Sample records for thermus thermophilus 16s
-
Crystallization of ribosomes from Thermus thermophilus
International Nuclear Information System (INIS)
Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.
1987-01-01
An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter
-
International Nuclear Information System (INIS)
Nakamura, Tsutomu; Kashima, Yasuhiro; Mine, Shouhei; Oku, Takashi; Uegaki, Koichi
2011-01-01
In this study, a putative glucokinase/hexokinase from T. thermophilus was purified and crystallized. Diffraction data were collected and processed to 2.02 Å resolution. Glucokinase/hexokinase catalyzes the phosphorylation of glucose to glucose 6-phosphate, which is the first step of glycolysis. The open reading frame TTHA0299 of the extreme thermophile Thermus thermophilus encodes a putative glucokinase/hexokinase which contains the consensus sequence for proteins from the repressors, open reading frames and sugar kinases family. In this study, the glucokinase/hexokinase from T. thermophilus was purified and crystallized using polyethylene glycol 8000 as a precipitant. Diffraction data were collected and processed to 2.02 Å resolution. The crystal belonged to space group P2 1 , with unit-cell parameters a = 70.93, b = 138.14, c = 75.16 Å, β = 95.41°
-
Cloning, purification and crystallization of Thermus thermophilus proline dehydrogenase
International Nuclear Information System (INIS)
White, Tommi A.; Tanner, John J.
2005-01-01
Cloning, purification and crystallization of T. thermophilus proline dehydrogenase is reported. The detergent n-octyl β-d-glucopyranoside was used to reduce polydispersity, which enabled crystallization. Nature recycles l-proline by converting it to l-glutamate. This four-electron oxidation process is catalyzed by the two enzymes: proline dehydrogenase (PRODH) and Δ 1 -pyrroline-5-carboxylate dehydrogenase. This note reports the cloning, purification and crystallization of Thermus thermophilus PRODH, which is the prototype of a newly discovered superfamily of bacterial monofunctional PRODHs. The results presented here include production of a monodisperse protein solution through use of the detergent n-octyl β-d-glucopyranoside and the growth of native crystals that diffracted to 2.3 Å resolution at Advanced Light Source beamline 4.2.2. The space group is P2 1 2 1 2 1 , with unit-cell parameters a = 82.2, b = 89.6, c = 94.3 Å. The asymmetric unit is predicted to contain two protein molecules and 46% solvent. Molecular-replacement trials using a fragment of the PRODH domain of the multifunctional Escherichia coli PutA protein as the search model (24% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of T. thermophilus PRODH will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative
-
Directory of Open Access Journals (Sweden)
Daly Michael J
2005-10-01
Full Text Available Abstract Background Thermus thermophilus and Deinococcus radiodurans belong to a distinct bacterial clade but have remarkably different phenotypes. T. thermophilus is a thermophile, which is relatively sensitive to ionizing radiation and desiccation, whereas D. radiodurans is a mesophile, which is highly radiation- and desiccation-resistant. Here we present an in-depth comparison of the genomes of these two related but differently adapted bacteria. Results By reconstructing the evolution of Thermus and Deinococcus after the divergence from their common ancestor, we demonstrate a high level of post-divergence gene flux in both lineages. Various aspects of the adaptation to high temperature in Thermus can be attributed to horizontal gene transfer from archaea and thermophilic bacteria; many of the horizontally transferred genes are located on the single megaplasmid of Thermus. In addition, the Thermus lineage has lost a set of genes that are still present in Deinococcus and many other mesophilic bacteria but are not common among thermophiles. By contrast, Deinococcus seems to have acquired numerous genes related to stress response systems from various bacteria. A comparison of the distribution of orthologous genes among the four partitions of the Deinococcus genome and the two partitions of the Thermus genome reveals homology between the Thermus megaplasmid (pTT27 and Deinococcus megaplasmid (DR177. Conclusion After the radiation from their common ancestor, the Thermus and Deinococcus lineages have taken divergent paths toward their distinct lifestyles. In addition to extensive gene loss, Thermus seems to have acquired numerous genes from thermophiles, which likely was the decisive contribution to its thermophilic adaptation. By contrast, Deinococcus lost few genes but seems to have acquired many bacterial genes that apparently enhanced its ability to survive different kinds of environmental stresses. Notwithstanding the accumulation of
-
Directory of Open Access Journals (Sweden)
Saurav Mallik
Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.
-
Cloning, purification and crystallization of Thermus thermophilus proline dehydrogenase
Energy Technology Data Exchange (ETDEWEB)
White, Tommi A.; Tanner, John J., E-mail: tannerjj@missouri.edu [Departments of Chemistry and Biochemistry, University of Missouri-Columbia, Columbia, Missouri 65211 (United States)
2005-08-01
Cloning, purification and crystallization of T. thermophilus proline dehydrogenase is reported. The detergent n-octyl β-d-glucopyranoside was used to reduce polydispersity, which enabled crystallization. Nature recycles l-proline by converting it to l-glutamate. This four-electron oxidation process is catalyzed by the two enzymes: proline dehydrogenase (PRODH) and Δ{sup 1}-pyrroline-5-carboxylate dehydrogenase. This note reports the cloning, purification and crystallization of Thermus thermophilus PRODH, which is the prototype of a newly discovered superfamily of bacterial monofunctional PRODHs. The results presented here include production of a monodisperse protein solution through use of the detergent n-octyl β-d-glucopyranoside and the growth of native crystals that diffracted to 2.3 Å resolution at Advanced Light Source beamline 4.2.2. The space group is P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 82.2, b = 89.6, c = 94.3 Å. The asymmetric unit is predicted to contain two protein molecules and 46% solvent. Molecular-replacement trials using a fragment of the PRODH domain of the multifunctional Escherichia coli PutA protein as the search model (24% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of T. thermophilus PRODH will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative.
-
Pennacchio, Angela; Giordano, Assunta; Esposito, Luciana; Langella, Emma; Rossi, Mosè; Raia, Carlo A
2010-04-01
The stereochemistry of the hydride transfer in reactions catalyzed by NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus HB27 was determined by means of (1)H-NMR spectroscopy. The enzyme transfers the pro-S hydrogen of [4R-(2)H]NADH and exhibits Prelog specificity. Enzyme-substrate docking calculations provided structural details about the enantioselectivity of this thermophilic enzyme. These results give additional insights into the diverse active site architectures of the largely versatile short-chain dehydrogenase superfamily enzymes. A feasible protocol for the synthesis of [4R-(2)H]NADH with high yield was also set up by enzymatic oxidation of 2-propanol-d(8) catalyzed by Bacillus stearothermophilus alcohol dehydrogenase.
-
Directory of Open Access Journals (Sweden)
Sayaka Igari
Full Text Available Methylenetetrahydrofolate reductase (MTHFR is one of the enzymes involved in homocysteine metabolism. Despite considerable genetic and clinical attention, the reaction mechanism and regulation of this enzyme are not fully understood because of difficult production and poor stability. While recombinant enzymes from thermophilic organisms are often stable and easy to prepare, properties of thermostable MTHFRs have not yet been reported.MTHFR from Thermus thermophilus HB8, a homologue of Escherichia coli MetF, has been expressed in E. coli and purified. The purified MTHFR was chiefly obtained as a heterodimer of apo- and holo-subunits, that is, one flavin adenine dinucleotide (FAD prosthetic group bound per dimer. The crystal structure of the holo-subunit was quite similar to the β(8α(8 barrel of E. coli MTHFR, while that of the apo-subunit was a previously unobserved closed form. In addition, the intersubunit interface of the dimer in the crystals was different from any of the subunit interfaces of the tetramer of E. coli MTHFR. Free FAD could be incorporated into the apo-subunit of the purified Thermus enzyme after purification, forming a homodimer of holo-subunits. Comparison of the crystal structures of the heterodimer and the homodimer revealed different intersubunit interfaces, indicating a large conformational change upon FAD binding. Most of the biochemical properties of the heterodimer and the homodimer were the same, except that the homodimer showed ≈50% activity per FAD-bound subunit in folate-dependent reactions.The different intersubunit interfaces and rearrangement of subunits of Thermus MTHFR may be related to human enzyme properties, such as the allosteric regulation by S-adenosylmethionine and the enhanced instability of the Ala222Val mutant upon loss of FAD. Whereas E. coli MTHFR was the only structural model for human MTHFR to date, our findings suggest that Thermus MTHFR will be another useful model for this important enzyme.
-
Synthesis of rare sugars with L-fuculose-1-phosphate aldolase (FucA) from Thermus thermophilus HB8.
Li, Zijie; Cai, Li; Qi, Qingsheng; Styslinger, Thomas J; Zhao, Guohui; Wang, Peng George
2011-09-01
We report herein a one-pot four-enzyme approach for the synthesis of the rare sugars d-psicose, d-sorbose, l-tagatose, and l-fructose with aldolase FucA from a thermophilic source (Thermus thermophilus HB8). Importantly, the cheap starting material DL-GP (DL-glycerol 3-phosphate), was used to significantly reduce the synthetic cost. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
Thermus arciformis sp. nov., a thermophilic species from a geothermal area.
Zhang, Xin-Qi; Ying, Yi; Ye, Ying; Xu, Xue-Wei; Zhu, Xu-Fen; Wu, Min
2010-04-01
Two aerobic, Gram-negative, non-motile, non-sporulating, yellow-pigmented bacteria, strains TH92(T) and TH91, were isolated from a hot spring located in Laibin, Guangxi, in the south-eastern geothermal area of China. The isolates grew at 40-77 degrees C (optimally at 70 degrees C) and at pH 6.0-9.5 (optimally at pH 7.5-8.0). Phylogenetic analysis of 16S rRNA gene sequences and levels of DNA-DNA relatedness together indicated that the new isolates represented a novel species of the genus Thermus with closest affinity to Thermus aquaticus, Thermus igniterrae and Thermus thermophilus. Compared with their closest relatives, strains TH92( T) and TH91 were able to assimilate a wider range of carbohydrates, amino acids and organic acids as sole carbon sources for growth, such as lactose and melibiose. The new isolates had lower combined levels of C(16 : 0 ) and iso-C(16 : 0) compared with their closest relatives. On the basis of polyphasic taxonomic characterization, strains TH92(T) and TH91 are considered to represent a single novel species of the genus Thermus, for which the name Thermus arciformis sp. nov. is proposed. The type strain is TH92(T) (=CGMCC 1.6992(T) =JCM 15153(T)).
