti, field-captured Aedes aegypti and Culex spp, and field-captured Aedes aegypti and Culex spp spiked with total nucleic acid...

  19. Encefalitis herpética confirmada por reacción en cadena de la polimerasa en tiempo real: reporte de caso Herpetic encephalitis confirmed by real time polymerase chain reaction: case report

    Directory of Open Access Journals (Sweden)

    Beatriz H. Aristizábal

    2006-04-01

    Full Text Available La encefalitis herpética es una enfermedad grave asociada al virus herpes simple 1 ó 2, con una alta letalidad, incidencia de complicaciones y secuelas neurológicas permanentes. Aparece en forma endémica y en pacientes inmunocompetentes. Puede manifestarse como un cuadro clásico de encefalitis infecciosa con fiebre, cefalea y alteración en el nivel de conciencia. Debido al compromiso del lóbulo temporal las manifestaciones clínicas pueden incluir también alucinaciones, afasia y cambios de personalidad. Las secuelas en los pacientes tratados son significativas. Objetivo: mostrar la importancia de la utilización del diagnóstico molecular temprano en pacientes con sospecha de encefalitis herpética. Métodos: el diagnóstico de la encefalitis herpética ha cambiado en los últimos años gracias al advenimiento de la reacción en cadena de la polimerasa en tiempo real en líquido cefalorraquídeo para Herpes virus simple, una estrategia rápida y de alta sensibilidad y especificidad, que en nuestro medio ha permitido reemplazar los diagnósticos presuntivos realizados por tomografía axial computarizada o electroencefalograma o los bajos rendimientos del aislamiento viral en el líquido cefaloraquídeo. Resultados: se describe el caso clínico de un paciente con encefalitis herpética asistido en nuestro hospital, con diagnóstico confirmado por reacción en cadena de la polimerasa en tiempo real, presentando estudios imaginológicos y neuropsicológicos compatibles con el diagnóstico. Conclusiones: los resultados de laboratorio y el diagnóstico temprano son críticos para el tratamiento precoz y la evolución del paciente. The herpetic encephalitis is a serious disease associated to the herpes virus simplex 1 or 2 with high mortality, permanent incidence of complications and neurological sequels. It appears in endemic form and in immunocompetent patients. It can be shown like a classical manifest of infectious encephalitis, with fever

  20. Avian metapneumovirus RT-nested-PCR: a novel false positive reducing inactivated control virus with potential applications to other RNA viruses and real time methods.

    Science.gov (United States)

    Falchieri, Marco; Brown, Paul A; Catelli, Elena; Naylor, Clive J

    2012-12-01

    Using reverse genetics, an avian metapneumovirus (AMPV) was modified for use as a positive control for validating all stages of a popular established RT-nested PCR, used in the detection of the two major AMPV subtypes (A and B). Resultant amplicons were of increased size and clearly distinguishable from those arising from unmodified virus, thus allowing false positive bands, due to control virus contamination of test samples, to be identified readily. Absorption of the control virus onto filter paper and subsequent microwave irradiation removed all infectivity while its function as an efficient RT-nested-PCR template was unaffected. Identical amplicons were produced after storage for one year. The modified virus is likely to have application as an internal standard as well as in real time methods. Additions to AMPV of RNA from other RNA viruses, including hazardous examples such HIV and influenza, are likely to yield similar safe RT-PCR controls. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3

    Directory of Open Access Journals (Sweden)

    Thonur Leenadevi

    2012-03-01

    Full Text Available Abstract Background Detection of respiratory viruses in veterinary species has traditionally relied on virus detection by isolation or immunofluorescence and/or detection of circulating antibody using ELISA or serum neutralising antibody tests. Multiplex real time PCR is increasingly used to diagnose respiratory viruses in humans and has proved to be superior to traditional methods. Bovine respiratory disease (BRD is one of the most common causes of morbidity and mortality in housed cattle and virus infections can play a major role. We describe here a one step multiplex reverse transcriptase quantitative polymerase chain reaction (mRT-qPCR to detect the viruses commonly implicated in BRD. Results A mRT-qPCR assay was developed and optimised for the simultaneous detection of bovine respiratory syncytial virus (BRSV, bovine herpes virus type 1 (BoHV-1 and bovine parainfluenza virus type 3 (BPI3 i & ii nucleic acids in clinical samples from cattle. The assay targets the highly conserved glycoprotein B gene of BoHV-1, nucleocapsid gene of BRSV and nucleoprotein gene of BPI3. This mRT-qPCR assay was assessed for sensitivity, specificity and repeatability using in vitro transcribed RNA and recent field isolates. For clinical validation, 541 samples from clinically affected animals were tested and mRT-qPCR result compared to those obtained by conventional testing using virus isolation (VI and/or indirect fluorescent antibody test (IFAT. Conclusions The mRT-qPCR assay was rapid, highly repeatable, specific and had a sensitivity of 97% in detecting 102 copies of BRSV, BoHV-1 and BPI3 i & ii. This is the first mRT-qPCR developed to detect the three primary viral agents of BRD and the first multiplex designed using locked nucleic acid (LNA, minor groove binding (MGB and TaqMan probes in one reaction mix. This test was more sensitive than both VI and IFAT and can replace the aforesaid methods for virus detection during outbreaks of BRD.

  2. Diseño de un Software de Intermediación de Comunicación para Sistemas Distribuidos de Tiempo Real Críticos en Java

    Directory of Open Access Journals (Sweden)

    Daniel Tejera

    2013-04-01

    Full Text Available Resumen: Las facilidades e independencia de plataforma de Java han generado un gran interés en la comunidad de tiempo real. Dicho interés se ha reflejado en la especificación RTSJ (Real-Time Specification for Java, que extiende y adapta el lenguaje Java para permitir el desarrollo de sistemas de tiempo real. Adicionalmente, se han desarrollado perfiles de RTSJ para garantizar la predecibilidad en sistemas de tiempo real críticos. Sin embargo, RTSJ y sus perfiles no proporcionan facilidades para sistemas distribuidos. El objetivo de este trabajo es afrontar dicha limitación definiendo un nuevo modelo de RMI (Remote Method Invocation basado en los principales perfiles de RTSJ para sistemas de tiempo real crítico. Este trabajo presenta el diseño y la implementación de RMI-HRT (RMI-Hard Real-Time que está enfocado a sistemas de tiempo real crítico con requisitos de alta integridad. Abstract: Distributed real-time embedded systems are becoming increasingly important to society. More demands will be made on them and greater reliance will be placed on the delivery of their services. A relevant subset of them is high-integrity or hard real-time systems, where failure can cause loss of life, environmental harm, or significant financial loss.Additionally, the evolution of communication networks and paradigms as well as the necessity of demanding processing power and fault tolerance, motivated the interconnection between electronic devices; many of the communications have the possibility of transferring data at a high speed. The concept of distributed systems emerged as systems where different parts are executed on several nodes that interact with each other via a communication network.Java's popularity, facilities and platform independence have made it an interesting language for the real-time and embedded community. This was the motivation for the development of RTSJ (Real-Time Specification for Java, which is a language extension intended to

  3. Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes.

    Science.gov (United States)

    Czechowski, Tomasz; Bari, Rajendra P; Stitt, Mark; Scheible, Wolf-Rüdiger; Udvardi, Michael K

    2004-04-01

    Summary To overcome the detection limits inherent to DNA array-based methods of transcriptome analysis, we developed a real-time reverse transcription (RT)-PCR-based resource for quantitative measurement of transcripts for 1465 Arabidopsis transcription factors (TFs). Using closely spaced gene-specific primer pairs and SYBR Green to monitor amplification of double-stranded DNA (dsDNA), transcript levels of 83% of all target genes could be measured in roots or shoots of young Arabidopsis wild-type plants. Only 4% of reactions produced non-specific PCR products. The amplification efficiency of each PCR was determined from the log slope of SYBR Green fluorescence versus cycle number in the exponential phase, and was used to correct the readout for each primer pair and run. Measurements of transcript abundance were quantitative over six orders of magnitude, with a detection limit equivalent to one transcript molecule in 1000 cells. Transcript levels for different TF genes ranged between 0.001 and 100 copies per cell. Only 13% of TF transcripts were undetectable in these organs. For comparison, 22K Arabidopsis Affymetrix chips detected less than 55% of TF transcripts in the same samples, the range of transcript levels was compressed by a factor more than 100, and the data were less accurate especially in the lower part of the response range. Real-time RT-PCR revealed 35 root-specific and 52 shoot-specific TF genes, most of which have not been identified as organ-specific previously. Finally, many of the TF transcripts detected by RT-PCR are not represented in Arabidopsis EST (expressed sequence tag) or Massively Parallel Signature Sequencing (MPSS) databases. These genes can now be annotated as expressed.

  4. Suitable housekeeping genes for normalization of transcript abundance analysis by real-time RT-PCR in cultured bovine granulosa cells during hypoxia and differential cell plating density.

    Science.gov (United States)

    Baddela, Vijay S; Baufeld, Anja; Yenuganti, Vengala R; Vanselow, Jens; Singh, Dheer

    2014-11-27

    Bovine granulosa cell culture models are important to understand molecular mechanisms of ovarian function. Folliculogenesis and luteinization are associated with increasing density of cells and local hypoxic conditions. The current study identified two reliable housekeeping genes useful for gene normalization in granulosa cells under different in vitro conditions. During the current experiments cells were subjected to different biological and physical stimuli, follicle stimulating hormone, different initial cell plating density and hypoxia. Transcript abundance of seven housekeeping genes was quantified by real-time RT-PCR with co-amplification of the respective external standard. Three of the genes, GAPDH, HMBS, and HPRT1 were found to be regulated by initial cell plating density, five of them, GAPDH, HMBS, HPRT1, RPLP0 and RPS18 under hypoxic conditions, but none of them after FSH stimulation. In detail, GAPDH was up regulated, but HPRT1 and HMBS were down regulated at high density and under hypoxia. Expression of RPLP0 and RPS18 was inconsistent, but was significantly down-regulated in particular at high cell density combined with hypoxia. In contrast, TBP and B2M genes were neither regulated under different plating density conditions nor by hypoxia as they showed similar expression levels under all conditions analyzed. The present data indicate that TBP and B2M are appropriate housekeeping genes for normalization of transcript abundance measured by real-time RT-PCR in granulosa cells subjected to different plating densities, oxygen concentrations and FSH stimulation.

  5. In vitro transcribed RNA molecules for the diagnosis of pandemic 2009 influenza A(H1N1) virus by real-time RT-PCR.

    Science.gov (United States)

    Bermúdez de León, Mario; Peñuelas-Urquides, Katia; Aguado-Barrera, Miguel E; Currás-Tuala, María José; Escobedo-Guajardo, Brenda L; González-Ríos, Rosa Nelly; Mata-Tijerina, Viviana L; Vázquez-Monsiváis, Ofelia E

    2013-11-01

    The 2009 influenza A(H1N1) outbreak allowed the implementation of new epidemiologic surveillance tools in several countries around the world. A new molecular protocol with appropriate sensitivity and specificity using real-time RT-PCR was developed by the Centers for Disease Control and Prevention (CDC) to identify the pandemic 2009 influenza A (H1N1) virus in human specimens. In the CDC protocol, positive controls are available only upon request and they are taken from cell cultures infected with 2009 influenza A(H1N1) virus, representing a handling risk for laboratory technicians. The poor availability of positive control materials in diagnostic laboratories may limit the public health response. The aim of the work presented in this paper was to develop positive controls for the diagnostic testing of influenza A(H1N1) virus that could be used in the CDC real-time RT-PCR protocol. A series of plasmid constructs bearing partial sequences of the viral genes were created and each construct was used as a template for in vitro transcription. RNA molecules were obtained successfully at high yield, i.e., 2×10(7) assays per microliter. Thus, the inclusion of these molecules in the influenza panel as positive controls is proposed. The in vitro transcribed RNA could also be used as quality standards in the design of international proficiency studies. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Detección y genotipado del virus del papiloma humano mediante una técnica de PCR a tiempo real: utilidad de la muestra de orina

    OpenAIRE

    Bernal Martínez, Samuel

    2014-01-01

    Texto completo descargado desde Teseo La infección por el virus del papiloma humano (VPH) es una causa necesaria, aunque, por si sola, insuficiente para el desarrollo del cáncer de cérvix. Normalmente las infecciones por VPH se resuelven espontáneamente, pero un pequeño porcentaje de ellas, dan lugar al desarrollo de lesiones pre-neoplásicas que pueden derivar en lesiones invasivas de la mucosa produciendo el cáncer. El tiempo medio entre la infección por el VPH y el desarrollo de las lesi...

  8. Biosurveillance of avian influenza and Newcastle disease viruses in the Barda region of Azerbaijan using real time RT-PCR and hemagglutination inhibition

    Directory of Open Access Journals (Sweden)

    Shalala eZeynalova

    2015-11-01

    Full Text Available The Azerbaijan State Veterinary Control Service (SVCS has conducted active serological surveillance for avian influenza (AI in poultry since 2006, when the first outbreak of AI H5N1 occurred in Azerbaijan. Samples are collected from September to May annually and tested using a hemagglutination inhibition (HI assay to detect antibodies against H5 AI viruses. HI testing is also performed for Newcastle disease virus (NDV upon request, but since this method cannot distinguish between natural infections and immune responses to vaccination, all positive results require follow-up epidemiological investigations. Furthermore, blood collection for the surveillance program is time-intensive and can be stressful to birds. In order to improve the national surveillance program, alternative sampling and testing methodologies were applied among a population of birds in the Barda region and compared with results of the national surveillance program. Tracheal and cloacal swabs were collected instead of blood. Rather than testing individual samples, RNA was pooled to conserve resources and time, and pools were tested by real-time reverse transcription PCR (rRT-PCR. Environmental sampling at a live bird market was also introduced as another surveillance mechanism. A total of 1,030 swabs were collected, comprising tracheal and cloacal samples from 441 birds and 148 environmental surface samples from farms or the live bird market. During the same time, 3,890 blood samples were collected nationally for the surveillance program; 400 of these samples originated in the Barda region. Birds sampled for rRT-PCR were likely different than those tested as part of national surveillance. All swab samples tested negative by rRT-PCR for both AI and NDV. All blood samples tested negative for H5 by HI, while 6.2% of all samples and 5% of the Barda samples tested positive for exposure to NDV. Follow-up investigations found that positive samples were from birds vaccinated in the

  9. Biosurveillance of avian influenza and Newcastle disease viruses in the Barda region of Azerbaijan using real time RT-PCR and hemagglutination inhibition.

    Science.gov (United States)

    Zeynalova, Shalala; Guliyev, Fizuli; Vatani, Mahira; Abbasov, Bahruz

    2015-01-01

    The Azerbaijan State Veterinary Control Service (SVCS) has conducted active serological surveillance for avian influenza (AI) in poultry since 2006, when the first outbreak of AI H5N1 occurred in Azerbaijan. Samples are collected from September to May annually and tested using a hemagglutination inhibition (HI) assay to detect antibodies against H5 AI viruses. HI testing is also performed for Newcastle disease virus (NDV) upon request, but since this method cannot distinguish between natural infections and immune responses to vaccination, all positive results require follow-up epidemiological investigations. Furthermore, blood collection for the surveillance program is time-intensive and can be stressful to birds. In order to improve the national surveillance program, alternative sampling and testing methodologies were applied among a population of birds in the Barda region and compared with results of the national surveillance program. Tracheal and cloacal swabs were collected instead of blood. Rather than testing individual samples, RNA was pooled to conserve resources and time, and pools were tested by real-time reverse transcription polymerase chain reaction (rRT-PCR). Environmental sampling at a live bird market was also introduced as another surveillance mechanism. A total of 1,030 swabs were collected, comprising tracheal, and cloacal samples from 441 birds and 148 environmental surface samples from farms or the live bird market. During the same time, 3,890 blood samples were collected nationally for the surveillance program; 400 of these samples originated in the Barda region. Birds sampled for rRT-PCR were likely different than those tested as part of national surveillance. All swab samples tested negative by rRT-PCR for both AI and NDV. All blood samples tested negative for H5 by HI, while 6.2% of all samples and 5% of the Barda samples tested positive for exposure to NDV. Follow-up investigations found that positive samples were from birds vaccinated in

  10. Ebola virus disease diagnosis by real-time RT-PCR: A comparative study of 11 different procedures.

    Science.gov (United States)

    Cherpillod, Pascal; Schibler, Manuel; Vieille, Gaël; Cordey, Samuel; Mamin, Aline; Vetter, Pauline; Kaiser, Laurent

    2016-04-01

    The diagnosis of Ebola virus disease relies on the detection of viral RNA in blood by real-time reverse-transcription PCR. While several of these assays were developed during the unprecedented 2013-2015 Ebola virus disease outbreak in West Africa, few were applied in the field. To compare technical performances and practical aspects of 11 Ebola virus real-time reverse-transcription PCR procedures. We selected the most promising assays using serial dilutions of culture-derived Ebola virus RNA and determined their analytical sensitivity and potential range of quantification using quantified in vitro transcribed RNA; viral load values in the serum of an Ebola virus disease patient obtained with these assays were reported. Finally, ease of use and turnaround times of these kits were evaluated. Commercial assays were at least as sensitive as in-house tests. Five of the former (Altona, Roche, Fast-track Diagnostics, and Life Technologies) were selected for further evaluation. Despite differences in analytical sensitivity and limits of quantification, all of them were suitable for Ebola virus diagnosis and viral load estimation. The Lifetech Lyophilized Ebola Virus (Zaire 2014) assay (Life Technologies) appeared particularly promising, displaying the highest analytical sensitivity and shortest turnaround time, in addition to requiring no reagent freezing. Commercial kits were at least as sensitive as in-house tests and potentially easier to use in the field than the latter. This qualitative comparison of real-time reverse transcription PCR assays may serve as a basis for the design of future Ebola virus disease diagnostics. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  12. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Science.gov (United States)

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum) using quantitative real-time RT-PCR.

    Science.gov (United States)

    Gimeno, Jacinta; Eattock, Nicholas; Van Deynze, Allen; Blumwald, Eduardo

    2014-01-01

    Switchgrass (Panicum virgatum) has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR) has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  14. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  15. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region....... the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce...

  16. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...... tests showed no positive results for heterologous pathogens. The assay was tested on clinical samples from BTV 8 outbreaks in Sweden and Denmark in 2008. The lowest detection limit for that serotype, determined with PCR standards, was 57 genome copies. The assay sensitivity for some other serotypes...... that circulate currently in Europe was also determined. BTV 2, 4, 9 and 16 were tested on available cell culture samples and the detection limits were 109, 12, 13 and 24 copies, respectively. This assay provides an important tool for early and rapid detection of a wide range of BTV strains, including emerging...

  17. The use of best estimate codes to improve the simulation in real time; El uso de codigos best estimate y de entornos disenados para mejorar su productividad en simulacion en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Rivero, N.; Esteban, J. A.; Lenhardt, G.

    2007-07-01

    Best estimate codes are assumed to be the technology solution providing the most realistic and accurate response. Best estimate technology provides a complementary solution to the conservative simulation technology usually applied to determine plant safety margins and perform security related studies. Tecnatom in the early 90's, within the MAS project, pioneered the initiative to implement best estimate code in its training simulators. Result of this project was the implementation of the first six-equations thermal hydraulic code worldwide (TRAC{sub R}T), running in a training environment. To meet real time and other specific training requirements, it was necessary to overcome important difficulties. Tecnatom has just adapted the Global Nuclear Fuel core Design code: PANAC 11, and is about to complete the General Electric TRACG04 thermal hydraulic code adaptation. This technology features a unique solution for nuclear plants aiming at providing the highest fidelity in simulation, enabling to consider the simulator as a multipurpose: engineering and training, simulation platform. Besides, a visual environment designed to optimize the models life cycle, covering both pre and post-processing activities, is in its late development phase. (Author)

  18. Development and evaluation of a SYBR green-based real time RT-PCR assay for detection of the emerging avian influenza A (H7N9 virus.

    Directory of Open Access Journals (Sweden)

    Zheng Zhu

    Full Text Available Most recently a novel avian-origin influenza A (H7N9 virus emerged in China and has been associated with lots of human infection and fatal cases. Genetic analysis of the viral genome revealed that this reassortant virus might be better adapted to humans than other avian influenza viruses. Molecular diagnostic methods are thus urgently needed in public health laboratories. In this study, a SYBR green-based one-step real time reverse transcription-PCR (RT-PCR was developed to detect the novel H7N9 virus. The primer pairs on the basis of the hemagglutinin and neuraminidase gene sequences of H7N9 viruses amplified subtype-specific fragments with Tm values of 80.77±0.06°C for H7 and 81.20±0.17°C for N9 respectively. The standard curves showed a dynamic linear range across 6 log units of RNA copy number (10(6 to 10(1 copies/ µl with a detection limit of 10 copies per reaction for both H7 and N9 assays by using serial ten-fold diluted in-vitro transcribed viral RNA. In addition, no cross-reactivity was observed with seasonal H1N1, H1N1 pdm09, H3N2, H5N1 and H9N2 viruses as well as other human respiratory viruses. When the assay was further evaluated in H7N9 virus infected clinical samples, positive amplification signals were obtained in all of the specimens with the accordance between H7 and N9 assays. Therefore, the established SYBR green-based real time RT-PCR assay could provide a rapid, sensitive, specific and reliable alternative approach with lower costs for high throughput screening of suspected samples from humans, animals and environments in first line public health laboratories.

  19. Utility of IgM ELISA, TaqMan real-time PCR, reverse transcription PCR, and RT-LAMP assay for the diagnosis of Chikungunya fever.

    Science.gov (United States)

    Reddy, Vijayalakshmi; Ravi, Vasanthapuram; Desai, Anita; Parida, Manmohan; Powers, Ann M; Johnson, Barbara W

    2012-11-01

    Chikungunya fever a re-emerging infection with expanding geographical boundaries, can mimic symptoms of other infections like dengue, malaria which makes the definitive diagnosis of the infection important. The present study compares the utility of four laboratory diagnostic methods viz. IgM capture ELISA, an in house reverse transcription PCR for the diagnosis of Chikungunya fever, TaqMan real-time PCR, and a one step reverse transcription-loop mediated isothermal amplification assay (RT-LAMP). Out of the 70 serum samples tested, 29 (41%) were positive for Chikungunya IgM antibody by ELISA and 50 (71%) samples were positive by one of the three molecular assays. CHIKV specific nucleic acid was detected in 33/70 (47%) by reverse transcription PCR, 46/70 (66%) by TaqMan real-time PCR, and 43/70 (62%) by RT-LAMP assay. A majority of the samples (62/70; 89%) were positive by at least one of the four assays used in the study. The molecular assays were more sensitive for diagnosis in the early stages of illness (2-5 days post onset) when antibodies were not detectable. In the later stages of illness, the IgM ELISA is a more sensitive diagnostic test. In conclusion we recommend that the IgM ELISA be used as an initial screening test followed one of the molecular assays in samples that are collected in the early phase of illness and negative for CHIKV IgM antibodies. Such as approach would enable rapid confirmation of the diagnosis and implementation of public health measures especially during outbreaks. Copyright © 2012 Wiley Periodicals, Inc.

  20. Performance of two Real-Time RT-PCR assays for quantitation of hepatitis C virus RNA: evaluation on HCV genotypes 1-4.

    Science.gov (United States)

    Elkady, Abeer; Tanaka, Yasuhito; Kurbanov, Fuat; Sugauchi, Fuminaka; Sugiyama, Masaya; Khan, Anis; Ali, Elsayed Mostafa; Mouhamed, Layla; Abou el-fetouh, Sahar; AbdEl-Hameed, AbdEl-Rahaman; Mizokami, Masashi

    2010-11-01

    Accuracy for monitoring of the concentration of hepatitis C virus (HCV) RNA represents a major challenge throughout the management of patients with chronic hepatitis C. To investigate the genotype-independent efficiency and the accuracy of two real-time detection reverse transcription-polymerase chain reaction (RT-PCR) assays; the Cobas Ampliprep/Cobas TaqMan (CAP/CTM); and the Abbott RealTime HCV (ART), a total of 184 samples with different HCV subtypes were examined; 1b (n=58), 2a (n=39), 2b (n=26), 3a (n=20), and 4 (n=41). A robust linear correlation was observed between the two assays applied to genotypes 1b, 2a, 2b, and 3a [the correlation coefficient (R) ranged from 0.99 to 0.98], but not to genotype 4 specimens (R=0.78). A significant difference in measurements of HCV RNA using CAP/CTM and ART in serum samples with genotypes 1b and 4 was observed (0.72, -0.53 log IU/ml, PHCV core antigen and HCV RNA values by either of the HCV RNA quantitation assays applied to all genotypes with exception of genotype 4, for which R was higher with ART (R=0.95) than with CAP/CTM (R=0.80). The lower limit of detection of CAP/CTM and ART were 41.4 and 28.5 IU/ml using the WHO standards, respectively. In conclusion, two RT-PCR assays had a high efficiency and accuracy for quantitation of HCV RNA of genotypes 2a, 2b, and 3a, but the mean values of HCV RNA differed for genotype 1b and 4. © 2010 Wiley-Liss, Inc.

  1. APLIKASI KUANTIFIKASI KOI HERPESVIRUS : REAL TIME – QUANTITATIVE POLYMERASE CHAIN REACTION (RT-Q PCR MENGGUNAKAN SYBR GREEN PADA IKAN MAS (Cyprinus carpio

    Directory of Open Access Journals (Sweden)

    Isti Koesharyani

    2017-08-01

    Full Text Available Koi Herpes Virus (KHV di Indonesia sejak tahun 2002 merupakan penyakit mematikan yang menyerang ikan koi Cyprinus carpio koi dan ikan mas Cyprinus carpio carpio, dan sampai saat ini, infeksi KHV dilaporkan sudah menyebar hampir di seluruh dunia. Untuk mengetahui adanya infeksi KHV perlu cara diagnosa yang sangat akurat/sensitif, sehingga keberadaan KHV dapat diketahui secara pasti dengan tingkat sensitivitas yang lebih baik pada ikan budidaya. Tujuan dari penelitian ini adalah untuk mengaplikasikan teknik deteksi dengan real time quantitative polymerase chain reaction (RT- qPCR/qPCR guna mengetahui adanya infeksi KHV secara kuantitatif pada ikan mas dengan mengetahui kandungan virus (viral load. Sebanyak masing-masing 3 ekor sampel diperoleh dari sentra budidaya ikan mas di Cirata-Jawa Barat, Maninjau-Sumatera Barat, dan Banjarmasin-Kalimantan Selatan. Sampel-sampel tersebut selanjutnya dianalisa keberadaan KHV-nya dengan RT-qPCR menggunakan SYBR Green. Hasil pengujian menunjukkan bahwa jumlah tertinggi (viral load diperoleh dari ikan mas asal Cirata-3 dengan nilai Threshold Cycle (Ct. 18,24 atau setara dengan 3,4 x 107 kopi, dan terendah dari ikan mas asal Banjarmasin-3 dengan nilai Ct. 33,39 atau 1,8 x 102 kopi. Dua standar yang digunakan dalam pengujian ini berupa plasmid dengan jumlah kopi 2 x 104 (Ct 27,24 dan 2 x 103 (Ct 30,24 dan kontrol atau Non Template Control (NTC adalah 3,1 x 10 atau dengan nilai Ct 35,65. Uji aplikasi deteksi KHV dengan metode RT-qPCR ini memberikan hasil yang lebih sensitif, di mana sampel yang tidak terdeteksi dengan metode PCR konvensional dapat dideteksi dan dihitung jumlah kopi DNA (DNA copy. Since 2002, Koi herpesvirus (KHV in Indonesian has been a malignant diseases, now recognized as a worldwide cause of mortality among populations of koi Cyprinus carpio koi and common carp Cyprinus carpio carpio. To determine the presence of infection is required the KHV diagnosis method with highly accurate and sensitive

  2. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  3. Relative quantification and detection of different types of infectious bursal disease virus in bursa of Fabricius and cloacal swabs using real time RT-PCR SYBR green technology

    DEFF Research Database (Denmark)

    Li, Yiping; Handberg, K.J.; Kabell, Susanne

    2007-01-01

    In present study, different types of infectious bursal disease virus (IBDV), virulent strain DK01, classic strain F52/70 and vaccine strain D78 were quantified and detected in infected bursa of Fabricius (BF) and cloacal swabs using quantitative real time RT-PCR with SYBR green dye. For selection...... or F52/70 inoculation were detected as virus positive at day I post inoculation (p.i.). The D78 viral load peaked at day 4 and day 8 p.i., while the DK01 and F52/70 viral load showed relatively high levels at day 2 p.i. In cloacal swabs, viruses detectable were at day 2 p.i. for DK01 and F52/70, day 8...... of a suitable internal control gene, real time PCR parameters were evaluated for three candidate genes, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 28S rRNA and beta-actin to IBDVs. Based on this P-actin was selected as an internal control for quantification of IBDVs in BF. All BF samples with D78, DK01...

  4. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  5. Development of a rapid, sensitive TaqMan real-time RT-PCR assay for the detection of Rose rosette virus using multiple gene targets.

    Science.gov (United States)

    Babu, Binoy; Jeyaprakash, Ayyamperumal; Jones, Debra; Schubert, Timothy S; Baker, Carlye; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L

    2016-09-01

    Rose rosette virus (RRV), belonging to the genus Emaravirus, is a highly destructive pathogen that causes rose rosette disease. The disease is a major concern for the rose industry in the U.S. due to the lack of highly sensitive methods for early detection of RRV. This is critical, as early identification of the infected plants and eradication is necessary in minimizing the risks associated with the spread of the disease. A highly reliable, specific and sensitive detection assay is thus required to test and confirm the presence of RRV in suspected plant samples. In this study a TaqMan real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was developed for the detection of RRV from infected roses, utilizing multiple gene targets. Four pairs of primers and probes; two of them (RRV_2-1 and RRV_2-2) based on the consensus sequences of the glycoprotein gene (RNA2) and the other two (RRV_3-2 and RRV_3-5) based on the nucleocapsid gene (RNA3) were designed. The specificity of the primers and probes was evaluated against other representative viruses infecting roses, belonging to the genera Alfamovirus, Cucumovirus, Ilarvirus, Nepovirus, Tobamovirus, and Tospovirus and one Emaravirus (Wheat mosaic virus). Dilution assays using the in vitro transcripts (spiked with total RNA from healthy plants, and non-spiked) showed that all the primers and probes are highly sensitive in consistently detecting RRV with a detection limit of 1 fg. Testing of the infected plants over a period of time (three times in monthly intervals) indicated high reproducibility, with the primer/probe RRV_3-5 showing 100% positive detection, while RRV_2-1, RRV_2-2 and RRV_3-2 showed 90% positive detection. The developed real-time RT-PCR assay is reliable, highly sensitive, and can be easily used in diagnostic laboratories for testing and confirmation of RRV. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  7. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  8. Use of reverse transcription-real time polymerase chain reaction (real time RT-PCR) assays with Universal Probe Library (UPL) probes for the detection and genotyping of infectious pancreatic necrosis virus strains isolated in Chile.

    Science.gov (United States)

    Calleja, Felipe; Godoy, Marcos G; Cárcamo, Juan G; Bandín, Isabel; Yáñez, Alejandro J; Dopazo, Carlos P; Kibenge, Fred S; Avendaño-Herrera, Ruben

    2012-07-01

    Reverse transcription-real time polymerase chain reaction (real time RT-PCR) assay with Universal Probe Library (UPL) probes has been developed for the detection and genotyping of Chilean infectious pancreatic necrosis virus (IPNV) isolates from infected cell culture. Partial nucleotide sequences (1175 bp) of the VP2 coding region from a selection of 7 Chilean IPNV isolates showed that they clustered into two main groups strongly correlated with Genogroups 1 and 5 proposed by Blake et al. (2001), corresponding to types West Buxton (WB) and Spajarup (Sp), respectively. Based on the VP2 gene sequences of those 7 Chilean isolates and different reference IPNV strains, 2 sets of candidate primer/UPL probes (# 8 and # 117) were designed and evaluated with a total of 32 field isolates isolated from Atlantic salmon (Salmo salar), rainbow trout (Oncorhynchus mykiss) and Pacific salmon (Oncorhynchus kisutch) farms from 2006 to 2010 in Chile. The UPL probes clearly differentiated the same two major Genogroups that those recognized by sequencing analysis. Among the Chilean isolates examined, 18 yielded amplification with UPL probe # 8, and 14 with probe # 117, respectively corresponding to types Sp and WB, as demonstrated by typing by sequencing. Based on the findings reported below, it has been demonstrated that the combined real time RT-PCR protocol with UPLs approach was efficient in discriminating distinct Genogroups of IPNV cultured in fish cell lines and, therefore, recommended its use for detection and typing of IPN viruses. The study also confirmed the existence of two IPNV type strains in Chilean salmonid aquaculture. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Real-time RT-PCR analysis of human histidine decarboxylase, a new marker for several types of leukemia and cancer.

    Science.gov (United States)

    Melgarejo, Esther; Medina, Miguel Angel; Paz, José Carlos; Sánchez-Jiménez, Francisca; Urdiales, José Luis

    2006-01-01

    Histamine is involved in different physiological and pathological responses, such as immune response, gastric acid secretion or neurotransmission, as either angiogenesis or cancer. Histidine decarboxylase (HDC) catalyzes the formation of histamine from histidine. HDC has been suggested as a new marker for neuroendocrine differentiation, inflammatory pathologies and several leukemia and highly malignant forms of cancer, such as melanoma and small cell lung carcinoma. In the present work, we describe the use of Syber Green-based quantitative real-time RT-PCR to determine the expression of histidine decarboxylase in human cells and tissue. As an internal control, glyceraldehyde 3-phosphate dehydrogenase was also amplified. The linear dynamic range of the assay covered 4 orders of magnitude for HDC amplification. The detection limit was 0.1 ng of total RNA extracted from HMC-1 cells. This method is simple, rapid, sensitive, and quantitative, and allows for the specific identification of cells and tissue expressing HDC, stressing its potential diagnostic usefulness in malignancies in which HDC is described as a new marker.

  10. Optimization of a real-time RT-PCR assay reveals an increase of genogroup I norovirus in the clinical setting.

    Science.gov (United States)

    Van Stelten, A; Kreman, T M; Hall, N; Desjardin, L E

    2011-07-01

    Although norovirus has been identified as the most common cause of gastroenteritis, the majority of cases have no etiologic agent identified. In this study, we describe the optimization of a real-time RT-PCR assay for the improved detection of genogroup I norovirus in patient specimens based upon sequence data from a collection of representative clinical norovirus sequences. The redesigned assay demonstrated a 64 fold increase in sensitivity, a 2 log decrease in the limit of detection, and an 18% increase in amplification efficiency, when compared to the standard assay. The optimized test also detected GI norovirus in clinical specimens that were initially negative by the standard assay. Use of the optimized assay increased the annual positivity of GI norovirus in Iowa from 1.2% to 4.5%, indicating the prevalence of GI norovirus may be higher than previously identified. Laboratory confirmation of the etiologic agent involved in gasteroenteritis cases is essential for better understanding of the prevalence and transmission of noroviruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  12. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    Science.gov (United States)

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  13. Clinical diagnosis of early dengue infection by novel one-step multiplex real-time RT-PCR targeting NS1 gene.

    Science.gov (United States)

    Kim, Je-Hyoung; Chong, Chom-Kyu; Sinniah, Mangalam; Sinnadurai, Jeyaindran; Song, Hyun-Ok; Park, Hyun

    2015-04-01

    Dengue is a mosquito-borne disease that causes a public health problem in tropical and subtropical countries. Current immunological diagnostics based on IgM and/or nonstructural protein 1 (NS1) antigen are limited for acute dengue infection due to low sensitivity and accuracy. This study aimed to develop a one-step multiplex real-time RT-PCR assay showing higher sensitivity and accuracy than previous approaches. Serotype-specific primers and probes were designed through the multiple alignment of NS1 gene. The linearity and limit of detection (LOD) of the assay were determined. The assay was clinically validated with an evaluation panel that was immunologically tested by WHO and Malaysian specimens. The LOD of the assay was 3.0 log10 RNA copies for DENV-1, 2.0 for DENV-3, and 1.0 for DENV-2 and DENV-4. The assay showed 95.2% sensitivity (20/21) in an evaluation panel, whereas NS1 antigen- and anti-dengue IgM-based immunological assays exhibited 0% and 23.8-47.6% sensitivities, respectively. The assay showed 100% sensitivity both in NS1 antigen- and anti-dengue IgM-positive Malaysian specimens (26/26). The assay provided the information of viral loads and serotype with discrimination of heterotypic mixed infection. The assay could be clinically applied to early dengue diagnosis, especially during the first 5 days of illness and approximately 14 days after infection showing an anti-dengue IgM-positive response. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Monitoring epidemic viral respiratory infections using one-step real-time triplex RT-PCR targeting influenza A and B viruses and respiratory syncytial virus.

    Science.gov (United States)

    Papillard-Marechal, Solesne; Enouf, Vincent; Schnuriger, Aurélie; Vabret, Astrid; Macheras, Edouard; Rameix-Welti, Marie-Anne; Page, Bernard; Freymuth, François; van der Werf, Sylvie; Garbarg-Chenon, Antoine; Chevallier, Bertrand; Gaillard, Jean-Louis; Gault, Elyanne

    2011-04-01

    Rapid and specific diagnosis of influenza A/B and respiratory syncytial virus (RSV) viruses is needed for optimal management of patients with acute respiratory infections. In this study, a one-step triplex real-time RT-PCR assay was developed for rapid diagnosis of influenza A/B and RSV infections to optimize diagnosis efficiency of acute respiratory infections. Cell-culture supernatants and clinical samples were used to evaluate specificity and sensitivity of the assay. The assay was used routinely during two winter epidemics for testing respiratory specimens from 2,417 patients. The limit of detection in cell-culture supernatant was 1-10 plaque forming units/input (influenza A/B) and 2 × 10(-2) 50% tissue culture infectious dose/input (RSV). In clinical samples, the assay was as sensitive as commercial molecular assays for the detection of each influenza A/B and RSV (Flu-A/B and RSV-A/B r-gene™) individually, and far more sensitive than antigen detection. During the winter 2008-2009, the assay identified 145 RSV, 42 influenza A, and one mixed RSV-influenza A infections among 298 patients. The next winter, the assay was used in two independent hospital laboratory settings. 776 patients were tested in one hospital and 1,343 in the other, resulting in 184 and 501 RSV, 133 and 150 influenza A, and 1 and 11 mixed RSV-influenza A infections, respectively, being detected. This new user-friendly assay allows rapid (within hours), effective molecular diagnosis of single or mixed infections involving influenza A (including seasonal A H1N1 and H3N2, and A(H1N1) 2009), influenza B, and RSV(A/B). The assay is very valuable for managing patients during winter epidemics when influenza and respiratory syncytial viruses co-circulate. Copyright © 2011 Wiley-Liss, Inc.

