WorldWideScience

Sample records for tiempo real rt

  1. Sistemas en tiempo real

    OpenAIRE

    Ramón, Hugo Dionisio; Romero, Fernando

    2002-01-01

    El objetivo de esta línea de investigación es el estudio y desarrollo de aplicaciones que poseen restricciones temporales. Resulta de interés el estudio de diferentes metodologías para la especificación y desarrollo de aplicaciones en tiempo real, así como las plataformas donde dichas aplicaciones pueden ejecutarse. Se trabaja experimentalmente con distintos tipos de hardware y software entre los que pueden mencionarse placas A/D, mini-robots, máquinas multimicroprocesadores y diferentes s...

  2. MINIX4RT: Real-Time Semaphores

    OpenAIRE

    Pessolani, Pablo Andrés

    2007-01-01

    MINIX4RT es una extensión del conocido Sistema Operativo MINIX que incorpora servicios de Tiempo Real Estricto en un nuevo microkernel pero manteniendo compatibilidad con las versiones anteriores del MINIX estándar. Los semáforos son el mecanismo primitivo para la sincronización y exclusion mutua en varios sistemas operativos, pero MINIX no brinda esa facilidad. Se adicionaron semáforos a MINIX4RT y, como éste es un Sistema Operativo de Tiempo Real, deben reunir ciertos requisitos de procesam...

  3. Sistemas de tiempo real y sistemas distribuidos de tiempo real

    OpenAIRE

    Pesado, Patricia Mabel; Ramón, Hugo Dionisio; Boracchia, Marcos; Pasini, Ariel C.; De Vito, María Cecilia; Osella Massa, Germán Leandro; Estrebou, César Armando

    2006-01-01

    El proyecto de investigación y desarrollo en Sistemas de Software Distribuido, abarca aspectos que van desde los fundamentos del desarrollo (Técnicas de Ingeniería de Requerimientos, Metodologías de Gestión y Desarrollo de Proyectos, Técnicas de Planificación, Métricas, Normas de Calidad, Web-Systems) hasta la concepción de aplicaciones específicas orientadas a los procesos industriales (Sistemas de Planeamiento de Producción, Control Industrial en tiempo real), procesos de E-government (Voto...

  4. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  5. Detección mediante RT-PCR en tiempo real del virus vacunal en cerdos inmunizados con la vacuna cubana contra la peste porcina clásica

    Directory of Open Access Journals (Sweden)

    Tania Campos-Cuello

    2016-08-01

    Full Text Available La peste porcina clásica (PPC es una enfermedad viral infectocontagiosa, producida por un virus ARN del género Pestivirus, familia Flaviviridae. En la actualidad es una de las causas de pérdidas económicas en la industria porcina a nivel mundial. En su prevención se han utilizado vacunas vivas atenuadas, empleando la cepa China lapinizada. La Reacción en Cadena de la Polimerasa Reverso Transcriptasa (RT-PCR ha sido uno de los métodos más sensibles aplicado en Medicina Veterinaria para la detección de virus ARN. En el caso del virus de la PPC es muy útil porque el ácido nucleico se puede detectar desde muy temprano en la infección y en periodos más largos en aquellos animales que se recuperan. El objetivo de este estudio fue aplicar la técnica de RT-PCR en tiempo real para la detección de la cepa China lapinizada de la vacuna cubana contra la PPC. Las tonsilas de los cerdos vacunados fueron el órgano más positivo en la detección del ARN del virus vacunal. Los resultados obtenidos evidenciaron una interferencia del virus vacunal en el diagnóstico, siendo el día 12 posvacunación en el que se obtiene una emisión umbral de fluorescencia más bajo.

  6. MINIX4RT: real-time interprocess communications facilities

    OpenAIRE

    Pessolani, Pablo Andrés

    2006-01-01

    MINIX4RT es una extensión del conocido Sistema Operativo MINIX que incorpora servicios de Tiempo Real Estricto en un nuevo microkernel pero manteniendo compatibilidad con las versiones anteriores del MINIX estándar. La Comunicación entre Procesos es un mecanismo que permite hacer extensible a un Sistema Operativo, pero debe estar libre de Inversión de Prioridades para ser utilizado en aplicaciones de Tiempo Real. Como las primitivas de MINIX no disponen de esta funcionalidad, se incorporar...

  7. Módulo Distribuido de Subasta Java sobre CORBA de Tiempo Real

    Directory of Open Access Journals (Sweden)

    P. Basanta-Val

    2012-10-01

    Full Text Available Resumen: El uso de infraestructuras middleware que permitan intercomunicar diferentes nodos de un sistema puede aliviar aspectos importantes relacionados con el coste de desarrollo y mantenimiento de dichos sistemas en entornos flexibles. En este contexto el artículo presenta una arquitectura desarrollada dentro del contexto de los sistemas de subasta distribuidos que tienen ciertos requisitos de tiempo real que han de ser satisfechos. Dicha arquitectura implementa un sistema de puja doble (CDA para un sistema de tiempo real industriales. El artículo presenta tanto la arquitectura del sistema con sus diferentes actores así como una evaluación en una plataforma real utilizando middleware de tiempo real ya existente. Abstract: Using middleware infrastructures that enable communication among different nodes in a system may alleviate aspects related to management and development cost in flexible environments. In that context the article presents an auction architecture with certain real-time requirements that have to be satisfied. The architecture implements a continuous double action (CDA algorithm for a real-time middleware. The article describes the architecture (actors and goals and the results obtained by using common-off-the-shelf real-time middleware. Palabras clave: Sistema de Subasta, Informática Industrial, Middleware, Tiempo Real, RT-CORBA, Real-time Java, Keywords: Action Systems, Real-time, Middleware, Industrial informatics, RT-CORBA, Real-time Java

  8. Sistemas de tiempo real en situaciones de sobrecarga

    OpenAIRE

    Pérez Almansa, Jordi

    2005-01-01

    En el proyecto presentado en esta memoria se estudia el análisis de sistemas de tiempo real en los que se debe verificar el cumplimiento de ciertos requerimientos temporales, principalmente referidos a plazos máximos de ejecución. El análisis de estos requerimientos se basa en el estudio de la Calidad de Control del sistema, es decir, observar como responde el sistema cuando tiene situaciones de sobrecarga. El análisis y diseño en tiempo real se trata de una tarea compleja, que requiere la...

  9. Alternativas eficientes para procesamiento y comunicaciones en sistemas de tiempo real

    OpenAIRE

    Romero, Fernando; Méndez, Mariano; Encinas, Diego; De Giusti, Armando Eduardo; Tinetti, Fernando Gustavo; Medina, Santiago; Pi Puig, Martín; Paniego, Juan Manuel; Dell'Oso, Matías

    2017-01-01

    El objetivo de esta línea de investigación es el estudio y desarrollo de Sistemas de Tiempo Real (STR), en particular, la planificación de tareas y la comunicación en Sistemas Distribuidos de Tiempo Real (SDTR), experimentando con microcontroladores y simulaciones para la adquisición y control de las variables del sistema.

  10. Evaluación de sistemas operativos de tiempo real sobre microcontroladores

    OpenAIRE

    Medina, Santiago; Pi Puig, Martín; Paniego, Juan Manuel; Dell'Oso, Matías; Romero, Fernando; De Giusti, Armando Eduardo; Tinetti, Fernando Gustavo

    2015-01-01

    En el presente trabajo se presentan mediciones sobre diferentes sistemas operativos que soportan las características de tiempo real, instalados sobre un sistema de microcontrolador. Dichas evaluaciones caracterizan los posibles tiempos de respuesta, es decir, un límite que determina el tipo de aplicación en la cual pueden ser utilizados, dentro del marco del desarrollo de aplicaciones de Sistemas Embebidos de Tiempo Real. Una de las principales métricas es el tiempo de latencia, el cual repre...

  11. Un modelo de eventos discretos para la simulación de sistemas de tiempo real

    OpenAIRE

    Páez, Francisco E.; Urriza, José M.; Orozco, Javier D.; Buckle, Carlos

    2011-01-01

    En este trabajo se presenta un modelo de eventos discretos para el diseño de simuladores de Sistemas de Tiempo Real. Los simuladores sirven para realizar comprobaciones de algoritmos, modelos, técnicas y para evaluar métricas de rendimiento. El modelo de eventos discretos se ajusta perfectamente a los sistemas dinámicos discretos como lo son los Sistemas de Tiempo Real. El modelo se desarrolla empleando la técnica de grafo de eventos, debido a su sencillez y facilidad de implementación.

  12. Gestión del tiempo ocioso dinámico para ajustar el consumo de energía en tareas de tiempo real integrando control multifrecuencia

    Directory of Open Access Journals (Sweden)

    Alfonso Salvador Alfonsi Sebastiani

    2014-11-01

    Full Text Available Este trabajo tiene como objetivo ajustar la energía consumida por tareas de tiempo real críticas, producto de la variabilidad de sus tiempos de cómputo usando la integración del control multifrecuencia y la planificación realimentada. Se adaptaron e integraron técnicas dinámicas que manejan el tiempo ocioso debido al tiempo de ejecución en el peor caso, al factor de carga del procesador y el aprovechamiento del tiempo ocioso por estiramiento a la(s próxima(s activación(es, en una Técnica Dinámica Multifrecuencia para el Manejo del Tiempo Ocioso, alojada en un planificador realimentado para el ahorro de energía, dirigido a procesadores que varían el voltaje de alimentación y frecuencia de operación. Además se tomó ventaja de las técnicas de control multifrecuencia dado que la gestión de recursos es formulada como un problema de control de sistemas de cómputo que especifica a cada tarea por un lazo de control que trabaja a su propio periodo de activación, diferentes a los requeridos en la referencia y respuesta del sistema (factor de carga total del procesador.Los resultados arrojan que el tiempo ocioso debido a variabilidad de los tiempos de cómputo se distribuye de forma natural por los lazos de control multifrecuencia, global y localmente, pudiendo llegar a un ahorro de energía del 61,04%, dando un valor agregado Intra e InterTarea. Además, sugiere un buen desempeño al contrastarlo con otras estrategias.

  13. Desarrollo de un sistema de reconocimiento de emociones faciales en tiempo real

    OpenAIRE

    Ribes Gil, Héctor

    2017-01-01

    Una organización del trastorno nutricional ha puesto en práctica un nuevo tratamiento para sus pacientes. Éste está directamente relacionado con la emoción del paciente, cuya emoción se clasifica oralmente. Llegados a ese punto aparece el reto de automatizar esta tarea, desarrollando un sistema de reconocimiento de emociones faciales en tiempo real caracterizado por un detector de rostros, un detector de Key Points y una red neuronal convolucional utilizando "DeepLearning" para extraer las ca...

  14. Reconocimiento de gestos en tiempo real basado en heurísticas y reconocimiento de patrones

    OpenAIRE

    López Rincón, Omar

    2015-01-01

    Desde los inicios de la computación, el área de procesado de imagen se ha ido incrementando y llegando a nuevas fronteras gracias al incremento del poder computacional que no se detiene, más rutinas han llegado a ser posibles, entre ellas el procesado de imagen en tiempo real. El desarrollo en el procesado de imagen ha ido incrementando junto con el desarrollo de nuevos procesadores y velocidad de computo, esto mismo ha ido abarcando desde imágenes satelitales, medicina y hoy en día los prime...

  15. Femtoquímica: reacciones en tiempo real, ?`Posibles aplicaciones en Astrofísica?

    Science.gov (United States)

    Douhal, Abderrazzak

    En esta conferencia, se mostrarán resultados de medidas en escala del femtosegundo por la primera vez obtenidos en España. Los sistemas elegidos muestran dinámicas que varían de 50 fs a centenas de picosegundo. La técnica usada (sumación de frecuencia) permite ver como ocurren las reacciones químicas y biológicas en tiempo real de reacciones. Su aplicación al estudio de las reacciones fotónicas en el espacio es evidente.

  16. Simulación en tiempo real de un MPC utilizando herramientas de software libre

    Directory of Open Access Journals (Sweden)

    Rafael F. Tanda Martínez

    2011-05-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabla normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} En este trabajo se implementa un controlador predictivo basado en modelos ARX en forma de bloque para el CACSD Scicos. El controlador es simulado sobre una plataforma RCP basada en herramientas de código abierto y libre distribución, como Scicoslab/Scicos, RTAI-LAB y el sistema operativo de tiempo real Linux/RTAI. Para la validación de esta estrategia de control se utiliza un proceso de segundo orden con un retardo considerablemente grande. La visualización y recolección de los datos, así como el ajuste de los parámetros de la tarea de tiempo real en ejecución se hacen mediante un osciloscopio virtual llamado Qrtailab.

  17. Detección de fraude bancario en tiempo real utilizando tecnologías de procesamiento distribuido

    OpenAIRE

    Mansilla Montero, Javier

    2016-01-01

    En este Trabajo de Fin de Máster se desarrollará un sistema de detección de fraude en pagos con tarjeta de crédito en tiempo real utilizando tecnologías de procesamiento distribuido. Concretamente se considerarán dos tecnologías: TIBCO, un conjunto de herramientas comerciales diseñadas para el procesamiento de eventos complejos, y Apache Spark, un sistema abierto para el procesamiento de datos en tiempo real. Además de implementar el sistema utilizando las dos tecnologías propuestas, un objet...

  18. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    . METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...

  19. Analyzer of neutron flux in real time; Analizador de flujo neutronico en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Rojas S, A.S.; Carrillo M, R.A.; Balderas, E.G. [Instituto Nacional de Investigaciones Nucleares, A.P. 18-1027, 11801 Mexico D.F. (Mexico)

    1999-07-01

    With base in the study of the real signals of neutron flux of instability events occurred in the Laguna Verde nuclear power plant where the nucleus oscillation phenomena of the reactor are in the 0 to 2.5 Hz range, it has been seen the possibility about the development a surveillance and diagnostic equipment capable to analyze in real time the behavior of nucleus in this frequencies range. An important method for surveillance the stability of the reactor nucleus is the use of the Power spectral density which allows to determine the frequencies and amplitudes contained in the signals. It is used an instrument carried out by LabVIEW graphic programming with a data acquisition card of 16 channels which works at Windows 95/98 environment. (Author)

  20. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  1. Monitor of dynamic parameters in real time; Monitor de parametros dinamicos en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Rojas S, A.S.; Ruiz E, J.A. [ININ, 52750 La Marquesa, Estado de Mexico (Mexico)

    2008-07-01

    In the complex physical systems exist parameters that are necessary for monitoring in real time. In the nuclear industry, particularly in a reactor this surveillance is important, where the times of the reactions are almost instantaneous. Although many of these parameters are monitored, given the advance of the computer systems the monitoring could either be enlarged direct or indirect of other parameters. The analysis of the neutron noise in the nuclear reactors, plays an important role, the noise signal it contains information about the operation conditions of a system, when analyzing it with analysis methodologies of analogical signals to provide important information for the early detection of possible flaws and to indicate the permissible operation levels. To show the characteristics of the operation of the system of Monitoring of Dynamic Parameters in Real Time, oscillations of neutron noise of the TRIGA Mark III of the ININ were analyzed, these were caused with the control bar to a power of 10 Watts, the oscillations were carried out to a frequency of 1Hz, signal of low frequency. In this work a virtual instrument that allows by means of the spectral analysis method in frequency point by point is presented, to indicate in real time periodic variations that could be presented in the neutron noise signal, visualizing in advance the dynamic behavior of the system or nuclear plant. Another of the tests of the monitoring system presented is that of the oscillatory event happened in the reactor of Laguna Verde Nucleo electric Central, would be convenient to have an instrument of surveillance for monitoring through the neutron noise signal the behavior of some important parameter to predict and to indicate in an immediate way an abnormal condition in the reactor operation or in the plant system. These parameters can be the power, the recirculation water flow, etc. The monitor is based on a personal computer (PC), a data acquisition card (ADC) and a computer program

  2. RT-Syn: A real-time software system generator

    Science.gov (United States)

    Setliff, Dorothy E.

    1992-01-01

    This paper presents research into providing highly reusable and maintainable components by using automatic software synthesis techniques. This proposal uses domain knowledge combined with automatic software synthesis techniques to engineer large-scale mission-critical real-time software. The hypothesis centers on a software synthesis architecture that specifically incorporates application-specific (in this case real-time) knowledge. This architecture synthesizes complex system software to meet a behavioral specification and external interaction design constraints. Some examples of these external constraints are communication protocols, precisions, timing, and space limitations. The incorporation of application-specific knowledge facilitates the generation of mathematical software metrics which are used to narrow the design space, thereby making software synthesis tractable. Success has the potential to dramatically reduce mission-critical system life-cycle costs not only by reducing development time, but more importantly facilitating maintenance, modifications, and extensions of complex mission-critical software systems, which are currently dominating life cycle costs.

  3. 17th IEEE NPSS Real Time Conference – RT-2010

    CERN Multimedia

    Carlos Varandas

    2010-01-01

    Congress Centre of “Instituto Superior Técnico”, Lisboa, Portugal, 24-28 May, 2010 ABSTRACT SUBMISSION OPEN Abstract Submission Deadline: March 1st, 2010 Dear Sir/Madam, We are pleased to announce that abstract submission for the 17th IEEE NPSS Real Time Conference is now open on our web site. The deadline for submitting an abstract is 1st March 2010. Full conference details General Chairman

  4. Data acquisition and real-time bolometer tomography using LabVIEW RT

    International Nuclear Information System (INIS)

    Giannone, L.; Eich, T.; Fuchs, J.C.; Ravindran, M.; Ruan, Q.; Wenzel, L.; Cerna, M.; Concezzi, S.

    2011-01-01

    The currently available multi-core PCI Express systems running LabVIEW RT (real-time), equipped with FPGA cards for data acquisition and real-time parallel signal processing, greatly shorten the design and implementation cycles of large-scale, real-time data acquisition and control systems. This paper details a data acquisition and real-time tomography system using LabVIEW RT for the bolometer diagnostic on the ASDEX Upgrade tokamak (Max Planck Institute for Plasma Physics, Garching, Germany). The transformation matrix for tomography is pre-computed based on the geometry of distributed radiation sources and sensors. A parallelized iterative algorithm is adapted to solve a constrained linear system for the reconstruction of the radiated power density. Real-time bolometer tomography is performed with LabVIEW RT. Using multi-core machines to execute the parallelized algorithm, a cycle time well below 1 ms is reached.

  5. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. MINIX4RT: a real-time operating system based on MINIX

    OpenAIRE

    Pessolani, Pablo Andrés

    2006-01-01

    Tanenbaum's MINIX Operating System was extended with a Real-Time microkernel and services to conform MINIX4RT, a Real-Time Operating System for academic uses that includes more flexible Interprocess Communications facilities supporting basic priority inheritance protocol, a fixed priority scheduler, timer and event driven interrupt management, statistics and Real-Time metrics gathering keeping backward compatibility with standard MINIX versions. Facultad de Informática

  7. Mejora de los Test de Planificabilidad para Asignación Incremental de Tareas en Sistemas Multiprocesadores de Tiempo Real

    Directory of Open Access Journals (Sweden)

    Sergio Sáez

    2013-04-01

    Full Text Available Resumen: Durante la etapa de diseño de un sistema multiprocesador de tiempo real, los test de planificabilidad son una parte clave de los algoritmos de asignación de tareas. El uso de test de planificabilidad exactos permite aumentar la eficiencia de los algoritmos de asignación a costa de un incremento en el tiempo de computo necesario para validar una partición. Aunque existen varios estudios que mejoran el rendimiento de dichos test de planificabilidad, ninguno se ha centrado en el contexto en que dichos test se utilizan. Este trabajo presenta diversas mejoras en los test de planificabilidad exactos basándose en la naturaleza incremental del proceso de asignación. Abstract: During the design of a Real-Time Multiprocessor System, schedulability tests are a key component of the task allocation algorithms. Using exact schedulability tests increases the efficiency of these allocation algorithms, but the execution cost to validate a task partition is also greatly increased. Although several improvement to these schedulability test have been recently published, their use in the multiprocessor context is still unaddressed. This work presents several improvements to execution costs of the schedulability test when they are used by task allocation algorithms taking advantage of the incremental nature of this allocation process. Palabras clave: Sistema Multiprocesadores, Análisis de Planificabilidad, Sistema de Tiempo Real, Keywords: Multiprocessor Systems, Schedulability Analysis, Real-Time Systems

  8. La diástasis del tiempo real, entre el mito, la praxis y el éskhaton

    Directory of Open Access Journals (Sweden)

    Cencillo, Luis

    2004-06-01

    Full Text Available Unlike physical time, which is what docks measure, living time is multidimensional because it concerns the very being of the living. For the living human being, time is existing; his experiencing time is his experiencing the active rhythm of his existing. This experiencing varies as it is either individual or collective, subjectal or socially committed in a praxis that produces «a world.» There are several modes, levels or rhythms of time (e. g., existential, junctural, terminal, as there are several —personally lived— experiences in time, such as that of anticipation, rush, changing (developmentally or abruptly or aging. Mythical time is not an historical time, yet it is not unreal: explains the origins of a people and their institutions or a regular phenomenon. Lived real time is the active dynamics of joining a past that remains as the effect of «past» (but operative causes, unfolding toward a future that begins to appear before our eyes —sometimes against our will—, with a present that is tension and sudden movement for a project that is still unreal. Existing is an organic and structured totality (Gestalt, which will terminate because of its very nature as an articulated process.

    A diferencia del tiempo físico, que es el que miden los relojes, el tiempo vital es múltiple, porque se trata del ser mismo del viviente. En el ser humano es el existir y su vivencia de tiempo es la vivencia de su ritmo vivo existiendo. Esta vivencia se diversifica en cuanto individual o en cuanto colectiva, en cuanto subjetal y en cuanto socialmente comprometida en una praxis productora de "mundo". Se pueden distinguir varias modalidades, niveles y ritmos de tiempo (v. g., un tiempo existencial, un tiempo coyuntural, un tiempo terminal, así como diversas experiencias personalmente vividas en el tiempo, como de anticipación, o de prisa, o de estar cambiando (evolutiva o abruptamente, o de envejecimiento. El tiempo mítico es un tiempo

  9. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  10. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  11. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  12. Marco de Componentes con soporte para reemplazo dinámico y seguro en sistemas de tiempo real

    Directory of Open Access Journals (Sweden)

    Julio Cano

    2014-01-01

    Full Text Available Resumen: En las últimas décadas se han aportado soluciones para el desarrollo de sistemas de tiempo real basados en componentes como base para aumentar la productividad y la fiabilidad de su desarrollo así como su posterior mantenimiento. De modo más reciente están apareciendo soluciones que permiten cierta flexibilidad en estos sistemas con miras a soportar ejecución dinámica a través de reemplazos de componentes en tiempo de ejecución. Para ello se adaptan los modelos de componentes intentando minimizar los conflictos que aparecen al integrar tiempo real y comportamiento dinámico y conseguir reemplazos de componentes en un tiempo acotado. Uno de los principales retos para esto es el cálculo de los tiempos requeridos por las diferentes operaciones necesarias para realizar un reemplazo de componente. El otro gran obstáculo es conocer los tiempos de operación de los componentes del sistema cuando la implementación de éstos puede cambiar durante la vida del sistema. En este trabajo se describe la implementación de un marco de componentes que aporta una solución parcial a estos problemas. Se proporciona un modelo de componentes junto con sus correspondientes algoritmos para asegurar que los componentes pueden ser cargados y reemplazados en tiempo de ejecución sin interferir en el cumplimiento de sus plazos de ejecución. El modelo está diseñado para evitar fallos en los reemplazos de componente. Finalmente se aporta la validación de los conceptos presentados. Abstract: In the last decades solutions have been provided for the real- time component-based systems development as a base to increase productivity and reliability of their development as well as their maintenance. Solutions are increasingly appearing that allow controlled flexibility in these systems, aiming to support dynamic execution through the component replacement at run-time. So, component models are adapted trying to minimize conflicts integrating real-time and

  13. Real-time particle image velocimetry based on FPGA technology;Velocimetria PIV en tiempo real basada en logica programable FPGA

    Energy Technology Data Exchange (ETDEWEB)

    Iriarte Munoz, Jose Miguel [Universidad Nacional de Cuyo, Instituto Balseiro, Centro Atomico Bariloche (Argentina)

    2008-07-01

    Particle image velocimetry (PIV), based on laser sheet, is a method for image processing and calculation of distributed velocity fields.It is well established as a fluid dynamics measurement tool, being applied to liquid, gases and multiphase flows.Images of particles are processed by means of computationally demanding algorithms, what makes its real-time implementation difficult.The most probable displacements are found applying two dimensional cross-correlation function. In this work, we detail how it is possible to achieve real-time visualization of PIV method by designing an adaptive embedded architecture based on FPGA technology.We show first results of a physical field of velocity calculated by this platform system in a real-time approach.;La velocimetria por imagenes de particulas (PIV), basada en plano laser, es una potente herramienta de medicion en dinamica de fluidos, capaz de medir sin grandes errores, un campo de velocidades distribuido en liquidos, gases y flujo multifase.Los altos requerimientos computacionales de los algoritmos PIV dificultan su empleo en tiempo-real.En este trabajo presentamos el diseno de una plataforma basada en tecnologia FPGA para capturar video y procesar en tiempo real el algoritmo de correlacion cruzada bidimensional.Mostramos resultados de un primer abordaje de la captura de imagenes y procesamiento de un campo fisico de velocidades en tiempo real.

  14. AmbientRT - real time system software support for data centric sensor networks

    NARCIS (Netherlands)

    Hofmeijer, T.J.; Dulman, S.O.; Jansen, P.G.; Havinga, Paul J.M.

    We present the architecture and design of a real time operating system for mobile wireless sensor networks. AmbientRT is being developed for environments with very limited resources in order to relieve the burden of the developer and to efficiently use the resources of the node. This paper presents

  15. AmbientRT - real time system software support for data centric sensor networks

    NARCIS (Netherlands)

    Hofmeijer, T.J.; Dulman, S.O.; Jansen, P.G.; Havinga, Paul J.M.

    2004-01-01

    We present the architecture and design of a real time operating system for mobile wireless sensor networks. AmbientRT is being developed for environments with very limited resources in order to relieve the burden of the developer and to efficiently use the resources of the node. This paper presents

  16. EL TIEMPO

    OpenAIRE

    Jaramillo Ochoa, Jaramillo

    2009-01-01

    El tiempo es el aliado misterioso que nos envuelve y nos transporta, nos permite ser viajeros de nuestro propio tren sin reglas. Cómo saber qué tiempo tomar... Cómo saber qué tiempo ceder... Cómo saber cuando el tiempo es correcto... Es silencioso, es voraz, es traicionero, el peor de los enemigos: el tiempo no perdona. Cómo saber si el tiempo se detiene.

  17. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  18. Aportación al diseño de aplicaciones de tiempo real sobre arquitecturas paralelas

    OpenAIRE

    Graña Domínguez, Santiago

    1997-01-01

    A lo largo de esta tesis se planteará el uso de técnicas de prototipado rápido para el diseño detallado, construcción y pruebas de sistemas de tiempo real (STR) que ejecutan sobre arquitecturas paralelas o distribuidas. El entorno propuesto permite la verificación y validación del STR desde una óptica marcadamente experimental, contrastando con análisis más formales como el popular RMA (Rate Monotonic Analysis), que también son aplicables de forma complementaria, con objeto de obtener sistema...

  19. Real-Time-Simulation of IEEE-5-Bus Network on OPAL-RT-OP4510 Simulator

    Science.gov (United States)

    Atul Bhandakkar, Anjali; Mathew, Lini, Dr.

    2018-03-01

    The Real-Time Simulator tools have high computing technologies, improved performance. They are widely used for design and improvement of electrical systems. The advancement of the software tools like MATLAB/SIMULINK with its Real-Time Workshop (RTW) and Real-Time Windows Target (RTWT), real-time simulators are used extensively in many engineering fields, such as industry, education, and research institutions. OPAL-RT-OP4510 is a Real-Time Simulator which is used in both industry and academia. In this paper, the real-time simulation of IEEE-5-Bus network is carried out by means of OPAL-RT-OP4510 with CRO and other hardware. The performance of the network is observed with the introduction of fault at various locations. The waveforms of voltage, current, active and reactive power are observed in the MATLAB simulation environment and on the CRO. Also, Load Flow Analysis (LFA) of IEEE-5-Bus network is computed using MATLAB/Simulink power-gui load flow tool.

  20. Real Time Physiological Status Monitoring (RT-PSM): Accomplishments, Requirements, and Research Roadmap

    Science.gov (United States)

    2016-03-01

    actionable information. With many lessons learned , the first implementation of real time physiological monitoring (RT-PSM) uses thermal-work strain... Bidirectional Inductive On-Body Network (BIONET) for WPSM Develop sensor links and processing nodes on-Soldier and non-RF links off-Soldier Elintrix...recent sleep watches (e.g., BASIS Peak, Intel Corp.) are attempting to parse sleep quality beyond duration and interruptions into deep and REM sleep

  1. Real-Time RT-PCR for the Detection of Lyssavirus Species

    Directory of Open Access Journals (Sweden)

    A. Deubelbeiss

    2014-01-01

    Full Text Available The causative agents of rabies are single-stranded, negative-sense RNA viruses in the genus Lyssavirus of Rhabdoviridae, consisting of twelve classified and three as yet unclassified species including classical rabies virus (RABV. Highly neurotropic RABV causes rapidly progressive encephalomyelitis with nearly invariable fatal outcome. Rapid and reliable diagnosis of rabies is highly relevant for public and veterinary health. Due to growing variety of the genus Lyssavirus observed, the development of suitable molecular assays for diagnosis and differentiation is challenging. This work focused on the establishment of a suitable real-time RT-PCR technique for rabies diagnosis as a complement to fluorescent antibody test and rabies tissue culture infection test as gold standard for diagnosis and confirmation. The real-time RT-PCR was adapted with the goal to detect the whole spectrum of lyssavirus species, for nine of which synthesized DNA fragments were used. For the detection of species, seven probes were developed. Serial dilutions of the rabies virus strain CVS-11 showed a 100-fold higher sensitivity of real-time PCR compared to heminested RT-PCR. Using a panel of thirty-one lyssaviruses representing four species, the suitability of the protocol could be shown. Phylogenetic analysis of the sequences obtained by heminested PCR allowed correct classification of all viruses used.

  2. OR.NET RT: how service-oriented medical device architecture meets real-time communication.

    Science.gov (United States)

    Pfeiffer, Jonas H; Kasparick, Martin; Strathen, Benjamin; Dietz, Christian; Dingler, Max E; Lueth, Tim C; Timmermann, Dirk; Radermacher, Klaus; Golatowski, Frank

    2018-02-23

    Today's landscape of medical devices is dominated by stand-alone systems and proprietary interfaces lacking cross-vendor interoperability. This complicates or even impedes the innovation of novel, intelligent assistance systems relying on the collaboration of medical devices. Emerging approaches use the service-oriented architecture (SOA) paradigm based on Internet protocol (IP) to enable communication between medical devices. While this works well for scenarios with no or only soft timing constraints, the underlying best-effort communication scheme is insufficient for time critical data. Real-time (RT) networks are able to reliably guarantee fixed latency boundaries, for example, by using time division multiple access (TDMA) communication patterns. However, deterministic RT networks come with their own limitations such as tedious, inflexible configuration and a more restricted bandwidth allocation. In this contribution we overcome the drawbacks of both approaches by describing and implementing mechanisms that allow the two networks to interact. We introduce the first implementation of a medical device network that offers hard RT guarantees for control and sensor data and integrates into SOA networks. Based on two application examples we show how the flexibility of SOA networks and the reliability of RT networks can be combined to achieve an open network infrastructure for medical devices in the operating room (OR).

  3. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  4. Development of a Web application for a real time information system; Desarrollo de una aplicacion web para un sistema de informacion en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa R, Alfredo; Silva F, Brisa M; Quintero R, Agustin [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2007-07-01

    In this article its is described a technique for the development of a Web application for a real time information system that allows the remote and concurrent connection of different equipment to the network historical data base of the system, without the need of the installation of any software component in the remote equipment of the user who makes the consultation. It defines and establishes the software architecture that allows the development of the Web application, the analysis stages, the operation of the technology to be used, as well as the design, development and implementation of the application. Finally, the accomplishments obtained with the development of the Web application for a real time information system are described. [Spanish] En este articulo se describe una tecnica para el desarrollo de una aplicacion web para un sistema de informacion en tiempo real, que permita la conexion remota y concurrente de diferentes equipos en la red a la base de datos historica del sistema, sin necesidad de que se instale ningun componente de software en el equipo remoto del usuario que realiza la consulta. Se define y establece la arquitectura de software que permite el desarrollo de la aplicacion web, las etapas de analisis, el funcionamiento de la tecnologia a utilizar, asi como el diseno, desarrollo e implementacion de la aplicacion. Finalmente, se describen los logros obtenidos con el desarrollo de la aplicacion web para un sistema de informacion en tiempo real.

  5. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  6. Evaluation Study of the Tactical Atmospheric Modeling System/Real-Time (TAMS-RT) at NPMOC San Diego

    National Research Council Canada - National Science Library

    Reiss, Arthur

    1999-01-01

    ...) has been developed by the Naval Research Lab in Monterey, California to meet this task. A forecast system employing COAMPS, called the Tactical Atmospheric Mesoscale System- Real Time (TAMS-RT...

  7. LIBERACIÓN EN TIEMPO REAL DE LOS PRODUCTOS COMERCIALES DEL CENTRO DE INMUNOLOGÍA MOLECULAR

    Directory of Open Access Journals (Sweden)

    Antonio E. Vallín García

    2010-11-01

    Full Text Available

    Este artículo describe un Procedimiento de Liberación en Tiempo Real para los productos comerciales del Centro de Inmunología Molecular. El Procedimiento incorpora el conocimiento del proceso a través de todas las etapas del proceso productivo, evaluando los parámetros y controles de proceso para asegurar la calidad del Ingrediente Farmacéutico Activo y del Producto Final.  La aplicación sistemática disminuirá significativamente el tiempo de liberación, garantizando la calidad del producto, el cumplimiento de las regulaciones y mayor conocimiento del proceso y del producto.

     

    This article describes a Procedure of Liberation in Real Time for the commercial products of the Center of Molecular Immunology. The Procedure incorporates the knowledge of the process through all the stages of the productive process, evaluating the parameters and process controls to assure the quality of the Active Pharmaceutical Ingredient and of the Final Product.  The systematic application will diminish the time of liberation, significantly guaranteeing the quality of the product, the execution of the regulations and bigger knowledge of the process and of the product.

  8. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  9. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Beneficios que aporta la metodología MDE a los entornos de desarrollo de sistemas de tiempo real

    Directory of Open Access Journals (Sweden)

    César Cuevas

    2013-04-01

    Full Text Available Resumen: Se analizan los beneficios que aporta el empleo de la metodología Model-Driven Engineering (MDE cuando se utiliza como base y soporte de entornos de diseño de sistemas de tiempo real. Con esta metodología, se incrementa la facilidad de uso del entorno para el diseñador, ya que, en función del paradigma que utilice y de la fase del proceso de diseño que esté llevando a cabo, el entorno le ofrece una vista especializada del sistema, la cual presenta de una forma precisa y coherente la información sobre la que está decidiendo. Por otro lado, una infraestructura MDE facilita el desarrollo de herramientas y su integración en el entorno, ya que, a través de los mecanismos de gestión y transformación de modelos con los que está dotada, cada herramienta recibe únicamente la información que utiliza, estructurada de modo adecuado, y así mismo, puede generar sus resultados de la forma que le sea natural, ya que el entorno los sabe gestionar. Por último, la metodología MDE permite considerar el entorno de diseño de tiempo real como una vista especializada que se integra coherentemente en un entorno más general, el cual soporta las restantes fases del diseño del sistema. Abstract: This paper analyses the benefits provided by the Model-Driven Engineering (MDE methodology when it is used as the base support for real-time systems design environments. The application of MDE eases the environment usage by the designer, because depending on the chosen paradigm and on the stage of the development process, the environment offers a specialized view of the system, presenting in a precise and coherent fashion the information under decision. On the other hand, an MDE infrastructure facilitates the development of tools and their integration within the environment, as, through the model management and transformation mechanisms this infrastructure is equipped with, every tool receives as input the right information it uses, structured as it

  11. Simulación de Tareas Aperiódicas y Esporádicas de Tiempo Real mediante un Modelo de Eventos Discretos

    OpenAIRE

    Paez, Francisco Ezequiel; Urriza, José M.; Orozco, Javier Dario

    2015-01-01

    Este trabajo presenta una extensión a un modelo de eventos discretos para el diseño de simuladores de Sistemas de Tiempo Real con tareas periódicas, incorporando tareas de tipo esporádico y aperiódico. Además, se estudia el soporte para jitter y offset. El modelo es diseñado empleando la técnica de grafo de eventos, y se ajusta a los sistemas dinámicos discretos como lo son los Sistemas de Tiempo Real. En la actualidad, el uso de simuladores para realizar comprobaciones de algoritmos, modelos...

  12. Optimización en Tiempo Real utilizando la Metodología de Adaptación de Modificadores

    Directory of Open Access Journals (Sweden)

    T. Rodríguez-Blanco

    2018-03-01

    Full Text Available La gestión óptima de las plantas de proceso normalmente se lleva a cabo en una capa de optimización en tiempo real (Real Time Optimization, RTO que actúa sobre la capa de control y que toma decisiones considerando objetivos económicos en base a un  modelo del proceso, normalmente estacionario. Sin embargo, dicha operación óptima no está garantizada debido a la presencia de incertidumbre entre el modelo usado para la toma de decisiones y el proceso real. Con la idea de conducir el proceso a su punto de operación óptimo usando un modelo que se sabe incierto o erróneo, surge la metodología de adaptación de modificadores (Modifier Adaptation o MA. En dicha metodología, el problema de optimización económica de la capa RTO es modificado mediante unos términos correctores, conocidos como modificadores, estimados a partir de medidas de la planta, con el objetivo de conducir el proceso a su punto de operación óptimo. El presente artículo hace una revisión de las técnicas desarrolladas hasta el momento dentro de la metodología MA analizando sus características y modos de implementación.

  13. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Reconfiguración Dinámica de Sistemas Distribuidos en Tiempo-Real Basada en Agentes

    Directory of Open Access Journals (Sweden)

    O. Esquivel-Flores

    2012-07-01

    Full Text Available Resumen: Actualmente los sistemas distribuidos están presentes en diversas aplicaciones dentro de la industria e investigación. Este tipo de sistemas está restringido al cumplimiento de condiciones temporales lo que los convierte en sistemas de tiempo crítico que ante la presencia de fallas es necesario tomar decisiones que eviten la pérdida de plazos, disminución de desempeñno, inestabilidad o la suspensión total del sistema. Una estrategia para lograr lo anterior es la reconfiguración dinámica de la estructura del sistema con el objetivo de contrarrestar el efecto de las fallas. En este artículo se presenta una propuesta de reconfiguración dinámica y distribuida que se basa en considerar a cada elemento del sistema distribuido como un agente con capacidad comunicación y cooperación que decida en conjunto con otros agentes una acción de reconfiguración. Se propone la modificación de periodos de muestreo de los agentes que sensan los estados del sistema, la disminución de la actividad de los agentes con falla y/o la utilización de algoritmos de voto. Para alguna posible falla en el sistema se hace corresponder un tipo particular de reconfiguración con base en el intercambio de información entre agentes para tomar un acuerdo consensado. El esquema de reconfiguración dinámico que se propone es implementado en el control de vuelo de un prototipo de helicóptero de dos hélices en el que se incluye un sistema distribuido que utiliza un medio de comunicación común entre sus componentes para forma el lazo cerrado de control de un sistema. La respuesta del sistema reconfigurado es explorada por medio de simulaciones numéricas realizadas en Matlab y Simulink utilizando TrueTime como herramienta de simulación de tiempo real. Abstract: Currently distributed systems are present in several applications in industry and research, such systems are restricted to time conditions. The presence of failures in these time critical systems

  15. Exploring valid reference genes for quantitative real - time rt - pce studies of hydrogenperoxide signaling in arabidopsis

    International Nuclear Information System (INIS)

    Zhou, H.; Han, B.; Xie, Y.; Zhang, J.; Shen, W.

    2015-01-01

    Hydrogen peroxide (H/sub 2/O/sub 2/ ) acts as a signaling molecule modulating the expression of various genes in plants. However, the reference gene(s) used for gene expression analysis of H/sub 2/O/sub 2/ signaling is still arbitrary. A reliable result obtained by quantitative real-time RT-PCR (RT-qPCR) highly depends on accurate transcript normalization using stably expressed reference genes, whereas the inaccurate normalization could easily lead to the false conclusions. In this report, by using geNorm and NormFinder algorithms, 12 candidate reference genes were evaluated and compared in root and shoot tissues of Arabidopsis upon different doses of H/sub 2/O/sub 2/. The results revealed that, in our experimental conditions, three novel reference genes (TIP41-like, UKN, and UBC21) were identified and validated as suitable reference genes for RT-qPCR normalization in both root and shoot tissues under oxidative stress. This conclusion was further confirmed by publicly available microarray data of methyl viologen and drought stress. In comparison with a single reference gene (EF-1a), the expression pattern of ZAT12 modulated by H/sub 2/O/sub 2/, when using TIP41-like, UKN, and UBC21 as multiple reference gene(s), was similar with the previous reports by using northern blotting. Thus, we proposed that these three reference genes might be good candidates for other researchers to include in their reference gene validation in gene expression studies under H/sub 2/O/sub 2/ related oxidative stress. (author)

  16. Tiempo y sociedad, en el Real Seminario de Minería, 1792-1821

    Directory of Open Access Journals (Sweden)

    Eduardo Flores Clai

    2012-02-01

    Full Text Available La industria de metales preciosos, oro y plata, a finales del siglo XVIII, recibió un gran impulso de la corona española. Para ello, intentó modernizar el sistema productivo de la minería con el fin de aumentar la recaudación fiscal. El Real Seminario de Minería (RSM fue un engranaje más de esta maquinaria que tenía como objetivos difundir los conocimientos científicos, instruir a la juventud novohispana en las técnicas más modernas de explotación y refinación de minerales. En esta historia queremos llamar la atención sobre la vida académica. Abstract At the end on the 18th century, the precious metal industry, gold and silver, received a great impulse from the Spanish crown. For this, it needed to modernize the productive system of the mining with the purpose to increase the fiscal collection. The Real Seminary of Mineração (RSM was a strategy that had objectives to spread out the scientific knowledge, to instruct new Hispanic youth in the most modern techniques of exploration and mineral refinement. It is on this history that we want to call the attention of the academy. Keywords Modern School; History; Industrialization; Youth; Modernization

  17. Microdroplet sandwich real-time rt-PCR for detection of pandemic and seasonal influenza subtypes.

    Directory of Open Access Journals (Sweden)

    Stephanie L Angione

    Full Text Available As demonstrated by the recent 2012/2013 flu epidemic, the continual emergence of new viral strains highlights the need for accurate medical diagnostics in multiple community settings. If rapid, robust, and sensitive diagnostics for influenza subtyping were available, it would help identify epidemics, facilitate appropriate antiviral usage, decrease inappropriate antibiotic usage, and eliminate the extra cost of unnecessary laboratory testing and treatment. Here, we describe a droplet sandwich platform that can detect influenza subtypes using real-time reverse-transcription polymerase chain reaction (rtRT-PCR. Using clinical samples collected during the 2010/11 season, we effectively differentiate between H1N1p (swine pandemic, H1N1s (seasonal, and H3N2 with an overall assay sensitivity was 96%, with 100% specificity for each subtype. Additionally, we demonstrate the ability to detect viral loads as low as 10(4 copies/mL, which is two orders of magnitude lower than viral loads in typical infected patients. This platform performs diagnostics in a miniaturized format without sacrificing any sensitivity, and can thus be easily developed into devices which are ideal for small clinics and pharmacies.

  18. Algoritmo genético permutacional para el despliegue y la planificación de sistemas de tiempo real distribuidos

    Directory of Open Access Journals (Sweden)

    Ekain Azketa

    2013-07-01

    Full Text Available Resumen: El despliegue y la planificación de tareas y mensajes en sistemas de tiempo real distribuidos son problemas NP-difíciles (NP- hard, por lo que no existen métodos óptimos para solucionarlos en tiempo polinómico. En consecuencia, estos problemas son adecuados para abordarse mediante algoritmos genéricos de búsqueda y optimización. En este artículo se propone un algoritmo genético multiobjetivo basado en una codificación permutacional de las soluciones para abordar el despliegue y la planificación de sistemas de tiempo real distribuidos. Además de desplegar tareas en computadores y de planificar tareas y mensajes, este algoritmo puede minimizar el número de computadores utilizados, la cantidad de recursos computacionales y de comunicaciones empleados y el tiempo de respuesta de peor caso medio de las aplicaciones. Los resultados experimentales muestran que este algoritmo genético permutacional puede desplegar y planificar sistemas de tiempo real distribuidos de forma satisfactoria y en tiempos razonables. Abstract: The deployment and scheduling of tasks and messages in distributed real-time systems are NP-hard problems, so there are no optimal methods to solve them in polynomial time. Consequently, these problems are suitable to be approached with generic search and optimisation algorithms. In this paper we propose a multi-objective genetic algorithm based on a permutational solution encoding for the deployment and scheduling of distributed real-time systems. Besides deploying and scheduling tasks and messages, the algorithm can minimize the number of the used computers, the utilization of computing and networking resources and the average worst-case response times of the applications. The experiments show that this genetic algorithm can successfully synthesize complex distributed real-time systems in reasonable times. Palabras clave: Sistemas de tiempo real, Algoritmos de planificaci

  19. Algoritmo genético permutacional para el despliegue y la planificación de sistemas de tiempo real distribuidos

    OpenAIRE

    Azketa, Ekain; Gutiérrez, J. Javier; Di Natale, Marco; Almeida, Luís; Marcos, Marga

    2013-01-01

    Resumen: El despliegue y la planificación de tareas y mensajes en sistemas de tiempo real distribuidos son problemas NP-difíciles (NP- hard), por lo que no existen métodos óptimos para solucionarlos en tiempo polinómico. En consecuencia, estos problemas son adecuados para abordarse mediante algoritmos genéricos de búsqueda y optimización. En este artículo se propone un algoritmo genético multiobjetivo basado en una codificación permutacional de las soluciones para abordar el despli...

  20. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  1. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  2. BIBLIOTECARIO EN LÍNEA: el servicio de referencia virtual en tiempo real de la Biblioteca de la Facultad de Agronomía

    Directory of Open Access Journals (Sweden)

    Eugenia Ortiz

    2013-12-01

    Full Text Available El presente artículo aborda el desarrollo del Servicio de Referencia Virtual en Tiempo Real del Departamento de Documentación y Biblioteca de la Facultad de Agronomía: el Bibliotecario en Línea. Se hace hincapié en el proceso de implementación, desarrollo y evaluación del servicio, finalizando con una breve conclusión de la experiencia.

  3. Review: Algoritmos de planificación para la transmisión de datos en tiempo real con IEEE 802.15.4

    Directory of Open Access Journals (Sweden)

    Sixto Enrique Campaña Bastidas

    2015-10-01

    Full Text Available Las redes de sensores inalámbricas (WSN se están extendiendo a muchos campos de aplicación, tales como ciudades inteligentes, ambientes inteligentes, internet de las cosas, entre otras tecnologías. Para muchasde estas tendencias es esencial establecer métodos para la entrega de paquetes, sobre todo aquellos que presenten garantías de tiempo real. En este trabajo se presenta un estudio de los avances recientes publicadosen la literatura científica, considerando principalmente las técnicas de acceso al medio y la planificación de transmisión de datos con garantías de tiempo real en WSN basadas en el estándar IEEE 802.15.4. Este estudiopresenta las características más importantes, así como las principales diferencias entre las distintas técnicas. Al final se presentan algunas conclusiones y se proponen futuras líneas de investigación que buscan con interés la aplicación de WSN en ambientes con restricciones de tiempo real.