-
International Nuclear Information System (INIS)
Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Baba, Seiki; Chen, Lirong; Liu, Zhi-Jie; Wang, Bi-Cheng; Nishida, Masami; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki
2006-01-01
The molybdenum-cofactor biosynthesis protein C from T. thermophilus has been crystallized in two different space groups, P2 1 and R32; the crystals diffracted to 1.9 and 1.75 Å resolution, respectively. The Gram-negative aerobic eubacterium Thermus thermophilus is an extremely important thermophilic microorganism that was originally isolated from a thermal vent environment in Japan. The molybdenum cofactor in this organism is considered to be an essential component required by enzymes that catalyze diverse key reactions in the global metabolism of carbon, nitrogen and sulfur. The molybdenum-cofactor biosynthesis protein C derived from T. thermophilus was crystallized in two different space groups. Crystals obtained using the first crystallization condition belong to the monoclinic space group P2 1 , with unit-cell parameters a = 64.81, b = 109.84, c = 115.19 Å, β = 104.9°; the crystal diffracted to a resolution of 1.9 Å. The other crystal form belonged to space group R32, with unit-cell parameters a = b = 106.57, c = 59.25 Å, and diffracted to 1.75 Å resolution. Preliminary calculations reveal that the asymmetric unit contains 12 monomers and one monomer for the crystals belonging to space group P2 1 and R32, respectively
-
Structure of TTHA1623, a novel metallo-β-lactamase superfamily protein from Thermus thermophilus HB8
International Nuclear Information System (INIS)
Yamamura, Akihiro; Okada, Akitoshi; Kameda, Yasuhiro; Ohtsuka, Jun; Nakagawa, Noriko; Ebihara, Akio; Nagata, Koji; Tanokura, Masaru
2009-01-01
The crystal structures of TTHA1623 from T. thermophilus HB8 in an iron-bound and a zinc-bound form have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 is a metallo-β-lactamase superfamily protein from the extremely thermophilic bacterium Thermus thermophilus HB8. Homologues of TTHA1623 exist in a wide range of bacteria and archaea and one eukaryote, Giardia lamblia, but their function remains unknown. To analyze the structural properties of TTHA1623, the crystal structures of its iron-bound and zinc-bound forms have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 possesses an αββα-fold similar to that of other metallo-β-lactamase superfamily proteins with glyoxalase II-type metal coordination. However, TTHA1623 exhibits a putative substrate-binding pocket with a unique shape
-
International Nuclear Information System (INIS)
Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Ohmori, Miwa; Agari, Kazuko; Kitamura, Yoshiaki; Baba, Seiki; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki
2007-01-01
The molybdopterin synthase from T. thermophilus HB8 was cloned, expressed, purified and crystallized. The crystals belong to space group P2 1 and diffracted to a resolution of 1.64 Å. Thermus thermophilus is a Gram-negative aerobic thermophilic eubacterium which can grow at temperatures ranging from 323 to 355 K. In addition to their importance in thermostability or adaptation strategies for survival at high temperatures, the thermostable enzymes in thermophilic organisms contribute to a wide range of biotechnological applications. The molybdenum cofactor in all three kingdoms consists of a tricyclic pyranopterin termed molybdopterin that bears the cis-dithiolene group responsible for molybdenum ligation. The crystals of molybdopterin synthase from T. thermophilus HB8 belong to the primitive monoclinic space group P2 1 , with unit-cell parameters a = 33.94, b = 103.32, c = 59.59 Å, β = 101.3°. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetric unit
-
International Nuclear Information System (INIS)
Hoshino, T.; Yoshino, Y.; Guevarra, E.D.; Ishida, S.; Hiruta, T.; Fujii, R.; Nakahara, T.
1994-01-01
Twenty-two carotenoid underproducing and thirteen overproducing mutants were obtained from Thermus thermophilus HB27. The strain HB27 was found to produce at least seven colored carotenoids, believed to be identical to those produced by Thermus aquaticus YT1. Based on the results of the genetic analyses performed on twelve carotenoid underproducing mutants, they were classified into three groups; groups 1, 2 and 3. No colored carotenoid was extracted from the cells of mutants belonging to groups 2 and 3, although the accumulation of phytoene, a colorless carotenoid, was observed in group 2 strains. Group 1 was subdivided into groups 1-a and 1-b, where 1-a stains produced neither colored carotenoids nor phytoene and 1-b strains produced two polar colored carotenoids. All of the overproducing mutants produced about twelve times as much seven colored carotenoid mixtures as the parental strain. The mutation loci among all the overproducing mutants were very close to one another, possibly in the same gene. Carotenoid overproducing mutants showed an extensive resistance to UV-irradiation and showed poorer growth at higher temperatures. Carotenoid underproducing mutants were slightly more UV-sensitive but they grew almost normally at higher temperatures. These results suggest that carotenoids are secondary metabolites which are not essential for growth of T. thermophilus
-
Sequence of the hyperplastic genome of the naturally competent Thermus scotoductus SA-01
Directory of Open Access Journals (Sweden)
Gounder Kamini
2011-11-01
Full Text Available Abstract Background Many strains of Thermus have been isolated from hot environments around the world. Thermus scotoductus SA-01 was isolated from fissure water collected 3.2 km below surface in a South African gold mine. The isolate is capable of dissimilatory iron reduction, growth with oxygen and nitrate as terminal electron acceptors and the ability to reduce a variety of metal ions, including gold, chromate and uranium, was demonstrated. The genomes from two different Thermus thermophilus strains have been completed. This paper represents the completed genome from a second Thermus species - T. scotoductus. Results The genome of Thermus scotoductus SA-01 consists of a chromosome of 2,346,803 bp and a small plasmid which, together are about 11% larger than the Thermus thermophilus genomes. The T. thermophilus megaplasmid genes are part of the T. scotoductus chromosome and extensive rearrangement, deletion of nonessential genes and acquisition of gene islands have occurred, leading to a loss of synteny between the chromosomes of T. scotoductus and T. thermophilus. At least nine large inserts of which seven were identified as alien, were found, the most remarkable being a denitrification cluster and two operons relating to the metabolism of phenolics which appear to have been acquired from Meiothermus ruber. The majority of acquired genes are from closely related species of the Deinococcus-Thermus group, and many of the remaining genes are from microorganisms with a thermophilic or hyperthermophilic lifestyle. The natural competence of Thermus scotoductus was confirmed experimentally as expected as most of the proteins of the natural transformation system of Thermus thermophilus are present. Analysis of the metabolic capabilities revealed an extensive energy metabolism with many aerobic and anaerobic respiratory options. An abundance of sensor histidine kinases, response regulators and transporters for a wide variety of compounds are indicative
-
International Nuclear Information System (INIS)
Vassylyeva, Marina N.; Mori, Hiroyuki; Tsukazaki, Tomoya; Yokoyama, Shigeyuki; Tahirov, Tahir H.; Ito, Koreaki; Vassylyev, Dmitry G.
2006-01-01
The SecA ATPase from T. thermophilus was cloned, expressed, purified and crystallized. Complete diffraction data sets were collected for two crystal forms at 2.8 and 3.5 Å resolution, respectively. Determination of the structure is now in progress. The Thermus thermophilus gene encoding the preprotein translocation ATPase SecA was cloned and expressed and the purified protein was crystallized by the hanging-drop vapour-diffusion technique in two different space groups P3 1(2) 21 (a = b = 168.6, c = 149.8 Å) and P6 1(5) 22 (a = b = 130.9, c = 564.6 Å). The crystals, improved by macroseeding, diffracted to beyond 2.8 and 3.5 Å resolution for the trigonal and hexagonal crystal forms, respectively. Structure determination using the multiple isomorphous replacement method is in progress
-
Effects of Argonaute on Gene Expression in Thermus thermophilus.
Directory of Open Access Journals (Sweden)
Daan C Swarts
Full Text Available Eukaryotic Argonaute proteins mediate RNA-guided RNA interference, allowing both regulation of host gene expression and defense against invading mobile genetic elements. Recently, it has become evident that prokaryotic Argonaute homologs mediate DNA-guided DNA interference, and play a role in host defense. Argonaute of the bacterium Thermus thermophilus (TtAgo targets invading plasmid DNA during and after transformation. Using small interfering DNA guides, TtAgo can cleave single and double stranded DNAs. Although TtAgo additionally has been demonstrated to cleave RNA targets complementary to its DNA guide in vitro, RNA targeting by TtAgo has not been demonstrated in vivo.To investigate if TtAgo also has the potential to control RNA levels, we analyzed RNA-seq data derived from cultures of four T. thermophilus strain HB27 variants: wild type, TtAgo knockout (Δago, and either strain transformed with a plasmid. Additionally we determined the effect of TtAgo on expression of plasmid-encoded RNA and plasmid DNA levels.In the absence of exogenous DNA (plasmid, TtAgo presence or absence had no effect on gene expression levels. When plasmid DNA is present, TtAgo reduces plasmid DNA levels 4-fold, and a corresponding reduction of plasmid gene transcript levels was observed. We therefore conclude that TtAgo interferes with plasmid DNA, but not with plasmid-encoded RNA. Interestingly, TtAgo presence stimulates expression of specific endogenous genes, but only when exogenous plasmid DNA was present. Specifically, the presence of TtAgo directly or indirectly stimulates expression of CRISPR loci and associated genes, some of which are involved in CRISPR adaptation. This suggests that TtAgo-mediated interference with plasmid DNA stimulates CRISPR adaptation.
-
Characterization of recombinant glyoxylate reductase from thermophile Thermus thermophilus HB27.
Ogino, Hiroyasu; Nakayama, Hitoshi; China, Hideyasu; Kawata, Takuya; Doukyu, Noriyuki; Yasuda, Masahiro
2008-01-01
A glyoxylate reductase gene from the thermophilic bacterium Thermus thermophilus HB27 (TthGR) was cloned and expressed in Escherichia coli cells. The recombinant enzyme was highly purified to homogeneity and characterized. The purified TthGR showed thermostability up to 70 degrees C. In contrast, the maximum reaction condition was relatively mild (45 degrees C and pH 6.7). Although the kcat values against co-enzyme NADH and NADPH were similar, the Km value against co-enzyme NADH was approximately 18 times higher than that against NADPH. TthGR prefers NADPH rather than NADH as an electron donor. These results indicate that a phosphate group of a co-enzyme affects the binding affinity rather than the reaction efficiency, and TthGR demands appropriate amount of phosphate for a high activity. Furthermore, it was found that the half-lives of TthGR in the presence of 25% dimethyl sulfoxide and diethylene glycol were significantly longer than that in the absence of an organic solvent.
-
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
-
International Nuclear Information System (INIS)
Clemons, William M. Jr.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki
2001-01-01
We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 (angstrom) resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 (angstrom) resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.
-
International Nuclear Information System (INIS)
Pioszak, Augen A.; Murayama, Kazutaka; Nakagawa, Noriko; Ebihara, Akio; Kuramitsu, Seiki; Shirouzu, Mikako; Yokoyama, Shigeyuki
2005-01-01
Three structures of a putative RNA 5-methyluridine methyltransferase from T. thermophilus, including its complex with S-adenosyl-l-homocysteine, are presented. The structures reveal the mode of cofactor binding, architecture of the putative active site, and the presence of a deep cleft adjacent to the active site that may bind RNA. The Thermus thermophilus hypothetical protein TTHA1280 belongs to a family of predicted S-adenosyl-l-methionine (AdoMet) dependent RNA methyltransferases (MTases) present in many bacterial and archaeal species. Inspection of amino-acid sequence motifs common to class I Rossmann-fold-like MTases suggested a specific role as an RNA 5-methyluridine MTase. Selenomethionine (SeMet) labelled and native versions of the protein were expressed, purified and crystallized. Two crystal forms of the SeMet-labelled apoprotein were obtained: SeMet-ApoI and SeMet-ApoII. Cocrystallization of the native protein with S-adenosyl-l-homocysteine (AdoHcy) yielded a third crystal form, Native-AdoHcy. The SeMet-ApoI structure was solved by the multiple anomalous dispersion method and refined at 2.55 Å resolution. The SeMet-ApoII and Native-AdoHcy structures were solved by molecular replacement and refined at 1.80 and 2.60 Å, respectively. TTHA1280 formed a homodimer in the crystals and in solution. Each subunit folds into a three-domain structure composed of a small N-terminal PUA domain, a central α/β-domain and a C-terminal Rossmann-fold-like MTase domain. The three domains form an overall clamp-like shape, with the putative active site facing a deep cleft. The architecture of the active site is consistent with specific recognition of uridine and catalysis of methyl transfer to the 5-carbon position. The cleft is suitable in size and charge distribution for binding single-stranded RNA.