  15. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  16. Modelando tiempo y espacio

    Directory of Open Access Journals (Sweden)

    Róger Churnside Harrison

    2008-06-01

    Full Text Available En este artículo se elaboran modelos de las ideas de tiempo y espacio social de Anthony Giddens o, por lo menos, compatibles con ellas. Hacia tal efecto, se aplican instrumentos gráficos y matemáticos para combinar conceptos cualitativos y cuantitativos, de los cuales se obtienen los siguientes resultados: Desde una perspectiva teórica y lógica, se muestra que la estructura de toda organización envuelve una cantidad de trabajo operativo que no es la simple suma de trabajo de sus miembros, sino una multiplicación o fracción de esa suma dada por la razón de la estancia promedio de trabajadores a la duración del ejercicio gerencial, ambas medidas en tiempo. Esta razón de tiempo laboral/gerencial tiene un carácter dual: se deriva del proceso de estructuración organizacional; y, a la vez, afecta, retroalimenta o reactiva ese proceso. En términos prácticos, los modelos permiten describir, cuantitativamente, fenómenos organizacionales de siempre o permanentes, como el compromiso recíproco o la responsabilidad mutua de gerentes y trabajadores; los cuales, en la tradición económica y sociológica, sólo han sido manejados de modo intuitivo, implícito o cualitativo. También permiten analizar y sintetizar problemas de estabilidad/inestabilidad y crecimiento/declinación observados en organizaciones actuales, especialmente corporaciones capitalistas. La composición de los modelos, así como las consecuencias y predicciones derivadas de ellos, son ilustradas con información empírica de varias fuentes, incluyendo las bases de datos internacionales de Challenger, Gray and Christmas Inc., Booz Allen Hamilton y The Economist.

  17. Detección de Listeria spp. y Listeria monocytogenes en muestras de leche cruda y quesos artesanales respectivamente, mediante PCR en Tiempo Real

    Directory of Open Access Journals (Sweden)

    Viviana Pamela Chiluisa-Utreras

    2017-07-01

    Full Text Available Background. In Ecuador, studies about bacteria genre Listeria in artisanal cheeses are scarce, and in raw milk, practically nonexistent. Milk production is one of the main livestock activities in the province of Pichincha and it is essential to study these products. Since all the cantons that make up Pichincha are milk producers, three of them, Cayambe, Quito and Pedro Moncayo were randomly sampled. Objective. To determine Listeria spp. And Listeria monocytogenes in samples of raw milk and artisanal cheeses, respectively, using Real Time PCR. Methods. The application of the qPCR technique in the detection of microorganisms and especially of bacteria in food, is based on four fundamental aspects: its sensitivity, specificity, speed and processing capacity of large sample flow. It is possible to detect small amounts of pathogenic microorganisms, such as Listeria spp in raw milk, after extraction and quantification of total DNA. Results. In this study in raw milk, one positive was determined from a total of 60 samples, representing 1.6% of Listeria spp. and 16 positive samples of 45, representing 35.6% of Listeria monocytogenes in artisanal cheeses from three farms in the province of Pichincha. Conclusions. The results, according to the statistical analyzes carried out with the Kruskal - Wallis test, show that in Pichincha the bacterium is present in raw milk, but in non - representative quantities, whereas for Listeria monocytogenes there is statistical significance in the cheeses samples

  18. Evaluation of ALK rearrangement in Chinese non-small cell lung cancer using FISH, immunohistochemistry, and real-time quantitative RT- PCR on paraffin-embedded tissues.

    Directory of Open Access Journals (Sweden)

    Yun-Gang Zhang

    Full Text Available Patients with ALK gene rearrangements often manifest dramatic responses to crizotinib, an ALK inhibitor. Accurate identification of patients with ALK-positive non-small cell lung cancer (NSCLC is essential for the clinical application of ALK-targeted therapy. However, assessing EML4-ALK rearrangement in NSCLC remains challenging in routine pathology practice. The aim of this study was to compare the diagnostic accuracy of FISH, immunohistochemistry (IHC, and real-time quantitative RT-PCR (QPCR methodologies for detection of EML4-ALK rearrangement in NSCLC and to appraise immunohistochemistry as a pre-screening tool. In this study, a total of 473 paraffin-embedded NSCLC samples from surgical resections and biopsies were analyzed by IHC with ALK antibody. ALK rearrangement was further confirmed by FISH and QPCR. ALK protein expression was detected in twenty patients (20/473, 4.2%. Of the 20 ALK-positive cases by IHC, 15 cases were further confirmed as ALK rearrangement by FISH, and 5 cases were not interpretable. Also, we evaluated 13 out of the 20 IHC-positive tissues by QPCR in additional to FISH, and found that 9 cases were positive and 2 cases were equivocal, whereas 2 cases were negative although they were positive by both IHC and FISH. The ALK status was concordant in 5 out of 8 cases that were interpretable by three methods. Additionally, none of the 110 IHC-negative cases with adenocarcinoma histology showed ALK rearrangements by FISH. Histologically, almost all the ALK-rearranged cases were adenocarcinoma, except that one case was sarcomatoid carcinoma. A solid signet-ring cell pattern or mucinous cribriform pattern was presented at least focally in all ALK-positive tumors. In conclusion, our findings suggested that ALK rearrangement was associated with ALK protein expression. The conventional IHC assay is a valuable tool for the pre-screening of patients with ALK rearrangement in clinical practice and a combination of FISH and QPCR is

  19. Removal of real-time reverse transcription polymerase chain reaction (RT-PCR) inhibitors associated with cloacal swab samples and tissues for improved diagnosis of avian influenza virus by RT-PCR

    Science.gov (United States)

    Real time reverse transcriptase polymerase chain reaction (RRT-PCR) is routinely used for the rapid detection of Avian Influenza virus (AIV) in clinical samples. The usefulness of diagnostic RRT-PCR can be limited, in part, by the inhibitory substances present in some clinical specimens, which can ...

  20. Tiempo para un cambio

    Science.gov (United States)

    Woltjer, L.

    1987-06-01

    En la reunion celebrada en diciembre dei ano pasado informe al Consejo de mi deseo de terminar mi contrato como Director General de la ESO una vez que fuera aprobado el proyecto dei VLT, que se espera sucedera hacia fines de este aAo. Cuando fue renovada mi designacion hace tres aAos, el Consejo conocia mi intencion de no completar los cinco aAos dei contrato debido a mi deseo de disponer de mas tiempo para otras actividades. Ahora, una vez terminada la fase preparatoria para el VLT, Y habiendose presentado el proyecto formalmente al Consejo el dia 31 de marzo, y esperando su muy probable aprobacion antes dei termino de este ano, me parece que el 10 de enero de 1988 presenta una excelente fecha para que se produzca un cambio en la administracion de la ESO.

  1. En tiempos de miseria

    Directory of Open Access Journals (Sweden)

    Mario Valencia

    2015-12-01

    Full Text Available http://dx.doi.org/10.5007/1807-9288.2015v11n2p192 En Tiempos Miseria constituye una propuesta de visual-concreta contemporánea basada en la exploración de la frontera entre artes visuales, literatura y tecnología. En este hipertexto se da un rompimiento estructural del esquema lingüístico tradicional. Por la forma, por el contenido, y por la participación del espectador en la puesta en escena del acontecimiento poiético y por la morfología del texto. Recogiendo la pregunta de Hölderlin “Para qué poetas en tiempos de penuria”, la obra establece un dialogo intertextual y transemiótico con ese cuestionamiento a través de esferas rítmicas y de sentidos expresados en 42 textos diseminados a través de enlaces y vínculos que permiten la multidireccionalidad y la libertad de orden de lectura para el espectador. La propuesta brevemente sintetizada asume un propósito ineludible de abordar, eficazmente, los retos de la actual cibercultura, para mostrar, desde la poesía en una clara filiación con la poética mesoamericana (en términos de temporalidades, ritmos y tonos, dada la estructura de este aparato de poesía, los paisajes del desastre de la actual civilización occidental, hija de la razón instrumental que transformó todas las esferas de lo humano  y que, por lo tanto, obliga a tomar posiciones, en este caso, desde la creación estética critico, sin desechar ni olvidar la génesis originaria de todo quehacer poético.

  2. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  3. Establishing quantitative real-time quaking-induced conversion (qRT-QuIC) for highly sensitive detection and quantification of PrPSc in prion-infected tissues.

    Science.gov (United States)

    Shi, Song; Mitteregger-Kretzschmar, Gerda; Giese, Armin; Kretzschmar, Hans A

    2013-08-02

    PrPSc, the only known constituent of prions, the infectious agents causing prion diseases, can be detected by real-time quaking-induced conversion (RT-QuIC). However, there is no efficient method to quantify the amount of PrPSc by RT-QuIC. Here we introduce quantitative RT-QuIC (qRT-QuIC) to quantify with high accuracy minute amounts of PrPSc in the brain and various peripheral tissues at levels far below detection by in vivo transmission. PrPSc is relatively resistant to treatment with proteinase K (PK). However, as there can also be a fraction of pathological PrP that is digested by PK, we use the term PrP27-30 to denote to the amount of PrPSc that can be detected by immunoblot after PK treatment. qRT-QuIC is based upon the quantitative correlation between the seeded amount of PrP27-30 and the lag time to the start of the conversion reaction detected by RT-QuIC. By seeding known amounts of PrP27-30 quantified by immunoblot into qRT-QuIC a standard calibration curve can be obtained. Based on this calibration curve, seeded undetermined amounts of PrP27-30 can be directly calculated. qRT-QuIC allowed to quantify PrP27-30 concentrations at extremely low levels as low as 10-15.5 g PrP27-30, which corresponds to 0.001 LD50 units obtained by in vivo i.c. transmission studies. We find that PrP27-30 concentration increases steadily in the brain after inoculation and can be detected at various time points during the incubation period in peripheral organs (spleen, heart, muscle, liver, kidney) in two experimental scrapie strains (RML, ME7) in the mouse. We suggest that an automatic quantitative system to measure disease progression as well as prion contamination of organs, blood and food product is feasible. Moreover, the concept of qRT-QuIC should be applicable to measure other disease-associated proteins rich in β-pleated structures (amyloid) that bind ThT and that show seeded aggregation.

  4. Reproducibility of detection of tyrosinase and MART-1 transcripts in the peripheral blood of melanoma patients: a quality control study using real-time quantitative RT-PCR

    NARCIS (Netherlands)

    de Vries, T. J.; Fourkour, A.; Punt, C. J.; van de Locht, L. T.; Wobbes, T.; van den Bosch, S.; de Rooij, M. J.; Mensink, E. J.; Ruiter, D. J.; van Muijen, G. N.

    1999-01-01

    In recent years, large discrepancies were described in the success rate of the tyrosinase reverse transcription polymerase chain reaction (RT-PCR) for detecting melanoma cells in the peripheral blood of melanoma patients. We present a quality control study in which we analysed the reproducibility of

  5. Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

    Science.gov (United States)

    Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

    2018-02-01

    Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

  6. TODOS LOS TIEMPO / All times

    Directory of Open Access Journals (Sweden)

    Juan José López de la Cruz

    2010-05-01

    Full Text Available RESUMEN La intervención sobre la arquitectura pasada no es más que un asunto concreto de una concepción universal de los procesos de transformación que incumben a todo el proyecto de arquitectura. Podríamos pensar que la acción arquitectónica es siempre una alteración de nuestro mundo ya existente, por lo que proyectar no es sino repensar una y otra vez sobre él, un fabuloso intento de transformar continuamente la realidad, construida o figurada, para acomodarla a lo variable de nuestro pensamiento en constante cambio. Este modo de aproximarnos al proyecto de arquitectura como alteración de una realidad continua, permanente antes y después del proyecto, observa el tiempo como materia de investigación y reflexión, el proyecto se convierte entonces en el Aleph capaz de reunir todos los instantes reales o imaginados que atañen a un lugar, entendiendo la arquitectura como una superposición de momentos entretejidos donde, a través de estrategias de alteración, podemos rescatar tiempos pasados y proyectar instantes futuros como quien recorre senderos que se bifurcan y se reencuentran, pudiendo reemprender caminos descartados en su día o descubriendo convergencias que han de producirse en un mañana a través del proyecto. La reunión de ayeres, presentes y futuros que propicia el proyecto de arquitectura permite incorporar a nuestro ámbito cultural realidades consideradas aparentemente agotadas, al tiempo que nos incita a imaginar nuestras intervenciones como un estadio más de una realidad permanente que volverá a ser ineludiblemente alterada en tiempos venideros. Este viaje pendular a través del tiempo del proyecto de arquitectura, induce a entender la degradación y la obsolescencia como parte del ciclo vital pero no siendo necesariamente el fin de éste, sino un momento intermedio a partir del cual explorar nuevas posibilidades formalizadas a través de la metamorfosis de la materia y los espacios degradados. Simult

  7. Docritfab: A program to assess the radiological impact in accidental emissions of a nuclear fuel factory in real time; Docritfab: Un programa para evaluar en tiempo real el impacto radiologico en emisiones accidentales de una fabrica de combustible nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez, J. G.; Ortiz, D.; Lopez, J.

    2014-07-01

    Docrit is a program developed for the manufacture of fuels of oxides of uranium Juzbado allowing an estimate in real time of the radiological impact in the case of accidental emissions from gaseous effluents (emissions of aerosols of UO{sub 2} and criticality accidents).

  8. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.

  9. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  10. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse...... transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all...

  11. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  12. Occupational dosimetry in real time hemodynamic rooms. utility of the system Dose-aware as a training tool; Dosimetria ocupacional en tiempo real en salas de hemodinamica. Utilidad del Sistema Dose-Aware como herramienta formativa

    Energy Technology Data Exchange (ETDEWEB)

    Pinto Monedero, M.; Rodriguez Cobo, C.; Pifarre Martinez, X.; Ruiz Martin, J.; Barros Candelero, J. M.; Goicolea Ruigomez, J.; Diaz Blaires, G.; Garcia Lunar

    2014-02-01

    This paper presents the results from a study in a real time dosimetry system used in the catheter laboratory room of our center. The objective was to know the occupational doses per procedure, on the one hand, and, on the other hand, to evaluate its utility as a learning tool for radiation protection purposes with the simultaneous video recording of the interventions. 83 diagnostic and therapeutic procedures were analyzed, and an average dose per procedure of 0,37 {mu}Sv and 0,10 {mu}Sv for the main cardiologist and nurse were obtained, respectively. 36 of these interventions were also recorded and the images were synchronized with the dosimetric information stored and the dosimetry system. The findings were presented to the interventional cardiology team in a learning session. They showed a high level of satisfaction with this new method of optimizing the occupational doses through a customized learning session. (Author)

  13. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  14. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  15. Algebra de clifford del espacio tiempo

    OpenAIRE

    Spinel G., Ma. Carolina

    2012-01-01

    En un artículo previo, presentamos la estructura y relaciones básicas del algebra de Clifford Gn generada por el producto geométrico de los vectores de un espacio vectorial Vn sobre el cuerpo de los reales en la versión moderna de Hestenes. Este artículo se dedica a los aspectos fundamentales algebra de Clifford del espacio-tiempo plano (A.E.T.) muestra algunos hechos interesantes relacionados con teoría de Dirac, que ponen de manifiesto la importancia sencillez de la aplicación de algebras d...

  16. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR.

    Science.gov (United States)

    Ray, Debashree L; Johnson, Joshua C

    2014-05-18

    Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level of expression stability across

  17. Optimal estimate of the coolant flow in the assemblies of a BWR of natural circulation in real time; Estimacion optima del flujo de refrigerante en los ensambles de un BWR de circulacion natural en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Valle H, J.; Morales S, J. B. [UNAM, Facultad de Ingenieria, Division de Estudios de Posgrado, Laboratorio de Analisis de Ingenieria de Reactores Nucleares, Paseo Cuauhnahuac 8532, Col. Progreso, 62550 Jiutepec, Morelos (Mexico); Espinosa P, G., E-mail: julfi_jg@yahoo.com.mx [Universidad Autonoma Metropolitana, Unidad Iztapalapa, Av. San Rafael Atlixco 186, Col. Vicentina, 09340 Mexico D. F. (Mexico)

    2012-10-15

    The present work exposes the design and the implementation of an advanced controller that allows estimating the coolant flow in the fuel assemblies of a BWR reactor of natural circulation in real time. To be able to reduce the penalizations that are established in the calculations of the operation limits due to the magnitude of the uncertainties in the coolant flows of a natural circulation reactor, is the objective of this research. In this work the construction of the optimal controller that allows estimating the coolant flows in a fuel channels group of the reactor is shown, as well as the operation of this applied to a reduced order model that simulates the dynamics of a natural circulation reactor. The controller design required of an estimator of the valuation variables not directly of the plant and of the estimates use of the local distributions of the coolant flow. The controller construction of the estimator was based mathematically in the filter Kalman whose algorithm allows to be carried out an advanced control of the system. To prove the estimator operation was development a simplified model that reproduces the basic dynamics of the flowing coolant in the reactor, which works as observer of the system, this model is coupled by means of the estimator controller to a detail model of the plant. The results are presented by means of graphics of the interest variables and the estimate flow, and they are documented in the chart that is presented at the end of this article. (Author)

  18. Ante-mortem detection of chronic wasting disease in recto-anal mucosa-associated lymphoid tissues from elk (Cervus elaphus nelsoni) using real-time quaking-induced conversion (RT-QuIC) assay: A blinded collaborative study.

    Science.gov (United States)

    Manne, Sireesha; Kondru, Naveen; Nichols, Tracy; Lehmkuhl, Aaron; Thomsen, Bruce; Main, Rodger; Halbur, Patrick; Dutta, Somak; Kanthasamy, Anumantha G

    2017-11-02

    Prion diseases are transmissible spongiform encephalopathies (TSEs) characterized by fatal, progressive neurologic diseases with prolonged incubation periods and an accumulation of infectious misfolded prion proteins. Antemortem diagnosis is often difficult due to a long asymptomatic incubation period, differences in the pathogenesis of different prions, and the presence of very low levels of infectious prion in easily accessible samples. Chronic wasting disease (CWD) is a TSE affecting both wild and captive populations of cervids, including mule deer, white-tailed deer, elk, moose, muntjac, and most recently, wild reindeer. This study represents a well-controlled evaluation of a newly developed real-time quaking-induced conversion (RT-QuIC) assay as a potential CWD diagnostic screening test using rectal biopsy sections from a depopulated elk herd. We evaluated 69 blinded samples of recto-anal mucosa-associated lymphoid tissue (RAMALT) obtained from USDA Veterinary Services. The results were later un-blinded and statistically compared to immunohistochemical (IHC) results from the USDA National Veterinary Services Laboratories (NVSL) for RAMALT, obex, and medial retropharyngeal lymph node (MRPLN). Comparison of RAMALT RT-QuIC assay results with the IHC results of RAMALT revealed 92% relative sensitivity (95% confidence limits: 61.52-99.8%) and 95% relative specificity (95% confidence limits: 85.13-99%). Collectively, our results show a potential utility of the RT-QuIC assay to advance the development of a rapid, sensitive, and specific prion diagnostic assay for CWD prions.

  19. Schmallenberg Virus Circulation in Culicoides in Belgium in 2012: Field Validation of a Real Time RT-PCR Approach to Assess Virus Replication and Dissemination in Midges

    Science.gov (United States)

    De Regge, Nick; Madder, Maxime; Deblauwe, Isra; Losson, Bertrand; Fassotte, Christiane; Demeulemeester, Julie; Smeets, François; Tomme, Marie; Cay, Ann Brigitte

    2014-01-01

    Indigenous Culicoides biting midges are suggested to be putative vectors for the recently emerged Schmallenberg virus (SBV) based on SBV RNA detection in field-caught midges. Furthermore, SBV replication and dissemination has been evidenced in C. sonorensis under laboratory conditions. After SBV had been detected in Culicoides biting midges from Belgium in August 2011, it spread all over the country by the end of 2011, as evidenced by very high between-herd seroprevalence rates in sheep and cattle. This study investigated if a renewed SBV circulation in midges occurred in 2012 in the context of high seroprevalence in the animal host population and evaluated if a recently proposed realtime RT-PCR approach that is meant to allow assessing the vector competence of Culicoides for SBV and bluetongue virus under laboratory conditions was applicable to field-caught midges. Therefore midges caught with 12 OVI traps in four different regions in Belgium between May and November 2012, were morphologically identified, age graded, pooled and tested for the presence of SBV RNA by realtime RT-PCR. The results demonstrate that although no SBV could be detected in nulliparous midges caught in May 2012, a renewed but short lived circulation of SBV in parous midges belonging to the subgenus Avaritia occured in August 2012 at all four regions. The infection prevalence reached up to 2.86% in the south of Belgium, the region where a lower seroprevalence was found at the end of 2011 than in the rest of the country. Furthermore, a frequency analysis of the Ct values obtained for 31 SBV-S segment positive pools of Avaritia midges showed a clear bimodal distribution with peaks of Ct values between 21–24 and 33–36. This closely resembles the laboratory results obtained for SBV infection of C. sonorensis and implicates indigenous midges belonging to the subgenus Avaritia as competent vectors for SBV. PMID:24466312

  20. El valor moral del tiempo

    Directory of Open Access Journals (Sweden)

    Pedro Ortiz

    2004-12-01

    Full Text Available Las personas son los únicos seres vivos que pueden adscribir, conscientemente, un valor a la naturaleza y a las cosas que hacen, puesto que de ellas depende su vida. Como consecuencia de su desarrollo cultural, y sobre todo de su estructura económica, nuestra sociedad ha privilegiado la propiedad territorial, y las personas valoran más las cosas que sus propias acciones. Esta situación implica una menor valoración de la vida en sí, tal como se la debería apreciar a través de la medida del tiempo. Es evidente que los niveles de valoración del tiempo varían de una estructura económica a otra. En las sociedades subdesarrolladas como la nuestra, está claro que la poca valoración del tiempo se expresa en la impuntualidad y en la pérdida casi irracional del tiempo en vez del estudio y el trabajo. Una explicación histórica de esta limitación de nuestro desarrollo personal, que desmitifique la impuntualidad como cuestión graciosa o idiosincrásica de nuestro pueblo, debería hacernos recapacitar acerca del valor del tiempo que es, en realidad, la valoración de nuestra propia vida y lo que significamos en términos de valor para los demás.

  1. A two-tube multiplex real-time RT-PCR assay for the detection of four hemorrhagic fever viruses: severe fever with thrombocytopenia syndrome virus, Hantaan virus, Seoul virus, and dengue virus.

    Science.gov (United States)

    Li, Zhifeng; Qi, Xian; Zhou, Minghao; Bao, Changjun; Hu, Jianli; Wu, Bin; Wang, Shenjiao; Tan, Zhongmin; Fu, Jianguang; Shan, Jun; Zhu, Yefei; Tang, Fenyang

    2013-09-01

    The aim of this study was to develop and evaluate a two-tube multiplex real-time RT-PCR assay for the detection and identification of four viral hemorrhagic fever (VHF) pathogens, severe fever with thrombocytopenia syndrome virus (SFTSV), Hantaan virus (HTNV), Seoul virus (SEOV), and dengue virus (DENV), from human clinical samples. The two-tube multiplex real-time RT-PCR assay we developed has a sensitivity of 10 copies/μL for each of the targets, and the performance was linear within the range of at least 10(7) transcript copies. Moreover, we evaluated the specificity of the assay using other virus RNA as template, and found no cross-reactivity. This new assay is able to detect SFTSV, HTNV, SEOV and DENV in two reactions and brings a cost of 40 % compared to separate reactions. Evaluation of this assay with clinical serum samples from laboratory-confirmed patients and healthy donors showed 100 % clinical diagnostic sensitivity and over 99 % specificity. The assay was applied for scanning 346 clinical samples collected from patients admitted to the hospital with suspected VHF and compared with virus isolation and immunofluorescence assay (IFA). The assay indentified 59 SFTSV-, 12 HTNV-, 11 SEOV- and 9 DENV-positive samples and showed higher sensitivity. This assay thus provides a reliable and cost-effective screening tool for early clinical diagnosis of SFTSV, HTNV, SEOV and DENV in the acute phase.

  2. Trombosis de válvulas cardiacas biológicas. Presentación de dos casos evaluados con ecocardiografía 3D en tiempo real Thrombosis of biological valves. Report of two cases evaluated by 3D echocardiography in real time

    Directory of Open Access Journals (Sweden)

    Jairo A Rendón

    2011-10-01

    Full Text Available La trombosis de las válvulas protésicas biológicas es una complicación infrecuente, que se asocia con mortalidad elevada. En este artículo se reporta el caso de un paciente de género masculino, de 72 años de edad, con prótesis valvular biológica en posición aórtica y trombosis asociada a degeneración valvular, así como el de una paciente de género femenino de 64 años de edad, con prótesis biológica en posición mitral y trombosis de la misma en el contexto de una infección sistémica. Ambos casos se evaluaron mediante ecocardiografía transesofágica tridimensional en tiempo real.Thrombosis of biological prosthetic valves is a rare complication, associated with high mortality. We report the case of a 72 years old male patient with biological valve prosthesis in the aortic position and thrombosis associated with valvular degeneration, as well as that of a 64 years old female patient with bioprosthesis in the mitral position and thrombosis of it in the context of a systemic infection. Both cases were evaluated by three-dimensional transesophageal echocardiography in real time.

  3. Los tres espacios (tiempos) de Kant

    OpenAIRE

    González Ruiz, Agustín

    1996-01-01

    En Este Articulo Se Trata La Teoria Kantiana Del Espacio Y El Tiempo. Ademas Dela Muy Conocida Concepcion Del Espacio Y El Tiempo Como Formas Puras De Lasensibilidad, Cabe Distinguir En Kant Un Espacio (Tiempo) Empirico Y Un Espacio(Tiempo) Absoluto. A La Luz De Estos Tres Espacios (Tiempos) Habria Dereconsiderarse La Relacion De Kant Con Newton Y Con La Fisica Contemporanea.(A.)

  4. Real-time Simulations using QuaRC and RT-LAB and Development of a Hardware-in-the-Loop Indoor Facility for Robot Formations

    Science.gov (United States)

    2009-09-01

    Wheel drop sensors • 1 Wall sensor • 4 Cliff sensors • 1 Omnidirectional ; Ir Receiver • Power Button • Play Button • Advance Button • Battery...32 4. Wheeled Mobile Robot Control Using QuaRC and Windows Real-Time Targets ........................................34 4.1...wireless networking technology WMR: Wheeled Mobile Robot 5 Abstract This report will present two commercial software environments used to

  5. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  6. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    OpenAIRE

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background : Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conven...

  7. Detection of West Nile virus using formalin fixed paraffin embedded tissues in crows and horses: quantification of viral transcripts by real-time RT-PCR.

    Science.gov (United States)

    Tewari, Deepanker; Kim, Hyun; Feria, Willard; Russo, Brigite; Acland, Helen

    2004-08-01

    West Nile virus (WNV) RNA was quantified in WNV infected crows and horses with the help of a real-time reverse transcriptase-PCR assay. A 5' nuclease assay, based on NS5 gene detection with a fluorescent probe was used for quantifying WNV RNA using formalin fixed paraffin embedded tissue specimens. Quantitative detection of WNV RNA showed the presence of a higher amount of the viral RNA in crow tissues compared to equine tissues and these results correlated well with the detection of WNV antigen by immunostaining. In crows, the highest amount of virus was seen in the intestine and in horses in the brain.

  8. Implementación de un algoritmo de búsqueda informada en el robot móvil Robotino de Festo para la obtención de la trayectoria mas óptima en tiempo real dentro de un entorno controlado.

    OpenAIRE

    Gualotuña Villavicencio, Roberto Jairo; LLinín Rea, Edisson Orlando

    2011-01-01

    El presente proyecto de tesis hace uso del robot móvil Robotino de FESTO para realizar tareas de búsqueda en tiempo real utilizando el algoritmo de búsqueda informada A*, con el fin de encontrar el camino de menor coste dentro de un entorno controlado. El sistema de control está basado en una arquitectura deliberativa, es decir, constituida de un nivel superior y un nivel inferior, las mismas que se comunican a través de una WLAN.

  9. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Science.gov (United States)

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Aplicación de RT-Linux en el control de motores de pasos. Parte I; Application of RT-Linux in the Control of Steps Mators. Part I

    Directory of Open Access Journals (Sweden)

    Ernesto Duany Renté

    2011-02-01

    Full Text Available La idea fundamental de este artículo es mostrar cómo controlar un motor de paso empleando el puertoparalelo de una computadora, y demostrar la eficiencia temporal de las aplicaciones que se desarrollan ensistemas preparados para ejecutar tareas de precisión; aprovechar al máximo la capacidad de tiempo realestricto que brinda RT-Linux para el control de accionamientos eléctricos. Se desarrolla un pequeño softwareen lenguaje C que envía las señales al puerto paralelo en el tiempo necesario. Este software no estádiseñado con fines comerciales, solo permite realizar pruebas sobre el circuito de control diseñado paraeste propósito.  The fundamental idea of this article is to control a steps motor using the parallel port of a computer anddemonstrate the temporary efficiency of the applications that are executed in prepared systems to executetasks of real time. To take advantage of to the maximum capacity of strict real time that RT-Linux offers usfor the control of electric workings. A small software is developed in language C that sent the signs to theparallel port in the necessary time. This software is not designed with commercial, only allows to carry outtests on the control circuit designed for this purpose.

  11. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  12. Metodología para identificar en tiempo real las zonas de inestabilidad geomecánica, y mitigar los riesgos durante las operaciones de perforación de pozos petroleros

    OpenAIRE

    Ángel Álvarez, John Byron

    2012-01-01

    Los problemas de estabilidad geomecánica constituyen en uno de los mayores desafíos de la industria del petróleo durante la perforación de un pozo. Debido al altísimo impacto de los problemas de estabilidad en los tiempos no productivos (NPT) y por ende en el costo final de los proyectos, en este trabajo se presenta una innovadora metodología que permite identificar las zonas de alto riesgo geomecánico en la perforación de un pozo, utilizando la información convencional generada en la perfora...

  13. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  14. Ocio, tiempo libre y empleo

    Directory of Open Access Journals (Sweden)

    Luis Fernando Jiménez Guzmán

    2010-11-01

    Full Text Available La propuesta de la Modernidad pretende que del trabajo, la sociedad derive el bienestar y la vida feliz. El trabajo informado como empleo proporciona seguridad, opciones, posibilidades, valores, bienes, riqueza, felicidad. Una visión bien distinta a la de la Grecia Clásica, inspiradora de la democracia de Occidente, que hace poner en duda la paradoja moderna del trabajo y del tiempo libre bajo todas sus institucionalizaciones, unas generadas culturalmente por las sociedades avanzadas, otras provenientes de la tradición lúdica heredada por el siglo de la Revolución Industrial (turismo, deporte, vacaciones, fiestas, carnavales, actividades de tiempo libre, ocio. Cabe entonces preguntarse si en los inicios de la nueva era postmoderna, de la que somos protagonistas, ocurre que el trabajo y el tiempo libre vienen generando un nuevo sentido, en donde ya no aparecen como irreconciliables opuestos, ni con tajante relación de subordinación. Lo cierto es que hoy, un buen sector del pensamiento sobre la lúdica se inclina por afirmar que se está produciendo una revolución/evolución del trabajo, del empleo y del tiempo libre que los relaciona de modo distinto, acercándolos al punto de compartir entre sí nuevas y cambiantes visiones. Este texto hace parte de esa actualidad del pensamiento. Sostiene que parece haberse superado la simple apuesta teórica de cambio en la tríada binomio trabajo/ empleo/tiempo libre, pues se aprecia un efectivo cambio de rumbo al concretarse una nueva visión de felicidad y de uso del tiempo libre, ya no ligada exclusivamente con la satisfacción de las necesidades materiales, ya no amparada en el binomio histórico esclavo/amo, ya no producto exclusivo del trabajo en su visión de antaño, ya no ansiosa de excesos y banalidades, y a la vez, se aprecia el inicio del cambio hacia un trabajo que ya no es empleo privativo de la libertad, que se llena de lúdica, dejando de ser único imperativo de la vida. La Felicidad

  15. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  16. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  17. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  18. Periodismo en tiempos de guerra

    Directory of Open Access Journals (Sweden)

    Rudolf Prevrátil

    2015-01-01

    Full Text Available En este artículo interesan las guerras en que cada una de las partes es un país occidental desarrollado, donde se agudiza en tiempos de guerra el normal y sutil conflicto entre la independencia informativa de los medios y las garantías constitucionales de libertad de prensa y los intentos del gobierno y los militares por aumentar su influencia sobre las comunicaciones. El control y la manipulación de la información noticiosa en tiempos de guerra ya son prácticas político-militares de rutina. En los principales conflictos del siglo veinte se perfeccionaron las tácticas y estrategias de control informativo. La experiencia histórica y las nuevas tecnologías sirvieron para montar el aparato de manejo informativo que operó en la Guerra del Golfo.

  19. Tiempo de Respuestas y Experiencia de Usuario Estudio Experimental

    Directory of Open Access Journals (Sweden)

    Delvis Echeverria

    2016-12-01

    Full Text Available La investigación está fundamentada por un estudio experimental, enfocado en la evaluación del comportamiento de los usuarios finales interactuando con tiempos de respuestas en aplicaciones reales. Se tomará como base el aporte de los autores Doherty y Thadani, investigadores de IBM relacionado con los tiempos de respuestas, y las investigaciones de Jacob Nielsen. Se llevarán a cabo un test con usuarios finales, y se expondrán optimizaciones a través de del uso de herramientas que contribuirán a mejorar los tiempos de respuestas de las aplicaciones web. Todo esto engloba una primera instancia de un proyecto que se está llevando a cabo en la empresa GeneXus Consulting, pretendiéndose lograr un punto de encuentro entre el rendimiento de las aplicaciones y la experiencia de usuario.

  20. Mal tiempo, tiempo maligno, tiempo de subversión ritual. La temposensitividad agrofestiva invernal

    Directory of Open Access Journals (Sweden)

    Del Campo Tejedor, Alberto

    2006-06-01

    Full Text Available In the light of a number of festive, ritual, poetico-musical and literary expresions, from Andalusia and elsewhere, the author discusses time as lived by agrarian cultures: a syncretic time, resulting from the superposition of civico-political, religious and peasant calendars; a cyclic time, given the effects of astronomico-meteorological time on nature and the subsequent cultural response on both the instrumental dimension (the work in the fields and the expresive dimension (the rituals and the festivals; and, finally, an ages-old bipolar time, experienced as the succession of two alternating seasons —wintertime and summertime—which also underlies a dichotomous agrofestive time-sensitiveness analyzed here under the following hypothesis: during the months of «good weather,» especially May and June, the rituals have a propitiatory and positively extolling sense; they mimetically dramatize the union between earth, vegetation, animals and humans by means of prototypes and archetypes that symbolically recreate the natural order of things. By contrast, the wintertime rituals and festivals—from 1st November till Carnival, and particularly around Christmas—all have in common a grotesque character and a sense of inverted order, symbolically signifying, with a logic at once serio-comic and ambiguous, the dark side of existence, while ritually conjuring up the fears of bad weather, of fateful and pernicious time, the time of cold nights, hunger and death.

    A la luz de algunas expresiones festivas, rituales, poético-musicales y literarias, de Andalucía y otros contextos, el artículo aborda el tiempo vivido por las culturas agroganaderas: un tiempo sincrético, como consecuencia de la superposición de los calendarios civil-político, religioso y campesino; un tiempo cíclico, fruto de la incidencia del tiempo astronómico-meteorológico en la naturaleza y la consiguiente respuesta cultural en el plano instrumental (los trabajos agr

  1. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    Science.gov (United States)

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

  2. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcio

    2010-03-01

    Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

  3. Lack of correlation between reaction speed and analytical sensitivity in isothermal amplification reveals the value of digital methods for optimization: validation using digital real-time RT-LAMP.

    Science.gov (United States)

    Khorosheva, Eugenia M; Karymov, Mikhail A; Selck, David A; Ismagilov, Rustem F

    2016-01-29

    In this paper, we asked if it is possible to identify the best primers and reaction conditions based on improvements in reaction speed when optimizing isothermal reactions. We used digital single-molecule, real-time analyses of both speed and efficiency of isothermal amplification reactions, which revealed that improvements in the speed of isothermal amplification reactions did not always correlate with improvements in digital efficiency (the fraction of molecules that amplify) or with analytical sensitivity. However, we observed that the speeds of amplification for single-molecule (in a digital device) and multi-molecule (e.g. in a PCR well plate) formats always correlated for the same conditions. Also, digital efficiency correlated with the analytical sensitivity of the same reaction performed in a multi-molecule format. Our finding was supported experimentally with examples of primer design, the use or exclusion of loop primers in different combinations, and the use of different enzyme mixtures in one-step reverse-transcription loop-mediated amplification (RT-LAMP). Our results show that measuring the digital efficiency of amplification of single-template molecules allows quick, reliable comparisons of the analytical sensitivity of reactions under any two tested conditions, independent of the speeds of the isothermal amplification reactions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Validation and utilization of an internally controlled multiplex Real-time RT-PCR assay for simultaneous detection of enteroviruses and enterovirus A71 associated with hand foot and mouth disease.

    Science.gov (United States)

    Thanh, Tran Tan; Anh, Nguyen To; Tham, Nguyen Thi; Van, Hoang Minh Tu; Sabanathan, Saraswathy; Qui, Phan Tu; Ngan, Tran Thuy; Van, Tran Thi My; Nguyet, Lam Anh; Ny, Nguyen Thi Han; Thanh, Le Thi My; Chai, Ong Kien; Perera, David; Viet, Do Chau; Khanh, Truong Huu; Ha, Do Quang; Tuan, Ha Manh; Wong, Kum Thong; Hung, Nguyen Thanh; Chau, Nguyen Van Vinh; Thwaites, Guy; van Doorn, H Rogier; Van Tan, Le

    2015-06-09

    Hand foot and mouth disease (HFMD) is a disease of public health importance across the Asia-Pacific region. The disease is caused by enteroviruses (EVs), in particular enterovirus A71 (EV-A71). In EV-A71-associated HFMD, the infection is sometimes associated with severe manifestations including neurological involvement and fatal outcome. The availability of a robust diagnostic assay to distinguish EV-A71 from other EVs is important for patient management and outbreak response. We developed and validated an internally controlled one-step single-tube real-time RT-PCR in terms of sensitivity, linearity, precision, and specificity for simultaneous detection of EVs and EV-A71. Subsequently, the assay was then applied on throat and rectal swabs sampled from 434 HFMD patients. The assay was evaluated using both plasmid DNA and viral RNA and has shown to be reproducible with a maximum assay variation of 4.41 % and sensitive with a limit of detection less than 10 copies of target template per reaction, while cross-reactivity with other EV serotypes was not observed. When compared against a published VP1 nested RT-PCR using 112 diagnostic throat and rectal swabs from 112 children with a clinical diagnosis of HFMD during 2014, the multiplex assay had a higher sensitivity and 100 % concordance with sequencing results which showed EVs in 77/112 (68.8 %) and EV-A71 in 7/112 (6.3 %). When applied to clinical diagnostics for 322 children, the assay detected EVs in throat swabs of 257/322 (79.8 %) of which EV-A71 was detected in 36/322 (11.2 %) children. The detection rate increased to 93.5 % (301/322) and 13.4 % (43/322) for EVs and EV-A71, respectively, when rectal swabs from 65 throat-negative children were further analyzed. We have successfully developed and validated a sensitive internally controlled multiplex assay for rapid detection of EVs and EV-A71, which is useful for clinical management and outbreak control of HFMD.