  4. Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

    OpenAIRE

    Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

    2015-01-01

    Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

  5. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  6. Un algoritmo de replanificación en tiempo real basado en un índice de estabilidad de Lyapunov para líneas de metro

    Directory of Open Access Journals (Sweden)

    A. Berbey

    2014-04-01

    Full Text Available Resumen: En este trabajo, se propone un nuevo índice basado en el método directo de Lyapunov para el diseño de un algoritmo de reprogramación en tiempo real para líneas de metro. En este estudio se utiliza una versión modificada de un modelo de espacio de estados en tiempo real discreto, que considera los efectos de saturación en la línea de metro. Una vez que el modelo de espacio de estados se ha obtenido, el método directo de Lyapunov se aplica con el fin de analizar la estabilidad del sistema de la línea de metro. Como resultado de este análisis no sólo se propone un nuevo índice de estabilidad, sino también la creación de tres zonas de estabilidad para indicar el estado actual del sistema. Finalmente, se presenta un nuevo algoritmo que permite la reprogramación del calendario de los trenes en tiempo real en presencia de perturbaciones medianas. Abstract: A new Lyapunov-based index for designing a rescheduling algorithm in real time for metro lines has been proposed in this paper. A modified real time discrete space state model which considers saturation effects in the metro line has been utilized in this study. Once the space state model has been obtained, the direct method of Lyapunov is applied in order to analyze the stability of the metro line system. As a result of this analysis not only a new stability index is proposed, but also the establishment of three stability zones to indicate the current state of the system. Finally, a new algorithm which allows the rescheduling of the timetable in the real time of the trains under presence of medium disturbances has been presented. Palabras clave: Sistema de metro, estabilidad de Lyapunov, planificación en tiempo real, Keywords: Metro system, Lyapunov stability, real time planning, traffic regulation

  7. Análisis de la implementación software de un conformador de señales ultrasónicas para tiempo real

    Directory of Open Access Journals (Sweden)

    D. Romero-Laorden

    2016-10-01

    Full Text Available Resumen: Este trabajo analiza la implementación software en un sistema de imagen ultrasónica del Total Focusing Method para la compensación dinámica en tiempo real de los tiempos de vuelo para emisión y recepción de todos los puntos de la imagen. Para ello, haciendo uso de técnicas GPGPU, se analizan dos diferentes alternativas de implementación, mostrando como una planificación adecuada de acceso a los datos permite mejorar los tiempos de ejecución del algoritmo. Abstract: This paper studies the software implementation in an ultrasonic imaging system of Total Focusing Method. In order to accomplish real-time requirements parallel programming techniques have been used. Then, using GPGPU techniques, two different implementation alternatives are analysed, showing how proper planning of access to data improves the performance of the algorithm. Palabras clave: Imagen Ultrasónica, Procesamiento de Señal, Computación Paralela, GPU, CUDA, Keywords: Ultrasonic imaging GPU Signal Processing Parallel computing CUDA

  8. Absolute estimation of initial concentrations of amplicon in a real-time RT-PCR process

    Directory of Open Access Journals (Sweden)

    Kohn Michael

    2007-10-01

    Full Text Available Abstract Background Since real time PCR was first developed, several approaches to estimating the initial quantity of template in an RT-PCR reaction have been tried. While initially only the early thermal cycles corresponding to exponential duplication were used, lately there has been an effort to use all of the cycles in a PCR. The efforts have included both fitting empirical sigmoid curves and more elaborate mechanistic models that explore the chemical reactions taking place during each cycle. The more elaborate mechanistic models require many more parameters than can be fit from a single amplification, while the empirical models provide little insight and are difficult to tailor to specific reactants. Results We directly estimate the initial amount of amplicon using a simplified mechanistic model based on chemical reactions in the annealing step of the PCR. The basic model includes the duplication of DNA with the digestion of Taqman probe and the re-annealing between previously synthesized DNA strands of opposite orientation. By modelling the amount of Taqman probe digested and matching that with the observed fluorescence, the conversion factor between the number of fluorescing dye molecules and observed fluorescent emission can be estimated, along with the absolute initial amount of amplicon and the rate parameter for re-annealing. The model is applied to several PCR reactions with known amounts of amplicon and is shown to work reasonably well. An expanded version of the model allows duplication of amplicon without release of fluorescent dye, by adding 1 more parameter to the model. The additional process is helpful in most cases where the initial primer concentration exceeds the initial probe concentration. Software for applying the algorithm to data may be downloaded at http://www.niehs.nih.gov/research/resources/software/pcranalyzer/ Conclusion We present proof of the principle that a mechanistically based model can be fit to observations

  9. Data acquisition and real-time signal processing of plasma diagnostics on ASDEX Upgrade using LabVIEW RT

    International Nuclear Information System (INIS)

    Giannone, L.; Cerna, M.; Cole, R.; Fitzek, M.; Kallenbach, A.; Lueddecke, K.; McCarthy, P.J.; Scarabosio, A.; Schneider, W.; Sips, A.C.C.; Treutterer, W.; Vrancic, A.; Wenzel, L.; Yi, H.; Behler, K.; Eich, T.; Eixenberger, H.; Fuchs, J.C.; Haas, G.; Lexa, G.

    2010-01-01

    The existing VxWorks real-time system for the position and shape control in ASDEX Upgrade has been extended to calculate magnetic flux surfaces in real-time using a multi-core PCI Express system running LabVIEW RT 8.6. real-time signal processing of bolometers and manometers is performed with the on-board FPGA to calculate the measured radiated power flux and particle flux respectively from the raw data. Radiation feedback experiments use halo current measurements from the outer divertor with real-time median filter pre-processing to remove the excursions produced by ELMs. Integration of these plasma diagnostics into the control system by the exchange of XML sheets for communicating the real-time variables to be produced and consumed is in operation. Reflective memory and UDP are employed by the LabVIEW RT plasma diagnostics to communicate with the control system and other plasma diagnostics in a multi-platform real-time network.

  10. Data acquisition and real-time signal processing of plasma diagnostics on ASDEX Upgrade using LabVIEW RT

    Energy Technology Data Exchange (ETDEWEB)

    Giannone, L., E-mail: Louis.Giannone@ipp.mpg.d [Max-Planck-Institut fuer Plasmaphysik, EURATOM-IPP Association, D-85748 Garching (Germany); Cerna, M. [National Instruments, Austin, TX 78759-3504 (United States); Cole, R.; Fitzek, M. [Unlimited Computer Systems GmbH, 82393 Iffeldorf (Germany); Kallenbach, A. [Max-Planck-Institut fuer Plasmaphysik, EURATOM-IPP Association, D-85748 Garching (Germany); Lueddecke, K. [Unlimited Computer Systems GmbH, 82393 Iffeldorf (Germany); McCarthy, P.J. [Department of Physics, University College Cork, Association EURATOM-DCU, Cork (Ireland); Scarabosio, A.; Schneider, W.; Sips, A.C.C.; Treutterer, W. [Max-Planck-Institut fuer Plasmaphysik, EURATOM-IPP Association, D-85748 Garching (Germany); Vrancic, A.; Wenzel, L.; Yi, H. [National Instruments, Austin, TX 78759-3504 (United States); Behler, K.; Eich, T.; Eixenberger, H.; Fuchs, J.C.; Haas, G.; Lexa, G. [Max-Planck-Institut fuer Plasmaphysik, EURATOM-IPP Association, D-85748 Garching (Germany)

    2010-07-15

    The existing VxWorks real-time system for the position and shape control in ASDEX Upgrade has been extended to calculate magnetic flux surfaces in real-time using a multi-core PCI Express system running LabVIEW RT 8.6. real-time signal processing of bolometers and manometers is performed with the on-board FPGA to calculate the measured radiated power flux and particle flux respectively from the raw data. Radiation feedback experiments use halo current measurements from the outer divertor with real-time median filter pre-processing to remove the excursions produced by ELMs. Integration of these plasma diagnostics into the control system by the exchange of XML sheets for communicating the real-time variables to be produced and consumed is in operation. Reflective memory and UDP are employed by the LabVIEW RT plasma diagnostics to communicate with the control system and other plasma diagnostics in a multi-platform real-time network.

  11. Rt-Space: A Real-Time Stochastically-Provisioned Adaptive Container Environment

    Science.gov (United States)

    2017-08-04

    Real-Time Systems (ECRTS) Conference Location: Toulouse, France Paper Title: Multiprocessor Real-Time Locking Protocols for Replicated Resources...Conference Location: Lille, France Paper Title: A Contention-Sensitive Fine-Grained Locking Protocol for Multiprocessor Real-Time Systems Publication...On the Soft Real-Time Optimality of Global EDF on Multiprocessors: From Identical to Uniform Heterogeneous Publication Type: Conference Paper or

  12. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  13. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. STAR-RT: Visual attention for real-time video game playing

    OpenAIRE

    Kotseruba, Iuliia; Tsotsos, John K.

    2017-01-01

    In this paper we present STAR-RT - the first working prototype of Selective Tuning Attention Reference (STAR) model and Cognitive Programs (CPs). The Selective Tuning (ST) model received substantial support through psychological and neurophysiological experiments. The STAR framework expands ST and applies it to practical visual tasks. In order to do so, similarly to many cognitive architectures, STAR combines the visual hierarchy (based on ST) with the executive controller, working and short-...

  15. Adquisición, registro y transmisión en tiempo real de señales sismológicas bajo TCP/IP

    Directory of Open Access Journals (Sweden)

    Vargas-jiménez Carlos A.

    2001-08-01

    Full Text Available

    The constant evolution of network technologies has made possible the development of applications facilitating the real time access to the information. This way, it is possible the implementation of remote monitoring systems that using PCs achieves efficient transmission of signals through computer networks. In this work, the procedures system design and implementation procedures are explain in Client/Server environment that, based on TCP/lP, transmits in real time 16 seismological signals over LAN network and the Internet. The server is a PC endowed with an acquisition data card and it is the one in charge of carrying out the signal Analog/Digital conversion, to store in files those that correspond to seismic events and, at the same time, to assist the applications of the different clients. The client's software allows the users to view in real time the signals that the server is acquiring and to carry out a basicn processing to the signals that have been registered in the server.

    Se presenta el desarrollo de un sistema de monitoreo de variables sísmicas, que incluye la adquisición y adecuación de 16 canales simultáneos, el preproceso, la grabación y la transmisión sobre redes IP en tiempo real. EI sistema esta orientado al sistema Windows, para lo cual se emplearon librerías dinámicas orientadas al acceso de dispositivos en tiempo real. Así mismo, el acceso de datos al PC se realiza vfa DMA, para implementar el proceso múltiple de señales en tiempo real. La arquitectura de la red IP de monitoreo sísmico es cliente/servidor, en la cual se tome como servidor un PC dotado de una tarjeta de adquisición de datos, encargado de realizar la conversión an

  16. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  17. Assessment of Real-Time Time-Dependent Density Functional Theory (RT-TDDFT) in Radiation Chemistry: Ionized Water Dimer.

    Science.gov (United States)

    Chalabala, Jan; Uhlig, Frank; Slavíček, Petr

    2018-03-29

    Ionization in the condensed phase and molecular clusters leads to a complicated chain of processes with coupled electron-nuclear dynamics. It is difficult to describe such dynamics with conventional nonadiabatic molecular dynamics schemes since the number of states swiftly increases as the molecular system grows. It is therefore attractive to use a direct electron and nuclear propagation such as the real-time time-dependent density functional theory (RT-TDDFT). Here we report a RT-TDDFT benchmark study on simulations of singly and doubly ionized states of a water monomer and dimer as a prototype for more complex processes in a condensed phase. We employed the RT-TDDFT based Ehrenfest molecular dynamics with a generalized gradient approximate (GGA) functional and compared it with wave-function-based surface hopping (SH) simulations. We found that the initial dynamics of a singly HOMO ionized water dimer is similar for both the RT-TDDFT/GGA and the SH simulations but leads to completely different reaction channels on a longer time scale. This failure is attributed to the self-interaction error in the GGA functionals and it can be avoided by using hybrid functionals with large fraction of exact exchange (represented here by the BHandHLYP functional). The simulations of doubly ionized states are reasonably described already at the GGA level. This suggests that the RT-TDDFT/GGA method could describe processes following the autoionization processes such as Auger emission, while its applicability to more complex processes such as intermolecular Coulombic decay remains limited.

  18. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Directory of Open Access Journals (Sweden)

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real

  19. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  20. Plataforma de desarrollo para el control en tiempo real de estructuras cinemáticas con realimentación visual//Platform to develop real time visual servoing control in kinematics systems

    Directory of Open Access Journals (Sweden)

    René González-Rodríguez

    2012-09-01

    Full Text Available En este trabajo se presenta una plataforma de desarrollo para el control en tiempo real de estructuras cinemáticas con realimentación visual. Se ha diseñado una configuración genérica que permite la implementación de cualquier variante de control visual. Para el procesamiento de la imagen se ha propuesto una estrategia que permite el uso de diferentes herramientas comerciales o algoritmos propiospara la captura y extracción de características de la imagen. El uso de Real Time Work Shop y Real Time Windows Target en el lazo de control interno brinda la posibilidad de implementar algoritmos de control servovisual en tiempo real. Al final del trabajo se presentan los resultados de un esquema de controlservovisual aplicado en un manipulador industrial. La plataforma propuesta constituye una herramienta de desarrollo para aplicaciones industriales de control servovisual y sirve de apoyo a la enseñanza de la mecatrónica en pregrado y postgrado.Palabras claves: control servovisual, control en tiempo real, estructuras cinemáticas._______________________________________________________________________________AbstractIn this work we propose a platform to develop visual servoing control systems. The platform has a generic design with the possibility to implement direct or look and move visual servoing systems. For the image processing we present a generic design allowing the use of any image processing library like Matrox MIL,Intel IPP, OpenCV or any algorithms for image capture and target characteristics extraction. The uses of Real Time Work Shop and Real Time Windows Target in the internal loop permits modify the control structure in SIMULINK very easy.Key words: visual servoing, real time control, kinematics systems.

  1. Sistema de detección de fugas en tiempo real en presas de materiales sueltos mediante sensores distribuidos en fibra óptica

    Directory of Open Access Journals (Sweden)

    O. Muñoz

    2016-04-01

    Full Text Available El presente trabajo pretende analizar el uso de fibra óptica como sensor de temperatura distribuido para la detección de posibles fugas en presas de materiales sueltos. El uso de esta técnica permite complementar los sistemas de auscultación  normalmente utilizados mejorando la monitorización de las zonas críticas de la infraestructura. Este tipo de sistema de monitorización en tiempo real ha sido implementado en dos casos reales, (presa de Soto-Terroba y recrecimiento de la presa de Yesa. Finalmente este trabajo quiere proporcionar una visión práctica sobre esta nueva técnica implementada y en particular sobre los criterios de selección de materiales y las precauciones necesarias a la hora del despliegue del elemento sensor.

  2. Real-Time Integrated Navigation System for Planetary Exploration (RT-INSPEX), Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — For supporting NASA's efforts in enhancing robotic autonomy and off-loading work from operators and astronauts, American GNC Corporation has developed the "Real-Time...

  3. OPTIMIZACION DE LA GESTION DE LAS OPERACIONES EN TIEMPO REAL EN LA INDUSTRIA FORESTAL: MODELOS, ALGORITMOS Y PROCEDIMIENTOS

    OpenAIRE

    EPSTEIN NUMHAUSER, RAFAEL DAVID

    2013-01-01

    La tendencia mundial en la gestión de las operaciones ha privilegiado el concepto producción "justo a tiempo" (o JIT por su sigla en inglés). El JIT fue incorporado por los japoneses en la industria manufacturera en los años 70's, específicamente en la fábrica de autos Toyota, siendo uno de los pilares del éxito japonés de la posguerra y de la recuperación de la industria norteamericana en este decenio. La filosofía JIT postula que el diseño estratégico de las operaciones debe pri...

  4. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  5. Analysis on the arcelin expression in bruchid pest resistant wild pulses using real time RT-qPCR.

    Science.gov (United States)

    Sakthivelkumar, Shanmugavel; Veeramani, Velayutham; Hilda, Karuppiah; Arumugam, Munusamy; Janarthanan, Sundaram

    2014-12-01

    Arcelin, the antimetabolic protein from wild pulses is a known natural insecticidal molecule. Wild pulses with high arcelin content could serve as potential source to. increase the levels of insect resistance in cultivated pulse crops. In this study, arcelin (Arl) gene expression was screened in seven stored product insect pest resistant wild pulse varieties using real time RT-qPCR. Arcelin gene specific real time PCR primers were synthesized from arcelin mRNA sequence of the wild pulse variety, Lablab purpureus. The results revealed different levels of arcelin gene expression in the tested varieties. Canavalia virosa registered significantly high content indicating its suitability for utilization of arcelin gene in developing stored product insect pest resistance with other cultivated pulses.

  6. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  7. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

    OpenAIRE

    Fischer, Carlo; Torres, Maria C.; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A.; Charrel, Rémi N.; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C.; Rodrigues, Cintia D.S.; Kümmerer, Beate M.; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-01-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  8. Cuantificación de citocinas caninas mediante reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real

    Directory of Open Access Journals (Sweden)

    Omar A. Saldarriaga

    2006-10-01

    Full Text Available Introducción. Los caninos son el principal reservorio domestico de la leishmaniasis visceral en el Nuevo y Viejo mundo. La reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real para la medición de citocinas caninas no ha sido implementada para el estudio de la leishmaniasis visceral. Objetivo. Estandarizar la cuantificación relativa de IFN-g, IL-4, IL-10, IL-12p40 y IL-12p35 caninas utilizando reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real. Materiales y métodos. Células mononucleares de sangre periférica de perros Fox-Hound fueron estimuladas con ConA, LPS y extracto de Staphylococcus aureus. El ARN fue utilizado en la reacción en cadena de la polimerasa de transcriptasa reversa en tiempo real de un solo paso para optimizar las concentraciones de iniciadores y sondas especificas de cada citocina, generar curvas estándar, confirmar la eficiencia de amplificación de las citocinas y del normalizador (18S ARNr y cuantificar la expresión de ARN. El método comparativo Ct fue utilizado para determinar los niveles relativos de expresión de ARN en las muestras, expresado como el incremento en el número de veces comparado con los controles. Resultados. El coeficiente de regresión para las curvas estándar y las eficiencias de amplificación de las citocinas y el normalizador, indicaron que la cuantificación fue confiable en un amplio rango de concentraciones de ARN. La activación de células mononucleares de sangre periférica resultó en un incremento en la expresión de IFN-g (132, IL-4 (8.8, IL-10 (7,2, y IL-12p40 (275, relativo a células control. La expresión basal de IL-12p35 fue también detectada. Conclusión. Esta metodología, comparada con los métodos convencionales disponibles para la medición de citocinas, ofrece varias ventajas y podría ser utilizada en estudios sobre inmunopatogenia e inmunidad en leishmaniasis visceral canina.

  9. Data acquisition and real time signal processing of plasma diagnostics on ASDEX Upgrade using LabVIEW RT

    Energy Technology Data Exchange (ETDEWEB)

    Giannone, L.; Scarabosio, A.; Eich, T.; Fuchs, C.; Haas, G.; Kallenbach, A.; McCarthy, P.; Mlynek, A.; Neu, G.; Reich, M.; Schneider, W.; Schuhbeck, K.; Treutterer, W.; Zehetbauer, T.; Asdex, Upgrade Team [Max-Planck-Institut fur Plasmaphysik, Garching (Germany); Cerna, M.; Wenzel, L.; Concezzi, S.; Debelle, T.; Marker, B.; Munroe, M.; Petersen, N.; Vrancic, A. [National Instruments Corporation, Austin (United States); Marquardt, M.; Sachtleben, J. [Max-Planck-Institute for Plasmaphysics, Teilinstitut Greifswald (Germany)

    2009-07-01

    There are 5 plasma diagnostics using LabVIEW RT for data acquisition and control on ASDEX Upgrade. These diagnostics are integrated into the VxWorks control system by the exchange of XML files. Real time communication to the control system is possible by Ethernet using UDP or by reflective memory using a dedicated fiber optic cable. The bolometer and manometer data acquisition systems are described, they use FPGA cards to process raw data in real time. The absorbed power of the bolometer foil is calculated in real time on the FPGA. The radiation peaking factor is also calculated in real time and is used for feedback control of the discharge. The manometer uses 8 analog inputs and 4 analog outputs of a FPGA card to provide PID control of the electron current emission of a filament. The electron and ion currents are acquired at 750 kHz and the neutral gas pressures of 4 manometers are calculated in real time on a FPGA card at up to 10 kHz. The magnetic equilibrium diagnostic acquires 80 magnetic probe and flux loop signals at 10 kHz. The 95 plasma position and shape parameters and magnetic flux surfaces are calculated in real time. The function parameterization algorithm used to calculate the magnetic flux surfaces in real time requires the multiplication of a matrix of dimension 2691*231 with a vector of length 231. This matrix and vector multiplication is solved through parallel computing on a dual quad-core computer and the execution time of this operation is reduced by a factor of four compared to calculation on a single core. This document is composed of an abstract followed by a poster. (authors)

  10. RT-Symmetric Laplace Operators on Star Graphs: Real Spectrum and Self-Adjointness

    Directory of Open Access Journals (Sweden)

    Maria Astudillo

    2015-01-01

    Full Text Available How ideas of PT-symmetric quantum mechanics can be applied to quantum graphs is analyzed, in particular to the star graph. The class of rotationally symmetric vertex conditions is analyzed. It is shown that all such conditions can effectively be described by circulant matrices: real in the case of odd number of edges and complex having particular block structure in the even case. Spectral properties of the corresponding operators are discussed.

  11. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Real-time computing platform for spiking neurons (RT-spike).

    Science.gov (United States)

    Ros, Eduardo; Ortigosa, Eva M; Agís, Rodrigo; Carrillo, Richard; Arnold, Michael

    2006-07-01

    A computing platform is described for simulating arbitrary networks of spiking neurons in real time. A hybrid computing scheme is adopted that uses both software and hardware components to manage the tradeoff between flexibility and computational power; the neuron model is implemented in hardware and the network model and the learning are implemented in software. The incremental transition of the software components into hardware is supported. We focus on a spike response model (SRM) for a neuron where the synapses are modeled as input-driven conductances. The temporal dynamics of the synaptic integration process are modeled with a synaptic time constant that results in a gradual injection of charge. This type of model is computationally expensive and is not easily amenable to existing software-based event-driven approaches. As an alternative we have designed an efficient time-based computing architecture in hardware, where the different stages of the neuron model are processed in parallel. Further improvements occur by computing multiple neurons in parallel using multiple processing units. This design is tested using reconfigurable hardware and its scalability and performance evaluated. Our overall goal is to investigate biologically realistic models for the real-time control of robots operating within closed action-perception loops, and so we evaluate the performance of the system on simulating a model of the cerebellum where the emulation of the temporal dynamics of the synaptic integration process is important.

  13. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Generación Automática de Software para Sistemas de Tiempo Real: Un Enfoque basado en Componentes, Modelos y Frameworks

    Directory of Open Access Journals (Sweden)

    Diego Alonso

    2012-04-01

    Full Text Available Resumen: Los Sistemas de Tiempo-Real poseen características que los hacen particularmente sensibles a las decisiones arquitectónicas que se adopten. El uso de Frameworks y Componentes ha demostrado ser eficaz en la mejora de la productividad y calidad del software, sobre todo si se combina con enfoques de Líneas de Productos. Sin embargo, los resultados en cuanto a reutilización y estandarización dejan patente la ausencia de portabilidad tanto de los diseños como las implementaciones basadas en componentes. Este artículo, fundamentado en el Desarrollo de Software Dirigido por Modelos, presenta un enfoque que separa la descripción de aplicaciones de tiempo–real basadas en componentes de sus posibles implementaciones para distintas plataformas. Esta separación viene soportada por la integración automática del código obtenido a partir de los modelos de entrada en frameworks implementados usando tecnología orientada a objetos. Asimismo, se detallan las decisiones arquitectónicas adoptadas en la implementación de uno de estos frameworks, que se utilizará como caso de estudio para ilustrar los beneficios derivados del enfoque propuesto. Por último, se realiza una comparativa en términos de coste de desarrollo con otros enfoques alternativos. Abstract: Real-Time Systems have some characteristics that make them particularly sensitive to architectural decisions. The use of Frameworks and Components has proven effective in improving productivity and software quality, especially when combined with Software Product Line approaches. However, the results in terms of software reuse and standardization make the lack of portability of both the design and componentbased implementations clear. This article, based on the Model- Driven Software Development paradigm, presents an approach that separates the component-based description of real-time applications from their possible implementations on different

  15. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  16. Searching for the best real-time RT-PCRs to detect Zika virus infections: the importance of comparing several protocols

    Directory of Open Access Journals (Sweden)

    F.M. de Moraes

    2018-05-01

    Full Text Available Clinical manifestations of Zika, dengue, and chikungunya virus infections are very similar, making it difficult to reach a diagnosis based only on clinical grounds. In addition, there is an intense cross-reactivity between antibodies directed to Zika virus and other flaviviruses, and an accurate Zika diagnosis is best achieved by real-time RT-PCR. However, some real-time RT-PCR show better performance than others. To reach the best possible Zika diagnosis, the analytic sensitivity of some probe-based real-time RT-PCR amplifying Zika virus RNA was evaluated in spiked and clinical samples. We evaluated primers and probes to detect Zika virus, which had been published before, and tested sensitivity using serum spiked and patient samples by real-time RT-PCR. When tested against spiked samples, the previously described primers showed different sensitivity, with very similar results when samples from patients (serum and urine were analyzed. Real-time RT-PCR designed to amplify Zika virus NS1 showed the best analytical sensitivity for all samples.

  17. LabVIEW aplicado al diagnóstico de estado en tiempo real de transformadores de potencia; LabVIEW apply to diagnostic that assess the condition in real time of the power transfor

    Directory of Open Access Journals (Sweden)

    Eliezer Fernández Padrón

    2014-04-01

    Full Text Available Este trabajo está dirigido al rediseño del Sistema de Adquisición y Procesamiento de Datos de la Estación para el Diagnóstico de Estado en Tiempo Real del Autotransformador de Potencia No. 2 de 100MVA, de la Subestación Barquisimeto de Venezuela, a partir de controladores embebidos en tiempo real de la familia cRIO de National Instruments y las técnicas de programación que ofrece la plataforma NI LabVIEW, con la finalidad de integrar un sistema único (software-hardware que permita aumentar la calidad en las mediciones, el procesamiento de los datos, la interface hombre-máquina, su capacidad de expansión y reproducibilidad. El mismo puede ser accedido mediante navegadores Web de Internet y transferir datos en tiempo real a través de la red, además es capaz de trabajar autónomo presentando respaldo en comunicación y alimentación de energía eléctrica, logrando un mejor servicio de diagnóstico continuo en dicho autotransformador.  This work is focused on the redesign of the Acquisition System and Processing Data of the Station for the Diagnostic that Assess the Condition in Real Time of the 100MVA Power Autotransformer No. 2 of the Substation Barquisimeto from Venezuela with the embedded controllers in real time of the cRIO technology of the National Instruments and the programming techniques supported by the NI LabVIEW platform with the purpose of integrating an unique system (hardware-software that allows to improve the quality in the measurements, the processing data, the man-machine interface, its expansion capability and reproduction. This system can be obtained by the internet web browser and it can transfer data in real time through the network, it is also able to work autonomous having a back in communicating and electrical energy feeding, getting a better continuous diagnostic service and the autotransformer.

  18. LabVIEW aplicado al diagnóstico de estado en tiempo real de transformadores de potencia LabVIEW apply to diagnostic that assess the condition in real time of the power transformers

    Directory of Open Access Journals (Sweden)

    Eliezer Fernández Padrón

    2012-02-01

    Full Text Available Este trabajo está dirigido al rediseño del Sistema de Adquisición y Procesamiento de Datos de la Estación para el Diagnóstico de Estado en Tiempo Real del Autotransformador de Potencia No. 2 de 100MVA, de la Subestación Barquisimeto de Venezuela, a partir de controladores embebidos en tiempo real de la familia cRIO de National Instruments y las técnicas de programación que ofrece la plataforma NI LabVIEW, con la finalidad de integrar un sistema único (software-hardware que permita aumentar la calidad en las mediciones, el procesamiento de los datos, la interface hombre-máquina, su capacidad de expansión y reproducibilidad. El mismo puede ser accedido mediante navegadores Web de Internet y transferir datos en tiempo real a través de la red, además es capaz de trabajar autónomo presentando respaldo en comunicación y alimentación de energía eléctrica, logrando un mejor servicio de diagnóstico continuo en dicho autotransformador.This work is focused on the redesign of the Acquisition System and Processing Data of the Station for the Diagnostic that Assess the Condition in Real Time of the 100MVA Power Autotransformer No. 2 of the Substation Barquisimeto from Venezuela with the embedded controllers in real time of the cRIO technology of the National Instruments and the programming techniques supported by the NI LabVIEW platform with the purpose of integrating an unique system (hardware-software that allows to improve the quality in the measurements, the processing data, the man-machine interface, its expansion capability and reproduction. This system can be obtained by the internet web browser and it can transfer data in real time through the network, it is also able to work autonomous having a back in communicating and electrical energy feeding, getting a better continuous diagnostic service and the autotransformer.

  19. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  20. The Natural History of Kidney Graft Cortical Microcirculation Determined by Real-Time Contrast-Enhanced Sonography (RT-CES).

    Science.gov (United States)

    Jiménez, Carlos; López, María Ovidia; Ros, Amaia; Aguilar, Ana; Menendez, David; Rivas, Begoña; Santana, María José; Vaca, Marco Antonio; Escuin, Fernando; Madero, Rosario; Selgas, Rafael

    2016-01-01

    Kidney transplantation is the therapy of choice for end-stage kidney disease. Graft's life span is shorter than expected due in part to the delayed diagnosis of various complications, specifically those related to silent progression. It is recognized that serum creatinine levels and proteinuria are poor markers of mild kidney lesions, which results in delayed clinical information. There are many investigation looking for early markers of graft damage. Decreasing kidney graft cortical microcirculation has been related to poor prognosis in kidney transplantation. Cortical capillary blood flow (CCBF) can be measured by real-time contrast-enhanced sonography (RT-CES). Our aim was to describe the natural history of CCBF over time under diverse conditions of kidney transplantation, to explore the influence of donor conditions and recipient events, and to determine the capacity of CCBF for predicting renal function in medium term. RT-CES was performed in 79 consecutive kidney transplant recipients during the first year under regular clinical practice. Cortical capillary blood flow was measured. Clinical variables were analyzed. The influence of CCBF has been determined by univariate and multivariate analysis using mixed regression models based on sequential measurements for each patient over time. We used a first-order autoregression model as the structure of the covariation between measures. The post-hoc comparisons were considered using the Bonferroni correction. The CCBF values varied significantly over the study periods and were significantly lower at 48 h and day 7. Brain-death donor age and CCBF levels showed an inverse relationship (r: -0.62, p<0.001). Living donors showed higher mean CCBF levels than brain-death donors at each point in the study. These significant differences persisted at month 12 (54.5 ± 28.2 vs 33.7 ± 30 dB/sec, living vs brain-death donor, respectively, p = 0.004) despite similar serum creatinine levels (1.5 ± 0.3 and 1.5 ± 0.5 mg/dL). A

  1. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  3. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    OpenAIRE

    Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

    2010-01-01

    Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

  4. Puesta a punto del método de PCR en tiempo real para la cuantificación de Aspergillus carbonarius en uvas Vitis vinifera cv. Tannat

    Directory of Open Access Journals (Sweden)

    Gustavo Garmendia

    2011-12-01

    Full Text Available La ocratoxina A (OTA es una micotoxina que ha sido detectada en uvas y vinos. Es producida por Aspergillus ochraceus, Penicillium verrucosum, Aspergillus carbonarius y especies pertenecientes al agregado Aspergillus niger. En los últimos años se ha descrito la presencia de Aspergillus aculeatus y Aspergillus japonicus en la superficie de uvas y su capacidad de producir OTA. A pesar de que la concentración detectada de cepas pertenecientes a la Sección Nigri fue < 100/g de uva, se han aislado, identificado y caracterizado 56 cepas de Aspergillus pertenecientes a la Sección Nigri. El 51 % fue identificado como A. niger, el 39 % como A. japonicus, 5 % como A. tubingensis -like y 5 % como A. foetidus. Ninguna cepa de A. carbonarius fue aislada. Debido a que esta especie ha sido descrita como la principal responsable de la presencia de OTA en uvas y vinos por su capacidad de producir altas concentraciones de OTA, se requiere un método más sensible que los métodos convencionales para detectar y cuantificar la presencia de A. carbonarius en uva. En este trabajo se optimizó la técnica de PCR en tiempo real para la detección y cuantificación de esta especie en uvas d e la variedad Tannat.

  5. Uso de la metodología GAIA para modelar el comportamiento de personajes en un juego de estrategia en tiempo real

    Directory of Open Access Journals (Sweden)

    Norman Muñoz

    2010-01-01

    Full Text Available Los juegos modernos en su permanente búsqueda por capturar más la atención de sus jugadores, requieren de técnicas de Inteligencia Artificial que les permita a los personajes asumir comportamientos más cercanos o parecidos a la realidad. Para lograr esto, existen muchas técnicas que se pueden utilizar, pero en los últimos años el uso de agentes inteligentes ha tomado gran importancia, ya que las propiedades de los personajes encajan perfectamente con la definición de dicha técnica. En este artículo, se presentan los principales resultados de investigación y la forma como se usó la metodología GAIA para el modelamiento del comportamiento de los personajes en un juego de estrategia de tiempo real llamado Independencia (basado en la Revolución de los Comuneros de la Independencia de Colombia.

  6. Redes Inalámbricas para el Monitoreo y Control en tiempo real de Sistemas de Calentamiento de agua con Colectores Solares

    Directory of Open Access Journals (Sweden)

    Alfredo Pino Escalona

    2011-05-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 Tecnología inalámbrica ZigBee para monitorear en tiempo real un sistema de calentamiento de agua  instalado en el hotel Las América en Santiago de Cuba con energía solar. Se analiza el flujo tecnológico de la instalación y las principales características del estándar IEEE 802.15.4 y la pila desarrollada por Microchip. El diseño del sistema incluye dos módulos y se controla la temperatura del agua para las habitaciones  manipulando el caudal que recircula entre los calentadores solares y el tanque de almacenamiento. El diseño e implementación del controlador se realiza utilizando microcontroladores PICs  y un sistema supervisorio  programado en LabWindowsTM/CVITM 9.0

  7. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  9. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  10. Enhanced control of dorsolateral prefrontal cortex neurophysiology with real-time functional magnetic resonance imaging (rt-fMRI) neurofeedback training and working memory practice.

    Science.gov (United States)

    Sherwood, Matthew S; Kane, Jessica H; Weisend, Michael P; Parker, Jason G

    2016-01-01

    Real-time functional magnetic resonance imaging (rt-fMRI) neurofeedback can be used to train localized, conscious regulation of blood oxygen level-dependent (BOLD) signals. As a therapeutic technique, rt-fMRI neurofeedback reduces the symptoms of a variety of neurologic disorders. To date, few studies have investigated the use of self-regulation training using rt-fMRI neurofeedback to enhance cognitive performance. This work investigates the utility of rt-fMRI neurofeedback as a tool to enhance human cognition by training healthy individuals to consciously control activity in the left dorsolateral prefrontal cortex (DLPFC). A cohort of 18 healthy participants in the experimental group underwent rt-fMRI neurofeedback from the left DLPFC in five training sessions across two weeks while 7 participants in the control group underwent similar training outside the MRI and without rt-fMRI neurofeedback. Working memory (WM) performance was evaluated on two testing days separated by the five rt-fMRI neurofeedback sessions using two computerized tests. We investigated the ability to control the BOLD signal across training sessions and WM performance across the two testing days. The group with rt-fMRI neurofeedback demonstrated a significant increase in the ability to self-regulate the BOLD signal in the left DLPFC across sessions. WM performance showed differential improvement between testing days one and two across the groups with the highest increases observed in the rt-fMRI neurofeedback group. These results provide evidence that individuals can quickly gain the ability to consciously control the left DLPFC, and this training results in improvements of WM performance beyond that of training alone. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Real-time onestep RT-PCR for the detection and differentiation of European and North American types of PRRSV in boar semen

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...

  12. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...

  13. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...

  14. Expansion of the Real-Time SPoRT-Land Information System for NOAA/National Weather Service Situational Awareness and Local Modeling Applications

    Science.gov (United States)

    Case, Jonathan L; White, Kristopher D.

    2014-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center in Huntsville, AL is running a real-time configuration of the Noah land surface model (LSM) within the NASA Land Information System (LIS) framework (hereafter referred to as the "SPoRT-LIS"). Output from the real-time SPoRT-LIS is used for (1) initializing land surface variables for local modeling applications, and (2) displaying in decision support systems for situational awareness and drought monitoring at select NOAA/National Weather Service (NWS) partner offices. The experimental CONUS run incorporates hourly quantitative precipitation estimation (QPE) from the National Severe Storms Laboratory Multi- Radar Multi-Sensor (MRMS) which will be transitioned into operations at the National Centers for Environmental Prediction (NCEP) in Fall 2014.This paper describes the current and experimental SPoRT-LIS configurations, and documents some of the limitations still remaining through the advent of MRMS precipitation analyses in the SPoRT-LIS land surface model (LSM) simulations.

  15. Comparison of ELISA and dual stage real time RT-PCR to differentiate Sabin like and non-Sabin like poliovirus isolates.

    Science.gov (United States)

    Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan

    2017-06-01

    Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.

  16. Exploring physical and chemical factors influencing the properties of recombinant prion protein and the real-time quaking-induced conversion (RT-QuIC) assay.

    Science.gov (United States)

    Cheng, Keding; Sloan, Angela; Avery, Kristen M; Coulthart, Michael; Carpenter, Michael; Knox, J David

    2014-01-01

    Real-time quaking-induced conversion (RT-QuIC), a highly specific and sensitive assay able to detect low levels of the disease-inducing isoform of the prion protein (PrP(d)) in brain tissue biopsies and cerebral spinal fluid, has great potential to become a method for diagnosing prion disease ante mortem. In order to standardize the assay method for routine analysis, an understanding of how physical and chemical factors affect the stability of the recombinant prion protein (rPrP) substrate and the RT-QuIC assay's sensitivity, specificity, and reproducibility is required. In this study, using sporadic Creutzfeldt-Jakob Disease brain homogenate to seed the reactions and an in vitro-expressed recombinant prion protein, hamster rPrP, as the substrate, the following factors affecting the RT-QuIC assay were examined: salt and substrate concentrations, substrate storage, and pH. Results demonstrated that both the generation of the quality and quantities of rPrP substrate critical to the reaction, as well as the RT-QuIC reaction itself required strict adherence to specific physical and chemical conditions. Once optimized, the RT-QuIC assay was confirmed to be a very specific and sensitive assay method for sCJD detection. Findings in this study indicate that further optimization and standardization of RT-QuIC assay is required before it can be adopted as a routine diagnostic test.

  17. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nagorsen Dirk

    2003-12-01

    Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

  19. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

    2003-01-01

    The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

  20. Evaluation of RIDA®GENE norovirus GI/GII real time RT-PCR using stool specimens collected from children and adults with acute gastroenteritis.

    Science.gov (United States)

    Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R

    2018-04-10

    Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.

  1. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  2. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  3. Rapid detection and subtyping of European swine influenza viruses in porcine clinical samples by haemagglutinin- and neuraminidase-specific tetra- and triplex real-time RT-PCRs.

    Science.gov (United States)

    Henritzi, Dinah; Zhao, Na; Starick, Elke; Simon, Gaelle; Krog, Jesper S; Larsen, Lars Erik; Reid, Scott M; Brown, Ian H; Chiapponi, Chiara; Foni, Emanuela; Wacheck, Silke; Schmid, Peter; Beer, Martin; Hoffmann, Bernd; Harder, Timm C

    2016-11-01

    A diversifying pool of mammalian-adapted influenza A viruses (IAV) with largely unknown zoonotic potential is maintained in domestic swine populations worldwide. The most recent human influenza pandemic in 2009 was caused by a virus with genes originating from IAV isolated from swine. Swine influenza viruses (SIV) are widespread in European domestic pig populations and evolve dynamically. Knowledge regarding occurrence, spread and evolution of potentially zoonotic SIV in Europe is poorly understood. Efficient SIV surveillance programmes depend on sensitive and specific diagnostic methods which allow for cost-effective large-scale analysis. New SIV haemagglutinin (HA) and neuraminidase (NA) subtype- and lineage-specific multiplex real-time RT-PCRs (RT-qPCR) have been developed and validated with reference virus isolates and clinical samples. A diagnostic algorithm is proposed for the combined detection in clinical samples and subtyping of SIV strains currently circulating in Europe that is based on a generic, M-gene-specific influenza A virus RT-qPCR. In a second step, positive samples are examined by tetraplex HA- and triplex NA-specific RT-qPCRs to differentiate the porcine subtypes H1, H3, N1 and N2. Within the HA subtype H1, lineages "av" (European avian-derived), "hu" (European human-derived) and "pdm" (human pandemic A/H1N1, 2009) are distinguished by RT-qPCRs, and within the NA subtype N1, lineage "pdm" is differentiated. An RT-PCR amplicon Sanger sequencing method of small fragments of the HA and NA genes is also proposed to safeguard against failure of multiplex RT-qPCR subtyping. These new multiplex RT-qPCR assays provide adequate tools for sustained SIV monitoring programmes in Europe. © 2016 The Authors. Influenza and Other Respiratory Viruses Published by John Wiley & Sons Ltd.

  4. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Real-time data management system for mobile equipment in opencast mining. Sistema de gestion de datos en tiempo real de la operacion de maquinas moviles en mineria

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Sineriz Martinez, J.L.; Colomo Gomez, M. (AITEMIN, Madrid (Spain))

    1989-10-01

    At Emma mine belonging to the company ENCASUR (Puertollano), a real-time data management system has been installed for mobile equipment which, initially, is being tested on a track-mounted rotary drill. The system monitors the machine and produces reports on output and productivity as well as providing information on the technical parameters of the drill holes. As part of research work for a doctoral thesis, these parameters will be used to define a single variable associated with the geomechanical characteristics of the material being drilled. The change in this variable along the length of the borehole will give the thickness and strength of the drilled material. This information can be used directly to determine the nature of the explosive required. The system was financed by the Directorate General of Mines and was developed by AITEMIN in conjunction with ENCASUR. 6 figs., 1 tab.

  6. DESARROLLO DE UN SISTEMA DE CONTROL PARA LA CAPTURA Y MEDICIÓN EXPERIMENTAL DE LA EFICIENCIA Y CURVA CARACTERÍSTICA I-V EN TIEMPO REAL DE UN SISTEMA FOTOVOLTAICO UTILIZANDO LABVIEW® Y ARDUINO

    Directory of Open Access Journals (Sweden)

    Juan Pablo Vargas Bautista

    2015-07-01

    Full Text Available En el presente artículo se presenta un sistema de control para la visualización en tiempo real de datos experimentales de la curva de eficiencia y de la curva característica I-V (corriente versus voltaje de un panel fotovoltaico (FV SUNTECH-STP030-12. El sistema está compuesto de un programa desarrollado en LabView® y un circuito electrónico de captura y procesamiento de datos.  Se utilizó un microprocesador Arduino UNO R3 para la interface entre los datos del panel FV y el programa en LabView®.  Los resultados muestran que es posible utilizar microprocesadores de bajo costo con suficiente capacidad de procesamiento en tiempo real de la información obtenida de los paneles FV.

  7. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

  8. PCR en tiempo real para el sexaje y análisis citológico de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis niloticus

    Directory of Open Access Journals (Sweden)

    Zulita Prieto

    2017-01-01

    Full Text Available El objetivo de la presente investigación fue dar a conocer nuevos marcadores moleculares para la PCR en tiempo real asociados a los cromosomas sexuales y el análisis de la sinapsis del bivalente más pequeño en espermatocitos en paquiteno de Oreochromis nil oticus . Se diseñaron cuatro pares de cebadores y se pusieron a prueba por PCR punto final y por PCR en tiempo real utilizando el fluorescente SYBR® Green en muestras de ADN de hembras XX, machos XY y supermachos YY. Los tamaños de los fragmentos amplificad os por PCR punto final fueron concordantes a los valores esperados y por PCR en tiempo real se demostró igual especificidad pero con ventaja en rapidez en la detección de amplificación de marcadores asociados a los cromosoma X y Y, de acuerdo con las condi ciones de la PCR establecidas. Las diferencias genéticas entre las regiones de los cromosomas X y Y demostradas con los marcadores específicos no fueron perceptibles citológicamente en los espermatocitos en paquiteno de O. niloticus XY. En base a las difer encias y homologías de las secuencias de ADN entre las accesiones KC710223 y KC710224 de los cromosomas X y Y se propone un modelo de sinapsis del bivalente XY.

  9. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  10. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  11. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  12. Supervisory system for real time monitoring of transient thermal stresses in turbines rotors; Sistema supervisorio para el monitoreo en tiempo real de esfuerzos termicos transitorios en rotores de turbinas

    Energy Technology Data Exchange (ETDEWEB)

    Urquiza Beltran, Gustavo; Rios Miranda, Edmundo; Venegas Guzman, Ricardo; Alvarez Garcia, Gabriela [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1991-12-31

    This article presents a supervisory system that, as its main functions, assists the operator on base of the thermal stresses, monitoring in real time the high pressure (HP) and intermediate pressure rotors (IP) of a steam turbine during the start, shut down and/or sudden load changes. The system is based on a thermal model uni-dimensional integrated to the SIMPER (Information System for the Predictive Maintenance of Rotating Equipment), tested in a 300 MW unit of Comision Federal de Electricidad (CFE). [Espanol] En este articulo se presenta un sistema supervisorio que, como funciones principales, asiste al operador con base en el monitoreo de esfuerzos termicos en tiempo real en los rotores de presion alta (PA) y presion intermedia (PI) de una turbina de vapor durante un arranque, paro y/o variaciones bruscas de carga. El sistema esta basado en un modelo termico unidimensional integrado al SIMPER (sistema informatico para el mantenimiento predictivo de equipo rotatorio), experimentado en una unidad de 300 MW de la Comision Federal de Electricidad (CFE).

  13. Supervisory system for real time monitoring of transient thermal stresses in turbines rotors; Sistema supervisorio para el monitoreo en tiempo real de esfuerzos termicos transitorios en rotores de turbinas

    Energy Technology Data Exchange (ETDEWEB)

    Urquiza Beltran, Gustavo; Rios Miranda, Edmundo; Venegas Guzman, Ricardo; Alvarez Garcia, Gabriela [Instituto de Investigaciones Electricas, Cuernavaca (Mexico)

    1992-12-31

    This article presents a supervisory system that, as its main functions, assists the operator on base of the thermal stresses, monitoring in real time the high pressure (HP) and intermediate pressure rotors (IP) of a steam turbine during the start, shut down and/or sudden load changes. The system is based on a thermal model uni-dimensional integrated to the SIMPER (Information System for the Predictive Maintenance of Rotating Equipment), tested in a 300 MW unit of Comision Federal de Electricidad (CFE). [Espanol] En este articulo se presenta un sistema supervisorio que, como funciones principales, asiste al operador con base en el monitoreo de esfuerzos termicos en tiempo real en los rotores de presion alta (PA) y presion intermedia (PI) de una turbina de vapor durante un arranque, paro y/o variaciones bruscas de carga. El sistema esta basado en un modelo termico unidimensional integrado al SIMPER (sistema informatico para el mantenimiento predictivo de equipo rotatorio), experimentado en una unidad de 300 MW de la Comision Federal de Electricidad (CFE).

  14. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Science.gov (United States)

    Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

    2017-01-01

    Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

  15. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa

    2017-01-01

    Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

  16. Diagnóstico molecular de tuberculosis extrapulmonar y sensibilidad a rifampicina con un método automatizado en tiempo real

    Directory of Open Access Journals (Sweden)

    Adrián Peñata

    2016-04-01

    Conclusión. La prueba Xpert® MTB/RIF tuvo un buen desempeño en muestras de diferentes tejidos y líquidos, y constituye un avance significativo como apoyo para el diagnóstico de la tuberculosis extrapulmonar en términos de tiempo y porcentaje de positividad.

  17. Diseño e implementación de un sistema de adquisición de datos sismológicos en tiempo real

    Directory of Open Access Journals (Sweden)

    Vega V. Pedro A.