-
Togawa, Yoichiro; Nunoshiba, Tatsuo; Hiratsu, Keiichiro
2018-02-01
Markerless gene-disruption technology is particularly useful for effective genetic analyses of Thermus thermophilus (T. thermophilus), which have a limited number of selectable markers. In an attempt to develop a novel system for the markerless disruption of genes in T. thermophilus, we applied a Cre/lox system to construct a triple gene disruptant. To achieve this, we constructed two genetic tools, a loxP-htk-loxP cassette and cre-expressing plasmid, pSH-Cre, for gene disruption and removal of the selectable marker by Cre-mediated recombination. We found that the Cre/lox system was compatible with the proliferation of the T. thermophilus HB27 strain at the lowest growth temperature (50 °C), and thus succeeded in establishing a triple gene disruptant, the (∆TTC1454::loxP, ∆TTC1535KpnI::loxP, ∆TTC1576::loxP) strain, without leaving behind a selectable marker. During the process of the sequential disruption of multiple genes, we observed the undesired deletion and inversion of the chromosomal region between multiple loxP sites that were induced by Cre-mediated recombination. Therefore, we examined the effects of a lox66-htk-lox71 cassette by exploiting the mutant lox sites, lox66 and lox71, instead of native loxP sites. We successfully constructed a (∆TTC1535::lox72, ∆TTC1537::lox72) double gene disruptant without inducing the undesired deletion of the 0.7-kbp region between the two directly oriented lox72 sites created by the Cre-mediated recombination of the lox66-htk-lox71 cassette. This is the first demonstration of a Cre/lox system being applicable to extreme thermophiles in a genetic manipulation. Our results indicate that this system is a powerful tool for multiple markerless gene disruption in T. thermophilus.
-
International Nuclear Information System (INIS)
Shimizu, Katsumi; Kunishima, Naoki
2007-01-01
The pyrimidine nucleoside phosphorylase TTHA1771 from T. thermophilus HB8 has been overexpressed, purified and crystallized. The crystals diffract X-rays to 1.8 Å resolution using synchrotron radiation. Pyrimidine nucleoside phosphorylase (PYNP) catalyzes the reversible phosphorolysis of pyrimidines in the nucleotide-synthesis salvage pathway. In order to study the structure–thermostability relationship of this enzyme, PYNP from the extreme thermophile Thermus thermophilus HB8 (TTHA1771) has been cloned, overexpressed and purified. The TTHA1771 protein was crystallized at 291 K using the oil-microbatch method with PEG 4000 as a precipitant. A native data set was collected to 1.8 Å resolution using synchrotron radiation. The crystal belongs to the monoclinic space group P2 1 , with unit-cell parameters a = 58.83, b = 76.23, c = 103.86 Å, β = 91.3°
-
International Nuclear Information System (INIS)
Antonyuk, S.V.; Melik-Adamyan, V.R.; Popov, A.N.; Lamzin, V.S.; Hempstead, P.D.; Harrison, P.M.; Artymyuk, P.J.; Barynin, V.V.
2000-01-01
The crystal structures of two forms of the enzyme dimanganese catalase from Thermus Thermophilus (native and inhibited by chloride) were studied by X-ray diffraction analysis at 1.05 and 0.98 A resolution, respectively. The atomic models of the molecules were refined to the R factors 9.8 and 10%, respectively. The three-dimensional molecular structures are characterized in detail. The analysis of electron-density distributions in the active centers of the native and inhibited enzyme forms revealed that the most flexible side chains of the amino acid residues Lys162 and Glu36 exist in two interrelated conformations. This allowed us to obtain the structural data necessary for understanding the mechanism of enzymatic activity of the dimanganese catalase
-
Directory of Open Access Journals (Sweden)
Minwoo Lee
Full Text Available One of the primary transcriptional regulators of fatty acid homeostasis in many prokaryotes is the protein FadR. To better understand its biological function in the extreme thermophile Thermus thermophilus HB8, we sought to first determine its preferred DNA-binding sequences in vitro using the combinatorial selection method Restriction Endonuclease Protection, Selection, and Amplification (REPSA and then use this information to bioinformatically identify potential regulated genes. REPSA determined a consensus FadR-binding sequence 5´-TTRNACYNRGTNYAA-3´, which was further characterized using quantitative electrophoretic mobility shift assays. With this information, a search of the T. thermophilus HB8 genome found multiple operons potentially regulated by FadR. Several of these were identified as encoding proteins involved in fatty acid biosynthesis and degradation; however, others were novel and not previously identified as targets of FadR. The role of FadR in regulating these genes was validated by physical and functional methods, as well as comparative genomic approaches to further characterize regulons in related organisms. Taken together, our study demonstrates that a systematic approach involving REPSA, biophysical characterization of protein-DNA binding, and bioinformatics can be used to postulate biological roles for potential transcriptional regulators.
-
Rayevsky A. V.; Tukalo M. A.
2016-01-01
Aim. To investigate the structural bases for the amino acid selectivity of the Thermus thermophilus leucyl-tRNA synthetase (LeuRSTT) aminoacylation site and to disclose the binding pattern of pre-transfer editing substrates. Methods. Eight amino acids proposed as semi-cognate substrates for aminoacylation and eight aminoacyl-adenylates (formed from AMP and eight amino acids) were prepared in zwitterions form. The protein structure with a co-crystallized substrate in the aminoacylation site [P...
-
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2012-11-01
Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.
-
Site-directed mutation of a laccase from Thermus thermophilus: Effect on the activity profile
Directory of Open Access Journals (Sweden)
Liu Xin
2012-01-01
Full Text Available A site-directed mutant R453T of a laccase from Thermus thermophilus HB27 (Tth-laccase was constructed in order to investigate the effect on laccase catalytic properties. The mutated gene was cloned and overexpressed in Escherichia coli. Nickel-affinity purification was achieved and followed by copper ion incorporation. The mature mutated enzyme was quantitatively equal to the wild type. A photometric assay based on the oxidation of the substrate 2,2-azino-bis-(3- ethylbenzthiazoline-6-sulfonate (ABTS was employed in comparison with the wild-type Tth-laccase on catalytic properties. The R453T mutant exhibited improvement in substrate affinity and specific activity at room temperature, whereas those parameters were not significantly influenced when the temperature increased up to 65°C or higher. The mutant had better catalytic activity than that of the wild type at acidic pH. Investigated by circular dichroism spectroscopy, the mutant Tth-laccase displayed similar profiles at low and high temperatures.
-
Pennacchio, Angela; Pucci, Biagio; Secundo, Francesco; La Cara, Francesco; Rossi, Mosè; Raia, Carlo A
2008-07-01
The gene encoding a novel alcohol dehydrogenase (ADH) that belongs to the short-chain dehydrogenase/reductase (SDR) superfamily was identified in the extremely thermophilic, halotolerant gram-negative eubacterium Thermus thermophilus HB27. The T. thermophilus ADH gene (adh(Tt)) was heterologously overexpressed in Escherichia coli, and the protein (ADH(Tt)) was purified to homogeneity and characterized. ADH(Tt) is a tetrameric enzyme consisting of identical 26,961-Da subunits composed of 256 amino acids. The enzyme has remarkable thermophilicity and thermal stability, displaying activity at temperatures up to approximately 73 degrees C and a 30-min half-inactivation temperature of approximately 90 degrees C, as well as good tolerance to common organic solvents. ADH(Tt) has a strict requirement for NAD(H) as the coenzyme, a preference for reduction of aromatic ketones and alpha-keto esters, and poor activity on aromatic alcohols and aldehydes. This thermophilic enzyme catalyzes the following reactions with Prelog specificity: the reduction of acetophenone, 2,2,2-trifluoroacetophenone, alpha-tetralone, and alpha-methyl and alpha-ethyl benzoylformates to (S)-(-)-1-phenylethanol (>99% enantiomeric excess [ee]), (R)-alpha-(trifluoromethyl)benzyl alcohol (93% ee), (S)-alpha-tetralol (>99% ee), methyl (R)-(-)-mandelate (92% ee), and ethyl (R)-(-)-mandelate (95% ee), respectively, by way of an efficient in situ NADH-recycling system involving 2-propanol and a second thermophilic ADH. This study further supports the critical role of the D37 residue in discriminating NAD(H) from NADP(H) in members of the SDR superfamily.
-
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
-
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.
Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide
2018-05-05
Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
-
Engineering the Substrate Specificity of a Thermophilic Penicillin Acylase from Thermus thermophilus
Torres, Leticia L.; Cantero, Ángel; del Valle, Mercedes; Marina, Anabel; López-Gallego, Fernando; Guisán, José M.
2013-01-01
A homologue of the Escherichia coli penicillin acylase is encoded in the genomes of several thermophiles, including in different Thermus thermophilus strains. Although the natural substrate of this enzyme is not known, this acylase shows a marked preference for penicillin K over penicillin G. Three-dimensional models were created in which the catalytic residues and the substrate binding pocket were identified. Through rational redesign, residues were replaced to mimic the aromatic binding site of the E. coli penicillin G acylase. A set of enzyme variants containing between one and four amino acid replacements was generated, with altered catalytic properties in the hydrolyses of penicillins K and G. The introduction of a single phenylalanine residue in position α188, α189, or β24 improved the Km for penicillin G between 9- and 12-fold, and the catalytic efficiency of these variants for penicillin G was improved up to 6.6-fold. Structural models, as well as docking analyses, can predict the positioning of penicillins G and K for catalysis and can demonstrate how binding in a productive pose is compromised when more than one bulky phenylalanine residue is introduced into the active site. PMID:23263966
-
Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.
2017-07-01
Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).
-
Norambuena, J; Wang, Y; Hanson, T; Boyd, J M; Barkay, T
2017-11-17
Mercury (Hg), one of the most toxic and widely distributed heavy metals, has a high affinity for thiol groups. Thiol groups reduce and sequester Hg. Therefore, low molecular weight and protein thiols may be important cell components used in Hg resistance. To date, the role of low molecular weight thiols in Hg-detoxification remains understudied. The mercury resistance ( mer ) operon of Thermus thermophilus suggests an evolutionary link between Hg(II) resistance and low molecular weight thiol metabolism. This mer operon encodes for an enzyme involved in methionine biosynthesis, Oah. Challenge with Hg(II) resulted in increased expression of genes involved in the biosynthesis of multiple low molecular weight thiols (cysteine, homocysteine, and bacillithiol), as well as the thioredoxin system. Phenotypic analysis of gene replacement mutants indicated that Oah contributes to Hg resistance under sulfur limiting conditions, and strains lacking bacillithiol and/or thioredoxins are more sensitive to Hg(II) than the wild type. Growth in presence of either a thiol oxidizing agent or a thiol alkylating agent increased sensitivity to Hg(II). Furthermore, exposure to 3 μM Hg(II) consumed all intracellular reduced bacillithiol and cysteine. Database searches indicate that oah2 is present in all Thermus spp. mer operons. The presence of a thiol related gene was also detected in some alphaprotobacterial mer operons, in which a glutathione reductase gene was present, supporting the role of thiols in Hg(II) detoxification. These results have led to a working model in which LMW thiols act as Hg(II) buffering agents while Hg is reduced by MerA. Importance The survival of microorganisms in presence of toxic metals is central to life's sustainability. The affinity of thiol groups to toxic heavy metals drives microbe-metal interactions and modulate metal toxicity. Mercury detoxification ( mer ) genes likely originated early in microbial evolution among geothermal environments. Little is
-
Schep, Daniel G.; Rubinstein, John L.