  5. Influenza B Viruses in the Population of Province of Vojvodina during the 2012/2013 Season: Differentiation of B/Yamagata and B/Victoria Lineages by Real-time RT-PCR, Antigenic and Phylogenetic Characterization.

    Science.gov (United States)

    Radovanov, Jelena; Milošević, Vesna; Cvjetković, Ivana Hrnjaković; Ristić, Mioljub; Djilas, Milan; Nikolić, Nataša; Patić, Aleksandra; Kovačević, Gordana; Galović, Aleksandra Jovanović; Petrović, Tamaš; Mikić, Sandra Stefan

    2015-01-01

    At present, two phylogenetically distinct influenza B virus lineages, B/Yamagata and B/ Victoria, co-circulate worldwide and can cause significant morbidity and mortality. The aim of this study was to determine the prevalences of two influenza B virus lineages in the population of Vojvodina and to identify their antigenic and phylogenetic properties. A total of 369 and 334 nasopharyngeal, or nasal/throat swab samples, collected during the 2012/2013 and 2013/2014 seasons, respectively, were tested using specific singleplex influenza A, influenza B, influenza B/Yamagata and influenza B/Victoria real-time reverse transcription polymerase chain reaction (RT-PCR) assays. Antigenic and genetic testing were done by hemagglutination inhibition assay and hemagglutinin and neuraminidase gene sequence analysis, respectively. During the 2012/2013 season, influenza B viruses were present in 53.4% (101/189) of influenza positive samples.The B/Yamagata-like viruses (81.2%) significantly predominated over the B/Victoria-like viruses (18.8%). Comparing to B/Victoria-like positive patients, among B/Yamagata-like positive patients, children 5-14 years of age were significantly more represented (5.3% vs. 35.4%, respectively), as well as patients with mild form of illness (15.8% vs. 45.1%, respectively). The results of sequence analysis and antigenic testing showed that tested viruses were not closely related to B/Wisconsin/1/2010, the vaccine virus for 2012/2013. During the 2013/2014 season influenza B viruses were not detected. The results of this study confirmed the health significance of influenza B viruses and indicated that B/Yamagata-like viruses were significantly more prevalent than B/Victoria lineage viruses, during the 2012/2013 season. They also showed a sub-optimal match between the tested viruses and the vaccine virus for season 2012/2013.

  6. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  7. Organización y funcionamiento administrativo y contable de la Real Hacienda de Indias en tiempo de los Austrias a la luz de la legislación aplicable

    Directory of Open Access Journals (Sweden)

    Alberto Donoso Anes

    2008-12-01

    Full Text Available Este artículo es sólo parte de una investigación de mucha mayor envergadura. Dentro de ella tiene por objeto pasar revista a la normativa que regía la organización y el funcionamiento administrativo y contable de la Real Hacienda española en los territorios americanos. A estos efectos, se estudia dicha normativa así como los comentarios efectuados por los especialistas que la han analizado y evaluado. A continuación, y a la luz de esta normativa, se describen la organización, estructura y oficiales reales de esta Hacienda indiana, así como los principales rasgos de su funcionamiento administrativo y de su contabilidad.

  8. Occupational dosimetry in rela-time hemodynamics rooms. Usefulness of system dose-aware as a tool for learning; Dosimetria ocupacional en tiempo real en salas de hemodinamica. Utilidad del sistema dose-aware como herramienta formativa

    Energy Technology Data Exchange (ETDEWEB)

    Pinto Monedero, M.; Rodriguez Cobo, C.; Pifarre Martinez, X.; Ruiz Martin, J.; Barros Candelero, J. M.; Goicolea Ruigomez, J.; Diaz Blaires, G.; Garcia lunar, I.

    2013-07-01

    The work pursues a dual objective: on the one hand, to know the typical doses that practitioners of a dosimetry system interventional cardiology receive in real time, which allows to know the dose rate at any time; on the other hand, to assess the validity of this system of dosimetry, together with a simultaneous recording of proceedings for further analysis, as a teaching tool from the point of view of radiation protection. (Author)

  9. La obertura del tiempo social

    Directory of Open Access Journals (Sweden)

    Jahir Navalles Gómez

    2004-11-01

    Es, ese recorrido, esa narrativa de múltiples episodios donde se localizan, refieren, aglutinan, prevalecen todos los acontecimientos, que entre la permanencia y la irruptibilidad, la estabilidad y la identidad, entre la perspectiva del presente y la prospectiva del pasado, bosquejan la continuidad que en su misma esencia volátil vuelve todo acontecimiento intangible, impalpable, tal y como si nada hubiera cambiado, materializando a su vez una contraparte, aquella que refiere a la transformación constante y gradual; la intención será la de señalar, reconocer y reclamar el papel del tiempo social como aquel sendero imperceptible bajo el cual es posible, entre otras cosas, identificar el eslabón que implica al pasado en el presente, volviéndose todo acontecimiento, toda experiencia, tan eterna o inaprensible, tan efímera como sea posible, algunas veces inaccesible otras irreconciliable, donde se insinúa que es la propia sociedad la que se reconocerá en el trayecto

  10. Performance of the Real Fungus-ID kit based on multiplex RT-PCR assay for the rapid detection and identification of Trichophyton spp. and Microsporum spp. in clinical specimens with suspected dermatophyte infection.

    Science.gov (United States)

    Wang, H-Y; Kim, H; Choi, E H; Lee, H

    2016-01-01

    The aim of this study was to evaluate the performance of a commercially available multiplex RT-PCR assay for the rapid detection and identification of dermatophytes directly from clinical samples and cultures. The multiplex RT-PCR assay was used to evaluate 118 clinical isolates from various specimen types and a total of 140 known specimens were compared with both conventional methods, commercially available PCR-REBA, and ITS sequence analysis. In this study, multiplex RT-PCR assay yield significantly more positive results than culture (91·9 vs 39·5%) and conventional methods including KOH microscopy (91·9 vs 71·3%). Although the results among the multiplex RT-PCR, PCR-REBA and ITS sequence analysis were concordant (100%) in 118 clinical isolates, concordant results between multiplex RT-PCR assay and culture were at 66% (78/118). The overall positive rates for the PCR-REBA, multiplex RT-PCR assay and ITS sequence analysis were 98·8, 91·9, and 52·9% respectively. In addition, the concordance rate of multiplex RT-PCR assay and the PCR-REBA assay was 93% (95% confidence interval (CI), 89·9-96·1, P culture can take up to 2-3 weeks. The use of the multiplex RT-PCR molecular diagnostic assay was rapid and reliable for detecting pathogen infections. Even though the use of molecular diagnostic technology is more expensive than conventional methods, the clinical and economic benefit of saving time relative to expense remains to be elucidated. Therefore, the multiplex RT-PCR assay may provide the essential information to accelerate therapeutic decisions for earlier and adequate antibiotic treatment in the acute phase of fungal pathogen infections. © 2015 The Society for Applied Microbiology.

  11. Estudio de tráfico de servicios de tiempo real en la red de datos de la Universidad de Cuenca utilizando modelos de simulación. Estudio de tráfico de servicios de tiempo real en la red de datos de la Universidad de Cuenca utilizando modelos de simulación. Estudio de selección de una herramienta de simulación y análisis cuantitativo de resultados

    OpenAIRE

    Palacios Maldonado, Pablo Vinicio

    2009-01-01

    Esta tesis analiza el comportamiento de la red de datos de la Universidad, utilizando una herramienta de simulación, mediante la alimentación de datos reales, muestra la situación en la que se encuentra esta red actualmente. Primero realizamos un estudio comparativo de herramientas se simulación y escogimos NCTUns. Luego realizamos 3 experimentos los que mostraron el comportamiento de la red de la Universidad, así como también el impacto que tendría introducir tráfico de voz y video. En el pr...

  12. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  13. Tiempo, memoria e identidad personal

    Directory of Open Access Journals (Sweden)

    Pazos, Álvaro

    2004-06-01

    Full Text Available In his analysis of the oral and written narratives by the former children evacuated to the Soviet Union during the Spanish Civil War, the author reflects on the manner in which time, memory and personal identity interrelate in these accounts. He proposes a sociological approach to the subject, comparatively more independent than that of history or psychology. His analysis reveals that the subjective dynamics that contextualizes the discourses of these people —the manner in which they talk about the past, the present, the future, life and so forth— defines these discourses in terms not so much of coherence or attempt of achievement of a synthetic unity, a well-structured narrative drawn from an individual remembrance of the past, as of disruptions, contradictions and aporias that make the narratives disorganized and uneven—which is characteristic of the present social and subjective conditions of these former children.

    En el análisis de los relatos orales y escritos de los antiguos niños españoles evacuados a la URSS durante la Guerra de España, el autor intenta problematizar el modo como tiempo, memoria e identidad personal se entrelazan en tales relatos, proponiendo un acercamiento sociológico, relativamente autónomo respecto del que podría hacer la historia o la psicología. El análisis pone de manifiesto que la dinámica subjetiva en la que se contextualizan los discursos de estas personas —los modos de hablar sobre el pasado, el presente, el futuro, la vida, etc.— define estos discursos, no tanto por la coherencia o el logro o el intento de conseguir una unidad sintética, una narración bien estructurada sacada de una memoria individual sobre el pasado, cuanto por las disrupciones, contradicciones y aporías en las que con frecuencia divaga y se demora el relato, elementos todos que remiten a la problemática social y subjetiva del presente de estos antiguos niños.

  14. Duración y tiempo humano.

    OpenAIRE

    González-Umeres, L. (Luz)

    2002-01-01

    Este trabajo presenta dos visiones del tiempo humano: las de Bergson y Polo. La propuesta bergsoniana está fechada en París, 1888, en un ambiente mecanicista al cual se enfrenta, recuperando el tiempo psicológico. La propuesta de Polo iniciada a mediados del siglo XX va más allá del nivel psicológico: se adentra en el ámbito de los trascendentales personales.

  15. Tiempo de sustentabilidad Time of sustainability

    Directory of Open Access Journals (Sweden)

    Enrique Leff

    2000-06-01

    Full Text Available El desarrollo sustentable, como todo desarrollo, se despliega en el tiempo. Mas este proceso no ocurre en los tiempos de la evolución biológica y del progreso económico. No es el tiempo cronológico en el que se suceden inercias y se enlazan las tendencias de la realidad existente. La sustentabilidad es la marca del límite de la racionalidad unidimensional de la modernidad, de una crisis de civilización que abre nuevos horizontes y evoca otros sentidos del tiempo. En la sustentabilidad convergen los tiempos multifacéticos de diversos procesos materiales y simbólicos -geológicos, biológicos, económicos, tecnológicos, culturales- y se enlazan las diferentes racionalidades que configuran la complejidad ambiental. Los tiempos de la sustentabilidad se forjan en formas del ser que se proyectan del pasado hacia el futuro arraigando en nuevas identidades. En esa perspectiva se esboza una visión fenomenológica de inspiración heideggeriana sobre los tiempos de sustentabilidad.Sustainable development, like any deveolopment, happens in time. But this process does not occur in the time of biological evolution or economic growth. It is not within cronological time that inercies happen and tendencies of existing reality take place. Sustentability is in the edge of the modern unidimensional rationality, of a civilization in crisis which opens new horizons and evokes different senses of time. Sustainability contains different times of diverse material and symbolic processes -geological, biological, economic, technological, cultural- and gathers different rationalities which shape environmental complexity. Sustainability times are forged by forms that are projected from the past to the future, resulting in new identities. This perspective inspires a heideggerian phenomenologic view on the times of sustainability.

  16. Development and validation of a real-time two-step RT-qPCR TaqMan(®) assay for quantitation of Sacbrood virus (SBV) and its application to a field survey of symptomatic honey bee colonies

    DEFF Research Database (Denmark)

    Blanchard, Philippe; Guillot, Sylvain; Antùnez, Karina

    2014-01-01

    evaluated at 0.11log10. The detection and quantitation limits were established respectively at 50 copies and 100 copies of SBV genome, for a template volume of 5μl of cDNA. The RT-qPCR assay was applied during a French SBV outbreak in 2012 where larvae with typical SBV signs were collected, along...

  17. El hysteron/proteron del tiempo

    Directory of Open Access Journals (Sweden)

    Diana María Acevedo Zapata

    2015-01-01

    Full Text Available El pasaje de la Física (218b21-219a ha llevado a postular un concepto de tiempo determinado por las condiciones perceptivas de la psyche. Se muestra cómo las condiciones de percepción son un punto de partida en la investigación: lo que es primero y más cercano a los sentidos y más conocido para los seres humanos. El punto de llegada es la conexión necesaria entre la existencia del tiempo y la del cambio. La percepción del cambio de los durmientes de Cerdeña permite determinar los elementos que componen la experiencia del tiempo y proceder a determinar aquellos que componen la existencia de este.

  18. REFLEXIONES ACERCA DEL VIAJE EN EL TIEMPO

    Directory of Open Access Journals (Sweden)

    LUIS CARLOS PALLARES

    2011-12-01

    Full Text Available No es de extrañar, el viaje en el tiempo siempre se ha considerado imposible. Después de todo, Newton creía que el tiempo era como una flecha; una vez disparada, se eleva en línea recta, sin desviarse. Un segundo en la tierra fue un segundo en Marte. Relojes dispersos por todo el universo funcionan a la misma velocidad. Einstein nos dio una imagen mucho más radical. De acuerdo con Einstein, el tiempo era más como un río, que serpentea alrededor de estrellas y galaxias, acelerando y desacelerando al pasar cerca de cuerpos masivos.

  19. Aspectos laborales del contrato a tiempo parcial

    OpenAIRE

    Garcia Perrote Escartin, Ignacio; Nieto Rojas, Patricia

    2010-01-01

    Las sucesivas reformas en materia de empleo a tiempo parcial han tratado de incrementar el espacio convencional para la regulación de aspectos nucleares de esta modalidad contractual con el objetivo de adecuar la regulación legal a las necesidades empresariales. Sin embargo, los resultados son bastante tenues: el escaso uso de este contrato (la tasa de empleo a tiempo parcial se sitúa en torno al 12%) y la nula atención prestada por los agentes sociales a este tipo de contrato han dific...

  20. Redes sociales : la memoria de la Historia en tiempo real

    OpenAIRE

    Argila Blanco, Judith

    2015-01-01

    Novedosos estudios muestran cómo a través de técnicas combinadas de análisis de redes y de minería de datos (especialmente en Twitter, que ofrece datos abiertos) es posible identificar climas de opinión dentro de colectivos de individuos inmersos en procesos históricos contemporáneos

  1. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    DEFF Research Database (Denmark)

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    -time RT-PCR is needed to a suitable internal control. We thus investigated the expression pattern of six chicken genes, including P-actin, 28S rRNA, 18S rRNA, glyceral dehyde-3-phosphate dehydrogenase (GAPDH), TATA box-binding protein (TBP) and beta-2-microglobulin, in chicken embryo (CE) cell cultures...... and GAPDH had a lower expression level in CE cell cultures. Also, beta-actin showed no significant variation in both normalized and non-normalized assays and virus dose-independent of inoculation, while other genes did. beta-Actin was further successfully used as an internal control to quantitate Bursine-2...... virus-specific RNA load in CE cell cultures. Thus, beta-actin was suggested as a suitable internal control in studying gene expression as well as virus-specific RNA load in CE cell after IBDV infection....

  2. El hysteron/proteron del tiempo

    OpenAIRE

    Diana María Acevedo Zapata

    2015-01-01

    El pasaje de la Física (218b21-219a) ha llevado a postular un concepto de tiempo determinado por las condiciones perceptivas de la psyche. Se muestra cómo las condiciones de percepción son un punto de partida en la investigación: lo que es primero y más cercano a los sentidos y más conocido para los seres humanos. El punto de llegada es la conexión necesaria entre la existencia del tiempo y la del cambio. La percepción del cambio de los durmientes de Cerdeña permite determinar los elementos q...

  3. Tiempo y edad biológica

    Directory of Open Access Journals (Sweden)

    Vargas, Esteban

    2013-04-01

    Full Text Available In this paper we attempt to think if it is possible to conceive age as a characteristic time of living organisms including man. In the paper we review several concepts of age coming from sciences such as chronobiology, gerontology, evolutionary biology and developmental biology, and trough all of them, we see that biological time is thought as time measured by a clock. We propose that age as biological time must be understood as a phase in the biological process, but depending on the complete cycle of the organism. In the case of human being, his age is determined also by what is “expected” about him. His age is then determined by biological and cultural aspects.En este trabajo intentamos meditar si es posible concebir la edad como un tiempo propio de los seres vivos incluyendo al hombre. En el trabajo revisamos diversos conceptos de edad obtenidos de diversas ciencias biológicas como la cronobiología, la gerontología, la biología evolutiva y la biología del desarrollo descubriendo que en ellas, en general, se sigue pensando el tiempo biológico como el tiempo que mide un reloj. Nosotros proponemos que la edad como tiempo biológico debe ser entendida como una fase del proceso biológico, pero en función del ciclo completo del organismo. En el caso del ser humano, su edad está determinada también por lo que se “espera” de él. Su edad está determinada entonces por aspectos biológicos y culturales.

  4. Estrategias locales en tiempos de globalización

    Directory of Open Access Journals (Sweden)

    Dr. Xosé López García

    1999-01-01

    Full Text Available La evolución de la comunicación en los últimos años apunta una doble tendencia: local y global. Mientras avanza la globalización, aumentan las redes que facilitan la intercomunicación en tiempo real o se tejen redes mundiales, se revaloriza el valor social de la información de proximidad. Esta situación exige una respuesta en lo referido a estrategias de comunicación desde los ámbitos más cercanos al ciudadano -municipio y ciudad-. En el nuevo escenario, las iniciativas más sólidas de plantean desde abajo, con criterios abiertos, sin trabas de barreras fronterizas y con propuestas de deslocalización de la producción. El resultado es una gran variedad de modelos, reflejo de la diversidad de situaciones del panorama comunicativo en distintos ámbitos.

  5. Device for the acquisition and visualization in real time of the velocity and direction of wind in a radiological post stage; Dispositivo para la adquisicion y visualizacion en tiempo real de la velocidad y direccion del viento en una posta radiologica

    Energy Technology Data Exchange (ETDEWEB)

    Ledo P, L.M.; Guibert G, R. [CEADEN, Calle 30 No. 502 e/5 y 7 Ave. Miramar, Ciudad La Habana (Cuba); Dominguez L, O.; Alonso A, D.; Ramos V, E.O. [CPHR, Calle 20 No. 4113 e/41 y 47, Playa, 11300 La Habana, A.P. 6195 C.P. 10600 (Cuba)]. e-mail: ledo@ceaden.edu.cu

    2006-07-01

    The work shows the development, construction and post stage of a device dedicated to the acquisition and transmission in real time of the information on the behavior of the meteorological variables: velocity and wind direction. It is introduced for the first time in an observation position the automatic monitoring, in real time, using the tools that it offers the digitalisation of the information and the computation. The obtained data are registered in a PC, its are visualized appropriately and can be objects of later analysis. It was developed the application program Autoclima for such purpose. (Author)

  6. Historia como interrupción del tiempo

    OpenAIRE

    Aguilera Pedrosa, Antonio

    2006-01-01

    Frente a un concepto de presente como transición y a otro como repetición, Benjamín elabora uno donde el tiempo se detiene, clave para entender su concepto de historia. La interpretación habitual que separa tiempo histórico de tiempo físico quiere facilitar la comprensión de Benjamin, pero al precio de olvidar ciertas paradojas: la misma detención, la reversibilidad del tiempo, la redención del pasado entero, la invocación de la teología, la posibilidad de un cambio respecto al tiempo natural...

  7. Automation of the monitoring in real time of the absorbed dose rate in air due to the environmental gamma radiation in Cuba; Automatizacion del monitoreo en tiempo real de la tasa de dosis absorbida en aire debido a la radiacion gamma ambiental en Cuba

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez L, O.; Capote F, E.; Carrazana G, J.A.; Manzano de Armas, J.F.; Alonso A, D.; Prendes A, M.; Zerquera, J.T.; Caveda R, C.A. [CPHR, Calle 20, No. 4113 e/41 y 47, Playa, La Habana, 11300, A.P. 6195 C.P. 10600 (Cuba); Kalberg, O. [Swedish Radiation Protection Institute (SSI) (Sweden); Fabelo B, O.; Montalvan E, A. [CIAC, Camaguey (Cuba); Cartas A, H. [CEAC, Cienfuegos (Cuba); Leyva F, J.C. [CISAT (Cuba)]. e-mail: orlando@cphr.edu.cu

    2006-07-01

    The Center of Protection and Hygiene of the Radiations (CPHR) like center rector of the National Net of Environmental Radiological Surveillance (RNVRA), it has strengthened their detection capacity and of answer before a situation of radiological emergency. The measurements of the absorbed dose rate in air due to the environmental gamma radiation in the main stations of the Net are obtained in real time and the CPHR receives the data coming from these posts at one time relatively short. To improve the operability of the RNVRA it was necessary to complete the facilities of existent monitoring using 4 automatic measurement stations with probes of gamma detection, implementing in this way a measurement system on real time. On the other hand the software were developed: GenironProbeFech, to obtain the data of the probes, DataMail for the shipment of the same ones by electronic mail and GammaRed that receives and processes the data in the rector center. (Author)

  8. Parejas viables que perduran en el tiempo

    OpenAIRE

    Juan José Cuervo Rodríguez

    2013-01-01

    El presente artículo científico presenta resultados del proceso llevado a cabo en el proyecto de investigación docente "Mecanismos de autorregulación en parejas viables que perduran en el tiempo". Se soporta en una mirada compleja de la psicología basada en una epistemología de la construcción. En el ámbito metodológico, se inscribe en los estudios de terapia familiar desde una perspectiva de la comunicación humana como un todo integrado. Participaron nueve parejas. Los criterios de inclusión...

  9. Characterization of Leucaena (Leucaena leucephala) oil by direct analysis in real time (DART) ion source and gas chromatography; Caracterización del aceite de Leucaena (Leucaena leucocephala) por análisis directo en tiempo real (DART) y cromatografía de gases

    Energy Technology Data Exchange (ETDEWEB)

    Alam, M.; Alandis, N.M.; Sharmin, E.; Ahmad, N.; Alrayes, B.F.; Ali, D.

    2017-07-01

    For the first time, we report the characterization of triacylglycerols and fatty acids in Leucaena (Leucaena leucephala) oil [LUCO], an unexplored nontraditional non-medicinal plant belonging to the family Fabaceae. LUCO was converted to fatty acid methyl esters (FAMEs). We analyzed the triacylglycerols (TAGs) of pure LUCO and their FAMEs by time-of-flight mass spectrometry (TOF-MS) followed by multivariate analysis for discrimination among the FAMEs. Our investigations for the analysis of LUCO samples represent noble features of glycerides. A new type of ion source, coupled with high-resolution TOF-MS was applied for the comprehensive analysis of triacylglycerols. The composition of fatty acid based LUCO oil was studied using Gas Chromatography (GC-FID). The major fatty acid components of LUCO oil are linoleic acid (52.08%) oleic acid (21.26%), palmitic acid (7.91%) and stearic acid (6.01%). A metal analysis in LUCO was done by Inductively Coupled Plasma Mass Spectrometry (ICP-MS). The structural elucidation and thermal stability of LUCO were studied by FT-IR, 1H NMR, 13C NMR spectroscopic techniques and TGA-DSC, respectively. We also measured the cytotoxicity of LUCO [Spanish] Se presenta por primera vez la caracterización de triacilgliceroles y ácidos grasos del aceite de Leucaena (Leucaena leucephala) [LUCO], una planta no medicinal, no tradicional y no explorada, perteneciente a la familia Fabaceae. Se analizaron triacilgliceroles (TAGs) de LUCO y sus FAMEs por espectrometría de masas de tiempo de vuelo (TOF-MS) seguido de análisis multivariante para discriminación entre los FAME. Nuestras investigaciones para el análisis de muestras de LUCO presentaron características propias de los glicéridos. Un nuevo tipo de fuente de iones, junto con alta resolución TOF-MS se aplicó para el análisis exhaustivo de triacilgliceroles. La composición de aceite de LUCO basado en ácidos grasos se estudió usando Cromatografía de Gas (GC-FID). Los principales

  10. Development and evaluation of a real-time RT-PCR assay for the detection of Ebola virus (Zaire) during an Ebola outbreak in Guinea in 2014-2015.

    Science.gov (United States)

    Dedkov, V G; Magassouba, N' F; Safonova, M V; Deviatkin, A A; Dolgova, A S; Pyankov, O V; Sergeev, A A; Utkin, D V; Odinokov, G N; Safronov, V A; Agafonov, A P; Maleev, V V; Shipulin, G A

    2016-02-01

    In early February 2014, an outbreak of the Ebola virus disease caused by Zaire ebolavirus (EBOV) occurred in Guinea; cases were also recorded in other West African countries with a combined population of approximately 25 million. A rapid, sensitive and inexpensive method for detecting EBOV is needed to effectively control such outbreak. Here, we report a real-time reverse-transcription PCR assay for Z. ebolavirus detection used by the Specialized Anti-epidemic Team of the Russian Federation during the Ebola virus disease prevention mission in the Republic of Guinea. The analytical sensitivity of the assay is 5 × 10(2) viral particles per ml, and high specificity is demonstrated using representative sampling of viral, bacterial and human nucleic acids. This assay can be applied successfully for detecting the West African strains of Z. ebolavirus as well as on strains isolated in the Democratic Republic of the Congo in 2014. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Tiempo e historia en el Islam

    Directory of Open Access Journals (Sweden)

    Viguera Molins, María Jesús

    2004-06-01

    Full Text Available As in other civilizations, time in Islam is one of the organizing principies of its concepts, representations and identity. The very emergence of this civilization, in 7thcentury Arabia, resulted in the establishment of an era, a calendar and an historical consciousness of its own. Within this specificity, there are different ways of understanding, living and feeling time and history: from the personal, subjective perspective to that of philosophers and astronomers to time in the organization of daily activities, and from history as a succession of reigns and dynasties. These different concepts and vantage points reflect the richness and complexity of a civilization that is currently spread across all five continents and more than 1400 years old since Hegira. Thus, for the "orthodox" Sunnites time is linear, whereas for the Shiites it is cyclical. Yet even the rationalization of history as a linear occurring is not free from a contested meaning relative to the political circumstances of the present, as a semantic analysis of the term dawla indicates.

    Como en otras civilizaciones, el tiempo en el Islam es uno de los principios organizativos de sus conceptos, sus representaciones y su identidad. El mismo surgimiento de esta civilización, en la Arabia del siglo VII de la Era Cristiana, supuso la constitución de una era, un calendario y una conciencia histórica propios. Dentro de esta especificidad, hay diferentes modos de entender, vivir y sentir el transcurso del tiempo y de la historia, desde una perspectiva personal y subjetiva a otra social y política en relación con reinados y dinastías, pasando por la misma organización de las actividades cotidianas y la producción filosófica y astronómica. Estas diferencias reflejan la riqueza y complejidad de una civilización que se extiende hoy por todos los continentes y sobrepasa los 1400 años desde la Hégira. Entre los sunníes u "ortodoxos", por ejemplo, el tiempo

  12. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  13. Aportes y tiempos del texto (de teatro

    Directory of Open Access Journals (Sweden)

    Jean-Frédéric Chevallier

    2018-01-01

    Full Text Available Volviendo a visitar, a la luz de las prácticas escénicas contemporáneas, la relación entre texto y teatro, se propone, para entender los matices de dicha relación, hablar de texto-pregunta, texto débil, texto fuerte, texto saturado e, in fine, texto-propuesta. El surgimiento de este último, el texto-propuesta, producido por el espectador, invita a pensar que si bien se ha hablado mucho del “devenir-escénico” de un texto literario, quizás haya llegado el tiempo de enfocar el “devenir-literatura” de un acto teatral.

  14. Parejas viables que perduran en el tiempo

    Directory of Open Access Journals (Sweden)

    Juan José Cuervo Rodríguez

    2013-01-01

    Full Text Available El presente artículo científico presenta resultados del proceso llevado a cabo en el proyecto de investigación docente "Mecanismos de autorregulación en parejas viables que perduran en el tiempo". Se soporta en una mirada compleja de la psicología basada en una epistemología de la construcción. En el ámbito metodológico, se inscribe en los estudios de terapia familiar desde una perspectiva de la comunicación humana como un todo integrado. Participaron nueve parejas. Los criterios de inclusión fueron: cinco o más años de convivencia, participación voluntaria, no presentar (ni haber presentado problemáticas especiales que ameriten intervención psicoterapéutica y la obtención de un porcentaje significativo en el uso de estrategias de comunicación asertiva en la resolución de conflictos. El método general utilizado fue el análisis de la comunicación en tarea de conversación. Los principales hallazgos señalan una estrecha relación entre el contexto de desarrollo de las parejas, la emergencia de códigos comunicacionales propios y la posibilidad de perdurar en el tiempo; también, se resalta el tipo de comunicación asertiva o constructiva, la construcción de valores como el respeto y la aceptación de las diferencias, y el deseo por vivir y construir bienestar común, como elementos constitutivos de su identidad como pareja.

  15. Tiempo y Cosa: la Influencia de Einstein en el Pensamiento de Zubiri en torno al Tiempo Lineal

    Directory of Open Access Journals (Sweden)

    Ronald Durán Allimant

    2015-02-01

    Full Text Available Este artículo busca mostrar la concepción del tiempo lineal de Xavier Zubiri en su obra Espacio. Tiempo. Materia. Y en tal concepción del tiempo podemos ver la impronta radical del pensamiento de la Teoría de la Relatividad Restringida de Albert Einstein. Por tanto, para comprender más acabadamente lo que se entiende por tiempo a la luz de las cosas tendremos que estudiar someramente cómo el propio Zubiri lee a Einstein en este tema.

  16. Tiempo y Cosa: la Influencia de Einstein en el Pensamiento de Zubiri en torno al Tiempo Lineal

    Directory of Open Access Journals (Sweden)

    Ronald Durán Allimant

    2015-02-01

    Full Text Available Este artículo busca mostrar la concepción del tiempo lineal de Xavier Zubiri en su obra Espacio. Tiempo. Materia. Y en tal concepción del tiempo podemos ver la impronta radical del pensamientode la Teoría de la Relatividad Restringida de Albert Einstein. Por tanto, para comprender más acabadamente lo que se entiende por tiempo a la luz de las cosas tendremos que estudiar someramente cómo el propio Zubiri lee a Einstein en este tema.

  17. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  18. Modelling Dynamic Topologies via Extensions of VDM-RT

    DEFF Research Database (Denmark)

    Nielsen, Claus Ballegård

    Only a few formal methods include descriptions of the network topology that the modelled system is deployed onto. In VDM Real-Time (VDM-RT) this has been enabled for distributed systems that have a static structure. However, when modelling dynamic systems this fixed topology becomes an issue....... Systems with highly distributed and alternating relationships cannot be expressed correctly in a static model. This document describes how VDM-RT can be extended with new language constructs to enable the description of dynamic reconfiguration of the network topology during the runtime execution...... of a model. The extension is developed on the basis of a case study involving a dynamic system that has a constant changing system topology. With a basis in the case study a model is developed that uses the static version of VDM-RT in order to reveal the limitations of the language. The case study...

  19. Agua y tiempo en el arte

    Directory of Open Access Journals (Sweden)

    Juan Pando Despierto

    1993-01-01

    Full Text Available Elemento básico de la división simbólica del mundo antiguo, el agua sigue siéndolo en la modernidad, y con una autoridad indiscutible, a la que su propia potencia —y su rareza esencial tratándose de agua dulce—, proporcionan un vigor estético y una fuerza geoestratégica planetarias. El arte hizo siempre del agua un factor de meditación y de representación, de concreción de los sueños del hombre. Su ductilidad plástica, propia para todos los marcos, todas las facturas, la hizo servir también como vehículo expresivo de todas las culturas. Unida a la eclosión misma de la vida, el agua es símil igualmente de tiempo: mientras ella exista, aquél será «comprensible», esto es, habitado por la inteligencia humana.

  20. El interculturalismo, tema de nuestro tiempo

    Directory of Open Access Journals (Sweden)

    Martín RODRÍGUEZ ROJO

    2006-01-01

    Full Text Available El presente artículo habla de los estadios diferentes por donde ha pasado la humanidad en el ámbito del interculturalismo. Se trata de una división personal del autor, sin más pretensiones que aclarar conceptos. ¿Es el interculturalismo tema de nuestro tiempo en el sentido orteguiano? Sí, se responde. Porque es la síntesis de dos grandes aspectos que caracterizan a su vez a nuestro siglo. La globalización y su revulsivo, el identitarismo. En efecto, interculturalidad significa apostar por la igualdad como meta común de todos y aceptar la diferencia de cada individuo, sociedad y cultura. Homogeneización y diversidad sin renunciar a la igualdad de derechos y deberes de todos. Dos en uno. Se añade la siguiente acotación: imposible separar interculturalismo de lucha por el desarrollo, porque no se pueden dar la mano dos sujetos sin antes darse la solidaridad de los bolsos. Si la persona humana es un complejo de biología y de pensamiento, no se concibe aceptación de mentes sin aceptación de cuerpos que se han de alimentar antes de poder pensar. Desde aquí se derivan consecuencias para el mundo de la educación y de la enseñanza, de los planes de estudio y de los currículos en general.

  1. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  2. El tiempo libre y ocio reivindicado por los trabajadores

    Directory of Open Access Journals (Sweden)

    Guillermo Miranda Román

    2006-01-01

    Full Text Available Estas líneas están referidas a la realización de actividades del ocio en el tiempo libre que como derecho ha sido logrado por las luchas de aquellas sociedades cuyo desarrollo industrial y comercial es caracterizado por la designación de tiempos para la producción o distribución de las mercancías. Los trabajadores históricamente han luchado por el derecho a un tiempo libre necesario para el desarrollo de las aptitudes del hombre, asunto que tratamos de discurrir, o en el mejor de los casos, reflexionar.

  3. Ética y valores en tiempos de guerra capitalista

    OpenAIRE

    Mónica GALLEGOS RAMÍREZ

    2016-01-01

    Vivimos tiempos convulsos, revueltos; tiempos considerados como catastróficos por los pueblos que sufren violencia sistemática a través de despojo y exterminio; tiempos en los que la vida humana y no humana enfrenta una disyuntiva decisiva: o luchar, rebelarse y organizarse para su preservación o aceptar su irremediable extinción. Es en este escenario de guerra total contra la vida en el que nos planteamos reflexionar en torno del papel central que está de...

  4. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532.......3-100) and a specificity of 99.1% (95% CI: 97.4-99.8) for detection of Influenza A virus. The positive predictive and negative predictive values were 98.5% (95% CI: 95.8-99.7) and 99.7% (95% CI: 98.3-100) respectively. Influenza B virus detection could not be evaluated due to a low positivity rate. The BD MAX platform......BACKGROUND: Diagnosing of influenza rapidly and accurately helps clinicians to initiate appropriate treatment options and isolation protocols. Unnecessary antimicrobial treatment and laboratory testing can also be reduced. Assess commercial alternatives to in-house assays that may not only reduce...

  5. Sound / Märt Milter

    Index Scriptorium Estoniae

    Milter, Märt

    1998-01-01

    Uute plaatide Rolling Stones "No Security", Spiritualized "Live At The Royal Albert Hall", Kelly family "From Their Hearts", Arnold "Hillside Album", Joe Cocker "Greatest Hits", OST "Acid House", Songs from Andrew Lloyd Webber and Jim Steinmans "Whistle Down The Wind", The Weather Girls "PuttinÒn The Hits", Cliff Richard "Real As I Wanna Be", Folkmill "Topelt rosin", SIG "Sig 20v. Juhla-EP", "Motown Celebrates Sinatra", John Lee Hooker "Best Of Friends"

  6. Aquellos Tiempos del Cólera

    Directory of Open Access Journals (Sweden)

    Fernando Serpa Florez

    1986-08-01

    de Panamá que, a la sazón, hacía parte de la Nueva Granada.

    El germen llegó en el vapor “Falcon”, proveniente de Nueva Orleans con gentes que, atraídas por el recientemente descubierto oro de California, debían atravesar el istmo para arribar a su destino en la forma más rápida posible en ese tiempo. En mayo, y procedente de Nueva York, otro barco trajo un nuevo cargamento de enfermos que hicieron mayor el contagio.

    La epidemia se extendió por el litoral y ascendió por los puertos del río Magdalena, corriendo al estrago. Se calcula que en el país hubo veinte mil muertos por esta enfermedad. Mas, como sucede a veces, en lugar de acudir todos a apagar el incendio, poniendo en rigor la cuarentena -única arma eficaz que se conocía para detener el mal comenzaron las discusiones, escogiéndose para ello un sitio no del todo adecuado desde el punto de vista científico, pero sí apto para lograr resonancia: el Congreso de la República.

    Y después de acalorado estudio cuyos argumentos resumiremos adelante, en desorbitada aplicación dellaisser faire, laisser passer se aprobó la ley del 9 de junio de 1850 que es paradigma de esos tiempos. En plena epidemia de cólera se decreta la abolición de: “Cuarentenas, cordones sanitarios, u otras medidas que, so pretexto de prevenir la introducción y propagación de alguna enfermedad, impidan la libre comunicación en el interior de la Nueva Granada, o entre esta i los países extranjeros”.

    Cuál fue el origen de esta ley? El egoísmo de los comerciantes del interior que anteponían sus intereses a la difusión del mal? El ignorarse la forma de transmisión del cólera o quizá el hecho de que el chorro de Padilla no fue contaminado? La desatentada aplicación de las teorías del libre cambio a los problemas de salud?

    A la aprobación de esta ley se opuso con razonables argumentos Domingo Arosemena quien, además de médico, era representan te por Panamá...

  7. Itinerarios residenciales en tiempos de la maquila

    Directory of Open Access Journals (Sweden)

    Claudia Carolina Zamorano

    2006-01-01

    Full Text Available By means of the analysis of the residential and professional practices of immigrant families over Ciudad Juarez, this essay tries to show that inside the well-known abstract categories such as “popular urban residents” and “female maquila labor” exists a wide range of populational profiles that is necessary to clarify. For this reason, the work hypothesis is based on a flexible correlation of the following variables: a labor situation, b migratory status, and c the real estate and labor market exact situation. It is considered that the entrance moment on the labor and real estate markets (which speaks to us of the socio-economic and political context in which a cycle of urban integration begins, as well as the migratory situation of the head of the family, both define their labor and residential itineraries at the same time.