    2001-08-01

    Full Text Available

    The proposed objective was the design, characterization and setting in operation of a real time data acquisition system. Starting with LAC type existent seismometer for which was implemented the software and hardware required to obtain the seismological registration station. The selected hardware was a National Instruments data acquisition card DAQ-516, this board has 8 analog input channels (16 bit and 50 ks/s. The used software LabVIEW 6.0 was also National Instruments which is a graphic programming software that controls all card's data acquisition possibilities and additionally has powerful data handling tools. The other system components are a portable computer and a signal conditioning card. Once implemented and proven the data acquisition system, we proceeded to carry out the characterization of the system. Here the instrumental noise was determined, and the sensor was "characterized for this a shaking table was designed and built. By means of an Internet connection, the system's internal clock synchronization is carried out by means of ATOMTIME 98 software.

    EI objetivo propuesto fue el diseño, caracterización y puesta en operación de un sistema de adquisición de datos en tiempo real. Para lograrlo se partió de un sismómetro existente tipo L-4C con base en el cual se implementaron el software y hardware requeridos para obtener la estación de registro sismológico. EI hardware seleccionado fue una tarjeta de adquisición de datos fabricada por National Instruments, referencia DAQ-516, la cual entre sus principales características cuenta con ocho canales de entrada analógica, y una rata de muestreo de 50.000 muestras por segundo. EI software utilizado fue el LabVIEW 6

  18. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  19. Evaluation of FTA cards as a laboratory and field sampling device for the detection of foot-and-mouth disease virus and serotyping by RT-PCR and real-time RT-PCR.

    Science.gov (United States)

    Muthukrishnan, Madhanmohan; Singanallur, Nagendrakumar B; Ralla, Kumar; Villuppanoor, Srinivasan A

    2008-08-01

    Foot-and-mouth disease virus (FMDV) samples transported to the laboratory from far and inaccessible areas for serodiagnosis pose a major problem in a tropical country like India, where there is maximum temperature fluctuation. Inadequate storage methods lead to spoilage of FMDV samples collected from clinically positive animals in the field. Such samples are declared as non-typeable by the typing laboratories with the consequent loss of valuable epidemiological data. The present study evaluated the usefulness of FTA Classic Cards for the collection, shipment, storage and identification of the FMDV genome by RT-PCR and real-time RT-PCR. The stability of the viral RNA, the absence of infectivity and ease of processing the sample for molecular methods make the FTA cards a useful option for transport of FMDV genome for identification and serotyping. The method can be used routinely for FMDV research as it is economical and the cards can be transported easily in envelopes by regular document transport methods. Live virus cannot be isolated from samples collected in FTA cards, which is a limitation. This property can be viewed as an advantage as it limits the risk of transmission of live virus.

  20. Development of a novel real-time RT-PCR assay to detect Seneca Valley virus-1 associated with emerging cases of vesicular disease in pigs.

    Science.gov (United States)

    Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa

    2017-01-01

    Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Selection of reference genes for quantitative real-time RT-PCR studies in tomato fruit of the genotype MT-Rg1

    Directory of Open Access Journals (Sweden)

    Karla L. González-Aguilera

    2016-09-01

    Full Text Available Quantitative real-time RT-PCR (qRT-PCR has become one of the most widely used methods for accurate quantification of gene expression. Since there are no universal reference genes for normalization, the optimal strategy to normalize raw qRT-PCR data is to perform an initial comparison of a set of independent reference genes to assess the most stable ones in each biological model. Normalization of a qRT-PCR experiment helps to ensure that the results are both statistically significant and biologically meaningful. Tomato is the model of choice to study fleshy fruit development. The miniature tomato (Solanum lycopersicum L. cultivar Micro-Tom (MT is considered a model system for tomato genetics and functional genomics. A new genotype, containing the Rg1 allele, improves tomato in vitro regeneration. In this work, we evaluated the expression stability of four tomato reference genes, namely CAC, SAND, Expressed and ACTIN2. We showed that the genes CAC and Exp are the best reference genes of the four we tested during fruit development in the MT-Rg1 genotype. Furthermore, we validated the reference genes by showing that the expression profiles of the transcription factors FRUITFULL1 (FUL1 and APETALA2c (AP2c during fruit development are comparable to previous reports using other tomato cultivars.

  2. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  3. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  4. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

    Science.gov (United States)

    Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

    2002-01-01

    A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

  5. Location and Classification of Moving Fruits in Real Time with a Single Color Camera Localización y Clasificación de Frutas Móviles en Tiempo Real con una Cámara Individual a Color

    Directory of Open Access Journals (Sweden)

    José F Reyes

    2009-06-01

    Full Text Available Quality control of fruits to satisfy increasingly competitive food markets requires the implementation of automatic servovisual systems in fruit processing operations to cope with market challenges. A new and fast method for identifying and classifying moving fruits by processing single color images from a static camera in real time was developed and tested. Two algorithms were combined to classify and track moving fruits on image plane using representative color features. The method allows classifying the fruit by color segmentation and estimating its position on the image plane, which provides a reliable algorithm to be implemented in robotic manipulation of fruits. To evaluate the methodology an experimental real time system simulating a conveyor belt and real fruit was used. Testing of the system indicates that with natural lighting conditions and proper calibration of the system a minimum error of 2% in classification of fruits is feasible. The methodology allows for very simple implementation, and although operational results are promising, even higher accuracy may be possible if structured illumination is used.El control de calidad en frutas y hortalizas para satisfacer mercados cada vez mas exigentes, requiere la implementación de sistemas automáticos servo visuales en operaciones de de procesamiento de frutas para responder a estos desafíos de mercado. En está trabajo se desarrollo y evaluó un nuevo método para identificar y clasificar frutas en movimiento mediante el procesamiento en tiempo real imágenes a color capturadas por una cámara individual estática. Se combinaron dos algoritmos para clasificar y rastrear frutas en movimiento en el plano de imagen utilizando aspectos representativos de color. El método permite clasificar las frutas en base a segmentación de color y estimar su posición en el plano de imagen, lo cual proporciona un algoritmo confiable para ser implementado en un brazo robótico.de manipulación de

  6. Encefalitis herpética confirmada por reacción en cadena de la polimerasa en tiempo real: reporte de caso Herpetic encephalitis confirmed by real time polymerase chain reaction: case report

    Directory of Open Access Journals (Sweden)

    Beatriz H. Aristizábal

    2006-04-01

    Full Text Available La encefalitis herpética es una enfermedad grave asociada al virus herpes simple 1 ó 2, con una alta letalidad, incidencia de complicaciones y secuelas neurológicas permanentes. Aparece en forma endémica y en pacientes inmunocompetentes. Puede manifestarse como un cuadro clásico de encefalitis infecciosa con fiebre, cefalea y alteración en el nivel de conciencia. Debido al compromiso del lóbulo temporal las manifestaciones clínicas pueden incluir también alucinaciones, afasia y cambios de personalidad. Las secuelas en los pacientes tratados son significativas. Objetivo: mostrar la importancia de la utilización del diagnóstico molecular temprano en pacientes con sospecha de encefalitis herpética. Métodos: el diagnóstico de la encefalitis herpética ha cambiado en los últimos años gracias al advenimiento de la reacción en cadena de la polimerasa en tiempo real en líquido cefalorraquídeo para Herpes virus simple, una estrategia rápida y de alta sensibilidad y especificidad, que en nuestro medio ha permitido reemplazar los diagnósticos presuntivos realizados por tomografía axial computarizada o electroencefalograma o los bajos rendimientos del aislamiento viral en el líquido cefaloraquídeo. Resultados: se describe el caso clínico de un paciente con encefalitis herpética asistido en nuestro hospital, con diagnóstico confirmado por reacción en cadena de la polimerasa en tiempo real, presentando estudios imaginológicos y neuropsicológicos compatibles con el diagnóstico. Conclusiones: los resultados de laboratorio y el diagnóstico temprano son críticos para el tratamiento precoz y la evolución del paciente. The herpetic encephalitis is a serious disease associated to the herpes virus simplex 1 or 2 with high mortality, permanent incidence of complications and neurological sequels. It appears in endemic form and in immunocompetent patients. It can be shown like a classical manifest of infectious encephalitis, with fever

  7. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Rapid detection and subtyping of European swine influenza viruses in porcine clinical samples by haemagglutinin- and neuraminidase-specific tetra- and triplex real-time RT-PCRs

    DEFF Research Database (Denmark)

    Henritzi, Dinah; Zhao, Na; Starick, Elke

    2016-01-01

    diagnostic methods which allow for cost-effective large-scale analysis. Methods New SIV haemagglutinin (HA) and neuraminidase (NA) subtype- and lineage-specific multiplex real-time RT-PCRs (RT-qPCR) have been developed and validated with reference virus isolates and clinical samples. Results A diagnostic....... Swine influenza viruses (SIV) are widespread in European domestic pig populations and evolve dynamically. Knowledge regarding occurrence, spread and evolution of potentially zoonotic SIV in Europe is poorly understood. Objectives Efficient SIV surveillance programmes depend on sensitive and specific......Background A diversifying pool of mammalian-adapted influenza A viruses (IAV) with largely unknown zoonotic potential is maintained in domestic swine populations worldwide. The most recent human influenza pandemic in 2009 was caused by a virus with genes originating from IAV isolated from swine...

  9. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Science.gov (United States)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  10. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  11. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  12. Plataforma de un sistema embebido para el control y monitoreo en tiempo real aplicado a biodigestores para la óptima producción de biogás

    OpenAIRE

    Siadén Paiva, Dany Manuel Eduardo

    2017-01-01

    El objetivo de la tesis es evaluar el diseño y construcción de una plataforma de sistema embebido para el control y monitoreo en tiempo real aplicado a diferentes prototipos de biodigestores a escala piloto ubicados en las instalaciones de la Universidad de Piura. Para ello, se inicia un estudio del proceso de digestión anaerobia con el fin de determinar las variables influyentes en el proceso. Luego, se realiza un análisis de los biodigestores instalados en el país para conocer la tecnología...

  13. Clasificación en tiempo real de materias primas mediante un sensor espectroscópico de imagen y técnicas lineales de procesado de datos

    OpenAIRE

    García Allende, Pilar Beatriz; Conde Portilla, Olga María; Mirapeix Serrano, Jesús María; Cubillas de Cos, Ana María; López Higuera, José Miguel

    2007-01-01

    RESUMEN: En este artículo se presenta un nuevo método de procesado de imágenes hiperespectrales capturadas mediante un sensor espectroscópico de imagen. Basado en un algoritmo de clasificación lineal, permite mejorar las restricciones de tiempo real que planteaba un sistema de clasificación de materia prima diseñado previamente. El procesado de datos consta de dos bloques: compresión de características e interpretación de las mismas. La compresión se realiza empleando Análisis de Componentes ...

  14. Diseño de un Software de Intermediación de Comunicación para Sistemas Distribuidos de Tiempo Real Críticos en Java

    Directory of Open Access Journals (Sweden)

    Daniel Tejera

    2013-04-01

    Full Text Available Resumen: Las facilidades e independencia de plataforma de Java han generado un gran interés en la comunidad de tiempo real. Dicho interés se ha reflejado en la especificación RTSJ (Real-Time Specification for Java, que extiende y adapta el lenguaje Java para permitir el desarrollo de sistemas de tiempo real. Adicionalmente, se han desarrollado perfiles de RTSJ para garantizar la predecibilidad en sistemas de tiempo real críticos. Sin embargo, RTSJ y sus perfiles no proporcionan facilidades para sistemas distribuidos. El objetivo de este trabajo es afrontar dicha limitación definiendo un nuevo modelo de RMI (Remote Method Invocation basado en los principales perfiles de RTSJ para sistemas de tiempo real crítico. Este trabajo presenta el diseño y la implementación de RMI-HRT (RMI-Hard Real-Time que está enfocado a sistemas de tiempo real crítico con requisitos de alta integridad. Abstract: Distributed real-time embedded systems are becoming increasingly important to society. More demands will be made on them and greater reliance will be placed on the delivery of their services. A relevant subset of them is high-integrity or hard real-time systems, where failure can cause loss of life, environmental harm, or significant financial loss.Additionally, the evolution of communication networks and paradigms as well as the necessity of demanding processing power and fault tolerance, motivated the interconnection between electronic devices; many of the communications have the possibility of transferring data at a high speed. The concept of distributed systems emerged as systems where different parts are executed on several nodes that interact with each other via a communication network.Java's popularity, facilities and platform independence have made it an interesting language for the real-time and embedded community. This was the motivation for the development of RTSJ (Real-Time Specification for Java, which is a language extension intended to

  15. Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology.

    Science.gov (United States)

    Huhtamo, Eili; Hasu, Essi; Uzcátegui, Nathalie Y; Erra, Elina; Nikkari, Simo; Kantele, Anu; Vapalahti, Olli; Piiparinen, Heli

    2010-01-01

    The increased traveling to dengue endemic regions and the numerous epidemics have led to a rise in imported dengue. The laboratory diagnosis of acute dengue requires several types of tests and often paired samples are needed for obtaining reliable results. Although several diagnostic methods are available, proper comparative data on their performance are lacking. To compare the performance of novel methods including a novel pan-DENV real-time RT-PCR and a commercially available NS1 capture-EIA in regard to IgM detection for optimizing the early diagnosis of DENV in travelers. A panel of 99 selected early phase serum samples of dengue patients was studied by real-time RT-PCR, NS1 antigen ELISA, IgM-EIA, IgG-IFA and cell culture virus isolation. The novel real-time RT-PCR was shown specific and sensitive for detection of DENV-1-4 RNA and suitable for diagnostic use. The diagnostic rate using combination of RNA and IgM detection was 99% and using NS1 and IgM detection 95.9%. The results of RNA and NS1 antigen detection disagreed in 15.5% of samples that had only RNA or NS1 antigen detected. The diagnostic rates of early samples are higher when either RNA or NS1 antigen detection is combined with IgM detection. Besides the differences in the RNA and NS1 detection assays, the observed discrepancy of results could suggest individual variation or differences in timing of these markers in patient serum. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  16. Novel Molecular Beacon Probe-Based Real-Time RT-PCR Assay for Diagnosis of Crimean-Congo Hemorrhagic Fever Encountered in India

    Directory of Open Access Journals (Sweden)

    Aman Kamboj

    2014-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging zoonotic disease in India and requires immediate detection of infection both for preventing further transmission and for controlling the infection. The present study describes development, optimization, and evaluation of a novel molecular beacon-based real-time RT-PCR assay for rapid, sensitive, and specific diagnosis of Crimean-Congo hemorrhagic fever virus (CCHFV. The developed assay was found to be a better alternative to the reported TaqMan assay for routine diagnosis of CCHF.

  17. Correlation of immune activation with HIV-1 RNA levels assayed by real-time RT-PCR in HIV-1 Subtype C infected patients in Northern India

    Science.gov (United States)

    Agarwal, Atima; Sankaran, Sumathi; Vajpayee, Madhu; Sreenivas, V; Seth, Pradeep; Dandekar, Satya

    2014-01-01

    Background Assays with specificity and cost effectiveness are needed for the measurement of HIV-1 burden to monitor disease progression or response to anti-retroviral therapy (ART) in HIV-1 subtype C infected patients. Objectives The objective of this study was to develop and validate an affordable; one step Real-Time RT-PCR assay with high specificity and sensitivity to measure plasma HIV-1 loads in HIV-1 subtype C infected patients. Results We developed an RT-PCR assay to detect and quantitate plasma HIV-1 levels in HIV-1 subtype C infected patients. An inverse correlation between plasma viral loads (PVL) and CD4+ T-cell numbers was detected at all CDC stages. Significant correlations were found between CD8+ T-cell activation and PVL, as well as with the clinical and immunological status of the patients. Conclusions The RT-PCR assay provides a sensitive method to measure PVL in HIV-1 subtype C infected patients. Viral loads correlated with immune activation and can be used to monitor HIV care in India. PMID:17962068

  18. Avian metapneumovirus RT-nested-PCR: a novel false positive reducing inactivated control virus with potential applications to other RNA viruses and real time methods.

    Science.gov (United States)

    Falchieri, Marco; Brown, Paul A; Catelli, Elena; Naylor, Clive J

    2012-12-01

    Using reverse genetics, an avian metapneumovirus (AMPV) was modified for use as a positive control for validating all stages of a popular established RT-nested PCR, used in the detection of the two major AMPV subtypes (A and B). Resultant amplicons were of increased size and clearly distinguishable from those arising from unmodified virus, thus allowing false positive bands, due to control virus contamination of test samples, to be identified readily. Absorption of the control virus onto filter paper and subsequent microwave irradiation removed all infectivity while its function as an efficient RT-nested-PCR template was unaffected. Identical amplicons were produced after storage for one year. The modified virus is likely to have application as an internal standard as well as in real time methods. Additions to AMPV of RNA from other RNA viruses, including hazardous examples such HIV and influenza, are likely to yield similar safe RT-PCR controls. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Real time Intelligent Control Laboratory (RT-ICL) of PowerLabDK for smart grid technology development

    DEFF Research Database (Denmark)

    Ostergaard, Jacob; Wu, Qiuwei; Garcia-Valle, Rodrigo

    2012-01-01

    This paper presents the Intelligent Control Laboratory (ICL) of the PowerLabDK and describes examples of ongoing research work utilizing the ICL. The ICL is comprised of a real time digital simulator (RTDS) with 5 racks, a full scale SCADA system and experimental control room with a link to the B......This paper presents the Intelligent Control Laboratory (ICL) of the PowerLabDK and describes examples of ongoing research work utilizing the ICL. The ICL is comprised of a real time digital simulator (RTDS) with 5 racks, a full scale SCADA system and experimental control room with a link...

  20. Evaluation of 793/B-like and Mass-like vaccine strain kinetics in experimental and field conditions by real-time RT-PCR quantification.

    Science.gov (United States)

    Tucciarone, C M; Franzo, G; Berto, G; Drigo, M; Ramon, G; Koutoulis, K C; Catelli, E; Cecchinato, M

    2018-01-01

    Infectious bronchitis virus (IBV) is a great economic burden both for productive losses and costs of the control strategies. Many different vaccination protocols are applied in the same region and even in consecutive cycles on the same farm in order to find the perfect balance between costs and benefits. In Northern Italy, the usual second vaccination is more and more often moved up to the chick's first d of life. The second strain administration together with the common Mass priming by spray at the hatchery allows saving money and time and reducing animal stress. The present work compared the different vaccine strains (Mass-like or B48, and 1/96) kinetics both in field conditions and in a 21-day-long experimental trial in broilers, monitoring the viral replication by upper respiratory tract swabbing and vaccine specific real time reverse transcription PCR (RT-PCR) quantification. In both field and experimental conditions, titers for all the vaccines showed an increasing trend in the first 2 wk and then a decrease, though still remaining detectable during the whole monitored period. IBV field strain and avian Metapneumovirus (aMPV) presence also was also investigated by RT-PCR and sequencing, and by multiplex real-time RT-PCR, respectively, revealing a consistency in the pathogen introduction timing at around 30 d, in correspondence with the vaccine titer's main decrease. These findings suggest the need for an accurate knowledge of live vaccine kinetics, whose replication can compete with the other pathogen one, providing additional protection to be added to what is conferred by the adaptive immune response. © 2017 Poultry Science Association Inc.

  1. Demonstration of a very inexpensive, turbidimetric, real-time, RT-LAMP detection platform using shrimp Laem-Singh virus (LSNV as a model.

    Directory of Open Access Journals (Sweden)

    Narong Arunrut

    Full Text Available Rapid and accurate detection of pathogens under field laboratory conditions is necessary for effective control of veterinary pathogens. Here we describe a prototype, portable, pathogen detection device developed for single tube, real-time, reverse transcription, loop-mediated isothermal amplification (RT-LAMP using Laem-Singh virus (LSNV as a model. LSNV is an RNA virus and a component cause of growth retardation in black tiger shrimp. We chose its RNA-dependent RNA polymerase (RdRp gene as the target for our tests. The basis for detection was measurement of turbidity arising from formation of a white, insoluble magnesium pyrophosphate precipitate byproduct upon amplification of the RdRp target sequence from 100 ng template RNA extracted from shrimp. The measurement device consisted of a heating block to maintain constant temperature in the RT-LAMP reaction for 8 Eppindorf sample tubes, a light-emitting diode (LED light source providing red light emission at 650 nm wavelength to pass through sample tubes, a light dependent resistance (LDR photo-detector and a software program to report turbidity events and could potentially be marketed for under US$3000. The device was connected to a computer to display real-time results in a variety of formats. The optimized protocol for LSNV detection consisted of incubation of the sample tubes at 65 °C for 1 h during which turbidity was continuously measured, and quantitative results could be obtained by reaction time measurement. The sensitivity of detection was comparable to that of conventional nested RT-PCR and there was no cross reaction with other common shrimp viruses. The device was used for quantitative measurement of relative copy numbers of LSNV RdRp in 8 shrimp tissues and they were found to be highest in the gills followed in order by the lymphoid organ and hemolymph (p ≤ 0.05. This platform can be easily adapted for detection of other pathogens under field laboratory settings.

  2. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

    Science.gov (United States)

    Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

    2012-03-01

    Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    OpenAIRE

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...

  5. The use of best estimate codes to improve the simulation in real time; El uso de codigos best estimate y de entornos disenados para mejorar su productividad en simulacion en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Rivero, N.; Esteban, J. A.; Lenhardt, G.

    2007-07-01

    Best estimate codes are assumed to be the technology solution providing the most realistic and accurate response. Best estimate technology provides a complementary solution to the conservative simulation technology usually applied to determine plant safety margins and perform security related studies. Tecnatom in the early 90's, within the MAS project, pioneered the initiative to implement best estimate code in its training simulators. Result of this project was the implementation of the first six-equations thermal hydraulic code worldwide (TRAC{sub R}T), running in a training environment. To meet real time and other specific training requirements, it was necessary to overcome important difficulties. Tecnatom has just adapted the Global Nuclear Fuel core Design code: PANAC 11, and is about to complete the General Electric TRACG04 thermal hydraulic code adaptation. This technology features a unique solution for nuclear plants aiming at providing the highest fidelity in simulation, enabling to consider the simulator as a multipurpose: engineering and training, simulation platform. Besides, a visual environment designed to optimize the models life cycle, covering both pre and post-processing activities, is in its late development phase. (Author)

  6. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  7. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  8. Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

    Science.gov (United States)

    Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

    2013-12-01

    Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  10. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    Science.gov (United States)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  11. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  12. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  13. Pandemic preparedness in Hawaii: a multicenter verification of real-time RT-PCR for the direct detection of influenza virus types A and B.

    Science.gov (United States)

    Whelen, A Christian; Bankowski, Matthew J; Furuya, Glenn; Honda, Stacey; Ueki, Robert; Chan, Amelia; Higa, Karen; Kumashiro, Diane; Moore, Nathaniel; Lee, Roland; Koyamatsu, Terrie; Effler, Paul V

    2010-01-01

    We integrated multicenter, real-time (RTi) reverse transcription polymerase chain reaction (RT-PCR) screening into a statewide laboratory algorithm for influenza surveillance and response. Each of three sites developed its own testing strategy and was challenged with one randomized and blinded panel of 50 specimens previously tested for respiratory viruses. Following testing, each participating laboratory reported its results to the Hawaii State Department of Health, State Laboratories Division for evaluation and possible discrepant analysis. Two of three laboratories reported a 100% sensitivity and specificity, resulting in a 100% positive predictive value and a 100% negative predictive value (NPV) for influenza type A. The third laboratory showed a 71% sensitivity for influenza type A (83% NPV) with 100% specificity. All three laboratories were 100% sensitive and specific for the detection of influenza type B. Discrepant analysis indicated that the lack of sensitivity experienced by the third laboratory may have been due to the analyte-specific reagent probe used by that laboratory. Use of a newer version of the product with a secondary panel of 20 specimens resulted in a sensitivity and specificity of 100%. All three laboratories successfully verified their ability to conduct clinical testing for influenza using diverse nucleic acid extraction and RTi RT-PCR platforms. Successful completion of the verification by all collaborating laboratories paved the way for the integration of those facilities into a statewide laboratory algorithm for influenza surveillance and response.

  14. Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

    Science.gov (United States)

    Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

    2016-10-01

    In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Science.gov (United States)

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  16. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  17. Normalización de un sistema de reacción en cadena de la polimerasa en tiempo real para la cuantificación de papilomavirus humano de alto riesgo oncogénico

    Directory of Open Access Journals (Sweden)

    Yudira Soto

    2012-04-01

    Full Text Available El objetivo de este trabajo fue normalizar e implementar un sistema de reacción en cadena de la polimerasa en tiempo real, para determinar la carga viral de 7 genotipos de papilomavirus humano (PVH de alto riesgo oncogénico. Se evaluó la especificidad del sistema y se construyeron las curvas estándar para PVH 16 y 18, que se emplearon para la cuantificación de ADN viral en diferentes muestras de pacientes identificados como positivos a PVH, mediante reacción en cadena de la polimerasa (RCP cualitativa y secuenciación nucleotídica. Se obtuvieron dos curvas estándar para PVH 16 y 18, a partir del ADN genómico de las líneas celulares SiHa y HeLa, las que mostraron una buena correlación lineal ( r = -0,99 y valores bajos de error. El límite inferior de detección a partir del ADN de las líneas celulares fue de hasta 10 copias para ambos genotipos. No se obtuvo reacción cruzada entre los diferentes tipos de PVH ni con otros virus ADN. La reacción en cadena de la polimerasa en tiempo real (RCP-TR normalizada probó ser un sistema simple, rápido, específico y altamente sensible. Además, permitirá desarrollar investigaciones sobre la prevalencia de infección por PVH en Cuba, con vistas a la aplicación de las vacunas que se encuentran disponibles en el mercado internacional, así como la evaluación de otros candidatos vacunales diseñados en el futuro.

  18. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  19. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  20. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  1. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  2. Modelando tiempo y espacio

    Directory of Open Access Journals (Sweden)

    Róger Churnside Harrison

    2008-06-01

    Full Text Available En este artículo se elaboran modelos de las ideas de tiempo y espacio social de Anthony Giddens o, por lo menos, compatibles con ellas. Hacia tal efecto, se aplican instrumentos gráficos y matemáticos para combinar conceptos cualitativos y cuantitativos, de los cuales se obtienen los siguientes resultados: Desde una perspectiva teórica y lógica, se muestra que la estructura de toda organización envuelve una cantidad de trabajo operativo que no es la simple suma de trabajo de sus miembros, sino una multiplicación o fracción de esa suma dada por la razón de la estancia promedio de trabajadores a la duración del ejercicio gerencial, ambas medidas en tiempo. Esta razón de tiempo laboral/gerencial tiene un carácter dual: se deriva del proceso de estructuración organizacional; y, a la vez, afecta, retroalimenta o reactiva ese proceso. En términos prácticos, los modelos permiten describir, cuantitativamente, fenómenos organizacionales de siempre o permanentes, como el compromiso recíproco o la responsabilidad mutua de gerentes y trabajadores; los cuales, en la tradición económica y sociológica, sólo han sido manejados de modo intuitivo, implícito o cualitativo. También permiten analizar y sintetizar problemas de estabilidad/inestabilidad y crecimiento/declinación observados en organizaciones actuales, especialmente corporaciones capitalistas. La composición de los modelos, así como las consecuencias y predicciones derivadas de ellos, son ilustradas con información empírica de varias fuentes, incluyendo las bases de datos internacionales de Challenger, Gray and Christmas Inc., Booz Allen Hamilton y The Economist.

  3. High-level expression of podoplanin in benign and malignant soft tissue tumors: immunohistochemical and quantitative real-time RT-PCR analysis.

    Science.gov (United States)

    Xu, Yongjun; Ogose, Akira; Kawashima, Hiroyuki; Hotta, Tetsuo; Ariizumi, Takashi; Li, Guidong; Umezu, Hajime; Endo, Naoto

    2011-03-01

    Podoplanin is a 38 kDa mucin-type transmembrane glycoprotein that was first identified in rat glomerular epithelial cells (podocytes). It is expressed in normal lymphatic endothelium, but is absent from vascular endothelial cells. D2-40 is a commercially available mouse monoclonal antibody which binds to an epitope on human podoplanin. D2-40 immunoreactivity is therefore highly sensitive and specific for lymphatic endothelium. Recent investigations have shown widespread applications of immunohistochemical staining with D2-40 in evaluating podoplanin expression as an immunohistochemical marker for diagnosis and prognosis in various tumors. To determine whether the podoplanin (D2-40) antibody may be useful for the diagnosis of soft tissue tumors, 125 cases, including 4 kinds of benign tumors, 15 kinds of malignant tumors and 3 kinds of tumor-like lesions were immunostained using the D2-40 antibody. Total RNA was extracted from frozen tumor tissue obtained from 41 corresponding soft tissue tumor patients and 12 kinds of soft tissue tumor cell lines. Quantitative real-time PCR reactions were performed. Immunohistochemical and quantitative real-time RT-PCR analyses demonstrated the expression of the podoplanin protein and mRNA in the majority of benign and malignant soft tissue tumors and tumor-like lesions examined, with the exception of alveolar soft part sarcoma, embryonal and alveolar rhabdomyosarcoma, extraskeletal Ewing's sarcoma/peripheral primitive neuro-ectodermal tumor and lipoma, which were completely negative for podoplanin. Since it is widely and highly expressed in nearly all kinds of soft tissue tumors, especially in spindle cell sarcoma, myxoid type soft tissue tumors and soft tissue tumors of the nervous system, podoplanin is considered to have little value in the differential diagnosis of soft tissue tumors.

  4. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  5. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    Science.gov (United States)

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  6. Detección de Listeria spp. y Listeria monocytogenes en muestras de leche cruda y quesos artesanales respectivamente, mediante PCR en Tiempo Real

    Directory of Open Access Journals (Sweden)

    Viviana Pamela Chiluisa-Utreras

    2017-07-01

    Full Text Available Background. In Ecuador, studies about bacteria genre Listeria in artisanal cheeses are scarce, and in raw milk, practically nonexistent. Milk production is one of the main livestock activities in the province of Pichincha and it is essential to study these products. Since all the cantons that make up Pichincha are milk producers, three of them, Cayambe, Quito and Pedro Moncayo were randomly sampled. Objective. To determine Listeria spp. And Listeria monocytogenes in samples of raw milk and artisanal cheeses, respectively, using Real Time PCR. Methods. The application of the qPCR technique in the detection of microorganisms and especially of bacteria in food, is based on four fundamental aspects: its sensitivity, specificity, speed and processing capacity of large sample flow. It is possible to detect small amounts of pathogenic microorganisms, such as Listeria spp in raw milk, after extraction and quantification of total DNA. Results. In this study in raw milk, one positive was determined from a total of 60 samples, representing 1.6% of Listeria spp. and 16 positive samples of 45, representing 35.6% of Listeria monocytogenes in artisanal cheeses from three farms in the province of Pichincha. Conclusions. The results, according to the statistical analyzes carried out with the Kruskal - Wallis test, show that in Pichincha the bacterium is present in raw milk, but in non - representative quantities, whereas for Listeria monocytogenes there is statistical significance in the cheeses samples

  7. Tiempo de los hechos, tiempo de la historia

    OpenAIRE

    Ruiz Torres, Pedro

    1996-01-01

    A lo largo de los siglos ha habido distintas experiencias y formas de representar el tiempo que han dado lugar a diversas topologías y modos de concebir su dirección. Este artículo se centra en algunas de esas representaciones del tiempo en la cultura moderna y en sus repercusiones en la historiografía, para terminar con una breve reflexión sobre la diferencia entre el tiempo pensado como algo externo y objetivo, y el tiempo en tanto construcción subjetiva.

  8. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Directory of Open Access Journals (Sweden)

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  9. Tiempo para un cambio

    Science.gov (United States)

    Woltjer, L.

    1987-06-01

    En la reunion celebrada en diciembre dei ano pasado informe al Consejo de mi deseo de terminar mi contrato como Director General de la ESO una vez que fuera aprobado el proyecto dei VLT, que se espera sucedera hacia fines de este aAo. Cuando fue renovada mi designacion hace tres aAos, el Consejo conocia mi intencion de no completar los cinco aAos dei contrato debido a mi deseo de disponer de mas tiempo para otras actividades. Ahora, una vez terminada la fase preparatoria para el VLT, Y habiendose presentado el proyecto formalmente al Consejo el dia 31 de marzo, y esperando su muy probable aprobacion antes dei termino de este ano, me parece que el 10 de enero de 1988 presenta una excelente fecha para que se produzca un cambio en la administracion de la ESO.

  10. En tiempos de miseria

    Directory of Open Access Journals (Sweden)

    Mario Valencia

    2015-12-01

    Full Text Available http://dx.doi.org/10.5007/1807-9288.2015v11n2p192 En Tiempos Miseria constituye una propuesta de visual-concreta contemporánea basada en la exploración de la frontera entre artes visuales, literatura y tecnología. En este hipertexto se da un rompimiento estructural del esquema lingüístico tradicional. Por la forma, por el contenido, y por la participación del espectador en la puesta en escena del acontecimiento poiético y por la morfología del texto. Recogiendo la pregunta de Hölderlin “Para qué poetas en tiempos de penuria”, la obra establece un dialogo intertextual y transemiótico con ese cuestionamiento a través de esferas rítmicas y de sentidos expresados en 42 textos diseminados a través de enlaces y vínculos que permiten la multidireccionalidad y la libertad de orden de lectura para el espectador. La propuesta brevemente sintetizada asume un propósito ineludible de abordar, eficazmente, los retos de la actual cibercultura, para mostrar, desde la poesía en una clara filiación con la poética mesoamericana (en términos de temporalidades, ritmos y tonos, dada la estructura de este aparato de poesía, los paisajes del desastre de la actual civilización occidental, hija de la razón instrumental que transformó todas las esferas de lo humano  y que, por lo tanto, obliga a tomar posiciones, en este caso, desde la creación estética critico, sin desechar ni olvidar la génesis originaria de todo quehacer poético.

  11. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  12. La Suspensión del Tiempo

    OpenAIRE

    Campo Baeza, Alberto

    2011-01-01

    Burnt Norton es el primero de los FOUR QUARTETS, una de las obras clave de T.S. Elliot (1). En sus 6 primeras líneas utiliza hasta 7 veces la palabra tiempo con reiteración sorprendente. “El tiempo presente y el tiempo pasado / quizás ambos están contenidos / el presente en el tiempo futuro / y el tiempo futuro en el tiempo pasado. / Si todo el tiempo es eternamente presente / todo tiempo es recuperable.” Pues éste, el tiempo que los poetas tan bien expresan, es el tiempo que quiere atr...

  13. TODOS LOS TIEMPO / All times

    Directory of Open Access Journals (Sweden)

    Juan José López de la Cruz

    2010-05-01

    Full Text Available RESUMEN La intervención sobre la arquitectura pasada no es más que un asunto concreto de una concepción universal de los procesos de transformación que incumben a todo el proyecto de arquitectura. Podríamos pensar que la acción arquitectónica es siempre una alteración de nuestro mundo ya existente, por lo que proyectar no es sino repensar una y otra vez sobre él, un fabuloso intento de transformar continuamente la realidad, construida o figurada, para acomodarla a lo variable de nuestro pensamiento en constante cambio. Este modo de aproximarnos al proyecto de arquitectura como alteración de una realidad continua, permanente antes y después del proyecto, observa el tiempo como materia de investigación y reflexión, el proyecto se convierte entonces en el Aleph capaz de reunir todos los instantes reales o imaginados que atañen a un lugar, entendiendo la arquitectura como una superposición de momentos entretejidos donde, a través de estrategias de alteración, podemos rescatar tiempos pasados y proyectar instantes futuros como quien recorre senderos que se bifurcan y se reencuentran, pudiendo reemprender caminos descartados en su día o descubriendo convergencias que han de producirse en un mañana a través del proyecto. La reunión de ayeres, presentes y futuros que propicia el proyecto de arquitectura permite incorporar a nuestro ámbito cultural realidades consideradas aparentemente agotadas, al tiempo que nos incita a imaginar nuestras intervenciones como un estadio más de una realidad permanente que volverá a ser ineludiblemente alterada en tiempos venideros. Este viaje pendular a través del tiempo del proyecto de arquitectura, induce a entender la degradación y la obsolescencia como parte del ciclo vital pero no siendo necesariamente el fin de éste, sino un momento intermedio a partir del cual explorar nuevas posibilidades formalizadas a través de la metamorfosis de la materia y los espacios degradados. Simult

  14. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  15. Docritfab: A program to assess the radiological impact in accidental emissions of a nuclear fuel factory in real time; Docritfab: Un programa para evaluar en tiempo real el impacto radiologico en emisiones accidentales de una fabrica de combustible nuclear

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez, J. G.; Ortiz, D.; Lopez, J.

    2014-07-01

    Docrit is a program developed for the manufacture of fuels of oxides of uranium Juzbado allowing an estimate in real time of the radiological impact in the case of accidental emissions from gaseous effluents (emissions of aerosols of UO{sub 2} and criticality accidents).

  16. Optimization of a magnetic capture RT-LAMP assay for fast and real-time detection of potato virus Y and differentiation of N and O serotypes.

    Science.gov (United States)

    Treder, Krzysztof; Chołuj, Joanna; Zacharzewska, Bogumiła; Babujee, Lavanya; Mielczarek, Mateusz; Burzyński, Adam; Rakotondrafara, Aurélie M

    2018-02-01

    Potato virus Y (PVY) infection has been a global challenge for potato production and the leading cause of downgrading and rejection of seed crops for certification. Accurate and timely diagnosis is a key for effective disease control. Here, we have optimized a reverse transcription loop-mediated amplification (RT-LAMP) assay to differentiate the PVY O and N serotypes. The RT-LAMP assay is based on isothermal autocyclic strand displacement during DNA synthesis. The high specificity of this method relies heavily on the primer sets designed for the amplification of the targeted regions. We designed specific primer sets targeting a region within the coat protein gene that contains nucleotide signatures typical for O and N coat protein types, and these primers differ in their annealing temperature. Combining this assay with total RNA extraction by magnetic capture, we have established a highly sensitive, simplified and shortened RT-LAMP procedure as an alternative to conventional nucleic acid assays for diagnosis. This optimized procedure for virus detection may be used as a preliminary test for identifying the viral serotype prior to investing time and effort in multiplex RT-PCR tests when a specific strain is needed.

  17. El tiempo y la historia. 1: Tiempo del historiador, tiempo del filósofo

    OpenAIRE

    Fortuny, F. J. (Francesc J.), 1936-2004

    1998-01-01

    No soy historiador. No voy a escribir algo que pueda parecer una historia de la idea de tiempo en la Edad Media. Ni puedo permitirme, como si fuera un dios menor, atemporal y omnisciente, dar sabios consejos a los historiadores. Un filósofo no puede adoctrinar a los profesionales de la historia sobre cómo usar sus expresiones temporales con precisión, o dictaminar sobre el meollo con- ceptual y entitativo del tiempo que hace posible su profesión, tiempo de historiadores.

  18. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  19. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  20. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Science.gov (United States)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  1. Occupational dosimetry in real time hemodynamic rooms. utility of the system Dose-aware as a training tool; Dosimetria ocupacional en tiempo real en salas de hemodinamica. Utilidad del Sistema Dose-Aware como herramienta formativa

    Energy Technology Data Exchange (ETDEWEB)

    Pinto Monedero, M.; Rodriguez Cobo, C.; Pifarre Martinez, X.; Ruiz Martin, J.; Barros Candelero, J. M.; Goicolea Ruigomez, J.; Diaz Blaires, G.; Garcia Lunar

    2014-02-01

    This paper presents the results from a study in a real time dosimetry system used in the catheter laboratory room of our center. The objective was to know the occupational doses per procedure, on the one hand, and, on the other hand, to evaluate its utility as a learning tool for radiation protection purposes with the simultaneous video recording of the interventions. 83 diagnostic and therapeutic procedures were analyzed, and an average dose per procedure of 0,37 {mu}Sv and 0,10 {mu}Sv for the main cardiologist and nurse were obtained, respectively. 36 of these interventions were also recorded and the images were synchronized with the dosimetric information stored and the dosimetry system. The findings were presented to the interventional cardiology team in a learning session. They showed a high level of satisfaction with this new method of optimizing the occupational doses through a customized learning session. (Author)

  2. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  3. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Optimal estimate of the coolant flow in the assemblies of a BWR of natural circulation in real time; Estimacion optima del flujo de refrigerante en los ensambles de un BWR de circulacion natural en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Valle H, J.; Morales S, J. B. [UNAM, Facultad de Ingenieria, Division de Estudios de Posgrado, Laboratorio de Analisis de Ingenieria de Reactores Nucleares, Paseo Cuauhnahuac 8532, Col. Progreso, 62550 Jiutepec, Morelos (Mexico); Espinosa P, G., E-mail: julfi_jg@yahoo.com.mx [Universidad Autonoma Metropolitana, Unidad Iztapalapa, Av. San Rafael Atlixco 186, Col. Vicentina, 09340 Mexico D. F. (Mexico)

    2012-10-15

    The present work exposes the design and the implementation of an advanced controller that allows estimating the coolant flow in the fuel assemblies of a BWR reactor of natural circulation in real time. To be able to reduce the penalizations that are established in the calculations of the operation limits due to the magnitude of the uncertainties in the coolant flows of a natural circulation reactor, is the objective of this research. In this work the construction of the optimal controller that allows estimating the coolant flows in a fuel channels group of the reactor is shown, as well as the operation of this applied to a reduced order model that simulates the dynamics of a natural circulation reactor. The controller design required of an estimator of the valuation variables not directly of the plant and of the estimates use of the local distributions of the coolant flow. The controller construction of the estimator was based mathematically in the filter Kalman whose algorithm allows to be carried out an advanced control of the system. To prove the estimator operation was development a simplified model that reproduces the basic dynamics of the flowing coolant in the reactor, which works as observer of the system, this model is coupled by means of the estimator controller to a detail model of the plant. The results are presented by means of graphics of the interest variables and the estimate flow, and they are documented in the chart that is presented at the end of this article. (Author)

  5. Epistolario para matar el tiempo

    OpenAIRE

    Salguero Jaramillo, Daniel Santiago

    2014-01-01

    Aquí me pongo en la tarea de intentar renunciar al tiempo tal y como lo conocemos. En esta narrativa estoy de pelea con las cronometrías y me sumerjo en la búsqueda de un tiempo propio, biológico, subjetivo, que no se mide en fracciones exactas, sino que depende de estados de ánimo, de la improductividad, del compartir con amigos y del cuidado de mi hogar y mi familia. Se trata de una puesta en escena - instalación dónde voy en estaciones jugando a quebrar mi relación con el ti...

  6. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  7. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  8. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    Science.gov (United States)

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  9. Trombosis de válvulas cardiacas biológicas. Presentación de dos casos evaluados con ecocardiografía 3D en tiempo real Thrombosis of biological valves. Report of two cases evaluated by 3D echocardiography in real time

    Directory of Open Access Journals (Sweden)

    Jairo A Rendón

    2011-10-01

    Full Text Available La trombosis de las válvulas protésicas biológicas es una complicación infrecuente, que se asocia con mortalidad elevada. En este artículo se reporta el caso de un paciente de género masculino, de 72 años de edad, con prótesis valvular biológica en posición aórtica y trombosis asociada a degeneración valvular, así como el de una paciente de género femenino de 64 años de edad, con prótesis biológica en posición mitral y trombosis de la misma en el contexto de una infección sistémica. Ambos casos se evaluaron mediante ecocardiografía transesofágica tridimensional en tiempo real.Thrombosis of biological prosthetic valves is a rare complication, associated with high mortality. We report the case of a 72 years old male patient with biological valve prosthesis in the aortic position and thrombosis associated with valvular degeneration, as well as that of a 64 years old female patient with bioprosthesis in the mitral position and thrombosis of it in the context of a systemic infection. Both cases were evaluated by three-dimensional transesophageal echocardiography in real time.

  10. Ante-mortem detection of chronic wasting disease in recto-anal mucosa-associated lymphoid tissues from elk (Cervus elaphus nelsoni) using real-time quaking-induced conversion (RT-QuIC) assay: A blinded collaborative study.

    Science.gov (United States)

    Manne, Sireesha; Kondru, Naveen; Nichols, Tracy; Lehmkuhl, Aaron; Thomsen, Bruce; Main, Rodger; Halbur, Patrick; Dutta, Somak; Kanthasamy, Anumantha G

    2017-11-02

    Prion diseases are transmissible spongiform encephalopathies (TSEs) characterized by fatal, progressive neurologic diseases with prolonged incubation periods and an accumulation of infectious misfolded prion proteins. Antemortem diagnosis is often difficult due to a long asymptomatic incubation period, differences in the pathogenesis of different prions, and the presence of very low levels of infectious prion in easily accessible samples. Chronic wasting disease (CWD) is a TSE affecting both wild and captive populations of cervids, including mule deer, white-tailed deer, elk, moose, muntjac, and most recently, wild reindeer. This study represents a well-controlled evaluation of a newly developed real-time quaking-induced conversion (RT-QuIC) assay as a potential CWD diagnostic screening test using rectal biopsy sections from a depopulated elk herd. We evaluated 69 blinded samples of recto-anal mucosa-associated lymphoid tissue (RAMALT) obtained from USDA Veterinary Services. The results were later un-blinded and statistically compared to immunohistochemical (IHC) results from the USDA National Veterinary Services Laboratories (NVSL) for RAMALT, obex, and medial retropharyngeal lymph node (MRPLN). Comparison of RAMALT RT-QuIC assay results with the IHC results of RAMALT revealed 92% relative sensitivity (95% confidence limits: 61.52-99.8%) and 95% relative specificity (95% confidence limits: 85.13-99%). Collectively, our results show a potential utility of the RT-QuIC assay to advance the development of a rapid, sensitive, and specific prion diagnostic assay for CWD prions.

  11. Aplicación de RT-Linux en el control de motores de pasos. Parte II; Appication of RT-Linux in the Control of Steps Motors. Part II

    Directory of Open Access Journals (Sweden)

    Ernesto Duany Renté

    2011-02-01

    Full Text Available Este trabajo complementa al presentado anteriormente: "Aplicación de RT-Linux en el control de motoresde pasos. Primera parte", de manera que se puedan relacionar a las tareas de adquisición y control para laobtención de un sistema lo más exacto posible. Las técnicas empleadas son las de tiempo real aprovechandolas posibilidades del microkernel RT-Linux y los software libres contenidos en sistemas Unix/Linux. Lasseñales se obtienen mediante un conversor AD y mostradas en pantalla empleando el Gnuplot.  The work presented in this paper is a complement to the control and acquisition tasks which were explainedin "Application of RT-Linux in the Control of Steps Motors. First Part", so that those both real time taskscan be fully related in order to make the whole control system more accurate. The employed techniquesare those of Real Time Taking advantage of the possibilities of the micro kernel RT-Linux and the freesoftware distributed in the Unix/Linux operating systems. The signals are obtained by means of an ADconverter and are shown in screen using Gnuplot.

  12. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East.