2016-01-01
Rotary ATPases couple ATP synthesis or hydrolysis to proton translocation across a membrane. However, understanding proton translocation has been hampered by a lack of structural information for the membrane-embedded a subunit. The V/A-ATPase from the eubacterium Thermus thermophilus is similar in structure to the eukaryotic V-ATPase but has a simpler subunit composition and functions in vivo to synthesize ATP rather than pump protons. We determined the T. thermophilus V/A-ATPase structure by cryo-EM at 6.4 Å resolution. Evolutionary covariance analysis allowed tracing of the a subunit sequence within the map, providing a complete model of the rotary ATPase. Comparing the membrane-embedded regions of the T. thermophilus V/A-ATPase and eukaryotic V-ATPase from Saccharomyces cerevisiae allowed identification of the α-helices that belong to the a subunit and revealed the existence of previously unknown subunits in the eukaryotic enzyme. Subsequent evolutionary covariance analysis enabled construction of a model of the a subunit in the S. cerevisae V-ATPase that explains numerous biochemical studies of that enzyme. Comparing the two a subunit structures determined here with a structure of the distantly related a subunit from the bovine F-type ATP synthase revealed a conserved pattern of residues, suggesting a common mechanism for proton transport in all rotary ATPases. PMID:26951669
-
Politi, Jane; Spadavecchia, Jolanda; Fiorentino, Gabriella; Antonucci, Immacolata; De Stefano, Luca
2016-10-01
Water sources pollution by arsenic ions is a serious environmental problem all around the world. Arsenate reductase enzyme (TtArsC) from Thermus thermophilus extremophile bacterium, naturally binds arsenic ions, As(V) and As (III), in aqueous solutions. In this research, TtArsC enzyme adsorption onto hybrid polyethylene glycol-stabilized gold nanoparticles (AuNPs) was studied at different pH values as an innovative nanobiosystem for metal concentration monitoring. Characterizations were performed by UV/Vis and circular dichroism spectroscopies, TEM images and in terms of surface charge changes. The molecular interaction between arsenic ions and the TtArsC-AuNPs nanobiosystem was also monitored at all pH values considered by UV/Vis spectroscopy. Tests performed revealed high sensitivities and limits of detection equal to 10 ± 3 M -12 and 7.7 ± 0.3 M -12 for As(III) and As(V), respectively. © 2016 The Author(s).
-
Directory of Open Access Journals (Sweden)
Benedikt eLeis
2015-04-01
Full Text Available Functional metagenomic screening strategies, which are independent of known sequence information, can lead to the identification of truly novel genes and enzymes. Since E. coli has been used exhaustively for this purpose as a host, it is important to establish alternative expression hosts and to use them for functional metagenomic screening for new enzymes. In this study we show that Thermus thermophilus HB27 is an excellent screening host and can be used as an alternative provider of truly novel biocatalysts. In a previous study we constructed the mutant strain BL03 that was no longer able to grow on defined minimal medium supplemented with tributyrin as the sole carbon source and could be used as a host to screen for metagenomic DNA fragments that could complement growth on tributyrin. Several thousand single fosmid clones from thermophilic metagenomic libraries from heated compost and hot spring water samples were subjected to a comparative screening for esterase activity in both T. thermophilus strain BL03 and E. coli EPI300. We scored a greater number of active clones in the thermophilic bacterium than in the mesophilic E. coli. From all clones functionally screened in E. coli, only two thermostable α/β-fold hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes were identifiable. In contrast, five further fosmids were found that conferred lipolytic activities in T. thermophilus. Four open reading frames (ORFs were found which did not share significant similarity to known esterase enzymes. Two of the genes were expressed in both hosts and the novel thermophilic esterases, which based on their primary structures could not be assigned to known esterase or lipase families, were purified and preliminarily characterized. Our work underscores the benefit of using additional screening hosts other than E. coli for the identification of novel biocatalysts with industrial relevance.
-
Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing
B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam
2016-01-01
We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.
-
Taniguchi, Hironori; Sungwallek, Sathidaphorn; Chotchuang, Phatcharin; Okano, Kenji; Honda, Kohsuke
2017-09-01
NAD (NAD + ) is a cofactor related to many cellular processes. This cofactor is known to be unstable, especially at high temperatures, where it chemically decomposes to nicotinamide and ADP-ribose. Bacteria, yeast, and higher organisms possess the salvage pathway for reconstructing NAD + from these decomposition products; however, the importance of the salvage pathway for survival is not well elucidated, except for in pathogens lacking the NAD + de novo synthesis pathway. Herein, we report the importance of the NAD + salvage pathway in the thermophilic bacterium Thermus thermophilus HB8 at high temperatures. We identified the gene encoding nicotinamidase (TTHA0328), which catalyzes the first reaction of the NAD + salvage pathway. This recombinant enzyme has a high catalytic activity against nicotinamide ( K m of 17 μM, k cat of 50 s -1 , k cat / K m of 3.0 × 10 3 s -1 · mM -1 ). Deletion of this gene abolished nicotinamide deamination activity in crude extracts of T. thermophilus and disrupted the NAD + salvage pathway in T. thermophilus Disruption of the salvage pathway led to the severe growth retardation at a higher temperature (80°C), owing to the drastic decrease in the intracellular concentrations of NAD + and NADH. IMPORTANCE NAD + and other nicotinamide cofactors are essential for cell metabolism. These molecules are unstable and decompose, even under the physiological conditions in most organisms. Thermophiles can survive at high temperatures where NAD + decomposition is, in general, more rapid. This study emphasizes that NAD + instability and its homeostasis can be one of the important factors for thermophile survival in extreme temperatures. Copyright © 2017 American Society for Microbiology.
-
Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing
Directory of Open Access Journals (Sweden)
B Dhawan
2016-01-01
Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.
-
Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei
2011-07-01
ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.
-
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Directory of Open Access Journals (Sweden)
Tina Y Liu
Full Text Available CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus Type III-A Csm complex (TthCsm with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
-
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A
2017-01-01
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
-
International Nuclear Information System (INIS)
Politi, Jane; De Stefano, Luca; Spadavecchia, Jolanda; Casale, Sandra; Fiorentino, Gabriella; Antonucci, Immacolata
2015-01-01
The thermophilic bacterium Thermus thermophilus HB27 encodes chromosomal arsenate reductase (TtArsC), the enzyme responsible for resistance to the harmful effects of arsenic. We report on adsorption of TtArsC onto gold nanoparticles for naked-eye monitoring of biomolecular interaction between the enzyme and arsenic species. Synthesis of hybrid biological–metallic nanoparticles has been characterized by transmission electron microscopy (TEM), ultraviolet-visible (UV–vis), dynamic light scattering (DLS) and phase modulated infrared reflection absorption (PM-IRRAS) spectroscopies. Molecular interactions have been monitored by UV–vis and Fourier transform-surface plasmon resonance (FT-SPR). Due to the nanoparticles’ aggregation on exposure to metal salts, pentavalent and trivalent arsenic solutions can be clearly distinguished by naked-eye assay, even at 85 μM concentration. Moreover, the assay shows partial selectivity against other heavy metals. (paper)
-
Energy Technology Data Exchange (ETDEWEB)
Kumar, S.M. [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India); Pampa, K.J. [Department of Studies in Microbiology, University of Mysore, Mysore 570 006 (India); Manjula, M. [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India); Abdoh, M.M.M. [Department of Physics, Faculty of Science, An-Najah National University, Nablus, West Bank, Palestine (Country Unknown); Kunishima, Naoki [Advanced Protein Crystallography Research Group, RIKEN SPring-8 Center, Harima Institute, Hyogo 679-5148 (Japan); Lokanath, N.K., E-mail: lokanath@physics.uni-mysore.ac.in [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India)
2014-06-20
Highlights: • We determined the structure of isocitrate dehydrogenase with citrate and cofactor. • The structure reveals a unique novel terminal domain involved in dimerization. • Clasp domain shows significant difference, and catalytic residues are conserved. • Oligomerization of the enzyme is quantized with subunit-subunit interactions. • Novel domain of this enzyme is classified as subfamily of the type IV. - Abstract: NADP{sup +} dependent isocitrate dehydrogenase (IDH) is an enzyme catalyzing oxidative decarboxylation of isocitrate into oxalosuccinate (intermediate) and finally the product α-ketoglutarate. The crystal structure of Thermus thermophilus isocitrate dehydrogenase (TtIDH) ternary complex with citrate and cofactor NADP{sup +} was determined using X-ray diffraction method to a resolution of 1.80 Å. The overall fold of this protein was resolved into large domain, small domain and a clasp domain. The monomeric structure reveals a novel terminal domain involved in dimerization, very unique and novel domain when compared to other IDH’s. And, small domain and clasp domain showing significant differences when compared to other IDH’s of the same sub-family. The structure of TtIDH reveals the absence of helix at the clasp domain, which is mainly involved in oligomerization in other IDH’s. Also, helices/beta sheets are absent in the small domain, when compared to other IDH’s of the same sub family. The overall TtIDH structure exhibits closed conformation with catalytic triad residues, Tyr144-Asp248-Lys191 are conserved. Oligomerization of the protein is quantized using interface area and subunit–subunit interactions between protomers. Overall, the TtIDH structure with novel terminal domain may be categorized as a first structure of subfamily of type IV.
-
Directory of Open Access Journals (Sweden)
Barbara Nicolaus
2016-12-01
Full Text Available Extremophiles are organisms able to thrive in extreme environmental conditions and some of them show the ability to survive high doses of heavy metals thanks to defensive mechanisms provided by primary and secondary metabolic products, i.e., extremolytes, lipids, and extremozymes. This is why there is a growing scientific and industrial interest in the use of thermophilic bacteria in a host of tasks, from the environmental detoxification of heavy metal to industrial activities, such as bio-machining and bio-metallurgy. In this work Thermus thermophilus was challenged against increasing Pb2+ concentrations spanning from 0 to 300 ppm in order to ascertain the sensitiveness of this bacteria to the Pb environmental pollution and to give an insight on its heavy metal resistance mechanisms. Analysis of growth parameters, enzyme activities, protein profiles, and lipid membrane modifications were carried out. In addition, genotyping analysis of bacteria grown in the presence of Pb2+, using random amplified polymorphic DNA-PCR and DNA melting evaluation, were also performed. A better knowledge of the response of thermophilic bacteria to the different pollutants, as heavy metals, is necessary for optimizing their use in remediation or decontamination processes.
-
International Nuclear Information System (INIS)
Okai, Masahiko; Yamamura, Akihiro; Hayakawa, Kou; Tsutsui, Shiho; Miyazono, Ken-ichi; Lee, Woo-Cheol; Nagata, Koji; Inoue, Yumiko; Tanokura, Masaru
2017-01-01
Carboxypeptidase cleaves the C-terminal amino acid residue from proteins and peptides. Here, we report the functional and structural characterizations of carboxypeptidase belonging to the M32 family from the thermophilic bacterium Thermus thermophilus HB8 (TthCP). TthCP exhibits a relatively broad specificity for both hydrophilic (neutral and basic) and hydrophobic (aliphatic and aromatic) residues at the C-terminus and shows optimal activity in the temperature range of 75–80 °C and in the pH range of 6.8–7.2. Enzyme activity was significantly enhanced by cobalt or cadmium and was moderately inhibited by Tris at 25 °C. We also determined the crystal structure of TthCP at 2.6 Å resolution. Two dimer types of TthCP are present in the crystal. One type consists of two subunits in different states, open and closed, with a C α RMSD value of 2.2 Å; the other type consists of two subunits in the same open state. This structure enables us to compare the open and closed states of an M32 carboxypeptidase. The TthCP subunit can be divided into two domains, L and S, which are separated by a substrate-binding groove. The L and S domains in the open state are almost identical to those in the closed state, with C α RMSD values of 0.84 and 0.53 Å, respectively, suggesting that the transition between the open and closed states proceeds with a large hinge-bending motion. The superimposition between the closed states of TthCP and BsuCP, another M32 family member, revealed that most putative substrate-binding residues in the grooves are oriented in the same direction. - Highlights: • The enzyme activity of TthCP was inhibited moderately by Tris molecule. • We solved the crystal structure of TthCP at 2.6 Å resolution. • The crystal structure of TthCP revealed both the open and closed conformations.
-
Directory of Open Access Journals (Sweden)
Huiping Liu
Full Text Available Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid (ABTS, syringaldazine (SGZ, guaiacol, and 2,6-dimethoxyphenol (2,6-DMP as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.