  8. Detección y cuantificación del Potato mop-top virus (PMTV en Colombia mediante qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nevar García Bastidas

    2013-04-01

    Full Text Available El Potato mop-top virus (PMTV es uno de los virus re-emergentes en cultivos de papa en Colombia. Es transmitido por Spongospora subterranea, el agente causal de la sarna polvosa. La detección del PMTV presenta dificultades debido a su distribución irregular en las plantas, bajo título y movimiento sistémico como ARN desnudo. Con el fin de ampliar el rango de herramientas disponibles para detectar el PMTV en los programas de certificación de tubérculo-semilla, en este estudio se evaluó la prueba de RT-PCR en tiempo real (qRT-PCR en dos pasos: con los cebadores PMTV-1948F/PMTV-2017R y la sonda Taqman® PMTV-1970, dirigidos al gen CP-RT del ARN2 viral. Se construyó una curva estándar a partir de la transcripción in vitro de un fragmento de 1513 pb de este gen. Posteriormente, se evaluó la utilidad de la técnica a partir de tres tipos de muestras: plantas señuelo de Nicotiana benthamiana y Solanum phureja inoculadas con quistosoros de Sss, raíces de papa con síntomas de sarna polvosa del municipio de La Unión (Antioquia y tubérculos-semilla. Mediante qRT-PCR fue posible detectar el virus en 11 de las 20 muestras de raíz de plantas señuelo, mientras que 14 de las 15 muestras de raíces de papa resultaron positivas, estimándose una concentración entre 4.72 x 10(11 y 7.60 x 10(13 partículas virales/µl. Adicionalmente, en el ensayo de tubérculo-semilla se determinó la presencia del PMTV en una de las 16 muestras. Estos resultados indican la viabilidad de utilizar rutinariamente la técnica de qRT-PCR para la detección de PMTV en Colombia.

  9. Estudio cuantitativo del tiempo y esfuerzo de los alumnos en la asignatura de lenguaje musical

    OpenAIRE

    Esteve-Faubel, José-María; Molina Valero, Miguel Ángel; López de Rego Fernández, Cruz; Espinosa Zaragoza, Juan Antonio

    2008-01-01

    Comunicación presentada en las VI Jornadas de Redes de Investigación en Docencia Universitaria, Universidad de Alicante, 9-10 de Junio de 2008. El objetivo de este trabajo es valorar si los tiempos propuestos en la guía de Lenguaje Musical adaptada a las directrices del Espacio Europeo de Educación Superior (EEES), son reales y adecuados para un alumnado con unos conocimientos musicales mínimos. La información se ha obtenido mediante un cuestionario autoadministrado a los alumnos, teniendo...

  10. El espacio y el tiempo en W. F. Flórez

    OpenAIRE

    Mandianes Castro, Manuel

    1990-01-01

    En las novelas de W. F. Flórez, como en la vida real de las aldeas gallegas, el espacio tiene muchos niveles: "lareira", aldea, parroquia, ciudad, Castilla, América, "fraga" y el subterráneo maravilloso, y el tiempo tiene cualidades: olor, sabor. Una lectura atenta de estas dos novelas demuestra que la oralidad forma parte importante de la narración; que el autor es, por lo mismo, en buena medida, un auténtico trasmisor de la tradición y que, por lo tanto, los etnólogos y antropólogos han de ...

  11. RT3D tutorials for GMS users

    Energy Technology Data Exchange (ETDEWEB)

    Clement, T.P. [Pacific Northwest National Lab., Richland, WA (United States); Jones, N.L. [Brigham Young Univ., Provo, UT (United States)

    1998-02-01

    RT3D (Reactive Transport in 3-Dimensions) is a computer code that solves coupled partial differential equations that describe reactive-flow and transport of multiple mobile and/or immobile species in a three dimensional saturated porous media. RT3D was developed from the single-species transport code, MT3D (DoD-1.5, 1997 version). As with MT3D, RT3D also uses the USGS groundwater flow model MODFLOW for computing spatial and temporal variations in groundwater head distribution. This report presents a set of tutorial problems that are designed to illustrate how RT3D simulations can be performed within the Department of Defense Groundwater Modeling System (GMS). GMS serves as a pre- and post-processing interface for RT3D. GMS can be used to define all the input files needed by RT3D code, and later the code can be launched from within GMS and run as a separate application. Once the RT3D simulation is completed, the solution can be imported to GMS for graphical post-processing. RT3D v1.0 supports several reaction packages that can be used for simulating different types of reactive contaminants. Each of the tutorials, described below, provides training on a different RT3D reaction package. Each reaction package has different input requirements, and the tutorials are designed to describe these differences. Furthermore, the tutorials illustrate the various options available in GMS for graphical post-processing of RT3D results. Users are strongly encouraged to complete the tutorials before attempting to use RT3D and GMS on a routine basis.

  12. Using CoRT Thinking in Schools.

    Science.gov (United States)

    Melchior, Timothy M.; And Others

    1988-01-01

    Describes the use of Edward de Bono's CoRT (Cognitive Research Trust) program in English classes during the past five years at Memorial Junior High School in Valley Stream, New York. CoRT tools were used to analyze literary characters and plot development and to generate and organize ideas for writing assignments. (TE)

  13. EVOLUCIÓN DEL CONCEPTO DEL TIEMPO COSMOLÓGICO

    Directory of Open Access Journals (Sweden)

    FRANCHESCA TIGLIOLI

    2011-12-01

    Full Text Available El concepto del tiempo ha evolucionado, desde los antiguos griegos, a lo largo de un período de más de dos mil años. Con el surgimiento de las ciencias particulares, el problema se desplazó desde la filosofía a las ciencias naturales, y la física, como la base de la ciencia fundamental, desempeña un papel esencial en este asunto. A principios del siglo pasado, Einstein revolucionó el concepto de tiempo con la Teoría de la Relatividad. Pero, ¿cuáles son las conexiones lógicas del concepto moderno de tiempo con la filosofía antigua? En este artículo se comparan las ideas de Aristóteles acerca del tiempo con las de la física posterior a Einstein, y se argumenta cómo esta comparación sugiere una interesante interpretación del tiempo en la cosmología moderna.

  14. Modelo de producción–inventario con tiempo de espera proporcional al tiempo de producción Modelo de producción-inventario con tiempo de espera proporcional al tiempo de producción

    Directory of Open Access Journals (Sweden)

    Andrés F. García Suaza

    2006-06-01

    Full Text Available In this paper is studied an inventory–production model with demand and production rates constants over time. One hypothesis is that waiting time, refereed to the time which the productive unit is off, is proportional to the working time of the same unit. The objective is to develop a mathematical model and to determine optimal number of cycles either minimizing cost or maximizing profit.En este trabajo se estudia un modelo de producción ¿inventario con tasas de demanda y producción constantes. Dentro de los supuestos se considera que el tiempo de espera, referido al tiempo en que la unidad de producción está inhabilitada, es proporcional al tiempo de actividad de la misma. El objetivo es desarrollar un modelo matemático y determinar el número óptimo de ciclos que minimice los costos, o bien, maximice la utilidad.

  15. Tiempo de Dios. Tiempo de los Hombres: El Breviario de Belleville

    Directory of Open Access Journals (Sweden)

    Ofelia Manzi

    2012-11-01

    Full Text Available Las imágenes cristianas, herederas de los sistemas narrativos romanos, expresaron visualmente los contenidos escriturarios. Uno de los elementos notables lo constituye la manera de representar la secuencia temporal en sus dos posibles dimensiones: humana y divina. Un recorrido por el arte cristiano tardo antiguo y medieval permite establecer de qué manera se generó una iconografía que permitió visualizar el mensaje que, de acuerdo con la correspondiente exégesis literaria, se quiso privilegiar en momentos históricos diversos. El objetivo de este trabajo es establecer de qué manera la imagen acompaña una concepción del tiempo en su doble dimensión. El Breviario de Belleville (París, siglo XIV ofrece un ejemplo en el que se conjugan ambas concepciones del transcurrir de la vida del hombre en una particular interpretación iconográfica.  

  16. A Polyadic pi-Calculus Approach for the Formal Specification of UML-RT

    Directory of Open Access Journals (Sweden)

    J. M. Bezerra

    2009-01-01

    Full Text Available UML-RT is a UML real-time profile that allows modeling event-driven and distributed systems; however it is not a formal specification language. This paper proposes a formal approach for UML-RT through a mapping of the UML-RT communicating elements into the -calculus (or pi-calculus process algebra. The formal approach both captures the intended behavior of the system being modeled and provides a rigorous and nonambiguous system description. Our proposal differentiates from other research work because we map UML-RT to -calculus, and we allow the mapping of dynamic reconfiguration of UML-RT unwired ports. We illustrate the usage and applicability of the mapping through three examples. The first example focuses on explaining the mapping; the second one aims to demonstrate the use of the -calculus definitions to verify system requirements; the third case is an example of mobile processes called Handover protocol.

  17. Detección de virus influenza A, B y subtipos A (H1N1 pdm09, A (H3N2 por múltiple RT-PCR en muestras clínicas

    Directory of Open Access Journals (Sweden)

    Pool Marcos

    Full Text Available Objetivos. Estandarizar la técnica de reacción en cadena de la polimerasa en tiempo real (RT-PCR múltiple para la detección de virus influenza A, B y tipificación de subtipos A (H1N1 pdm09, A (H3N2 en muestras clínicas. Materiales y métodos. Se analizaron 300 muestras de hisopado nasofaríngeo. Esta metodología fue estandarizada en dos pasos: la primera reacción detectó el gen de la matriz del virus de influenza A, gen de la nucleoproteína del virus influenza B y el gen GAPDH de las células huésped. La segunda reacción detectó el gen de la hemaglutinina de los subtipos A (H1N1 pandémico (pdm09 y A (H3N2. Resultados. Se identificaron 109 muestras positivas a influenza A y B, de las cuales 72 fueron positivas a influenza A (36 positivas a influenza A (H1N1 pdm09 y 36 positivos a influenza A (H3N2 y 37 muestras positivas a influenza B. 191 fueron negativas a ambos virus mediante RT-PCR en tiempo real multiplex. Se encontró una sensibilidad y especificidad del 100% al analizar los resultados de ambas reacciones. El límite de detección viral fue del rango de 7 a 9 copias/µL por virus. Los resultados no mostraron ninguna reacción cruzada con otros virus tales como adenovirus, virus sincitial respiratorio, parainfluenza (1,2 y 3, metapneumovirus, subtipos A (H1N1 estacional, A (H5N2 y VIH. Conclusiones. La RT-PCR múltiple demostró ser una prueba muy sensible y específica para la detección de virus influenza A, B y subtipos A (H1N1, H3N2 y su uso puede ser conveniente en brotes estacionales.

  18. rt: Fratres / Robert Cowan

    Index Scriptorium Estoniae

    Cowan, Robert

    1995-01-01

    Uuest heliplaadist "Pärt: Fratres (seven versions). Festina Lente. Cantus in Memory of Benjamin Britten. Summa. Peter Manning (vn.), France Springuel (vc.), Mireille Gleizes (pf.), I Fiamminghi. Telare CD CD80387 (79 minutes)

  19. Arvo Pärt. Litany / Peter Korfmacher

    Index Scriptorium Estoniae

    Korfmacher, Peter

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo. Litany; Psalom; Trisagion. Hilliard Ensemble, Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra, Tõnu Kaljuste"; Lithuanian Chamber Orchestra, Saulius Sondeckis. ECM 1592/449 810-2

  20. rt: Berliner Messe / Rob Cowan

    Index Scriptorium Estoniae

    Cowan, Rob

    1998-01-01

    Uuest heliplaadist "Pärt: Berliner Messe. The Beatitudes. Annum per Annum. Magnificat. Seven Magnificat Antiphons. De profundis. Polyphony / Steven Layton with Andrew Lucas" Hyperion CDA66960 (74 minutes:DDD)

  1. SMAP Data Assimilation at NASA SPoRT

    Science.gov (United States)

    Blankenship, Clay B.; Case, Jonathan L.; Zavodsky, Bradley T.

    2016-01-01

    The NASA Short-Term Prediction Research and Transition (SPoRT) Center maintains a near-real- time run of the Noah Land Surface Model within the Land Information System (LIS) at 3-km resolution. Soil moisture products from this model are used by several NOAA/National Weather Service Weather Forecast Offices for flood and drought situational awareness. We have implemented assimilation of soil moisture retrievals from the Soil Moisture Ocean Salinity (SMOS) and Soil Moisture Active/ Passive (SMAP) satellites, and are now evaluating the SMAP assimilation. The SMAP-enhanced LIS product is planned for public release by October 2016.

  2. Sistemas de control moderno volumen II: sistemas de tiempo discreto

    OpenAIRE

    Fernández del Busto, Ricardo; Ramírez Mendoza, Ricardo A.

    2014-01-01

    El objetivo del eBook es iniciar al estudiante en los conceptos de los sistemas de control en tiempo discreto de tal manera que el alumno pueda entender los temas y complementarlos con los contenidos de libros de texto clásicos, ya sea para autoestudio o desarrollo de tareas.

  3. Estudio de distribución de tiempos de residencia en un reactor biológico de lecho empacado cerámico

    OpenAIRE

    Tatiana Rodríguez Chaparro; Luz Helena Pinzón; Carlos Alberto Arámbula

    2004-01-01

    La distribución de tiempos de residencia de un reactor es una característica del mezclado que ocurre dentro de él [ ] 1 [ ] 2 ; su determinación es básica para el diseño de cualquier tipo de reactor en escala real. El objetivo de esta investigación consistió en determinar la distribución de tiempos de residencia en un reactor biológico de lecho empacado cerámico (anillos) a partir de pruebas con trazadores. Los resultados obtenidos utilizando las técnicas de inyección por paso ...

  4. Artist - analytical RT inspection simulation tool

    International Nuclear Information System (INIS)

    Bellon, C.; Jaenisch, G.R.

    2007-01-01

    The computer simulation of radiography is applicable for different purposes in NDT such as for the qualification of NDT systems, the prediction of its reliability, the optimization of system parameters, feasibility analysis, model-based data interpretation, education and training of NDT/NDE personnel, and others. Within the framework of the integrated project FilmFree the radiographic testing (RT) simulation software developed by BAM is being further developed to meet practical requirements for inspection planning in digital industrial radiology. It combines analytical modelling of the RT inspection process with the CAD-orientated object description applicable to various industrial sectors such as power generation, railways and others. (authors)

  5. The SPoRT-WRF: Evaluating the Impact of NASA Datasets on Convective Forecasts

    Science.gov (United States)

    Zavodsky, Bradley; Kozlowski, Danielle; Case, Jonathan; Molthan, Andrew

    2012-01-01

    Short-term Prediction Research and Transition (SPoRT) seeks to improve short-term, regional weather forecasts using unique NASA products and capabilities SPoRT has developed a unique, real-time configuration of the NASA Unified Weather Research and Forecasting (WRF)WRF (ARW) that integrates all SPoRT modeling research data: (1) 2-km SPoRT Sea Surface Temperature (SST) Composite, (2) 3-km LIS with 1-km Greenness Vegetation Fraction (GVFs) (3) 45-km AIRS retrieved profiles. Transitioned this real-time forecast to NOAA's Hazardous Weather Testbed (HWT) as deterministic model at Experimental Forecast Program (EFP). Feedback from forecasters/participants and internal evaluation of SPoRT-WRF shows a cool, dry bias that appears to suppress convection likely related to methodology for assimilation of AIRS profiles Version 2 of the SPoRT-WRF will premier at the 2012 EFP and include NASA physics, cycling data assimilation methodology, better coverage of precipitation forcing, and new GVFs

  6. Tiempo anómico: el carnaval de Barranquilla

    Directory of Open Access Journals (Sweden)

    Victor Reyes Morris

    2011-01-01

    Full Text Available En este artículo, al retomar el viejo concepto de Anomia, el autor pretende hacer un aporte a su desarrollo teórico a través de la introducción de los conceptos sucedáneos de “espacio anómico” y “tiempo anómico”. Los ilustra, a la manera de Émile Durkheim en La División del Trabajo Social, con tres ejemplos para cada uno de estos conceptos. Precisamente en este artículo se hacen algunas nuevas reflexiones acerca de esa “ilustración” del tiempo anómico con respecto al Carnaval de Barranquilla, fiesta emblemática de la Costa Caribe colombiana.

  7. An Overview of NASA SPoRT GOES-R JPSS Proving Ground Testbed Activities

    Science.gov (United States)

    Berndt, Emily; Stano, Geoffrey; Fuell, Kevin; Leroy, Anita; Mcgrath, Kevin; Molthan, Andrew; Schultz, Lori; Smith, Matthew; White, Kris; Schultz, Christopher; hide

    2017-01-01

    The Short-term Prediction Research and Transition (SPoRT) Center is funded by NASA's Earth Science Division and NOAA's JPSS and GOES-R Proving Grounds to transition satellite products and capabilities to the NWS to improve short term (0-48 hr) forecasts on a regional and local scale. SPoRT currently collaborates with 30+ NWS WFOs (at least one in each NWS region) and 5 National Centers/Testbeds. SPoRT matches user-identified forecast challenges to specific products, providing access to these data in AWIPS through new plug-in development, and generating applications-based training to use the products for their needs (R20). Upon transition, SPoRT collaborates with the user to assess the product impact in a real-world environment for feedback to product developers (O2R) and to benefit their peers.

  8. rt, Arvo: "Litany" / Barry Witherden

    Index Scriptorium Estoniae

    Witherden, Barry

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: "Litany". Litany. Psalom. Trisagion. The Hilliard Ensemble, Tallinn Chamber Orchestra, Estonian Philharmonic Chamber Orchestra, Estonian Philharmonic Chamber Choir, Tõnu Kaljuste. Orchestre de chambre de Lituanie, Saulius Sondeckis". ECM New Series ECM 1592, distribution Polygram 449 810-2 (CD:158F)

  9. rt, Arvo: "Litany" / Patric Wiklacz

    Index Scriptorium Estoniae

    Wiklacz, Patric

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: "Litany". Litany. Psalom. Trisagion. The Hilliard Ensemble, Orchestre de chambre de Tallinn, Choeur de chambre Philharmonique d'Estonie, Tõnu Kaljuste. Orchestre de chambre de Lituanie, Saulius Sondeckis. ECM New Series ECM 1592, distribution Polygram 449 810-2 (CD:158F)

  10. Forført af hjernen?

    DEFF Research Database (Denmark)

    Lieberoth, Andreas

    2013-01-01

    Blandingen af offentlig interesse, gode mediehistorier og smarte sælgere har ført til sejlivede neuromyter, der ikke bare distraherer almindelige mennesker, men også fører til udbredte misforståelser blandt professionelle som lærere og plejepersonale. I bedste fald leder neuromyter til spild af t...

  11. rt, Arvo. Fratres / Rainer Wagner

    Index Scriptorium Estoniae

    Wagner, Rainer

    1995-01-01

    Uuest heliplaadist "Pärt, Arvo. Fratres, Cantus (in Memory of Benjamin Britten), summa, Festina Lente; Peter Manning, France Springuel, Mireille Gleizes, Huub Righarts, I Fiamminghi, Rudolf Werthen" (AD: 1994) Telarc/in-akustik CD 80 387 (WD: 79'00")

  12. Falsificación del sello y reales cédulas de Felipe V en tiempos del marqués de Casa Fuerte: Nueva España, 1720-1731 (Fake stamp and royal charters of Philip V in the time of the Marquis of Casa Fuerte: New Spain, 1720-1731

    Directory of Open Access Journals (Sweden)

    Rafael Diego-Fernández Sotelo

    2015-03-01

    Full Text Available Resumen: En el siguiente trabajo se da cuenta del escándalo que se armó en la Nueva España en los años de 1729 a 1731, bajo el gobierno del célebre virrey Marqués de Casa Fuerte, cuando se descubrió una falsificación del sello real, así como una serie de cédulas en blanco con la firma del rey y de sus más cercanos colaboradores que desde Puebla se estaban comerciando. A pesar de tratarse a todas luces de un crimen de lesa magestad, el falsificador encontró el amparo decidido de la jerarquía eclesiástica, lo que en consecuencia generó un furioso enfrentamiento entre el poder temporal y el espiritual que desembocó, como era de esperar, en una guerra de excomuniones y recursos de fuerza.Abstract: In this paper realizes the scandal that erupted in New Spain in the years 1729-1731, under the rule of the famous Viceroy Marqués de Casa Fuerte, when a fake royal seal was found, as well as a series of bonds blank with the signature of the king and his closest collaborators from Puebla were trading. Although this is clearly a crime against majesty, the forger found the strong defense of the ecclesiastical hierarchy, which consequently led to an angry confrontation between the temporal and spiritual powers that led, as expected, in a war excommunications and resources force.

  13. Description of execution time dynamics for a set of concurrent real-time tasks

    Directory of Open Access Journals (Sweden)

    Pedro Guevara López

    2011-01-01

    Full Text Available Un Sistema en Tiempo Real (STR implantado en una computadora digital, interactúa con el mundo físico a través del acondicionamiento de variables (sensores, actuadores convertidores Analógico/Digital A/D y Digital/ Analógico D/A y procesa sus peticiones mediante tareas en tiempo real (Ji: i¿Z+. Cada Ji está formada por un conjunto de instancias {ji,k: i, k¿Z+, i es el índice de la tarea, k es el índice de la instancia} con al menos tres restricciones temporales: tiempo de arribo, tiempo de ejecución y plazo (Li,k, Ci,k, Di,k. En este sentido, es importante proponer un modelo para reconstruir el comportamiento de los tiempos de ejecución Ci,k. El modelo propuesto es un ARMA con un estimador de parámetros basado en la variable instrumental. Los tiempos de ejecución fueron medidos experimentalmente en QNX Neutrino 6.5 utilizando un procesador Intel Core i7 de 2.66 GHz. Se presentan los antecedentes teóricos del modelado de tareas en tiempo real, las mediciones de tiempo de ejecución, el modelo de tiempos de ejecución, el estimador de parámetros con variable instrumental, la experimentación y los resultados.

  14. Calibración de cámaras de tiempo de vuelo: Ajuste adaptativo del tiempo de integración y análisis de la frecuencia de modulación

    Directory of Open Access Journals (Sweden)

    P. Gil

    2013-10-01

    Full Text Available Resumen: La percepción de profundidad se hace imprescindible en muchas tareas de manipulación, control visual y navegación de robots. Las cámaras de tiempo de vuelo (ToF: Time of Flight generan imágenes de rango que proporcionan medidas de profundidad en tiempo real. No obstante, el parámetro distancia que calculan estas cámaras es fuertemente dependiente del tiempo de integración que se configura en el sensor y de la frecuencia de modulación empleada por el sistema de iluminación que integran. En este artículo, se presenta una metodología para el ajuste adaptativo del tiempo de integración y un análisis experimental del comportamiento de una cámara ToF cuando se modifica la frecuencia de modulación. Este método ha sido probado con éxito en algoritmos de control visual con arquitectura ‘eye-in-hand’ donde el sistema sensorial está compuesto por una cámara ToF. Además, la misma metodología puede ser aplicada en otros escenarios de trabajo. Abstract: The depth perception is essential in many manipulation tasks, visual inspection and robot navigation. The cameras of Time of Flight (TOF generate range images which provide depth measurements in real time. However, the distance parameter computed from these cameras is strongly dependent on the integration time set for the sensor and the frequency of modulation used by the integrated lighting system. In this paper, a methodology for automatic setting of integration time and an experimental analysis of ToF camera behavior adjusting its modulation frequency is presented. This method has been successfully tested on visual servoing algorithms with architecture ‘eye-in-hand’ in which the sensory system consists of a ToF camera, in addition this methodology can be applied to other workspaces and scenarios. Palabras clave: Tiempo de vuelo, calibración, imagen de rango, percepción robótica, cámaras 3D, Keywords

  15. EL TIEMPO: SECRETO DE LA INVESTIGACIÓN

    Directory of Open Access Journals (Sweden)

    Omar Parra Rozo

    2008-01-01

    Full Text Available Cualquier enunciación de un plan, identificación de unas hipótesis o formulación de variables se transforma constantemente y obedece a unos procesos temporales que consolidan los elementos de un proyecto y conlle - van su realización. En este artículo se plantea la necesidad de encontrar lo esencial de un elemento clave en la investigación y en la producción del conocimiento: el tiempo, a través de diversos acercamientos y fuentes, desde reflexiones sencillas hasta resultados científicos complejos, que contrastan la precisión de éste con su posible administración y control. Asimismo, se analiza la importancia de los referentes narrativos y científicos concernientes al tiempo, relacionados de forma directa con algunas connotaciones filosóficas, científicas y estéticas, las cuales son materia obligada en la producción y acceso al conocimiento y estructuran cualquier práctica pedagógica e investigativa. Acercarse al proceso investigativo en un proyecto, con la conciencia plena de la importancia del tiempo, representa una manera distinta de visualizar la meta, lanzar hipótesis, aproximarse a los indicadores, hacer un plan, un presu - puesto y, en particular, de fijar gran atención en uno de los elementos que, muchas veces se descuida, pero que cumple inexorablemente su papel: la elaboración y el cumplimiento del cronograma.

  16. Tipos de Tiempo en el periodo de Semana Santa Vallisoletana.

    OpenAIRE

    Miranda Martín, Javier

    2017-01-01

    El propósito del proyecto es el análisis y la caracterización de ciertos tipos de tiempo a partir de los datos observados de la Base de Datos Climatológica del Observatorio de Valladolid. Los datos analizados corresponden a los ocho días de Semana Santa de un periodo de 37 años que comprenden entre los años 1981 y 2017. Grado en Geografía y Ordenación del Territorio

  17. RT-qPCR for the diagnosis of dermatophilosis in horses.

    Science.gov (United States)

    Frank, Linda A; Kania, Stephen A; Weyant, Ellie

    2016-10-01

    Dermatophilus congolensis causes a crusting dermatitis that affects horses. Diagnosis requires the identification of the organism with cytological evaluation of crust samples. This method can lack sensitivity in chronic cases. To develop a probe-based real time quantitative polymerase chain reaction (RT-qPCR) test to assist with the diagnosis of dermatophilosis in horses. Twenty six privately owned horses and seven horses from a research colony were used. Crust samples, collected from 14 horses with suspected dermatophilosis and 12 horses with crusting skin disease not characteristic of dermatophilosis, were evaluated by cytological evaluation and RT-qPCR; the latter was also performed on hair samples collected from seven healthy horses. Cytological evaluation revealed organisms consistent with Dermatophilus congolensis from nine horses with suspected dermatophilosis, with only a few organisms seen from five samples. Cytological evaluation of all other crusts was negative for Dermatophilus. Other bacterial organisms were detected on cytological evaluation from 15 samples. RT-qPCR for Dermatophilus was positive from 11 crusts, whereas all other samples were negative. Two samples were cytologically negative but RT-qPCR positive for Dermatophilus. No samples were cytologically positive but RT-qPCR negative for Dermatophilus. Results of this study show that RT-qPCR may be a more sensitive and easier method than cytological evaluation for the diagnosis of dermatophilosis in horses. © 2016 ESVD and ACVD.

  18. Tiempo y relaciones sostenibles en el espacio urbano

    Directory of Open Access Journals (Sweden)

    Carlos Silva

    2011-01-01

    Full Text Available En el texto que sigue, hacemos un recorrido por la noción de sostenibilidad y de relaciones urbanas sostenibles, resaltando el nexo entre las fuentes consultadas y un acontecimiento específico: cruzar la calle en puntos gestionados por semáforos. Además, presentamos una visión diferente de temporalidad en el marco de las mencionadas relaciones. Así, introducimos la noción de tiempo vertical oponiéndola, sin pretender sustituir, a visiones más tradicionales que ubicamos dentro de lo que llamamos tiempo horizontal. Finalmente, ejemplificamos nuestros argumentos con unas notas etnográficas extraídas de nuestro diario de campo cuya forma tiene como fondo la descripción densa (Geertz, 2003, sin llegar a ser tan exhaustiva como lo fue la producción geertziana. Para ello asumimos como sustento teórico algunos de los principios de la Teoría del Actor-Red (Latour, 2005, 2002, 2001. Concluimos que la sostenibilidad relacional urbana es una noción compleja, cuya comprensión requiere tomar en cuenta agentes humanos y no humanos, es decir, relaciones intersubjetivas y, también, interobjetivas (Latour, 2005.

  19. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  20. Development of a novel recombinant encapsidated RNA particle: evaluation as an internal control for diagnostic RT-PCR

    DEFF Research Database (Denmark)

    King, Donald P.; Montague, Nick; Ebert, Katja

    2007-01-01

    This report describes the generation of novel encapsidated RNA particles and their evaluation as in-tube internal controls in diagnostic real-time reverse-transcription PCR (rRT-PCR) assays for the detection of RNA viruses. A cassette containing sequences of 2 diagnostic primer sets for foot...... unguiculata). RNA contained in these particles was amplified in diagnostic rRT-PCR assays used for detection of FMDV and SVDV. Amplification of these internal controls was used to confirm that rRT-PCR inhibitors were absent from clinical samples, thereby verifying negative assay results. The recombinant CPMVs...... did not reduce the analytical sensitivity of the rRT-PCRs when amplification of the insert was performed in the same tube as the diagnostic target. This system provides an attractive solution to the production of internal controls for rRT-PCR assays since CPMV grows to high yields in plants...

  1. Prompt detection of influenza A and B viruses using the BD Veritor™ System Flu A+B, Quidel® Sofia® Influenza A+B FIA, and Alere BinaxNOW® Influenza A&B compared to real-time reverse transcription-polymerase chain reaction (RT-PCR).

    Science.gov (United States)

    Dunn, Jim; Obuekwe, Joy; Baun, Traci; Rogers, Justin; Patel, Twinkle; Snow, Linda

    2014-05-01

    The performance characteristics of rapid influenza diagnostic tests vary widely. This study evaluated the BD Veritor™ System Flu A+B (Veritor; BD Diagnostics, Sparks, MD, USA), Quidel® Sofia® Influenza A+B FIA (Sofia; Quidel Corp., San Diego, CA, USA), and Alere BinaxNOW® Influenza A&B (Binax; Alere Scarborough, Inc., Scarborough, ME, USA) compared to reverse transcription-polymerase chain reaction (RT-PCR) for detection of influenza viruses in nasal wash specimens from 240 pediatric patients. Positive percent agreements for influenza A and B virus detection were 93.8% and 94.2%, 95.8% and 98.1%, and 79.2% and 80.8% for Veritor, Sofia, and Binax, respectively. The Veritor and Binax tests demonstrated negative percent agreements >97.9% for detection of both influenza viruses, but the negative percent agreement of the Sofia test was 91.1% for influenza A and 70.7% for influenza B virus. Overall, the Veritor and Sofia tests were nearly as sensitive as RT-PCR and considerably more sensitive than Binax for detection of influenza viruses. However, the accuracy of the Sofia test was significantly lower than either Veritor or Binax. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  2. COMO FOMENTAR EL DEPARTAMENTO DE RECURSOS HUMANOS A NIVEL INTERNO EN TIEMPOS DE CRISIS. EXPERIENCIA REAL.

    OpenAIRE

    ROSALES GUIJARRO, RAQUEL

    2013-01-01

    En este trabajo quiero mostrar cómo se puede potenciar el departamento de recursos humanos de una empresa a nivel interno a través de la implantación de un Plan de Marketing orientado a dicho departamento. Comencé con la empresa Colebega, S.A., pero por cuestiones de cambio accionarial el trabajo tuvo que paralizarse. He mantenido la esencia inicial del trabajo, pero centrándome en el sector de la hostelería en general y en particular en el subsector de la restauración, con el ...

  3. [Reseña: La temporalidad estremecida] Araújo, A. (2013. Todos los tiempos, el tiempo. Montevideo: Psicolibros

    Directory of Open Access Journals (Sweden)

    Ana Luisa Hounie

    2014-05-01

    Full Text Available Corrientes muy diversas del pensamiento que procuran dar luz al problema de la percepción humana de la experiencia del mundo (desde Wilfrid Sellars (1962 a Edgar Morin (2001 -por situar dos filósofos que se encuentran en el origen de concepciones epistemológicas bien distintas- coinciden en un punto: de lo que se trata es de entender de qué forma las cosas, en el sentido más amplio posible, se componen juntas. El texto de Ana María Araújo fortifica esta idea doblemente, pues esta composición resulta precisamente el fundamento epistémico que le da lugar y al mismo tiempo el principio que sostiene el riguroso método que lo hace posible. En otras palabras, desde el comienzo hasta el final, la autora produce una respuesta en acto a la pregunta por el tiempo que guía su inquietud investigativa.

  4. Hard Real-Time Networking on FIrewire

    NARCIS (Netherlands)

    Zhang, Yuchen; Orlic, B.; Visser, P.M.; Broenink, Johannes F.; Marquet, P; McGuire, N; Wurmsdobler, P

    2005-01-01

    This paper investigates the possibility of using standard, low-cost, widely used FireWire as a new generation fieldbus medium for real-time distributed control applications. A real-time software subsys- tem, RT-FireWire was designed that can, in combination with Linux-based real-time operating

  5. Real-Time Java Commercial Product Assessment

    National Research Council Canada - National Science Library

    Piszcz, Alan; Vidrine, Kent

    2000-01-01

    .... Specification status and implementation towards an industry standard application-programming interface are split between two consortiums striving to introduce different paradigms of Java integration with real-time (RT) services...

  6. Prospective comparison of the detection rates of human enterovirus and parechovirus RT-qPCR and viral culture in different pediatric specimens

    NARCIS (Netherlands)

    de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A

    2013-01-01

    BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared

  7. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator

    Science.gov (United States)

    Quantitative real-time PCR (qRT-PCR) is a reliable and reproducible technique for measuring and evaluating changes in gene expression. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. In this study, expres...

  8. Encuentro con el tiempo: Adagio con variaciones de Alfredo Aracil

    Directory of Open Access Journals (Sweden)

    Rosa María Rodríguez Hernández

    2012-01-01

    Full Text Available Examinando analíticamente la obra sinfónica Adagio con variaciones de Aracil, estudiaremos los principales componentes para concluir con una evaluación de los mismos. A través de la cronología de la obra de Aracil175, observamos la importancia que adquiere en su trayectoria la memoria; su pensamiento va siempre unido a ésta. Uno de sus recursos principales es la cita; es Adagio con variaciones donde claramente observaremos la memoria lejana e inmediata al tiempo: Wagner es el punto de referencia al pasado, Wolf impulsa hacia el presente, y, Aracil advierte el devenir en cada una de sus variaciones.

  9. ¿Cómo pensamos acerca del tiempo?

    Directory of Open Access Journals (Sweden)

    Antonio Román

    2007-11-01

    Full Text Available ¿Cómo somos las personas capaces de pensar sobre cosas que jamás hemos podido ver o tocar? La ciencia está llena de conceptos e ideas abstractas como, por ejemplo, el campo electromagnético. Pero también la vida cotidiana está plagada de conceptos sin un referente tangible, como justicia, amor o, como en el caso que nos ocupa en este artículo, la idea de tiempo. Exponemos aquí algunas de las estrategias que utiliza nuestro cerebro para poder entender, manipular, y sentir algo que, de forma racional, no deja de ser un constructo con la etiqueta “tiempo”.

  10. Tiempo de retardo en las paradas de emergencia del reactor nuclear RP-10

    OpenAIRE

    Arrieta, Rolando; Urcia, Agustín; Canaza, Dionisio; Ramón, Arturo; Ovalle, Edgard; Veramendi, Emilio; Salazar, Alberto

    2011-01-01

    En una parada de emergencia, al tiempo de caída libre de las barras de seguridad, se suma el tiempo de respuesta de la instrumentación asociada y del propio conjunto de izaje electromagnético, este último denominado “Tiempo de retardo”. En el presente trabajo se muestra la medición del tiempo de retardo para la iniciación de una acción de parada de seguridad y la determinación de la corriente de trabajo de los electroimanes en cumplimiento a lo exigido por las especificaciones técnicas del re...

  11. Power lies in interdisciplinary cooperation / Kärt Summatavet ; interv. Kärt Blumberg

    Index Scriptorium Estoniae

    Summatavet, Kärt, 1963-

    2008-01-01

    Ehtekunstnik Kärt Summatavet oma uudsest meetodist ehete valmistamisel - paberil oleva kujutise ülekandmisest arvuti abil metallile, mille ta töötas väljas oma doktoritöö raames Soomes Helsingi Kunsti- ja Disainiülikoolis ning mis pälvis Soulis toimunud ülemaailmsel naisleiutajate konkursil hõbemedali

  12. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  13. Competitive RT-PCR Strategy for Quantitative Evaluation of the Expression of Tilapia (Oreochromis niloticus) Growth Hormone Receptor Type I

    Science.gov (United States)

    2009-01-01

    Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes. PMID:19495916

  14. Applications of NASA and NOAA Satellite Observations by NASA's Short-term Prediction Research and Transition (SPoRT) Center in Response to Natural Disasters

    Science.gov (United States)

    Molthan, Andrew L.; Burks, Jason E.; McGrath, Kevin M.; Jedlovec, Gary J.

    2012-01-01

    NASA s Short-term Prediction Research and Transition (SPoRT) Center supports the transition of unique NASA and NOAA research activities to the operational weather forecasting community. SPoRT emphasizes real-time analysis and prediction out to 48 hours. SPoRT partners with NOAA s National Weather Service (NWS) Weather Forecast Offices (WFOs) and National Centers to improve current products, demonstrate future satellite capabilities and explore new data assimilation techniques. Recently, the SPoRT Center has been involved in several activities related to disaster response, in collaboration with NOAA s National Weather Service, NASA s Applied Sciences Disasters Program, and other partners.

  15. Recent Upgrades to NASA SPoRT Initialization Datasets for the Environmental Modeling System

    Science.gov (United States)

    Case, Jonathan L.; Lafontaine, Frank J.; Molthan, Andrew L.; Zavodsky, Bradley T.; Rozumalski, Robert A.

    2012-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed several products for its NOAA/National Weather Service (NWS) partners that can initialize specific fields for local model runs within the NOAA/NWS Science and Training Resource Center Environmental Modeling System (EMS). The suite of SPoRT products for use in the EMS consists of a Sea Surface Temperature (SST) composite that includes a Lake Surface Temperature (LST) analysis over the Great Lakes, a Great Lakes sea-ice extent within the SST composite, a real-time Green Vegetation Fraction (GVF) composite, and NASA Land Information System (LIS) gridded output. This paper and companion poster describe each dataset and provide recent upgrades made to the SST, Great Lakes LST, GVF composites, and the real-time LIS runs.