    Science.gov (United States)

    Reid, Scott M; Mioulet, Valerie; Knowles, Nick J; Shirazi, Nazeem; Belsham, Graham J; King, Donald P

    2014-10-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all three primer/probe sets detected the RNA from homotypic viruses and no cross-reactivity was observed with heterotypic viruses. Similar results were obtained using both single- and multiplex assay formats. Using plasmid standards, the minimum detection level of these tests was found to be lower than two copies. The results illustrate the potential of tailored rRT-PCR tools for the detection and categorization of viruses circulating in the Middle East belonging to distinct subgroups of serotypes O, A and Asia-1. These assays can also overcome the problem of serotyping samples which are found positive by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Evaluation of the analytical performance of the new Abbott RealTime RT-PCRs for the quantitative detection of HCV and HIV-1 RNA

    NARCIS (Netherlands)

    Schutten, Martin; Fries, E; Burghoorn-Maas, C; Niesters, H G M

    2007-01-01

    BACKGROUND: Despite FDA approval and CE marking of commercial tests, manufacturer independent testing of technical aspects is important. OBJECTIVES: To evaluate the analytical performance of the new Abbott RealTime HCV and HIV-1 viral load tests. STUDY DESIGN: Sensitivity, specificity and

  14. Ocio, tiempo libre y empleo

    Directory of Open Access Journals (Sweden)

    Luis Fernando Jiménez Guzmán

    2010-11-01

    Full Text Available La propuesta de la Modernidad pretende que del trabajo, la sociedad derive el bienestar y la vida feliz. El trabajo informado como empleo proporciona seguridad, opciones, posibilidades, valores, bienes, riqueza, felicidad. Una visión bien distinta a la de la Grecia Clásica, inspiradora de la democracia de Occidente, que hace poner en duda la paradoja moderna del trabajo y del tiempo libre bajo todas sus institucionalizaciones, unas generadas culturalmente por las sociedades avanzadas, otras provenientes de la tradición lúdica heredada por el siglo de la Revolución Industrial (turismo, deporte, vacaciones, fiestas, carnavales, actividades de tiempo libre, ocio. Cabe entonces preguntarse si en los inicios de la nueva era postmoderna, de la que somos protagonistas, ocurre que el trabajo y el tiempo libre vienen generando un nuevo sentido, en donde ya no aparecen como irreconciliables opuestos, ni con tajante relación de subordinación. Lo cierto es que hoy, un buen sector del pensamiento sobre la lúdica se inclina por afirmar que se está produciendo una revolución/evolución del trabajo, del empleo y del tiempo libre que los relaciona de modo distinto, acercándolos al punto de compartir entre sí nuevas y cambiantes visiones. Este texto hace parte de esa actualidad del pensamiento. Sostiene que parece haberse superado la simple apuesta teórica de cambio en la tríada binomio trabajo/ empleo/tiempo libre, pues se aprecia un efectivo cambio de rumbo al concretarse una nueva visión de felicidad y de uso del tiempo libre, ya no ligada exclusivamente con la satisfacción de las necesidades materiales, ya no amparada en el binomio histórico esclavo/amo, ya no producto exclusivo del trabajo en su visión de antaño, ya no ansiosa de excesos y banalidades, y a la vez, se aprecia el inicio del cambio hacia un trabajo que ya no es empleo privativo de la libertad, que se llena de lúdica, dejando de ser único imperativo de la vida. La Felicidad

  15. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  16. Mal tiempo, tiempo maligno, tiempo de subversión ritual. La temposensitividad agrofestiva invernal

    Directory of Open Access Journals (Sweden)

    Del Campo Tejedor, Alberto

    2006-06-01

    Full Text Available In the light of a number of festive, ritual, poetico-musical and literary expresions, from Andalusia and elsewhere, the author discusses time as lived by agrarian cultures: a syncretic time, resulting from the superposition of civico-political, religious and peasant calendars; a cyclic time, given the effects of astronomico-meteorological time on nature and the subsequent cultural response on both the instrumental dimension (the work in the fields and the expresive dimension (the rituals and the festivals; and, finally, an ages-old bipolar time, experienced as the succession of two alternating seasons —wintertime and summertime—which also underlies a dichotomous agrofestive time-sensitiveness analyzed here under the following hypothesis: during the months of «good weather,» especially May and June, the rituals have a propitiatory and positively extolling sense; they mimetically dramatize the union between earth, vegetation, animals and humans by means of prototypes and archetypes that symbolically recreate the natural order of things. By contrast, the wintertime rituals and festivals—from 1st November till Carnival, and particularly around Christmas—all have in common a grotesque character and a sense of inverted order, symbolically signifying, with a logic at once serio-comic and ambiguous, the dark side of existence, while ritually conjuring up the fears of bad weather, of fateful and pernicious time, the time of cold nights, hunger and death.

    A la luz de algunas expresiones festivas, rituales, poético-musicales y literarias, de Andalucía y otros contextos, el artículo aborda el tiempo vivido por las culturas agroganaderas: un tiempo sincrético, como consecuencia de la superposición de los calendarios civil-político, religioso y campesino; un tiempo cíclico, fruto de la incidencia del tiempo astronómico-meteorológico en la naturaleza y la consiguiente respuesta cultural en el plano instrumental (los trabajos agr

  17. Tiempo de Respuestas y Experiencia de Usuario Estudio Experimental

    Directory of Open Access Journals (Sweden)

    Delvis Echeverria

    2016-12-01

    Full Text Available La investigación está fundamentada por un estudio experimental, enfocado en la evaluación del comportamiento de los usuarios finales interactuando con tiempos de respuestas en aplicaciones reales. Se tomará como base el aporte de los autores Doherty y Thadani, investigadores de IBM relacionado con los tiempos de respuestas, y las investigaciones de Jacob Nielsen. Se llevarán a cabo un test con usuarios finales, y se expondrán optimizaciones a través de del uso de herramientas que contribuirán a mejorar los tiempos de respuestas de las aplicaciones web. Todo esto engloba una primera instancia de un proyecto que se está llevando a cabo en la empresa GeneXus Consulting, pretendiéndose lograr un punto de encuentro entre el rendimiento de las aplicaciones y la experiencia de usuario.

  18. Aplicación de RT-Linux en el control de motores de pasos. Parte I; Application of RT-Linux in the Control of Steps Mators. Part I

    Directory of Open Access Journals (Sweden)

    Ernesto Duany Renté

    2011-02-01

    Full Text Available La idea fundamental de este artículo es mostrar cómo controlar un motor de paso empleando el puertoparalelo de una computadora, y demostrar la eficiencia temporal de las aplicaciones que se desarrollan ensistemas preparados para ejecutar tareas de precisión; aprovechar al máximo la capacidad de tiempo realestricto que brinda RT-Linux para el control de accionamientos eléctricos. Se desarrolla un pequeño softwareen lenguaje C que envía las señales al puerto paralelo en el tiempo necesario. Este software no estádiseñado con fines comerciales, solo permite realizar pruebas sobre el circuito de control diseñado paraeste propósito.  The fundamental idea of this article is to control a steps motor using the parallel port of a computer anddemonstrate the temporary efficiency of the applications that are executed in prepared systems to executetasks of real time. To take advantage of to the maximum capacity of strict real time that RT-Linux offers usfor the control of electric workings. A small software is developed in language C that sent the signs to theparallel port in the necessary time. This software is not designed with commercial, only allows to carry outtests on the control circuit designed for this purpose.

  19. Real-time RT-PCR systems for CTC detection from blood samples of breast cancer and gynaecological tumour patients (Review).

    Science.gov (United States)

    Andergassen, Ulrich; Kölbl, Alexandra C; Mahner, Sven; Jeschke, Udo

    2016-04-01

    Cells, which detach from a primary epithelial tumour and migrate through lymphatic vessels and blood stream are called 'circulating tumour cells'. These cells are considered to be the main root of remote metastasis and are correlated to a worse prognosis concerning progression-free and overall survival of the patients. Therefore, the detection of the minimal residual disease is of great importance regarding therapeutic decisions. Many different detection strategies are already available, but only one method, the CellSearch® system, reached FDA approval. The present review focusses on the detection of circulating tumour cells by means of real-time PCR, a highly sensitive method based on differences in gene expression between normal and malignant cells. Strategies for an enrichment of tumour cells are mentioned, as well as a large panel of potential marker genes. Drawbacks and advantages of the technique are elucidated, whereas, the greatest advantage might be, that by selection of appropriate marker genes, also tumour cells, which have already undergone epithelial to mesenchymal transition can be detected. Finally, the application of real-time PCR in different gynaecological malignancies is described, with breast cancer being the most studied cancer entity.

  20. La savia del tiempo. Apuntes para una concepción relacional del tiempo

    OpenAIRE

    Garrido-Maturano, Ángel E.

    2008-01-01

    El artículo primero «abre» la tijera del tiempo y muestra por qué tiempo cósmico y tiempo vivido son irreductibles uno a otro. En segundo lugar «afila» las hojas de la tijera y analiza tanto tiempo cósmico cuanto tiempo vivido como categorías relacionales y la alteridad como conditio sine qua non de la efectividad del tiempo. En tercer lugar «cierra» la tijera señalando los rasgos formales comunes a tiempo cósmico y vivido. Finalmente se pregunta en qué med...

  1. Los juegos de Borges con el tiempo

    Directory of Open Access Journals (Sweden)

    Paulína Šišmišová

    2012-12-01

    Full Text Available La preocupación por el tiempo es una de las constantes de la obra del escritor argentino Jorge Luis Borges. Los «juegos con el tiempo» forman parte indispensable de sus estrategias narrativas, tal como lo documenta también su célebre cuento «Borges y yo». En nuestra contribución nos dedicaremos a estudiar la problemática del tiempo en Borges bajo dos aspectos: el tiempo como recurso de configuración del texto narrativo y el tiempo como categoria metafísica.

  2. Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

    Science.gov (United States)

    Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

    2015-03-01

    Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Field evaluation of an open and polyvalent universal HIV-1/SIVcpz/SIVgor quantitative RT-PCR assay for HIV-1 viral load monitoring in comparison to Abbott RealTime HIV-1 in Cameroon.

    Science.gov (United States)

    Guichet, Emilande; Aghokeng, Avelin; Eymard-Duvernay, Sabrina; Vidal, Nicole; Ayouba, Ahidjo; Mpoudi Ngole, Eitel; Delaporte, Eric; Ciaffi, Laura; Peeters, Martine

    2016-11-01

    With the increasing demand of HIV viral load (VL) tests in resource-limited countries (RLCs) there is a need for assays at affordable cost and able to quantify all known HIV-1 variants. VLs obtained with a recently developed open and polyvalent universal HIV-1/SIVcpz/SIVgor RT-qPCR were compared to Abbott RealTime HIV-1 assay in Cameroon. On 474 plasma samples, characterized by a wide range of VLs and a broad HIV-1 group M genetic diversity, 97.5% concordance was observed when using the lower detection limit of each assay. When using the threshold of 3.00 log 10 copies/mL, according to WHO guidelines to define virological failure (VF) in RLCs, the concordance was 94.7%, 360/474 versus 339/474 patients were identified with VF with the new assay and Abbott RealTime HIV-1, respectively. Higher VLs were measured with the new assay, +0.47 log 10 copies/mL (95% CI; 0.42-0.52) as shown with Bland-Altman analysis. Eleven samples from patients on VF with drug resistance were not detected by Abbott RealTime HIV-1 versus two only with the new assay. Overall, our study showed that the new assay can be easily implemented in a laboratory in RLCs with VL experience and showed good performance on a wide diversity of HIV-1 group M variants. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Evaluation of the Xpert Flu test and comparison with in-house real-time RT-PCR assays for detection of influenza virus from 2008 to 2011 in Marseille, France.

    Science.gov (United States)

    Salez, N; Ninove, L; Thirion, L; Gazin, C; Zandotti, C; de Lamballerie, X; Charrel, R N

    2012-04-01

    Rapid documentation of respiratory specimens can have an impact on the management of patients and their relatives in terms of preventive and curative measures. We compared the results of the Xpert(®) Flu assay (Cepheid) with three real-time RT-PCR assays using 127 nasopharyngeal samples, of which 75 were positive for influenza A (with 52 identified as A/H1N1-2009) and 52 were positive for influenza B. The Xpert(®) Flu assay presented a quasi-absence of non-interpretable tests, and showed sensitivity and specificity of 100% and 100% for Flu A, 98.4% and 100% for A/H1N1-2009, and 80.7% and 100% for Flu B. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  5. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  6. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  7. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  8. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  9. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  10. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcio

    2010-03-01

    Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

  11. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    Science.gov (United States)

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

  12. Tiempo y evolución

    OpenAIRE

    Vargas, Esteban

    2012-01-01

    En este trabajo se intenta mostrar el problema del tiempo evolutivo en dos posibles concepciones. Por una parte, ya sea que la evolución se entienda como microevolución (cambio de frecuencias génicas) o macroevolución (especiación), el concepto de tiempo usado, en general, es el cronométrico, es decir, el tiempo que mide el reloj (meses, años, miles de años, etc.). Esto quiere decir que el tiempo es considerado como una variable independiente de los procesos biológicos. Sus fases temporales s...

  13. ¿POR QUÉ LEIBNIZ REQUIERE DEL TIEMPO ABSOLUTO?

    Directory of Open Access Journals (Sweden)

    NICOLÁS VAUGHAN C

    2007-01-01

    Full Text Available En este ensayo pongo en contraposición dos doctrinas conspicuamente leibnicianas: la doctrina del tiempo relacional e ideal, y la doctrina de la armonía preestablecida. Argumentaré que si todas las substancias están necesariamente coordinadas, entonces no tiene sentido negar el carácter absoluto y real del tiempo. En la primera sección describiré la concepción newtoniana y clarkeana del tiempo absoluto; en la segunda discutiré la crítica leibniciana a dicha concepción, crítica sobre la que se erige su doctrina relacional e ideal del tiempo; en la tercera sección daré un vistazo a la metafísica monádica madura de Leibniz, haciendo especial énfasis en la doctrina de la armonía preestablecida; finalmente, en la última sección sugeriré la existencia de una tensión irreconciliable entre estas dos doctrinas.

  14. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  15. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532...

  16. Tiempo, memoria e identidad personal

    Directory of Open Access Journals (Sweden)

    Pazos, Álvaro

    2004-06-01

    Full Text Available In his analysis of the oral and written narratives by the former children evacuated to the Soviet Union during the Spanish Civil War, the author reflects on the manner in which time, memory and personal identity interrelate in these accounts. He proposes a sociological approach to the subject, comparatively more independent than that of history or psychology. His analysis reveals that the subjective dynamics that contextualizes the discourses of these people —the manner in which they talk about the past, the present, the future, life and so forth— defines these discourses in terms not so much of coherence or attempt of achievement of a synthetic unity, a well-structured narrative drawn from an individual remembrance of the past, as of disruptions, contradictions and aporias that make the narratives disorganized and uneven—which is characteristic of the present social and subjective conditions of these former children.

    En el análisis de los relatos orales y escritos de los antiguos niños españoles evacuados a la URSS durante la Guerra de España, el autor intenta problematizar el modo como tiempo, memoria e identidad personal se entrelazan en tales relatos, proponiendo un acercamiento sociológico, relativamente autónomo respecto del que podría hacer la historia o la psicología. El análisis pone de manifiesto que la dinámica subjetiva en la que se contextualizan los discursos de estas personas —los modos de hablar sobre el pasado, el presente, el futuro, la vida, etc.— define estos discursos, no tanto por la coherencia o el logro o el intento de conseguir una unidad sintética, una narración bien estructurada sacada de una memoria individual sobre el pasado, cuanto por las disrupciones, contradicciones y aporías en las que con frecuencia divaga y se demora el relato, elementos todos que remiten a la problemática social y subjetiva del presente de estos antiguos niños.

  17. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  18. Duración y tiempo humano.

    OpenAIRE

    González-Umeres, L. (Luz)

    2002-01-01

    Este trabajo presenta dos visiones del tiempo humano: las de Bergson y Polo. La propuesta bergsoniana está fechada en París, 1888, en un ambiente mecanicista al cual se enfrenta, recuperando el tiempo psicológico. La propuesta de Polo iniciada a mediados del siglo XX va más allá del nivel psicológico: se adentra en el ámbito de los trascendentales personales.

  19. RT-PLG

    DEFF Research Database (Denmark)

    Yahya, Bernardo Nugroho; Khosiawan, Yohanes; Choi, Woosik

    2016-01-01

    Streaming process mining has been rising as an emergent tool to analyze industrial practices. Obviously, the advance of streaming process mining requires the availability of a suite of real-world business processes and the execution logs in the real time manner. Literally, it is hard to obtain it...

  20. Desarrollo de sistemas expertos en tiempo real para la detección y diagnóstico de faltas en motores trifásicos de inducción

    Directory of Open Access Journals (Sweden)

    Luis Diego Murillo Soto

    2011-10-01

    Full Text Available El presente trabajo muestra las etapas y arquitectura para el  desarrollo de sistemas expertos (SE, orientados a detectar y diagnosticar las condiciones anormales de diseño en que opera el motor, estas condiciones fuera de rango son conocidas como faltas. Las faltas pueden evidenciarse al comparar el valor de diseño de alguna variable y la medición real en el punto de operación.Comercialmente existen sistemas en línea que permiten monitorear un conjunto de variables, pero requiere de una persona experta en el tema, que establezca las variables a medir y la frecuencia de medición. Posteriormente se requiere el análisis de los datos y las recomendaciones generales de los posibles causantes del problema, así como las respectivas acciones correctivas por parte del experto.El anterior sistema de monitoreo y diagnóstico está limitado principalmente por: existencia del equipo de monitoreo, contar con un experto que realice el diagnóstico, y sus respectivos costos.El diseño e implementación de un sistema experto que automatice la captura e interpretación de los datos, permitirá lograr una solución económica a las limitantes planteadas.

  1. Tiempo de sustentabilidad Time of sustainability

    Directory of Open Access Journals (Sweden)

    Enrique Leff

    2000-06-01

    Full Text Available El desarrollo sustentable, como todo desarrollo, se despliega en el tiempo. Mas este proceso no ocurre en los tiempos de la evolución biológica y del progreso económico. No es el tiempo cronológico en el que se suceden inercias y se enlazan las tendencias de la realidad existente. La sustentabilidad es la marca del límite de la racionalidad unidimensional de la modernidad, de una crisis de civilización que abre nuevos horizontes y evoca otros sentidos del tiempo. En la sustentabilidad convergen los tiempos multifacéticos de diversos procesos materiales y simbólicos -geológicos, biológicos, económicos, tecnológicos, culturales- y se enlazan las diferentes racionalidades que configuran la complejidad ambiental. Los tiempos de la sustentabilidad se forjan en formas del ser que se proyectan del pasado hacia el futuro arraigando en nuevas identidades. En esa perspectiva se esboza una visión fenomenológica de inspiración heideggeriana sobre los tiempos de sustentabilidad.Sustainable development, like any deveolopment, happens in time. But this process does not occur in the time of biological evolution or economic growth. It is not within cronological time that inercies happen and tendencies of existing reality take place. Sustentability is in the edge of the modern unidimensional rationality, of a civilization in crisis which opens new horizons and evokes different senses of time. Sustainability contains different times of diverse material and symbolic processes -geological, biological, economic, technological, cultural- and gathers different rationalities which shape environmental complexity. Sustainability times are forged by forms that are projected from the past to the future, resulting in new identities. This perspective inspires a heideggerian phenomenologic view on the times of sustainability.

  2. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  3. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Science.gov (United States)

    Jamal, Syed M; Belsham, Graham J

    2015-01-01

    Rapid and accurate diagnosis of foot-and-mouth disease (FMD) and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT) values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples) and specificity (100% each for serotypes O, A and Asia-1 positive samples) for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for the poor

  4. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Directory of Open Access Journals (Sweden)

    Syed M Jamal

    Full Text Available Rapid and accurate diagnosis of foot-and-mouth disease (FMD and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08. In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples and specificity (100% each for serotypes O, A and Asia-1 positive samples for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for

  5. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    zino

    2014-02-05

    Feb 5, 2014 ... ecological studies - A review ... The objective of this review is to assess the importance of RT-qPCR in soil related ... phenol extraction step with heat inactivation of the added .... Real time polymerase chain reaction (PCR).

  6. REFLEXIONES ACERCA DEL VIAJE EN EL TIEMPO

    Directory of Open Access Journals (Sweden)

    LUIS CARLOS PALLARES

    2011-12-01

    Full Text Available No es de extrañar, el viaje en el tiempo siempre se ha considerado imposible. Después de todo, Newton creía que el tiempo era como una flecha; una vez disparada, se eleva en línea recta, sin desviarse. Un segundo en la tierra fue un segundo en Marte. Relojes dispersos por todo el universo funcionan a la misma velocidad. Einstein nos dio una imagen mucho más radical. De acuerdo con Einstein, el tiempo era más como un río, que serpentea alrededor de estrellas y galaxias, acelerando y desacelerando al pasar cerca de cuerpos masivos.

  7. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world....

  8. Redes sociales : la memoria de la Historia en tiempo real

    OpenAIRE

    Argila Blanco, Judith

    2015-01-01

    Novedosos estudios muestran cómo a través de técnicas combinadas de análisis de redes y de minería de datos (especialmente en Twitter, que ofrece datos abiertos) es posible identificar climas de opinión dentro de colectivos de individuos inmersos en procesos históricos contemporáneos

  9. Redes sociales: La memoria de la Historia en tiempo real

    OpenAIRE

    Argila Blanco, Judith

    2015-01-01

    Novedosos estudios muestran cómo a través de técnicas combinadas de análisis de redes y de minería de datos (especialmente en Twitter, que ofrece datos abiertos) es posible identificar climas de opinión dentro de colectivos de individuos inmersos en procesos históricos contemporáneos.

  10. Aplicaciones sobre plataformas de redes neuronales en tiempo real

    OpenAIRE

    Tosini, Marcelo Alejandro; Acosta, Nelson

    2003-01-01

    El presente trabajo pretende el diseño de una metodología para la construcción de aplicaciones basadas en redes neuronales sobre una plataforma Muren. Las aplicaciones se restringen a sistemas de control y reconocimiento de patrones por imágenes. Se describe la arquitectura del sistema de desarrollo Muren, basado en 2 procesadores ZISC de 78 neuronas cada uno, una FPGA Spartan II, bancos de memoria y lógica adicional de comunicación.

  11. Proyección de la demanda a corto plazo basada en un modelo de demanda sensible al tiempo

    OpenAIRE

    Espol; Santana Villamar, Cesar Napoleon

    2017-01-01

    La tesis a desarrollarse pretende simplemente proporcionar un algoritmo, para proyectar la demanda de energía eléctrica a corto plazo, con gran precisión; mediante la descomposición de la carga en sus componentes físicas, desarrollando un modelo matemático para las diferentes componentes; y en especial de la componente sensible al tiempo. El modelo de proyección será probado con datos de carga y tiempo reales. Los datos de carga y tiempo corresponden a la ciudad de Guayaquil. Se prueb...

  12. Propuesta en MAC de redes de área personal (WPAN) para optimizar el tiempo de respuesta

    OpenAIRE

    Reggiani, Guillermo; Alimenti, Omar; Friedrich, Guillermo Rodolfo

    2009-01-01

    En redes inalámbricas de área personal (WPAN) como la 802.15.3, el tiempo de uso del canal es asignado por el controlador de la red (PNC) en base a las solicitudes de los dispositivos. En sistemas de tiempo real (STR), la asignación de pedidos por CAP (Contention Access Period) genera una indeterminación en el uso del canal. En cambio el mecanismo por MCTAs (Management Channel Time Allocation) es más apropiado para STR, ya que brinda una ranura de tiempo por cada dispositivo para que éste rea...

  13. El hysteron/proteron del tiempo

    OpenAIRE

    Diana María Acevedo Zapata

    2015-01-01

    El pasaje de la Física (218b21-219a) ha llevado a postular un concepto de tiempo determinado por las condiciones perceptivas de la psyche. Se muestra cómo las condiciones de percepción son un punto de partida en la investigación: lo que es primero y más cercano a los sentidos y más conocido para los seres humanos. El punto de llegada es la conexión necesaria entre la existencia del tiempo y la del cambio. La percepción del cambio de los durmientes de Cerdeña permite determinar los elementos q...

  14. Tiempo del indio, tiempo de Dios, tiempo de nadie (El tiempo, factor en la evangelización del Perú)

    OpenAIRE

    Mandianes Castro, Manuel

    1988-01-01

    Estudio del problema de la inculturación del Evangelio y de la aculturación de los nativos para lo que me serviré de una serie de haces de imágenes sobre el tiempo, entresacadas de "Doctrina christiana" y "Catecismo para instrucción de Indios" y Constituciones del Sínodo diocesano de Lima de 1613.

  15. Tiempo y edad biológica

    Directory of Open Access Journals (Sweden)

    Vargas, Esteban

    2013-04-01

    Full Text Available In this paper we attempt to think if it is possible to conceive age as a characteristic time of living organisms including man. In the paper we review several concepts of age coming from sciences such as chronobiology, gerontology, evolutionary biology and developmental biology, and trough all of them, we see that biological time is thought as time measured by a clock. We propose that age as biological time must be understood as a phase in the biological process, but depending on the complete cycle of the organism. In the case of human being, his age is determined also by what is “expected” about him. His age is then determined by biological and cultural aspects.En este trabajo intentamos meditar si es posible concebir la edad como un tiempo propio de los seres vivos incluyendo al hombre. En el trabajo revisamos diversos conceptos de edad obtenidos de diversas ciencias biológicas como la cronobiología, la gerontología, la biología evolutiva y la biología del desarrollo descubriendo que en ellas, en general, se sigue pensando el tiempo biológico como el tiempo que mide un reloj. Nosotros proponemos que la edad como tiempo biológico debe ser entendida como una fase del proceso biológico, pero en función del ciclo completo del organismo. En el caso del ser humano, su edad está determinada también por lo que se “espera” de él. Su edad está determinada entonces por aspectos biológicos y culturales.

  16. Historia como interrupción del tiempo

    OpenAIRE

    Aguilera Pedrosa, Antonio

    2006-01-01

    Frente a un concepto de presente como transición y a otro como repetición, Benjamín elabora uno donde el tiempo se detiene, clave para entender su concepto de historia. La interpretación habitual que separa tiempo histórico de tiempo físico quiere facilitar la comprensión de Benjamin, pero al precio de olvidar ciertas paradojas: la misma detención, la reversibilidad del tiempo, la redención del pasado entero, la invocación de la teología, la posibilidad de un cambio respecto al tiempo natural...

  17. Device for the acquisition and visualization in real time of the velocity and direction of wind in a radiological post stage; Dispositivo para la adquisicion y visualizacion en tiempo real de la velocidad y direccion del viento en una posta radiologica

    Energy Technology Data Exchange (ETDEWEB)

    Ledo P, L.M.; Guibert G, R. [CEADEN, Calle 30 No. 502 e/5 y 7 Ave. Miramar, Ciudad La Habana (Cuba); Dominguez L, O.; Alonso A, D.; Ramos V, E.O. [CPHR, Calle 20 No. 4113 e/41 y 47, Playa, 11300 La Habana, A.P. 6195 C.P. 10600 (Cuba)]. e-mail: ledo@ceaden.edu.cu

    2006-07-01

    The work shows the development, construction and post stage of a device dedicated to the acquisition and transmission in real time of the information on the behavior of the meteorological variables: velocity and wind direction. It is introduced for the first time in an observation position the automatic monitoring, in real time, using the tools that it offers the digitalisation of the information and the computation. The obtained data are registered in a PC, its are visualized appropriately and can be objects of later analysis. It was developed the application program Autoclima for such purpose. (Author)

  18. Automation of the monitoring in real time of the absorbed dose rate in air due to the environmental gamma radiation in Cuba; Automatizacion del monitoreo en tiempo real de la tasa de dosis absorbida en aire debido a la radiacion gamma ambiental en Cuba

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez L, O; Capote F, E; Carrazana G, J A; Manzano de Armas, J F; Alonso A, D; Prendes A, M; Zerquera, J T; Caveda R, C A [CPHR, Calle 20, No. 4113 e/41 y 47, Playa, La Habana, 11300, A.P. 6195 C.P. 10600 (Cuba); Kalberg, O [Swedish Radiation Protection Institute (SSI) (Sweden); Fabelo B, O; Montalvan E, A [CIAC, Camaguey (Cuba); Cartas A, H [CEAC, Cienfuegos (Cuba); Leyva F, J C [CISAT (Cuba)

    2006-07-01

    The Center of Protection and Hygiene of the Radiations (CPHR) like center rector of the National Net of Environmental Radiological Surveillance (RNVRA), it has strengthened their detection capacity and of answer before a situation of radiological emergency. The measurements of the absorbed dose rate in air due to the environmental gamma radiation in the main stations of the Net are obtained in real time and the CPHR receives the data coming from these posts at one time relatively short. To improve the operability of the RNVRA it was necessary to complete the facilities of existent monitoring using 4 automatic measurement stations with probes of gamma detection, implementing in this way a measurement system on real time. On the other hand the software were developed: GenironProbeFech, to obtain the data of the probes, DataMail for the shipment of the same ones by electronic mail and GammaRed that receives and processes the data in the rector center. (Author)

  19. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    DEFF Research Database (Denmark)

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    following a 7-day IBDV infection. The CE cells were inoculated with various multiplicity of infection (MOI) of IBDV vaccine strain Bursine-2, the expression of genes was measured by quantitative real-time PCR-based on cDNA synthesized from either normalized (100 ng) or non-normalized (10 mu l) total RNA...

  20. Characterization of Leucaena (Leucaena leucephala) oil by direct analysis in real time (DART) ion source and gas chromatography; Caracterización del aceite de Leucaena (Leucaena leucocephala) por análisis directo en tiempo real (DART) y cromatografía de gases

    Energy Technology Data Exchange (ETDEWEB)

    Alam, M.; Alandis, N.M.; Sharmin, E.; Ahmad, N.; Alrayes, B.F.; Ali, D.

    2017-07-01

    For the first time, we report the characterization of triacylglycerols and fatty acids in Leucaena (Leucaena leucephala) oil [LUCO], an unexplored nontraditional non-medicinal plant belonging to the family Fabaceae. LUCO was converted to fatty acid methyl esters (FAMEs). We analyzed the triacylglycerols (TAGs) of pure LUCO and their FAMEs by time-of-flight mass spectrometry (TOF-MS) followed by multivariate analysis for discrimination among the FAMEs. Our investigations for the analysis of LUCO samples represent noble features of glycerides. A new type of ion source, coupled with high-resolution TOF-MS was applied for the comprehensive analysis of triacylglycerols. The composition of fatty acid based LUCO oil was studied using Gas Chromatography (GC-FID). The major fatty acid components of LUCO oil are linoleic acid (52.08%) oleic acid (21.26%), palmitic acid (7.91%) and stearic acid (6.01%). A metal analysis in LUCO was done by Inductively Coupled Plasma Mass Spectrometry (ICP-MS). The structural elucidation and thermal stability of LUCO were studied by FT-IR, 1H NMR, 13C NMR spectroscopic techniques and TGA-DSC, respectively. We also measured the cytotoxicity of LUCO [Spanish] Se presenta por primera vez la caracterización de triacilgliceroles y ácidos grasos del aceite de Leucaena (Leucaena leucephala) [LUCO], una planta no medicinal, no tradicional y no explorada, perteneciente a la familia Fabaceae. Se analizaron triacilgliceroles (TAGs) de LUCO y sus FAMEs por espectrometría de masas de tiempo de vuelo (TOF-MS) seguido de análisis multivariante para discriminación entre los FAME. Nuestras investigaciones para el análisis de muestras de LUCO presentaron características propias de los glicéridos. Un nuevo tipo de fuente de iones, junto con alta resolución TOF-MS se aplicó para el análisis exhaustivo de triacilgliceroles. La composición de aceite de LUCO basado en ácidos grasos se estudió usando Cromatografía de Gas (GC-FID). Los principales

  1. Aportes y tiempos del texto (de teatro

    Directory of Open Access Journals (Sweden)

    Jean-Frédéric Chevallier

    2018-01-01

    Full Text Available Volviendo a visitar, a la luz de las prácticas escénicas contemporáneas, la relación entre texto y teatro, se propone, para entender los matices de dicha relación, hablar de texto-pregunta, texto débil, texto fuerte, texto saturado e, in fine, texto-propuesta. El surgimiento de este último, el texto-propuesta, producido por el espectador, invita a pensar que si bien se ha hablado mucho del “devenir-escénico” de un texto literario, quizás haya llegado el tiempo de enfocar el “devenir-literatura” de un acto teatral.

  2. La vida y la flecha del tiempo

    Directory of Open Access Journals (Sweden)

    Jaksel Nájera Mota

    2014-01-01

    Full Text Available La vida y la flecha del tiempo se fundamentan en una interrelación entre orden-desorden, muerte-vida, acumulación-pérdida que permite transformaciones y disipaciones en la estructura orgánica. Por lo anterior, se analizan algunos procesos metabólicos y de regeneración celular. Se demuestra que a pesar de los esfuerzos por retrasar el desgaste del organismo, la vida se mantiene dirigida a la degradación; sin embargo, es posible minimizar algunos problemas causados por el envejecimiento manteniendo una vida más saludable, con ejercicio y buena alimentación.

  3. Parejas viables que perduran en el tiempo

    Directory of Open Access Journals (Sweden)

    Juan José Cuervo Rodríguez

    2013-01-01

    Full Text Available El presente artículo científico presenta resultados del proceso llevado a cabo en el proyecto de investigación docente "Mecanismos de autorregulación en parejas viables que perduran en el tiempo". Se soporta en una mirada compleja de la psicología basada en una epistemología de la construcción. En el ámbito metodológico, se inscribe en los estudios de terapia familiar desde una perspectiva de la comunicación humana como un todo integrado. Participaron nueve parejas. Los criterios de inclusión fueron: cinco o más años de convivencia, participación voluntaria, no presentar (ni haber presentado problemáticas especiales que ameriten intervención psicoterapéutica y la obtención de un porcentaje significativo en el uso de estrategias de comunicación asertiva en la resolución de conflictos. El método general utilizado fue el análisis de la comunicación en tarea de conversación. Los principales hallazgos señalan una estrecha relación entre el contexto de desarrollo de las parejas, la emergencia de códigos comunicacionales propios y la posibilidad de perdurar en el tiempo; también, se resalta el tipo de comunicación asertiva o constructiva, la construcción de valores como el respeto y la aceptación de las diferencias, y el deseo por vivir y construir bienestar común, como elementos constitutivos de su identidad como pareja.

  4. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia

    DEFF Research Database (Denmark)

    Jamal, Syed M.; Belsham, Graham

    2015-01-01

    Asia,A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 subline-agewere also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV....... Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysableprobe-based real time reverse transcription quantitative polymerase chain reaction (RTqPCR) assays were developed for specific detection...... and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnosticassays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of OPan...

  5. Development and evaluation of a real-time RT-PCR assay for the detection of Ebola virus (Zaire) during an Ebola outbreak in Guinea in 2014-2015.

    Science.gov (United States)

    Dedkov, V G; Magassouba, N' F; Safonova, M V; Deviatkin, A A; Dolgova, A S; Pyankov, O V; Sergeev, A A; Utkin, D V; Odinokov, G N; Safronov, V A; Agafonov, A P; Maleev, V V; Shipulin, G A

    2016-02-01

    In early February 2014, an outbreak of the Ebola virus disease caused by Zaire ebolavirus (EBOV) occurred in Guinea; cases were also recorded in other West African countries with a combined population of approximately 25 million. A rapid, sensitive and inexpensive method for detecting EBOV is needed to effectively control such outbreak. Here, we report a real-time reverse-transcription PCR assay for Z. ebolavirus detection used by the Specialized Anti-epidemic Team of the Russian Federation during the Ebola virus disease prevention mission in the Republic of Guinea. The analytical sensitivity of the assay is 5 × 10(2) viral particles per ml, and high specificity is demonstrated using representative sampling of viral, bacterial and human nucleic acids. This assay can be applied successfully for detecting the West African strains of Z. ebolavirus as well as on strains isolated in the Democratic Republic of the Congo in 2014. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  7. El interculturalismo, tema de nuestro tiempo

    Directory of Open Access Journals (Sweden)

    Martín RODRÍGUEZ ROJO

    2006-01-01

    Full Text Available El presente artículo habla de los estadios diferentes por donde ha pasado la humanidad en el ámbito del interculturalismo. Se trata de una división personal del autor, sin más pretensiones que aclarar conceptos. ¿Es el interculturalismo tema de nuestro tiempo en el sentido orteguiano? Sí, se responde. Porque es la síntesis de dos grandes aspectos que caracterizan a su vez a nuestro siglo. La globalización y su revulsivo, el identitarismo. En efecto, interculturalidad significa apostar por la igualdad como meta común de todos y aceptar la diferencia de cada individuo, sociedad y cultura. Homogeneización y diversidad sin renunciar a la igualdad de derechos y deberes de todos. Dos en uno. Se añade la siguiente acotación: imposible separar interculturalismo de lucha por el desarrollo, porque no se pueden dar la mano dos sujetos sin antes darse la solidaridad de los bolsos. Si la persona humana es un complejo de biología y de pensamiento, no se concibe aceptación de mentes sin aceptación de cuerpos que se han de alimentar antes de poder pensar. Desde aquí se derivan consecuencias para el mundo de la educación y de la enseñanza, de los planes de estudio y de los currículos en general.

  8. EL ESTUDIO DEL TIEMPO: EL USO DE LA INDUMENTARIA COMO CONCEPTO ORDENADOR DEL TIEMPO

    OpenAIRE

    Llonch Molina, Nayra

    2015-01-01

    El presente artículo es el resultado de diversas investigaciones basadas en el uso de la indumentaria como estructurante cronológico de la historia. La investigación aquí presentada plantea el problema de la conceptualización del tiempo y valora la aplicación de algunas propuestas metodológicas en este sentido.La investigación que aquí se presenta se planteó como una muestra criterial para detectar el potencial didáctico de un conjunto de unidades articuladas, con la finalidad de hilar una lí...

  9. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  10. Modelling Dynamic Topologies via Extensions of VDM-RT

    DEFF Research Database (Denmark)

    Nielsen, Claus Ballegård

    Only a few formal methods include descriptions of the network topology that the modelled system is deployed onto. In VDM Real-Time (VDM-RT) this has been enabled for distributed systems that have a static structure. However, when modelling dynamic systems this fixed topology becomes an issue....... Systems with highly distributed and alternating relationships cannot be expressed correctly in a static model. This document describes how VDM-RT can be extended with new language constructs to enable the description of dynamic reconfiguration of the network topology during the runtime execution...... of a model. The extension is developed on the basis of a case study involving a dynamic system that has a constant changing system topology. With a basis in the case study a model is developed that uses the static version of VDM-RT in order to reveal the limitations of the language. The case study...

  11. Filosofía y tiempo final

    Directory of Open Access Journals (Sweden)

    Eduardo Subirats

    2011-01-01

    Full Text Available Revisar el efecto del 11 de septiembre como detonante de una nueva guerra global extendida públicamente a través de los mass media, y analizar las relaciones con el confinamiento individual, la dependencia de los medios electrónicos, el ecocidio sistemático y, principalmente, con la actual crisis del medio intelectual, son puntos centrales de este texto. La afirmación academicista del postestructuralismo, en la que el lenguaje se ostenta como única realidad legitimada, se enfrenta e impone a la creatividad y a la experiencia individual; de ello se desprenden consecuencias morales: nihilismo intelectual, constitución de la realidad como espectáculo, destrucción de culturas humanas con afanes colonialistas y destrucción de la naturaleza apoyada en el dominio científico y el poder tecnoindustrial. En el ensayo se reflexiona sobre la Teoría Crítica después del postmodernismo norteamericano, y sobre la inminencia del tiempo final contrastada con la estupidización masiva. Ante esto se plantea la recuperación de la esperanza como conocimiento activo y transformador; como el Prinzip Hoffnung de Ernst Bloch. Review the effect of September 11 as a trigger for a new global war extended publicly through the mass media and analyze relationships with individual confinement, the dependence of the electronic media, the systematic ecocide and mainly with the current crisis in the intellectual milieu, are central points of this text. The academic affirmation of post-structuralism, in which the language holds as only legitimate reality, facing and requires creativity and individual experience. This gives rise to moral consequences: intellectual nihilism, construction of the reality show, destruction of human with colonialist cares cultures and destruction of nature supported in the scientific domain and power techno. In the essay he reflects on the critical theory after the American Postmodernism and the imminence of the end time contrasted with

  12. Aquellos Tiempos del Cólera

    Directory of Open Access Journals (Sweden)

    Fernando Serpa Florez

    1986-08-01

    de Panamá que, a la sazón, hacía parte de la Nueva Granada.

    El germen llegó en el vapor “Falcon”, proveniente de Nueva Orleans con gentes que, atraídas por el recientemente descubierto oro de California, debían atravesar el istmo para arribar a su destino en la forma más rápida posible en ese tiempo. En mayo, y procedente de Nueva York, otro barco trajo un nuevo cargamento de enfermos que hicieron mayor el contagio.

    La epidemia se extendió por el litoral y ascendió por los puertos del río Magdalena, corriendo al estrago. Se calcula que en el país hubo veinte mil muertos por esta enfermedad. Mas, como sucede a veces, en lugar de acudir todos a apagar el incendio, poniendo en rigor la cuarentena -única arma eficaz que se conocía para detener el mal comenzaron las discusiones, escogiéndose para ello un sitio no del todo adecuado desde el punto de vista científico, pero sí apto para lograr resonancia: el Congreso de la República.

    Y después de acalorado estudio cuyos argumentos resumiremos adelante, en desorbitada aplicación dellaisser faire, laisser passer se aprobó la ley del 9 de junio de 1850 que es paradigma de esos tiempos. En plena epidemia de cólera se decreta la abolición de: “Cuarentenas, cordones sanitarios, u otras medidas que, so pretexto de prevenir la introducción y propagación de alguna enfermedad, impidan la libre comunicación en el interior de la Nueva Granada, o entre esta i los países extranjeros”.

    Cuál fue el origen de esta ley? El egoísmo de los comerciantes del interior que anteponían sus intereses a la difusión del mal? El ignorarse la forma de transmisión del cólera o quizá el hecho de que el chorro de Padilla no fue contaminado? La desatentada aplicación de las teorías del libre cambio a los problemas de salud?

    A la aprobación de esta ley se opuso con razonables argumentos Domingo Arosemena quien, además de médico, era representan te por Panamá...

  13. Las facetas del tiempo en la prosa de Miguel Delibes

    Directory of Open Access Journals (Sweden)

    Maria-Teresa De Pieri

    2012-12-01

    Full Text Available Con el presente estudio nos proponemos investigar la representación del tiempo y sus matices en la obra de Miguel Delibes, con particular atención a la prosa periodística y a los cuentos que el escritor vallisoletano produjo a lo largo de su intenso recorrido literario. La categoría del tiempo se relaciona en estos escritos con una idea de la existencia que sigue el ritmo cíclico de la naturaleza; un tiempo natural y mítico a la vez, un tiempo personal y colectivo, cuya fugacidad se detiene solo a través del poder eternizante de las palabras. En este sentido, la prosa breve de Delibes pretende conservar un patrimonio léxico que corre el riesgo de ser eliminado con el tiempo y con las transformaciones sociales que ello conlleva. La cuestión del tiempo abarca no solo el nivel temático y su vocabulario, sino que también irrumpe en un ámbito formal y puramente lingüístico, que intentaremos evidenciar, reflexionando sobre las particularidades de los verbos, de los adverbios y de las locuciones adverbiales, de las que la obra del escritor se alimenta de manera considerable.

  14. Itinerarios residenciales en tiempos de la maquila

    Directory of Open Access Journals (Sweden)

    Claudia Carolina Zamorano

    2006-01-01

    Full Text Available By means of the analysis of the residential and professional practices of immigrant families over Ciudad Juarez, this essay tries to show that inside the well-known abstract categories such as “popular urban residents” and “female maquila labor” exists a wide range of populational profiles that is necessary to clarify. For this reason, the work hypothesis is based on a flexible correlation of the following variables: a labor situation, b migratory status, and c the real estate and labor market exact situation. It is considered that the entrance moment on the labor and real estate markets (which speaks to us of the socio-economic and political context in which a cycle of urban integration begins, as well as the migratory situation of the head of the family, both define their labor and residential itineraries at the same time.

  15. RT 128: New Project Incubator

    Science.gov (United States)

    2015-09-04

    Evaluation and Improvements Using Dynamic Failure Valuation and Genetic Algorithms Missouri S&T University Dincer Konus Cihan Dagli Stability of System of...methodologies. From our perspective, these three collectively fall under the rubric of engineered resilience. The last three also require real-time tradeoffs

  16. El espacio y el tiempo en W. F. Flórez

    OpenAIRE

    Mandianes Castro, Manuel

    1990-01-01

    En las novelas de W. F. Flórez, como en la vida real de las aldeas gallegas, el espacio tiene muchos niveles: "lareira", aldea, parroquia, ciudad, Castilla, América, "fraga" y el subterráneo maravilloso, y el tiempo tiene cualidades: olor, sabor. Una lectura atenta de estas dos novelas demuestra que la oralidad forma parte importante de la narración; que el autor es, por lo mismo, en buena medida, un auténtico trasmisor de la tradición y que, por lo tanto, los etnólogos y antropólogos han de ...

  17. Sound / Märt Milter

    Index Scriptorium Estoniae

    Milter, Märt

    1998-01-01

    Uute plaatide Rolling Stones "No Security", Spiritualized "Live At The Royal Albert Hall", Kelly family "From Their Hearts", Arnold "Hillside Album", Joe Cocker "Greatest Hits", OST "Acid House", Songs from Andrew Lloyd Webber and Jim Steinmans "Whistle Down The Wind", The Weather Girls "PuttinÒn The Hits", Cliff Richard "Real As I Wanna Be", Folkmill "Topelt rosin", SIG "Sig 20v. Juhla-EP", "Motown Celebrates Sinatra", John Lee Hooker "Best Of Friends"

  18. Detección y cuantificación del Potato mop-top virus (PMTV en Colombia mediante qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nevar García Bastidas

    2013-04-01

    Full Text Available El Potato mop-top virus (PMTV es uno de los virus re-emergentes en cultivos de papa en Colombia. Es transmitido por Spongospora subterranea, el agente causal de la sarna polvosa. La detección del PMTV presenta dificultades debido a su distribución irregular en las plantas, bajo título y movimiento sistémico como ARN desnudo. Con el fin de ampliar el rango de herramientas disponibles para detectar el PMTV en los programas de certificación de tubérculo-semilla, en este estudio se evaluó la prueba de RT-PCR en tiempo real (qRT-PCR en dos pasos: con los cebadores PMTV-1948F/PMTV-2017R y la sonda Taqman® PMTV-1970, dirigidos al gen CP-RT del ARN2 viral. Se construyó una curva estándar a partir de la transcripción in vitro de un fragmento de 1513 pb de este gen. Posteriormente, se evaluó la utilidad de la técnica a partir de tres tipos de muestras: plantas señuelo de Nicotiana benthamiana y Solanum phureja inoculadas con quistosoros de Sss, raíces de papa con síntomas de sarna polvosa del municipio de La Unión (Antioquia y tubérculos-semilla. Mediante qRT-PCR fue posible detectar el virus en 11 de las 20 muestras de raíz de plantas señuelo, mientras que 14 de las 15 muestras de raíces de papa resultaron positivas, estimándose una concentración entre 4.72 x 10(11 y 7.60 x 10(13 partículas virales/µl. Adicionalmente, en el ensayo de tubérculo-semilla se determinó la presencia del PMTV en una de las 16 muestras. Estos resultados indican la viabilidad de utilizar rutinariamente la técnica de qRT-PCR para la detección de PMTV en Colombia.

  19. Tiempo de Dios. Tiempo de los Hombres: El Breviario de Belleville

    Directory of Open Access Journals (Sweden)

    Ofelia Manzi

    2012-11-01

    Full Text Available Las imágenes cristianas, herederas de los sistemas narrativos romanos, expresaron visualmente los contenidos escriturarios. Uno de los elementos notables lo constituye la manera de representar la secuencia temporal en sus dos posibles dimensiones: humana y divina. Un recorrido por el arte cristiano tardo antiguo y medieval permite establecer de qué manera se generó una iconografía que permitió visualizar el mensaje que, de acuerdo con la correspondiente exégesis literaria, se quiso privilegiar en momentos históricos diversos. El objetivo de este trabajo es establecer de qué manera la imagen acompaña una concepción del tiempo en su doble dimensión. El Breviario de Belleville (París, siglo XIV ofrece un ejemplo en el que se conjugan ambas concepciones del transcurrir de la vida del hombre en una particular interpretación iconográfica.  