-
DEFF Research Database (Denmark)
Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen
2008-01-01
of previously reported capreomycin resistance base substitutions. Capreomycin resistance in other bacteria has been shown to result from inactivation of the TlyA methyltransferase which 2'-O methylates C1920 of 23S rRNA. Inactivation of the tlyA gene in T. thermophilus does not affect its sensitivity...... for resistance to the tuberactinomycin antibiotic capreomycin. Two base substitutions, A1913U and mU1915G, and a single base deletion, DeltamU1915, were identified in helix 69 of 23S rRNA, a structural element that forms part of an interribosomal subunit bridge with the decoding center of 16S rRNA, the site...... to capreomycin. Finally, none of the mutations in helix 69 interferes with methylation at C1920 or with pseudouridylation at positions 1911 and 1917. We conclude that the resistance phenotype is a consequence of structural changes introduced by the mutations....
-
Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.
Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian
2005-10-01
Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.
-
Directory of Open Access Journals (Sweden)
Yejing Wang
Full Text Available The effects of urea and guanidine hydrochloride (GdnHCl on the activity, conformation and unfolding process of protein tyrosine phosphatase (PTPase, a thermostable low molecular weight protein from Thermus thermophilus HB27, have been studied. Enzymatic activity assays showed both urea and GdnHCl resulted in the inactivation of PTPase in a concentration and time-dependent manner. Inactivation kinetics analysis suggested that the inactivation of PTPase induced by urea and GdnHCl were both monophasic and reversible processes, and the effects of urea and GdnHCl on PTPase were similar to that of mixed-type reversible inhibitors. Far-ultraviolet (UV circular dichroism (CD, Tryptophan and 1-anilinonaphthalene -8-sulfonic acid (ANS fluorescence spectral analyses indicated the existence of a partially active and an inactive molten globule-like intermediate during the unfolding processes induced by urea and GdnHCl, respectively. Based on the sequence alignment and the homolog Tt1001 protein structure, we discussed the possible conformational transitions of PTPase induced by urea and GdnHCl and compared the conformations of these unfolding intermediates with the transient states in bovine PTPase and its complex structures in detail. Our results may be able to provide some valuable clues to reveal the relationship between the structure and enzymatic activity, and the unfolding pathway and mechanism of PTPase.
-
ORF Alignment: NC_005835 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available [Thermus thermophilus HB8] pdb|1FP9|A Chain A, Structure ... Of Amylomaltase From Thermus Thermophilus Hb8 In Space... ... Amylomaltase From Thermus Thermophilus Hb8 In Space ... Group P21212 ... Length = 500 ... Query
-
ORF Alignment: NC_006461 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available [Thermus thermophilus HB8] pdb|1FP9|A Chain A, Structure ... Of Amylomaltase From Thermus Thermophilus Hb8 In Space... ... Amylomaltase From Thermus Thermophilus Hb8 In Space ... Group P21212 ... Length = 500 ... Query
-
Surerus, K K; Oertling, W A; Fan, C; Gurbiel, R J; Einarsdóttir, O; Antholine, W E; Dyer, R B; Hoffman, B M; Woodruff, W H; Fee, J A
1992-01-01
Cytochrome ba3 from Thermus thermophilus reacts slowly with excess HCN at pH 7.4 to create a form of the enzyme in which CuA, cytochrome b, and CuB remain oxidized, while cytochrome a3 is reduced by one electron, presumably with the formation of cyanogen. We have examined this form of the enzyme by UV-visible, resonance Raman, EPR, and electron nuclear double resonance spectroscopies in conjunction with permutations of 13C- and 15N-labeled cyanide. The results support a model in which one CN- binds through the carbon atom to ferrous a3, supporting a low-spin (S = 0) configuration on the Fe; bridging by this cyanide to the CuB is weak or absent. Four 14N atoms, presumably donated by histidine residues of the protein, provide a strong equatorial ligand field about CuB; a second CN- is coordinated through the carbon atom to CuB in an axial position. PMID:1314380
-
Directory of Open Access Journals (Sweden)
Torres Leticia L
2012-08-01
Full Text Available Abstract Background Penicillin acylases (PACs are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Results Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1. The optimum pH was aprox. 4 and the optimum
-
Torres, Leticia L; Ferreras, Eloy R; Cantero, Angel; Hidalgo, Aurelio; Berenguer, José
2012-08-09
Penicillin acylases (PACs) are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth) HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin) was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1). The optimum pH was aprox. 4 and the optimum temperature was 75 °C. The half-life of
-
Energy Technology Data Exchange (ETDEWEB)
Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation); Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S., E-mail: esipov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation)
2017-01-15
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.
-
NCBI nr-aa BLAST: CBRC-TBEL-01-0397 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TBEL-01-0397 ref|YP_005572.1| competence factor comEC [Thermus thermophilus HB...27] gb|AAG34707.1|AF319938_2 competence factor ComEC [Thermus thermophilus] gb|AAS81945.1| competence factor comEC [Thermus thermophilus HB27] YP_005572.1 0.10 31% ...
-
Directory of Open Access Journals (Sweden)
Charu Tripathi
2017-07-01
Full Text Available Thermophilic environments represent an interesting niche. Among thermophiles, the genus Thermus is among the most studied genera. In this study, we have sequenced the genome of Thermus parvatiensis strain RL, a thermophile isolated from Himalayan hot water springs (temperature >96°C using PacBio RSII SMRT technique. The small genome (2.01 Mbp comprises a chromosome (1.87 Mbp and a plasmid (143 Kbp, designated in this study as pTP143. Annotation revealed a high number of repair genes, a squeezed genome but containing highly plastic plasmid with transposases, integrases, mobile elements and hypothetical proteins (44%. We performed a comparative genomic study of the group Thermus with an aim of analysing the phylogenetic relatedness as well as niche specific attributes prevalent among the group. We compared the reference genome RL with 16 Thermus genomes to assess their phylogenetic relationships based on 16S rRNA gene sequences, average nucleotide identity (ANI, conserved marker genes (31 and 400, pan genome and tetranucleotide frequency. The core genome of the analyzed genomes contained 1,177 core genes and many singleton genes were detected in individual genomes, reflecting a conserved core but adaptive pan repertoire. We demonstrated the presence of metagenomic islands (chromosome:5, plasmid:5 by recruiting raw metagenomic data (from the same niche against the genomic replicons of T. parvatiensis. We also dissected the CRISPR loci wide all genomes and found widespread presence of this system across Thermus genomes. Additionally, we performed a comparative analysis of competence loci wide Thermus genomes and found evidence for recent horizontal acquisition of the locus and continued dispersal among members reflecting that natural competence is a beneficial survival trait among Thermus members and its acquisition depicts unending evolution in order to accomplish optimal fitness.
-
Zhu, Lizhe
2016-02-24
Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Agos but rigid for eukaryotic Agos. © 2016 American Chemical Society.
-
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Gao, Xin; Wang, Yanli; Huang, Xuhui
2016-03-17
Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Ago's but rigid for eukaryotic Ago's.
-
Energy Technology Data Exchange (ETDEWEB)
Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G
2008-01-01
Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.
-
Directory of Open Access Journals (Sweden)
Theresa Tiefenbrunn
Full Text Available The fundamental chemistry underpinning aerobic life on Earth involves reduction of dioxygen to water with concomitant proton translocation. This process is catalyzed by members of the heme-copper oxidase (HCO superfamily. Despite the availability of crystal structures for all types of HCO, the mode of action for this enzyme is not understood at the atomic level, namely how vectorial H(+ and e(- transport are coupled. Toward addressing this problem, we report wild type and A120F mutant structures of the ba(3-type cytochrome c oxidase from Thermus thermophilus at 1.8 Å resolution. The enzyme has been crystallized from the lipidic cubic phase, which mimics the biological membrane environment. The structures reveal 20 ordered lipid molecules that occupy binding sites on the protein surface or mediate crystal packing interfaces. The interior of the protein encloses 53 water molecules, including 3 trapped in the designated K-path of proton transfer and 8 in a cluster seen also in A-type enzymes that likely functions in egress of product water and proton translocation. The hydrophobic O(2-uptake channel, connecting the active site to the lipid bilayer, contains a single water molecule nearest the Cu(B atom but otherwise exhibits no residual electron density. The active site contains strong electron density for a pair of bonded atoms bridging the heme Fe(a3 and Cu(B atoms that is best modeled as peroxide. The structure of ba(3-oxidase reveals new information about the positioning of the enzyme within the membrane and the nature of its interactions with lipid molecules. The atomic resolution details provide insight into the mechanisms of electron transfer, oxygen diffusion into the active site, reduction of oxygen to water, and pumping of protons across the membrane. The development of a robust system for production of ba(3-oxidase crystals diffracting to high resolution, together with an established expression system for generating mutants, opens the
-
Yu, Tian-Tian; Yao, Ji-Cheng; Ming, Hong; Yin, Yi-Rui; Zhou, En-Min; Liu, Min-Jiao; Tang, Shu-Kun; Li, Wen-Jun
2013-03-01
A Gram-stain negative aerobic bacterium, designated YIM 77924(T), was isolated from a geothermally heated soil sample collected at Rehai National Park, Tengchong, Yunnan province, south-west China. Growth was found to occur from 55 to 75 °C (optimum 65 °C), pH 6.0-8.0 (optimum pH 7.0) and 0-1 % NaCl (w/v). Cells were observed to be rod-shaped and the colonies convex, circular, smooth, yellow and non-transparent. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain YIM 77924(T) belongs to the genus Thermus. The 16S rRNA gene sequence similarity values between strain YIM 77924(T) and other species of the genus Thermus were all below 97 %. The polar lipids of strain YIM 77924(T) were determined to be aminophospholipid, phospholipid and glycolipid. The predominant respiratory quinone was determined to be MK-8 and the G+C content was 66.64 mol%. The major fatty acids identified were iso-C(16:0), iso-C(15:0), iso-C(17:0) and C(16:0). On the basis of the morphological and chemotaxonomic characteristics as well as genotypic data, strain YIM 77924(T) is proposed to represent a novel species, Thermus tengchongensis sp. nov., in the genus Thermus. The type strain is YIM 77924(T) (=KCTC 32025(T) = CCTCC AB2012063(T)).
-
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2009-04-01
The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.