  16. Desafío del tiempo, memoria y esperanza

    Directory of Open Access Journals (Sweden)

    Fredy Parra C

    2007-01-01

    Full Text Available El artículo reflexiona sobre diversas dimensiones y tensiones de la temporalidad: Se muestra que el tiempo de la vida humana es, a la vez, duración, proyección y destinación, y se profundiza en los momentos de la línea proyectiva propia del acontecer, a saber, pasado-presente-futuro. A seguir se define la historicidad como aquella experiencia fundamental por la que el hombre, sujeto libre, se encuentra entre un pasado ya dado y un futuro porvenir-por crear, y se indagan sus tensiones. Por el hecho de ser como es, el hombre tiene que esperar y ve su existencia como un proyecto inconcluso, abierto a la novedad. La existencia humana vive rodeada de la posibilidad, no solo de la presencia. Por lo mismo, el artículo esboza una crítica a las filosofías del progreso que, al no superar una ontología del presente, pierden su fuerza innovadora y dañan sus vínculos con el pasado y el futuro. Se trata de rescatar el pasado sin renunciar al futuro. Solo la razón anamnética, la memoria, puede salvar del olvido del pasado. Finalmente, se plantea que la fe judeocristiana valora todos los tiempos porque precisamente cree y espera en Dios Creador y Consumador, Dios de vivos y muertos, en una palabra, Señor de la historia y de todos los tiemposThis article reflects upon the diverse dimensions and tensions of temporality: the time of human life is shown to be, at the same time, duration, projection and destination, and deepens in the moments of the projective line proper to events-that is, past-present-future. Then historicity is defined as that fundamental experience through which the human person, as a free subject, is found between a given past and a future yet to be created. The tensions involved are examined. Just by being as one is, the human person has to wait, and sees his or her existence as an inconclusive project, open to novelty. Human existence lives surrounded by possibility, and not only presence. For this reason, the article seeks to

  17. La prueba de McTaggart de la irrealidad del tiempo

    Directory of Open Access Journals (Sweden)

    Eduardo Shore

    2010-10-01

    Full Text Available McTaggart se apoya en el hecho de que no percibimos el tiempo en si mismo, un tiempo vacio de sucesos:  lo que en verdad percibimos es el transcurrir de los acontecimientos, tanto de los extemos como los de nuestro propio estado intemo en la conciencia. Todo el desarrollo de McTaggart y tambien su originalidad, consiste en el desentraiiamiento del mecanismo por el cual aprehendemos el caracter temporal del acaecer, a traves del cual tenemos la ilusión de que percibimos el tiempo. De ese analisis se desprende su tesis: La manera de captar lo temporal es contradictoria en si misma, par lo que, si el significante es contradictorio, lo significado, en este caso el tiempo, es nada: el nihil privativum kantiano" Pregunto: no tendra razón McTaggart, en cuyo caso podria decirse que los sucesos "son" el tiempo?

  18. LabVIEW Real-Time

    CERN Multimedia

    CERN. Geneva; Flockhart, Ronald Bruce; Seppey, P

    2003-01-01

    With LabVIEW Real-Time, you can choose from a variety of RT Series hardware. Add a real-time data acquisition component into a larger measurement and automation system or create a single stand-alone real-time solution with data acquisition, signal conditioning, motion control, RS-232, GPIB instrumentation, and Ethernet connectivity. With the various hardware options, you can create a system to meet your precise needs today, while the modularity of the system means you can add to the solution as your system requirements grow. If you are interested in Reliable and Deterministic systems for Measurement and Automation, you will profit from this seminar. Agenda: Real-Time Overview LabVIEW RT Hardware Platforms - Linux on PXI Programming with LabVIEW RT Real-Time Operating Systems concepts Timing Applications Data Transfer

  19. CÓMO MOTIVAR Y MOTIVARSE EN TIEMPOS DE CRISIS

    Directory of Open Access Journals (Sweden)

    José Navarro

    2014-01-01

    Full Text Available La motivación laboral constituye un tipo de comportamiento adaptativo con el que respondemos de manera eficaz a las demandas de nuestro trabajo. La crisis actual ha supuesto el cambio de algunas condiciones laborales básicas (horarios, retribución, seguridad, etc. que están incidiendo en un tipo de motivación, determinada por condiciones externas al trabajador, que la investigación conoce es una motivación débil en intensidad y poco persistente en el tiempo. Propondremos algunas guías que se centran en el estímulo de motivaciones más autónomas y bajo el control del trabajador en base a investigaciones propias que hemos venido desarrollando en los últimos años. Gran parte de estas investigaciones se han basado en una comprensión dinámica de la motivación laboral. Entender la dinámica de la motivación nos aporta este tipo de guías útiles para la acción.

  20. LA POLÍTICA SOCIAL EN TIEMPOS DE AJUSTE

    Directory of Open Access Journals (Sweden)

    Leonardo Garnier Rímolo

    2011-09-01

    Full Text Available La política social está nuevamente de moda. Hace unos años, eran la estabilización y el ajuste los temas que dominaban la literatura, los debates y hasta las conversaciones de los economistas. Hoy, es cada vez más frecuente la referencia a la pobreza, el costo social del ajuste, el rostro humano de la política económica, el gasto social, la salud, la educación, en fin, todos aquellos temas relativos a la calidad de vida y el desarrollo humano. A diferencia del pasado, sin embargo, este redescubrimiento de los objetivos sociales del desarrollo no olvida, sino que parte precisamente del reconocimiento de las limitaciones materiales y financieras que enfrentan las sociedades menos desarrolladas. La discusión actual busca redefinir el sentido de la política social en los tiempos del ajuste o, si se quiere, redefinir los procesos de ajuste a la luz de su verdadero objetivo: el desarrollo social.

  1. Tiempo e imagen en Gaston Bachelard y Herni Bergson

    Directory of Open Access Journals (Sweden)

    Juan de Dios Martínez Lozornio

    2016-01-01

    Full Text Available Este artículo busca un acercamiento a la cuestión del tiempo de la creación. Las reflexiones estéticas de Gastón Bachelard ponen énfasis en dicho aspecto, sin embargo, hace referencia constantemente –en contraposición– a la duración de Henri Bergson, desarrollando así una dialéctica intuicional en la que la duración se enfrenta al instante. El lugar en el que se da esta lucha de intuiciones es la imagen, pues en ésta se manifiesta la temporalidad esencial de la creación artística según Bachelard. This article seeks an approach to the question of the time of creation. The aesthetic reflections of Gaston Bachelard put emphasis on this aspect, however, constant reference –as opposed– to the duration of Henri Bergson, thus developing an intuitional dialectic in which the duration is faced to the instant. The place where takes place this struggle of intuitions is the image, because there, following Bachelard, the essential temporality of the artistic creation manifests itself.

  2. Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms

    Directory of Open Access Journals (Sweden)

    Charlotte Nejad

    2018-01-01

    Full Text Available MicroRNA (miRNA detection by reverse transcription (RT quantitative real-time PCR (RT-qPCR is the most popular method currently used to measure miRNA expression. Although the majority of miRNA families are constituted of several 3′-end length variants (“isomiRs”, little attention has been paid to their differential detection by RT-qPCR. However, recent evidence indicates that 3′-end miRNA isoforms can exhibit 3′-length specific regulatory functions, underlining the need to develop strategies to differentiate 3′-isomiRs by RT-qPCR approaches. We demonstrate here that polyadenylation-based RT-qPCR strategies targeted to 20–21 nt isoforms amplify entire miRNA families, but that primers targeted to >22 nt isoforms were specific to >21 nt isoforms. Based on this observation, we developed a simple method to increase selectivity of polyadenylation-based RT-qPCR assays toward shorter isoforms, and demonstrate its capacity to help distinguish short RNAs from longer ones, using synthetic RNAs and biological samples with altered isomiR stoichiometry. Our approach can be adapted to many polyadenylation-based RT-qPCR technologies already exiting, providing a convenient way to distinguish long and short 3′-isomiRs.

  3. SPoRT - An End-to-End R2O Activity

    Science.gov (United States)

    Jedlovec, Gary J.

    2009-01-01

    Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the Short-term Prediction Research and Transition (SPoRT) program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral observational data applications from EOS satellites to improve short-term weather forecasts on a regional and local scale. SPoRT currently partners with several universities and other government agencies for access to real-time data and products, and works collaboratively with them and operational end users at 13 WFOs to develop and test the new products and capabilities in a "test-bed" mode. The test-bed simulates key aspects of the operational environment without putting constraints on the forecaster workload. Products and capabilities which show utility in the test-bed environment are then transitioned experimentally into the operational environment for further evaluation and assessment. SPoRT focuses on a suite of data and products from MODIS, AMSR-E, and AIRS on the NASA Terra and Aqua satellites, and total lightning measurements from ground-based networks. Some of the observations are assimilated into or used with various versions of the WRF model to provide supplemental forecast guidance to operational end users. SPoRT is enhancing partnerships with NOAA / NESDIS for new product development and data access to exploit the remote sensing capabilities of instruments on the NPOESS satellites to address short term weather forecasting problems. The VIIRS and CrIS instruments on the NPP and follow-on NPOESS satellites provide similar observing capabilities to the MODIS and AIRS instruments on Terra and Aqua. SPoRT will be transitioning existing and new capabilities into the AWIIPS II environment to continue the continuity of its activities.

  4. Comparison of the Roche RealTime ready Influenza A/H1N1 Detection Set with CDC A/H1N1pdm09 RT-PCR on samples from three hospitals in Ho Chi Minh City, Vietnam.

    Science.gov (United States)

    Tham, Nguyen thi; Hang, Vu thi Ty; Khanh, Trong Huu; Viet, Do Chau; Hien, Tran Tinh; Farrar, Jeremy; Chau, Nguyen van Vinh; van Doorn, H Rogier

    2012-10-01

    Real-time polymerase chain reaction (PCR) can be considered the gold standard for detection of influenza viruses due to its high sensitivity and specificity. Roche has developed the RealTime ready Influenza A/H1N1 Detection Set, consisting of a generic influenza virus A PCR targeting the M2 gene (M2 PCR) and a specific PCR targeting the hemagglutinin (HA) of A/H1N1-pdm09 (HA PCR, 2009 H1N1), with the intention to make a reliable, rapid, and simple test to detect and quantify 2009 H1N1 in clinical samples. We evaluated this kit against the US Centers for Disease Control and Prevention (USCDC)/World Health Organization real-time PCR for influenza virus using 419 nose and throat swabs from 210 patients collected in 3 large hospitals in Ho Chi Minh City, Vietnam. In the per-patient analysis, when compared to CDC PCR, the sensitivity and specificity of the M2 PCR were 85.8% and 97.6%, respectively; the sensitivity and specificity of HA PCR were 88.2% and 100%, respectively. In the per-sample analysis, the sensitivity and specificity in nose swabs were higher than those in throat swabs for both M2 and HA PCRs. The viral loads as determined with the M2 and HA PCRs correlated well with the Ct values of the CDC PCR. Compared with the CDC PCR, the kit has a reasonable sensitivity and very good specificity for the detection and quantification of influenza A virus and A/H1N1-pdm09. However, given the current status of 2009 H1N1, a kit that can detect all circulating seasonal influenza viruses would be preferable. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Analysis of evolution and virological characteristics of rtI233V mutations in the hepatitis B virus reverse transcriptase domain

    Directory of Open Access Journals (Sweden)

    Xiao-ling YE

    2015-04-01

    Full Text Available Objective To analyze the evolution of rtI233V mutation in the reverse transcriptase domain of hepatitis B virus (HBV and its association with adefovir dipivoxil (ADV resistance. Methods The rate of detection of rtI233V mutation in 9830 patients with chronic HBV infection was analyzed. HBV reverse transcriptase genes isolated from serial serum samples of two patients were amplified by nested PCR, and clonal sequencing (>20 clones/sample was performed to analyze the evolution of rtI233V mutations. The replica of pTriEx-HBV1.1 vectors harboring wild-type and mutant strains (rtI233V, rtN236T, rtI233V+rtN236T were respectively constructed and transiently transfected into HepG2 cells. Media containing serial concentrations of lamivudine (LAM, ADV, entecavir (ETV, or tenofovir (TDF were used to treat the cells. Then HBV DNA in the supernatants was quantitatively determined by real-time PCR in order to analyze HBV mutants' replication competence and phenotypic characteristics under the drug pressures. Results The detection rate of rtI233V mutation in 9830 nucleos(tide analogues-treated patients was 0.28% (28/9830, including 0.19% (19 patients with rtI233V individual mutation and 0.09% (9 patients with rtI233V mutation combining with rtN236T or other mutations. All of the patients had rtI233V had ADV exposure history: 16 (57.1% of them received ADV monotherapy for over six months, and 12(42.9% of them received ADV combined sequential therapy for over 12 months. Replication competence and phenotypic resistance analysis showed rtI233V and wild-type strains had similar viral replication competence, while rtN236T exhibited significantly lower replication competence compared with wild-type strains. rtI233V strains remained sensitive to LAM, ADV, ETV, and TDF and showed little influence on drug resistance when combined with rtN236T, but it showed ability to restore the defected replication capacity of rtN236T strains. Conclusions  The rtI233V mutation

  6. Ritual, tiempo y espacio sagrado en el budismo zen argentino

    Directory of Open Access Journals (Sweden)

    Catón Eduardo Carini

    2010-07-01

    Full Text Available El budismo zen es una religión oriental que desde hace varias décadas se ha esparcido en numerosos países occidentales, incluido la Argentina. Una característica notable de su vida comunitaria es la compleja ritualización de sus prácticas cotidianas. En nuestra aproximación a la dimensión ritual del zen indagaremos la forma en que ésta contribuye a crear un tiempo y un espacio sagrado y observaremos cómo estas prácticas son consideradas por los propios miembros del grupo como un recurso pedagógico que posibilita entrenarse en una diferente manera de estar en el mundo, de vivirse y percibirse tanto a ellos mismos como a los demás. De modo que algunos elementos del complejo ritual zen juegan un rol de primera importancia como una tecnología del ser.Zen Buddhism is an oriental religion that since several decades has expanded in various western countries, Argentina being one of them. The complex ritualization of its everyday practices is a considerable characteristic of Zen Buddhist community life. In our exploration of the ritual dimension of Zen, first we will investigate how this contributes to the creation of a sacred time and place. After this, we will show how ritual practices are considered a pedagogic recourse by group members; a means to make possible their training of a different way of being in the world, of experimenting, living and perceiving both themselves and others in a different way. Some elements of the often complex Zen ritual play a highly important part as technologies of the self.

  7. Development and evaluation of a RT-LAMP assay for rapid detection of hepatitis E virus from shellfish.

    Science.gov (United States)

    Gao, Shenyang; Li, Dandan; Liu, Ying; Zha, Enhui; Wang, Shen; Li, Yonggang; Zhou, Tiezhong; Yue, Xiqing

    2016-03-02

    Hepatitis E virus (HEV) has becoming a well known zoonotic enteric pathogen and circulated widely inter human-animal-water-food. Generally, detection of the virus has relied on conventional reverse transcription-PCR (RT-PCR) and TaqMan/SYBR quantitative real-time RT-PCR (RT-qPCR), but these tools are usually disadvantages in time-consuming and expensive instruments required. In the present study, we report here on the development of a one-step single-tube reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for rapid detection of HEV contamination in shellfish. The amplification is completed under the isothermal condition (63 °C) for 60 min, and can be visually evaluated by staining at a time in about 1h. In addition, a total of 315 shellfish (80 Anadara granosa, 115 Scapharca subcrenata and 120 Ruditapes philippinarum) collected monthly from the Jinzhou coastal estuary of China Bohai gulf were investigated for HEV contamination by the RT-LAMP compared with a standard RT-qPCR. It was found that genotype 4 HEV was detected in all three species of shellfish sampled using the RT-LAMP assay and was in accordance with RT-qPCR detection of HEV in shellfish. Summarily, our results indicate that the RT-LAMP is a rapid, specific, sensitive and reliable method. This method offers a new tool for the routine monitoring of HEV contamination in shellfish or its harvesting waters in field. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  9. Mamma diagnostics for MTRA (medical-radiological personnel)/RT (radiologists); Mammadiagnostik fuer MTRA/RT

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Uwe; Baum, Friedemann

    2014-07-01

    The text book on mamma diagnostics for MTRA (medical-radiological personnel)/RT (radiologists) covers the following issues: Anatomy, development and physiology of mammary glands; tumor development an breast cancer risk; pathology, non-imaging diagnostics; mammography: physical-technical fundamentals; mammography: analogue technique; mammography: digital technique; mammography: quality assurance; mammography: legal questions and radiation protection; mammography: new developments; mammography: setting technique; mammography: use and appraisal; mamma-sonography: technique and methodology; mamma-sonography: assignment and appraisal, mamma-NMR: technique and methodology; mamma-NMR: assignment and appraisal lymph node diagnostics; mamma interventions; biopsy; mamma interventions: marking examination concepts; therapeutic concepts; hygienic concepts; communication and interaction.

  10. El tiempo en Cien años de soledad

    OpenAIRE

    Valesini, María Silvina; Cortés, Karina Alejandra

    2005-01-01

    En este trabajo vamos a abordar el tema del tiempo en la obra de Gabriel García Márquez Cien años de soledad. Consideramos que, dentro de las múltiples miradas que la obra posibilita, la del tiempo es una de las más pregnantes. La referencia al tiempo es recurrente, derivándose a conceptos relacionados tales como la memoria, el olvido, la muerte. Facultad de Periodismo y Comunicación Social

  11. Sobre el supuesto carácter circular del tiempo en el eterno retorno de Nietzsche

    OpenAIRE

    Galparsoro, José Ignacio

    2012-01-01

    La noción de infinito se presenta en Nietzsche en estrecha relación con la noción de tiempo y en el contexto del intento de construir una cosmología vinculada con su hipótesis del eterno retorno. En esta cosmología no encaja una concepción circular del tiempo. Para Nietzsche el tiempo es una serie infinita de cíclicos períodos idénticos. Por ello, y pese a una muy extendida interpretación, es preciso concluir que la hipótesis nietzscheana del eterno retorno es incom...

  12. Educación para el Ocio y Tiempo Libre en personas con discapacidad visual

    OpenAIRE

    Gómez de Frutos, Noelia

    2015-01-01

    El ocio y tiempo libre, es un derecho fundamental del que nadie debe ser excluido, sea cual sea su condición física, sexual y/o mental. Sin embargo, la comunidad, aunque cada vez más se acerca a un ocio y tiempo libre inclusivo, no garantiza la plena participación de todas las personas. Las personas con discapacidad visual deben poder disfrutar de un ocio y tiempo libre adaptado a sus necesidades, pero no apartado, pues entonces no estaríamos hablando de inclusión. Grado en Educación So...

  13. Quantitative real-time imaging of glutathione

    Science.gov (United States)

    Glutathione plays many important roles in biological processes; however, the dynamic changes of glutathione concentrations in living cells remain largely unknown. Here, we report a reversible reaction-based fluorescent probe—designated as RealThiol (RT)—that can quantitatively monitor the real-time ...

  14. MRAS speed estimator with fuzzy and PI stator resistance adaptation for sensorless induction motor drives using RT-lab

    Directory of Open Access Journals (Sweden)

    S. Mohan Krishna

    2016-09-01

    Full Text Available This paper presents a real-time simulation study of Model Reference Adaptive System based rotor speed estimator with parallel stator resistance adaptation mechanism for speed sensorless induction motor drive. Both, the traditional Proportional Integral and Fuzzy logic based control mechanisms are utilised for stator resistance adaptation, while, the rotor speed is estimated parallely by means of Proportional Integral based mechanism. The estimator's response to dynamic changes in Load perturbation and doubling of the nominal value of the actual stator resistance of the motor is observed. The superiority of the fuzzy based stator resistance adaptation in the Model Reference Adaptive System estimator is proved through results validated in real-time. The purpose of employing a fairly new real-time platform is to reduce the test and prototype time. The model is initially built using Matlab/Simulink blocksets and the results are validated in real time using RT-Lab. The RT-lab blocksets are integrated into the Simulink model and then executed in real-time using the OP-4500 target developed by Opal-RT. The real-time simulation results are observed in the workstation.

  15. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  16. Las multitudes y las revoluciones de nuestro tiempo

    Directory of Open Access Journals (Sweden)

    John Harold Biervliet

    2015-08-01

    Full Text Available Este artículo examina el motivo de las multitudes y las revoluciones de nuestro tiempo. Primeramente, se discuten las diferencias entre los conceptos de multitud y masa. Así, podemos considerar las revoluciones como acontecimientos de cambios sociales, económicos y políticos, provenientes de las clases baja y media de la sociedad. El meollo de este artículo refiere a la dignidad humana articulada a la contracción de los Estados de bienestar. Los ciudadanos están reflejando un desencanto hacia la clase política y una frustración con respecto al empeoramiento de las condiciones económicas y sociales. Podemos observar los casos de indignados en Grecia, España y Portugal pero también en los países árabes. De esta misma manera, las revoluciones de las multitudes siguen avanzando por medio de las demostraciones públicas y protestas sobre los espacios geográficos. Finalmente, las dinámicas de cambio a través de las revoluciones árabes son una cuestión compleja debido al círculo vicioso entre la tendencia autoritaria y la islámica. This article examines the reason of multitudes and revolutions in our time. First of all, it discusses the difference between the concept of multitude and mass. Consequently, revolutions can be considered as social, economic, and political events of changes, which come from the low and middle classes of the society. This article refers to the human dignity articulated with the contraction of Welfare states. Citizens are reflecting disenchantment towards the political class and frustration regarding the deterioration of social and economic conditions. We can observe angry people in Greece, Spain, and Portugal but also in Arabian countries. In this same way, revolutions of multitudes continue by means of public demonstrations and protests on geographical spaces. Finally, the dynamics of change through Arabian Revolutions are a complex matter due to the vicious circle between the authoritarian or Islamic

  17. La noción del tiempo en la cultura maya prehispánica

    Directory of Open Access Journals (Sweden)

    Alexander Wolfgang Voss

    2015-07-01

    Full Text Available La concepción del tiempo de los mayas prehispánicos se estudia mediante el análisis epigráfico y filológico de textos jeroglíficos bajo los planteamientos teóricos de la escuela italiana de historia de las religiones. Los datos indican que el tiempo es animado y formado por unidades discretas tangibles que se representan con un calendario de 365 días. Las características de cada día son fijadas por un oráculo de suertes de 260 unidades que es proyectado sobre el tiempo. El tiempo y el oráculo son pensados como dioses que se alternan en un orden y no como una magnitud física abstracta.

  18. Les activités de gestion d’alerte épidémiologique : les transformations induites par l’utilisation d’un système de surveillance en temps réel Alert Management Activity: Cognitive and team activity modifications due to the use of an early warning system Las actividades de gestión de alerta epidemiológica : las transformaciones inducidas por la utilización de un sistema de vigilancia en tiempo real

    Directory of Open Access Journals (Sweden)

    Charlotte Gaudin

    2012-05-01

    dinámico puesto que las epidemias evolucionan y se propagan rápidamente si ninguna acción es emprendida para controlarlas. Más precisamente dos tipos de situaciones son analizadas : (1 la actividad tradicional de gestión de alerta y (2 esta misma actividad cuando es asistida por un sistema informático, en el caso el sistema ASTER (o Alerta y Supervisión en Tiempo Real. Luego, los resultados obtenidos son discutidos a nivel cognitivo y a nivel de las actividades colectivas consecutivamente a la introducción y a la utilización de un sistema técnico.

  19. Real Science, Real Classrooms

    Science.gov (United States)

    Parker, Becky

    2017-01-01

    The Institute for Research in Schools (IRIS) was set up to give science students the opportunity to work on cutting-edge research projects. Teachers and students can access data and equipment that enable them to tackle real-life issues. As a result, not only do students gain in confidence and experience in their scientific work, they are also able…

  20. Tiempo máximo aceptable de trabajo para tareas ejecutadas con miembros superiores e inferiores

    Directory of Open Access Journals (Sweden)

    Juan C. Velásquez V.

    2015-12-01

    Full Text Available Introducción: La carga física de trabajo es uno de los principales factores de riesgo a los que se enfrentan los trabajadores. En la actualidad los métodos propuestos para evaluar la carga física dinámica contemplan el trabajo con todo el cuerpo y no discriminan por segmentos corporales. Objetivo: Determinar el tiempo máximo aceptable de trabajo cuando el trabajo se ejecuta con todo el cuerpo, con los miembros superiores o los miembros inferiores. Métodos: Se realizó medición de consumo de oxígeno mediante ergoespirometria y monitorización de la frecuencia cardiaca en 30 trabajadores expuestos a diversas cargas ejecutadas con todo el cuerpo, miembros inferiores y miembros superiores. Se determinó el umbral anaeróbico por coeficiente respiratorio, el cual sirvió de base para de determinación del tiempo máximo aceptable de trabajo. Resultados: Los tiempos máximos aceptables de trabajo fueron similares para tareas con todo el cuerpo y con miembros inferiores, pero significativamente menores para tareas realizadas con miembros superiores. Se halló un modelo de correlación exponencial negativo entre en tiempo de trabajo, el consumo de oxígeno, y la frecuencia cardiaca, R > 0,9 en todos los casos. Se plantearon 9 ecuaciones de regresión para determinar el tiempo máximo aceptable de trabajo. Conclusiones: El tiempo máximo aceptable de trabajo para miembros inferiores y para todo el cuerpo se comportan de manera similar. El tiempo máximo aceptables de trabajo con miembros superiores es significativamente inferior a los anteriores. La frecuencia cardiaca relativa parece ser el mejor indicador para medir el tiempo máximo aceptables de trabajo en campo.

  1. Performance Evaluation of Real-Time Precise Point Positioning Method

    Science.gov (United States)

    Alcay, Salih; Turgut, Muzeyyen

    2017-12-01

    Post-Processed Precise Point Positioning (PPP) is a well-known zero-difference positioning method which provides accurate and precise results. After the experimental tests, IGS Real Time Service (RTS) officially provided real time orbit and clock products for the GNSS community that allows real-time (RT) PPP applications. Different software packages can be used for RT-PPP. In this study, in order to evaluate the performance of RT-PPP, 3 IGS stations are used. Results, obtained by using BKG Ntrip Client (BNC) Software v2.12, are examined in terms of both accuracy and precision.

  2. Rapid group-, serotype-, and vaccine strain-specific identification of poliovirus isolates by real-time reverse transcription-PCR using degenerate primers and probes containing deoxyinosine residues.

    Science.gov (United States)

    Kilpatrick, David R; Yang, Chen-Fu; Ching, Karen; Vincent, Annelet; Iber, Jane; Campagnoli, Ray; Mandelbaum, Mark; De, Lina; Yang, Su-Ju; Nix, Allan; Kew, Olen M

    2009-06-01

    We have adapted our previously described poliovirus diagnostic reverse transcription-PCR (RT-PCR) assays to a real-time RT-PCR (rRT-PCR) format. Our highly specific assays and rRT-PCR reagents are designed for use in the WHO Global Polio Laboratory Network for rapid and large-scale identification of poliovirus field isolates.

  3. NASA SPoRT Modeling and Data Assimilation Research and Transition Activities Using WRF, LIS and GSI

    Science.gov (United States)

    Case, Jonathan L.; Blankenship, Clay B.; Zavodsky, Bradley T.; Srikishen, Jayanthi; Berndt, Emily B.

    2014-01-01

    weather research and forecasting ===== The NASA Short-term Prediction Research and Transition (SPoRT) program has numerous modeling and data assimilation (DA) activities in which the WRF model is a key component. SPoRT generates realtime, research satellite products from the MODIS and VIIRS instruments, making the data available to NOAA/NWS partners running the WRF/EMS, including: (1) 2-km northwestern-hemispheric SST composite, (2) daily, MODIS green vegetation fraction (GVF) over CONUS, and (3) NASA Land Information System (LIS) runs of the Noah LSM over the southeastern CONUS. Each of these datasets have been utilized by specific SPoRT partners in local EMS model runs, with select offices evaluating the impacts using a set of automated scripts developed by SPoRT that manage data acquisition and run the NCAR Model Evaluation Tools verification package. SPoRT is engaged in DA research with the Gridpoint Statistical Interpolation (GSI) and Ensemble Kalman Filter in LIS for soil moisture DA. Ongoing DA projects using GSI include comparing the impacts of assimilating Atmospheric Infrared Sounder (AIRS) radiances versus retrieved profiles, and an analysis of extra-tropical cyclones with intense non-convective winds. As part of its Early Adopter activities for the NASA Soil Moisture Active Passive (SMAP) mission, SPoRT is conducting bias correction and soil moisture DA within LIS to improve simulations using the NASA Unified-WRF (NU-WRF) for both the European Space Agency's Soil Moisture Ocean Salinity and upcoming SMAP mission data. SPoRT has also incorporated real-time global GVF data into LIS and WRF from the VIIRS product being developed by NOAA/NESDIS. This poster will highlight the research and transition activities SPoRT conducts using WRF, NU-WRF, EMS, LIS, and GSI.

  4. Modelado sólido y análisis por elementos finitos de un cilindro de motor endotérmico de 2 tiempos de altas prestaciones

    OpenAIRE

    Pérez Ferreirós, Oscar

    2005-01-01

    El proyecto pretende explicar el proceso de evolución de un cilindro monobloque de motor endotérmico, 2 tiempos de altas prestaciones. El proceso real de evolución del motor consta de los siguientes pasos: - Modelado en 3D del cilindro, de una forma sencilla para que sea fácilmente modificable (modelado con Pro-Engineer WildFire). - Hipótesis de cálculo para realizar un cálculo de esfuerzos sobre los pernos que fijan el culatín y la culata del cilindro (Se proponen 2 estudio...

  5. Schedulability Analysis for Rate Monotonic Algorithm-Shortest Job First Using UML-RT

    Directory of Open Access Journals (Sweden)

    S. Ewins Pon Pushpa

    2014-01-01

    Full Text Available System modelling with a unified modelling language (UML is an active research area for developing real-time system development. UML is widely used modelling language in software engineering community, to specify the requirement, and analyse the target system successfully. UML can be used to provide multiple views of the system under design with the help of a variety of structural and behavioural diagrams at an early stage. UML-RT (unified modelling language-real time is a language used to build an unambiguous executable specification of a real-time system based on UML concepts. This paper presents a unified modeling approach for a newly proposed rate monotonic scheduling algorithm-shortest job first (RMA-SJF for partitioned, semipartitioned and global scheduling strategies in multiprocessor architecture using UML-RT for different system loads. As a technical contribution, effective processor utilization of individual processors and success ratio are analyzed for various scheduling principles and compared with EDF and D_EDF to validate our proposal.

  6. Projected Applications of a "Weather in a Box" Computing System at the NASA Short-Term Prediction Research and Transition (SPoRT) Center

    Science.gov (United States)

    Jedlovec, Gary J.; Molthan, Andrew; Zavodsky, Bradley T.; Case, Jonathan L.; LaFontaine, Frank J.; Srikishen, Jayanthi

    2010-01-01

    The NASA Short-term Prediction Research and Transition Center (SPoRT)'s new "Weather in a Box" resources will provide weather research and forecast modeling capabilities for real-time application. Model output will provide additional forecast guidance and research into the impacts of new NASA satellite data sets and software capabilities. By combining several research tools and satellite products, SPoRT can generate model guidance that is strongly influenced by unique NASA contributions.

  7. rt, Arvo: "Beatus". Statuit ei Dominus / Patric Wiklacz

    Index Scriptorium Estoniae

    Wiklacz, Patric

    1997-01-01

    Uuest heliplaadist "Pärt, Arvo: "Beatus". Statuit ei Dominus. Missa syllabica. Beatus Petronius. 7 Magnificat-Antiphonen. De profundis. Memento. Cantate Domino. Solfeggio. Estonian Philharmonic Chamber Choir, T. Kaljuste". Virgin Classics 545 276-2 (CD:167F)

  8. rt, Arvo: "Miserere", "Festina lente" / Volkmar Fischer

    Index Scriptorium Estoniae

    Fischer, Volkmar

    1991-01-01

    Uuest heliplaadist Pärt, Arvo: "Miserere", "Festina lente", "Sarah Was Ninety Years Old". The Hilliard Ensemble. Orchester der Beethovenhalle Bonn. Dirigent Dennis Russel Davies (ECM Records, distr Amigo)

  9. rt, Arvo. Litany; Psalom; Trisagion / Andreas Obst

    Index Scriptorium Estoniae

    Obst, Andreas

    1996-01-01

    rt, Arvo. Litany; Psalom; Trisagion. Hilliard Ensemble, Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra, Tõnu Kaljuste; Lithuanian Chamber Orchestra, Saulius Sondeckis. ECM 1592/449 810-2

  10. rt, Arvo: Litany. Psalom. Trisagion / Robert Cowan

    Index Scriptorium Estoniae

    Cowan, Robert

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: Litany. Psalom. Trisagion. Hilliard Ensemble, Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra, Tõnu Kaljuste; Lithuanian Chamber Orchestra, Saulius Sondeckis" ECM New Series 449 810-4; 449 810-2 (42 minutes: DDD)

  11. rt, Arvo: Seven Magnificat Antiphons / Barry Witherden

    Index Scriptorium Estoniae

    Witherden, Barry

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: Seven Magnificat Antiphons. Magnificat. Summa; Tormis, Veljo: The Curse Upon Iron. Karelian Destiny. BBC Singers, Bo Holton". Collins Classics 1472-2 (61 minutes: DDD)

  12. Milan Kundera poeediparukaga faun / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    1996-01-01

    Arvustus: Kundera, Milan. Surematus. Tln. : Monokkel, 1995. Ilmunud ka kogumikus: Hellerma, Kärt. Kohanenud kirjandus : valik kirjanduskriitikat 1987-2006. Eesti Keele Sihtasutus : Tallinn, 2006. Lk. 176-179

  13. Kuidas sünnib pealkiri? / Pärt Lias

    Index Scriptorium Estoniae

    Lias, Pärt

    2003-01-01

    Eesti kirjanikud vastavad Pärt Liase küsimusele oma teoste pealkirjade saamisloo kohta: Doris Kareva, Ilona Laaman, Eha Lättemäe, Priidu Beier, Oskar Kruus, Jaan Kruusvall, Paul-Eerik Rummo ja Andres Vanapa (1); Triin Soomets, Priit Aimla, Aarne Puu, Einar Sander, Jüri Tuulik ja Ülo Tuulik (2); Nikolai Baturin, Leo Metsar, Toomas Vint, Leonid Stolovitš ja Pärt Lias (3)

  14. SPoRT: Transitioning NASA and NOAA Experimental Data to the Operational Weather Community

    Science.gov (United States)

    Jedlovec, Gary J.

    2013-01-01

    Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the NASA Short-term Prediction Research and Transition (SPoRT) program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral data from EOS satellites to improve short-term weather forecasts on a regional and local scale. With the ever-broadening application of real-time high resolution satellite data from current EOS, Suomi NPP, and planned JPSS and GOES-R sensors to weather forecast problems, significant challenges arise in the acquisition, delivery, and integration of the new capabilities into the decision making process of the operational weather community. For polar orbiting sensors such as MODIS, AIRS, VIIRS, and CRiS, the use of direct broadcast ground stations is key to the real-time delivery of the data and derived products in a timely fashion. With the ABI on the geostationary GOES-R satellite, the data volumes will likely increase by a factor of 5-10 from current data streams. However, the high data volume and limited bandwidth of end user facilities presents a formidable obstacle to timely access to the data. This challenge can be addressed through the use of subsetting techniques, innovative web services, and the judicious selection of data formats. Many of these approaches have been implemented by SPoRT for the delivery of real-time products to NWS forecast offices and other weather entities. Once available in decision support systems like AWIPS II, these new data and products must be integrated into existing and new displays that allow for the integration of the data with existing operational products in these systems. SPoRT is leading the way in demonstrating this enhanced capability. This paper will highlight the ways SPoRT is overcoming many of the challenges presented by the enormous data

  15. Challenges in Transitioning Research Data to Operations: The SPoRT Paradigm

    Science.gov (United States)

    Jedloved, Gary J.; Smith, Matt; McGrath, Kevin

    2010-01-01

    Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the NASA Short-term Prediction Research and Transition (SPoRT) program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral data from EOS satellites to improve short-term weather forecasts on a regional and local scale. With the ever-broadening application of real-time high resolution satellite data from current EOS and planned NPP, JPSS, and GOES-R sensors to weather forecast problems, significant challenges arise in the acquisition, delivery, and integration of the new capabilities into the decision making process of the operational weather community. For polar orbiting sensors such as MODIS, AIRS, VIIRS, and CRiS, the use of direct broadcast ground stations is key to the real-time delivery of the data and derived products in a timely fashion. With the ABI on the geostationary GOES-R satellite, the data volume will likely increase by a factor of 5- 10 from current data streams. However, the high data volume and limited bandwidth of end user facilities presents a formidable obstacle to timely access to the data. This challenge can be addressed through the use of subsetting techniques, innovative web services, and the judicious selection of data formats. Many of these approaches have been implemented by SPoRT for the delivery of real-time products to NWS forecast offices and other weather entities. Once available in decision support systems like AWIPS II, these new data and products must be integrated into existing and new displays that allow for the integration of the data with existing operational products in these systems. SPoRT is leading the way in demonstrating this enhanced capability. This paper will highlight the ways SPoRT is overcoming many of the challenges presented by the enormous data volumes of

  16. Understanding watershed hydrogeochemistry: 1. Development of RT-Flux-PIHM

    Science.gov (United States)

    Bao, Chen; Li, Li; Shi, Yuning; Duffy, Christopher

    2017-03-01

    Model development in hydrology and geochemistry has been advancing separately with limited integration. We developed a watershed hydrogeochemical code RT-Flux-PIHM to understand complex interactions between hydrological processes (PIHM), land-surface processes (FLUX—Noah Land Surface Model), and multicomponent subsurface reactive transport (RT). The RT module simulates geochemical processes including aqueous complexation, surface complexation, mineral dissolution and precipitation, and cation exchange. The RT module is verified against the widely used reactive transport code CrunchFlow. The code uses semidiscrete finite volume method and irregular gridding and offers data harvesting capabilities from national databases. The application of RT-Flux-PIHM is demonstrated in the Susquehanna Shale Hills Critical Zone Observatory (SSHCZO). We aim to understand key processes that govern hydrogeochemical dynamics of the nonreactive chloride and reactive magnesium. Simulation results indicate that watershed characteristics, in particular topography, dictate the spatial distributions of water content and soil dissolution rates. Ion exchange provides buffering capacities and leads to a hysteresis loop of concentration and discharge relationship of magnesium, which differs from the open hysteresis of chloride. RT-Flux-PIHM offers physics-based modeling capabilities to integrate the vast amount of water and chemistry data that have now become available, to differentiate the relative importance of competing processes, and to test hypotheses at the interface of hydrology and geochemistry.

  17. Hyperthermic Fibrinolysis with rt-PA: In Vitro Results

    International Nuclear Information System (INIS)

    Schwarzenberg, Helmut; Mueller-Huelsbeck, Stefan; Brossman, Joachim; Christian Glueer, Claus; Bruhn, Hans Dieter; Heller, Martin

    1998-01-01

    Purpose: To investigate the influence of hyperthermia up to 45 deg. C on fibrinolysis with recombinant tissue-type plasminogen activator (rt-PA). Methods: Standardized fibrin clots were incubated in a water bath for 5 hr with either rt-PA (test group) or 0.9% sodium chloride (control group) and blood plasma at temperatures of 30-45 deg. C. Concentrations of D-dimer and time to complete clot lysis were measured.Results: The activity of fibrinolysis with rt-PA rose with increasing temperature: time to lysis approximately halved from 30 deg. C to 40 deg. C and the concentration of D-dimer tripled. In the control group clot size did not change.Conclusions: Activity of rt-PA-induced fibrinolysis rises distinctly with higher temperatures. Since even healthy subjects show a physiologic decline in body temperature in the extremities, in patients with occlusive arterial disease decreased activity of fibrinolysis with rt-PA can be expected. Controlled hyperthermia may improve fibrinolysis with rt-PA and should be investigated in vivo

  18. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  19. El tiempo, el otro y la muerte a través de Emmanuel Levinas

    Directory of Open Access Journals (Sweden)

    Fredy Parra

    2009-01-01

    Full Text Available El artículo indaga la peculiar visión del filósofo Emmanuel Levinas en torno al tiempo en su articulación con la muerte y el otro(s. Muestra el empeño levinasiano por desformalizar la noción del tiempo analizando las relaciones que el autor establece entre el tiempo y el otro, entre el tiempo y la muerte, entre pasividad-paciencia y responsabilidad, entre pasado inmemorial, presente y futuro. Finalmente, el estudio se concentra en la confrontación crítica entre Levinas y Heidegger a propósito de la muerte y el tiempo. Concluye que es posible superar el planteo heideggeriano concibiendo la muerte a partir del tiempo y no solo el tiempo a partir de la muerte. Para Levinas, ser temporal implica tener todavía tiempo, poder aplazar la muerte o enfrentarla libremente en el presente del amor-misericordia, en la responsabilidad frente al otro y dando sentido al tiempo procurando un mundo más auténticamente humano.The articl investigates peculiar visión of the philosopher Emmanuel Levinas regarding time in its articulation with death and the other (s. It shows the levinasiano commitment by deformalizing the notion of the time, analyzing the relationships that the author establishes between time and the other, time and death, between passiveness-patience and responsibility, between immemorial past, present and future. Finally, the study focuses on the critical confrontation between Levinas and Heidegger with regard to death and time. He concludes that ¡t is possible to move beyond the Heideggerian position, understanding death from the perspective of the time, and not only time from death. For Levinas, to be temporal means still have time, to defer death or to face it freely in the present of love-mercy, in the responsibility of one to another, and giving sense to time by seeking a more truly human world.