  20. Detección de virus influenza A, B y subtipos A (H1N1 pdm09, A (H3N2 por múltiple RT-PCR en muestras clínicas

    Directory of Open Access Journals (Sweden)

    Pool Marcos

    Full Text Available Objetivos. Estandarizar la técnica de reacción en cadena de la polimerasa en tiempo real (RT-PCR múltiple para la detección de virus influenza A, B y tipificación de subtipos A (H1N1 pdm09, A (H3N2 en muestras clínicas. Materiales y métodos. Se analizaron 300 muestras de hisopado nasofaríngeo. Esta metodología fue estandarizada en dos pasos: la primera reacción detectó el gen de la matriz del virus de influenza A, gen de la nucleoproteína del virus influenza B y el gen GAPDH de las células huésped. La segunda reacción detectó el gen de la hemaglutinina de los subtipos A (H1N1 pandémico (pdm09 y A (H3N2. Resultados. Se identificaron 109 muestras positivas a influenza A y B, de las cuales 72 fueron positivas a influenza A (36 positivas a influenza A (H1N1 pdm09 y 36 positivos a influenza A (H3N2 y 37 muestras positivas a influenza B. 191 fueron negativas a ambos virus mediante RT-PCR en tiempo real multiplex. Se encontró una sensibilidad y especificidad del 100% al analizar los resultados de ambas reacciones. El límite de detección viral fue del rango de 7 a 9 copias/µL por virus. Los resultados no mostraron ninguna reacción cruzada con otros virus tales como adenovirus, virus sincitial respiratorio, parainfluenza (1,2 y 3, metapneumovirus, subtipos A (H1N1 estacional, A (H5N2 y VIH. Conclusiones. La RT-PCR múltiple demostró ser una prueba muy sensible y específica para la detección de virus influenza A, B y subtipos A (H1N1, H3N2 y su uso puede ser conveniente en brotes estacionales.

  1. Study on the Image Quality Comparison between in Digital RT and Film RT

    International Nuclear Information System (INIS)

    Park, Sang Ki; Ahn, Yean Shik; Gil, Doo Song

    2011-01-01

    Conventional film radiographic test has been generally and widely used in the inspection on the weldment for quality assurance. On the other hand, since the analog RT is well known for typical time and cost consuming method with complex process of inspection, the industry has researched various ways how to improve radiographic test technology. In this study, we verified the fact that digital RT provides a lot more benefit in effectively detecting defects, ever film details, through digital processing of image enhancement, compared to film RT. As a result, we reached conclusion that digital RT is positively able to replace the film RT in industry in part or in whole

  2. Node Ranking Tool - NoRT

    Science.gov (United States)

    2018-03-23

    NoRT) that was developed as part of the Applied Network Science 6.2 base program work unit at NRL, Code 5580. We explain the theory of NoRT and how...to use it. 23-03-2018 Memorandum Report TOPSIS, Social Network, Sensor Network, Centrality, Diffusion, Disease, Virus, Expectation , Pandemic...base program work unit at NRL. We explain the theory of NoRT and how to use it. Index Terms TOPSIS, Social Network, Sensor Network, Centrality, Diffusion

  3. La relación entre la capacidad de atencion dividida y la estimación prospectiva del tiempo

    Directory of Open Access Journals (Sweden)

    Susana Celeste Azzollini

    2004-01-01

    Full Text Available Se realizó una investigación cuyo objetivo fue determinar si la capacidad de atención dividida resultaba explicativa de la variabilidad de las estimaciones prospectivas del tiempo. Los modelos teóricos sobre dicha estimación postulan que los recursos atencionales de procesamiento están divididos entre un procesador temporal, que cuenta y almacena unidades temporales subjetivas (Subjective Temporal Units - STUs y otras actividades de procesamiento no temporal (Zakay, 1993. Se seleccionó una muestra de 36 estudiantes universitarios que fueron asignados al azar a cada una de las seis condiciones experimentales, determinadas por un diseño factorial 3 x 2, y sus factores básicos fueron: cantidad de tareas y niveles de complejidad del material. Se confeccionaron materiales para las diferentes tareas y otros con el fin de evaluar las aptitudes mnémicas y la capacidad de atención dividida. Se solicitó a los sujetos que mientras realizaban las tareas, detuvieran un cronómetro cuando consideraran que había pasado un período de tiempo predeterminado. La estimación del tiempo se calculó por la diferencia en segundos entre el tiempo real y el tiempo estimado. Los datos se procesaron con análisis de correlación, discriminante y factorial de variancia. Los resultados obtenidos indican que la capacidad de atención dividida se correlaciona con la estimación temporal prospectiva y además, la capacidad de atención dividida resulta un buen predictor de la capacidad estimativa de los sujetos, especialmente de los sobre-estimadores. Las diferencias en las aptitudes mnémicas no explicaron la variabilidad de las estimaciones prospectivas.

  4. Datalogger compacto, con tiempo real, para almacenaje de grandes cantidades de información provenientes de sensores externos en una memoria usb, con capacidad de comunicación serial. fuente de energía: 4 pilas recargables aa

    OpenAIRE

    Cercado, Cristhian; Touriz, Victor; Valdivieso, Carlos

    2011-01-01

    This project consist in the design and construction of a compact datalogger, on real time and it is based on a PIC with a MEMORY STICK DATALOGGER. The main objective is to store big quantities of information from several external sensors by means of serial communication. Compact datalogger communicates with external sensors and USB memory by means of USART communication, this process is controlled by a PIC, Iits main program realizes the communication with the MEMORY STICK DATA ...

  5. rt: Berliner Messe / Rob Cowan

    Index Scriptorium Estoniae

    Cowan, Rob

    1998-01-01

    Uuest heliplaadist "Pärt: Berliner Messe. The Beatitudes. Annum per Annum. Magnificat. Seven Magnificat Antiphons. De profundis. Polyphony / Steven Layton with Andrew Lucas" Hyperion CDA66960 (74 minutes:DDD)

  6. Arvo Pärt. Litany / Peter Korfmacher

    Index Scriptorium Estoniae

    Korfmacher, Peter

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo. Litany; Psalom; Trisagion. Hilliard Ensemble, Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra, Tõnu Kaljuste"; Lithuanian Chamber Orchestra, Saulius Sondeckis. ECM 1592/449 810-2

  7. rt: Fratres / Robert Cowan

    Index Scriptorium Estoniae

    Cowan, Robert

    1995-01-01

    Uuest heliplaadist "Pärt: Fratres (seven versions). Festina Lente. Cantus in Memory of Benjamin Britten. Summa. Peter Manning (vn.), France Springuel (vc.), Mireille Gleizes (pf.), I Fiamminghi. Telare CD CD80387 (79 minutes)

  8. SMAP Data Assimilation at NASA SPoRT

    Science.gov (United States)

    Blankenship, Clay B.; Case, Jonathan L.; Zavodsky, Bradley T.

    2016-01-01

    The NASA Short-Term Prediction Research and Transition (SPoRT) Center maintains a near-real- time run of the Noah Land Surface Model within the Land Information System (LIS) at 3-km resolution. Soil moisture products from this model are used by several NOAA/National Weather Service Weather Forecast Offices for flood and drought situational awareness. We have implemented assimilation of soil moisture retrievals from the Soil Moisture Ocean Salinity (SMOS) and Soil Moisture Active/ Passive (SMAP) satellites, and are now evaluating the SMAP assimilation. The SMAP-enhanced LIS product is planned for public release by October 2016.

  9. Predicción de series de tiempo con redes cascada-correlación

    Directory of Open Access Journals (Sweden)

    Juan David Velásquez

    2010-01-01

    Full Text Available Las redes neuronales, y en particular los perceptrones multicapa (MLP, han sido reconocidos como una de las más poderosas técnicas para estimar series de tiempo; sin embargo, la técnica de redes cascada-correlación (CC es un fuerte competidor para pronosticar series temporales pues incorpora mejoras a los problemas de identificabilidad estadística del modelo del MLP. En és- te artículo se compara el rendimiento de las redes CC respecto de otras técnicas, entre ellas el MLP, ANN y Arima, usando va- rias series de tiempo no lineales del mundo real, con el fin de determinar si las CC ofrecen buenos resultados en la práctica. Los resultados indican que las redes CC, en la mayoría de los casos, son superiores a los MLP, ANN y Arima, logrando errores me- nores en magnitud que los reportados en la literatura usando dichas técnicas, mientras que en relación a DAN2 se lograron e- rrores cercanos e incluso mejores.

  10. El tiempo en la vida humana. Disfrutar la vida.

    OpenAIRE

    Fernández-Crehuet, José María

    2016-01-01

    La conciliación de la vida profesional, familiar y personal es una tarea que estará presente durante toda nuestra vida y no siempre será sencilla. En la medida en que descubramos el sentido de nuestra vida, identificando nuestra misión, el camino que hemos de recorrer y la meta a alcanzar, podremos priorizar e integrar los distintos roles que tenemos que ejercer disfrutando del tiempo de nuestra vida.

  11. Artist - analytical RT inspection simulation tool

    International Nuclear Information System (INIS)

    Bellon, C.; Jaenisch, G.R.

    2007-01-01

    The computer simulation of radiography is applicable for different purposes in NDT such as for the qualification of NDT systems, the prediction of its reliability, the optimization of system parameters, feasibility analysis, model-based data interpretation, education and training of NDT/NDE personnel, and others. Within the framework of the integrated project FilmFree the radiographic testing (RT) simulation software developed by BAM is being further developed to meet practical requirements for inspection planning in digital industrial radiology. It combines analytical modelling of the RT inspection process with the CAD-orientated object description applicable to various industrial sectors such as power generation, railways and others. (authors)

  12. The SPoRT-WRF: Evaluating the Impact of NASA Datasets on Convective Forecasts

    Science.gov (United States)

    Zavodsky, Bradley; Kozlowski, Danielle; Case, Jonathan; Molthan, Andrew

    2012-01-01

    Short-term Prediction Research and Transition (SPoRT) seeks to improve short-term, regional weather forecasts using unique NASA products and capabilities SPoRT has developed a unique, real-time configuration of the NASA Unified Weather Research and Forecasting (WRF)WRF (ARW) that integrates all SPoRT modeling research data: (1) 2-km SPoRT Sea Surface Temperature (SST) Composite, (2) 3-km LIS with 1-km Greenness Vegetation Fraction (GVFs) (3) 45-km AIRS retrieved profiles. Transitioned this real-time forecast to NOAA's Hazardous Weather Testbed (HWT) as deterministic model at Experimental Forecast Program (EFP). Feedback from forecasters/participants and internal evaluation of SPoRT-WRF shows a cool, dry bias that appears to suppress convection likely related to methodology for assimilation of AIRS profiles Version 2 of the SPoRT-WRF will premier at the 2012 EFP and include NASA physics, cycling data assimilation methodology, better coverage of precipitation forcing, and new GVFs

  13. Calibración de cámaras de tiempo de vuelo: Ajuste adaptativo del tiempo de integración y análisis de la frecuencia de modulación

    Directory of Open Access Journals (Sweden)

    P. Gil

    2013-10-01

    Full Text Available Resumen: La percepción de profundidad se hace imprescindible en muchas tareas de manipulación, control visual y navegación de robots. Las cámaras de tiempo de vuelo (ToF: Time of Flight generan imágenes de rango que proporcionan medidas de profundidad en tiempo real. No obstante, el parámetro distancia que calculan estas cámaras es fuertemente dependiente del tiempo de integración que se configura en el sensor y de la frecuencia de modulación empleada por el sistema de iluminación que integran. En este artículo, se presenta una metodología para el ajuste adaptativo del tiempo de integración y un análisis experimental del comportamiento de una cámara ToF cuando se modifica la frecuencia de modulación. Este método ha sido probado con éxito en algoritmos de control visual con arquitectura ‘eye-in-hand’ donde el sistema sensorial está compuesto por una cámara ToF. Además, la misma metodología puede ser aplicada en otros escenarios de trabajo. Abstract: The depth perception is essential in many manipulation tasks, visual inspection and robot navigation. The cameras of Time of Flight (TOF generate range images which provide depth measurements in real time. However, the distance parameter computed from these cameras is strongly dependent on the integration time set for the sensor and the frequency of modulation used by the integrated lighting system. In this paper, a methodology for automatic setting of integration time and an experimental analysis of ToF camera behavior adjusting its modulation frequency is presented. This method has been successfully tested on visual servoing algorithms with architecture ‘eye-in-hand’ in which the sensory system consists of a ToF camera, in addition this methodology can be applied to other workspaces and scenarios. Palabras clave: Tiempo de vuelo, calibración, imagen de rango, percepción robótica, cámaras 3D, Keywords

  14. A Formal Approach for RT-DVS Algorithms Evaluation Based on Statistical Model Checking

    Directory of Open Access Journals (Sweden)

    Shengxin Dai

    2015-01-01

    Full Text Available Energy saving is a crucial concern in embedded real time systems. Many RT-DVS algorithms have been proposed to save energy while preserving deadline guarantees. This paper presents a novel approach to evaluate RT-DVS algorithms using statistical model checking. A scalable framework is proposed for RT-DVS algorithms evaluation, in which the relevant components are modeled as stochastic timed automata, and the evaluation metrics including utilization bound, energy efficiency, battery awareness, and temperature awareness are expressed as statistical queries. Evaluation of these metrics is performed by verifying the corresponding queries using UPPAAL-SMC and analyzing the statistical information provided by the tool. We demonstrate the applicability of our framework via a case study of five classical RT-DVS algorithms.

  15. rt, Arvo. Fratres / Rainer Wagner

    Index Scriptorium Estoniae

    Wagner, Rainer

    1995-01-01

    Uuest heliplaadist "Pärt, Arvo. Fratres, Cantus (in Memory of Benjamin Britten), summa, Festina Lente; Peter Manning, France Springuel, Mireille Gleizes, Huub Righarts, I Fiamminghi, Rudolf Werthen" (AD: 1994) Telarc/in-akustik CD 80 387 (WD: 79'00")

  16. rt, Arvo: "Litany" / Barry Witherden

    Index Scriptorium Estoniae

    Witherden, Barry

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: "Litany". Litany. Psalom. Trisagion. The Hilliard Ensemble, Tallinn Chamber Orchestra, Estonian Philharmonic Chamber Orchestra, Estonian Philharmonic Chamber Choir, Tõnu Kaljuste. Orchestre de chambre de Lituanie, Saulius Sondeckis". ECM New Series ECM 1592, distribution Polygram 449 810-2 (CD:158F)

  17. Forført af hjernen?

    DEFF Research Database (Denmark)

    Lieberoth, Andreas

    2013-01-01

    Blandingen af offentlig interesse, gode mediehistorier og smarte sælgere har ført til sejlivede neuromyter, der ikke bare distraherer almindelige mennesker, men også fører til udbredte misforståelser blandt professionelle som lærere og plejepersonale. I bedste fald leder neuromyter til spild af t...

  18. rt, Arvo: "Litany" / Patric Wiklacz

    Index Scriptorium Estoniae

    Wiklacz, Patric

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: "Litany". Litany. Psalom. Trisagion. The Hilliard Ensemble, Orchestre de chambre de Tallinn, Choeur de chambre Philharmonique d'Estonie, Tõnu Kaljuste. Orchestre de chambre de Lituanie, Saulius Sondeckis. ECM New Series ECM 1592, distribution Polygram 449 810-2 (CD:158F)

  19. Tipos de Tiempo en el periodo de Semana Santa Vallisoletana.

    OpenAIRE

    Miranda Martín, Javier

    2017-01-01

    El propósito del proyecto es el análisis y la caracterización de ciertos tipos de tiempo a partir de los datos observados de la Base de Datos Climatológica del Observatorio de Valladolid. Los datos analizados corresponden a los ocho días de Semana Santa de un periodo de 37 años que comprenden entre los años 1981 y 2017. Grado en Geografía y Ordenación del Territorio

  20. Description of execution time dynamics for a set of concurrent real-time tasks

    Directory of Open Access Journals (Sweden)

    Pedro Guevara López

    2011-01-01

    Full Text Available Un Sistema en Tiempo Real (STR implantado en una computadora digital, interactúa con el mundo físico a través del acondicionamiento de variables (sensores, actuadores convertidores Analógico/Digital A/D y Digital/ Analógico D/A y procesa sus peticiones mediante tareas en tiempo real (Ji: i¿Z+. Cada Ji está formada por un conjunto de instancias {ji,k: i, k¿Z+, i es el índice de la tarea, k es el índice de la instancia} con al menos tres restricciones temporales: tiempo de arribo, tiempo de ejecución y plazo (Li,k, Ci,k, Di,k. En este sentido, es importante proponer un modelo para reconstruir el comportamiento de los tiempos de ejecución Ci,k. El modelo propuesto es un ARMA con un estimador de parámetros basado en la variable instrumental. Los tiempos de ejecución fueron medidos experimentalmente en QNX Neutrino 6.5 utilizando un procesador Intel Core i7 de 2.66 GHz. Se presentan los antecedentes teóricos del modelado de tareas en tiempo real, las mediciones de tiempo de ejecución, el modelo de tiempos de ejecución, el estimador de parámetros con variable instrumental, la experimentación y los resultados.

  1. Tiempo y relaciones sostenibles en el espacio urbano

    Directory of Open Access Journals (Sweden)

    Carlos Silva

    2011-01-01

    Full Text Available En el texto que sigue, hacemos un recorrido por la noción de sostenibilidad y de relaciones urbanas sostenibles, resaltando el nexo entre las fuentes consultadas y un acontecimiento específico: cruzar la calle en puntos gestionados por semáforos. Además, presentamos una visión diferente de temporalidad en el marco de las mencionadas relaciones. Así, introducimos la noción de tiempo vertical oponiéndola, sin pretender sustituir, a visiones más tradicionales que ubicamos dentro de lo que llamamos tiempo horizontal. Finalmente, ejemplificamos nuestros argumentos con unas notas etnográficas extraídas de nuestro diario de campo cuya forma tiene como fondo la descripción densa (Geertz, 2003, sin llegar a ser tan exhaustiva como lo fue la producción geertziana. Para ello asumimos como sustento teórico algunos de los principios de la Teoría del Actor-Red (Latour, 2005, 2002, 2001. Concluimos que la sostenibilidad relacional urbana es una noción compleja, cuya comprensión requiere tomar en cuenta agentes humanos y no humanos, es decir, relaciones intersubjetivas y, también, interobjetivas (Latour, 2005.

  2. UNA POLÍTICA ALIMENTARIA PARA TIEMPOS DE CRISIS

    Directory of Open Access Journals (Sweden)

    Gustavo Gordillo

    2012-01-01

    Full Text Available Este artículo revisa el concepto de seguridad alimentaria. A partir de éste sugiere que es necesario considerar tanto la producción como el acceso a los alimentos como parte de una misma estrategia. Esto requiere implicar y al mismo tiempo fortalecer las capacidades nacionales, regionales y de las comunidades locales, prio-rizar el potencial de las comunidades, los agricultores y los ciudadanos de construir y apropiarse de las políticas alimentarias y de manera señalada la promoción a redes locales y regionales de productores de alimentos y consumidores. Argumenta que el propósito de entrecruzar en vez de confrontar el discurso de la seguridad alimen-taria y de la soberanía es una de las vías para avanzar en la discusión. Asimismo, argumenta que el significado de una política alimentaria en tiempos de crisis parte de la necesidad de enfrentar la desarticulación productiva y la desintegración social prevalecientes en el medio rural con una estrategia de reconstrucción institucional basada en la autonomía de los habitantes rurales y en una dinámica de intervencio-nes estatales a partir de una elaboración institucional inteligente capaz de aprender y adaptarse a las situaciones heterogéneas y cambiantes en el ámbito rural.

  3. Tiempo escolar y subjetividad: significaciones sobre la práctica docente en escuelas de tiempo completo

    OpenAIRE

    Pérez Ruiz, Abel; Ferrer Meza, Rosalba; García Díaz, Enrique

    2015-01-01

    El presente artículo aborda la forma en que docentes de educación básica, adscritos a escuelas de tiempo completo, interpretan y le dan sentido a su actividad profesional a partir de la articulación entre las condiciones institucionales del centro escolar, particularmente en relación con la organización de la jornada, y la práctica pedagógica ejercida cotidianamente. A partir de un estudio de caso en dos escuelas ubicadas en la zona oriente del Distrito Federal, se desprenden singulares aprec...

  4. The SPoRT concept of bracing for idiopathic scoliosis.

    Science.gov (United States)

    Zaina, Fabio; Fusco, Claudia; Atanasio, Salvatore; Negrini, Stefano

    2011-01-01

    The SPoRT (acronym: Symmetrical, Patient-oriented, Rigid, Three-dimensional, active) concept of bracing is a new way to build braces based on our 20 years of experience and the biomechanical principles of scoliosis correction, inclusive of the Sibilla and Sforzesco braces. The concept always requires a custom brace, which is made according to the patient's individual requirements. New technologies such as CAD-CAM can be applied, and often for better results, without the customary use of prebuilt forms whose measurements are stored in databases. Once the initial draft brace is completed, a final test must be made on the patient to modify and adapt it, depending on his or her real interaction between the body and the brace. The results that are today available on the SPoRT concept relate to the Sforzesco brace and are necessarily short-term, because the first treated patients are now reaching the fourth-year follow-up examination and haven't yet completed their treatments. On the basis of the initial evaluations, we can state that the Sforzesco brace is more effective than the Lyon brace after 6 months of treatment and that the Sforzesco brace is equally effective as the Risser Plast brace.

  5. [Reseña: La temporalidad estremecida] Araújo, A. (2013. Todos los tiempos, el tiempo. Montevideo: Psicolibros

    Directory of Open Access Journals (Sweden)

    Ana Luisa Hounie

    2014-05-01

    Full Text Available Corrientes muy diversas del pensamiento que procuran dar luz al problema de la percepción humana de la experiencia del mundo (desde Wilfrid Sellars (1962 a Edgar Morin (2001 -por situar dos filósofos que se encuentran en el origen de concepciones epistemológicas bien distintas- coinciden en un punto: de lo que se trata es de entender de qué forma las cosas, en el sentido más amplio posible, se componen juntas. El texto de Ana María Araújo fortifica esta idea doblemente, pues esta composición resulta precisamente el fundamento epistémico que le da lugar y al mismo tiempo el principio que sostiene el riguroso método que lo hace posible. En otras palabras, desde el comienzo hasta el final, la autora produce una respuesta en acto a la pregunta por el tiempo que guía su inquietud investigativa.

  6. Los diferentes conceptos de tiempo en el aula. Del soliloquio al diálogo: el espacio

    Directory of Open Access Journals (Sweden)

    Leonor Sáez Méndez

    2012-12-01

    Full Text Available Se trata, apartir de las variables cognitivas descubrir, indirectamente, la función imprescincible que tienen las variables afectivas en la enseñanza de las lenguas extranjeras. La transmisión y orientación para la incorporación de una segunda lengua exige al mediador distinguir diferentes conceptos filosóficos de tiempo y espacio. A partir de los 70 las necesidades lingüísticas en la transmisión de las segundas lenguas (vivas se han tintado de kantianismo. Junto a la pragmática y a los principios de interculturalidad se nos presenta la necesidad de trabajar conceptos como percepción, disposición, motivación, intuición, disposición, empatía y miedos. Factores complejos, que influyen en el proceso de incorporación de un segundo idioma, cabe preguntarse, si ellos son solo temporales. El aprendizaje real, el autónomo, requiere de la correlación de un acompañamiento que ayude a economizar recursos y a facilitar el entusiasmo de ampliar nuestras identidades en las lenguas que incorporamos. Sobre estos aspectos encontramos en el periodo crítico y, especialmente, en el post-crítico kantiano, umbrales empíricos que facilitan nuestra reflexión y orientan en la elección de ejercicios prácticos. En la exposición se propone: 1. Reflexionar sobre las diferentes concepciones del tiempo (como sentido interno, tiempo cognitivo seguidas en la didáctica de la enseñanza de idiomas extranjeros. 2. Trabajar la cuestión de si es posible restringirnos metodológicamente al tiempo y desestimar el espacio, o por el contrario, es el espacio el que determina al tiempo en la incorporación de una lengua como lugar de encuentro.

  7. Modelo de render en tiempo real aplicado al diseño arquitectónico

    OpenAIRE

    Benito Martín, Daniel

    2010-01-01

    El diseño en tres dimensiones (3D) asistido por ordenador es un campo de la informática muy amplio, presente ahora más que nunca en nuestra vida cotidiana. Los arquitectos tienen que depender de la imaginación de los clientes para visualizar cualquier propuesta arquitectónica que diseñan y que plasman en los planos, dando por hecho que los clientes están familiarizados con símbolos arquitectónicos, y que tienen la formación y la experiencia, necesarios para poder visualizar imágenes tridimens...

  8. Protocolos para redes inalámbricas de tiempo real: simulaciones y ensayos experimentales

    OpenAIRE

    Alimenti, Omar; Friedrich, Guillermo Rodolfo; Reggiani, Guillermo; Cayssials, Ricardo; Galasso, Christian L.; Gomez de Marco, Damián; Maidana, Federico; Tonietti, Santiago

    2012-01-01

    En el estudio de distintas propuestas tendientes a mejorar los protocolos de redes de datos, la simulación es una técnica muy valiosa para la evaluación del desempeño. El simulador Network Simulator ns-2 [1] es uno de los referentes utilizados en los trabajos de investigación en el campo de las redes de datos. Por otra parte, para la implementación práctica de los mecanismos desarrollados, se requiere de hardware específico para tal fin. La idea básica consiste en que, en función de las...

  9. Escenario para una Corte real: Madrid en tiempos de Enrique IV

    Directory of Open Access Journals (Sweden)

    María del Pilar RÁBADE OBRADÓ

    2009-05-01

    Full Text Available Este trabajo pretende estudiar la itinerancia cortesana durante el reinado de Enrique IV de Castilla (1454-1474, en relación con el caso concreto de Madrid. El estudio se va a realizar a través del análisis de la crónica del reinado redactada por Diego Enríquez del Castillo. Durante el reinado de Enrique IV, Madrid fue la ciudad que se convirtió con más frecuencia en residencia de la Corte. Lo fue porque Madrid contaba con alicientes como su estratégica ubicación geográfica, su potente alcázar y la proximidad con el cazadero de El Pardo. Madrid albergó a la Corte en momentos de calma y sosiego y en otros convulsos y difíciles. Además, Madrid fue testigo de acontecimientos muy destacados de la vida del rey: el nacimiento de su hija Juana, e incluso su muerte.Ce travail essaie d'étudier l'itinérance de la cour pendant le règne d'Henri IV de Castille (1454-1474, en relation avec le cas concret de Madrid. L'étude partira de l'analyse de la chronique du règne rédigée par Diego Enríquez del Castillo. Sous Henri IV, Madrid a été la ville qui s'est le plus fréquemment convertie en résidence de la cour. En effet, Madrid disposait des attraits suivants : sa situation géographique stratégique, son puissant alcazar et la proximité du manoir de chasse d’El Pardo. Madrid a hébergé la cour dans des moments de calme comme dans des périodes agitées. De plus, Madrid a été témoin d'événements importants de la vie du roi : la naissance de sa fille Juana, et même sa mort.

  10. El tiempo y el mito: los argonautas en Liubliana

    Directory of Open Access Journals (Sweden)

    Ana María Sánchez Tarrío

    2012-12-01

    Full Text Available Nuestro estudio se centrará en el tiempo de los mitos de fundación, observando el papel de la tradición clásica en la invención de un imaginario nacional esloveno (Jasón fundador de Ljubljana y comparándolo con apropiaciones semejantes en la construcción identitaria de la Península Ibérica (Ulises fundador de Lisboa. Procuraremos iluminar la especificidad eslovena de la transmisión textual de esta tradición y analizar la singularidad de la intervención de los sucesivos agentes: humanistas, ilustrados, románticos..., a la luz de sus homólogos ibéricos.

  11. LA SAETA DEL TIEMPO: UNA LECTURA A GERALD WHITROW

    Directory of Open Access Journals (Sweden)

    M. BUTLER

    2011-12-01

    Full Text Available En la vida cotidiana, el mundo muestra una marcada diferencia entre el pasado y el futuro, pero —con una pequeña excepción— las leyes de la física son simétricas en el tiempo. Gerald Whitrow fue uno de los primeros en darse cuenta que la resolución de esta paradoja está de acuerdo con la cosmología y las condiciones iniciales en el nacimiento del universo. Pero esta simple conclusión oculta algunas profundas sutilezas que toman un nuevo giro con la aparición de la cosmología cuántica y la hipótesis del universo inflacionario. La cuestión aún no ha sido resuelta por completo, y sigue siendo uno de los grandes

  12. Tiempo y capital financiero en El Capital de Marx

    Directory of Open Access Journals (Sweden)

    Boris Salazar

    2018-06-01

    Full Text Available Este artículo sugiere que la metamorfosis de las deudas en derivados y títulos financieros, y de estos en deudas, genera redes de activos y obligaciones, que inducen la emergencia de distintos tiempos del capital, articulados en un sistema complejo, cuya dinámica hace posible sincronizarlos en forma de crisis de carácter global. La crisis se trata como un cambio de estado en un sistema complejo, precipitada por la conectividad generada por el apalancamiento creciente. Es un desarrollo de las teorías de la crisis y de la socialización de la deuda planteadas por Marx en El Capital.

  13. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    Science.gov (United States)

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  14. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  15. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  16. El tiempo y los tiempos en la obra de Santa Teresa de Jesús: un acercamiento narratológico

    Directory of Open Access Journals (Sweden)

    Tomaž Šmid

    2012-12-01

    Full Text Available Aunque el estilo de los textos teresianos está marcado por el tono de la conversación oral esto no excluye su preocupación por la forma. El lenguaje se orienta en la narración hacia procesos que tienen su fundamento en la temporalidad. El tiempo se convierte así en una de las dimensiones fundamentales de cualquier narración. En el artículo nos interesa el tiempo en su doble dimensión: como componente de la historia y su manifestación al nivel del discurso. Analizamos primero lo que atañe al acto de narrar la historia en la obra de Santa Teresa (si en su mayoría es ulterior, anterior, simultáneo o intercalado y después las relaciones y las discordancias que se producen en su obra entre el tiempo del relato y el tiempo de la historia, utilizando para ello tres parámetros: el orden, la duración y la frecuencia (Genette, 1972. Contrastando el tiempo de la historia y el tiempo del discurso en la obra de Santa Teresa constatamos la agilidad de su estilo literario y su capacidad para organizar una sintaxis narrativa.

  17. Desafío del tiempo, memoria y esperanza

    Directory of Open Access Journals (Sweden)

    Fredy Parra C

    2007-01-01

    Full Text Available El artículo reflexiona sobre diversas dimensiones y tensiones de la temporalidad: Se muestra que el tiempo de la vida humana es, a la vez, duración, proyección y destinación, y se profundiza en los momentos de la línea proyectiva propia del acontecer, a saber, pasado-presente-futuro. A seguir se define la historicidad como aquella experiencia fundamental por la que el hombre, sujeto libre, se encuentra entre un pasado ya dado y un futuro porvenir-por crear, y se indagan sus tensiones. Por el hecho de ser como es, el hombre tiene que esperar y ve su existencia como un proyecto inconcluso, abierto a la novedad. La existencia humana vive rodeada de la posibilidad, no solo de la presencia. Por lo mismo, el artículo esboza una crítica a las filosofías del progreso que, al no superar una ontología del presente, pierden su fuerza innovadora y dañan sus vínculos con el pasado y el futuro. Se trata de rescatar el pasado sin renunciar al futuro. Solo la razón anamnética, la memoria, puede salvar del olvido del pasado. Finalmente, se plantea que la fe judeocristiana valora todos los tiempos porque precisamente cree y espera en Dios Creador y Consumador, Dios de vivos y muertos, en una palabra, Señor de la historia y de todos los tiemposThis article reflects upon the diverse dimensions and tensions of temporality: the time of human life is shown to be, at the same time, duration, projection and destination, and deepens in the moments of the projective line proper to events-that is, past-present-future. Then historicity is defined as that fundamental experience through which the human person, as a free subject, is found between a given past and a future yet to be created. The tensions involved are examined. Just by being as one is, the human person has to wait, and sees his or her existence as an inconclusive project, open to novelty. Human existence lives surrounded by possibility, and not only presence. For this reason, the article seeks to

  18. Conceptos y fundamentos para una crítica del ‘tiempo vulgar’ en Heidegger

    Directory of Open Access Journals (Sweden)

    Martin Simesen de Bielke

    2016-12-01

    Full Text Available Una crítica del concepto vulgar de tiempo busca explicitar los caracteres básicos de dicho concepto y fundamentalmente las aporías en el planteo. En relación a lo primero, en este artículo se pone énfasis en el carácter “originario” del concepto vulgar, es decir, su conexión con el “tiempo del mundo” y en el nexo de fundamentación que conecta ambos – tiempo vulgar y tiempo del mundo – con la temporalidad originaria del Dasein. En relación a lo segundo (las aporías, el artículo cuestiona los límites de una atribución del concepto vulgar de tiempo a Aristóteles; se discute asimismo la homologación de espacio y tiempo, por un lado, y la relación entre tiempo y presencia por otro, dos presupuestos de la representación tradicional (física y filosófica del tiempo como medida/parámetro de los cambios en general.

  19. Prospective comparison of the detection rates of human enterovirus and parechovirus RT-qPCR and viral culture in different pediatric specimens

    NARCIS (Netherlands)

    de Crom, S C M; Obihara, C C; de Moor, R A; Veldkamp, E J M; van Furth, A M; Rossen, J W A

    2013-01-01

    BACKGROUND: Reverse-transcriptase quantitative real-time polymerase chain reaction (RT-qPCR) has become the gold standard for the diagnosis of human enterovirus (EV) and parechovirus (HPeV) infections. The detection rate of RT-qPCR in different pediatric body specimens has not been compared

  20. Selection of reference genes for RT-qPCR analysis in the monarch butterfly, Danaus plexippus (L.), a migrating bio-indicator

    Science.gov (United States)

    Quantitative real-time PCR (qRT-PCR) is a reliable and reproducible technique for measuring and evaluating changes in gene expression. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. In this study, expres...

  1. La prueba de McTaggart de la irrealidad del tiempo

    Directory of Open Access Journals (Sweden)

    Eduardo Shore

    2010-10-01

    Full Text Available McTaggart se apoya en el hecho de que no percibimos el tiempo en si mismo, un tiempo vacio de sucesos:  lo que en verdad percibimos es el transcurrir de los acontecimientos, tanto de los extemos como los de nuestro propio estado intemo en la conciencia. Todo el desarrollo de McTaggart y tambien su originalidad, consiste en el desentraiiamiento del mecanismo por el cual aprehendemos el caracter temporal del acaecer, a traves del cual tenemos la ilusión de que percibimos el tiempo. De ese analisis se desprende su tesis: La manera de captar lo temporal es contradictoria en si misma, par lo que, si el significante es contradictorio, lo significado, en este caso el tiempo, es nada: el nihil privativum kantiano" Pregunto: no tendra razón McTaggart, en cuyo caso podria decirse que los sucesos "son" el tiempo?

  2. Hard Real-Time Networking on Firewire

    NARCIS (Netherlands)

    Zhang, Yuchen; Orlic, Bojan; Visser, Peter; Broenink, Jan

    2005-01-01

    This paper investigates the possibility of using standard, low-cost, widely used FireWire as a new generation fieldbus medium for real-time distributed control applications. A real-time software subsys- tem, RT-FireWire was designed that can, in combination with Linux-based real-time operating

  3. Tiempo e imagen en Gaston Bachelard y Herni Bergson

    Directory of Open Access Journals (Sweden)

    Juan de Dios Martínez Lozornio

    2016-01-01

    Full Text Available Este artículo busca un acercamiento a la cuestión del tiempo de la creación. Las reflexiones estéticas de Gastón Bachelard ponen énfasis en dicho aspecto, sin embargo, hace referencia constantemente –en contraposición– a la duración de Henri Bergson, desarrollando así una dialéctica intuicional en la que la duración se enfrenta al instante. El lugar en el que se da esta lucha de intuiciones es la imagen, pues en ésta se manifiesta la temporalidad esencial de la creación artística según Bachelard. This article seeks an approach to the question of the time of creation. The aesthetic reflections of Gaston Bachelard put emphasis on this aspect, however, constant reference –as opposed– to the duration of Henri Bergson, thus developing an intuitional dialectic in which the duration is faced to the instant. The place where takes place this struggle of intuitions is the image, because there, following Bachelard, the essential temporality of the artistic creation manifests itself.

  4. LA POLÍTICA SOCIAL EN TIEMPOS DE AJUSTE

    Directory of Open Access Journals (Sweden)

    Leonardo Garnier Rímolo

    2011-09-01

    Full Text Available La política social está nuevamente de moda. Hace unos años, eran la estabilización y el ajuste los temas que dominaban la literatura, los debates y hasta las conversaciones de los economistas. Hoy, es cada vez más frecuente la referencia a la pobreza, el costo social del ajuste, el rostro humano de la política económica, el gasto social, la salud, la educación, en fin, todos aquellos temas relativos a la calidad de vida y el desarrollo humano. A diferencia del pasado, sin embargo, este redescubrimiento de los objetivos sociales del desarrollo no olvida, sino que parte precisamente del reconocimiento de las limitaciones materiales y financieras que enfrentan las sociedades menos desarrolladas. La discusión actual busca redefinir el sentido de la política social en los tiempos del ajuste o, si se quiere, redefinir los procesos de ajuste a la luz de su verdadero objetivo: el desarrollo social.

  5. Power lies in interdisciplinary cooperation / Kärt Summatavet ; interv. Kärt Blumberg

    Index Scriptorium Estoniae

    Summatavet, Kärt, 1963-

    2008-01-01

    Ehtekunstnik Kärt Summatavet oma uudsest meetodist ehete valmistamisel - paberil oleva kujutise ülekandmisest arvuti abil metallile, mille ta töötas väljas oma doktoritöö raames Soomes Helsingi Kunsti- ja Disainiülikoolis ning mis pälvis Soulis toimunud ülemaailmsel naisleiutajate konkursil hõbemedali

  6. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  7. Tiempo y narración en La Regenta de Clarín

    Directory of Open Access Journals (Sweden)

    Vladimir Karanović

    2012-12-01

    Full Text Available Nuestro trabajo se ocupa del concepto pluridimensional del tiempo en La Regenta de Leopoldo Alas «Clarín». El tiempo es una de las categorías principales de la experiencia humana y un componente básico del texto narrativo: se ordena cronológicamente en la historia y se materializa discursivamente. Se puede afirmar que se trata de una categoría que, hasta un cierto grado, pertenece a la dimensión espacial más que a la temporal. Por este motivo, el tiempo y la narración en la novela se pueden marcar como pseudo-temporales. El concepto del tiempo en esta novela clariniana se puede percibir de dos modos principales: el tiempo lingüístico, narrativo, y el tiempo figurado, vinculado a la imagen temporal suscitada por el texto narrativo (tiempo narrado y tiempo narrante o tiempo de la historia y tiempo del discurso. El tiempo narrativo del texto recurre con preferencia a tres métodos: retrospección, anticipación e inversión. En nuestro artículo se estudian también los aspectos sintácticos de la categoría del tiempo: sucesión, orden y duración. En la novela clariniana se distinguen dos partes, de similar extensión, que coinciden con los dos volúmenes publicados (1884-85. Una parte estática y expositiva que se desarrolla durante tres días (I-XV; y otra parte activa durante unos tres años (XVI-XXX. Los rasgos estructurales y temporales de la narración nos permiten hacer hincapié en la estructura circular de la novela: todo ha pasado y nada ha cambiado. Vetusta, la estática localidad, ha dejado que se consumase en su interior la tragedia humana. De este modo, Clarín juega estratégicamente con el concepto de tiempo con la intención de trasformar a los personajes en piezas que, tras tanta lucha espiritual, han quedado inertes y petrificadas.

  8. Applications of NASA and NOAA Satellite Observations by NASA's Short-term Prediction Research and Transition (SPoRT) Center in Response to Natural Disasters

    Science.gov (United States)

    Molthan, Andrew L.; Burks, Jason E.; McGrath, Kevin M.; Jedlovec, Gary J.

    2012-01-01

    NASA s Short-term Prediction Research and Transition (SPoRT) Center supports the transition of unique NASA and NOAA research activities to the operational weather forecasting community. SPoRT emphasizes real-time analysis and prediction out to 48 hours. SPoRT partners with NOAA s National Weather Service (NWS) Weather Forecast Offices (WFOs) and National Centers to improve current products, demonstrate future satellite capabilities and explore new data assimilation techniques. Recently, the SPoRT Center has been involved in several activities related to disaster response, in collaboration with NOAA s National Weather Service, NASA s Applied Sciences Disasters Program, and other partners.

  9. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  10. Recent Upgrades to NASA SPoRT Initialization Datasets for the Environmental Modeling System

    Science.gov (United States)

    Case, Jonathan L.; Lafontaine, Frank J.; Molthan, Andrew L.; Zavodsky, Bradley T.; Rozumalski, Robert A.

    2012-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed several products for its NOAA/National Weather Service (NWS) partners that can initialize specific fields for local model runs within the NOAA/NWS Science and Training Resource Center Environmental Modeling System (EMS). The suite of SPoRT products for use in the EMS consists of a Sea Surface Temperature (SST) composite that includes a Lake Surface Temperature (LST) analysis over the Great Lakes, a Great Lakes sea-ice extent within the SST composite, a real-time Green Vegetation Fraction (GVF) composite, and NASA Land Information System (LIS) gridded output. This paper and companion poster describe each dataset and provide recent upgrades made to the SST, Great Lakes LST, GVF composites, and the real-time LIS runs.

  11. Ritual, tiempo y espacio sagrado en el budismo zen argentino

    Directory of Open Access Journals (Sweden)

    Catón Eduardo Carini

    2010-07-01

    Full Text Available El budismo zen es una religión oriental que desde hace varias décadas se ha esparcido en numerosos países occidentales, incluido la Argentina. Una característica notable de su vida comunitaria es la compleja ritualización de sus prácticas cotidianas. En nuestra aproximación a la dimensión ritual del zen indagaremos la forma en que ésta contribuye a crear un tiempo y un espacio sagrado y observaremos cómo estas prácticas son consideradas por los propios miembros del grupo como un recurso pedagógico que posibilita entrenarse en una diferente manera de estar en el mundo, de vivirse y percibirse tanto a ellos mismos como a los demás. De modo que algunos elementos del complejo ritual zen juegan un rol de primera importancia como una tecnología del ser.Zen Buddhism is an oriental religion that since several decades has expanded in various western countries, Argentina being one of them. The complex ritualization of its everyday practices is a considerable characteristic of Zen Buddhist community life. In our exploration of the ritual dimension of Zen, first we will investigate how this contributes to the creation of a sacred time and place. After this, we will show how ritual practices are considered a pedagogic recourse by group members; a means to make possible their training of a different way of being in the world, of experimenting, living and perceiving both themselves and others in a different way. Some elements of the often complex Zen ritual play a highly important part as technologies of the self.

  12. The Effect of Mutation on Explorative & Exploitative Behaviours with rt-NEAT

    OpenAIRE

    Pham, Khoa Dang Phu

    2017-01-01

    This thesis aims to explore how different factors can affect the search performance of evolutionary algorithms. Additionally how applying different mutation techniques changes the overall search performance of rtNEAT. This thesis demonstrates how mutation affects exploration and exploitation when optimizing for a 3-input XOR gate as well as optimizing agent movements in a real time environment. This thesis is also provided as a guideline in the development of an evolutionary algorithm, partic...

  13. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    OpenAIRE

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain sampl...

  14. El tiempo en Cien años de soledad

    OpenAIRE

    Valesini, María Silvina; Cortés, Karina Alejandra

    2005-01-01

    En este trabajo vamos a abordar el tema del tiempo en la obra de Gabriel García Márquez Cien años de soledad. Consideramos que, dentro de las múltiples miradas que la obra posibilita, la del tiempo es una de las más pregnantes. La referencia al tiempo es recurrente, derivándose a conceptos relacionados tales como la memoria, el olvido, la muerte. Facultad de Periodismo y Comunicación Social

  15. Modified Polyadenylation-Based RT-qPCR Increases Selectivity of Amplification of 3′-MicroRNA Isoforms

    Directory of Open Access Journals (Sweden)

    Charlotte Nejad

    2018-01-01

    Full Text Available MicroRNA (miRNA detection by reverse transcription (RT quantitative real-time PCR (RT-qPCR is the most popular method currently used to measure miRNA expression. Although the majority of miRNA families are constituted of several 3′-end length variants (“isomiRs”, little attention has been paid to their differential detection by RT-qPCR. However, recent evidence indicates that 3′-end miRNA isoforms can exhibit 3′-length specific regulatory functions, underlining the need to develop strategies to differentiate 3′-isomiRs by RT-qPCR approaches. We demonstrate here that polyadenylation-based RT-qPCR strategies targeted to 20–21 nt isoforms amplify entire miRNA families, but that primers targeted to >22 nt isoforms were specific to >21 nt isoforms. Based on this observation, we developed a simple method to increase selectivity of polyadenylation-based RT-qPCR assays toward shorter isoforms, and demonstrate its capacity to help distinguish short RNAs from longer ones, using synthetic RNAs and biological samples with altered isomiR stoichiometry. Our approach can be adapted to many polyadenylation-based RT-qPCR technologies already exiting, providing a convenient way to distinguish long and short 3′-isomiRs.

  16. SPoRT - An End-to-End R2O Activity

    Science.gov (United States)

    Jedlovec, Gary J.

    2009-01-01

    Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the Short-term Prediction Research and Transition (SPoRT) program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral observational data applications from EOS satellites to improve short-term weather forecasts on a regional and local scale. SPoRT currently partners with several universities and other government agencies for access to real-time data and products, and works collaboratively with them and operational end users at 13 WFOs to develop and test the new products and capabilities in a "test-bed" mode. The test-bed simulates key aspects of the operational environment without putting constraints on the forecaster workload. Products and capabilities which show utility in the test-bed environment are then transitioned experimentally into the operational environment for further evaluation and assessment. SPoRT focuses on a suite of data and products from MODIS, AMSR-E, and AIRS on the NASA Terra and Aqua satellites, and total lightning measurements from ground-based networks. Some of the observations are assimilated into or used with various versions of the WRF model to provide supplemental forecast guidance to operational end users. SPoRT is enhancing partnerships with NOAA / NESDIS for new product development and data access to exploit the remote sensing capabilities of instruments on the NPOESS satellites to address short term weather forecasting problems. The VIIRS and CrIS instruments on the NPP and follow-on NPOESS satellites provide similar observing capabilities to the MODIS and AIRS instruments on Terra and Aqua. SPoRT will be transitioning existing and new capabilities into the AWIIPS II environment to continue the continuity of its activities.

  17. LabVIEW Real-Time

    CERN Multimedia

    CERN. Geneva; Flockhart, Ronald Bruce; Seppey, P

    2003-01-01

    With LabVIEW Real-Time, you can choose from a variety of RT Series hardware. Add a real-time data acquisition component into a larger measurement and automation system or create a single stand-alone real-time solution with data acquisition, signal conditioning, motion control, RS-232, GPIB instrumentation, and Ethernet connectivity. With the various hardware options, you can create a system to meet your precise needs today, while the modularity of the system means you can add to the solution as your system requirements grow. If you are interested in Reliable and Deterministic systems for Measurement and Automation, you will profit from this seminar. Agenda: Real-Time Overview LabVIEW RT Hardware Platforms - Linux on PXI Programming with LabVIEW RT Real-Time Operating Systems concepts Timing Applications Data Transfer

  18. Las multitudes y las revoluciones de nuestro tiempo

    Directory of Open Access Journals (Sweden)

    John Harold Biervliet

    2015-08-01

    Full Text Available Este artículo examina el motivo de las multitudes y las revoluciones de nuestro tiempo. Primeramente, se discuten las diferencias entre los conceptos de multitud y masa. Así, podemos considerar las revoluciones como acontecimientos de cambios sociales, económicos y políticos, provenientes de las clases baja y media de la sociedad. El meollo de este artículo refiere a la dignidad humana articulada a la contracción de los Estados de bienestar. Los ciudadanos están reflejando un desencanto hacia la clase política y una frustración con respecto al empeoramiento de las condiciones económicas y sociales. Podemos observar los casos de indignados en Grecia, España y Portugal pero también en los países árabes. De esta misma manera, las revoluciones de las multitudes siguen avanzando por medio de las demostraciones públicas y protestas sobre los espacios geográficos. Finalmente, las dinámicas de cambio a través de las revoluciones árabes son una cuestión compleja debido al círculo vicioso entre la tendencia autoritaria y la islámica. This article examines the reason of multitudes and revolutions in our time. First of all, it discusses the difference between the concept of multitude and mass. Consequently, revolutions can be considered as social, economic, and political events of changes, which come from the low and middle classes of the society. This article refers to the human dignity articulated with the contraction of Welfare states. Citizens are reflecting disenchantment towards the political class and frustration regarding the deterioration of social and economic conditions. We can observe angry people in Greece, Spain, and Portugal but also in Arabian countries. In this same way, revolutions of multitudes continue by means of public demonstrations and protests on geographical spaces. Finally, the dynamics of change through Arabian Revolutions are a complex matter due to the vicious circle between the authoritarian or Islamic

  19. La noción del tiempo en la cultura maya prehispánica

    Directory of Open Access Journals (Sweden)

    Alexander Wolfgang Voss

    2015-07-01

    Full Text Available La concepción del tiempo de los mayas prehispánicos se estudia mediante el análisis epigráfico y filológico de textos jeroglíficos bajo los planteamientos teóricos de la escuela italiana de historia de las religiones. Los datos indican que el tiempo es animado y formado por unidades discretas tangibles que se representan con un calendario de 365 días. Las características de cada día son fijadas por un oráculo de suertes de 260 unidades que es proyectado sobre el tiempo. El tiempo y el oráculo son pensados como dioses que se alternan en un orden y no como una magnitud física abstracta.