-
Bassi, D; Cappa, F; Gazzola, S; Orrù, L; Cocconcelli, P S
2017-04-15
In Streptococcus thermophilus , gene transfer events and loss of ancestral traits over the years contribute to its high level of adaptation to milk environments. Biofilm formation capacity, a phenotype that is lost in the majority of strains, plays a role in persistence in dairy environments, such as milk pasteurization and cheese manufacturing plants. To investigate this property, we have studied S. thermophilus UC8547, a fast-acidifying dairy starter culture selected for its high capacity to form biofilm on stainless steel under environmental conditions resembling the dairy environment. Using a dynamic flow cell apparatus, it was shown that S. thermophilus UC8547 biofilm formation on stainless steel depends on the presence of milk proteins. From this strain, which harbors the prtS gene for the cell wall protease and shows an aggregative phenotype, spontaneous mutants with impaired biofilm capacity can be isolated at high frequency. These mutants lack the PrtS expendable island, as confirmed by comparison of the genome sequence of UC8547Δ3 with that of the parent strain. The prtS island excision occurs between two 26-bp direct repeats located in the two copies of the IS Sth1 flanking this genomic island. The central role of PrtS was confirmed by analyzing the derivative strain UC8547Δ16, whose prtS gene was interrupted by an insertional mutation, thereby making it incapable of biofilm formation. PrtS, acting as a binding substance between the milk proteins adhered to stainless steel and S. thermophilus cell envelopes, mediates biofilm formation in dairy environments. This feature provides S. thermophilus with an ecological benefit for its survival and persistence in this environment. IMPORTANCE The increased persistence of S. thermophilus biofilm has consequences in the dairy environment: if, on the one hand, the release of this microorganism from biofilm can promote the fermentation of artisanal cheeses, under industrial conditions it may lead to undesirable
-
Yu, Jie; Sun, Zhihong; Liu, Wenjun; Xi, Xiaoxia; Song, Yuqin; Xu, Haiyan; Lv, Qiang; Bao, Qiuhua; Menghe, Bilige; Sun, Tiansong
2015-10-26
Streptococcus thermophilus is a major dairy starter used for manufacturing of dairy products. In the present study, we developed a multilocus sequence typing (MLST) scheme for this important food bacterium. Sequences of 10 housekeeping genes (carB, clpX, dnaA, murC, murE, pepN, pepX, pyrG, recA, and rpoB) were obtained for 239 S. thermophilus strains, which were isolated from home-made fermented dairy foods in 18 different regions of Mongolia and China. All 10 genes of S. thermophilus were sequenced, aligned, and defined sequence types (STs) using the BioNumerics Software. The nucleotide diversity was calculated by START v2.0. The population structure, phylogenetic relationships and the role of recombination were inferred using ClonalFrame v1.2, SplitsTree 4.0 and Structure v2.3. The 239 S. thermophilus isolates and 18 reference strains could be assigned into 119 different STs, which could be further separated into 16 clonal complexes (CCs) and 38 singletons. Among the 10 loci, a total of 132 polymorphic sites were detected. The standardized index of association (IAS=0.0916), split-decomposition and ρ/θ (relative frequency of occurrence of recombination and mutation) and r/m value (relative impact of recombination and mutation in the diversification) confirms that recombination may have occurred, but it occurred at a low frequency in these 10 loci. Phylogenetic trees indicated that there were five lineages in the S. thermophilus isolates used in our study. MSTree and ClonalFrame tree analyses suggest that the evolution of S. thermophilus isolates have little relationship with geographic locality, but revealed no association with the types of fermented dairy product. Phylogenetic analysis of 36 whole genome strains (18 S. thermophilus, 2 S. vestibularis and 16 S. salivarius strains) indicated that our MLST scheme could clearly separate three closely related species within the salivarius group and is suitable for analyzing the population structure of the
-
NCBI nr-aa BLAST: CBRC-TBEL-01-0397 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TBEL-01-0397 ref|YP_145234.1| competence protein ComEC [Thermus thermophilus HB8] dbj|BAD71791.1| compe...tence protein ComEC [Thermus thermophilus HB8] YP_145234.1 0.020 31% ...
-
Thermus caliditerrae sp. nov., a novel thermophilic species isolated from a geothermal area.
Ming, Hong; Yin, Yi-Rui; Li, Shuai; Nie, Guo-Xing; Yu, Tian-Tian; Zhou, En-Min; Liu, Lan; Dong, Lei; Li, Wen-Jun
2014-02-01
Two thermophilic bacterial strains, designated YIM 77925(T) and YIM 77777, were isolated from two hot springs, one in the Hydrothermal Explosion (Shuirebaozhaqu) area and Frog Mouth Spring in Tengchong county, Yunnan province, south-western China. The taxonomic positions of the two isolates were investigated by a polyphasic approach. Cells of the two strains were Gram-stain-negative, aerobic and rod-shaped. They were able to grow at 50-70 °C, pH 6.0-8.0 and with a NaCl tolerance up to 0.5% (w/v). Colonies are circular, convex, non-transparent and produce yellow pigment. Phylogenetic analyses based on 16S rRNA gene sequences comparison clearly demonstrated that strains YIM 77925(T) and YIM 77777 represent members of the genus Thermus, and they also detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. Their predominant menaquinone was MK-8. The genomic DNA G+C contents of strains YIM 77925(T) and YIM 77777 were 65.6 mol% and 67.2 mol%, respectively. Based on the results of physiological and biochemical tests and phylogenetic analyses, strains YIM 77925(T) and YIM 77777 could not be classified as representing any species of the genus Thermus with a validly published name. Thus the two strains are considered to represent a novel species of the genus Thermus, for which the name Thermus caliditerrae sp. nov. is proposed. The type strain is YIM 77925(T) ( = DSM 25901(T) = CCTCC 2012061(T)).
-
Yamasaki, Takashi; Oohata, Yukiko; Nakamura, Toshiki; Watanabe, Yo-hei
2015-04-10
The ClpB/Hsp104 chaperone solubilizes and reactivates protein aggregates in cooperation with DnaK/Hsp70 and its cofactors. The ClpB/Hsp104 protomer has two AAA+ modules, AAA-1 and AAA-2, and forms a homohexamer. In the hexamer, these modules form a two-tiered ring in which each tier consists of homotypic AAA+ modules. By ATP binding and its hydrolysis at these AAA+ modules, ClpB/Hsp104 exerts the mechanical power required for protein disaggregation. Although ATPase cycle of this chaperone has been studied by several groups, an integrated understanding of this cycle has not been obtained because of the complexity of the mechanism and differences between species. To improve our understanding of the ATPase cycle, we prepared many ordered heterohexamers of ClpB from Thermus thermophilus, in which two subunits having different mutations were cross-linked to each other and arranged alternately and measured their nucleotide binding, ATP hydrolysis, and disaggregation abilities. The results indicated that the ATPase cycle of ClpB proceeded as follows: (i) the 12 AAA+ modules randomly bound ATP, (ii) the binding of four or more ATP to one AAA+ ring was sensed by a conserved Arg residue and converted another AAA+ ring into the ATPase-active form, and (iii) ATP hydrolysis occurred cooperatively in each ring. We also found that cooperative ATP hydrolysis in at least one ring was needed for the disaggregation activity of ClpB. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
-
Turchi, Barbara; Pedonese, Francesca; Torracca, Beatrice; Fratini, Filippo; Mancini, Simone; Galiero, Alessia; Montalbano, Benedetta; Cerri, Domenico; Nuvoloni, Roberta
2017-09-01
Donkey milk is recently gaining attention due to its nutraceutical properties. Its low casein content does not allow caseification, so the production of a fermented milk would represent an alternative way to increase donkey milk shelf life. The aim of this study was to investigate the possibility of employing selected Streptococcus thermophilus and Lactobacillus plantarum isolates for the production of a novel donkey milk fermented beverage. Lysozyme resistance and the ability to acidify donkey milk were chosen as main selection parameters. Different fermented beverages (C1-C9) were produced, each with a specific combination of isolates, and stored at refrigerated conditions for 35days. The pH values and viability of the isolates were weekly assessed. In addition, sensory analysis was performed. Both S. thermophilus and L.plantarum showed a high degree of resistance to lysozyme with a Minimum Bactericidal Concentration>6.4mg/mL for 100% of S. thermophilus and 96% of L. plantarum. S. thermophilus and L. plantarum showed the ability to acidify donkey milk in 24h at 37°C, with an average ΔpH value of 2.91±0.16 and 1.78±0.66, respectively. Four L. plantarum and two S. thermophilus were chosen for the production of fermented milks. Those containing the association S. thermophilus/L. plantarum (C1-C4) reached a pH lower than 4.5 after 18h of fermentation and showed microbial loads higher than 7.00logcfu/mL until the end of the storage period. Moreover, comparing the microbial loads of samples containing both species and those containing S. thermophilus alone (C5), we highlighted the ability of L. plantarum to stimulate S. thermophilus replication. This boosted replication of S. thermophilus allowed to reach an appropriate pH in a time frame fitting the production schedule. This was not observed for samples containing a single species (C5-C9). Thus, L. plantarum strains seem to be good candidates in the production of a novel type of fermented milk, not only for their
-
Directory of Open Access Journals (Sweden)
Muriel Thomas
Full Text Available Streptococcus thermophilus is the archetype of lactose-adapted bacterium and so far, its sugar metabolism has been mainly investigated in vitro. The objective of this work was to study the impact of lactose and lactose permease on S. thermophilus physiology in the gastrointestinal tract (GIT of gnotobiotic rats. We used rats mono-associated with LMD-9 strain and receiving 4.5% lactose. This model allowed the analysis of colonization curves of LMD-9, its metabolic profile, its production of lactate and its interaction with the colon epithelium. Lactose induced a rapid and high level of S. thermophilus in the GIT, where its activity led to 49 mM of intra-luminal L-lactate that was related to the induction of mono-carboxylic transporter mRNAs (SLC16A1 and SLC5A8 and p27(Kip1 cell cycle arrest protein in epithelial cells. In the presence of a continuous lactose supply, S. thermophilus recruited proteins involved in glycolysis and induced the metabolism of alternative sugars as sucrose, galactose, and glycogen. Moreover, inactivation of the lactose transporter, LacS, delayed S. thermophilus colonization. Our results show i/that lactose constitutes a limiting factor for colonization of S. thermophilus, ii/that activation of enzymes involved in carbohydrate metabolism constitutes the metabolic signature of S. thermophilus in the GIT, iii/that the production of lactate settles the dialogue with colon epithelium. We propose a metabolic model of management of carbohydrate resources by S. thermophilus in the GIT. Our results are in accord with the rationale that nutritional allegation via consumption of yogurt alleviates the symptoms of lactose intolerance.
-
ORF Alignment: NC_005835 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available ine pdb|1FJG|S Chain S, Structure ... Of The Thermus Thermophilus 30s Ribosomal Subunit In ... Complex With The Antibioti...cs Streptomycin, ... Spectinomycin, And Paromomycin ... Length = 84 ... Q
-
ORF Alignment: NC_006461 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available ine pdb|1FJG|S Chain S, Structure ... Of The Thermus Thermophilus 30s Ribosomal Subunit In ... Complex With The Antibioti...cs Streptomycin, ... Spectinomycin, And Paromomycin ... Length = 84 ... Q
-
Thermostabilization of desulfurization enzymes from Rhodococcos sp. IGTS8. Final technical report
Energy Technology Data Exchange (ETDEWEB)
John J. Kilbane II
2000-12-15
The objective of this project was to develop thermophilic cultures capable of expressing the desulfurization (dsz) operon of Rhodococcus sp. IGTS8. The approaches taken in this project included the development of plasmid and integrative expression vectors that function well in Thermus thermophilus, the cloning of Rhodococcus dsz genes in Thermus expression vectors, and the isolation of bacterial cultures that express the dsz operon at thermophilic temperatures. This project has resulted in the development of plasmid and integrative expression vectors for use in T. thermophilus. The dsz genes have been expressed at moderately thermophilic temperatures (52 C) in Mycobacterium phlei and at temperatures as high as 72 C in T. thermophilus. The tools and methods developed in this project will be generally useful for the expression of heterologous genes in Thermus. Key developments in the project have been the isolation of a Mycobacterium phlei culture capable of expressing the desulfurization operon at 52 C, development of plasmid and integrative expression vectors for Thermus thermophilus, and the development of a host-vector system based on the malate dehydrogenase gene that allows plasmids to be stably maintained in T. thermophilus and provides a convenient reporter gene for the accurate quantification of gene expression. Publications have been prepared regarding each of these topics; these preprints are included.
-
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...
-
Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W
2003-10-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.
-
Directory of Open Access Journals (Sweden)
Rayevsky A. V.