  20. Get real!

    DEFF Research Database (Denmark)

    Hyldgaard, Kirsten

    2017-01-01

    of the Lacanian concepts of the Symbolic, the Imaginary, and the Real. Particularly the concept of the Real is central. The Real has to be distinguished from any concept of reality. The concept of the Real refers to a pure negativity: to what cannot be represented; to what breaks down the safe opposition between...

  1. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  2. Development of an improved RT-LAMP assay for detection of currently circulating rubella viruses.

    Science.gov (United States)

    Abo, H; Okamoto, K; Anraku, M; Otsuki, N; Sakata, M; Icenogle, J; Zheng, Q; Kurata, T; Kase, T; Komase, K; Takeda, M; Mori, Y

    2014-10-01

    Rubella virus is the causative agent of rubella. The symptoms are usually mild, and characterized by a maculopapular rash and fever. However, rubella infection in pregnant women sometimes can result in the birth of infants with congenital rubella syndrome (CRS). Global efforts have been made to reduce and eliminate CRS. Although a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for detection of rubella virus has been reported, the primers contained several mismatched nucleotides with the genomes of currently circulating rubella virus strains. In the present study, a new RT-LAMP assay was established. The detection limit of this assay was 100-1000PFU/reaction of viruses for all rubella genotypes, except for genotype 2C, which is not commonly found in the current era. Therefore, the new RT-LAMP assay can successfully detect all current rubella virus genotypes, and does not require sophisticated devices like TaqMan real-time PCR systems. This assay should be a useful assay for laboratory diagnosis of rubella and CRS. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Filipe Pinto

    Full Text Available Cyanobacteria are a group of photosynthetic prokaryotes that have a diverse morphology, minimal nutritional requirements and metabolic plasticity that has made them attractive organisms to use in biotechnological applications. The use of these organisms as cell factories requires the knowledge of their physiology and metabolism at a systems level. For the quantification of gene transcripts real-time quantitative polymerase chain reaction (RT-qPCR is the standard technique. However, to obtain reliable RT-qPCR results the use and validation of reference genes is mandatory. Towards this goal we have selected and analyzed twelve candidate reference genes from three morphologically distinct cyanobacteria grown under routinely used laboratory conditions. The six genes exhibiting less variation in each organism were evaluated in terms of their expression stability using geNorm, NormFinder and BestKeeper. In addition, the minimum number of reference genes required for normalization was determined. Based on the three algorithms, we provide a list of genes for cyanobacterial RT-qPCR data normalization. To our knowledge, this is the first work on the validation of reference genes for cyanobacteria constituting a valuable starting point for future works.

  4. NASA SPoRT GOES-R Proving Ground Activities

    Science.gov (United States)

    Stano, Geoffrey T.; Fuell, Kevin K.; Jedloec, Gary J.

    2010-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) program is a partner with the GOES-R Proving Ground (PG) helping prepare forecasters understand the unique products to come from the GOES-R instrument suite. SPoRT is working collaboratively with other members of the GOES-R PG team and Algorithm Working Group (AWG) scientists to develop and disseminate a suite of proxy products that address specific forecast problems for the WFOs, Regional and National Support Centers, and other NOAA users. These products draw on SPoRT s expertise with the transition and evaluation of products into operations from the MODIS instrument and the North Alabama Lightning Mapping Array (NALMA). The MODIS instrument serves as an excellent proxy for the Advanced Baseline Imager (ABI) that will be aboard GOES-R. SPoRT has transitioned and evaluated several multi-channel MODIS products. The true and false color products are being used in natural hazard detection by several SPoRT partners to provide better observation of land features, such as fires, smoke plumes, and snow cover. Additionally, many of SPoRT s partners are coastal offices and already benefit from the MODIS sea surface temperature composite. This, along with other surface feature observations will be developed into ABI proxy products for diagnostic use in the forecast process as well as assimilation into forecast models. In addition to the MODIS instrument, the NALMA has proven very valuable to WFOs with access to these total lightning data. These data provide situational awareness and enhanced warning decision making to improve lead times for severe thunderstorm and tornado warnings. One effort by SPoRT scientists includes a lightning threat product to create short-term model forecasts of lightning activity. Additionally, SPoRT is working with the AWG to create GLM proxy data from several of the ground based total lightning networks, such as the NALMA. The evaluation will focus on the vastly improved spatial

  5. SPoRT's Participation in the GOES-R Proving Ground Activity

    Science.gov (United States)

    Jedlovec, Gary; Fuell, Kevin; Smith, Matthew; Stano, Geoffrey; Molthan, Andrew

    2011-01-01

    The next generation geostationary satellite, GOES-R, will carry two new instruments with unique atmospheric and surface observing capabilities, the Advanced Baseline Imager (ABI) and the Geostationary Lightning Mapper (GLM), to study short-term weather processes. The ABI will bring enhanced multispectral observing capabilities with frequent refresh rates for regional and full disk coverage to geostationary orbit to address many existing and new forecast challenges. The GLM will, for the first time, provide the continuous monitoring of total lightning flashes over a hemispherical region from space. NOAA established the GOES-R Proving Ground activity several years ago to demonstrate the new capabilities of these instruments and to prepare forecasters for their day one use. Proving Ground partners work closely with algorithm developers and the end user community to develop and transition proxy data sets representing GOES-R observing capabilities. This close collaboration helps to maximize refine algorithms leading to the delivery of a product that effectively address a forecast challenge. The NASA Short-term Prediction Research and Transition (SPoRT) program has been a participant in the NOAA GOES-R Proving Ground activity by developing and disseminating selected GOES-R proxy products to collaborating WFOs and National Centers. Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the SPoRT program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral data from EOS satellites to improve short-term weather forecasts on a regional and local scale. Participation in the Proving Ground activities extends SPoRT s activities and taps its experience and expertise in diagnostic weather analysis, short-term weather forecasting, and the transition of research and experimental

  6. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  7. Diferencias, en el uso del tiempo, entre varones y mujeres y otros grupos sociales

    Directory of Open Access Journals (Sweden)

    MARIANO ÁLVARO PAGE

    1996-01-01

    Full Text Available En este artículo se presentan los resultados encontrados al estudiar como usa su tiempo la población española de 18 y más años. Las actividades de "usos del tiempo" se han clasificado en cinco diferentes grupos o áreas conductuales: necesidades personales, trabajo doméstico, educación, trabajo remunerado y tiempo libre. se comparan los resultados obtenidos por mujeres y varones, así como por otros grupos, confeccionados con las siguientes variables sociodemográficas: hábitat, edad, estudios terminados, ingresos mensuales recibidos en el hogar, número de personas que conviven juntas en el mismo hogar, estado civil y días de la semana. todos estos resultados se comparan de manera sistematica con los de estudios parecidos realizados con anterioridad.

  8. El juego como resistencia: El juego frente al tiempo de la alienación

    Directory of Open Access Journals (Sweden)

    John Jairo Uribe Sarmiento

    2011-09-01

    Full Text Available El artículo aborda algunos usos y conceptos del tiempo de los sujetos sociales en el capitalismo contemporáneo. Primero analiza la relación entre el mundo del trabajo y la mercantilización del tiempo. Luego describe la “precariedad del tiempo” en términos del trabajo inmaterial, de la exacerbación del individualismo y del miedo como elementos articuladores de las experiencias vitales de los sujetos. Finalmente desarrolla una propuesta de juego como estrategia educativa para abordar dicha precariedad. Esta gira en torno al potencial de resistencia que tiene el juego, frente al empobrecimiento de la vida que ocurre en los actuales procesos de uso y concepciones del tiempo.

  9. La exclusión métodica del tiempo en metafísica

    OpenAIRE

    Haya, F. (Fernando)

    2010-01-01

    El límite mental es descrito como la plenitud formal del tiempo en atención a su carácter de condición antecedente en relación con la esencia inteligible. El conocimiento metafísico incluye una exclusión metódica que confina el tiempo en la posición de tema en orden a su abandono. El abandono de la plenitud formal del tiempo advierte el ser. Como condición antecedente del objeto pensado, el límite queda atrás de la acción práctica y es en ella traspasado.

  10. Autobiografía intelectual de Manuel Martín Serrano. Los tiempos que han traído nuestro tiempo

    Directory of Open Access Journals (Sweden)

    Revista Chasqui

    2011-09-01

    Full Text Available Esta autobiografía esclarece el sentido que tiene la creación científica en la vida de Manuel MARTÍN SERRANO y al hacerlo, revela cómo estamos concernidos por la aventura del conocimiento, las gentes que ahora compartimos y antes compartieron con él, la misma época existencial. MMS sugiere que nuestro tiempo se ha conformado por el transcurso de dos épocas diferentes: En España la primera de ellas abarca la dictadura franquista y la transición democrática, que concluyó hacia 1982. Es "Del tiempo del silencio al de la esperanza" Le sigue la segunda época, en la que estamos desde entonces: "Del tiempo de la esperanza al de la humanización" Es nuestro presente y previsiblemente se prolongará durante generaciones. Dice el Autor que son dos periodos indisociables; y que sin embargo el tránsito de uno al otro ha supuesto una rotura histórica.

  11. NASA SPoRT Initialization Datasets for Local Model Runs in the Environmental Modeling System

    Science.gov (United States)

    Case, Jonathan L.; LaFontaine, Frank J.; Molthan, Andrew L.; Carcione, Brian; Wood, Lance; Maloney, Joseph; Estupinan, Jeral; Medlin, Jeffrey M.; Blottman, Peter; Rozumalski, Robert A.

    2011-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed several products for its National Weather Service (NWS) partners that can be used to initialize local model runs within the Weather Research and Forecasting (WRF) Environmental Modeling System (EMS). These real-time datasets consist of surface-based information updated at least once per day, and produced in a composite or gridded product that is easily incorporated into the WRF EMS. The primary goal for making these NASA datasets available to the WRF EMS community is to provide timely and high-quality information at a spatial resolution comparable to that used in the local model configurations (i.e., convection-allowing scales). The current suite of SPoRT products supported in the WRF EMS include a Sea Surface Temperature (SST) composite, a Great Lakes sea-ice extent, a Greenness Vegetation Fraction (GVF) composite, and Land Information System (LIS) gridded output. The SPoRT SST composite is a blend of primarily the Moderate Resolution Imaging Spectroradiometer (MODIS) infrared and Advanced Microwave Scanning Radiometer for Earth Observing System data for non-precipitation coverage over the oceans at 2-km resolution. The composite includes a special lake surface temperature analysis over the Great Lakes using contributions from the Remote Sensing Systems temperature data. The Great Lakes Environmental Research Laboratory Ice Percentage product is used to create a sea-ice mask in the SPoRT SST composite. The sea-ice mask is produced daily (in-season) at 1.8-km resolution and identifies ice percentage from 0 100% in 10% increments, with values above 90% flagged as ice.

  12. El conde de Valdeparaíso y su tiempo

    Directory of Open Access Journals (Sweden)

    Francisco Asensio Rubio

    1995-01-01

    Full Text Available La muerte en 1700 de Carlos II sin descendencia abrió para España y especialmente para el resto de Europa, una etapa de intrigas que condujo a nuestro país a una guerra civil, ya que las cortes europeas se movilizaron para situar a sus candidatos a la vacante corona española. La guerra tardó en iniciarse en suelo español pues hasta el año 1705 no se generalizó en nuestro territorio, especialmente cuando los catalanes, aragoneses y valencianos tomaron partido por el candidato austríaco, el archiduque Carlos, y el resto del país, especialmente Castilla, quedó al lado del candidato francés Felipe de Anjou, nieto de Luis XIV de Francia. En 1706 se conjuraron en Ciudad Real en favor del candidato austríaco cuatro caballeros, tres de los cuales fueron ejecutados y el otro se salvó gracias a que era caballero de hábito.

  13. Tiempo libre y espacio público: Marcas de una civilización

    Directory of Open Access Journals (Sweden)

    Alejandra Lema

    2011-11-01

    Full Text Available El presente artículo procede de la investigación titulada "Tiempo libre, espacio público e identidad. Análisis del caso Parque Plaza Líber Seregni". El mismo pretende problematizar las nociones de tiempo libre y espacio público, y su papel en los procesos civilizatorios de Uruguay moderno, para pensar las configuraciones que adquieren tales conceptos en la actualidad. Para tal cometido, se realizarán aproximaciones teóricas desde la perspectiva de Milner, así como desde el abordaje histórico que propone Barrán. Uruguay, entre fines del siglo XIX y principios del XX, experimenta una serie de transformaciones políticas, económicas, sociales y culturales propiasde la "modernización". Un proyecto civilizador reorganizaría la vida social de la población, en relación a un territorio y una producción. La aprobación de la ley de las 8 horas, como señal de establecimiento de la frontera entre un tiempo de trabajo y un tiempo libre; así como la invención y fomento de los espacios públicos, dan lugar a las dicotomías tiempo de trabajo-tiempo libre y espacio público-espacio privado. Cabe preguntarse, ¿qué configuraciones adquieren estos binomios en la actualidad? ¿Bajo qué supuestos se asienta la popularización de estos términos?

  14. Priority-Based Resource Allocation for Downlink OFDMA Systems Supporting RT and NRT Traffics

    DEFF Research Database (Denmark)

    Wang, Hua; Dittmann, Lars

    2008-01-01

    Efficient radio resource management is essential in Quality-of-Service (QoS) provisioning for wireless communication networks. In this paper, we propose a novel priority-based packet scheduling algorithm for downlink OFDMA systems. The proposed algorithm is designed to support heterogeneous...... applications consisting of both real-time (RT) and non-real-time (NRT) traffics with the objective to increase the spectrum efficiency while satisfying diverse QoS requirements. It tightly couples the subchannel allocation and packet scheduling together through an integrated cross-layer approach in which each...... show that the proposed algorithm can significantly improve the system performance in terms of high spectral efficiency and low outage probability compared to conventional packet scheduling algorithms, thus is very suitable for the downlink of current OFDMA systems....

  15. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  16. Real Time Physiological Status Monitoring (RT-PSM): Accomplishments, Requirements, and Research Roadmap

    Science.gov (United States)

    2016-03-01

    Monitor RQ Respiratory Quotient SAN Squad Area Network Communications SBIR Small Business Innovative Research Program SECARMY Secretary of the...monitors both the energy expenditure and carbohydrate and fat utilization as metabolic fuel. This wearable device measures respiratory quotient (RQ) or...chemicals, heat, dehydration, battle stress response, and fatigue  Artificial Intelligence (AI) system to assess Warfighter performance

  17. QBeRT: an innovative instrument for qualification of particle beam in real-time

    Science.gov (United States)

    Gallo, G.; Lo Presti, D.; Bonanno, D. L.; Longhitano, F.; Bongiovanni, D. G.; Reito, S.; Randazzo, N.; Leonora, E.; Sipala, V.; Tommasino, F.

    2016-11-01

    This paper describes an innovative beam diagnostic and monitoring system composed of a position sensitive detector and a residual range detector, based on scintillating optical fiber and on an innovative read-out strategy and reconstruction algorithm. The position sensitive detector consists of four layers of pre-aligned and juxtaposed scintillating fibres arranged to form two identical overlying and orthogonal planes. The 500 μm square section fibres are optically coupled to two Silicon Photomultiplier arrays using a channel reduction system patented by the Istituto Nazionale di Fisica Nucleare. The residual range detector is a stack of sixty parallel layers of the same fibres used in the position detector, each of which is optically coupled to a channel of Silicon Photomultiplier array by wavelength shifting fibres. The sensitive area of the two detectors is 9 × 9 cm2. After being fully characterized at CATANA proton therapy facility, the performance of the prototypes was tested during last year also at TIFPA proton irradiation facility. The unique feature of these detectors is the possibility to work in imaging conditions (e.g. a particle at a time up to 106 particles per second) and in therapy conditions up to 109 particles per second. The combined use of the two detectors, in imaging conditions, as an example of application, allows the particle radiography of an object. In therapy conditions, in particular, the system measures the position, the profiles, the energy and the fluence of the beam.

  18. Comparing influenza positivity rates by Real-Time RT-PCR, Elisa ...

    African Journals Online (AJOL)

    Detection of circulating influenza strains is a key public health concern especially in limited-resource settings where diagnosis capabilities remain a challenge. As part of multi-site surveillance in Côte d'Ivoire during the 2009 influenza A(H1N1) pandemic, we had the opportunity to test respiratory specimens collected from ...

  19. Tiempo libre y espacio público: Marcas de una civilización

    OpenAIRE

    Alejandra Lema; Verónica Ruiz; Inés Scarlato

    2011-01-01

    El presente artículo procede de la investigación titulada "Tiempo libre, espacio público e identidad. Análisis del caso Parque Plaza Líber Seregni". El mismo pretende problematizar las nociones de tiempo libre y espacio público, y su papel en los procesos civilizatorios de Uruguay moderno, para pensar las configuraciones que adquieren tales conceptos en la actualidad. Para tal cometido, se realizarán aproximaciones teóricas desde la perspectiva de Milner, así como desde el abordaje histórico ...

  20. Política y tiempo: pensar la conmemoración

    OpenAIRE

    Rabotnikof, Nora

    2009-01-01

    Las conmemoraciones parecen movilizar nuevas posibilidades para pensar la relación entre política y tiempo o, más acotadamente, entre política y pasado. ¿Qué significa conmemorar un pasado político, aparentemente sancionado por el tiempo (como es el caso de la Independencia y de la Revolución Mexicana), desde un presente políticamente controvertido? ¿Cómo se recupera, se recuerda, se construye o se inventa (y la elección del verbo no es banal) el pasado para celebrar o denostar el presente? ¿...

  1. Una propuesta para el aprendizaje de ELE: tiempo libre e interculturalidad

    Directory of Open Access Journals (Sweden)

    Concepción Francos Maldonado

    2012-08-01

    Full Text Available En la propuesta que aquí describimos nos centramos en el tiempo de ocio comoelemento esencial de socialización y desarrollo personal, y pretendemos que elalumnado participe en las actividades de ocio de la ciudad, a través de las que, ademásde favorecer la igualdad de oportunidades, la autonomía y las potencialidadesindividuales, se aprende la lengua y se trabaja la interculturalidad conociendo formas deuso del tiempo libre en la sociedad en la que estamos, informándonos de aspectoslúdicos de diferentes culturas, y también de algunos aspectos curriculares.

  2. EL SECUESTRO DE LAS HISTORIAS INDÍGENAS: ITENERARIO Y LIMITACIONES DEL TIEMPO LINEAL EN CHILE

    OpenAIRE

    MAXIMILIANO SALINAS CAMPOS

    2015-01-01

    La historia de Chile está cruzada por el conflicto entre la cultura moderna europea y las culturas indígenas. El tiempo lineal impuesto por el Estado nacional ha dejado al descubierto su irresponsabilidad con el tiempo indígena de los Andes. Esta temporalidad expresa una profunda y sustentable «ontología arcaica». Tras el fin de la Guerra Fría, y la postdictadura de Pinochet, esta propuesta se vuelve acuciante con las demandas políticas y los desafíos epistémicos indígenas del siglo XXI. En...

  3. SUBDIVISIÓN DEL TIEMPO GEOLÓGICO EN LA AMAZONÍA PERUANA

    Directory of Open Access Journals (Sweden)

    Fredy Hugo Guerra-Turín

    2011-07-01

    Full Text Available Mucho antes que el ser humano recorriera las tierras de nuestra cuenca,  sabana de la selva amazónica, existieron mares, grandes ríos, montañas y llanuras en lo que ahora es nuestro hábitat. En este breve texto se plantea un viaje por los paisajes creados que debieron existir a lo largo de los diferentes tiempos geológicos y lograr proponer la subdivisión del tiempo geológico en la Amazonía peruana, base para determinar la herencia de una gran biodiversidad; más grande en el mundo.

  4. Vectores de Killing y cantidades conservadas para espacio-tiempos cuasi-esféricos

    Directory of Open Access Journals (Sweden)

    J. Carot

    2007-01-01

    Full Text Available En este trabajo se estudian los espacio-tiempos con deformación de tipo B, con simetría axial y cuasi-esféricos. Se obtiene un elemento de linea tal que admite vectores de Killing de la familia 1 propuesta por J. Flores et. al. [1]. Se encuentran las cantidades conservadas asociadas a estos vectores de Killing y por tanto una primera integral de las ecuaciones de las geodésicas que describen una partícula libre inmersa en este tipo espacio- tiempo.

  5. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  6. Screening inhibitory potential of anti-HIV RT RNA aptamers.

    Science.gov (United States)

    Lange, Margaret J; Burke, Donald H

    2014-01-01

    Aptamers targeted to HIV reverse transcriptase (RT) have been demonstrated to inhibit RT in biochemical assays and as in cell culture. However, methods employed to date to evaluate viral suppression utilize time-consuming serial passage of infectious HIV in aptamer-expressing stable cell lines. We have established a rapid, transfection-based assay system to effectively examine the inhibitory potential of anti-HIV RT aptamers expressed between two catalytically inactive hammerhead ribozymes. Our system can be altered and optimized for a variety of cloning schemes, and addition of sequences of interest to the cassette is simple and straightforward. When paired with methods to analyze aptamer RNA accumulation and localization in cells and as packaging into pseudotyped virions, the method has a very high level of success in predicting good inhibitors.

  7. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Baker, B R; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; Reid, S M; Ebert, K; Ferris, N P; King, D P

    2007-09-18

    A high-throughput multiplexed assay (Multiplex Version 1.0) was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRTPCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  8. Soft-Rt: software for IMRT simulations based on MCNPX

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira F, T. C. [Centro de Desenvolvimento da Tecnologia Nuclear / CNEN, Av. Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte, Minas Gerais (Brazil); Campos, T., E-mail: tcff01@gmail.com [Universidade Federal de Minas Gerais, Departamento de Engenharia Nuclear, Programa de Pos Graduacao em Ciencias e Tecnicas Nucleares, Av. Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte, Minas Gerais (Brazil)

    2015-10-15

    Intensity Modulated Radiation Therapy (IMRT) is an advanced treatment technique, widely used in external radiotherapy. This paper presents the Soft-Rt which allows the simulation of an entire IMRT treatment protocol. The Soft-Rt performs a full three-dimensional rendering of a set of patient images, including the definitions of region of interest with organs in risk, and the target tumor volume and margins (PTV). Thus, a more accurate analysis and planning can be performed, taking into account the features and orientation of the radiation beams. The exposed tissues as well as the amount of absorbed dose is depicted in healthy and/or cancerous tissues. As conclusion, Soft-Rt can predict dose on the PTV accurately, preserving the surrounding healthy tissues. Soft-Rt is coupled with SISCODES code. The SISCODES code is firstly applied to segment the set of CT or MRI patient images in distinct tissues pointing out its respective density and chemical compositions. Later, the voxel model is export to the Soft-Rt IMRT planning module in which a full treatment planning is created. All geometrical parameters are sent to the general purpose Monte Carlo transport code - MCNP - to simulate the interaction of each incident beam towards to the PTV avoiding organs in risk. The normalized dose results are exported to the Soft-Rt out-module, in which the three-dimensional model visualization is shown in a transparent glass procedure adopting gray scale for the dependence on the mass density of the correlated tissue; while, a color scale to depict dose values in a superimpose protocol. (Author)

  9. Soft-Rt: software for IMRT simulations based on MCNPX

    International Nuclear Information System (INIS)

    Ferreira F, T. C.; Campos, T.

    2015-10-01

    Intensity Modulated Radiation Therapy (IMRT) is an advanced treatment technique, widely used in external radiotherapy. This paper presents the Soft-Rt which allows the simulation of an entire IMRT treatment protocol. The Soft-Rt performs a full three-dimensional rendering of a set of patient images, including the definitions of region of interest with organs in risk, and the target tumor volume and margins (PTV). Thus, a more accurate analysis and planning can be performed, taking into account the features and orientation of the radiation beams. The exposed tissues as well as the amount of absorbed dose is depicted in healthy and/or cancerous tissues. As conclusion, Soft-Rt can predict dose on the PTV accurately, preserving the surrounding healthy tissues. Soft-Rt is coupled with SISCODES code. The SISCODES code is firstly applied to segment the set of CT or MRI patient images in distinct tissues pointing out its respective density and chemical compositions. Later, the voxel model is export to the Soft-Rt IMRT planning module in which a full treatment planning is created. All geometrical parameters are sent to the general purpose Monte Carlo transport code - MCNP - to simulate the interaction of each incident beam towards to the PTV avoiding organs in risk. The normalized dose results are exported to the Soft-Rt out-module, in which the three-dimensional model visualization is shown in a transparent glass procedure adopting gray scale for the dependence on the mass density of the correlated tissue; while, a color scale to depict dose values in a superimpose protocol. (Author)

  10. RT-PCR detection of HIV in Republic of Macedonia.

    Science.gov (United States)

    Bosevska, Golubinka; Panovski, Nikola; Dokić, Eleni; Grunevska, Violeta

    2008-11-01

    The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works. The total of 33 examined persons were divided in two groups: 1) 13 persons seropositive for HIV; and 2) 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5). ELFA test for combined detection of HIV p24 antigen and anti HIV-1+2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity. Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly. In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70 masculineC, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20 masculineC for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  11. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  12. Evaluating the Impacts of NASA/SPoRT Daily Greenness Vegetation Fraction on Land Surface Model and Numerical Weather Forecasts

    Science.gov (United States)

    Bell, Jordan R.; Case, Jonathan L.; Molthan, Andrew L.

    2011-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center develops new products and techniques that can be used in operational meteorology. The majority of these products are derived from NASA polar-orbiting satellite imagery from the Earth Observing System (EOS) platforms. One such product is a Greenness Vegetation Fraction (GVF) dataset, which is produced from Moderate Resolution Imaging Spectroradiometer (MODIS) data aboard the NASA EOS Aqua and Terra satellites. NASA SPoRT began generating daily real-time GVF composites at 1-km resolution over the Continental United States (CONUS) on 1 June 2010. The purpose of this study is to compare the National Centers for Environmental Prediction (NCEP) climatology GVF product (currently used in operational weather models) to the SPoRT-MODIS GVF during June to October 2010. The NASA Land Information System (LIS) was employed to study the impacts of the new SPoRT-MODIS GVF dataset on land surface models apart from a full numerical weather prediction (NWP) model. For the 2010 warm season, the SPoRT GVF in the western portion of the CONUS was generally higher than the NCEP climatology. The eastern CONUS GVF had variations both above and below the climatology during the period of study. These variations in GVF led to direct impacts on the rates of heating and evaporation from the land surface. The second phase of the project is to examine the impacts of the SPoRT GVF dataset on NWP using the Weather Research and Forecasting (WRF) model. Two separate WRF model simulations were made for individual severe weather case days using the NCEP GVF (control) and SPoRT GVF (experimental), with all other model parameters remaining the same. Based on the sensitivity results in these case studies, regions with higher GVF in the SPoRT model runs had higher evapotranspiration and lower direct surface heating, which typically resulted in lower (higher) predicted 2-m temperatures (2-m dewpoint temperatures). The opposite was true

  13. Evaluating the Impacts of NASA/SPoRT Daily Greenness Vegetation Fraction on Land Surface Model and Numerical Weather Forecasts

    Science.gov (United States)

    Bell, Jordan R.; Case, Jonathan L.; LaFontaine, Frank J.; Kumar, Sujay V.

    2012-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed a Greenness Vegetation Fraction (GVF) dataset, which is updated daily using swaths of Normalized Difference Vegetation Index data from the Moderate Resolution Imaging Spectroradiometer (MODIS) data aboard the NASA EOS Aqua and Terra satellites. NASA SPoRT began generating daily real-time GVF composites at 1-km resolution over the Continental United States (CONUS) on 1 June 2010. The purpose of this study is to compare the National Centers for Environmental Prediction (NCEP) climatology GVF product (currently used in operational weather models) to the SPoRT-MODIS GVF during June to October 2010. The NASA Land Information System (LIS) was employed to study the impacts of the SPoRT-MODIS GVF dataset on a land surface model (LSM) apart from a full numerical weather prediction (NWP) model. For the 2010 warm season, the SPoRT GVF in the western portion of the CONUS was generally higher than the NCEP climatology. The eastern CONUS GVF had variations both above and below the climatology during the period of study. These variations in GVF led to direct impacts on the rates of heating and evaporation from the land surface. In the West, higher latent heat fluxes prevailed, which enhanced the rates of evapotranspiration and soil moisture depletion in the LSM. By late Summer and Autumn, both the average sensible and latent heat fluxes increased in the West as a result of the more rapid soil drying and higher coverage of GVF. The impacts of the SPoRT GVF dataset on NWP was also examined for a single severe weather case study using the Weather Research and Forecasting (WRF) model. Two separate coupled LIS/WRF model simulations were made for the 17 July 2010 severe weather event in the Upper Midwest using the NCEP and SPoRT GVFs, with all other model parameters remaining the same. Based on the sensitivity results, regions with higher GVF in the SPoRT model runs had higher evapotranspiration and

  14. Tiempo atmosférico meteorología y climatología

    OpenAIRE

    María Elena Delvasto Jaimes

    2009-01-01

    Es muy comun emplear los terminos meteorologia, climatologia y tiempo atmosterlco sin hacer dlstlnclón alguna entre ellos; sin embargo, para interpretar y utilizar adecuadamente los pronósticos relacionados con este tema, es necesario precisar a que se refiere cada uno.

  15. Tiempo atmosférico meteorología y climatología

    Directory of Open Access Journals (Sweden)

    María Elena Delvasto Jaimes

    2009-01-01

    Full Text Available Es muy comun emplear los terminos meteorologia, climatologia y tiempo atmosterlco sin hacer dlstlnclón alguna entre ellos; sin embargo, para interpretar y utilizar adecuadamente los pronósticos relacionados con este tema, es necesario precisar a que se refiere cada uno.

  16. "Siempre" and "todo el tiempo": Investigating Semantic Convergence in a Bilingual Dialect.

    Science.gov (United States)

    Garcia, MaryEllen

    2001-01-01

    Investigates to what extent the variability between "siempre" and "todo el tiempo" in the San Antonio dialect demonstrates semantic convergence between them, and whether there will be a selection of the innovating form for the future. Examination of this variability may illuminate questions of how such changes occur…

  17. Uso de kits desechables para optimizar tiempos, movimientos y apego a protocolos de la terapia intravenosa

    Directory of Open Access Journals (Sweden)

    José Juan Escamilla Zamudio

    2017-09-01

    Cómo citar este artículo: Escamilla JJ, Ramírez GI. Uso de kits desechables para optimizar tiempos, movimientos y apego a protocolos de la terapia intravenosa. Rev Cuid. 2017; 8(3: 1749-57. http://dx.doi.org/10.15649/cuidarte.v8i3.412

  18. Tiempos líquidos. Configuraciones de la temporalidad actual en la obra de Zygmunt Bauman

    Directory of Open Access Journals (Sweden)

    José Francisco Durán Vázquez

    2014-01-01

    Full Text Available Este artículo analiza la obra de Zygmunt Bauman centrándose en uno de sus aspectos fundamentales, el del tiempo, que por otra parte la vertebra casi por completo. Desde este punto de vista, se muestra en primer lugar las consecuencias que ha tenido el paso de la modernidad sólida a la líquida para la configuración del tiempo, y cómo esta transformación ha influido de modo determinante en la estructuración y en la legitimación de dichas sociedades. En segundo lugar, se presta atención a las diferentes vivencias del tiempo líquido, experiencias que articulan los distintos mundos de vida, conformando un nuevo orden social y unas nuevas identidades. En tercer lugar, se señala como esta nueva dimensión del tiempo contribuye a la des-institucionalización e individualización de las sociedades, pero también a su legitimación, al crear una temporalidad ambivalente.

  19. Tiempo y sucesión ecológica en Ramón Margalef

    Directory of Open Access Journals (Sweden)

    Vargas Abarzúa, Esteban

    2010-02-01

    Full Text Available In this paper we attempt to think about the time in the Margalef’s ecological succession theory. In the classical model of ecological succession, populations succeed each other. Each phases of that succession “as a temporary phase” is merely juxtaposed with the other. It is the clock time, time like “measure” of the clock. Time here is absolute, independent of the process like in Newton. This does not happen in the model of Margalef. He thinks the ecosystem like a process in which energy is transfer and information acumulated. Thus, in the dynamic process of ecosystem appears various phases determined by the intrinsic dynamics of the system. Each ecosystem has its own time.

    En este trabajo intentamos meditar la concepción de tiempo en la teoría de sucesión ecológica de Margalef. En un modelo clásico de sucesión ecológica, las poblaciones se suceden unas a otras. Cada fase de esa sucesión “en tanto fase temporal” está meramente yuxtapuesta a las demás fases. Es el tiempo cronométrico, el tiempo como “medida” del reloj. El tiempo es aquí algo absoluto, independiente del proceso como en Newton. Esto no ocurre en el modelo de Margalef. Él piensa el ecosistema como un proceso de transferencia de energía y acumulación de información. Por esto, en el proceso dinámico del ecosistema existen diversas fases determinadas por la dinámica intrínseca del sistema. Cada ecosistema posee así su tiempo propio.

  20. Real Language Meets Real Business

    Science.gov (United States)

    Muirhead, Muirhead; Schechter, Sarah

    2016-01-01

    The Real Business Language Challenge was a collaborative pilot project between Coca-Cola Enterprises (CCE) and Routes into Languages East for Year 9 and 10 pupils. It was based on CCE's award-winning Real Business Challenge, part of its highly acclaimed education programme. The Real Business Language Challenge transformed the project into a…

  1. Narr kui ajastu metafoor / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    2001-01-01

    William Shakespeare'i "Kuningas Lear" (lav. Priit Pedajas) ja Pedro Calder̤n de la Barca "Elu on unenägu" (lav. Ingo Normet) Eesti Draamateatris. Ilmunud ka kogumikus : Hellerma, Kärt. Avanenud ruum. Tallinn : Eesti Keele Sihtasutus, 2006, lk. 213-216. Pealk. Narr kui meie aja kangelane

  2. Systemisk vaskulært lækage-syndrom

    DEFF Research Database (Denmark)

    Kjærgaard, Krista Dybtved; Rickers, Hans

    2008-01-01

    , træthed og ødemer) og biokemiske abnormiteter (hypoalbuminæmi, hæmokoncentration og monoklonalkomponent), som viste, at tilstanden var forenelig med den akutte - og potentielt letale - form af systemisk vaskulært lækage-syndrom. Ved Mayo Clinic i USA har man haft gode resultater med profylaktisk...

  3. Kirjanduskriitikute suvemängud / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    2007-01-01

    Arvustus: Lodge, David. Ühest kohast teise / tlk. Aet Varik. Tallinn : Varrak, 2005 ; Lodge, David. Väike maailm / tlk. Kersti Unt. Tallinn : Varrak, 1996 ; Lodge, David. Väärt töö / tlk. Kersti Unt. Tallinn : Varrak, 2006

  4. Torm Balti merel / Märt Treier ; interv. Inge Pitsner

    Index Scriptorium Estoniae

    Treier, Märt, 1975-

    2004-01-01

    TV3 näitab saksa poliitilist põnevusfilmi "Balti torm" ("Baltic Storm"), mis kujutab parvlaev "Estonia" hukku : stsenarist, produtsent Jutta Rabe : režissöör Reuben Leder. Filmi eel on teles Märt Treieri saade "Tormist sündinud tormid"

  5. Use of rt-PA (Alteplase) for acute cerebral infarction

    International Nuclear Information System (INIS)

    Oshibuchi, Rumi; Fukusako, Toshihiro; Matayoshi, Yasutoshi; Shiramoto, Kiyotaka; Itoh, Makoto; Oka, Hideo

    2008-01-01

    Among those patients with cerebral infarction who were brought to our emergency department from December 2005 through June 2007, 28 satisfied the criteria for indication for alteplase, recombinant tissue plasminogen activator (rt-PA), and served as the subjects of this study. According to the treatment protocol that our group, led by neurologists, had prepared, 0.6 mg/kg of rt-PA was administered following a CT of the head region that negated the presence of a brain hemorrhage. The time that elapsed between onset and rt-PA administration was 41-167 minutes (median 95). For 24 hours after medication, the patients were placed under respiratory and circulatory care and their neurological performances were observed in an intensive care unit (ICU) or a neurological ward. On a modified ranking scale, which indicates the possibility for social rehabilitation, 9 patients (32%) were rated to be between 0 to 1. Four (14%) succumbed during this period. By formulating a treatment protocol, rapid administration of rt-PA and monitoring to prevent complications became possible. (author)

  6. rt, Arvo: De profundis. Missa Sillabica / Patric Wiklacz

    Index Scriptorium Estoniae

    Wiklacz, Patric

    1997-01-01

    Uuest heliplaadist "Pärt, Arvo: De profundis. Missa Sillabica. Solfeggio. And one of the Pharisees. Cantate Domino. Summa. 7 Antiennes du Magnificat. The Beautitudes. Magnificat. Christopher Bowers-Broadbent (org.), Daniel Kennedy (perc.). Theatre of Voices / Paul Hillier (bass)" Harmonia Mundi HMU907 182 F (CD:165F). 1996. TT:1h 16'06"

  7. Future of the reprocessing business at the RT-1 plant

    International Nuclear Information System (INIS)

    Bukharin, O.