  20. Experiment vs simulation RT WFNDEC 2014 benchmark: CIVA results

    International Nuclear Information System (INIS)

    Tisseur, D.; Costin, M.; Rattoni, B.; Vienne, C.; Vabre, A.; Cattiaux, G.; Sollier, T.

    2015-01-01

    The French Atomic Energy Commission and Alternative Energies (CEA) has developed for years the CIVA software dedicated to simulation of NDE techniques such as Radiographic Testing (RT). RT modelling is achieved in CIVA using combination of a determinist approach based on ray tracing for transmission beam simulation and a Monte Carlo model for the scattered beam computation. Furthermore, CIVA includes various detectors models, in particular common x-ray films and a photostimulable phosphor plates. This communication presents the results obtained with the configurations proposed in the World Federation of NDEC 2014 RT modelling benchmark with the RT models implemented in the CIVA software

  1. Experiment vs simulation RT WFNDEC 2014 benchmark: CIVA results

    Energy Technology Data Exchange (ETDEWEB)

    Tisseur, D., E-mail: david.tisseur@cea.fr; Costin, M., E-mail: david.tisseur@cea.fr; Rattoni, B., E-mail: david.tisseur@cea.fr; Vienne, C., E-mail: david.tisseur@cea.fr; Vabre, A., E-mail: david.tisseur@cea.fr; Cattiaux, G., E-mail: david.tisseur@cea.fr [CEA LIST, CEA Saclay 91191 Gif sur Yvette Cedex (France); Sollier, T. [Institut de Radioprotection et de Sûreté Nucléaire, B.P.17 92262 Fontenay-Aux-Roses (France)

    2015-03-31

    The French Atomic Energy Commission and Alternative Energies (CEA) has developed for years the CIVA software dedicated to simulation of NDE techniques such as Radiographic Testing (RT). RT modelling is achieved in CIVA using combination of a determinist approach based on ray tracing for transmission beam simulation and a Monte Carlo model for the scattered beam computation. Furthermore, CIVA includes various detectors models, in particular common x-ray films and a photostimulable phosphor plates. This communication presents the results obtained with the configurations proposed in the World Federation of NDEC 2014 RT modelling benchmark with the RT models implemented in the CIVA software.

  2. Tiempo máximo aceptable de trabajo para tareas ejecutadas con miembros superiores e inferiores

    Directory of Open Access Journals (Sweden)

    Juan C. Velásquez V.

    2015-12-01

    Full Text Available Introducción: La carga física de trabajo es uno de los principales factores de riesgo a los que se enfrentan los trabajadores. En la actualidad los métodos propuestos para evaluar la carga física dinámica contemplan el trabajo con todo el cuerpo y no discriminan por segmentos corporales. Objetivo: Determinar el tiempo máximo aceptable de trabajo cuando el trabajo se ejecuta con todo el cuerpo, con los miembros superiores o los miembros inferiores. Métodos: Se realizó medición de consumo de oxígeno mediante ergoespirometria y monitorización de la frecuencia cardiaca en 30 trabajadores expuestos a diversas cargas ejecutadas con todo el cuerpo, miembros inferiores y miembros superiores. Se determinó el umbral anaeróbico por coeficiente respiratorio, el cual sirvió de base para de determinación del tiempo máximo aceptable de trabajo. Resultados: Los tiempos máximos aceptables de trabajo fueron similares para tareas con todo el cuerpo y con miembros inferiores, pero significativamente menores para tareas realizadas con miembros superiores. Se halló un modelo de correlación exponencial negativo entre en tiempo de trabajo, el consumo de oxígeno, y la frecuencia cardiaca, R > 0,9 en todos los casos. Se plantearon 9 ecuaciones de regresión para determinar el tiempo máximo aceptable de trabajo. Conclusiones: El tiempo máximo aceptable de trabajo para miembros inferiores y para todo el cuerpo se comportan de manera similar. El tiempo máximo aceptables de trabajo con miembros superiores es significativamente inferior a los anteriores. La frecuencia cardiaca relativa parece ser el mejor indicador para medir el tiempo máximo aceptables de trabajo en campo.

  3. Mamma diagnostics for MTRA (medical-radiological personnel)/RT (radiologists); Mammadiagnostik fuer MTRA/RT

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Uwe; Baum, Friedemann

    2014-07-01

    The text book on mamma diagnostics for MTRA (medical-radiological personnel)/RT (radiologists) covers the following issues: Anatomy, development and physiology of mammary glands; tumor development an breast cancer risk; pathology, non-imaging diagnostics; mammography: physical-technical fundamentals; mammography: analogue technique; mammography: digital technique; mammography: quality assurance; mammography: legal questions and radiation protection; mammography: new developments; mammography: setting technique; mammography: use and appraisal; mamma-sonography: technique and methodology; mamma-sonography: assignment and appraisal, mamma-NMR: technique and methodology; mamma-NMR: assignment and appraisal lymph node diagnostics; mamma interventions; biopsy; mamma interventions: marking examination concepts; therapeutic concepts; hygienic concepts; communication and interaction.

  4. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  5. Les activités de gestion d’alerte épidémiologique : les transformations induites par l’utilisation d’un système de surveillance en temps réel Alert Management Activity: Cognitive and team activity modifications due to the use of an early warning system Las actividades de gestión de alerta epidemiológica : las transformaciones inducidas por la utilización de un sistema de vigilancia en tiempo real

    Directory of Open Access Journals (Sweden)

    Charlotte Gaudin

    2012-05-01

    dinámico puesto que las epidemias evolucionan y se propagan rápidamente si ninguna acción es emprendida para controlarlas. Más precisamente dos tipos de situaciones son analizadas : (1 la actividad tradicional de gestión de alerta y (2 esta misma actividad cuando es asistida por un sistema informático, en el caso el sistema ASTER (o Alerta y Supervisión en Tiempo Real. Luego, los resultados obtenidos son discutidos a nivel cognitivo y a nivel de las actividades colectivas consecutivamente a la introducción y a la utilización de un sistema técnico.

  6. MRAS speed estimator with fuzzy and PI stator resistance adaptation for sensorless induction motor drives using RT-lab

    Directory of Open Access Journals (Sweden)

    S. Mohan Krishna

    2016-09-01

    Full Text Available This paper presents a real-time simulation study of Model Reference Adaptive System based rotor speed estimator with parallel stator resistance adaptation mechanism for speed sensorless induction motor drive. Both, the traditional Proportional Integral and Fuzzy logic based control mechanisms are utilised for stator resistance adaptation, while, the rotor speed is estimated parallely by means of Proportional Integral based mechanism. The estimator's response to dynamic changes in Load perturbation and doubling of the nominal value of the actual stator resistance of the motor is observed. The superiority of the fuzzy based stator resistance adaptation in the Model Reference Adaptive System estimator is proved through results validated in real-time. The purpose of employing a fairly new real-time platform is to reduce the test and prototype time. The model is initially built using Matlab/Simulink blocksets and the results are validated in real time using RT-Lab. The RT-lab blocksets are integrated into the Simulink model and then executed in real-time using the OP-4500 target developed by Opal-RT. The real-time simulation results are observed in the workstation.

  7. Reverse transcriptase-quantitative polymerase chain reaction (RT ...

    African Journals Online (AJOL)

    The reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a highly specific polymerase chain reaction (PCR) method that allows one to detect very low transcription levels of functional gene(s) in soil. RT-qPCR helps us to know the active members of the microbial community, and their activities can be ...

  8. Modelado sólido y análisis por elementos finitos de un cilindro de motor endotérmico de 2 tiempos de altas prestaciones

    OpenAIRE

    Pérez Ferreirós, Oscar

    2005-01-01

    El proyecto pretende explicar el proceso de evolución de un cilindro monobloque de motor endotérmico, 2 tiempos de altas prestaciones. El proceso real de evolución del motor consta de los siguientes pasos: - Modelado en 3D del cilindro, de una forma sencilla para que sea fácilmente modificable (modelado con Pro-Engineer WildFire). - Hipótesis de cálculo para realizar un cálculo de esfuerzos sobre los pernos que fijan el culatín y la culata del cilindro (Se proponen 2 estudio...

  9. Tiempo y espacio en la Duat: observaciones respecto de los Libros del Más Allá del Reino Nuevo

    Directory of Open Access Journals (Sweden)

    Mariano Bonanno

    2017-12-01

    Full Text Available Se reflexiona sobre las categorías tiempo y espacio en un marco acotado: la Duat y la noche, donde Ra se sumerge a partir de las primeras horas de oscuridad y hasta los primeros signos del amanecer. El objeto de este estudio son los denominados Libros del Más Allá del Reino Nuevo (Libro del Amduat, Libro de las Puertas, Libro de las Cavernas y Libro de la Tierra, composiciones funerarias que decoran las tumbas reales del Valle de los Reyes, en Luxor, Egipto.

  10. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases

    DEFF Research Database (Denmark)

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian

    2016-01-01

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results......, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected...... by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori...

  11. NASA SPoRT Modeling and Data Assimilation Research and Transition Activities Using WRF, LIS and GSI

    Science.gov (United States)

    Case, Jonathan L.; Blankenship, Clay B.; Zavodsky, Bradley T.; Srikishen, Jayanthi; Berndt, Emily B.

    2014-01-01

    weather research and forecasting ===== The NASA Short-term Prediction Research and Transition (SPoRT) program has numerous modeling and data assimilation (DA) activities in which the WRF model is a key component. SPoRT generates realtime, research satellite products from the MODIS and VIIRS instruments, making the data available to NOAA/NWS partners running the WRF/EMS, including: (1) 2-km northwestern-hemispheric SST composite, (2) daily, MODIS green vegetation fraction (GVF) over CONUS, and (3) NASA Land Information System (LIS) runs of the Noah LSM over the southeastern CONUS. Each of these datasets have been utilized by specific SPoRT partners in local EMS model runs, with select offices evaluating the impacts using a set of automated scripts developed by SPoRT that manage data acquisition and run the NCAR Model Evaluation Tools verification package. SPoRT is engaged in DA research with the Gridpoint Statistical Interpolation (GSI) and Ensemble Kalman Filter in LIS for soil moisture DA. Ongoing DA projects using GSI include comparing the impacts of assimilating Atmospheric Infrared Sounder (AIRS) radiances versus retrieved profiles, and an analysis of extra-tropical cyclones with intense non-convective winds. As part of its Early Adopter activities for the NASA Soil Moisture Active Passive (SMAP) mission, SPoRT is conducting bias correction and soil moisture DA within LIS to improve simulations using the NASA Unified-WRF (NU-WRF) for both the European Space Agency's Soil Moisture Ocean Salinity and upcoming SMAP mission data. SPoRT has also incorporated real-time global GVF data into LIS and WRF from the VIIRS product being developed by NOAA/NESDIS. This poster will highlight the research and transition activities SPoRT conducts using WRF, NU-WRF, EMS, LIS, and GSI.

  12. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  13. Autobiografía intelectual de Manuel Martín Serrano. Los tiempos que han traído nuestro tiempo

    Directory of Open Access Journals (Sweden)

    Revista Chasqui

    2011-09-01

    Full Text Available Esta autobiografía esclarece el sentido que tiene la creación científica en la vida de Manuel MARTÍN SERRANO y al hacerlo, revela cómo estamos concernidos por la aventura del conocimiento, las gentes que ahora compartimos y antes compartieron con él, la misma época existencial. MMS sugiere que nuestro tiempo se ha conformado por el transcurso de dos épocas diferentes: En España la primera de ellas abarca la dictadura franquista y la transición democrática, que concluyó hacia 1982. Es "Del tiempo del silencio al de la esperanza" Le sigue la segunda época, en la que estamos desde entonces: "Del tiempo de la esperanza al de la humanización" Es nuestro presente y previsiblemente se prolongará durante generaciones. Dice el Autor que son dos periodos indisociables; y que sin embargo el tránsito de uno al otro ha supuesto una rotura histórica.

  14. Confiabilidad de dispositivo observable en un instante del tiempo: Aplicación a componentes de transmisión de radares

    Directory of Open Access Journals (Sweden)

    Juan Pablo Valencia Arango

    2015-08-01

    Full Text Available Determinar la confiabilidad de dispositivos es una de las principales tareas de la ingeniería. En algunas situaciones experimentales sólo es posible observar el tiempo completo de falla de una unidad. Sin embargo, para chequear si está o no trabajando basta con un punto del tiempo. Bajo algunos modelos paramétricos se pueden desarrollar análisis estadísticos de estas situaciones encontrando los estimadores de máxima verosimilitud, sus distribuciones asintóticas y los intervalos de confianza. El presente trabajo tiene como objetivo presentar una propuesta metodológica para el cálculo del intervalo de confianza de un dispositivo en presencia de doble censura. Se presenta la metodología paramétrica bajo la distribución exponencial, mostrando de manera detallada el cálculo del intervalo de confianza para el tiempo medio de falla. Posteriormente se presentan simulaciones para el cálculo del nivel real y longitud media del intervalo de confianza, se encuentra que los niveles alcanzados en el caso de doble censura son muy similares a cuando se observan los tiempos completos. Los resultados son aceptables y recomendados en situaciones en las que es costosa la observación de la muestra a lo largo del tiempo. To determine the reliability of devices is one of the main tasks of engineering. In some experimental situations it is only possible to observe the full time of a drive failure. However, to check whether or not working just one point of time. Under some parametric models can develop statistical analyzes of these situations by finding the maximum likelihood estimators, their asymptotic distributions and confidence intervals. This paper aims to present a methodology for the calculation of the confidence interval of a device in the presence of double censorship. Parametric methodology under the exponential distribution is presented, showing in detail the calculation of the confidence interval for the mean time to failure. Later

  15. MZC Gel Inhibits SHIV-RT and HSV-2 in Macaque Vaginal Mucosa and SHIV-RT in Rectal Mucosa.

    Science.gov (United States)

    Calenda, Giulia; Villegas, Guillermo; Barnable, Patrick; Litterst, Claudia; Levendosky, Keith; Gettie, Agegnehu; Cooney, Michael L; Blanchard, James; Fernández-Romero, José A; Zydowsky, Thomas M; Teleshova, Natalia

    2017-03-01

    The Population Council's microbicide gel MZC (also known as PC-1005) containing MIV-150 and zinc acetate dihydrate (ZA) in carrageenan (CG) has shown promise as a broad-spectrum microbicide against HIV, herpes simplex virus (HSV), and human papillomavirus. Previous data show antiviral activity against these viruses in cell-based assays, prevention of vaginal and rectal simian-human immunodeficiency virus reverse transcriptase (SHIV-RT) infection, and reduction of vaginal HSV shedding in rhesus macaques and also excellent antiviral activity against HSV and human papillomavirus in murine models. Recently, we demonstrated that MZC is safe and effective against SHIV-RT in macaque vaginal explants. Here we established models of ex vivo SHIV-RT/HSV-2 coinfection of vaginal mucosa and SHIV-RT infection of rectal mucosa in macaques (challenge of rectal mucosa with HSV-2 did not result in reproducible tissue infection), evaluated antiviral activity of MZC, and compared quantitative polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay readouts for monitoring SHIV-RT infection. MZC (at nontoxic dilutions) significantly inhibited SHIV-RT in vaginal and rectal mucosas and HSV-2 in vaginal mucosa when present during viral challenge. Analysis of SHIV-RT infection and MZC activity by 1-step simian immunodeficiency virus gag quantitative RT-PCR and p27 enzyme-linked immunosorbent assay demonstrated similar virus growth dynamics and MZC activity by both methods and higher sensitivity of quantitative RT-PCR. Our data provide more evidence that MZC is a promising dual compartment multipurpose prevention technology candidate.

  16. El conde de Valdeparaíso y su tiempo

    Directory of Open Access Journals (Sweden)

    Francisco Asensio Rubio

    1995-01-01

    Full Text Available La muerte en 1700 de Carlos II sin descendencia abrió para España y especialmente para el resto de Europa, una etapa de intrigas que condujo a nuestro país a una guerra civil, ya que las cortes europeas se movilizaron para situar a sus candidatos a la vacante corona española. La guerra tardó en iniciarse en suelo español pues hasta el año 1705 no se generalizó en nuestro territorio, especialmente cuando los catalanes, aragoneses y valencianos tomaron partido por el candidato austríaco, el archiduque Carlos, y el resto del país, especialmente Castilla, quedó al lado del candidato francés Felipe de Anjou, nieto de Luis XIV de Francia. En 1706 se conjuraron en Ciudad Real en favor del candidato austríaco cuatro caballeros, tres de los cuales fueron ejecutados y el otro se salvó gracias a que era caballero de hábito.

  17. The diagnostic utility of stabilized blood for detection of foot-and-mouth disease virus RNA by RT-qPCR

    DEFF Research Database (Denmark)

    S. Fontél, Kristina; Bøtner, Anette; Belsham, Graham

    In Europe, clinical signs indicative of foot-and-mouth disease (FMD), would immediately lead to collection of blood and relevant organ material for further laboratory examination for this vesicular disease virus. Today, the first line system for detection of virus in the sample material is real t...... time RT-PCR (RT-qPCR). The aim of this study was to investigate the diagnostic utility of stabilized blood for detection of FMDV RNA in this system....

  18. Projected Applications of a "Weather in a Box" Computing System at the NASA Short-Term Prediction Research and Transition (SPoRT) Center

    Science.gov (United States)

    Jedlovec, Gary J.; Molthan, Andrew; Zavodsky, Bradley T.; Case, Jonathan L.; LaFontaine, Frank J.; Srikishen, Jayanthi

    2010-01-01

    The NASA Short-term Prediction Research and Transition Center (SPoRT)'s new "Weather in a Box" resources will provide weather research and forecast modeling capabilities for real-time application. Model output will provide additional forecast guidance and research into the impacts of new NASA satellite data sets and software capabilities. By combining several research tools and satellite products, SPoRT can generate model guidance that is strongly influenced by unique NASA contributions.

  19. rt, Arvo: "Miserere", "Festina lente" / Volkmar Fischer

    Index Scriptorium Estoniae

    Fischer, Volkmar

    1991-01-01

    Uuest heliplaadist Pärt, Arvo: "Miserere", "Festina lente", "Sarah Was Ninety Years Old". The Hilliard Ensemble. Orchester der Beethovenhalle Bonn. Dirigent Dennis Russel Davies (ECM Records, distr Amigo)

  20. rt, Arvo: Seven Magnificat Antiphons / Barry Witherden

    Index Scriptorium Estoniae

    Witherden, Barry

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: Seven Magnificat Antiphons. Magnificat. Summa; Tormis, Veljo: The Curse Upon Iron. Karelian Destiny. BBC Singers, Bo Holton". Collins Classics 1472-2 (61 minutes: DDD)

  1. rt, Arvo. Litany; Psalom; Trisagion / Andreas Obst

    Index Scriptorium Estoniae

    Obst, Andreas

    1996-01-01

    rt, Arvo. Litany; Psalom; Trisagion. Hilliard Ensemble, Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra, Tõnu Kaljuste; Lithuanian Chamber Orchestra, Saulius Sondeckis. ECM 1592/449 810-2

  2. rt, Arvo: Litany. Psalom. Trisagion / Robert Cowan

    Index Scriptorium Estoniae

    Cowan, Robert

    1996-01-01

    Uuest heliplaadist "Pärt, Arvo: Litany. Psalom. Trisagion. Hilliard Ensemble, Estonian Philharmonic Chamber Choir, Tallinn Chamber Orchestra, Tõnu Kaljuste; Lithuanian Chamber Orchestra, Saulius Sondeckis" ECM New Series 449 810-4; 449 810-2 (42 minutes: DDD)

  3. rt, Arvo: "Beatus". Statuit ei Dominus / Patric Wiklacz

    Index Scriptorium Estoniae

    Wiklacz, Patric

    1997-01-01

    Uuest heliplaadist "Pärt, Arvo: "Beatus". Statuit ei Dominus. Missa syllabica. Beatus Petronius. 7 Magnificat-Antiphonen. De profundis. Memento. Cantate Domino. Solfeggio. Estonian Philharmonic Chamber Choir, T. Kaljuste". Virgin Classics 545 276-2 (CD:167F)

  4. The value of research : telling the R&T story

    Science.gov (United States)

    2009-07-01

    The Federal Highway Administration (FHWA) plays a leadership role in shaping and executing a National Research and Technology (R&T) program. The agency also acts as a convener; collaborations with State, industry, and academic partners provide the fo...

  5. Milan Kundera poeediparukaga faun / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    1996-01-01

    Arvustus: Kundera, Milan. Surematus. Tln. : Monokkel, 1995. Ilmunud ka kogumikus: Hellerma, Kärt. Kohanenud kirjandus : valik kirjanduskriitikat 1987-2006. Eesti Keele Sihtasutus : Tallinn, 2006. Lk. 176-179

  6. EL SECUESTRO DE LAS HISTORIAS INDÍGENAS: ITENERARIO Y LIMITACIONES DEL TIEMPO LINEAL EN CHILE

    OpenAIRE

    MAXIMILIANO SALINAS CAMPOS

    2015-01-01

    La historia de Chile está cruzada por el conflicto entre la cultura moderna europea y las culturas indígenas. El tiempo lineal impuesto por el Estado nacional ha dejado al descubierto su irresponsabilidad con el tiempo indígena de los Andes. Esta temporalidad expresa una profunda y sustentable «ontología arcaica». Tras el fin de la Guerra Fría, y la postdictadura de Pinochet, esta propuesta se vuelve acuciante con las demandas políticas y los desafíos epistémicos indígenas del siglo XXI. En...

  7. EL SECUESTRO DE LAS HISTORIAS INDÍGENAS: ITINERARIO Y LIMITACIONES DEL TIEMPO LINEAL EN CHILE

    OpenAIRE

    Salinas Campos, Maximiliano

    2015-01-01

    La historia de Chile está cruzada por el conflicto entre la cultura moderna europea y las culturas indígenas. El tiempo lineal impuesto por el Estado nacional ha dejado al descubierto su irresponsabilidad con el tiempo indígena de los Andes. Esta temporalidad expresa una profunda y sustentable «ontología arcaica». Tras el fin de la Guerra Fría, y la postdictadura de Pinochet, esta propuesta se vuelve acuciante con las demandas políticas y los desafíos epistémicos indígenas del siglo XXI. En e...

  8. TIEMPO RECOMENDADO PARA UNA NUEVA CONCEPCIÓN POST ABORTO ESPONTÁNEO

    OpenAIRE

    Baltra E,Estebeni; de Mayo G,Tomás; Rojas G,María de los Ángeles; Arraztoa V,José Antonio

    2008-01-01

    Antecedentes: La recomendación del clínico acerca del tiempo a esperar para una nueva concepción post aborto espontáneo correspondería a una práctica basada en la experiencia y no en la evidencia. Objetivo: Análisis crítico de la literatura científica, en relación al tiempo de espera para intentar un nuevo embarazo en pacientes con aborto espontáneo, y los resultados materno-perinatales asociados a las diferentes conductas. Búsqueda sistemática en múltiples bases de datos. Resultados: Se enco...

  9. SUBDIVISIÓN DEL TIEMPO GEOLÓGICO EN LA AMAZONÍA PERUANA

    Directory of Open Access Journals (Sweden)

    Fredy Hugo Guerra-Turín

    2011-07-01

    Full Text Available Mucho antes que el ser humano recorriera las tierras de nuestra cuenca,  sabana de la selva amazónica, existieron mares, grandes ríos, montañas y llanuras en lo que ahora es nuestro hábitat. En este breve texto se plantea un viaje por los paisajes creados que debieron existir a lo largo de los diferentes tiempos geológicos y lograr proponer la subdivisión del tiempo geológico en la Amazonía peruana, base para determinar la herencia de una gran biodiversidad; más grande en el mundo.

  10. La administración del tiempo : una prioridad en la vida

    OpenAIRE

    Pérez Ibarra, Alba de Jesús

    2016-01-01

    El presente artículo plantea una reflexión en torno al impacto del tiempo como elemento vital, ya que su uso y optimización lo convierten en nuestro aliado, a sabiendas de que este es un componente que pertenece al pasado, implica el presente y también se relaciona con lo que vendrá. Se expone el valor del tiempo como el capital que hemos de aprender a gerenciar, por ser preciado para alcanzar propósitos, no solo de carácter personal, sino además aquellos objetivos altruistas que involucran a...

  11. Una propuesta para el aprendizaje de ELE: tiempo libre e interculturalidad

    Directory of Open Access Journals (Sweden)

    Concepción Francos Maldonado

    2012-08-01

    Full Text Available En la propuesta que aquí describimos nos centramos en el tiempo de ocio comoelemento esencial de socialización y desarrollo personal, y pretendemos que elalumnado participe en las actividades de ocio de la ciudad, a través de las que, ademásde favorecer la igualdad de oportunidades, la autonomía y las potencialidadesindividuales, se aprende la lengua y se trabaja la interculturalidad conociendo formas deuso del tiempo libre en la sociedad en la que estamos, informándonos de aspectoslúdicos de diferentes culturas, y también de algunos aspectos curriculares.

  12. Soluciones analiticas AL problema de jets con velocidad de eyeccion variable EN EL tiempo.

    Science.gov (United States)

    Canto, J.; Raga, A. C.; D'Alessio, P.

    1998-11-01

    Se presenta un nuevo metodo que permite resolver de manera exacta y analitica las ecuaciones que describen un jet hipersonico con velocidad de eyeccion variable en el tiempo. El metodo se basa en consideraciones sencillas de conservacion de momento para las superficies de trabajo que se forman en el interior del jet. Como ejemplo, se presentan soluciones para jets con variacion sinusoidal en la velocidad de eyeccion, y tambien para el caso de un incremento lineal en el tiempo. Estas soluciones analiticas tienen una clara aplicacion en la interpretacion de las observaciones de jets asociados a objetos Herbig-Haro.

  13. Vectores de Killing y cantidades conservadas para espacio-tiempos cuasi-esféricos

    Directory of Open Access Journals (Sweden)

    J. Carot

    2007-01-01

    Full Text Available En este trabajo se estudian los espacio-tiempos con deformación de tipo B, con simetría axial y cuasi-esféricos. Se obtiene un elemento de linea tal que admite vectores de Killing de la familia 1 propuesta por J. Flores et. al. [1]. Se encuentran las cantidades conservadas asociadas a estos vectores de Killing y por tanto una primera integral de las ecuaciones de las geodésicas que describen una partícula libre inmersa en este tipo espacio- tiempo.

  14. Análisis de los componentes del tiempo de reacción

    OpenAIRE

    Malapeira Gas, Joan Ma. (Joan Maria), 1951-2015; Honrubia Serrano, Ma. Luisa; Viader Junyent, Manel; Cosculluela Mas, Antonio; Viadé Sanzano, Albert; Ferrer Puig, Ramon

    1995-01-01

    En el presente trabajo se hacen una serie de consideraciones sobre la utilización de la técnica de los tiempos de reacción en diferentes campos de investigación, ejemplijicándose con experimentos en el campo de la percepción auditiva, en el estudio de los anteperiodos y en el establecimiento de la relación entre diferencias individuales, inteligencia y personalidad, y tiempos de reacción. A lo largo del trabajo se realizan varios comentarios sobre la necesidad de utilizar la información compl...

  15. Kuidas sünnib pealkiri? / Pärt Lias

    Index Scriptorium Estoniae

    Lias, Pärt

    2003-01-01

    Eesti kirjanikud vastavad Pärt Liase küsimusele oma teoste pealkirjade saamisloo kohta: Doris Kareva, Ilona Laaman, Eha Lättemäe, Priidu Beier, Oskar Kruus, Jaan Kruusvall, Paul-Eerik Rummo ja Andres Vanapa (1); Triin Soomets, Priit Aimla, Aarne Puu, Einar Sander, Jüri Tuulik ja Ülo Tuulik (2); Nikolai Baturin, Leo Metsar, Toomas Vint, Leonid Stolovitš ja Pärt Lias (3)

  16. Hyperthermic Fibrinolysis with rt-PA: In Vitro Results

    International Nuclear Information System (INIS)

    Schwarzenberg, Helmut; Mueller-Huelsbeck, Stefan; Brossman, Joachim; Christian Glueer, Claus; Bruhn, Hans Dieter; Heller, Martin

    1998-01-01

    Purpose: To investigate the influence of hyperthermia up to 45 deg. C on fibrinolysis with recombinant tissue-type plasminogen activator (rt-PA). Methods: Standardized fibrin clots were incubated in a water bath for 5 hr with either rt-PA (test group) or 0.9% sodium chloride (control group) and blood plasma at temperatures of 30-45 deg. C. Concentrations of D-dimer and time to complete clot lysis were measured.Results: The activity of fibrinolysis with rt-PA rose with increasing temperature: time to lysis approximately halved from 30 deg. C to 40 deg. C and the concentration of D-dimer tripled. In the control group clot size did not change.Conclusions: Activity of rt-PA-induced fibrinolysis rises distinctly with higher temperatures. Since even healthy subjects show a physiologic decline in body temperature in the extremities, in patients with occlusive arterial disease decreased activity of fibrinolysis with rt-PA can be expected. Controlled hyperthermia may improve fibrinolysis with rt-PA and should be investigated in vivo

  17. SPoRT: Transitioning NASA and NOAA Experimental Data to the Operational Weather Community

    Science.gov (United States)

    Jedlovec, Gary J.

    2013-01-01

    Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the NASA Short-term Prediction Research and Transition (SPoRT) program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral data from EOS satellites to improve short-term weather forecasts on a regional and local scale. With the ever-broadening application of real-time high resolution satellite data from current EOS, Suomi NPP, and planned JPSS and GOES-R sensors to weather forecast problems, significant challenges arise in the acquisition, delivery, and integration of the new capabilities into the decision making process of the operational weather community. For polar orbiting sensors such as MODIS, AIRS, VIIRS, and CRiS, the use of direct broadcast ground stations is key to the real-time delivery of the data and derived products in a timely fashion. With the ABI on the geostationary GOES-R satellite, the data volumes will likely increase by a factor of 5-10 from current data streams. However, the high data volume and limited bandwidth of end user facilities presents a formidable obstacle to timely access to the data. This challenge can be addressed through the use of subsetting techniques, innovative web services, and the judicious selection of data formats. Many of these approaches have been implemented by SPoRT for the delivery of real-time products to NWS forecast offices and other weather entities. Once available in decision support systems like AWIPS II, these new data and products must be integrated into existing and new displays that allow for the integration of the data with existing operational products in these systems. SPoRT is leading the way in demonstrating this enhanced capability. This paper will highlight the ways SPoRT is overcoming many of the challenges presented by the enormous data

  18. Challenges in Transitioning Research Data to Operations: The SPoRT Paradigm

    Science.gov (United States)

    Jedloved, Gary J.; Smith, Matt; McGrath, Kevin

    2010-01-01

    Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the NASA Short-term Prediction Research and Transition (SPoRT) program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral data from EOS satellites to improve short-term weather forecasts on a regional and local scale. With the ever-broadening application of real-time high resolution satellite data from current EOS and planned NPP, JPSS, and GOES-R sensors to weather forecast problems, significant challenges arise in the acquisition, delivery, and integration of the new capabilities into the decision making process of the operational weather community. For polar orbiting sensors such as MODIS, AIRS, VIIRS, and CRiS, the use of direct broadcast ground stations is key to the real-time delivery of the data and derived products in a timely fashion. With the ABI on the geostationary GOES-R satellite, the data volume will likely increase by a factor of 5- 10 from current data streams. However, the high data volume and limited bandwidth of end user facilities presents a formidable obstacle to timely access to the data. This challenge can be addressed through the use of subsetting techniques, innovative web services, and the judicious selection of data formats. Many of these approaches have been implemented by SPoRT for the delivery of real-time products to NWS forecast offices and other weather entities. Once available in decision support systems like AWIPS II, these new data and products must be integrated into existing and new displays that allow for the integration of the data with existing operational products in these systems. SPoRT is leading the way in demonstrating this enhanced capability. This paper will highlight the ways SPoRT is overcoming many of the challenges presented by the enormous data volumes of

  19. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  20. ICG: a wiki-driven knowledgebase of internal control genes for RT-qPCR normalization.

    Science.gov (United States)

    Sang, Jian; Wang, Zhennan; Li, Man; Cao, Jiabao; Niu, Guangyi; Xia, Lin; Zou, Dong; Wang, Fan; Xu, Xingjian; Han, Xiaojiao; Fan, Jinqi; Yang, Ye; Zuo, Wanzhu; Zhang, Yang; Zhao, Wenming; Bao, Yiming; Xiao, Jingfa; Hu, Songnian; Hao, Lili; Zhang, Zhang

    2018-01-04

    Real-time quantitative PCR (RT-qPCR) has become a widely used method for accurate expression profiling of targeted mRNA and ncRNA. Selection of appropriate internal control genes for RT-qPCR normalization is an elementary prerequisite for reliable expression measurement. Here, we present ICG (http://icg.big.ac.cn), a wiki-driven knowledgebase for community curation of experimentally validated internal control genes as well as their associated experimental conditions. Unlike extant related databases that focus on qPCR primers in model organisms (mainly human and mouse), ICG features harnessing collective intelligence in community integration of internal control genes for a variety of species. Specifically, it integrates a comprehensive collection of more than 750 internal control genes for 73 animals, 115 plants, 12 fungi and 9 bacteria, and incorporates detailed information on recommended application scenarios corresponding to specific experimental conditions, which, collectively, are of great help for researchers to adopt appropriate internal control genes for their own experiments. Taken together, ICG serves as a publicly editable and open-content encyclopaedia of internal control genes and accordingly bears broad utility for reliable RT-qPCR normalization and gene expression characterization in both model and non-model organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  2. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  3. Selection of suitable reference genes for RT-qPCR analyses in cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Filipe Pinto

    Full Text Available Cyanobacteria are a group of photosynthetic prokaryotes that have a diverse morphology, minimal nutritional requirements and metabolic plasticity that has made them attractive organisms to use in biotechnological applications. The use of these organisms as cell factories requires the knowledge of their physiology and metabolism at a systems level. For the quantification of gene transcripts real-time quantitative polymerase chain reaction (RT-qPCR is the standard technique. However, to obtain reliable RT-qPCR results the use and validation of reference genes is mandatory. Towards this goal we have selected and analyzed twelve candidate reference genes from three morphologically distinct cyanobacteria grown under routinely used laboratory conditions. The six genes exhibiting less variation in each organism were evaluated in terms of their expression stability using geNorm, NormFinder and BestKeeper. In addition, the minimum number of reference genes required for normalization was determined. Based on the three algorithms, we provide a list of genes for cyanobacterial RT-qPCR data normalization. To our knowledge, this is the first work on the validation of reference genes for cyanobacteria constituting a valuable starting point for future works.

  4. Assessment of brain reference genes for RT-qPCR studies in neurodegenerative diseases.

    Science.gov (United States)

    Rydbirk, Rasmus; Folke, Jonas; Winge, Kristian; Aznar, Susana; Pakkenberg, Bente; Brudek, Tomasz

    2016-11-17

    Evaluation of gene expression levels by reverse transcription quantitative real-time PCR (RT-qPCR) has for many years been the favourite approach for discovering disease-associated alterations. Normalization of results to stably expressed reference genes (RGs) is pivotal to obtain reliable results. This is especially important in relation to neurodegenerative diseases where disease-related structural changes may affect the most commonly used RGs. We analysed 15 candidate RGs in 98 brain samples from two brain regions from Alzheimer's disease (AD), Parkinson's disease (PD), Multiple System Atrophy, and Progressive Supranuclear Palsy patients. Using RefFinder, a web-based tool for evaluating RG stability, we identified the most stable RGs to be UBE2D2, CYC1, and RPL13 which we recommend for future RT-qPCR studies on human brain tissue from these patients. None of the investigated genes were affected by experimental variables such as RIN, PMI, or age. Findings were further validated by expression analyses of a target gene GSK3B, known to be affected by AD and PD. We obtained high variations in GSK3B levels when contrasting the results using different sets of common RG underlining the importance of a priori validation of RGs for RT-qPCR studies.

  5. NASA SPoRT GOES-R Proving Ground Activities

    Science.gov (United States)

    Stano, Geoffrey T.; Fuell, Kevin K.; Jedloec, Gary J.

    2010-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) program is a partner with the GOES-R Proving Ground (PG) helping prepare forecasters understand the unique products to come from the GOES-R instrument suite. SPoRT is working collaboratively with other members of the GOES-R PG team and Algorithm Working Group (AWG) scientists to develop and disseminate a suite of proxy products that address specific forecast problems for the WFOs, Regional and National Support Centers, and other NOAA users. These products draw on SPoRT s expertise with the transition and evaluation of products into operations from the MODIS instrument and the North Alabama Lightning Mapping Array (NALMA). The MODIS instrument serves as an excellent proxy for the Advanced Baseline Imager (ABI) that will be aboard GOES-R. SPoRT has transitioned and evaluated several multi-channel MODIS products. The true and false color products are being used in natural hazard detection by several SPoRT partners to provide better observation of land features, such as fires, smoke plumes, and snow cover. Additionally, many of SPoRT s partners are coastal offices and already benefit from the MODIS sea surface temperature composite. This, along with other surface feature observations will be developed into ABI proxy products for diagnostic use in the forecast process as well as assimilation into forecast models. In addition to the MODIS instrument, the NALMA has proven very valuable to WFOs with access to these total lightning data. These data provide situational awareness and enhanced warning decision making to improve lead times for severe thunderstorm and tornado warnings. One effort by SPoRT scientists includes a lightning threat product to create short-term model forecasts of lightning activity. Additionally, SPoRT is working with the AWG to create GLM proxy data from several of the ground based total lightning networks, such as the NALMA. The evaluation will focus on the vastly improved spatial

  6. Evaluation of the expression of internal control transcripts by real ...

    African Journals Online (AJOL)

    Evaluation of the expression of internal control transcripts by real-time RT-PCR analysis during tomato flower abscission. Song Gao, Tao Xu, Mingfang Qi, Yufeng Liu, Hong Li, Shuangshuang Lv, Jinhong Li, Tianlai Li ...

  7. SPoRT's Participation in the GOES-R Proving Ground Activity

    Science.gov (United States)

    Jedlovec, Gary; Fuell, Kevin; Smith, Matthew; Stano, Geoffrey; Molthan, Andrew

    2011-01-01

    The next generation geostationary satellite, GOES-R, will carry two new instruments with unique atmospheric and surface observing capabilities, the Advanced Baseline Imager (ABI) and the Geostationary Lightning Mapper (GLM), to study short-term weather processes. The ABI will bring enhanced multispectral observing capabilities with frequent refresh rates for regional and full disk coverage to geostationary orbit to address many existing and new forecast challenges. The GLM will, for the first time, provide the continuous monitoring of total lightning flashes over a hemispherical region from space. NOAA established the GOES-R Proving Ground activity several years ago to demonstrate the new capabilities of these instruments and to prepare forecasters for their day one use. Proving Ground partners work closely with algorithm developers and the end user community to develop and transition proxy data sets representing GOES-R observing capabilities. This close collaboration helps to maximize refine algorithms leading to the delivery of a product that effectively address a forecast challenge. The NASA Short-term Prediction Research and Transition (SPoRT) program has been a participant in the NOAA GOES-R Proving Ground activity by developing and disseminating selected GOES-R proxy products to collaborating WFOs and National Centers. Established in 2002 to demonstrate the weather and forecasting application of real-time EOS measurements, the SPoRT program has grown to be an end-to-end research to operations activity focused on the use of advanced NASA modeling and data assimilation approaches, nowcasting techniques, and unique high-resolution multispectral data from EOS satellites to improve short-term weather forecasts on a regional and local scale. Participation in the Proving Ground activities extends SPoRT s activities and taps its experience and expertise in diagnostic weather analysis, short-term weather forecasting, and the transition of research and experimental

  8. "Siempre" and "todo el tiempo": Investigating Semantic Convergence in a Bilingual Dialect.

    Science.gov (United States)

    Garcia, MaryEllen

    2001-01-01

    Investigates to what extent the variability between "siempre" and "todo el tiempo" in the San Antonio dialect demonstrates semantic convergence between them, and whether there will be a selection of the innovating form for the future. Examination of this variability may illuminate questions of how such changes occur…

  9. ANÁLISIS EMPÍRICO A LA RESOLUCIÓN DEL ENIGMA DEL TIEMPO

    Directory of Open Access Journals (Sweden)

    ALFRED DIESTIG

    2009-12-01

    Full Text Available Muchos creen que el tiempo discurre de manera continua, pero la ciencia moderna ha descubierto que la realidad puede ser mucho más compleja, y que el viaje por el tiempo tal vez sea físicamente posible. Si según los principios abstractos de la física es posible viajar a través del tiempo, ¿cómo puede conseguirse? Quizás algún día las súper densas estrellas de neutrones permitirán a los viajeros del espacio trasladarse hacia el pasado. Muchos hombres de ciencia están de acuerdo en que sólo podremos entender el mundo físico si estamos dispuestos a renunciar a muchas de nuestras ideas acerca de la naturaleza del tiempo. Las huidas al pasado parecen indicar que realmente éste siempre nos acompaña, que existe a un nivel al que todas las personas psíquicamente influenciables pueden acceder, ¿cuáles son las implicaciones de esta fascinante idea?

  10. Una reflexión entorno al tiempo. Experiencias docentes en la India

    Directory of Open Access Journals (Sweden)

    Julio Grijalba Bengoetxea

    2014-10-01

    Full Text Available Nuestra relación con la enseñanza de la Arquitectura en la India, entre 2009 y 2014, ha fructificado en varias ac­ciones: La participación en el III Euro/ Indian Summit, la elaboración de la exposición “Discovering Ahmedabad”. Annals of Reinvention, la intervención en la “Ahmedabad Heritage Week”, la propuesta de “Proyecto de residencia para profesores y alumnos de Máster en Ahmedabad” y, como conclusión, el Programa europeo EuropeAid: “Cultural Heritage and Management Venture Lab” in Ahmedabad, India. En todas ellas, tuvimos conciencia de que hablar de Patrimonio, Restauración y Preservación es reflexionar sobre el sentido y la representación del Tiempo. Mientras que en Occidente el tiempo está ligado al movimiento (sucesión de un antes y un después diferentes en Oriente, el tiempo se integra en el fluir de la naturaleza. Una reflexión sobre el tiempo como instrumento del proyecto desde dos puntos de vista que cree­mos complementarios o, en términos más ortodoxos, desde una lectura disciplinar, de conciliación de opuestos: Oriente versus Occidente.

  11. Uso de kits desechables para optimizar tiempos, movimientos y apego a protocolos de la terapia intravenosa

    Directory of Open Access Journals (Sweden)

    José Juan Escamilla Zamudio

    2017-09-01

    Cómo citar este artículo: Escamilla JJ, Ramírez GI. Uso de kits desechables para optimizar tiempos, movimientos y apego a protocolos de la terapia intravenosa. Rev Cuid. 2017; 8(3: 1749-57. http://dx.doi.org/10.15649/cuidarte.v8i3.412

  12. Viajes por el tiempo y otras perplejidades matemáticas

    OpenAIRE

    Méndez, José Manuel

    2011-01-01

    Se presenta una breve descripción de los contenidos de cada uno de los artículos de el libro Viajes por el tiempo y otras perplejidades matemáticas. De algunos capítulos se puede extraer material didáctico para llevar a las aulas de enseñanza secundaria.

  13. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  14. NASA SPoRT Initialization Datasets for Local Model Runs in the Environmental Modeling System

    Science.gov (United States)

    Case, Jonathan L.; LaFontaine, Frank J.; Molthan, Andrew L.; Carcione, Brian; Wood, Lance; Maloney, Joseph; Estupinan, Jeral; Medlin, Jeffrey M.; Blottman, Peter; Rozumalski, Robert A.

    2011-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed several products for its National Weather Service (NWS) partners that can be used to initialize local model runs within the Weather Research and Forecasting (WRF) Environmental Modeling System (EMS). These real-time datasets consist of surface-based information updated at least once per day, and produced in a composite or gridded product that is easily incorporated into the WRF EMS. The primary goal for making these NASA datasets available to the WRF EMS community is to provide timely and high-quality information at a spatial resolution comparable to that used in the local model configurations (i.e., convection-allowing scales). The current suite of SPoRT products supported in the WRF EMS include a Sea Surface Temperature (SST) composite, a Great Lakes sea-ice extent, a Greenness Vegetation Fraction (GVF) composite, and Land Information System (LIS) gridded output. The SPoRT SST composite is a blend of primarily the Moderate Resolution Imaging Spectroradiometer (MODIS) infrared and Advanced Microwave Scanning Radiometer for Earth Observing System data for non-precipitation coverage over the oceans at 2-km resolution. The composite includes a special lake surface temperature analysis over the Great Lakes using contributions from the Remote Sensing Systems temperature data. The Great Lakes Environmental Research Laboratory Ice Percentage product is used to create a sea-ice mask in the SPoRT SST composite. The sea-ice mask is produced daily (in-season) at 1.8-km resolution and identifies ice percentage from 0 100% in 10% increments, with values above 90% flagged as ice.

  15. An Experimental Evaluation of Real-Time DVFS Scheduling Algorithms

    OpenAIRE

    Saha, Sonal

    2011-01-01

    Dynamic voltage and frequency scaling (DVFS) is an extensively studied energy manage- ment technique, which aims to reduce the energy consumption of computing platforms by dynamically scaling the CPU frequency. Real-Time DVFS (RT-DVFS) is a branch of DVFS, which reduces CPU energy consumption through DVFS, while at the same time ensures that task time constraints are satisfied by constructing appropriate real-time task schedules. The literature presents numerous RT-DVFS schedul...

  16. Tiempo y sucesión ecológica en Ramón Margalef

    Directory of Open Access Journals (Sweden)

    Vargas Abarzúa, Esteban

    2010-02-01

    Full Text Available In this paper we attempt to think about the time in the Margalef’s ecological succession theory. In the classical model of ecological succession, populations succeed each other. Each phases of that succession “as a temporary phase” is merely juxtaposed with the other. It is the clock time, time like “measure” of the clock. Time here is absolute, independent of the process like in Newton. This does not happen in the model of Margalef. He thinks the ecosystem like a process in which energy is transfer and information acumulated. Thus, in the dynamic process of ecosystem appears various phases determined by the intrinsic dynamics of the system. Each ecosystem has its own time.

    En este trabajo intentamos meditar la concepción de tiempo en la teoría de sucesión ecológica de Margalef. En un modelo clásico de sucesión ecológica, las poblaciones se suceden unas a otras. Cada fase de esa sucesión “en tanto fase temporal” está meramente yuxtapuesta a las demás fases. Es el tiempo cronométrico, el tiempo como “medida” del reloj. El tiempo es aquí algo absoluto, independiente del proceso como en Newton. Esto no ocurre en el modelo de Margalef. Él piensa el ecosistema como un proceso de transferencia de energía y acumulación de información. Por esto, en el proceso dinámico del ecosistema existen diversas fases determinadas por la dinámica intrínseca del sistema. Cada ecosistema posee así su tiempo propio.