2016-02-01
Full Text Available Aim. To investigate the structural bases for the amino acid selectivity of the Thermus thermophilus leucyl-tRNA synthetase (LeuRSTT aminoacylation site and to disclose the binding pattern of pre-transfer editing substrates. Methods. Eight amino acids proposed as semi-cognate substrates for aminoacylation and eight aminoacyl-adenylates (formed from AMP and eight amino acids were prepared in zwitterions form. The protein structure with a co-crystallized substrate in the aminoacylation site [PDBID: 1OBH] was taken from RCSB. Docking settings and evaluation of substrate efficiency were followed by twofold docking function analysis for each conformation with Gold CCDC. The molecular dynamics simulation was performed using Gromacs. The procedures of relaxation and binding study were separated in two different subsequent simulations for 50ns and 5ns. Results. The evaluation of substrate efficiency for 8 amino acids by twofold docking function analysis, based on score values,has shown that the ligands of LeuRSTT can be positioned in the following order: Leu>Nva>Hcy>Nle>Met>Cys>Ile >Val. MD simulation has revealed lower electrostatic interactions of isoleucine with the active site of the enzyme compared with those for norvaline and leucine. In the case of aminoacyl-adenylates no significant differences were found based on score values for both GoldScore and Asp functions. Molecular dynamics of leucyl-, isoleucyl- and norvalyl-adenylates showed that the most stable and conformationally favorable is leucine, then follow norvaline and isoleucine. It has been also found that the TYR43 of the active site covers carboxyl group of leucine and norvaline like a shield and deflected towards isoleucine, allowing water molecules to come closer. Conclusions. In this study we revealed some structural basis for screening unfavorable substrates by shape, size and flexibility of a radical. The results obtained for different amino acids by molecular docking and MD studies
-
Complete Genome Sequence of the Pigmented Streptococcus thermophilus Strain JIM8232
Delorme, Christine; Bartholini, Claire; Luraschi, Mélanie; Pons, Nicolas; Loux, Valentin; Almeida, Mathieu; Guédon, Eric; Gibrat, Jean-François; Renault, Pierre
2011-01-01
Streptococcus thermophilus is a dairy species commonly used in the manufacture of cheese and yogurt. Here, we report the complete sequence of S. thermophilus strain JIM8232, isolated from milk and which produces a yellow pigment, an atypical trait for this bacterium. PMID:21914889
-
Dan, Tong; Jin, Rulin; Ren, Weiyi; Li, Ting; Chen, Haiyan; Sun, Tiansong
2018-04-11
The lactic acid bacterium Streptococcus thermophilus is a major starter culture for the production of dairy products. In this study, the physiochemical characteristics of milk fermented by the MGA45-4 isolate of S. thermophilus were analyzed. Our data indicate that milk fermented using S. thermophilus MGA45-4 maintained a high viable cell count (8.86 log10 colony-forming units/mL), and a relatively high pH (4.4), viscosity (834.33 mPa·s), and water holding capacity (40.85%) during 14 days of storage. By analyzing the volatile compound profile using solid-phase microextraction and gas chromatography/mass spectrometry, we identified 73 volatile compounds in the fermented milk product, including five carboxylic acids, 21 aldehydes, 13 ketones, 16 alcohols, five esters, and 13 aromatic carbohydrates. According to the odor activity values, 11 of these volatile compounds were found to play a key role in producing the characteristic flavor of fermented milk, particularly octanal, nonanal, hexanal, 2,3-butanedione, and 1-octen-3-ol, which had the highest odor activity values among all compounds analyzed. These findings thus provide more insights in the chemical/molecular characteristics of milk fermented using S. thermophilus , which may provide a basis for improving dairy product flavor/odor during the process of fermentation and storage.
-
DEFF Research Database (Denmark)
Szymczak, Paula; Janzen, Thomas; Neves, Ana Rute
2017-01-01
lactis P335 phages. Phage CHPC1151 was closely related to the atypical S. thermophilus phage 5093, homologous with a nondairy streptococcal prophage. By testing adsorption of the related streptococcal and lactococcal phages to the surface of S. thermophilus and L. lactis strains, we revealed....... thermophilus phages from the Chr. Hansen A/S collection, using PCR specific for the cos- or pac-type phages, as well as for the V2 antireceptor region. Three phages did not produce positive results with the assays. Analysis of phage morphologies indicated that two of these phages, CHPC577 and CHPC926, had...... the possibility of cross-interactions. Our data indicated that the use of S. thermophilus together with L. lactis, extensively applied for dairy fermentations, triggered the recombination between phages infecting different bacterial species. A notable diversity among S. thermophilus phage populations requires...
-
Bassi, D.; Cappa, F.; Gazzola, S.; Orrù, L.; Cocconcelli, P. S.
2017-01-01
In Streptococcus thermophilus, gene transfer events and loss of ancestral traits over the years contribute to its high level of adaptation to milk environments. Biofilm formation capacity, a phenotype that is lost in the majority of strains, plays a role in persistence in dairy environments, such as milk pasteurization and cheese manufacturing plants. To investigate this property, we have studied S. thermophilus UC8547, a fast-acidifying dairy starter culture selected for its high capacity to...
-
Rhamnolipid-producing thermophilic bacteria of species Thermus and Meiothermus
Czech Academy of Sciences Publication Activity Database
Řezanka, Tomáš; Siřišťová, L.; Sigler, Karel
2011-01-01
Roč. 15, č. 6 (2011), s. 697-709 ISSN 1431-0651 R&D Projects: GA ČR(CZ) GAP503/11/0215 Institutional research plan: CEZ:AV0Z50200510 Keywords : Thermus sp * T. aquaticus * Meiothermus ruber Subject RIV: EE - Microbiology, Virology Impact factor: 2.941, year: 2011
-
Directory of Open Access Journals (Sweden)
Raden Haryo Bimo Setiarto
2017-06-01
Full Text Available Prebiotics are food components that can not enzymatically digested, thus it fermented by probiotic bacteria. Inulin is a prebiotic source that widely used in processed food products such as fermented milk. This study aimed to know the variation concentrations effect of prebiotic inulin on the growth of lactic acid bacteria starter yogurt (Lactobacillus acidophillus, Lactobacillus bulgaricus, Streptococcus thermophillus. The growth of those lactic acid bacteries was determined based on OD (Optical Density, Total Plate Count (TPC, total lactic acid content and pH. Inulin concentration of 0.5% (w/v increased the growth of those three bacteries. Reductioned of pH value during inulin fermentation indicated the growth of bacteria that produced lactic acid. L.bulgaricus and S.thermophilus growth rate were more sensitive than L.acidophilus in addition of prebiotic inulin concentration. The growth of those bacteries in MRSB medium supplemented inulin decreased pH around 7.00 into below 5.00 due to organic acids formation.Keywords: Fermentation, Inulin, L.acidophilus, L.bulgaricus, S.thermophilusABSTRAKPrebiotik adalah komponen bahan pangan yang tidak dapat dicerna oleh saluran pencernaan secara enzimatis sehingga akan difermentasi oleh bakteri probiotik di usus besar. Inulin merupakan salah satu sumber prebiotik yang banyak dimanfaatkan dalam produk pangan olahan seperti susu fermentasi. Pemberian inulin pada kadar tertentu perlu diketahui untuk mengetahui jumlah optimal yang diperlukan untuk menjaga kesehatan. Penelitian ini bertujuan untuk mengetahui pengaruh variasi konsentrasi prebiotik inulin terhadap pertumbuhan bakteri asam laktat starter yogurt (Lactobacillus acidophillus, Lactobacillus bulgaricus dan Streptococcus thermophillus. Pengamatan pertumbuhan L. acidophilus, L. bulgaricus dan S. thermophillus dilakukan dengan beberapa cara antara lain perhitungan total sel dengan menggunakan prinsip turbidimetrik OD (Optical Density, jumlah total
-
Sasaki, Yasuko; Horiuchi, Hiroshi; Kawashima, Hiroko; Mukai, Takao; Yamamoto, Yuji
2014-01-01
We previously reported that dissolved oxygen (DO) suppresses yogurt fermentation with an industrial starter culture composed of Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) 2038 and Streptococcus thermophilus 1131, and also found that reducing the DO in the medium prior to fermentation (deoxygenated fermentation) shortens the fermentation time. In this study, we found that deoxygenated fermentation primarily increased the cell number of S. thermophilus 1131 rather than that of L. bulgaricus 2038, resulting in earlier l-lactate and formate accumulation. Measurement of the DO concentration and hydrogen peroxide generation in the milk medium suggested that DO is mainly removed by S. thermophilus 1131. The results using an H2O-forming NADH oxidase (Nox)-defective mutant of S. thermophilus 1131 revealed that Nox is the major oxygen-consuming enzyme of the bacterium. Yogurt fermentation with the S. thermophilus Δnox mutant and L. bulgaricus 2038 was significantly slower than with S. thermophilus 1131 and L. bulgaricus 2038, and the DO concentrations of the mixed culture did not decrease to less than 2 mg/kg within 3 hr. These observations suggest that Nox of S. thermophilus 1131 contributes greatly to yogurt fermentation, presumably by removing the DO in milk.
-
Therapeutic effect of Streptococcus thermophilus CRL 1190-fermented milk on chronic gastritis.
Rodríguez, Cecilia; Medici, Marta; Mozzi, Fernanda; Font de Valdez, Graciela
2010-04-07
To investigate the potential therapeutic effect of exopolysaccharide (EPS)-producing Streptococcus thermophilus (S. thermophilus) CRL 1190 fermented milk on chronic gastritis in Balb/c mice. Balb/c mice were fed with the fermented milk for 7 d after inducing gastritis with acetyl-salicylic acid (ASA, 400 mg/kg body weight per day for 10 d). Omeprazole was included in this study as a positive therapeutic control. The gastric inflammatory activity was evaluated from gastric histology and inflammation score, number of interleukin-10 (IL-10), interferon-gamma (INFgamma) and tumor necrosis factor-alpha (TNF-alpha) cytokine-producing cells in the gastric mucosa, and thickness of the mucus layer. Animals receiving treatment with the EPS-producing S. thermophilus CRL 1190 fermented milk showed a conserved gastric mucosa structure similar to that of healthy animals. Inflammation scores of the fermented milk-treated mice were lower than those of mice in the gastritis group (0.2 + or - 0.03 vs 2.0 + or - 0.6, P mucus gel layer (2.2 + or - 0.6 vs 1.0 + or - 0.3; 5.1 + or - 0.8 vs 1.5 + or - 0.4 in the corpus and antrum mucosa, respectively, P milk suspension of the purified EPS from S. thermophilus CRL1190 was also effective as therapy for gastritis. This study suggests that fermented milk with S. thermophilus CRL 1190 and/or its EPS could be used in novel functional foods as an alternative natural therapy for chronic gastritis induced by ASA.
-
Directory of Open Access Journals (Sweden)
Tong Dan
2018-04-01
Full Text Available The lactic acid bacterium Streptococcus thermophilus is a major starter culture for the production of dairy products. In this study, the physiochemical characteristics of milk fermented by the MGA45-4 isolate of S. thermophilus were analyzed. Our data indicate that milk fermented using S. thermophilus MGA45-4 maintained a high viable cell count (8.86 log10 colony-forming units/mL, and a relatively high pH (4.4, viscosity (834.33 mPa·s, and water holding capacity (40.85% during 14 days of storage. By analyzing the volatile compound profile using solid-phase microextraction and gas chromatography/mass spectrometry, we identified 73 volatile compounds in the fermented milk product, including five carboxylic acids, 21 aldehydes, 13 ketones, 16 alcohols, five esters, and 13 aromatic carbohydrates. According to the odor activity values, 11 of these volatile compounds were found to play a key role in producing the characteristic flavor of fermented milk, particularly octanal, nonanal, hexanal, 2,3-butanedione, and 1-octen-3-ol, which had the highest odor activity values among all compounds analyzed. These findings thus provide more insights in the chemical/molecular characteristics of milk fermented using S. thermophilus, which may provide a basis for improving dairy product flavor/odor during the process of fermentation and storage.