    1995-01-01

    Economic viability of reprocessing operations at the RT-1 plant is provided by the contracts with nuclear utilities from Finland and Hungary. Finland will stop sending fuel to Mayak for reprocessing after 1996. Hungary will be capable to resolve the problem of spent fuel domestically some time in the future. This increases vulnerability of the reprocessing business at Mayak to future political uncertainties. (author)

  8. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  9. 25 kaadrit sekundis / Liis Auväärt

    Index Scriptorium Estoniae

    Auväärt, Liis

    2009-01-01

    Nukufilmis käib töö filmiga "Lisa Limone & Maroc Orange", režissöör Mait Laas, animaatorid Triin Sarapik-Kivi, Märt Kivi, operaator Ragnar Neljandi, nukumeistrid Heigo Eeriksoo, Taivo Müürsep, Ene Mellow ja Kreeta Käeri. Dekoratsioonimeistrid Mait Erik ja Roman Kuznetsov

  10. Karje kunstniku südamest / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    1997-01-01

    Arvustus: Dinesen, Isak [Blixen, Karen]. Babette'i pidusöök / tlk. Piret Peiker. Tallinn : Varrak, 1996. Ilmunud ka kogumikus: Hellerma, Kärt. Kohanenud kirjandus : valik kirjanduskriitikat 1987-2006. Eesti Keele Sihtasutus : Tallinn, 2006. Lk. 167-169

  11. rt: Chamber and Orchestral Works / Robert Cowan

    Index Scriptorium Estoniae

    Cowan, Robert

    1994-01-01

    Uuest heliplaadist "Pärt: Chamber and Orchestral Works. Bournemouth Sinfonietta, Richard Studt. EMI Eminence CD CD-EMX 2221; Fratres; Cantus in memory of Benjamin Britten; Summa; Spiegel im Spiegel; Festina lente; Tabula Rasa; Fratres - selected comparison: Bachmann, Kibonoff (12/94)(CATA) 09026 61824-2. Kremer, Jarrett (ECM) 817 764-2

  12. Real Time Conference 2016 Overview

    Science.gov (United States)

    Luchetta, Adriano

    2017-06-01

    This is a special issue of the IEEE Transactions on Nuclear Science containing papers from the invited, oral, and poster presentation of the 20th Real Time Conference (RT2016). The conference was held June 6-10, 2016, at Centro Congressi Padova “A. Luciani,” Padova, Italy, and was organized by Consorzio RFX (CNR, ENEA, INFN, Università di Padova, Acciaierie Venete SpA) and the Istituto Nazionale di Fisica Nucleare. The Real Time Conference is multidisciplinary and focuses on the latest developments in real-time techniques in high-energy physics, nuclear physics, astrophysics and astroparticle physics, nuclear fusion, medical physics, space instrumentation, nuclear power instrumentation, general radiation instrumentation, and real-time security and safety. Taking place every second year, it is sponsored by the Computer Application in Nuclear and Plasma Sciences technical committee of the IEEE Nuclear and Plasma Sciences Society. RT2016 attracted more than 240 registrants, with a large proportion of young researchers and engineers. It had an attendance of 67 students from many countries.

  13. Arvo Pärt jagab preemia koolidele / Rebekka Lotman, Eva Kübar ; kommenteerinud Arvo Pärt

    Index Scriptorium Estoniae

    Lotman, Rebekka, 1978-

    2009-01-01

    Kultuuriministeerium tegi ettepaneku anda Arvo Pärdile elutööpreemia, millega kaasneva rahasumma lubas Pärt kinkida Rakvere ja Paide muusikakoolile. Elutööpreemiad saavad veel Ellen Niit ja Aarne Üksküla

  14. rt Haamer: Tsahknal pole Overalliga mingisugust seost / Märt Haamer ; intervjueerinud Jan Jõgis-Laats

    Index Scriptorium Estoniae

    Haamer, Märt, 1973-

    2009-01-01

    Overall Eesti juhi Märt Haameri väitel pole Anders Tsahkna ühtegi riigihanget Overalli ettevõtetele suunanud. Overalli omandusse kuuluv firma Gennet Lab on olnud alltöövõtja paaris E-tervise Sihtasutuse korraldatud hankes

  15. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... and subsequent downstream applications (England et al.,. 2001; England and Trevors, 2003; Sayler et al., 2001; ... Real time polymerase chain reaction (PCR). The cDNA produced can be used for real-time ... phoresis after completion of the reaction, real-time qPCR technology allows quantification of PCR ...

  16. Environmental Regulation of Plant Gene Expression: An Rt-qPCR Laboratory Project for an Upper-Level Undergraduate Biochemistry or Molecular Biology Course

    Science.gov (United States)

    Eickelberg, Garrett J.; Fisher, Alison J.

    2013-01-01

    We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the "FLOWERING LOCUS C" gene, a key regulator of floral timing in "Arabidopsis thaliana" plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate…

  17. An advanced real time energy management system for microgrids

    International Nuclear Information System (INIS)

    Elsied, Moataz; Oukaour, Amrane; Youssef, Tarek; Gualous, Hamid; Mohammed, Osama

    2016-01-01

    This paper presents an advanced Real-Time Energy Management System (RT-EMS) for Microgrid (MG) systems. The proposed strategy of RT-EMS capitalizes on the power of Genetic Algorithms (GAs) to minimize the energy cost and carbon dioxide emissions while maximizing the power of the available renewable energy resources. MATLAB-dSPACE Real-Time Interface Libraries (MLIB/MTRACE) are used as new tools to run the optimization code in Real-Time Operation (RTO). The communication system is developed based on ZigBee communication network which is designed to work in harsh radio environment where the control system is developed based on Advanced Lead-Lag Compensator (ALLC) which its parameters are tuned online to achieve fast convergence and good tracking response. The proposed RT-EMS along with its control and communication systems is experimentally tested to validate the results obtained from the optimization algorithm in a real MG testbed. The simulation and experimental results using real-world data highlight the effectiveness of the proposed RT-EMS for MGs applications. - Highlights: • Real-time energy management system of a typical MG is developed, and analyzed. • RT-EMS considered the nonlinear cost function and emission constraints. • MLIB/MTRACE libraries in dSPACE are used as new tools to run the optimization code. • The communication system is developed based on a Zigbee communication network. • Control system parameters are tuned online to achieve good tracking response.

  18. Increased sensitivity of RT-PCR for Potato virus Y detection using RNA isolated by a procedure with differential centrifugation.

    Science.gov (United States)

    Zhang, Jianhua; Nie, Xianzhou; Boquel, Sébastien; Al-Daoud, Fadi; Pelletier, Yvan

    2015-12-01

    The sensitivity of reverse transcription-polymerase chain reaction (RT-PCR) for virus detection is influenced by many factors such as specificity of primers and quality of templates. These factors become extremely important for successful detection when virus concentration is low. Total RNA isolated from Potato virus Y (PVY)-infected potato plants using the sodium sulfite RNA isolation method or RNeasy plant mini kit contains a high proportion of host RNA and may also contain trace amount of phenolic and polysaccharide residues, which may inhibit RT-PCR. The goal of this study was to enhance the sensitivity of PVY detection by reducing host RNA in the extract by differential centrifugation followed by extraction using an RNeasy mini kit (DCR method). One-step RT-PCR had relatively low amplification efficiency for PVY RNA when a high proportion of plant RNA was present. SYBR Green-based real time RT-PCR showed that the RNA isolated by the DCR method had a higher cycle threshold value (Ct) for the elongation factor 1-α mRNA (Ef1α) of potato than the Ct value of the RNA extracted using the RNeasy plant mini kit, indicating that the DCR method significantly reduced the proportion of potato RNA in the extract. The detectable amount of RNA extracted using the DCR method was sulfite RNA isolation methods, respectively. Copyright © 2015. Published by Elsevier B.V.

  19. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Determinación y cuantificación de bacterias acidolácticas por PCR en tiempo real

    OpenAIRE

    Vienvilay Phandanouvong L; Liliana Betancourt L

    2010-01-01

    Objetivo. Establecer un ensayo de PCR-TR para determinar el tamaño poblacional y la composición de bacterias totales y de ácido lácticas, en particular las pertenecientes a los géneros Lactobacillus y Bifidobacterium. Materiales y métodos. La especificidad de los iniciadores fue verificada utilizando la técnica de PCR convencional. Diluciones de 101 a 10- 4 ng/μl de ADN fueron preparadas a partir de cada cultivo microbiano y utilizadas en las curvas de calibración. La temperatura de disociac...

  1. Determinación y cuantificación de bacterias acidolácticas por PCR en tiempo real

    OpenAIRE

    Phandanouvong, Vienvilay; Betancourt, Liliana; Rodriguez, Fernando

    2010-01-01

    Objetivo. Establecer un ensayo de PCR-TR para determinar el tamaño poblacional y la composición de bacterias totales y de ácido lácticas, en particular las pertenecientes a los géneros Lactobacillus y Bifidobacterium. Materiales y métodos. La especificidad de los iniciadores fue verificada utilizando la técnica de PCR convencional. Diluciones de 101 a 10- 4 ng/µl de ADN fueron preparadas a partir de cada cultivo microbiano y utilizadas en las curvas de calibración. La temperatura de disociaci...

  2. Orígenes del archivo de la Corona de Aragón, (en tiempos, Archivo Real de Barcelona

    Directory of Open Access Journals (Sweden)

    Carlos López Rodríguez

    2007-08-01

    Only at the beginning of the 14th century were the concepts of recordkeeping, information management and documents as a source of evidence brought together within the Crown of Aragon and led to a transformation of the medieval archival institutions into useful instruments of power for the Monarchy.

  3. Aplicaciones del efecto fotorrefractivo del cristal BSO al procesamiento óptico de imágenes a tiempo real

    OpenAIRE

    Grosz, Susana I.

    1993-01-01

    Presentamos en este trabajo algunas aplicaciones al procesamiento óptico de imágenes usando un cristal fotorrefractivo BSO. Para ello en el capítulo 1 estudiamos las propiedades físicas del cristal BSO, describiendo aspectos generales del mismo, sus propiedades ópticas y la estructura de niveles de energía . En el capítulo 2 se estudia el efecto fotorrefractivo haciendo un análisis del efecto electroóptico tanto en el caso general como en el caso particular del cristal BSO...

  4. Estudio de distribución de tiempos de residencia en un reactor biológico de lecho empacado cerámico

    Directory of Open Access Journals (Sweden)

    Tatiana Rodríguez Chaparro

    2004-01-01

    Full Text Available La distribución de tiempos de residencia de un reactor es una característica del mezclado que ocurre dentro de él [ ] 1 [ ] 2 ; su determinación es básica para el diseño de cualquier tipo de reactor en escala real. El objetivo de esta investigación consistió en determinar la distribución de tiempos de residencia en un reactor biológico de lecho empacado cerámico (anillos a partir de pruebas con trazadores. Los resultados obtenidos utilizando las técnicas de inyección por paso y pulso fueron 34.577 seg., y 17.745 seg., respectivamente, y la dispersión calculada infinita. Lo anterior permite concluir que en reactores de lecho empacado cerámico (anillos las moléculas del trazador se distribuyen uniformemente en todo el sistema. Los ensayos se realizaron en un modelo a escala laboratorio.

  5. Metal cask RT-5000 for the dry storage and transportation of spent nuclear fuel

    Energy Technology Data Exchange (ETDEWEB)

    Vorobyov, A.I.; Kazeev, V.G.; Krayev, V.S.; Shcherbina, A.N.; Churikov, Y.I. [All-Russian Research Inst. of Technical Physics, Snezhinsk (Russian Federation)

    2003-05-01

    Presentation of new-type cask, developed at RFNC-VNIITF, is in the article. The prototype model of the shipping cask was subjected to tests imitating normal shipment conditions (free fall, pressing, and impact) and to tests imitating emergency situation during shipment (a drop from the 9-m height onto a pin is replaced by acceleration of the shipping cask at a guide rail of the rocket-catapult installation (RCI), a 1-m drop onto a pin, heat tests a 30-minutes fire at the temperature of for 8500 C, submergence to the depth of 15 and 200 meters). After each test the hermeticity preservation is examined. Parallel with the real testing, a mathematical simulation of physical processes induced by the corresponding tests was conducted at the RFNC-VNIITF. The required parameters obtained from the tests are used to calibrate the calculation methods. As a result it has been possible to obtain a good agreement between the results of calculations and experiments; this will allow the mathematic simulation to be used wider. The advantage of the RT-5000 metal cask in comparison with metal-concrete analogs are as follows: SFA are placed into the RT-5000 entirely without cutting into two bunches of fuel elements; the expensive hot doom is not required for automatic cutting the SFA and for loading the bunches of fuel elements into intermediate cases; the possibility remains to transport the RT-5000 without reloading SFA after 50-year storage, although this is a problem for the metal-concrete casks.

  6. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    Real time polymerase chain reaction (RT-PCR) is a new technique in molecular genetics which allows quantifica- tion of polymorphic DNA regions and genotyping of sin- gle nucleotide polymorphisms (SNPs) in one run. A by- product of real time PCR is the opportunity to identify new SNPs in the proximity of gene loci of ...

  7. Contradições entre as medições de audiência em tempo real e consolidada: um problema para a programação ao vivo da tv brasileira

    Directory of Open Access Journals (Sweden)

    Valdecir Becker

    2014-01-01

    Full Text Available Este artículo es una comparación estadística entre los índices de audiencia en tiempo real y los datos consolidados, medidos en São Paulo, el merca - do de televisión más importante de Brasil. A partir de la necesidad de información para tomar decisiones sobre la programación en vivo, el artículo cuestiona la validez de los tipos de medidas en tiempo real. Toma nota de que toda la información en tiempo real se actualizan en las calificaciones consolidadas, y llega a la conclusión de que las mediciones en tiempo real no son creíbles para las decisiones políticas sobre los programas en vivo.

  8. RT/OS — realtime programming and application environment for the COSY control system

    Science.gov (United States)

    Weinert, A.; Hacker, U.; Haberbosch, Ch.; Henn, K.; Simon, M.

    1994-12-01

    This paper presents the highlights and constraints of RT/OS and how it can be used at other places. The support of approximately 1000 VME and VXI CPUs in network-based multiprocessor systems needs a special set of programming tools and application environment which are bundled as the RT/OS Real-Time-Operating-System. Supporting the Motorola 680χ0 processors and micro-controller with a development system on UNIX and MS-DOS platforms, the tool set gives the opportunity of bringing small embedded controllers as well as VME multiprocessor systems into operation. The tool set includes a cross compiler and a special version of a remote debugger, as well as application support such as downloading and configuration management. The main feature is a modular kernel with message-based task switching, using the rendezvous principle to allow easy extension. Special features of this kernel for a distributed system are networking with the Berkeley socket library supporting TCP/IP, XNS and Novell Netware, a multiprocessor system on VMEbus with the interprocessor Communication Module (IPC), a device driver library for almost every G64 I/O card using a FieldBus Interface called PDV and a X11R4 port.

  9. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P AR, ERalpha or PSA expression between the groups. This study represents the first to show an upregulation of ERbeta gene expression in laser microdissected prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  10. Acuerdo en tiempo: un procedimiento de eficaz aplicación en las visitas de terreno

    Directory of Open Access Journals (Sweden)

    Rafael Borroto Chao

    1995-04-01

    Full Text Available Se destaca el valor de las actividades y las posibilidades que ofrecen al efecto las visitas periódicas de terreno que realizan los equipos de salud de la familia a las viviendas de la población que ateinden. Se fundamenta la importancia de aplicar métodos educativos durante estas visitas y se sugiere en tal sentido un procedimiento al que se le ha denominado "acuerdo en tiempo". Se exponen las cuestiones que se deben considerar en las visitas de terreno y se brindan ejemplos de los aspectos que se deben enfatizar desde el punto de vista educativo. Se recomienda la aplicación de técnicas educativas bidireccionales como la entrevista y la dinámica grupal, así como el procedimiento "acuerdo en tiempo" como estrategia de prometedoras perspectivas en la educación para la salud de la población.

  11. El tiempo, la ciudad y la historia en la Grecia clásica

    Directory of Open Access Journals (Sweden)

    Plácido Suárez, Domingo

    2004-06-01

    Full Text Available It is simplistic to oppose a circular idea of time among the ancient Greeks to the linear time of the Judeo-Christian tradition. In the Judeo-Christian tradition, linear time appears in combination with a history understood as oriented toward a predetermined, revealed end. Moreover, there also appears in this tradition a concept of repetitive time. In contrast, in classical Greece the concept of circular time coexisted with that of a secular, linear historical time, of which Herodotus and Thucydides are the leading representatives. It is true, though, that this concept of time was not the prevailing one in classical Antiquity; it only dominated the literature in the periods of rapid and deep political transformations, such as those that affected Athens in the 5th century B. C. Nonetheless, the teleological concept of time is absent in the Greek tradition. The historical narrative, as we understand it today, would only emerge in the 19th century, in connection with the mature development of capitalism. Classicism can no longer be viewed as a monolithic phenomenon that produced models for the rest of humankind in its long historical unfolding.

    Es simplista contraponer la idea circular del tiempo que tenían los antiguos griegos al tiempo lineal judeocristiano. En la concepción judeocristiana, el tiempo lineal aparece en combinación con una historia orientada hacia un final preestablecido y revelado. Además, también se da en esta tradición una concepción repetitiva del tiempo. Por su parte, en la Grecia clásica el concepto circular del tiempo coexistió con un tiempo histórico laico que es lineal, del que Heródoto y Tucídides fueron sus principales exponentes. Es verdad, sin embargo, que este concepto de tiempo no fue el dominante en la Antigüedad; prevaleció sobre todo en periodos de rápidas y grandes transformaciones políticas, como las que afectaron a la Atenas del siglo v a.C. No obstante, el tiempo

  12. Tiempo libre en adolescentes escolarizados de dos clases sociales de Costa Rica

    Directory of Open Access Journals (Sweden)

    Juan Diego García-Castro

    2010-01-01

    Full Text Available Este artículo indaga la relación entre tiempo libre, clase social y género en adolescentes costarricenses de educación secundaria. Se aplicó un cuestionario a 219 adolescentes de Costa Rica, entre los 16 y 17 años, de una institución educativa pública y una institución educativa privada. Los resultados muestran diferencias de clase y género pertinentes en la organización del tiempo libre. Las diferencias se asocian con la estructuración capitalista del género y los efectos conexos de la industria cultural y la dominación social. Los resultados son una contribución al estudio de los nuevos patrones de reproducción capitalista en la vida cotidiana.

  13. El cine de ciencia ficción como máquina del tiempo

    OpenAIRE

    Francescutti, Luis Pablo

    1997-01-01

    Análisis de las películas de ciencia ficción desde la perspectiva de la sociología del tiempo, y en especial del futuro. El cine, auténtica máquina de remontar los tiempos visualmente, actualizó esta potencialidad con el cine histórico en una primera fase, y con el cine de ciencia ficción en un momento posterior. Este género se especializó en explorar el continuo temporal mediante saltos hacia adelante o hacia atrás en el marco de una historia conjetural (qué hubiera sucedido si...) Cie...

  14. Performance Evaluation of Irbene RT-16 Radio Telescope Receiving System

    Directory of Open Access Journals (Sweden)

    Bleiders M.

    2017-12-01

    Full Text Available In the present paper, recent measurement results of refurbished Irbene RT-16 radio telescope receiving system performance are presented. The aim of the research is to evaluate characteristics of RT-16, which will allow carrying out necessary amplitude calibration in both single dish and VLBI observations, to improve the performance of existing system as well as to monitor, control and compare performance if possible changes in the receiving system will occur in future. The evaluated receiving system is 16 m Cassegrain antenna equipped with a cryogenic receiver with frequency range from 4.5 to 8.8 GHz, which is divided into four sub-bands. Multiple calibration sessions have been carried out by observing stable astronomical sources with known flux density by using in-house made total power registration backend. First, pointing offset calibration has been carried out and pointing model coefficients calculated and applied. Then, amplitude calibration, namely antenna sensitivity, calibration diode equivalent flux density and gain curve measurements have been carried out by observing calibration sources at different antenna elevations at each of the receiver sub-bands. Beam patterns have also been evaluated at different frequency bands. As a whole, acquired data will serve as a reference point for comparison in future performance evaluation of RT-16.

  15. GOKaRT: Graphical Online Search Tool for Maps

    Directory of Open Access Journals (Sweden)

    Mechthild Schüler

    2008-09-01

    Full Text Available The map department of the Staats- und Universitätsbibliothek Göttingen together with the Berlin State Library propose a project to develop a web-based graphic cataloguing and search system for maps, to be funded by the German Research Foundation. This tool shall be made available to all map holdings in archives, libraries, university departments and museums in Germany as a comfortable means for the administration of map holdings and as a search tool. Sheets belonging to map series as well as single maps (old and new will be registered cooperatively by the participants with simple tools. This cooperation in data maintenance will facilitate the work especially for understaffed map holdings. Depending on the type of map there are four different mechanisms for map reference. For map series electronic index sheets are used which will show information regarding the various issues of the map sheets. Due to the intuitive graphic search entry GOKaRT-users will easily find the required maps of a certain region available in a chosen holding. User administration modules ensure comfortable handling. GOKaRT is being developed on the basis of licence-free open source programmes. In case financing is provided by the German Research Foundation, GOKaRT can be used free of charge internationally. This would require a contract stipulating data exchange between the partners as well as permanent storage and usability of the data.

  16. WE-H-207B-00: MRgRT

    International Nuclear Information System (INIS)

    2016-01-01

    In recent years, steady progress has been made towards the implementation of MRI in external beam radiation therapy for processes ranging from treatment simulation to in-room guidance. Novel procedures relying mostly on MR data are currently implemented in the clinic. This session will cover topics such as (a) commissioning and quality control of the MR in-room imagers and simulators specific to RT, (b) treatment planning requirements, constraints and challenges when dealing with various MR data, (c) quantification of organ motion with an emphasis on treatment delivery guidance, and (d) MR-driven strategies for adaptive RT workflows. The content of the session was chosen to address both educational and practical key aspects of MR guidance. Learning Objectives: Good understanding of MR testing recommended for in-room MR imaging as well as image data validation for RT chain (e.g. image transfer, filtering for consistency, spatial accuracy, manipulation for task specific); Familiarity with MR-based planning procedures: motivation, core workflow requirements, current status, challenges; Overview of the current methods for the quantification of organ motion; Discussion on approaches for adaptive treatment planning and delivery. T. Stanescu - License agreement with Modus Medical Devices to develop a phantom for the quantification of MR image system-related distortions.; T. Stanescu, N/A

  17. WE-H-207B-04: Strategies for Adaptive RT

    International Nuclear Information System (INIS)

    Green, O.

    2016-01-01

    In recent years, steady progress has been made towards the implementation of MRI in external beam radiation therapy for processes ranging from treatment simulation to in-room guidance. Novel procedures relying mostly on MR data are currently implemented in the clinic. This session will cover topics such as (a) commissioning and quality control of the MR in-room imagers and simulators specific to RT, (b) treatment planning requirements, constraints and challenges when dealing with various MR data, (c) quantification of organ motion with an emphasis on treatment delivery guidance, and (d) MR-driven strategies for adaptive RT workflows. The content of the session was chosen to address both educational and practical key aspects of MR guidance. Learning Objectives: Good understanding of MR testing recommended for in-room MR imaging as well as image data validation for RT chain (e.g. image transfer, filtering for consistency, spatial accuracy, manipulation for task specific); Familiarity with MR-based planning procedures: motivation, core workflow requirements, current status, challenges; Overview of the current methods for the quantification of organ motion; Discussion on approaches for adaptive treatment planning and delivery. T. Stanescu - License agreement with Modus Medical Devices to develop a phantom for the quantification of MR image system-related distortions.; T. Stanescu, N/A

  18. PROFESIONALES, TRAYECTORIAS Y USO DEL TIEMPO. EGRESADAS DE LA UNIVERSIDAD DE GUADALAJARA

    Directory of Open Access Journals (Sweden)

    BEATRIZ ADRIANA BUSTOS TORRES

    2017-01-01

    Full Text Available El uso del tiempo es determinante en la construcción de las trayectorias laborales; las mujeres encontrarán limitación al desarrollar su trayectoria laboral, dada la distribución del mismo entre no trabajo remunerado y trabajo remunerado. La carga de actividades reproductivas y domésticas provoca que las mujeres tengan menores posibilidades de desarrollarse en el ámbito laboral.

  19. Espacio, tiempo y privacidad en la comunicación móvil

    Directory of Open Access Journals (Sweden)

    Amaro La Rosa

    2013-06-01

    Full Text Available Se presentan resultados de investigaciones, criterios teóricos y experiencias que muestran a los teléfonos móviles en la vida cotidiana, su uso y su relación con los espacios, el tiempo y la privacidad en la sociedad actual. Se propone una aproximación preliminar al impacto social y cultural producido por estos recursos tecnológicos.

  20. Género y construcción diferenciada de los espacios y los tiempos cotidianos

    OpenAIRE

    Romo Parra, Carmen

    2014-01-01

    Sin lugar a dudas el análisis del cambio social debe introducir variables que midan los avances y retrocesos en la igualdad de oportunidades en función del género. En este sentido, el uso de los tiempos y los espacios cotidianos constituyen indicadores clave para analizar la evolución del estatus de las mujeres en el marco de cualquier modelo social. Universidad de Málaga. Campus de Excelencia Andalucía Tech.

  1. PROFESIONALES, TRAYECTORIAS Y USO DEL TIEMPO. EGRESADAS DE LA UNIVERSIDAD DE GUADALAJARA

    OpenAIRE

    BEATRIZ ADRIANA BUSTOS TORRES

    2017-01-01

    El uso del tiempo es determinante en la construcción de las trayectorias laborales; las mujeres encontrarán limitación al desarrollar su trayectoria laboral, dada la distribución del mismo entre no trabajo remunerado y trabajo remunerado. La carga de actividades reproductivas y domésticas provoca que las mujeres tengan menores posibilidades de desarrollarse en el ámbito laboral.

  2. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  3. La constelación freudiana y el tiempo del consumo

    Directory of Open Access Journals (Sweden)

    Marinas, José Miguel

    2007-02-01

    Full Text Available Psychoanalysis arises in the context of the crisis of the liberal subject: the transition from the culture of production to the culture of consumption. The time of progress (production comes hand in hand with a new model of time: the instant (repetition, and the time of the unconscious (desire. The biographical task is demanded as a moral duty. This paper examines the antecedents of this Freudian constellation: Nietzsche, for example, talks about fashion.El psicoanalisis surge en el contexto de la crisis del sujeto liberal, es decir en el paso de la cultura de la producción a la cultura del consumo. El tiempo del progreso (de la producción se ve acompañado de un nuevo modelo el tiempo del instante (de la repetición, y el tiempo de lo inconsciente (del deseo. La tarea biográfica se incrementa como tarea moral. Este artículo examina los antecedentes de esa constelación freudiana: Nietzsche, por ejemplo, habla de la moda.

  4. La colonización del tiempo libre en la sociedad costarricense, a partir del siglo XXI

    OpenAIRE

    Coto Vega, Edwin; Sojo Mora, Blanca Luz

    2012-01-01

    En la actualidad las personas cuentan con tiempo libre, el cual está siendo utilizado o colonizado por algunos entes sociales, que determinan cómo y en qué usarlo, de manera muy sutil, a través de los diferentes medios de comunicación.Se realiza un análisis descriptivo sobre la influencia de los medios de comunicación masiva en la utilización del tiempo libre.El planteamiento permite que los ciudadanos sean críticos, ante las propuestas sociales que orientan el aprovechamiento del tiempo libr...

  5. Estimación de aportaciones deducidas a presas mediante análisis de series de tiempo estacionales.

    OpenAIRE

    Ariza Hernández, Isaías

    2012-01-01

    Para el estudio de las aportaciones deducidas, que se pueden esperar en presas, se analizan con modelos matemáticos basados en la estadística, con los que se trata de inferir el comportamiento de las variables hidrológicas, que en este caso, son las aportaciones deducidas. Dichos modelos pueden ser modelos de series de tiempo. El objetivo fundamental de este trabajo es presentar una metodología de análisis de series de tiempo estacionales cuyo dominio es el tiempo propuesto por Box y Jenki...

  6. Real Forestry for Real Estate

    Science.gov (United States)

    Gagnon, Jennifer; Fisher, Jason

    2013-01-01

    Virginia is poised to see an unprecedented change in forest land ownership. To provide new landowners with information on sustainable forest management, we developed a two-part program, Real Forestry for Real Estate. First, we assembled New Landowner Packets, which contain a variety of sustainable forest management resources. Second, two…

  7. Using the SPoRT POES/GOES Hybrid Product in OCONUS Forecasting

    Science.gov (United States)

    Smith, Matt; Fuell, Kevin; Nelson, Jim

    2014-01-01

    The SPoRT (Short-term Prediction and Research Transition) Program at the NASA/Marshall Space Flight Center has been providing unique NASA and NOAA data and techniques to partner Weather Forecast Offices (WFOs) for ten years. Data are provided in the Decision Support System used by WFO forecasters: AWIPS. For the last couple of years, SPoRT has been producing the POES/GOES Hybrid. This suite of products combines the strength ofl5- minute animations of GOES imagery - providing temporal continuity, with the higher resolution, relatively random availability, of polar orbiting (POES) imagery data. The product was first introduced with only MODIS data from NASA's Terra and Aqua satellites, but recently the VIIRS instrument onboard the Suomi-NPP satellite was added, providing better high-resolution coverage. These products represent SPoRT's efforts to prepare for higher resolution, higher frequency GOES-R imagery - as well as helping to move VIIRS (JPSS) data into the mainstream of weather forecasting. SPoRT generates 5 products for this dataset: Visible, Longwave Infrared (11 micrometers), Shortwave IR (3.7 micrometers), Water Vapor (6.7 micrometers), and Fog (Difference of 11 micrometer and 3.7 micrometer channels). The Water Vapor hybrid product has a Red-Blue-Green image from MODIS inlaid, since it provides even more qualitative information than water vapor alone. Animated examples of the products will be shown in this presentation. While the resolution at nadir of GOES imagery is nominally Han (4km for IR channels), the inlaid polar orbiter imagery has a resolution of 250m (lkm for IR channels). This has tremendous application in the continental US. However, in high latitudes, since the usefulness of GOES degrades poleward rapidly, the contrast of GOES and POES data is stark. The consistent temporal nature of GOES, even though at a reduced resolution at high latitudes, provides basic situational awareness, but the introduction of polar data is very helpful in seeing

  8. Desastres do pós-guerra civil espanhola: uma leitura de \\'Tiempo de Silencio\\', de Luis Martín-Santos e \\'Nada\\', de Carmen Laforet

    OpenAIRE

    Margareth dos Santos

    2006-01-01

    O trabalho propõe-se a analisar os romances Nada (1945), de Carmen Laforet e Tiempo de Silencio (1962), de Luis Martín-Santos para examinar o traço singular da construção de ambas obras, qual seja, a apropriação das séries de gravuras Los Caprichos e Los Desastres de la Guerra de Goya. Em Nada, abordamos a integração do aspecto monstruoso ao espaço romanesco, o apagamento da fronteira entre o mundo onírico e o real, a representação fragmentária e a diluição dos limites entre o passado da maté...

  9. Tiempo histórico y tiempo mítico entre los mayas del Periodo Clásico (ss. II-X d.C.

    Directory of Open Access Journals (Sweden)

    Lacadena García-Gallo, Alfonso

    2004-06-01

    Full Text Available The use and development of a rather precise calendrical system enabled the Maya of the Classic Period of this Mesoamerican civilization (centuries 2nd through 10th A. D. to turn time into an habitable space. For them, time was like a path leading to either the past, in the form of an historical record registered in written documents, or the future, by way of forecasts and prophecies. Compared to other archaic cultures or early civilizations, the Classic Maya has been known for years for the peculiarity of having a linear, historical concept of time, including absolute dating. Yet the decipherment of the hieroglyphic inscriptions has revealed that this historical concept of time meshed with mythical time to make up a single temporal dimension —which was at once linear and cyclical— for the actions of men as well as gods. With obsessive accuracy and recurrence, the Classic Maya used calendrical Information as mortar for the construction of an historical (especially political and religious discourse on their monuments, full of cross references to contemporary, past and even future events in texts commemorating anniversaries in several calendarial cycles.

    La utilización y desarrollo de un sistema calendárico sumamente preciso permitió a los mayas del Periodo Clásico de esta civilización mesoamericana (siglos II-X d.C. hacer del tiempo un espacio habitable. Para ellos, el tiempo era un sendero por el que era posible transitar o bien hacia el pasado, en forma de memoria histórica consignada en textos escritos, o bien hacia el futuro, mediante predicciones y profecías. Lo que es una rareza en comparación con otras culturas arcaicas o primeras civilizaciones, la clásica de los mayas incluía un concepto de tiempo histórico de carácter lineal, con dataciones absolutas. Pero el desciframiento de las inscripciones jeroglíficas está revelando que este tiempo histórico estaba integrado con el mítico en una

  10. Tiempo para quedar en embarazo: Evaluación de su reproducibilidad en una cohorte retrospectiva

    Directory of Open Access Journals (Sweden)

    Diana Carolina Jaimes Vega

    2015-04-01

    Full Text Available Introducción: El tiempo para quedar en embarazo (TPE es una medida clínica de la fecundidad útil en la evaluación de efectos reproductivos relacionados con exposiciones ambientales u ocupacionales. Estudios con mujeres europeas evidencian que su uso tiene una adecuada recordación y reproducibilidad; sin embargo, estas propiedades no han sido evaluadas en Latinoamérica. Objetivos: Evaluar la reproducibilidad de la medida TPE en una población de mujeres colombianas como una aproximación clínica de la fecundidad. Metodología: Estudio de reproducibilidad prueba-reprueba de un cuestionario para determinar el tiempo al primer embarazo en una sub-muestra de 27 mujeres, anidado en una cohorte retrospectiva de evaluación de los efectos reproductivos de la exposición al mercurio metálico en la minería artesanal de oro. El cuestionario fue administrado de forma repetida por un evaluador entrenado, en el primer momento en una entrevista presencial y 12 meses después en una entrevista telefónica. La reproducibilidad del cuestionario fue evaluada usando el coeficiente de correlación intraclase (CCI. Resultados: La mediana de tiempo al embarazo fue de 4 meses (rango intercuartil 1-12. El rango de tiempo transcurrido desde el primer embarazo estuvo entre 1 y 15 años. El CCI (2,k fue 0.726 (IC 95% 0.39, 0.88, demostrando una buena reproducibilidad de la variable después de un año de separación entre la primera y segunda entrevista. Conclusiones: El TPE para el primer embarazo mostró ser una medida clínica de fecundidad sencilla y reproducible, con un tiempo de recordación de hasta 15 años y en evaluación presencial o telefónica en una población de mujeres colombianas.

  11. Transitioning NPOESS Data to Weather Offices: The SPoRT Paradigm with EOS Data

    Science.gov (United States)

    Jedlovec, Gary

    2009-01-01

    Real-time satellite information provides one of many data sources used by NWS weather forecast offices (WFOs) to diagnose current weather conditions and to assist in short-term forecast preparation. While GOES satellite data provides relatively coarse spatial resolution coverage of the continental U.S. on a 10-15 minute repeat cycle, polar orbiting imagery has the potential to provide snapshots of weather conditions at high-resolution in many spectral channels. Additionally, polar orbiting sounding data can provide additional information on the thermodynamic structure of the atmosphere in data sparse regions of at asynoptic observation times. The NASA Short-term Prediction Research and Transition (SPoRT) project has demonstrated the utility of polar orbiting MODIS and AIRS data on the Terra and Aqua satellites to improve weather diagnostics and short-term forecasting on the regional and local scales. SPoRT scientists work directly forecasters at selected WFOS in the Southern Region (SR) to help them ingest these unique data streams into their AWIPS system, understand how to use the data (through on-site and distance learn techniques), and demonstrate the utility of these products to address significant forecast problems. This process also prepares forecasters for the use of similar observational capabilities from NPOESS operational sensors. NPOESS environmental data records (EDRs) from the Visible 1 Infrared Imager I Radiometer Suite (VIIRS), the Cross-track Infrared Sounder (CrlS) and Advanced Technology Microwave Sounder (ATMS) instruments and additional value-added products produced by NESDIS will be available in near real-time and made available to WFOs to extend their use of NASA EOS data into the NPOESS era. These new data streams will be integrated into the NWs's new AWIPS II decision support tools. The AWIPS I1 system to be unveiled in WFOs in 2009 will be a JAVA-based decision support system which preserves the functionality of the existing systems and

  12. Real analysis

    CERN Document Server

    McShane, Edward James

    2013-01-01

    This text surveys practical elements of real function theory, general topology, and functional analysis. Discusses the maximality principle, the notion of convergence, the Lebesgue-Stieltjes integral, function spaces and harmonic analysis. Includes exercises. 1959 edition.

  13. La relación entre el tiempo no estructurado, el ocio y las funciones cognitivas en personas mayores

    Directory of Open Access Journals (Sweden)

    María Plaza Carmona

    2015-12-01

    Conclusiones: El tipo de práctica de actividades de ocio se relaciona positiva y significativamente con una planificación más variada e intensa del tiempo no estructurado y un mejor nivel cognitivo.

  14. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  15. Recent Upgrades to NASA SPoRT Initialization Datasets for the Environmental Modeling System

    Science.gov (United States)

    Case, Jonathan L.; LaFontaine, Frank J.; Molthan, Andrew L.; Zavodsky, Bradley T.; Rozumalski, Robert A.

    2012-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed several products for its National Weather Service (NWS) partners that can initialize specific fields for local model runs within the NOAA/NWS Science and Training Resource Center (STRC) Environmental Modeling System (EMS). In last year's NWA abstract on this topic, the suite of SPoRT products supported in the STRC EMS was presented, which includes a Sea Surface Temperature (SST) composite, a Great Lakes sea-ice extent, a Green Vegetation Fraction (GVF) composite, and NASA Land Information System (LIS) gridded output. This abstract and companion presentation describes recent upgrades made to the SST and GVF composites, as well as the real-time LIS runs. The Great Lakes sea-ice product is unchanged from 2011. The SPoRT SST composite product has been expanded geographically and as a result, the resolution has been coarsened from 1 km to 2 km to accommodate the larger domain. The expanded domain covers much of the northern hemisphere from eastern Asia to western Europe (0 N to 80 N latitude and 150 E to 10 E longitude). In addition, the NESDIS POES-GOES product was added to fill in gaps caused by the Moderate Resolution Imaging Spectroradiometer (MODIS) being unable to sense in cloudy regions, replacing the recently-lost Advanced Microwave Scanning Radiometer for EOS with negligible change to product fidelity. The SST product now runs twice per day for Terra and Aqua combined data collections from 0000 to 1200 UTC and from 1200 to 0000 UTC, with valid analysis times at 0600 and 1800 UTC. The twice-daily compositing technique reduces the overall latency of the previous version while still representing the diurnal cycle characteristics. The SST composites are available at approximately four hours after the end of each collection period (i.e. 1600 UTC for the nighttime analysis and 0400 UTC for the daytime analysis). The real-time MODIS GVF composite has only received minor updates in the

  16. Applications of LANCE Data at SPoRT

    Science.gov (United States)

    Molthan, Andrew

    2014-01-01

    Short term Prediction Research and Transition (SPoRT) Center: Mission: Apply NASA and NOAA measurement systems and unique Earth science research to improve the accuracy of short term weather prediction at the regional/local scale. Goals: Evaluate and assess the utility of NASA and NOAA Earth science data and products and unique research capabilities to address operational weather forecast problems; Provide an environment which enables the development and testing of new capabilities to improve short term weather forecasts on a regional scale; Help ensure successful transition of new capabilities to operational weather entities for the benefit of society

  17. 47: A new RT-CT system for radiotherapy

    International Nuclear Information System (INIS)

    Tsujii, H.; Kamada, T.; Takamura, A.; Irie, G.; Ohta, H.; Kubo, Y.; Inamura, K.