  17. Desarrollo de la Habilidad de Administración del Tiempo en directivas del primer nivel del MITRANS.

    OpenAIRE

    García Remus, Mayelín

    2009-01-01

    Valoración de cómo administran el tiempo las mujeres directivas del sector del transporte en Ciudad de La Habana. Establece las competencias individuales que pueden influir en el desarrollo de la habilidad de administración del tiempo.

  18. QBeRT: an innovative instrument for qualification of particle beam in real-time

    Science.gov (United States)

    Gallo, G.; Lo Presti, D.; Bonanno, D. L.; Longhitano, F.; Bongiovanni, D. G.; Reito, S.; Randazzo, N.; Leonora, E.; Sipala, V.; Tommasino, F.

    2016-11-01

    This paper describes an innovative beam diagnostic and monitoring system composed of a position sensitive detector and a residual range detector, based on scintillating optical fiber and on an innovative read-out strategy and reconstruction algorithm. The position sensitive detector consists of four layers of pre-aligned and juxtaposed scintillating fibres arranged to form two identical overlying and orthogonal planes. The 500 μm square section fibres are optically coupled to two Silicon Photomultiplier arrays using a channel reduction system patented by the Istituto Nazionale di Fisica Nucleare. The residual range detector is a stack of sixty parallel layers of the same fibres used in the position detector, each of which is optically coupled to a channel of Silicon Photomultiplier array by wavelength shifting fibres. The sensitive area of the two detectors is 9 × 9 cm2. After being fully characterized at CATANA proton therapy facility, the performance of the prototypes was tested during last year also at TIFPA proton irradiation facility. The unique feature of these detectors is the possibility to work in imaging conditions (e.g. a particle at a time up to 106 particles per second) and in therapy conditions up to 109 particles per second. The combined use of the two detectors, in imaging conditions, as an example of application, allows the particle radiography of an object. In therapy conditions, in particular, the system measures the position, the profiles, the energy and the fluence of the beam.

  19. QBeRT: an innovative instrument for qualification of particle beam in real-time

    International Nuclear Information System (INIS)

    Gallo, G.; Presti, D. Lo; Bonanno, D.L.; Longhitano, F.; Bongiovanni, D.G.; Reito, S.; Randazzo, N.; Leonora, E.; Sipala, V.; Tommasino, F.

    2016-01-01

    This paper describes an innovative beam diagnostic and monitoring system composed of a position sensitive detector and a residual range detector, based on scintillating optical fiber and on an innovative read-out strategy and reconstruction algorithm. The position sensitive detector consists of four layers of pre-aligned and juxtaposed scintillating fibres arranged to form two identical overlying and orthogonal planes. The 500 μm square section fibres are optically coupled to two Silicon Photomultiplier arrays using a channel reduction system patented by the Istituto Nazionale di Fisica Nucleare. The residual range detector is a stack of sixty parallel layers of the same fibres used in the position detector, each of which is optically coupled to a channel of Silicon Photomultiplier array by wavelength shifting fibres. The sensitive area of the two detectors is 9 × 9 cm 2 . After being fully characterized at CATANA proton therapy facility, the performance of the prototypes was tested during last year also at TIFPA proton irradiation facility. The unique feature of these detectors is the possibility to work in imaging conditions (e.g. a particle at a time up to 10 6 particles per second) and in therapy conditions up to 10 9 particles per second. The combined use of the two detectors, in imaging conditions, as an example of application, allows the particle radiography of an object. In therapy conditions, in particular, the system measures the position, the profiles, the energy and the fluence of the beam.

  20. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  1. Soft-Rt: software for IMRT simulations based on MCNPX

    International Nuclear Information System (INIS)

    Ferreira F, T. C.; Campos, T.

    2015-10-01

    Intensity Modulated Radiation Therapy (IMRT) is an advanced treatment technique, widely used in external radiotherapy. This paper presents the Soft-Rt which allows the simulation of an entire IMRT treatment protocol. The Soft-Rt performs a full three-dimensional rendering of a set of patient images, including the definitions of region of interest with organs in risk, and the target tumor volume and margins (PTV). Thus, a more accurate analysis and planning can be performed, taking into account the features and orientation of the radiation beams. The exposed tissues as well as the amount of absorbed dose is depicted in healthy and/or cancerous tissues. As conclusion, Soft-Rt can predict dose on the PTV accurately, preserving the surrounding healthy tissues. Soft-Rt is coupled with SISCODES code. The SISCODES code is firstly applied to segment the set of CT or MRI patient images in distinct tissues pointing out its respective density and chemical compositions. Later, the voxel model is export to the Soft-Rt IMRT planning module in which a full treatment planning is created. All geometrical parameters are sent to the general purpose Monte Carlo transport code - MCNP - to simulate the interaction of each incident beam towards to the PTV avoiding organs in risk. The normalized dose results are exported to the Soft-Rt out-module, in which the three-dimensional model visualization is shown in a transparent glass procedure adopting gray scale for the dependence on the mass density of the correlated tissue; while, a color scale to depict dose values in a superimpose protocol. (Author)

  2. AWIPS II Application Development, a SPoRT Perspective

    Science.gov (United States)

    Burks, Jason E.; Smith, Matthew; McGrath, Kevin M.

    2014-01-01

    The National Weather Service (NWS) is deploying its next-generation decision support system, called AWIPS II (Advanced Weather Interactive Processing System II). NASA's Short-term Prediction Research and Transition (SPoRT) Center has developed several software 'plug-ins' to extend the capabilities of AWIPS II. SPoRT aims to continue its mission of improving short-term forecasts by providing NASA and NOAA products on the decision support system used at NWS weather forecast offices (WFOs). These products are not included in the standard Satellite Broadcast Network feed provided to WFOs. SPoRT has had success in providing support to WFOs as they have transitioned to AWIPS II. Specific examples of transitioning SPoRT plug-ins to WFOs with newly deployed AWIPS II systems will be presented. Proving Ground activities (GOES-R and JPSS) will dominate SPoRT's future AWIPS II activities, including tool development as well as enhancements to existing products. In early 2012 SPoRT initiated the Experimental Product Development Team, a group of AWIPS II developers from several institutions supporting NWS forecasters with innovative products. The results of the team's spring and fall 2013 meeting will be presented. Since AWIPS II developers now include employees at WFOs, as well as many other institutions related to weather forecasting, the NWS has dealt with a multitude of software governance issues related to the difficulties of multiple remotely collaborating software developers. This presentation will provide additional examples of Research-to-Operations plugins, as well as an update on how governance issues are being handled in the AWIPS II developer community.

  3. Soft-Rt: software for IMRT simulations based on MCNPX

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira F, T. C. [Centro de Desenvolvimento da Tecnologia Nuclear / CNEN, Av. Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte, Minas Gerais (Brazil); Campos, T., E-mail: tcff01@gmail.com [Universidade Federal de Minas Gerais, Departamento de Engenharia Nuclear, Programa de Pos Graduacao em Ciencias e Tecnicas Nucleares, Av. Pte. Antonio Carlos 6627, 31270-901 Belo Horizonte, Minas Gerais (Brazil)

    2015-10-15

    Intensity Modulated Radiation Therapy (IMRT) is an advanced treatment technique, widely used in external radiotherapy. This paper presents the Soft-Rt which allows the simulation of an entire IMRT treatment protocol. The Soft-Rt performs a full three-dimensional rendering of a set of patient images, including the definitions of region of interest with organs in risk, and the target tumor volume and margins (PTV). Thus, a more accurate analysis and planning can be performed, taking into account the features and orientation of the radiation beams. The exposed tissues as well as the amount of absorbed dose is depicted in healthy and/or cancerous tissues. As conclusion, Soft-Rt can predict dose on the PTV accurately, preserving the surrounding healthy tissues. Soft-Rt is coupled with SISCODES code. The SISCODES code is firstly applied to segment the set of CT or MRI patient images in distinct tissues pointing out its respective density and chemical compositions. Later, the voxel model is export to the Soft-Rt IMRT planning module in which a full treatment planning is created. All geometrical parameters are sent to the general purpose Monte Carlo transport code - MCNP - to simulate the interaction of each incident beam towards to the PTV avoiding organs in risk. The normalized dose results are exported to the Soft-Rt out-module, in which the three-dimensional model visualization is shown in a transparent glass procedure adopting gray scale for the dependence on the mass density of the correlated tissue; while, a color scale to depict dose values in a superimpose protocol. (Author)

  4. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  5. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  6. Evaluating the Impacts of NASA/SPoRT Daily Greenness Vegetation Fraction on Land Surface Model and Numerical Weather Forecasts

    Science.gov (United States)

    Bell, Jordan R.; Case, Jonathan L.; Molthan, Andrew L.

    2011-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center develops new products and techniques that can be used in operational meteorology. The majority of these products are derived from NASA polar-orbiting satellite imagery from the Earth Observing System (EOS) platforms. One such product is a Greenness Vegetation Fraction (GVF) dataset, which is produced from Moderate Resolution Imaging Spectroradiometer (MODIS) data aboard the NASA EOS Aqua and Terra satellites. NASA SPoRT began generating daily real-time GVF composites at 1-km resolution over the Continental United States (CONUS) on 1 June 2010. The purpose of this study is to compare the National Centers for Environmental Prediction (NCEP) climatology GVF product (currently used in operational weather models) to the SPoRT-MODIS GVF during June to October 2010. The NASA Land Information System (LIS) was employed to study the impacts of the new SPoRT-MODIS GVF dataset on land surface models apart from a full numerical weather prediction (NWP) model. For the 2010 warm season, the SPoRT GVF in the western portion of the CONUS was generally higher than the NCEP climatology. The eastern CONUS GVF had variations both above and below the climatology during the period of study. These variations in GVF led to direct impacts on the rates of heating and evaporation from the land surface. The second phase of the project is to examine the impacts of the SPoRT GVF dataset on NWP using the Weather Research and Forecasting (WRF) model. Two separate WRF model simulations were made for individual severe weather case days using the NCEP GVF (control) and SPoRT GVF (experimental), with all other model parameters remaining the same. Based on the sensitivity results in these case studies, regions with higher GVF in the SPoRT model runs had higher evapotranspiration and lower direct surface heating, which typically resulted in lower (higher) predicted 2-m temperatures (2-m dewpoint temperatures). The opposite was true

  7. Evaluating the Impacts of NASA/SPoRT Daily Greenness Vegetation Fraction on Land Surface Model and Numerical Weather Forecasts

    Science.gov (United States)

    Bell, Jordan R.; Case, Jonathan L.; LaFontaine, Frank J.; Kumar, Sujay V.

    2012-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed a Greenness Vegetation Fraction (GVF) dataset, which is updated daily using swaths of Normalized Difference Vegetation Index data from the Moderate Resolution Imaging Spectroradiometer (MODIS) data aboard the NASA EOS Aqua and Terra satellites. NASA SPoRT began generating daily real-time GVF composites at 1-km resolution over the Continental United States (CONUS) on 1 June 2010. The purpose of this study is to compare the National Centers for Environmental Prediction (NCEP) climatology GVF product (currently used in operational weather models) to the SPoRT-MODIS GVF during June to October 2010. The NASA Land Information System (LIS) was employed to study the impacts of the SPoRT-MODIS GVF dataset on a land surface model (LSM) apart from a full numerical weather prediction (NWP) model. For the 2010 warm season, the SPoRT GVF in the western portion of the CONUS was generally higher than the NCEP climatology. The eastern CONUS GVF had variations both above and below the climatology during the period of study. These variations in GVF led to direct impacts on the rates of heating and evaporation from the land surface. In the West, higher latent heat fluxes prevailed, which enhanced the rates of evapotranspiration and soil moisture depletion in the LSM. By late Summer and Autumn, both the average sensible and latent heat fluxes increased in the West as a result of the more rapid soil drying and higher coverage of GVF. The impacts of the SPoRT GVF dataset on NWP was also examined for a single severe weather case study using the Weather Research and Forecasting (WRF) model. Two separate coupled LIS/WRF model simulations were made for the 17 July 2010 severe weather event in the Upper Midwest using the NCEP and SPoRT GVFs, with all other model parameters remaining the same. Based on the sensitivity results, regions with higher GVF in the SPoRT model runs had higher evapotranspiration and

  8. One-step cross-genogroup multiplex RT-qPCR with an internal control system for the detection of infectious pancreatic necrosis virus (IPNV).

    Science.gov (United States)

    Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard

    2017-09-01

    Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Estudio de distribución de tiempos de residencia en un reactor biológico de lecho empacado cerámico

    Directory of Open Access Journals (Sweden)

    Tatiana Rodríguez Chaparro

    2004-01-01

    Full Text Available La distribución de tiempos de residencia de un reactor es una característica del mezclado que ocurre dentro de él [ ] 1 [ ] 2 ; su determinación es básica para el diseño de cualquier tipo de reactor en escala real. El objetivo de esta investigación consistió en determinar la distribución de tiempos de residencia en un reactor biológico de lecho empacado cerámico (anillos a partir de pruebas con trazadores. Los resultados obtenidos utilizando las técnicas de inyección por paso y pulso fueron 34.577 seg., y 17.745 seg., respectivamente, y la dispersión calculada infinita. Lo anterior permite concluir que en reactores de lecho empacado cerámico (anillos las moléculas del trazador se distribuyen uniformemente en todo el sistema. Los ensayos se realizaron en un modelo a escala laboratorio.

  10. Kirjanduskriitikute suvemängud / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    2007-01-01

    Arvustus: Lodge, David. Ühest kohast teise / tlk. Aet Varik. Tallinn : Varrak, 2005 ; Lodge, David. Väike maailm / tlk. Kersti Unt. Tallinn : Varrak, 1996 ; Lodge, David. Väärt töö / tlk. Kersti Unt. Tallinn : Varrak, 2006

  11. Future of the reprocessing business at the RT-1 plant

    International Nuclear Information System (INIS)

    Bukharin, O.

    1995-01-01

    Economic viability of reprocessing operations at the RT-1 plant is provided by the contracts with nuclear utilities from Finland and Hungary. Finland will stop sending fuel to Mayak for reprocessing after 1996. Hungary will be capable to resolve the problem of spent fuel domestically some time in the future. This increases vulnerability of the reprocessing business at Mayak to future political uncertainties. (author)

  12. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  13. rt, Arvo: De profundis. Missa Sillabica / Patric Wiklacz

    Index Scriptorium Estoniae

    Wiklacz, Patric

    1997-01-01

    Uuest heliplaadist "Pärt, Arvo: De profundis. Missa Sillabica. Solfeggio. And one of the Pharisees. Cantate Domino. Summa. 7 Antiennes du Magnificat. The Beautitudes. Magnificat. Christopher Bowers-Broadbent (org.), Daniel Kennedy (perc.). Theatre of Voices / Paul Hillier (bass)" Harmonia Mundi HMU907 182 F (CD:165F). 1996. TT:1h 16'06"

  14. Narr kui ajastu metafoor / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    2001-01-01

    William Shakespeare'i "Kuningas Lear" (lav. Priit Pedajas) ja Pedro Calder̤n de la Barca "Elu on unenägu" (lav. Ingo Normet) Eesti Draamateatris. Ilmunud ka kogumikus : Hellerma, Kärt. Avanenud ruum. Tallinn : Eesti Keele Sihtasutus, 2006, lk. 213-216. Pealk. Narr kui meie aja kangelane

  15. rt: Chamber and Orchestral Works / Robert Cowan

    Index Scriptorium Estoniae

    Cowan, Robert

    1994-01-01

    Uuest heliplaadist "Pärt: Chamber and Orchestral Works. Bournemouth Sinfonietta, Richard Studt. EMI Eminence CD CD-EMX 2221; Fratres; Cantus in memory of Benjamin Britten; Summa; Spiegel im Spiegel; Festina lente; Tabula Rasa; Fratres - selected comparison: Bachmann, Kibonoff (12/94)(CATA) 09026 61824-2. Kremer, Jarrett (ECM) 817 764-2

  16. 25 kaadrit sekundis / Liis Auväärt

    Index Scriptorium Estoniae

    Auväärt, Liis

    2009-01-01

    Nukufilmis käib töö filmiga "Lisa Limone & Maroc Orange", režissöör Mait Laas, animaatorid Triin Sarapik-Kivi, Märt Kivi, operaator Ragnar Neljandi, nukumeistrid Heigo Eeriksoo, Taivo Müürsep, Ene Mellow ja Kreeta Käeri. Dekoratsioonimeistrid Mait Erik ja Roman Kuznetsov

  17. rt, Arvo: De profundis / Barry Witherden

    Index Scriptorium Estoniae

    Witherden, Barry

    1997-01-01

    Uuest heliplaadist "Pärt, Arvo: De profundis. Missa Sillabica. Solfeggio. And one of the Pharisees. Cantate Domino. Summa. Seven Magnificat Antiphons. The Beautitudes. Magnificat. Christopher Bowers-Broadbent (org.), Daniel Kennedy (perc.). Theatre of Voices / Paul Hillier (bass)". Harmonia Mundi HMU40 7182; HMU90 7182 (76 minutes:DDD)

  18. Torm Balti merel / Märt Treier ; interv. Inge Pitsner

    Index Scriptorium Estoniae

    Treier, Märt, 1975-

    2004-01-01

    TV3 näitab saksa poliitilist põnevusfilmi "Balti torm" ("Baltic Storm"), mis kujutab parvlaev "Estonia" hukku : stsenarist, produtsent Jutta Rabe : režissöör Reuben Leder. Filmi eel on teles Märt Treieri saade "Tormist sündinud tormid"

  19. Karje kunstniku südamest / Kärt Hellerma

    Index Scriptorium Estoniae

    Hellerma, Kärt, 1956-

    1997-01-01

    Arvustus: Dinesen, Isak [Blixen, Karen]. Babette'i pidusöök / tlk. Piret Peiker. Tallinn : Varrak, 1996. Ilmunud ka kogumikus: Hellerma, Kärt. Kohanenud kirjandus : valik kirjanduskriitikat 1987-2006. Eesti Keele Sihtasutus : Tallinn, 2006. Lk. 167-169

  20. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

    Science.gov (United States)

    Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

    2018-01-01

    Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

  1. Tiempo y situacionalidad. La “respuesta” merleaupontiana a la paradoja de McTaggart

    Directory of Open Access Journals (Sweden)

    Claudio Cormick

    2014-01-01

    Full Text Available Se busca establecer una relación, no satisfactoriamente explorada, entre la fenomenología merleaupontiana del tiempo y un problema central de la “theory of time” analítica, la paradoja de McTaggart. Al clarificar, en polémica con Priest (1998, el auténtico sentido del “subjetivismo” merleaupontiano con respecto al tiempo, se señala cómo establecer una confluencia entre el acercamiento fenomenológico y las tesis desarrolladas por Michael Dummett como respuesta a la mencionada paradoja. Con los señalamientos de Dummett y la interpretación de Bimbenet acerca del “perspectivismo” merleaupontiano, se intenta una solución “situacional” a la paradoja.

  2. La identidad como categoría relacional en el tiempo-lugar de recreo

    Directory of Open Access Journals (Sweden)

    Luis Guillermo Jaramillo Echeverry

    2013-08-01

    Full Text Available Construcción de Identidad en el tiempo de recreo: un estudio en cinco escuelas de la ciudad de Popayán’ es el título de la investigación que sirvió de fuente para este artículo. En él se presenta el enfoque y diseño metodológico usado, conocido como ‘la complementariedad’, constituido por tres momentos: pre-configuración, configuración y re-configuración de la realidad. En el estudio el recreo emerge como ese tiempo-lugar en el cual los niños se expresan como sujetos activos y participes de su realidad. En el recreo serán producidas formas de identidad asociadas con la capacidad de decisión, con los procesos de alteridad y con los sentidos otorgados a la normatividad institucional.

  3. Acuerdo en tiempo: un procedimiento de eficaz aplicación en las visitas de terreno

    Directory of Open Access Journals (Sweden)

    Rafael Borroto Chao

    1995-04-01

    Full Text Available Se destaca el valor de las actividades y las posibilidades que ofrecen al efecto las visitas periódicas de terreno que realizan los equipos de salud de la familia a las viviendas de la población que ateinden. Se fundamenta la importancia de aplicar métodos educativos durante estas visitas y se sugiere en tal sentido un procedimiento al que se le ha denominado "acuerdo en tiempo". Se exponen las cuestiones que se deben considerar en las visitas de terreno y se brindan ejemplos de los aspectos que se deben enfatizar desde el punto de vista educativo. Se recomienda la aplicación de técnicas educativas bidireccionales como la entrevista y la dinámica grupal, así como el procedimiento "acuerdo en tiempo" como estrategia de prometedoras perspectivas en la educación para la salud de la población.

  4. Imagen familiar y concepto de tiempo. Propuesta para tercer grado de educación primaria.

    OpenAIRE

    Carreras-Soler, Anna

    2014-01-01

    El presente Trabajo de Fin de Grado hace una aproximación a la didáctica de la historia y el modo cómo se comprende el concepto del tiempo en la Educación Primaria. Con el principio de la imagen como código de comunicación de nuestro tiempo y sus posibilidades a través de las TIC, analiza el papel que desempeña en este proceso cognitivo, desde el estudio de los parámetros de la percepción visual, las posibilidades emocionales que ofrece y las estrategias para su correcta interpretación. En...

  5. Determinación y cuantificación de bacterias acidolácticas por PCR en tiempo real

    Directory of Open Access Journals (Sweden)

    Vienvilay Phandanouvong L

    2010-04-01

    Full Text Available Objetivo. Establecer un ensayo de PCR-TR para determinar el tamaño poblacional y la composición de bacterias totales y de ácido lácticas, en particular las pertenecientes a los géneros Lactobacillus y Bifidobacterium. Materiales y métodos. La especificidad de los iniciadores fue verificada utilizando la técnica de PCR convencional. Diluciones de 101 a 10- 4 ng/μl de ADN fueron preparadas a partir de cada cultivo microbiano y utilizadas en las curvas de calibración. La temperatura de disociación y la eficiencia de cada reacción de PCR-TR se determinaron con el software del iQCycler (Bio Rad®, versión 3.1. Resultados. Los juegos de iniciadores utilizados resultaron específicos para cada grupo microbiano, sin detectar reacción cruzada. Las eficiencias de las reacciones de la PCR-TR para bacterias totales, acidolácticas, Lactobacillus y Bifidobacterium fueron 104.4%, 98.1%, 113.3% y 103.3%, respectivamente. Conclusiones. Al obtener reacciones específicas y eficiencias cercanas al 100%, es posible cuantificar las poblaciones bacterianas totales, acidolácticas, Lactobacillus y Bifidobacterium con una alta especificidad. Por lo tanto, la técnica de PCRTR puede utilizarse para monitorear cambios poblacionales bacterianos en ambientes como el tracto gastrointestinal de pollos de engorde, donde las bacterias acidolácticas, Lactobacillus y Bifidobacterium son habitantes comunes.

  6. Aplicación M-learning para uso en tiempo real en clases de matemáticas

    OpenAIRE

    Landa Nicolás, Oliver

    2015-01-01

    EI presente proyecto trata de Ia implementación de una aplicación web Mobile Learning (aprendizaje móvil) en el ámbito de Ias matemáticas, que complementa Ias actividades dentro del aula para fomentar el aprendizaje de los alumnos, a través de dispositivos electrónicos personales (ordenadores, móviles, tabletas...). El profesor lanza una pregunta y los alumnos podrán responder utilizando dispositivos electrónicos personales, así los profesores pueden visualizar el resultado de Ias respuest...

  7. Análisis sentimental de la polaridad de tweets en tiempo real aplicando algoritmos de clasificación

    OpenAIRE

    Campillos García, Eduardo

    2017-01-01

    El objetivo de este proyecto es el análisis, desarrollo y evaluación de un sistema de clasificación de polaridad sobre un producto determinado a través del contenido generado en Twitter en español. En primer lugar, se ha estudiado la situación actual en el campo del análisis sentimental (AS) y los avances más notables en esta área perteneciente al procesamiento del lenguaje natural. En segundo lugar, una vez estudiado el estado del arte, se pasará a desarrollar el código que implementarem...

  8. Simulación para programar y controlar por monitoreo en tiempo real sistemas de atención hospitalaria

    OpenAIRE

    Cossa Cabanillas, Jesús Alberto; Cossa Cabanillas, Jesús Alberto

    2008-01-01

    Este trabajo de investigación pretende presentar una base cognoscitiva para la determinación de los productos terminados de las empresas prestadoras de salud. El camino, para lograr el cometido, se inicia buscando la forma de cuantificar la necesidad de recursos hospitalarios (horas médico, horas enfermeras, horas cama, etc.) que necesita un paciente para el tratamiento de su enfermedad. Así mismo se determinan y agrupan todos los tratamientos que consumen similares cantidades de estos re...

  9. Diseño e implementación de un sistema de control en tiempo real mediante ondas cerebrales

    OpenAIRE

    Vimos Tixi, Víctor Hugo; Yánez Flores, Christian Marcelo

    2016-01-01

    Este proyecto desarrolla el procedimiento para adquirir señales cerebrales relacionadas a la intensión de movimiento de los brazos y estado de relajación con ojos cerrados además de los potenciales desarrollados por el movimiento ocular, las señales obtenidas son procesadas y clasificadas respectivamente. El resultado de la clasificación es utilizado como base para la decisión y la ejecución del movimiento básico de un brazo robótico de cinco grados de libertad, se diseña y construye un softw...

  10. Métodos tiempo-frecuencia basados en la transformada wavelet

    Directory of Open Access Journals (Sweden)

    Eduardo P. Serrano

    2012-07-01

    Full Text Available La información contenida en una señal analógica se evidencia por su representación numérica. El par de Fourier en dos representaciones complementarias explicita las estructuras temporales y frecuenciales. Para detectar y caracterizar eventos que combinan esas estructuras en diversos y complejos patrones es necesario implementar métodos más refinados de representación conjunta tiempo-frecuencia. Entre diversas opciones, la transformada wavelet (en onditas u ondaletas brinda una eficiente herramienta tiempo-escala. Sus extensiones conducen a apropiadas representaciones conjuntas en un unico contexto analítico permiten implementar estrategias flexibles y bien adaptadas a las características de la señal. Palabras clave: representaciones tiempo-frecuencia, transformada wavelet, análisis de multirresolución, paquetes de wavelets, frecuencia instantánea. Mathematics Subject Classification: 42C40, 44A05.

  11. La constelación freudiana y el tiempo del consumo

    Directory of Open Access Journals (Sweden)

    Marinas, José Miguel

    2007-02-01

    Full Text Available Psychoanalysis arises in the context of the crisis of the liberal subject: the transition from the culture of production to the culture of consumption. The time of progress (production comes hand in hand with a new model of time: the instant (repetition, and the time of the unconscious (desire. The biographical task is demanded as a moral duty. This paper examines the antecedents of this Freudian constellation: Nietzsche, for example, talks about fashion.El psicoanalisis surge en el contexto de la crisis del sujeto liberal, es decir en el paso de la cultura de la producción a la cultura del consumo. El tiempo del progreso (de la producción se ve acompañado de un nuevo modelo el tiempo del instante (de la repetición, y el tiempo de lo inconsciente (del deseo. La tarea biográfica se incrementa como tarea moral. Este artículo examina los antecedentes de esa constelación freudiana: Nietzsche, por ejemplo, habla de la moda.

  12. Estimación de aportaciones deducidas a presas mediante análisis de series de tiempo estacionales.

    OpenAIRE

    Ariza Hernández, Isaías

    2012-01-01

    Para el estudio de las aportaciones deducidas, que se pueden esperar en presas, se analizan con modelos matemáticos basados en la estadística, con los que se trata de inferir el comportamiento de las variables hidrológicas, que en este caso, son las aportaciones deducidas. Dichos modelos pueden ser modelos de series de tiempo. El objetivo fundamental de este trabajo es presentar una metodología de análisis de series de tiempo estacionales cuyo dominio es el tiempo propuesto por Box y Jenki...

  13. Arvo Pärt jagab preemia koolidele / Rebekka Lotman, Eva Kübar ; kommenteerinud Arvo Pärt

    Index Scriptorium Estoniae

    Lotman, Rebekka, 1978-

    2009-01-01

    Kultuuriministeerium tegi ettepaneku anda Arvo Pärdile elutööpreemia, millega kaasneva rahasumma lubas Pärt kinkida Rakvere ja Paide muusikakoolile. Elutööpreemiad saavad veel Ellen Niit ja Aarne Üksküla

  14. rt Haamer: Tsahknal pole Overalliga mingisugust seost / Märt Haamer ; intervjueerinud Jan Jõgis-Laats

    Index Scriptorium Estoniae

    Haamer, Märt, 1973-

    2009-01-01

    Overall Eesti juhi Märt Haameri väitel pole Anders Tsahkna ühtegi riigihanget Overalli ettevõtetele suunanud. Overalli omandusse kuuluv firma Gennet Lab on olnud alltöövõtja paaris E-tervise Sihtasutuse korraldatud hankes

  15. Real Language Meets Real Business

    Science.gov (United States)

    Muirhead, Muirhead; Schechter, Sarah

    2016-01-01

    The Real Business Language Challenge was a collaborative pilot project between Coca-Cola Enterprises (CCE) and Routes into Languages East for Year 9 and 10 pupils. It was based on CCE's award-winning Real Business Challenge, part of its highly acclaimed education programme. The Real Business Language Challenge transformed the project into a…

  16. Tiempo histórico y tiempo mítico entre los mayas del Periodo Clásico (ss. II-X d.C.

    Directory of Open Access Journals (Sweden)

    Lacadena García-Gallo, Alfonso

    2004-06-01

    Full Text Available The use and development of a rather precise calendrical system enabled the Maya of the Classic Period of this Mesoamerican civilization (centuries 2nd through 10th A. D. to turn time into an habitable space. For them, time was like a path leading to either the past, in the form of an historical record registered in written documents, or the future, by way of forecasts and prophecies. Compared to other archaic cultures or early civilizations, the Classic Maya has been known for years for the peculiarity of having a linear, historical concept of time, including absolute dating. Yet the decipherment of the hieroglyphic inscriptions has revealed that this historical concept of time meshed with mythical time to make up a single temporal dimension —which was at once linear and cyclical— for the actions of men as well as gods. With obsessive accuracy and recurrence, the Classic Maya used calendrical Information as mortar for the construction of an historical (especially political and religious discourse on their monuments, full of cross references to contemporary, past and even future events in texts commemorating anniversaries in several calendarial cycles.

    La utilización y desarrollo de un sistema calendárico sumamente preciso permitió a los mayas del Periodo Clásico de esta civilización mesoamericana (siglos II-X d.C. hacer del tiempo un espacio habitable. Para ellos, el tiempo era un sendero por el que era posible transitar o bien hacia el pasado, en forma de memoria histórica consignada en textos escritos, o bien hacia el futuro, mediante predicciones y profecías. Lo que es una rareza en comparación con otras culturas arcaicas o primeras civilizaciones, la clásica de los mayas incluía un concepto de tiempo histórico de carácter lineal, con dataciones absolutas. Pero el desciframiento de las inscripciones jeroglíficas está revelando que este tiempo histórico estaba integrado con el mítico en una

  17. Tiempo para quedar en embarazo: Evaluación de su reproducibilidad en una cohorte retrospectiva

    Directory of Open Access Journals (Sweden)

    Diana Carolina Jaimes Vega

    2015-04-01

    Full Text Available Introducción: El tiempo para quedar en embarazo (TPE es una medida clínica de la fecundidad útil en la evaluación de efectos reproductivos relacionados con exposiciones ambientales u ocupacionales. Estudios con mujeres europeas evidencian que su uso tiene una adecuada recordación y reproducibilidad; sin embargo, estas propiedades no han sido evaluadas en Latinoamérica. Objetivos: Evaluar la reproducibilidad de la medida TPE en una población de mujeres colombianas como una aproximación clínica de la fecundidad. Metodología: Estudio de reproducibilidad prueba-reprueba de un cuestionario para determinar el tiempo al primer embarazo en una sub-muestra de 27 mujeres, anidado en una cohorte retrospectiva de evaluación de los efectos reproductivos de la exposición al mercurio metálico en la minería artesanal de oro. El cuestionario fue administrado de forma repetida por un evaluador entrenado, en el primer momento en una entrevista presencial y 12 meses después en una entrevista telefónica. La reproducibilidad del cuestionario fue evaluada usando el coeficiente de correlación intraclase (CCI. Resultados: La mediana de tiempo al embarazo fue de 4 meses (rango intercuartil 1-12. El rango de tiempo transcurrido desde el primer embarazo estuvo entre 1 y 15 años. El CCI (2,k fue 0.726 (IC 95% 0.39, 0.88, demostrando una buena reproducibilidad de la variable después de un año de separación entre la primera y segunda entrevista. Conclusiones: El TPE para el primer embarazo mostró ser una medida clínica de fecundidad sencilla y reproducible, con un tiempo de recordación de hasta 15 años y en evaluación presencial o telefónica en una población de mujeres colombianas.

  18. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Environmental Regulation of Plant Gene Expression: An Rt-qPCR Laboratory Project for an Upper-Level Undergraduate Biochemistry or Molecular Biology Course

    Science.gov (United States)

    Eickelberg, Garrett J.; Fisher, Alison J.

    2013-01-01

    We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the "FLOWERING LOCUS C" gene, a key regulator of floral timing in "Arabidopsis thaliana" plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate…

  20. Real Time Conference 2016 Overview

    Science.gov (United States)

    Luchetta, Adriano

    2017-06-01

    This is a special issue of the IEEE Transactions on Nuclear Science containing papers from the invited, oral, and poster presentation of the 20th Real Time Conference (RT2016). The conference was held June 6-10, 2016, at Centro Congressi Padova “A. Luciani,” Padova, Italy, and was organized by Consorzio RFX (CNR, ENEA, INFN, Università di Padova, Acciaierie Venete SpA) and the Istituto Nazionale di Fisica Nucleare. The Real Time Conference is multidisciplinary and focuses on the latest developments in real-time techniques in high-energy physics, nuclear physics, astrophysics and astroparticle physics, nuclear fusion, medical physics, space instrumentation, nuclear power instrumentation, general radiation instrumentation, and real-time security and safety. Taking place every second year, it is sponsored by the Computer Application in Nuclear and Plasma Sciences technical committee of the IEEE Nuclear and Plasma Sciences Society. RT2016 attracted more than 240 registrants, with a large proportion of young researchers and engineers. It had an attendance of 67 students from many countries.

  1. La relación entre el tiempo no estructurado, el ocio y las funciones cognitivas en personas mayores

    Directory of Open Access Journals (Sweden)

    María Plaza Carmona

    2015-12-01

    Conclusiones: El tipo de práctica de actividades de ocio se relaciona positiva y significativamente con una planificación más variada e intensa del tiempo no estructurado y un mejor nivel cognitivo.

  2. An advanced real time energy management system for microgrids

    International Nuclear Information System (INIS)

    Elsied, Moataz; Oukaour, Amrane; Youssef, Tarek; Gualous, Hamid; Mohammed, Osama

    2016-01-01

    This paper presents an advanced Real-Time Energy Management System (RT-EMS) for Microgrid (MG) systems. The proposed strategy of RT-EMS capitalizes on the power of Genetic Algorithms (GAs) to minimize the energy cost and carbon dioxide emissions while maximizing the power of the available renewable energy resources. MATLAB-dSPACE Real-Time Interface Libraries (MLIB/MTRACE) are used as new tools to run the optimization code in Real-Time Operation (RTO). The communication system is developed based on ZigBee communication network which is designed to work in harsh radio environment where the control system is developed based on Advanced Lead-Lag Compensator (ALLC) which its parameters are tuned online to achieve fast convergence and good tracking response. The proposed RT-EMS along with its control and communication systems is experimentally tested to validate the results obtained from the optimization algorithm in a real MG testbed. The simulation and experimental results using real-world data highlight the effectiveness of the proposed RT-EMS for MGs applications. - Highlights: • Real-time energy management system of a typical MG is developed, and analyzed. • RT-EMS considered the nonlinear cost function and emission constraints. • MLIB/MTRACE libraries in dSPACE are used as new tools to run the optimization code. • The communication system is developed based on a Zigbee communication network. • Control system parameters are tuned online to achieve good tracking response.

  3. RT/OS - realtime programming and application environment for the COSY control system

    International Nuclear Information System (INIS)

    Weinert, A.; Hacker, U.; Haberbosch, Ch.; Henn, K.; Simon, M.

    1994-01-01

    This paper presents the highlights and constraints of RT/OS and how it can be used at other places. The support of approximately 1000 VME and VXI CPUs in network-based multiprocessor systems needs a special set of programming tools and application environment which are bundled as the RT/OS Real-Time-Operating-System. Supporting the Motorola 680x0 processors and micro-controller with a development system on UNIX and MS-DOS platforms, the tool set gives the opportunity of bringing small embedded controllers as well as VME multiprocessor systems into operation. The tool set includes a cross compiler and a special version of a remote debugger, as well as application support such as downloading and configuration management. The main feature is a modular kernel with message-based task switching, using the rendezvous principle to allow easy extension. Special features of this kernel for a distributed system are networking with the Berkeley socket library supporting TCP/IP, XNS and Novell Netware, a multiprocessor system on VMEbus with the interprocessor Communication Module (IPC), a device driver library for almost every G64 I/O card using a FieldBus Interface called PDV and a X11R4 port. ((orig.))

  4. Engineering development of an HTS floating coil for the Mini-RT project

    International Nuclear Information System (INIS)

    Yanagi, Nagato; Mito, Toshiyuki; Morikawa, Junji

    2004-01-01

    A magnetically-levitated superconducting coil device, Mini-RT, has been constructed using a high temperature superconductor (HTS) for the purpose of examining a new magnetic confinement scheme of high-beta non-neutral plasmas. The floating coil is wound with silver-sheathed Bi-2223 tapes, and it is operated in the temperature range of 20-40 K. A number of studies and experiments were carried out in order to realize the necessary system. One of them was to demonstrate magnetic levitation using a miniature HTS floating coil having a diameter of 80 mm. The coil was fabricated using Bi-2223/Ag tapes of 12 m and excited by field cooling with liquid nitrogen. The magnetic levitation was examined using a real-time feedback control system with laser displacement gauges. Additionally, a persistent current switch (PCS) has been developed using Bi-2223/Ag tapes of 21 m, and a prototype HTS-PCS was tested in a cryostat. After construction of the floating coil and HTS-PCS for the Mini-RT device was completed, excitation tests were carried out in the cryostat and the basic properties up to the nominal operation condition were examined. (author)

  5. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  6. RT/OS - realtime programming and application environment for the COSY control system

    Energy Technology Data Exchange (ETDEWEB)

    Weinert, A [Forschungszentrum, Juelich, Postfach 1913, 52425 Juelich (Germany); Hacker, U [Forschungszentrum, Juelich, Postfach 1913, 52425 Juelich (Germany); Haberbosch, Ch [Forschungszentrum, Juelich, Postfach 1913, 52425 Juelich (Germany); Henn, K [Forschungszentrum, Juelich, Postfach 1913, 52425 Juelich (Germany); Simon, M [Forschungszentrum, Juelich, Postfach 1913, 52425 Juelich (Germany)

    1994-12-15

    This paper presents the highlights and constraints of RT/OS and how it can be used at other places. The support of approximately 1000 VME and VXI CPUs in network-based multiprocessor systems needs a special set of programming tools and application environment which are bundled as the RT/OS Real-Time-Operating-System. Supporting the Motorola 680x0 processors and micro-controller with a development system on UNIX and MS-DOS platforms, the tool set gives the opportunity of bringing small embedded controllers as well as VME multiprocessor systems into operation. The tool set includes a cross compiler and a special version of a remote debugger, as well as application support such as downloading and configuration management. The main feature is a modular kernel with message-based task switching, using the rendezvous principle to allow easy extension. Special features of this kernel for a distributed system are networking with the Berkeley socket library supporting TCP/IP, XNS and Novell Netware, a multiprocessor system on VMEbus with the interprocessor Communication Module (IPC), a device driver library for almost every G64 I/O card using a FieldBus Interface called PDV and a X11R4 port. ((orig.))

  7. Atucha II NPP full scope simulator modelling with the thermal hydraulic code TRAC{sub R}T

    Energy Technology Data Exchange (ETDEWEB)

    Alonso, Pablo Rey; Ruiz, Jose Antonio; Rivero, Norberto, E-mail: prey@tecnatom.e, E-mail: jaruiz@tecnatom.e, E-mail: nrivero@tecnatom.e [Tecnatom S.A., Madrid (Spain)

    2011-07-01

    In February 2010 NA-SA (Nucleoelectrica Argentina S.A.) awarded Tecnatom the Atucha II full scope simulator project. NA-SA is a public company owner of the Argentinean nuclear power plants. Atucha II is due to enter in operation shortly. Atucha II NPP is a PHWR type plant cooled by the water of the Parana River and has the same design as the Atucha I unit, doubling its power capacity. Atucha II will produce 745 MWe utilizing heavy water as coolant and moderator, and natural uranium as fuel. A plant singular feature is the permanent core refueling. TRAC{sub R}T is the first real time thermal hydraulic six-equations code used in the training simulation industry for NSSS modeling. It is the result from adapting to real time the best estimate code TRACG. TRAC{sub R}T is based on first principle conservation equations for mass, energy and momentum for liquid and steam phases, with two phase flows under non homogeneous and non equilibrium conditions. At present, it has been successfully implemented in twelve full scope replica simulators in different training centers throughout the world. To ease the modeling task, TRAC{sub R}T includes a graphical pre-processing tool designed to optimize this process and alleviate the burden of entering alpha numerical data in an input file. (author)

  8. Performance Evaluation of Irbene RT-16 Radio Telescope Receiving System

    Directory of Open Access Journals (Sweden)

    Bleiders M.

    2017-12-01

    Full Text Available In the present paper, recent measurement results of refurbished Irbene RT-16 radio telescope receiving system performance are presented. The aim of the research is to evaluate characteristics of RT-16, which will allow carrying out necessary amplitude calibration in both single dish and VLBI observations, to improve the performance of existing system as well as to monitor, control and compare performance if possible changes in the receiving system will occur in future. The evaluated receiving system is 16 m Cassegrain antenna equipped with a cryogenic receiver with frequency range from 4.5 to 8.8 GHz, which is divided into four sub-bands. Multiple calibration sessions have been carried out by observing stable astronomical sources with known flux density by using in-house made total power registration backend. First, pointing offset calibration has been carried out and pointing model coefficients calculated and applied. Then, amplitude calibration, namely antenna sensitivity, calibration diode equivalent flux density and gain curve measurements have been carried out by observing calibration sources at different antenna elevations at each of the receiver sub-bands. Beam patterns have also been evaluated at different frequency bands. As a whole, acquired data will serve as a reference point for comparison in future performance evaluation of RT-16.

  9. NASA SPoRT JPSS PG Activities in Alaska

    Science.gov (United States)

    Berndt, Emily; Molthan, Andrew; Fuell, Kevin; McGrath, Kevin; Smith, Matt; LaFontaine, Frank; Leroy, Anita; White, Kris

    2018-01-01

    SPoRT (NASA's Short-term Prediction Research and Transition Center) has collaboratively worked with Alaska WFOs (Weather Forecast Offices) to introduce RGB (Red/Green/Blue false color image) imagery to prepare for NOAA-20 (National Oceanic and Atmospheric Administration, JPSS (Joint Polar Satellite System) series-20 satellite) VIIRS (Visible Infrared Imaging Radiometer Suite) and improve forecasting aviation-related hazards. Last R2O/O2R (Research-to-Operations/Operations-to-Research) steps include incorporating NOAA-20 VIIRS in RGB suite and fully transitioning client-side RGB processing to GINA (Geographic Information Network of Alaska) and Alaska Region. Alaska Region WFOs have been part of the successful R2O/O2R story to assess the use of NESDIS (National Environmental Satellite, Data, and Information Service) Snowfall Rate product in operations. SPoRT introduced passive microwave rain rate and IMERG (Integrated Multi-satellitE Retrievals for GPM (Global Precipitation Measurement)) (IMERG) to Alaska WFOs for use in radar-void areas and assessing flooding potential. SPoRT has been part of the multi-organization collaborative effort to introduce Gridded NUCAPS (NOAA Unique CrIS/ATMS (Crosstrack Infrared Sounder/Advanced Technology Microwave Sounder) Processing System) to the Anchorage CWSU (Center Weather Service Unit) to assess Cold Air Aloft events, [and as part of NOAA's PG (Product Generation) effort].

  10. WE-H-207B-04: Strategies for Adaptive RT

    Energy Technology Data Exchange (ETDEWEB)

    Green, O. [Washington University School of Medicine (United States)

    2016-06-15

    In recent years, steady progress has been made towards the implementation of MRI in external beam radiation therapy for processes ranging from treatment simulation to in-room guidance. Novel procedures relying mostly on MR data are currently implemented in the clinic. This session will cover topics such as (a) commissioning and quality control of the MR in-room imagers and simulators specific to RT, (b) treatment planning requirements, constraints and challenges when dealing with various MR data, (c) quantification of organ motion with an emphasis on treatment delivery guidance, and (d) MR-driven strategies for adaptive RT workflows. The content of the session was chosen to address both educational and practical key aspects of MR guidance. Learning Objectives: Good understanding of MR testing recommended for in-room MR imaging as well as image data validation for RT chain (e.g. image transfer, filtering for consistency, spatial accuracy, manipulation for task specific); Familiarity with MR-based planning procedures: motivation, core workflow requirements, current status, challenges; Overview of the current methods for the quantification of organ motion; Discussion on approaches for adaptive treatment planning and delivery. T. Stanescu - License agreement with Modus Medical Devices to develop a phantom for the quantification of MR image system-related distortions.; T. Stanescu, N/A.

  11. WE-H-207B-00: MRgRT

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2016-06-15

    In recent years, steady progress has been made towards the implementation of MRI in external beam radiation therapy for processes ranging from treatment simulation to in-room guidance. Novel procedures relying mostly on MR data are currently implemented in the clinic. This session will cover topics such as (a) commissioning and quality control of the MR in-room imagers and simulators specific to RT, (b) treatment planning requirements, constraints and challenges when dealing with various MR data, (c) quantification of organ motion with an emphasis on treatment delivery guidance, and (d) MR-driven strategies for adaptive RT workflows. The content of the session was chosen to address both educational and practical key aspects of MR guidance. Learning Objectives: Good understanding of MR testing recommended for in-room MR imaging as well as image data validation for RT chain (e.g. image transfer, filtering for consistency, spatial accuracy, manipulation for task specific); Familiarity with MR-based planning procedures: motivation, core workflow requirements, current status, challenges; Overview of the current methods for the quantification of organ motion; Discussion on approaches for adaptive treatment planning and delivery. T. Stanescu - License agreement with Modus Medical Devices to develop a phantom for the quantification of MR image system-related distortions.; T. Stanescu, N/A.

  12. GOKaRT: Graphical Online Search Tool for Maps

    Directory of Open Access Journals (Sweden)

    Mechthild Schüler

    2008-09-01

    Full Text Available The map department of the Staats- und Universitätsbibliothek Göttingen together with the Berlin State Library propose a project to develop a web-based graphic cataloguing and search system for maps, to be funded by the German Research Foundation. This tool shall be made available to all map holdings in archives, libraries, university departments and museums in Germany as a comfortable means for the administration of map holdings and as a search tool. Sheets belonging to map series as well as single maps (old and new will be registered cooperatively by the participants with simple tools. This cooperation in data maintenance will facilitate the work especially for understaffed map holdings. Depending on the type of map there are four different mechanisms for map reference. For map series electronic index sheets are used which will show information regarding the various issues of the map sheets. Due to the intuitive graphic search entry GOKaRT-users will easily find the required maps of a certain region available in a chosen holding. User administration modules ensure comfortable handling. GOKaRT is being developed on the basis of licence-free open source programmes. In case financing is provided by the German Research Foundation, GOKaRT can be used free of charge internationally. This would require a contract stipulating data exchange between the partners as well as permanent storage and usability of the data.

  13. WE-H-207B-00: MRgRT

    International Nuclear Information System (INIS)

    2016-01-01

    In recent years, steady progress has been made towards the implementation of MRI in external beam radiation therapy for processes ranging from treatment simulation to in-room guidance. Novel procedures relying mostly on MR data are currently implemented in the clinic. This session will cover topics such as (a) commissioning and quality control of the MR in-room imagers and simulators specific to RT, (b) treatment planning requirements, constraints and challenges when dealing with various MR data, (c) quantification of organ motion with an emphasis on treatment delivery guidance, and (d) MR-driven strategies for adaptive RT workflows. The content of the session was chosen to address both educational and practical key aspects of MR guidance. Learning Objectives: Good understanding of MR testing recommended for in-room MR imaging as well as image data validation for RT chain (e.g. image transfer, filtering for consistency, spatial accuracy, manipulation for task specific); Familiarity with MR-based planning procedures: motivation, core workflow requirements, current status, challenges; Overview of the current methods for the quantification of organ motion; Discussion on approaches for adaptive treatment planning and delivery. T. Stanescu - License agreement with Modus Medical Devices to develop a phantom for the quantification of MR image system-related distortions.; T. Stanescu, N/A

  14. WE-H-207B-04: Strategies for Adaptive RT

    International Nuclear Information System (INIS)

    Green, O.

    2016-01-01

    In recent years, steady progress has been made towards the implementation of MRI in external beam radiation therapy for processes ranging from treatment simulation to in-room guidance. Novel procedures relying mostly on MR data are currently implemented in the clinic. This session will cover topics such as (a) commissioning and quality control of the MR in-room imagers and simulators specific to RT, (b) treatment planning requirements, constraints and challenges when dealing with various MR data, (c) quantification of organ motion with an emphasis on treatment delivery guidance, and (d) MR-driven strategies for adaptive RT workflows. The content of the session was chosen to address both educational and practical key aspects of MR guidance. Learning Objectives: Good understanding of MR testing recommended for in-room MR imaging as well as image data validation for RT chain (e.g. image transfer, filtering for consistency, spatial accuracy, manipulation for task specific); Familiarity with MR-based planning procedures: motivation, core workflow requirements, current status, challenges; Overview of the current methods for the quantification of organ motion; Discussion on approaches for adaptive treatment planning and delivery. T. Stanescu - License agreement with Modus Medical Devices to develop a phantom for the quantification of MR image system-related distortions.; T. Stanescu, N/A

  15. Cien años de soledad : Una aproximación al estudio del tiempo

    OpenAIRE

    Cortés, Karina Alejandra; Valesini, María Silvina

    2006-01-01

    Este trabajo analiza el tratamiento del tiempo en la novela de Gabriel García Márquez Cien años de soledad. Se considera que, dentro de las múltiples miradas que la obra posibilita, la del tiempo es una de las más pregnantes. En esta obra es recurrente y deriva en conceptos relacionados tales como la memoria, el olvido, la muerte. Facultad de Bellas Artes

  16. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    2009-01-01

    research use and needs qualit control for accuracy and precision. Especially the identification of experimental variations and statistical analysis has recently created discussions. The standard analytical technique is to use the Delta-Delta-Ct method. Although this method accounts for sample specific...... developed based on a linear mixed effects model for factorial designs. The model consists of an analysis of variance where the variation of each fixed effect of interest and identified experimental and biological nuisance variations are split. Hereby it accounts for varying efficiency, inhomogeneous......The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  17. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  18. System of programming units for the K556RT4 and K556RT5 fixed programmed memory devices

    International Nuclear Information System (INIS)

    Bobkov, S.G.; Ermolin, Yu.V.; Kantserov, V.A.; Strigin, V.B.

    1983-01-01

    The programming system of constant programmable memory devices K556RT4 and K556RT5 that consist of two units (a programming device and an electrothermotraining unit) is described. The modules are made in the KAMAK standard. The programming device takes up 2 normal places, while the electrothermotraining block takes up 1 place. As information recording is done using a computer the time for programming is reduced and the possibility of errors is limited as compared with the manual method. The computer introduces the whole word to be recorded, not the separate parts, in the programming device. The transition to a new digit of a given word in the programming device is done automatically. This reduces the expense of computer time and accelerates the programming of microdiagrams

  19. Performance of a RT-PCR Assay in Comparison to FISH and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hout, David R; Schweitzer, Brock L; Lawrence, Kasey; Morris, Stephan W; Tucker, Tracy; Mazzola, Rosetta; Skelton, Rachel; McMahon, Frank; Handshoe, John; Lesperance, Mary; Karsan, Aly; Saltman, David L

    2017-08-01

    Patients with lung cancers harboring an activating anaplastic lymphoma kinase ( ALK ) rearrangement respond favorably to ALK inhibitor therapy. Fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) are validated and widely used screening tests for ALK rearrangements but both methods have limitations. The ALK RGQ RT-PCR Kit (RT-PCR) is a single tube quantitative real-time PCR assay for high throughput and automated interpretation of ALK expression. In this study, we performed a direct comparison of formalin-fixed paraffin-embedded (FFPE) lung cancer specimens using all three ALK detection methods. The RT-PCR test (diagnostic cut-off Δ C t of ≤8) was shown to be highly sensitive (100%) when compared to FISH and IHC. Sequencing of RNA detected full-length ALK transcripts or EML4-ALK and KIF5B-ALK fusion variants in discordant cases in which ALK expression was detected by the ALK RT-PCR test but negative by FISH and IHC. The overall specificity of the RT-PCR test for the detection of ALK in cases without full-length ALK expression was 94% in comparison to FISH and sequencing. These data support the ALK RT-PCR test as a highly efficient and reliable diagnostic screening approach to identify patients with non-small cell lung cancer whose tumors are driven by oncogenic ALK.

  20. Using the SPoRT POES/GOES Hybrid Product in OCONUS Forecasting

    Science.gov (United States)

    Smith, Matt; Fuell, Kevin; Nelson, Jim

    2014-01-01

    The SPoRT (Short-term Prediction and Research Transition) Program at the NASA/Marshall Space Flight Center has been providing unique NASA and NOAA data and techniques to partner Weather Forecast Offices (WFOs) for ten years. Data are provided in the Decision Support System used by WFO forecasters: AWIPS. For the last couple of years, SPoRT has been producing the POES/GOES Hybrid. This suite of products combines the strength ofl5- minute animations of GOES imagery - providing temporal continuity, with the higher resolution, relatively random availability, of polar orbiting (POES) imagery data. The product was first introduced with only MODIS data from NASA's Terra and Aqua satellites, but recently the VIIRS instrument onboard the Suomi-NPP satellite was added, providing better high-resolution coverage. These products represent SPoRT's efforts to prepare for higher resolution, higher frequency GOES-R imagery - as well as helping to move VIIRS (JPSS) data into the mainstream of weather forecasting. SPoRT generates 5 products for this dataset: Visible, Longwave Infrared (11 micrometers), Shortwave IR (3.7 micrometers), Water Vapor (6.7 micrometers), and Fog (Difference of 11 micrometer and 3.7 micrometer channels). The Water Vapor hybrid product has a Red-Blue-Green image from MODIS inlaid, since it provides even more qualitative information than water vapor alone. Animated examples of the products will be shown in this presentation. While the resolution at nadir of GOES imagery is nominally Han (4km for IR channels), the inlaid polar orbiter imagery has a resolution of 250m (lkm for IR channels). This has tremendous application in the continental US. However, in high latitudes, since the usefulness of GOES degrades poleward rapidly, the contrast of GOES and POES data is stark. The consistent temporal nature of GOES, even though at a reduced resolution at high latitudes, provides basic situational awareness, but the introduction of polar data is very helpful in seeing

  1. Standardized comparison of the relative impacts of HIV-1 reverse transcriptase (RT) mutations on nucleoside RT inhibitor susceptibility.

    Science.gov (United States)

    Melikian, George L; Rhee, Soo-Yon; Taylor, Jonathan; Fessel, W Jeffrey; Kaufman, David; Towner, William; Troia-Cancio, Paolo V; Zolopa, Andrew; Robbins, Gregory K; Kagan, Ron; Israelski, Dennis; Shafer, Robert W

    2012-05-01

    Determining the phenotypic impacts of reverse transcriptase (RT) mutations on individual nucleoside RT inhibitors (NRTIs) has remained a statistical challenge because clinical NRTI-resistant HIV-1 isolates usually contain multiple mutations, often in complex patterns, complicating the task of determining the relative contribution of each mutation to HIV drug resistance. Furthermore, the NRTIs have highly variable dynamic susceptibility ranges, making it difficult to determine the relative effect of an RT mutation on susceptibility to different NRTIs. In this study, we analyzed 1,273 genotyped HIV-1 isolates for which phenotypic results were obtained using the PhenoSense assay (Monogram, South San Francisco, CA). We used a parsimonious feature selection algorithm, LASSO, to assess the possible contributions of 177 mutations that occurred in 10 or more isolates in our data set. We then used least-squares regression to quantify the impact of each LASSO-selected mutation on each NRTI. Our study provides a comprehensive view of the most common NRTI resistance mutations. Because our results were standardized, the study provides the first analysis that quantifies the relative phenotypic effects of NRTI resistance mutations on each of the NRTIs. In addition, the study contains new findings on the relative impacts of thymidine analog mutations (TAMs) on susceptibility to abacavir and tenofovir; the impacts of several known but incompletely characterized mutations, including E40F, V75T, Y115F, and K219R; and a tentative role in reduced NRTI susceptibility for K64H, a novel NRTI resistance mutation.

  2. Estimación del tiempo de desarrollo de Lutzomyia evansi bajo condiciones experimentales

    Directory of Open Access Journals (Sweden)

    Claudia Martínez Suárez

    2012-01-01

    Full Text Available Objetivo: Estimar el tiempo promedio de desarrollo de Lutzomyia evansi. Materiales y métodos: Se inició una colonia de Lutzomyia evansi con individuos recolectados en la zona urbana de la ciudad de Sincelejo (Colombia. La colonia fue mantenida en el laboratorio durante tres generaciones filiales bajo condiciones experimentales promedio de 26ºC de temperatura y 94% de humedad relativa. Resultados: La duración del desarrollo de Lutzomyia evansi fue de 36 a 45 días. El tiempo requerido para el desarrollo de los huevos fue en promedio de 6,75 días (rango de 6 a 8 días. La duración en promedio de los diferentes estadios larvales fue 5,75 días en larvas de primer estadio (rango de 5 a 8 días, 5,75 días en larvas de segundo estadio (rango de 4 a 7 días, 5 días en larvas de tercer estadio (rango de 4 a 7 días y 7 días en larvas de cuarto estadio (rango de 6 a 8 días. En la fase de pupa, la duración en promedio fue de 9,75 días (rango de 7 a 17 días. Conclusiones: El tiempo promedio requerido para el desarrollo de Lutzomyia evansi, comprendido desde la alimentación sanguínea de la hembra madre hasta la emergencia del adulto, es de 40 días.

  3. ESTUDIO DE SISTEMAS DE MEDIDA CON ENSAYOS DESTRUCTIVOS. UNA APLICACIÓN SOBRE TIEMPOS DE PRODUCCIÓN

    Directory of Open Access Journals (Sweden)

    Marta Quaglino

    2010-01-01

    Full Text Available Los estudios de repetibilidad y reproducibilidad fueron diseñados con el propósito de analizar la bondad de los sistemas de medición, análisis cuya importancia radica en el hecho que un sistema inadecuado introducirá variabilidad adicional ocasionando que las mediciones no reflejen el verdadero comportamiento del proceso. El análisis se basa en la cuantificación de la variabilidad asociada al sistema de medición y su posterior comparación con la variabilidad total observada, siendo requerimiento fundamental para ello que resulte factible obtener mediciones repetidas de una misma unidad bajo las mismas condiciones experimentales, de lo contrario, la variabilidad en las mediciones estará confundida con la variabilidad propia de las partes medidas. Tal es el caso en que los ensayos de medición son “destructivos”, esto es, las unidades no son robustas frente al proceso de medición, o bien, las unidades no son temporalmente estables.En este trabajo se exponen diversas alternativas para el caso de estudios R&R con ensayos destructivos y una aplicación particular en un problema real sobre estimación de tiempos de producción en una empresa metalúrgica. El empleo de Modelos Lineales Generalizados permitió obtener estimaciones adecuadas de ciertas Componentes de Variancia, que advirtieron sobre características importantes a mejorar en el proceso de medición.

  4. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue

    Directory of Open Access Journals (Sweden)

    Ravid Rivka

    2008-05-01

    Full Text Available Abstract Background Studies of gene expression in post mortem human brain can contribute to understanding of the pathophysiology of neurodegenerative diseases, including Alzheimer's disease (AD, Parkinson's disease (PD and dementia with Lewy bodies (DLB. Quantitative real-time PCR (RT qPCR is often used to analyse gene expression. The validity of results obtained using RT qPCR is reliant on accurate data normalization. Reference genes are generally used to normalize RT qPCR data. Given that expression of some commonly used reference genes is altered in certain conditions, this study aimed to establish which reference genes were stably expressed in post mortem brain tissue from individuals with AD, PD or DLB. Results The present study investigated the expression stability of 8 candidate reference genes, (ubiquitin C [UBC], tyrosine-3-monooxygenase [YWHAZ], RNA polymerase II polypeptide [RP II], hydroxymethylbilane synthase [HMBS], TATA box binding protein [TBP], β-2-microglobulin [B2M], glyceraldehyde-3-phosphate dehydrogenase [GAPDH], and succinate dehydrogenase complex-subunit A, [SDHA] in cerebellum and medial temporal gyrus of 6 AD, 6 PD, 6 DLB subjects, along with 5 matched controls using RT qPCR (TaqMan® Gene Expression Assays. Gene expression stability was analysed using geNorm to rank the candidate genes in order of decreasing stability in each disease group. The optimal number of genes recommended for accurate data normalization in each disease state was determined by pairwise variation analysis. Conclusion This study identified validated sets of mRNAs which would be appropriate for the normalization of RT qPCR data when studying gene expression in brain tissue of AD, PD, DLB and control subjects.

  5. El calendario sagrado: El problema del tiempo en la sociología durkheimiana (I

    Directory of Open Access Journals (Sweden)

    RAMÓN RAMOS TORRE

    1989-01-01

    Full Text Available Al abordar sociológicamente el problema del tiempo, Durkheim no hizo sino intervenir en un debate muy vivo en su época. Ese debate tuvo en H. Bergson uno de sus protagonistas fundamentales. Su crítica "temporalista" de la ciencia moderna fue rechazada por Durkheim, que la minusvaloró como simple patología "mística". Consecuente con ese rechazo, la sociología durkheimiana encontró dificultades para definir sus relaciones con la historia y construir una "sociología dinámica" que diera cuenta del cambio histórico.

  6. Tiempo y espacio en atención primaria de salud

    OpenAIRE

    Uribe Oyarbide, José María

    1994-01-01

    En este artículo se esbozan las líneas de repercusión que la reforma sanitaria provoca en la percepción y significación de las categorías tiempo y espacio. La Atención Primaria de Salud obliga a un aprendizaje tanto para trabajadores sanitarios como para usuarios de los criterios que definen y contextualizan la prestación de los servicios de salud. En ese contexto, los equipos de Atención Primaria introducen variaciones en su interrelación con instituciones como los hospitales y los ambulator...

  7. La obra minera del Rey Sabio y las explotaciones de su tiempo

    OpenAIRE

    Puche Riart, Octavio

    1995-01-01

    Toda la obra de Alfonso x el Sabio está impregnada de datos mineros, desde la Legislación a la Astronomía, desde los libros de Alquimia a los Lapidarios. Esta circunstancia no es de extrañar al ser la minería la industria histórica por excelencia y al ser sus productos, los minerales y los metales, materias primas imprescindibles y pilares básicos del comercio. 'A la influencia de los clásicos greco-latinos (principalmente de Aristóteles) y de la Biblia, conjunción obligada en aquellos tiempo...

  8. Modelo de gestión del tiempo en proyectos viales.

    OpenAIRE

    Luzuriaga Bojorque, Juan Pablo

    2015-01-01

    El presente trabajo demuestra la importancia de utilizar un método internacionalmente reconocido para gestionar la terminación de los proyectos viales a tiempo. Tanto entidad contratante como contratistas podrán utilizar las mejores prácticas en gerenciamiento de proyectos para lograr que la construcción de carreteras sean proyectos exitosos. Las entidades contratantes en el Ecuador, evalúan el cumplimiento del cronograma de un proyecto vial, en base de la consecución de un nivel determinado ...

  9. Demandas-control y salud: El rol mediador del tiempo libre

    OpenAIRE

    Londoño Londoño, María Eugenia; Cifre, Eva; Rosel Remírez, Jesús

    2016-01-01

    Esta investigación explora el papel mediador que tiene la utilización del tiempo libre en la relación existente entre las altas demandas mentales y el escaso control en el trabajo y las respuestas de engagement, burnout y sintomatología percibida. Participantes: 9.090 trabajadores y trabajadoras de 13 empresas colombianas. Metodología: verificación por medio de análisis de ecuaciones estructurales siguiendo los pasos propuestos por Baron y Kenny (2014). Resultados: disponer de tie...

  10. Tiempo y espacio en atención primaria de salud

    Directory of Open Access Journals (Sweden)

    JOSÉ Mª URIBE OYARBIDE

    1994-01-01

    Full Text Available En este artículo se esbozan las líneas de repercusión que la reforma sanitaria provoca en la percepción y significación de las categorías tiempo y espacio. La atención primaria de salud obliga a un aprendizaje tanto para los trabajadores sanitarios como para los usuarios de los criterios que definen y contextualizan la prestación de los servicios de salud. En este contexto, los equipos de atención primaria introducen variaciones en su interrelación con instituciones como los hospitales y los ambulatorios,

  11. Proyecciones de rabia canina en Argentina, Bolivia y Paraguay, usando series de tiempo

    OpenAIRE

    SCORTTI, M.; CATTAN, P.; CANALS, M.

    1997-01-01

    Se estudió el número de casos mensuales de rabia canina en Argentina (1971-1993), Bolivia (1987-1993) y Paraguay (1976-1993), a fin de identificar fluctuaciones regulares y predecir el comportamiento futuro de la rabia en dichos países. Los métodos empleados consistieron en análisis de series de tiempo, incluyendo el análisis armónico de Fourier y los modelos multiplicativos ARIMA-SARIMA de Box-Jenkins. Se evidenciaron ciclos en Argentina y Paraguay. La estacionalidad ocurrió a fines de invie...

  12. Los proyectos de cooperación: una alternativa al tiempo libre de alumnos universitarios

    OpenAIRE

    Beatriz Núñez Angulo; Rafael Calvo de León; Jesús Mª Álvarez Martínez

    2014-01-01

    Es sabido por todos que la Universidad ha de fomentar los Proyectos de Cooperación, como función social. Presentamos la trayectoria de un proyecto de Cooperación al Desarrollo de la Universidad de Burgos que, a lo largo de 10 años se ha ido consolidando y ha permitido la participación directa de 88 personas entre profesores y alumnos, siendo una alternativa al tiempo libre del alumnado, tanto en el verano como durante el curso académico. Los resultados avalan el nivel de implicación de los es...

  13. Efectos de los rangos de movimientos y tiempos de descanso sobre la prueba de 1 RM

    OpenAIRE

    Barrantes Segura, Ariel; Aragón Vargas, Luis Fernando

    2014-01-01

    Este informe de investigación fue publicado como póster en Medicine and Science in Sports and Exercise 46(5):s192, 10.1249/01.mss.0000493922.19651.52, issn:1530-0315, issn:0195-9131 Los resultados de las pruebas de fuerza de 1RM varían para el mismo ejercicio en función del rango de movimiento (RDM) que se utiliza. El reposo insuficiente entre intentos también puede perjudicar el rendimiento en la prueba. OBJETIVO: determinar el efecto del rango de movimiento y el tiempo de recuperación en...

  14. Percepción del clima emocional, problemas sociales y confianza institucional en tiempos de violencia

    OpenAIRE

    Gabriela Rodríguez Hernández; Karla Patricia Cruz Calderón

    2014-01-01

    El objetivo de este estudio es conocer el clima emocional que predomina en habitantes del Estado de México y cómo este se relaciona con la percepción de problemas sociales y la confianza institucional, en un tiempo en que la violencia se ubica como tema prioritario tanto en la agenda como en la percepción pública en México. Esta investigación es descriptiva-correlacional, de diseño transversal. Los resultados revelaron que en la muestra de 552 participantes, habitantes del Estado de México, l...

  15. Contribución al modelado unidimensional en motores de dos tiempos de altas prestaciones

    OpenAIRE

    JIMENEZ MACEDO, VICTOR DANIEL

    2013-01-01

    Un modelo de simulación presenta muchas ventajas en el campo del desarrollo de motores de combustión interna alternativos. Su utilidad es doble. Por un lado, para entender la naturaleza de los fenómenos físicos que suceden en el interior del motor, y por otro, con el fin de optimizar el diseño de los sistemas que integran el mismo. El principal objetivo de esta tesis es desarrollar un modelo de un motor de dos tiempos de 125 cc de altas prestaciones para caracterizar la fluidodinámica interna...

  16. Immunomagnetic separation combined with RT-qPCR for determining the efficacy of disinfectants against human noroviruses

    Directory of Open Access Journals (Sweden)

    Pengbo Liu

    2015-03-01

    Full Text Available Summary: Little is known about the effectiveness of disinfectants against human noroviruses (NoV partially because human NoV cannot be routinely cultured in laboratory. The objective of this study was to develop a NoV monoclonal antibody-conjugated immunomagnetic separation (IMS procedure combined with real-time reverse transcription polymerase chain reaction (RT-qPCR assays to study the in vitro efficacy of disinfectants against human NoV. Monoclonal antibodies against Norwalk virus (NV, GI.1 and NoV GII.4 were produced using unique NoV capsid proteins, and the antibodies were conjugated to magnetic Dynalbeads. The immunomagnetic beads were used to simultaneously capture intact NoV in samples and effectively remove PCR inhibitors. We examined the efficacy of ethanol, sodium hypochlorite, nine commercially available disinfectants, and one prototype disinfectant using the IMS/RT-qPCR. The sensitivity of this procedure was approximately 100 virus particles for both the NV and GII.4 viruses. The average log reductions in in vitro activities varied between disinfectants. The prototype disinfectant produced an average 3.19-log reduction in NV and a 1.38-log reduction in GII.4. The prototype disinfectant is promising of inactivating NoV. This method can be used to evaluate in vitro activity of disinfectants against human NoV. The IMS/RT-qPCR method is promising as an effective method to remove PCR inhibitors in disinfectants and enable the evaluation of the efficacy of disinfectants. Keywords: Disinfectant, Norovirus, Immunomagnetic separation, Real-time RT-PCR, PCR inhibition

  17. Transitioning NPOESS Data to Weather Offices: The SPoRT Paradigm with EOS Data

    Science.gov (United States)

    Jedlovec, Gary

    2009-01-01

    Real-time satellite information provides one of many data sources used by NWS weather forecast offices (WFOs) to diagnose current weather conditions and to assist in short-term forecast preparation. While GOES satellite data provides relatively coarse spatial resolution coverage of the continental U.S. on a 10-15 minute repeat cycle, polar orbiting imagery has the potential to provide snapshots of weather conditions at high-resolution in many spectral channels. Additionally, polar orbiting sounding data can provide additional information on the thermodynamic structure of the atmosphere in data sparse regions of at asynoptic observation times. The NASA Short-term Prediction Research and Transition (SPoRT) project has demonstrated the utility of polar orbiting MODIS and AIRS data on the Terra and Aqua satellites to improve weather diagnostics and short-term forecasting on the regional and local scales. SPoRT scientists work directly forecasters at selected WFOS in the Southern Region (SR) to help them ingest these unique data streams into their AWIPS system, understand how to use the data (through on-site and distance learn techniques), and demonstrate the utility of these products to address significant forecast problems. This process also prepares forecasters for the use of similar observational capabilities from NPOESS operational sensors. NPOESS environmental data records (EDRs) from the Visible 1 Infrared Imager I Radiometer Suite (VIIRS), the Cross-track Infrared Sounder (CrlS) and Advanced Technology Microwave Sounder (ATMS) instruments and additional value-added products produced by NESDIS will be available in near real-time and made available to WFOs to extend their use of NASA EOS data into the NPOESS era. These new data streams will be integrated into the NWs's new AWIPS II decision support tools. The AWIPS I1 system to be unveiled in WFOs in 2009 will be a JAVA-based decision support system which preserves the functionality of the existing systems and

  18. Study of Real-Time Programming for Simulation of Nuclear Reactor Dynamics

    International Nuclear Information System (INIS)

    Aliq; Widi Setiawan; Hendro Tjahjono

    2003-01-01

    Many aspects of real-time system are reviewed including the method, programming techniques, and its possibility to be applied in research reactor. The main point of real-time system is that it must designed to have a characteristics not only fast response but the most important is on-time response. In order to cover this requirements, real-time system need also a simple operating system consist of a kernel and application software. At the level of programming, real-time system require a modular approach, hard and soft time division and interprocess communications. The implementation can include some real-time (RT) operation system such as: RT-Linux, RT-OS9 and RT-Mat lab. Because of fast and on-time response requirements, if this system is going to be applied to research reactor, the transfer function model maybe more appropriate model compared to point kinetics model for the reason of computation time. (author)

  19. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  20. Real Forestry for Real Estate

    Science.gov (United States)

    Gagnon, Jennifer; Fisher, Jason

    2013-01-01

    Virginia is poised to see an unprecedented change in forest land ownership. To provide new landowners with information on sustainable forest management, we developed a two-part program, Real Forestry for Real Estate. First, we assembled New Landowner Packets, which contain a variety of sustainable forest management resources. Second, two…

  1. Applications of LANCE Data at SPoRT

    Science.gov (United States)

    Molthan, Andrew

    2014-01-01

    Short term Prediction Research and Transition (SPoRT) Center: Mission: Apply NASA and NOAA measurement systems and unique Earth science research to improve the accuracy of short term weather prediction at the regional/local scale. Goals: Evaluate and assess the utility of NASA and NOAA Earth science data and products and unique research capabilities to address operational weather forecast problems; Provide an environment which enables the development and testing of new capabilities to improve short term weather forecasts on a regional scale; Help ensure successful transition of new capabilities to operational weather entities for the benefit of society

  2. Expert system based on cases for a diagnosis system in real time; Sistema experto basado en casos para un sistema de diagnostico en tiempo real

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa R, Alfredo; Quintero R, Agustin; Zambrano D, S Venecia [Instituto de Investigaciones Electricas, Cuernavaca, Morelos (Mexico)

    2006-07-01

    This article presents the development of an Expert System based in the Reasoning Based on Cases methodology. Such system was performed with the purpose of creating an information system in charge of supervising and diagnosing the status of the main equipment of fossil fuel power plants for electricity generation. Here is presented the reasons why this methodology was used for the expert system and why Induce-It -the specialized tool that implements it- was also chosen, as well as the analysis made for the disposition of the operative architecture of the Expert System, the very development of this software architecture and, finally, the validation of the correct operation of this system by means of a simulator that simultaneously puts to the test the error handling of the Expert System. [Spanish] Este articulo presenta el procedimiento que siguio el desarrollo de un Sistema Experto asentado en la metodologia de Razonamiento Basado en Casos; realizado con el fin de crear un sistema de informacion encargado de supervisar y diagnosticar el estado de los equipos principales de centrales de generacion termoelectrica. Se expone justificadamente la seleccion de la metodologia del sistema experto y de la herramienta especializada que lo implementa (Induce-It), asi como el analisis realizado para la disposicion de la arquitectura operativa del Sistema Experto, el desarrollo mismo de esta arquitectura del software y, finalmente, la validacion del correcto funcionamiento de este sistema mediante un simulador que a la vez pone a prueba el manejo de errores del Sistema Experto.

  3. Gestión del tiempo en alumnado universitario con diferentes niveles de rendimiento académico

    Directory of Open Access Journals (Sweden)

    Angélica Garzón Umerenkova

    2017-09-01

    Full Text Available Resumen En este trabajo se estudia la relación entre gestión del tiempo y rendimiento académico en el alumnado universitario. La hipótesis de partida es que los estudiantes con alto nivel de habilidades en gestión del tiempo obtienen mejores resultados de aprendizaje. Se ha utilizado una muestra de 494 estudiantes universitarios de primer año, en dos universidades colombianas. A esta muestra se administró una adaptación al español del Time Management Behavior Questionnaire (TMBQ, y se recogieron datos sobre las calificaciones académicas en su primer año en la universidad. De manera complementaria, se han celebrado cuatro grupos focales con alumnado de bajo y alto nivel de rendimiento, accediendo a sus experiencias, opiniones y valoraciones en relación con la gestión del tiempo. Los resultados obtenidos indican la existencia de una cierta relación positiva entre las dos variables analizadas, en línea con los hallazgos de estudios previos. Al comparar la gestión del tiempo entre subgrupos de estudiantes que alcanzan las mejores y peores calificaciones, se observan diferencias a favor de los primeros, particularmente en la sub-escala relativa a sus percepciones sobre el control del tiempo. Los discursos de grupo reflejan también mejores conductas autorregulatorias en el manejo del tiempo por parte del alumnado de alto nivel de rendimiento. De acuerdo con estos resultados, se hacen recomendaciones sobre el entrenamiento del alumnado universitario de primer año en estrategias para la gestión del tiempo.

  4. Recent Upgrades to NASA SPoRT Initialization Datasets for the Environmental Modeling System

    Science.gov (United States)

    Case, Jonathan L.; LaFontaine, Frank J.; Molthan, Andrew L.; Zavodsky, Bradley T.; Rozumalski, Robert A.

    2012-01-01

    The NASA Short-term Prediction Research and Transition (SPoRT) Center has developed several products for its National Weather Service (NWS) partners that can initialize specific fields for local model runs within the NOAA/NWS Science and Training Resource Center (STRC) Environmental Modeling System (EMS). In last year's NWA abstract on this topic, the suite of SPoRT products supported in the STRC EMS was presented, which includes a Sea Surface Temperature (SST) composite, a Great Lakes sea-ice extent, a Green Vegetation Fraction (GVF) composite, and NASA Land Information System (LIS) gridded output. This abstract and companion presentation describes recent upgrades made to the SST and GVF composites, as well as the real-time LIS runs. The Great Lakes sea-ice product is unchanged from 2011. The SPoRT SST composite product has been expanded geographically and as a result, the resolution has been coarsened from 1 km to 2 km to accommodate the larger domain. The expanded domain covers much of the northern hemisphere from eastern Asia to western Europe (0 N to 80 N latitude and 150 E to 10 E longitude). In addition, the NESDIS POES-GOES product was added to fill in gaps caused by the Moderate Resolution Imaging Spectroradiometer (MODIS) being unable to sense in cloudy regions, replacing the recently-lost Advanced Microwave Scanning Radiometer for EOS with negligible change to product fidelity. The SST product now runs twice per day for Terra and Aqua combined data collections from 0000 to 1200 UTC and from 1200 to 0000 UTC, with valid analysis times at 0600 and 1800 UTC. The twice-daily compositing technique reduces the overall latency of the previous version while still representing the diurnal cycle characteristics. The SST composites are available at approximately four hours after the end of each collection period (i.e. 1600 UTC for the nighttime analysis and 0400 UTC for the daytime analysis). The real-time MODIS GVF composite has only received minor updates in the

  5. De jóvenes a estudiantes. La forja del tiempo y el orden escolares

    Directory of Open Access Journals (Sweden)

    Antonio Padilla Arroyo

    2012-02-01

    Full Text Available Una de las dimensiones culturales más significativas de las formas del tiempo social lo constituye el tiempo escolar, el cual se convierte en un instrumento primordial en los “procesos civilizatorios” en la medida en que regula las actividades que el niño y el joven necesitan realizar en un espacio como la institución educativa. Esto im plica la organización de los hábitos del trabajo escolar mediante una disciplina que incorpora incentivos, estímulos, saberes, sentimientos, conductas, habilidades, valores e ideas, todo ello en un marco de regulaciones y controles específicos, cuyo objetivo es la configuración de una naturaleza humana. Abstract One of the more significant cultural dimensions of the social time pertains to school time, which converts into a primordial instrument in the “process that civilize” and at the same time it regulates the activities that the child and the young need to carry through in a space as the educative instruction. This implies that the organization habits of the school work by means of one of the disciplines that incorporate incentives, stimulus, knowledge, feelings, behaviors, abilities, values and ideas , all that in landmarks of regulations and specific controls whose objective is the configuration of a human being. Keywords Social Time; School Time; School Culture

  6. Ideología y matemáticas: Equilibrio y tiempo

    Directory of Open Access Journals (Sweden)

    Llorente Marrón, Mª del Mar

    2001-01-01

    Full Text Available En esta comunicación se recogen distintas definiciones del concepto de equilibrio económico, y las opiniones de distintos autores partidarios de que el concepto de equilibrio se defina en un contexto dinámico. De otro modo no tendría sentido caracterizar el equilibrio como un estado de reposo, ya que todo cambio, movimiento o fluctuación ocurre en el tiempo. Posteriormente, se estudian distintas propuestas para formular modelos económicos dinámicos. Se defiende la necesidad de un análisis en profundidad, para el cual la Matemática proporciona un instrumento imprescindible: las funciones compuestas. En este análisis el elemento tiempo debe aparecer, de forma explícita, como única variable exógena, esto es, como soporte y causa última de cualquier cambio o evolución. Este planteamiento implica la revisión de hipótesis y supuestos generalmente admitidos en el Análisis Económico estático. Respecto a la docencia de las Matemáticas, será preciso introducir en nuestro programas aspectos que permitan estudiar unas Matemáticas para el Desequilibrio Económico.

  7. TIEMPO E HISTORIA EN LA FENOMENOLOGÍA DEL ESPÍRITU DE HEGEL

    Directory of Open Access Journals (Sweden)

    LUIS MARIANO DE LA MAZA

    2007-01-01

    Full Text Available Resumen: En este artículo se presenta una interpretación de las tesis fundamentales de Hegel en la Fenomenología del Espíritu acerca de la relación entre tiempo, historia y filosofía especulativa o ciencia. Para Hegel la formación de la conciencia individual hacia la ciencia se conecta con la historia universal, y el concepto de la historia es inseparable del concepto del espíritu. Se distinguen los distintos sentidos del tiempo en la Fenomenología, para centrar la atención principalmente en uno de ellos, que corresponde a la organización fenomenológico-conceptual de la historia. Finalmente, se ofrece una reflexión sobre la cuestión más general de la relación entre filosofía y temporalidad desde una perspectiva actual.

  8. The Spanish word tiempo: its omnipresence and conceptual, logical and lexical versatility

    Directory of Open Access Journals (Sweden)

    Karlo Budor

    2012-12-01

    Full Text Available The common Spanish word tiempo corresponds to three English terms, each of them being a lexical equivalent based on a specific notion: (1 time – physical, astronomical, philosophical reference; (2 weather – geographical, climatological, meteorological reference; (3 tense: linguistic, lexical, grammatical reference. As far as universal and metalinguistic referential distinctions are concerned, all natural languages in fact present a considerable degree of variation ranging from inexistent or very vague to complete differentiation of these terms. In order to express these three types of specific references, some languages have a single word of general usage covering all its lexical acceptations. Therefore in such languages, Spanish included, different references can be distinguished only in part lexically. However, asemantic analysis of the Spanish word tiempo reveals its complexity as well as its conceptual, logical and lexical versatility. This is reflected in its capacity to combine in numerous lexical units, i.e. word compounds and/or phrases, endowed with different or specific semantic meanings. The repertory of these virtual and derived lexical forms appears to be practically unlimited, although their sphere of application and their boundaries are neither always very clear nor precise, which can be illustrated with the examples given in Spanish dictionaries.

  9. Control repetitivo digital de sistemas con frecuencia incierta o variante en el tiempo

    Directory of Open Access Journals (Sweden)

    Ramon Costa-Castelló

    2012-07-01

    Full Text Available Resumen: El control repetitivo digital es una técnica basada en el principio del modelo interno que permite seguir y/o rechazar señales periódicas. Una hipótesis clave en los diseños tradicionales de control repetitivo es que la frecuencia de tales señales es constante y conocida, siendo su principal desventaja la elevada degradación de prestaciones que aparece cuando dicha frecuencia es incierta o varía con el tiempo. En este trabajo se presenta una revisión de las principales estrategias introducidas hasta la fecha para resolver este problema. Abstract: Digital repetitive control is an internal model principle-based control technique that aims at tracking/rejecting periodic signals. A key assumption in traditional repetitive control designs is that the frequency of such signals is constant and known, its main drawback being the dramatic loss of performance that occurs when this frequency is uncertain or time-varying. This article reviews the most relevant proposals introduced so far to overcome this problem. Palabras clave: Control repetitivo, Sistemas de control lineal, Sistemas de tiempo discreto, Regulación de salida, Keywords: Learning control, Linear control systems, Discretetime systems, Output regulation

  10. EL SECUESTRO DE LAS HISTORIAS INDÍGENAS: ITENERARIO Y LIMITACIONES DEL TIEMPO LINEAL EN CHILE

    Directory of Open Access Journals (Sweden)

    MAXIMILIANO SALINAS CAMPOS

    2015-01-01

    Full Text Available La historia de Chile está cruzada por el conflicto entre la cultura moderna europea y las culturas indígenas. El tiempo lineal impuesto por el Estado nacional ha dejado al descubierto su irresponsabilidad con el tiempo indígena de los Andes. Esta temporalidad expresa una profunda y sustentable «ontología arcaica». Tras el fin de la Guerra Fría, y la postdictadura de Pinochet, esta propuesta se vuelve acuciante con las demandas políticas y los desafíos epistémicos indígenas del siglo XXI. En el «círculo de la vida» estos pueblos reclaman presencia, pasado y futuro: su historia. Este trabajo es resultado del proyecto de investigación de la Universidad de Santiago de Chile sobre la historia y la cultura de los pueblos indígenas en Chile en los siglos XX y XXI (Fondecyt 1121083, 2012-2014.

  11. Tiempo de excreción de Vibrio cholerae O1 en pacientes con tratamiento

    Directory of Open Access Journals (Sweden)

    Elizabeth Castañeda

    1992-12-01

    Full Text Available El tiempo de excreción del Vibrio cholerae O1 en pacientes con cólera está influenciado por el tratamiento antimicrobiano. Se determinó en un grupo de pacientes con diagnóstico bacteriológico de cólera, que empezaron a recibir tratamiento con antibióticos una vez establecido el diagnóstico clínico, el tiempo de excreción del V. cholerae O1 empleando muestras de materia fecal obtenidas dentro de los cinco días siguientes al diagnóstico clínico inicial. En las 32 muestras obtenidas en ese período de cinco días el porcentaje de negativos fue del 81,2% (26/ 32; en 21 muestras obtenidas 24 horas después de haberse establecido el diagnóstico, se observó negativización en el 81% (17/21. Con nuestros datos podemos confirmar, al compararlos con los datos de la literatura en pacientes no tratados, que el tratamiento acorta el periodo de excreción del V. cholerae O1.

  12. PRONÓSTICO DE LA DEMANDA MENSUAL DE ELECTRICIDAD CON SERIES DE TIEMPO

    Directory of Open Access Journals (Sweden)

    Víctor Daniel Gil Vera

    Full Text Available La alta volatilidad de los precios de la electricidad ha motivado a diseñar a investigadores y académicos modelos que permitan pronosticar la demanda de la misma en el corto, mediano y largo plazo. Este trabajo presenta un modelo de pronóstico de la demanda mensual de electricidad basado en series de tiempo, el cual toma como base los valores de la demanda de energía eléctrica en el Sistema Interconectado Nacional (SIN de Colombia en el período 2008-2014. Se concluye que las series de tiempo aplicadas al pronóstico de la demanda de electricidad permiten predecir con un alto grado de exactitud demandas futuras de energía eléctrica (GWh, información que puede generar ventajas a productores, distribuidores y grandes consumidores a la hora de establecer estrategias, optimizar su operación y realizar contratos bilaterales.

  13. Real analysis

    CERN Document Server

    McShane, Edward James

    2013-01-01

    This text surveys practical elements of real function theory, general topology, and functional analysis. Discusses the maximality principle, the notion of convergence, the Lebesgue-Stieltjes integral, function spaces and harmonic analysis. Includes exercises. 1959 edition.

  14. Used mixed oxide fuel reprocessing at RT-1 plant

    Energy Technology Data Exchange (ETDEWEB)

    Kolupaev, D.; Logunov, M.; Mashkin, A.; Bugrov, K.; Korchenkin, K. [FSUE PA ' Mayak' , 30, Lenins str, Ozersk, 460065 (Russian Federation); Shadrin, A.; Dvoeglazov, K. [ITCP ' PRORYV' , 2/8 Malaya Krasmoselskay str, Moscow, 107140 (Russian Federation)

    2016-07-01

    Reprocessing of the mixed uranium-plutonium spent nuclear fuel of the BN-600 reactor was performed at the RT-1 plant twice, in 2012 and 2014. In total, 8 fuel assemblies with a burn-up from 73 to 89 GW day/t and the cooling time from 17 to 21 years were reprocessed. The reprocessing included the stages of dissolution, clarification, extraction separation of U and Pu with purification from the fission products, refining of uranium and plutonium at the relevant refining cycles. Dissolution of the fuel composition of MOX used nuclear fuel (UNF) in nitric acid solutions in the presence of fluoride ion has occurred with the full transfer of actinides into solution. Due to the high content of Pu extraction separation of U and Pu was carried out on a nuclear-safe equipment designed for the reprocessing of highly enriched U spent nuclear fuel and Pu refining. Technological processes of extraction, separation and refining of actinides proceeded without deviations from the normal mode. The output flow of the extraction outlets in their compositions corresponded to the regulatory norms and remained at the level of the compositions of the streams resulting from the reprocessing of fuel types typical for the RT-1 plant. No increased losses of Pu into waste have been registered during the reprocessing of BN-600 MOX UNF an compare with VVER-440 uranium UNF reprocessing. (authors)

  15. Request for regular monitoring of the symbiotic variable RT Cru

    Science.gov (United States)

    Waagen, Elizabeth O.

    2014-08-01

    Dr. Margarita Karovska (Harvard-Smithsonian Center for Astrophysics) and colleagues have requested AAVSO observer assistance in their campaign on the symbiotic variable RT Cru (member of a new class of hard X-ray emitting symbiotic binaries). Weekly or more frequent monitoring (B, V, and visual) beginning now is requested in support of upcoming Chandra observations still to be scheduled. "We plan Chandra observations of RT Cru in the near future that will help us understand the characteristics of the accretion onto the white dwarf in this sub-class of symbiotics. This is an important step for determining the precursor conditions for formation of a fraction of asymmetric Planetary Nebulae, and the potential of symbiotic systems as progenitors of at least a fraction of Type Ia supernovae." Finder charts with sequence may be created using the AAVSO Variable Star Plotter (http://www.aavso.org/vsp). Observations should be submitted to the AAVSO International Database. See full Alert Notice for more details and observations.

  16. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Full Text Available AbstrakLatar belakang: Virus polio indigenous terakhir ditemukan di Indonesia tahun 1995 tetapi ancaman viruspolio impor dan mutasi virus dari Oral Polio Vaccine (OPV menjadi Vaccine Derived Poliovirus (VDPVmasih berlanjut. Tahun 1991 WHO mengembangkan Surveilans Acute Flaccid Paralysis (AFP dan tahun2014, identifikasi virus polio dengan real-time reverse transcriptase Polymerase Chain Reaction (rRTPCRmulai digunakan di Laboratorium Nasional Polio Pusat Biomedis dan Teknologi Dasar Kesehatan.Tujuan dari penggunaan rRT-PCR untuk mendapatkan metode yang cepat dan lebih baik dalam memantausirkulasi dan mutasi virus polio.Metode: Isolat polio positif diidentifikasi menggunakanan rRT PCR dengan kombinasi primer dan probeyang ditetapkan WHO. RNA virus di konversi ke cDNA menggunakan reverse transcriptase lalu diamplifikasimenggunakan taq polymerase. Produk PCR di deteksi dan diidentifikasi dengan hibridisasi menggunakanprobe spesifik. Sintesis cDNA dan reaksi PCR menggunakan primer yang dilekatkan di probe. Kombinasiprimer dan probe menghasilkan identifikasi serotipe dan intratypic differentiation (ITD dari isolat virus.Hasil: Selama tahun 2014, NPL Jakarta menerima 604 kasus AFP dari surveilans dan lima kasusterdeteksi positif mengandung virus polio. Semua spesimen positif mengandung virus polio yang berasaldari vaksin. Dua kasus positif virus polio tipe P2 (40%, satu kasus jenis virus polio P1 (20%, 1 kasusjenis virus polio P3 (20% dan satu kasus virus polio campuran jenis P1 + P2 (20%.Kesimpulan: Real-time PCR dapat digunakan di Laboratorium Polio Jakarta untuk membantu identifikasivirus Polio secara cepat. Tes ini dapat digunakan untuk memantau sirkulasi virus polio pada populasiyang rutin diimunisasi dengan OPV. (Health Science Journal of Indonesia 2016;7:27-31Kata kunci: ITD, Poliovirus, Identification, rRT-PCR AbstractBackground: The last indigenous polio was detected in 1995 but the threat of wild type polio viruses and themutation of Oral

  17. Arvo Pärt: Kui kannatab üks inimene, siis kannatab kogu maailm! / Arvo Pärt, Nora Pärt ; intervjueerinud Yana Toom, Maarja-Liis Arujärv, Aleksandr Zukerman ; kommenteerinud Edgar Savisaar

    Index Scriptorium Estoniae

    Pärt, Arvo, 1935-

    2010-01-01

    Arvo Pärt ja tema abikaasa Nora Pärt andsid Türgis enne Pärdi uudisteose "Aadama itk" esiettekannet intervjuu, kus rääkisid nii nende raskustest Läände elama asumisel kui uudisteose sügavamast mõttest

  18. Experimentation of RT-LOTOS for a critical function of a power plant instrumentation and control system; Experimentation de RT-LOTOS pour une fonction critique d`un systeme de controle-commande en centrale

    Energy Technology Data Exchange (ETDEWEB)

    Andriantsiiferana, L.; Courtiat, J.P.; De Oliveira, R.C.

    1996-01-01

    This document is the final report of the contract between LAAS-CNRS and the EdF Direction of Researches and Studies about the experimentation of RT-LOTOS formal description technique on a critical function of a nuclear power plant instrumentation and control system. This report comprises 4 parts: part 1 describes the RT-LOTOS (Real Time-Language of Temporal Ordering Specifications) tutorial and its RTL tool environment, the different RT-LOTOS operators and semantics, and the RTL tool main functionalities; part 2 deals with the methodology and the global architecture for the specification and validation of the CCT (Central Calculator for Treatment); part 3 gives more details about the different processes identified in the specification architecture and presents the main results obtained for the validation of the nominal functioning; part 4 describes some exceptional situations and shows how some failures and their associated recovery mechanisms can be modelled. (J.S.). 6 refs., 53 figs., 5 tabs., 2 appends.

  19. Insights into the Mechanism of Severe Mitral Regurgitation: RT-3D TEE Guided Management with Pathological Correlation.

    Science.gov (United States)

    Anand, Senthil; Hamoud, Naktal; Thompson, Jess; Janardhanan, Rajesh

    2015-01-01

    Mitral valve perforation is an uncommon but important complication of infective endocarditis. We report a case of a 65-year-old man who was diagnosed to have infective endocarditis of his mitral valve. Through the course of his admission he had a rapid development of hemodynamic instability and pulmonary edema secondary to acutely worsening mitral regurgitation. While the TEE demonstrated an increase in the size of his bacterial vegetation, Real Time 3D TEE was ultimately the imaging modality through which the valve perforation was identified. Through this case report we discuss the advantages that RT-3D TEE has over traditional 2D TEE in the management of valve perforation.

  20. On the design of a real-time volume rendering engine

    NARCIS (Netherlands)

    Smit, Jaap; Wessels, H.L.F.; van der Horst, A.; Bentum, Marinus Jan

    1992-01-01

    An architecture for a Real-Time Volume Rendering Engine (RT-VRE) is given, capable of computing 750 × 750 × 512 samples from a 3D dataset at a rate of 25 images per second. The RT-VRE uses for this purpose 64 dedicated rendering chips, cooperating with 16 RISC-processors. A plane interpolator