    1987-01-01

    A new radiotherapy dedicated CT-system (RT-CT system) has been developed, allowing various aspects of radiotherapy including pre-treatment staging, treatment planning, treatment delivery and follow-up after irradiation. The hardwares include a CT scanner, laser-beam field projector, dose planning unit, independent diagnostic console, data processing and filing unit, and related accessories. The main feature of treatment planning involves the determination of radiation parameters using CT scans with or without a scout view, where a conventional X-ray simulator is no longer used. The system permits 3-D dose calculation with inhomogeneity corrections. 8 refs.; 4 figs

  18. ESTUDIO DE SISTEMAS DE MEDIDA CON ENSAYOS DESTRUCTIVOS. UNA APLICACIÓN SOBRE TIEMPOS DE PRODUCCIÓN

    Directory of Open Access Journals (Sweden)

    Marta Quaglino

    2010-01-01

    Full Text Available Los estudios de repetibilidad y reproducibilidad fueron diseñados con el propósito de analizar la bondad de los sistemas de medición, análisis cuya importancia radica en el hecho que un sistema inadecuado introducirá variabilidad adicional ocasionando que las mediciones no reflejen el verdadero comportamiento del proceso. El análisis se basa en la cuantificación de la variabilidad asociada al sistema de medición y su posterior comparación con la variabilidad total observada, siendo requerimiento fundamental para ello que resulte factible obtener mediciones repetidas de una misma unidad bajo las mismas condiciones experimentales, de lo contrario, la variabilidad en las mediciones estará confundida con la variabilidad propia de las partes medidas. Tal es el caso en que los ensayos de medición son “destructivos”, esto es, las unidades no son robustas frente al proceso de medición, o bien, las unidades no son temporalmente estables.En este trabajo se exponen diversas alternativas para el caso de estudios R&R con ensayos destructivos y una aplicación particular en un problema real sobre estimación de tiempos de producción en una empresa metalúrgica. El empleo de Modelos Lineales Generalizados permitió obtener estimaciones adecuadas de ciertas Componentes de Variancia, que advirtieron sobre características importantes a mejorar en el proceso de medición.

  19. Real analysis

    CERN Document Server

    Loeb, Peter A

    2016-01-01

    This textbook is designed for a year-long course in real analysis taken by beginning graduate and advanced undergraduate students in mathematics and other areas such as statistics, engineering, and economics. Written by one of the leading scholars in the field, it elegantly explores the core concepts in real analysis and introduces new, accessible methods for both students and instructors. The first half of the book develops both Lebesgue measure and, with essentially no additional work for the student, general Borel measures for the real line. Notation indicates when a result holds only for Lebesgue measure. Differentiation and absolute continuity are presented using a local maximal function, resulting in an exposition that is both simpler and more general than the traditional approach. The second half deals with general measures and functional analysis, including Hilbert spaces, Fourier series, and the Riesz representation theorem for positive linear functionals on continuous functions with compact support....

  20. Expert system based on cases for a diagnosis system in real time; Sistema experto basado en casos para un sistema de diagnostico en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa R, Alfredo; Quintero R, Agustin; Zambrano D, S Venecia [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2006-07-01

    This article presents the development of an Expert System based in the Reasoning Based on Cases methodology. Such system was performed with the purpose of creating an information system in charge of supervising and diagnosing the status of the main equipment of fossil fuel power plants for electricity generation. Here is presented the reasons why this methodology was used for the expert system and why Induce-It -the specialized tool that implements it- was also chosen, as well as the analysis made for the disposition of the operative architecture of the Expert System, the very development of this software architecture and, finally, the validation of the correct operation of this system by means of a simulator that simultaneously puts to the test the error handling of the Expert System. [Spanish] Este articulo presenta el procedimiento que siguio el desarrollo de un Sistema Experto asentado en la metodologia de Razonamiento Basado en Casos; realizado con el fin de crear un sistema de informacion encargado de supervisar y diagnosticar el estado de los equipos principales de centrales de generacion termoelectrica. Se expone justificadamente la seleccion de la metodologia del sistema experto y de la herramienta especializada que lo implementa (Induce-It), asi como el analisis realizado para la disposicion de la arquitectura operativa del Sistema Experto, el desarrollo mismo de esta arquitectura del software y, finalmente, la validacion del correcto funcionamiento de este sistema mediante un simulador que a la vez pone a prueba el manejo de errores del Sistema Experto.

  1. Validation of artificial microRNA expression by poly(A) tailing-based RT-PCR

    OpenAIRE

    sprotocols

    2015-01-01

    Authors: Rui Shi, Chenmin Yang, Ronald Sederoff & Vincent Chiang ### Abstract Here we describe a protocol for validating expression of artificial microRNAs (amiRNAs) by poly(A) tailing-based RT-PCR. Total RNAs, including amiRNA, are poly(A) tailed using E.coli. poly(A) polymerase. Poly(A) tailed amiRNA can be converted into cDNA along with mRNAs in a reverse transcription reaction primed by a standard poly(T) anchor adaptor. AmiRNA can then be amplified and quantitated by real-time PC...

  2. Experimentation of RT-LOTOS for a critical function of a power plant instrumentation and control system; Experimentation de RT-LOTOS pour une fonction critique d`un systeme de controle-commande en centrale

    Energy Technology Data Exchange (ETDEWEB)

    Andriantsiiferana, L.; Courtiat, J.P.; De Oliveira, R.C.

    1996-01-01

    This document is the final report of the contract between LAAS-CNRS and the EdF Direction of Researches and Studies about the experimentation of RT-LOTOS formal description technique on a critical function of a nuclear power plant instrumentation and control system. This report comprises 4 parts: part 1 describes the RT-LOTOS (Real Time-Language of Temporal Ordering Specifications) tutorial and its RTL tool environment, the different RT-LOTOS operators and semantics, and the RTL tool main functionalities; part 2 deals with the methodology and the global architecture for the specification and validation of the CCT (Central Calculator for Treatment); part 3 gives more details about the different processes identified in the specification architecture and presents the main results obtained for the validation of the nominal functioning; part 4 describes some exceptional situations and shows how some failures and their associated recovery mechanisms can be modelled. (J.S.). 6 refs., 53 figs., 5 tabs., 2 appends.

  3. Acerca del uso del tiempo apocalíptico en la Edad Media

    Directory of Open Access Journals (Sweden)

    Villacañas Berlanga, José Luis

    2007-12-01

    Full Text Available After a first section in which the essential thesis of Reinhart Koselleck’s work Zeitverkürzung und Beschleunigung are synthesized, the text discusses some of its main conclusions. In the analysis is very important the reflection about the use of apocalyptic time in the Middle Ages. So, the paper criticizes the way the Christian Apocalypse is presented as profane acceleration, last consequence of secularization. The essay ends by breaking up the temporal sequence between reduction and acceleration, human action and divine action, the time of humans and the time of transcendence, which have indeed coexisted in a dialectical way.

    Tras un primer apartado dedicado a sintetizar las tesis básicas del escrito de Reinhart Koselleck Zeitverkürzung und Beschleunigung, el texto discute algunas de sus conclusiones nucleares, como la identificación de mundanización, temporalización y aceleración. En el análisis es fundamental la reflexión acerca del uso del tiempo apocalíptico en la Edad Media. Así, se critica como simplificadora la presentación del Apocalipsis cristiano como aceleración profana, última consecuencia de la secularización. El ensayo se cierra con la disolución de la secuencia temporal entre acortamiento y aceleración, acción humana y acción divina, tiempo del ser humano y tiempo de la trascendencia, que han convivido en verdad dialécticamente.

  4. Talking the talk, but not walking the walk: RT-qPCR as a paradigm for the lack of reproducibility in molecular research.

    Science.gov (United States)

    Bustin, Stephen; Nolan, Tania

    2017-10-01

    Poorly executed and inadequately reported molecular measurement methods are amongst the causes underlying the lack of reproducibility of much biomedical research. Although several high impact factor journals have acknowledged their past failure to scrutinise adequately the technical soundness of manuscripts, there is a perplexing reluctance to implement basic corrective measures. The reverse transcription real-time quantitative PCR (RT-qPCR) is probably the most straightforward measurement technique available for RNA quantification and is widely used in research, diagnostic, forensic and biotechnology applications. Despite the impact of the minimum information for the publication of quantitative PCR experiments (MIQE) guidelines, which aim to improve the robustness and the transparency of reporting of RT-qPCR data, we demonstrate that elementary protocol errors, inappropriate data analysis and inadequate reporting continue to be rife and conclude that the majority of published RT-qPCR data are likely to represent technical noise. © 2017 Stichting European Society for Clinical Investigation Journal Foundation.

  5. Global Dynamics and International Cooperation Needs of RT Development and Utilization for the Establishment of the Northeast Asia RT Hub in Korea

    International Nuclear Information System (INIS)

    Kim, Y. K.; Oh, G. B.; Yun, S. W.; Yang, M. H.; Ryu, J. S.; Choi, S. J.; Choi, S. G.

    2005-11-01

    In an effort to achieve the objectives, the following scopes were categorized for in-depth study. First, analysis framework was developed for RT capacity development and international technology cooperation strategy. RT survey checklist and international technology cooperation was analyzed with interviewing and reports of domestic participants recently. Second, RT strategic environment was analyze for East-Asia hub competition/cooperation and developing nations using analysis framework. Korean RT was analyzed using SWOT analysis for establishment of RT hub in Korea. Third, East-Asian nations were classified analyzed by RT categories in standpoint of our country. Technology status and future cooperation plan were discussed about RT application for bio-medicine. Products/technology seminar related to an export was hold about support plan of admission/sales for functional food HemoHIM. This study can be utilized in the establishment of RT hub and development strategy. And it can be also utilized in promotion devising of domestic RT and planning setup for obtaing the international competitive power

  6. Global Dynamics and International Cooperation Needs of RT Development and Utilization for the Establishment of the Northeast Asia RT Hub in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Y. K.; Oh, G. B.; Yun, S. W.; Yang, M. H.; Ryu, J. S.; Choi, S. J.; Choi, S. G

    2005-11-15

    In an effort to achieve the objectives, the following scopes were categorized for in-depth study. First, analysis framework was developed for RT capacity development and international technology cooperation strategy. RT survey checklist and international technology cooperation was analyzed with interviewing and reports of domestic participants recently. Second, RT strategic environment was analyze for East-Asia hub competition/cooperation and developing nations using analysis framework. Korean RT was analyzed using SWOT analysis for establishment of RT hub in Korea. Third, East-Asian nations were classified analyzed by RT categories in standpoint of our country. Technology status and future cooperation plan were discussed about RT application for bio-medicine. Products/technology seminar related to an export was hold about support plan of admission/sales for functional food HemoHIM. This study can be utilized in the establishment of RT hub and development strategy. And it can be also utilized in promotion devising of domestic RT and planning setup for obtaing the international competitive power.

  7. The Use of Real-Time Reverse Transcription-PCR for Assessing Estrogen Receptor and Estrogen-Responsive Gene Expression.

    Science.gov (United States)

    Booze, Michelle L; Eyster, Kathleen M

    2016-01-01

    Real-time reverse transcription-polymerase chain reaction (RT-PCR), also known as quantitative RT-PCR (qRT-PCR), is a powerful tool for assessing gene transcription levels. The technique is especially useful for measuring estrogen receptor transcript levels as well as gene expression changes in response to estrogen stimulation as it is quick, accurate, robust, and allows the measurement of gene expression in a variety of tissues and cells. This chapter describes the protocols used for the real-time RT-PCR assay using hydrolysis (TaqMan-type) probes.

  8. Tiempo y espacio en atención primaria de salud

    OpenAIRE

    Uribe Oyarbide, José María

    1994-01-01

    En este artículo se esbozan las líneas de repercusión que la reforma sanitaria provoca en la percepción y significación de las categorías tiempo y espacio. La Atención Primaria de Salud obliga a un aprendizaje tanto para trabajadores sanitarios como para usuarios de los criterios que definen y contextualizan la prestación de los servicios de salud. En ese contexto, los equipos de Atención Primaria introducen variaciones en su interrelación con instituciones como los hospitales y los ambulator...

  9. Juan Huarte de San Juan (c.1529-c.1588) en la medicina de su tiempo

    OpenAIRE

    Arrizabalaga, Jon

    2003-01-01

    El proposito de este trabajo es comprender la personalidad de Huarte de San Juan en su contexto histórico, en particular sus relaciones con la medicina de su tiempo. Estas relaciones se analizan desde una doble perspectiva: de un lado, la biográfica, en razon de su formación y práctica médicas en la Corona de Castilla durante la segunda mitad del siglo XVI; de otro, la hermenéutica, en razón del papel decisivo jugado por el galenismo médico en la construcción de su EIC.

  10. Pensar en tiempos de crisis: ¿cómo dialogar con la vida?

    Directory of Open Access Journals (Sweden)

    Juan Felipe Guevara-Aristizábal

    2017-01-01

    Full Text Available Nuestra propuesta, en consecuencia, parte del concepto de crisis civilizatoria Ante la crisis civi- lizatoria que atravesamos, expresada en diversos problemas socioambientales, se hace necesario plantear formas de pensamiento diferentes cuyo punto de partida, en nuestro caso, se encuentra en la vida, ya sea como concepto científico o como forma de habitar el planeta. Ello nos per- mitirá cuestionar las bases epistemológicas de un modo de hacer ciencia que ha contribuido a la crisis, al tiempo que nos ofrece alternativas para pensar con la ciencia y salir al encuentro de otras tradiciones, como es el caso del sumak kawsay.

  11. Rómulo Betancourt. Liderazgo democrático versus personalismo en tiempos de celebraciones

    Directory of Open Access Journals (Sweden)

    Frédérique Langue

    2009-01-01

    Full Text Available Este ensayo intenta resaltar las principales etapas de un itinerario fundacional por lo que a práctica de la democracia representativa se refiere. Examina la manera cómo la obra y la acción políticas de Rómulo Betancourt influyeron de forma decisiva en la historia intelectual, el imaginario político y a la consolidaciónde la democracia en Venezuela durante la segunda mitad de siglo XX así como los retos que conllevan para el tiempo presente en el contexto del centenario de su nacimiento.

  12. Factores asociados con la adherencia a la actividad física en el tiempo libre

    OpenAIRE

    Arango Vélez, Elkin Fernando; Patiño Villada, Fredy Alonso; Díaz Cardona, Gildardo

    2014-01-01

    Introducción: existe en Colombia poco conocimiento respecto a los factores asociados con la adherencia al ejercicio. Objetivo: evaluar los factores asociados con la adherencia a la actividad física en el tiempo libre (AFTL) de los adultos que participan en un programa de actividad física (AF). Métodos: se realizó un estudio prospectivo de Casos y Controles. Se definió como caso a quien realizó durante un periodo de 5 meses un promedio 150 minutos o más de AFTL por semana a una intensidad mode...

  13. Tiempo y espacio en atención primaria de salud

    Directory of Open Access Journals (Sweden)

    JOSÉ Mª URIBE OYARBIDE

    1994-01-01

    Full Text Available En este artículo se esbozan las líneas de repercusión que la reforma sanitaria provoca en la percepción y significación de las categorías tiempo y espacio. La atención primaria de salud obliga a un aprendizaje tanto para los trabajadores sanitarios como para los usuarios de los criterios que definen y contextualizan la prestación de los servicios de salud. En este contexto, los equipos de atención primaria introducen variaciones en su interrelación con instituciones como los hospitales y los ambulatorios,

  14. Tiempo para quedar en embarazo: Evaluación de su reproducibilidad en una cohorte retrospectiva

    OpenAIRE

    Diana Carolina Jaimes Vega; Laura Andrea Rodriguez Villamizar; Luz Helena Sánchez

    2015-01-01

    Introducción: El tiempo para quedar en embarazo (TPE) es una medida clínica de la fecundidad útil en la evaluación de efectos reproductivos relacionados con exposiciones ambientales u ocupacionales. Estudios con mujeres europeas evidencian que su uso tiene una adecuada recordación y reproducibilidad; sin embargo, estas propiedades no han sido evaluadas en Latinoamérica. Objetivos: Evaluar la reproducibilidad de la medida TPE en una población de mujeres colombianas como una aproximación clínic...

  15. Cultura, rito y emplazamiento: espacio, tiempo y economía en comunidades Mapuche en Chile

    OpenAIRE

    Del Valle, Carlos; Facultad de Educación, Ciencias Sociales y Humanidades en la Universidad de La Frontera, Temuco, Chile; Maldonado, Claudio; Facultad de Educación, Ciencias Sociales y Humanidades en la Universidad de La Frontera, Temuco, Chile.; Del Valle, Juan; Investigador y Profesor de inglés en Fundación Creseres.

    2014-01-01

    El propósito del presente trabajo es abordar el proceso de desarrollo local en contextos interculturales, considerando el caso específico de un rito indígena mapuche, a partir de tres factores: el espacio, el tiempo y la oralidad; todas como dimensiones productoras de sentido. La preocupación frente a la globalización creciente de nuestras sociedades en relación a las comunidades locales no supone regular y filtrar la globalización, sino garantizar los procesos de producción simbólica. Por el...

  16. Tiempo requerido de enfermería para un cuidado con calidad

    OpenAIRE

    Puerta Cataño, Ana Margarita; Universidad de Antioquia; Gaviria Noreña, Dora Lucía; Universidad de Antioquia; Duque Henao, Sandra Lorena; Universidad de Antioquia

    2017-01-01

    Objetivo: Identificar el tiempo requerido de enfermería para el cuidado, la educación, la investigación y la gestión del cuidado y del servicio, a fin de determinar el talento humano necesario para la prestación del cuidado con calidad en un hospital de primer nivel de atención. Método: Estudio descriptivo-transversal realizado con estudiantes de enfermería del último semestre de pregrado. Se aplica el proceso de atención de enfermería (PAE), siguiendo los criterios de la NANDA y la valoració...

  17. El tiempo y los métodos de la biología

    OpenAIRE

    Murillo, J.I. (José Ignacio)

    2010-01-01

    La biología contemporánea comparte el ideal de las ciencias positivas. Esto supone que debe aceptar una reducción en sus objetivos explicativos. No obstante, para describir adecuadamente su objeto ha tenido que desprenderse del mecanicismo y adoptar teorías más ajustadas, como la cibernética o la teoría de sistemas. Esto posibilita planteamientos más respetuosos con la naturaleza del tiempo de los seres vivos. De todos modos, sólo la filosofía, que examina la realidad sin restr...

  18. Nuevas tendencias en el mercado laboral europeo: la reorganización del tiempo de trabajo

    OpenAIRE

    Sánchez García, Isabel; Rasines, Alberto

    1995-01-01

    El aumento del paro en la Comunidad a partir del año 1990 ha llevado, por un lado a muchos gobiernos europeos a fomentar las reducciones de las jornadas laborales en las empresas y, por otra parte, a numerosos sindicatos y patronos a firmar de forma descentralizada convenios colectivos con importantes reducciones de los tiempos de trabajo. El debate sobre la reducción de la jornada laboral sigue abierto y se vislumbra como un importante elemento de ajuste en el mercado laboral que permita hac...

  19. Una genealogía de la máscara mortuoria. Tiempo, imagen, presencia

    OpenAIRE

    López de Munain, Gorka, 1984-

    2017-01-01

    [spa] La presente investigación tiene como objetivo el estudio de las máscaras mortuorias desde una perspectiva doble: por un lado, busca desarrollar una teoría de la máscara mortuoria que nos permita organizar algunos de los elementos centrales que convergen en ellas (rostro, presencia, muerte, semejanza, tiempo, etc.) y, por otro, abordar una aplicación de dicha teoría sobre unos casos y entornos concretos previamente seleccionados. Es por ello que el objeto de estudio, las máscaras mortuor...

  20. TIEMPO Y EXPERIENCIA. EL COMPLEJO DURACION-MATERIA EN EL PENSAMIENTO DE HENRIQU BERGSON

    OpenAIRE

    RUIZ STULL, MIGUEL

    2012-01-01

    La presente tesis se propone indagar sobre aspectos específicos de la filosofía de Henri Bergson. La serie de conceptos que caracterizan este pensamiento, a saber, duración, memoria y élan vital se encuentran en nuestra hipótesis íntimamente ligadas con las nociones de tiempo y experiencia. En este sentido, esta investigación se centrará en analizar las condiciones de emergencia y desarrollo de estos conceptos en la medida en que son expresiones o productos de una configuración temporal de la...

  1. La obra minera del Rey Sabio y las explotaciones de su tiempo

    OpenAIRE

    Puche Riart, Octavio

    1995-01-01

    Toda la obra de Alfonso x el Sabio está impregnada de datos mineros, desde la Legislación a la Astronomía, desde los libros de Alquimia a los Lapidarios. Esta circunstancia no es de extrañar al ser la minería la industria histórica por excelencia y al ser sus productos, los minerales y los metales, materias primas imprescindibles y pilares básicos del comercio. 'A la influencia de los clásicos greco-latinos (principalmente de Aristóteles) y de la Biblia, conjunción obligada en aquellos tiempo...

  2. Demandas-control y salud: El rol mediador del tiempo libre

    OpenAIRE

    Londoño Londoño, María Eugenia; Cifre, Eva; Rosel Remírez, Jesús

    2016-01-01

    Esta investigación explora el papel mediador que tiene la utilización del tiempo libre en la relación existente entre las altas demandas mentales y el escaso control en el trabajo y las respuestas de engagement, burnout y sintomatología percibida. Participantes: 9.090 trabajadores y trabajadoras de 13 empresas colombianas. Metodología: verificación por medio de análisis de ecuaciones estructurales siguiendo los pasos propuestos por Baron y Kenny (2014). Resultados: disponer de tie...

  3. El calendario sagrado: El problema del tiempo en la sociología durkheimiana (I

    Directory of Open Access Journals (Sweden)

    RAMÓN RAMOS TORRE

    1989-01-01

    Full Text Available Al abordar sociológicamente el problema del tiempo, Durkheim no hizo sino intervenir en un debate muy vivo en su época. Ese debate tuvo en H. Bergson uno de sus protagonistas fundamentales. Su crítica "temporalista" de la ciencia moderna fue rechazada por Durkheim, que la minusvaloró como simple patología "mística". Consecuente con ese rechazo, la sociología durkheimiana encontró dificultades para definir sus relaciones con la historia y construir una "sociología dinámica" que diera cuenta del cambio histórico.

  4. Proyecciones de rabia canina en Argentina, Bolivia y Paraguay, usando series de tiempo

    OpenAIRE

    M. SCORTTI; P. CATTAN; M. CANALS

    1997-01-01

    Se estudió el número de casos mensuales de rabia canina en Argentina (1971-1993), Bolivia (1987-1993) y Paraguay (1976-1993), a fin de identificar fluctuaciones regulares y predecir el comportamiento futuro de la rabia en dichos países. Los métodos empleados consistieron en análisis de series de tiempo, incluyendo el análisis armónico de Fourier y los modelos multiplicativos ARIMA-SARIMA de Box-Jenkins. Se evidenciaron ciclos en Argentina y Paraguay. La estacionalidad ocurrió a fines de invie...

  5. Tiempo y aspecto verbal: marco teórico para la clase de ELE

    OpenAIRE

    Real Espinosa, Juan Manuel

    2005-01-01

    En el presente trabajo se analizan las relaciones temporales y aspectuales del verbo en español. Se defiende que el tiempo es una categoría gramatical pertinente con un comportamiento constante en los modos indicativo y subjuntivo, y que se estructura mediante dos pares de oposiciones binarias, que dan lugar a dos niveles o segmentos temporales y a cuatro áreas de significación temporal. Los comportamientos que podríamos considerar ajenos a esta norma, generan de forma regular un contenido mo...

  6. Contribución al modelado unidimensional en motores de dos tiempos de altas prestaciones

    OpenAIRE

    JIMENEZ MACEDO, VICTOR DANIEL

    2013-01-01

    Un modelo de simulación presenta muchas ventajas en el campo del desarrollo de motores de combustión interna alternativos. Su utilidad es doble. Por un lado, para entender la naturaleza de los fenómenos físicos que suceden en el interior del motor, y por otro, con el fin de optimizar el diseño de los sistemas que integran el mismo. El principal objetivo de esta tesis es desarrollar un modelo de un motor de dos tiempos de 125 cc de altas prestaciones para caracterizar la fluidodinámica interna...

  7. Percepción del clima emocional, problemas sociales y confianza institucional en tiempos de violencia

    OpenAIRE

    Gabriela Rodríguez Hernández

    2014-01-01

    El objetivo de este estudio es conocer el clima emocional que predomina en habitantes del Estado de México y cómo este se relaciona con la percepción de problemas sociales y la confianza institucional, en un tiempo en que la violencia se ubica como tema prioritario tanto en la agenda como en la percepción pública en México. Esta investigación es descriptiva-correlacional, de diseño transversal. Los resultados revelaron que en la muestra de 552 participantes, habitantes del Estado de México, l...

  8. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  9. Validation of Suitable Reference Genes for RT-qPCR Data in Achyranthes bidentata Blume under Different Experimental Conditions

    Directory of Open Access Journals (Sweden)

    Jinting Li

    2017-05-01

    Full Text Available Real-time quantitative polymerase chain reaction (RT-qPCR is a sensitive technique for gene expression studies. However, choosing the appropriate reference gene is essential to obtain reliable results for RT-qPCR assays. In the present work, the expression of eight candidate reference genes, EF1-α (elongation factor 1-α, GAPDH (glyceraldehyde 3-phosphate dehydrogenase, UBC (ubiquitin-conjugating enzyme, UBQ (polyubiquitin, ACT (actin, β-TUB (β-tubulin, APT1 (adenine phosphoribosyltransferase 1, and 18S rRNA (18S ribosomal RNA, was evaluated in Achyranthes bidentata samples using two algorithms, geNorm and NormFinder. The samples were classified into groups according to developmental stages, various tissues, stresses (cold, heat, drought, NaCl, and hormone treatments (MeJA, IBA, SA. Suitable combination of reference genes for RT-qPCR normalization should be applied according to different experimental conditions. In this study, EF1-α, UBC, and ACT genes were verified as the suitable reference genes across all tested samples. To validate the suitability of the reference genes, we evaluated the relative expression of CAS, which is a gene that may be involved in phytosterol synthesis. Our results provide the foundation for gene expression analysis in A. bidentata and other species of Amaranthaceae.

  10. Standardized quantitative RT-PCR assays for quantitation of yellow fever and chimeric yellow fever-dengue vaccines.

    Science.gov (United States)

    Mantel, N; Aguirre, M; Gulia, S; Girerd-Chambaz, Y; Colombani, S; Moste, C; Barban, V

    2008-07-01

    Yellow fever-dengue chimeras (CYDs) are being developed currently as live tetravalent dengue vaccine candidates. Specific quantitative assays are needed to evaluate the viral load of each serotype in vaccine batches and biological samples. A quantitative real-time RT-PCR (qRT-PCR) system was developed comprising five one-step qRT-PCRs targeting the E/NS1 junction of each chimera, or the NS5 gene in the yellow fever backbone. Each assay was standardized using in vitro transcribed RNA qualified according to its size and purity, and precisely quantified. A non RNA-extracted virus sample was introduced as external quality control (EQC), as well as 2 extraction controls consisting of 2 doses, 40 and 4,000 GEQ (genomic equivalents), of this EQC extracted in parallel to the samples. Between 6 and 10 GEQ/reaction were reproducibly measured with all assays and similar titers were obtained with the two methods when chimeric virus samples were quantified with the E/NS1- or the NS5-specific assays. Reproducibility of RNA extraction was ensured by automation of the process (yield>or=50%), and infectious virus was isolated in >or=80% of PCR-positive sera from immune monkeys.

  11. Identification and Validation of Reference Genes for qRT-PCR Studies of Gene Expression in Dioscorea opposita.

    Science.gov (United States)

    Zhao, Xiting; Zhang, Xiaoli; Guo, Xiaobo; Li, Shujie; Han, Linlin; Song, Zhihui; Wang, Yunying; Li, Junhua; Li, Mingjun

    2016-01-01

    Quantitative real-time polymerase chain reaction (qRT-PCR) is one of the most common methods for gene expression studies. Data normalization based on reference genes is essential for obtaining reliable results for qRT-PCR assays. This study evaluated potential reference genes of Chinese yam (Dioscorea opposita Thunb.), which is an important tuber crop and medicinal plant in East Asia. The expression of ten candidate reference genes across 20 samples from different organs and development stages was assessed. We identified the most stable genes for qRT-PCR studies using combined samples from different organs. Our results also suggest that different suitable reference genes or combinations of reference genes for normalization should be applied according to different organs and developmental stages. To validate the suitability of the reference genes, we evaluated the relative expression of PE2.1 and PE53, which are two genes that may be associated with microtuber formation. Our results provide the foundation for reference gene(s) selection in D. opposita and will contribute toward more accurate gene analysis studies of the genus Dioscorea.

  12. Management and Development of the RT Research Facilities and Infrastructures

    International Nuclear Information System (INIS)

    Kim, Won Ho; Nho, Young Chang; Kim, Jae Sung

    2009-01-01

    The purpose of this project are to operate the core facilities of the research for the Radiation Technology in stable and to assist the research activities efficiently in the industry, academic, and research laboratory. By developing the infrastructure of the national radio technology industry, we can activate the researching area of the RT and the related industry, and obtain the primary and original technology. The key point in the study of the RT and the assistance of the industry, academic, and research laboratory for the RT area smoothly, is managing the various of unique radiation facilities in our country. The gamma Phytotron and Gene Bank are essential in the agribiology because these facilities are used to preserve and utilize the genes and to provide an experimental field for the environment and biotechnology. The Radiation Fusion Technology research supporting facilities are the core support facilities, and are used to develop the high-tech fusion areas. In addition, the most advanced analytical instruments, whose costs are very high, should be managed in stable and be utilized in supporting works, and the experimental animal supporting laboratory and Gamma Cell have to be maintained in high level and managed in stable also. The ARTI have been developed the 30MeV cyclotron during 2005∼2006, aimed to produce radioisotopes and to research the beam applications as a result of the project, 'Establishment of the Infrastructure for the Atomic Energy Research Expansion', collaborated with the Korea Institute of Radiological and Medical Sciences. In addition, the ARTI is in the progress of establishing cyclotron integrated complex as a core research facility, using a proton beam to produce radioisotopes and to support a various research areas. The measurement and evaluation of the irradiation dose, and irradiation supporting technology of the Good Irradiation Practice(GIP) are essential in various researching areas. One thing to remember is that the publicity

  13. Screening Reliable Reference Genes for RT-qPCR Analysis of Gene Expression in Moringa oleifera.

    Science.gov (United States)

    Deng, Li-Ting; Wu, Yu-Ling; Li, Jun-Cheng; OuYang, Kun-Xi; Ding, Mei-Mei; Zhang, Jun-Jie; Li, Shu-Qi; Lin, Meng-Fei; Chen, Han-Bin; Hu, Xin-Sheng; Chen, Xiao-Yang

    2016-01-01

    Moringa oleifera is a promising plant species for oil and forage, but its genetic improvement is limited. Our current breeding program in this species focuses on exploiting the functional genes associated with important agronomical traits. Here, we screened reliable reference genes for accurately quantifying the expression of target genes using the technique of real-time quantitative polymerase chain reaction (RT-qPCR) in M. oleifera. Eighteen candidate reference genes were selected from a transcriptome database, and their expression stabilities were examined in 90 samples collected from the pods in different developmental stages, various tissues, and the roots and leaves under different conditions (low or high temperature, sodium chloride (NaCl)- or polyethyleneglycol (PEG)- simulated water stress). Analyses with geNorm, NormFinder and BestKeeper algorithms revealed that the reliable reference genes differed across sample designs and that ribosomal protein L1 (RPL1) and acyl carrier protein 2 (ACP2) were the most suitable reference genes in all tested samples. The experiment results demonstrated the significance of using the properly validated reference genes and suggested the use of more than one reference gene to achieve reliable expression profiles. In addition, we applied three isotypes of the superoxide dismutase (SOD) gene that are associated with plant adaptation to abiotic stress to confirm the efficacy of the validated reference genes under NaCl and PEG water stresses. Our results provide a valuable reference for future studies on identifying important functional genes from their transcriptional expressions via RT-qPCR technique in M. oleifera.

  14. MO-E-BRC-01: Online Adaptive MR-Guided RT: Workflow and Clinical Implementation

    Energy Technology Data Exchange (ETDEWEB)

    Kashani, R. [Washington University School of Medicine (United States)

    2016-06-15

    Online adaptive radiation therapy has the potential to ensure delivery of optimal treatment to the patient by accounting for anatomical and potentially functional changes that occur from one fraction to the next and over the course of treatment. While on-line adaptive RT (ART) has been a topic of many publications, discussions, and research, it has until very recently remained largely a concept and not a practical implementation. However, recent advances in on-table imaging, use of deformable image registration for contour generation and dose tracking, faster and more efficient plan optimization, as well as fast quality assurance method has enabled the implementation of ART in the clinic in the past couple of years. The introduction of these tools into routine clinical use requires many considerations and progressive knowledge to understand how processes that have historically taken hours/days to complete can now be done in less than 30 minutes. This session will discuss considerations to perform real time contouring, planning and patient specific QA, as well as a practical workflow and the required resources. Learning Objectives: To understand the difficulties, challenges and available technologies for online adaptive RT. To understand how to implement online adaptive therapy in a clinical environment and to understand the workflow and resources required. To understand the limitations and sources of uncertainty in the online adaptive process I have research funding from ViewRay Inc. and Philips Medical Systems.; R. Kashani, I have research funding from ViewRay Inc. and Philips Medical Systems.; X. Li, Research supported by Elekta Inc.

  15. MO-E-BRC-01: Online Adaptive MR-Guided RT: Workflow and Clinical Implementation

    International Nuclear Information System (INIS)

    Kashani, R.

    2016-01-01

    Online adaptive radiation therapy has the potential to ensure delivery of optimal treatment to the patient by accounting for anatomical and potentially functional changes that occur from one fraction to the next and over the course of treatment. While on-line adaptive RT (ART) has been a topic of many publications, discussions, and research, it has until very recently remained largely a concept and not a practical implementation. However, recent advances in on-table imaging, use of deformable image registration for contour generation and dose tracking, faster and more efficient plan optimization, as well as fast quality assurance method has enabled the implementation of ART in the clinic in the past couple of years. The introduction of these tools into routine clinical use requires many considerations and progressive knowledge to understand how processes that have historically taken hours/days to complete can now be done in less than 30 minutes. This session will discuss considerations to perform real time contouring, planning and patient specific QA, as well as a practical workflow and the required resources. Learning Objectives: To understand the difficulties, challenges and available technologies for online adaptive RT. To understand how to implement online adaptive therapy in a clinical environment and to understand the workflow and resources required. To understand the limitations and sources of uncertainty in the online adaptive process I have research funding from ViewRay Inc. and Philips Medical Systems.; R. Kashani, I have research funding from ViewRay Inc. and Philips Medical Systems.; X. Li, Research supported by Elekta Inc.

  16. Gestión del tiempo en alumnado universitario con diferentes niveles de rendimiento académico

    Directory of Open Access Journals (Sweden)

    Angélica Garzón Umerenkova

    2017-09-01

    Full Text Available Resumen En este trabajo se estudia la relación entre gestión del tiempo y rendimiento académico en el alumnado universitario. La hipótesis de partida es que los estudiantes con alto nivel de habilidades en gestión del tiempo obtienen mejores resultados de aprendizaje. Se ha utilizado una muestra de 494 estudiantes universitarios de primer año, en dos universidades colombianas. A esta muestra se administró una adaptación al español del Time Management Behavior Questionnaire (TMBQ, y se recogieron datos sobre las calificaciones académicas en su primer año en la universidad. De manera complementaria, se han celebrado cuatro grupos focales con alumnado de bajo y alto nivel de rendimiento, accediendo a sus experiencias, opiniones y valoraciones en relación con la gestión del tiempo. Los resultados obtenidos indican la existencia de una cierta relación positiva entre las dos variables analizadas, en línea con los hallazgos de estudios previos. Al comparar la gestión del tiempo entre subgrupos de estudiantes que alcanzan las mejores y peores calificaciones, se observan diferencias a favor de los primeros, particularmente en la sub-escala relativa a sus percepciones sobre el control del tiempo. Los discursos de grupo reflejan también mejores conductas autorregulatorias en el manejo del tiempo por parte del alumnado de alto nivel de rendimiento. De acuerdo con estos resultados, se hacen recomendaciones sobre el entrenamiento del alumnado universitario de primer año en estrategias para la gestión del tiempo.

  17. Real Closed Rings and Real Closed * Rings

    OpenAIRE

    Capco, Jose

    2007-01-01

    Here we try to distinguish and compare different notions of real closedness mainly one developed by N. Schwartz in his Habilitationschrift and the other developed by A. Sankaranand K. Varadarajan which we shall call real closed *. We stick to the definition of real closed rings as defined and characterized N. Schwartz and we try to determine and characterize real closed rings that are real closed *. The main result is that real closed rings have unique real closure * and that real closure of ...

  18. Laguna Verde simulator: A new TRAC-RT based application

    International Nuclear Information System (INIS)

    Munoz Cases, J.J.; Tanarro Onrubia, A.

    2006-01-01

    In a partnership with GSE Systems, TECNATOM is developing a full scope training simulator for Laguna Verde Unit 2 (LV2). The simulator design is based upon the current 'state-of-the art technology' regarding the simulation platform, instructor station, visualization tools, advanced thermalhydraulics and neutronics models, I/O systems and automated model building technology. When completed, LV2 simulator will achieve a remarkable level of modeling fidelity by using TECNATOM's TRAC-RT advanced thermalhydraulic code for the reactor coolant and main steam systems, and NEMO neutronic model for the reactor core calculations. These models have been utilized up to date for the development or upgrading of nine NPP simulators in Spain and abroad, with more than 8000 hours of training sessions, and have developed an excellent reputation for its robustness and high fidelity. (author)

  19. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  20. De jóvenes a estudiantes. La forja del tiempo y el orden escolares

    Directory of Open Access Journals (Sweden)

    Antonio Padilla Arroyo

    2012-02-01

    Full Text Available Una de las dimensiones culturales más significativas de las formas del tiempo social lo constituye el tiempo escolar, el cual se convierte en un instrumento primordial en los “procesos civilizatorios” en la medida en que regula las actividades que el niño y el joven necesitan realizar en un espacio como la institución educativa. Esto im plica la organización de los hábitos del trabajo escolar mediante una disciplina que incorpora incentivos, estímulos, saberes, sentimientos, conductas, habilidades, valores e ideas, todo ello en un marco de regulaciones y controles específicos, cuyo objetivo es la configuración de una naturaleza humana. Abstract One of the more significant cultural dimensions of the social time pertains to school time, which converts into a primordial instrument in the “process that civilize” and at the same time it regulates the activities that the child and the young need to carry through in a space as the educative instruction. This implies that the organization habits of the school work by means of one of the disciplines that incorporate incentives, stimulus, knowledge, feelings, behaviors, abilities, values and ideas , all that in landmarks of regulations and specific controls whose objective is the configuration of a human being. Keywords Social Time; School Time; School Culture