-
Characterization of Exopolysaccharide Produced by Streptococcus thermophilus CC30
Directory of Open Access Journals (Sweden)
Sri Lakshmi Ramya Krishna Kanamarlapudi
2017-01-01
Full Text Available An exopolysaccharide (EPS producing strain CC30 was isolated from raw milk and identified as Streptococcus thermophilus with morphological and 16S sequencing analysis. The strain was shown to produce 1.95 g/L of EPS when grown in skim milk lactose medium at 30°C by increasing the viscosity of the medium. The EPS was isolated and purified, and it was shown to consist of glucose and galactose in 1 : 1 ratio, with molecular weights ranging from 58 to 180 kDa. FTIR spectroscopy indicated the EPS to have amide, hydroxyl, and carboxyl groups. Under Atomic Force Microscopy, EPS showed spike-like lumps of EPS. Scanning Electron Microscopy (SEM studies showed that it had irregular lumps with a coarse surface. The EPS displayed pseudoplastic nature. Thermogravimetric analysis (TGA reported a degradation temperature of 110.84°C. The purified EPS exhibited reducing activity, hydrogen peroxide radical scavenging activity, and emulsification activity. The results of the present study indicated that EPS producing Streptococcus thermophilus could serve as a promising candidate for further exploitation in food industry.
-
Qin, Q Q; Xia, B S; Xiong, Y; Zhang, S X; Luo, Y B; Hao, Y L
2011-01-01
An exopolysaccharide (EPS) producing strain was isolated from Tibetan kefir grains in China, which was identified by 16S rDNA tests and designated as Streptococcus thermophilus 05-34. The high-performance liquid chromatography analysis showed that it was composed of galactose and glucose in a molar ratio of 1.0:0.8 with a molecular mass of 2.5 × 10(4) Da. EPS was further revealed to have α-d-glucose, α-d-galactose, β-d-glucose, and β-d-galactose by Fourier transform infrared spectroscopy combined with 1D (1) H nuclear magnetic resonance spectroscopy. The length of EPS ranged from 10 to 100 nm and the maximal height of lumps was 2.5 nm through atomic force micrograph analysis. Furthermore, yogurt fermented with EPS-producing S. thermophilus 05-34 exhibited lower susceptibility to whey separation, higher viscosity, and sensory scores than those made with non-EPS-producing strain in yogurt production. These results suggested that EPS-producing Streptococcus thermophilus 05-34 provided a potential application in the fermented dairy industry. © 2011 China Agricultural University © 2011 Journal of Food Science © 2011 Institute of Food Technologists®
-
2015-01-01
The objective of this study was to identify the coccoidal bacteria present in 188 samples of fermented yaks’, mares’ and cows’ milk products collected from 12 different regions in Mongolia. Furthermore, we evaluated the fermentation properties of ten selected isolates of the predominant species, Streptococcus (S.) thermophiles, during the process of milk fermentation and subsequent storage of the resulting yoghurt at 4℃. Overall, 159 isolates were obtained from 188 samples using M17 agar. These isolates were presumed to be lactic acid bacteria based on their gram-positive and catalase-negative properties, and were identified to species level using 16S rRNA gene sequence analysis. These coccoid isolates were distributed in four genera and six species: Enterococcus (E.) durans, Enterococcus (E.) faecalis, Lactococcus (Lac.) subsp. lactis, Leuconostoc (Leuc.) lactis, Leuconostoc (Leuc.) mesenteroides. subsp. mesenteroides and S. thermophilus. Among these S. thermophilus was the most common species in most samples. From evaluation of the fermentation characteristics (viable counts, pH, titratable acidity [TA]) of ten selected S. thermophilus isolates we could identify four isolates (IMAU 20246, IMAU20764, IMAU20729 and IMAU20738) that were fast acid producers. IMAU20246 produced the highest concentrations of lactic acid and formic acid. These isolates have potential as starter cultures for yoghurt production. PMID:26761898
-
Kaneko, Daisuke; Igarashi, Toshinori; Aoyama, Kenji
2014-02-19
Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus establish a symbiotic relationship in milk; however, S. thermophilus predominantly grows in soymilk. This study determined that excess diacetyl was notably generated mainly by S. thermophilus in soymilk, and this flavor compound created an unpleasant odor in fermented soymilk. The addition of l-valine to soymilk reduced the amount of diacetyl and increased the levels of acetoin during fermentation by S. thermophilus . In addition, it was found that the expression of the ilvC gene was repressed and that of the als and aldB genes was stimulated in S. thermophilus by l-valine. Sensory evaluations with the triangle difference test and a preference test showed that the soymilk fermented with l-valine was significantly preferred compared with that without l-valine. In this study, we successfully controlled the metabolic flux of S. thermophilus in soymilk and produced more favorable fermented soymilk without the use of genetically modified lactic acid bacteria strains.
-
Ben-Yahia, L; Mayeur, C; Rul, F; Thomas, M
2012-09-01
The yoghurt bacteria, Streptococcus thermophilus and Lactobacillus delbrueckii ssp. bulgaricus, are alleged to have beneficial effects on human health. The objective of this study was to characterise growth, biochemical activity and competitive behaviour of these two bacteria in vitro and in vivo. S. thermophilus LMD-9 and L. bulgaricus ATCC 11842 growth and lactate production were monitored in different media and in the gastrointestinal tract (GIT) of germ-free rats. In vitro, particularly in milk, S. thermophilus had a selective growth advantage over L. bulgaricus. The GIT of germ-free rats not supplemented with lactose was colonised by S. thermophilus but not by L. bulgaricus. Both bacteria were able to colonise the GIT of germ-free rats supplemented with 45 g/l lactose in their drinking water. However, if germ-free rats were inoculated with a mixture of the two bacteria and were supplemented with lactose, S. thermophilus rapidly and extensively colonised the GIT (1010 cfu/g faeces) at the expense of L. bulgaricus, which remained in most cases at levels bulgaricus produced only D-lactate, both in vitro and in vivo. S. thermophilus showed competitive and growth advantage over L. bulgaricus in vitro as well as in vivo in the GIT of germ-free rats and, accordingly, L-lactate was the main lactate isomer produced.
-
The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction
Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.
1989-01-01
Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.
-
Catabolite control of sugar metabolism in Streptococcus thermophilus
Bogaard, van den P.T.C.
2002-01-01
Streptococcus thermophilus
is used in many industrial dairy fermentations that require processing of milk at elevated temperatures. Its primary function is the rapid conversion of lactose to lactate while it also contributes to important sensory qualities. S. -
Anbukkarasi, Kaliyaperumal; UmaMaheswari, Thiyagamoorthy; Hemalatha, Thiagarajan; Nanda, Dhiraj Kumar; Singh, Prashant; Singh, Rameshwar
2014-09-01
Streptococcus thermophilus is an important lactic starter used in the production of yogurt. Most strains of S. thermophilus are galactose negative (Gal(-)) and are able to metabolize only glucose portion of lactose and expel galactose into the medium. This metabolic defect leads to the accumulation of free galactose in yogurt, resulting in galactosemia among consumers. Hence there is an absolute need to develop low galactose yogurt. Therefore, in this study, three galactose positive (Gal(+)) S. thermophilus strains from National Collection of Dairy Cultures (NCDC) viz. NCDC 659 (AJM), NCDC 660 (JM1), NCDC 661 (KM3) and a reference galactose negative (Gal(-)) S. thermophilus NCDC 218 were used for preparation of low galactose yogurt. In milk fermented using S. thermophilus isolates alone, NCDC 659 released less galactose (0.27 %) followed by NCDC 661 (0.3 %) and NCDC 660 (0.45 %) after 10 h at 42 °C. Milk was fermented in combination with Gal(-) L. delbrueckii subsp. bulgaricus NCDC 04, in which NCDC 659 released least galactose upto 0.49 % followed by NCDC 661 (0.51 %) and NCDC 660 (0.60 %) than reference Gal(-) NCDC 218(0.79 %). Low galactose yogurt was prepared following standard procedure using Gal(+) S. thermophilus isolates and Gal(-) L. delbrueckii subsp. bulgaricus NCDC 04 in 1:1 ratio. Among which low galactose yogurt by NCDC 659 combination contained less galactose 0.37 % followed by NCDC 661 (0.51 %), NCDC 660 (0.65 %) and reference Gal(-) NCDC 218 (0.98 %) after 4 h of fermentation. This study clearly reveals that Gal(+) S. thermophilus isolates can be paired with Gal(-) L. delbrueckii subsp. bulgaricus for developing low galactose yogurt.
-
Wang, Xiao-Nan; Qin, Mei; Feng, Yu-Ying; Chen, Jian-Kang; Song, Yi-Shan
2017-09-01
The promotion effect on proliferation of Streptococcus thermophilus by enzymatic hydrolysates of aquatic products was firstly studied. The effect of influencing factors of the hydrolysis on the growth of S. thermophilus was investigated. Grass Carp fish skin was hydrolysed to peptides by enzymatic hydrolysis using protease ProteAX, and for the S. thermophilus growth, the optimal enzymatic hydrolysis conditions were temperature of 60 °C, initial pH of 9.0, enzyme concentration of 10 g kg -1 , hydrolysis time of 80 min, and ratio of material to liquid of 1:2. The Grass Carp fish skin hydrolysate (GCFSH) prepared under the optimum conditions was fractionated to five fragments (GCFSH 1, GCFSH 2, GCFSH 3, GCFSH 4, GCFSH 5) according to molecular weight sizes, in which the fragments GCFSH 4 and GCFSH 5, with molecular weights of less than 1000 Da, significantly promoted the growth of S. thermophilus. The hydrolysis process of Grass Carp fish skin can be simplified, and the peptides with molecular weights below 1000 Da in the hydrolysates are the best nitrogen source for proliferation of S. thermophilus. This work can provide a fundamental theoretical basis for the production of multi-component functional foods, especially in milk drinks or yogurt. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
-
AbiA, a Lactococcal Abortive Infection Mechanism Functioning in Streptococcus thermophilus
Tangney, Mark; Fitzgerald, Gerald F.
2002-01-01
The lactococcal abortive infection mechanisms AbiA and AbiG were introduced into Streptococcus thermophilus 4035, and a range of phages capable of infecting this host were examined for sensitivity to these mechanisms. AbiA proved effective against six phages when examined at a growth temperature of 30°C but had no effect on any of the phages when tested at 37 or 42°C. AbiG failed to affect any of the S. thermophilus phages at 30, 37, or 42°C.
-
AbiA, a lactococcal abortive infection mechanism functioning in Streptococcus thermophilus.
Tangney, Mark; Fitzgerald, Gerald F
2002-12-01
The lactococcal abortive infection mechanisms AbiA and AbiG were introduced into Streptococcus thermophilus 4035, and a range of phages capable of infecting this host were examined for sensitivity to these mechanisms. AbiA proved effective against six phages when examined at a growth temperature of 30 degrees C but had no effect on any of the phages when tested at 37 or 42 degrees C. AbiG failed to affect any of the S. thermophilus phages at 30, 37, or 42 degrees C.
-
Directory of Open Access Journals (Sweden)
Smith E. Evivie
2017-07-01
Full Text Available Lactic acid bacteria play increasingly important roles in the food industry. Streptococcus thermophilus KLDS 3.1003 strain was isolated from traditional yogurt in Inner Mongolia, China. It has shown high antimicrobial activity against selected foodborne and vaginal pathogens. In this study, we investigated and analyzed its complete genome sequence. The S. thermophilus KLDS 3.1003 genome comprise of a 1,899,956 bp chromosome with a G+C content of 38.92%, 1,995 genes, and 6 rRNAs. With the exception of S. thermophilus M17TZA496, S. thermophilus KLDS 3.1003 has more tRNAs (amino acid coding genes compared to some S. thermophilus strains available on the National Centre for Biotechnology Information database. MG-RAST annotation showed that this strain has 317 subsystems with most genes associated with amino acid and carbohydrate metabolism. This strain also has a unique EPS gene cluster containing 23 genes, and may be a mixed dairy starter culture. This information provides more insight into the molecular basis of its potentials for further applications in the dairy and allied industries.
-
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
-
Stephens, Joanna; Turner, David P.J.
2015-01-01
Introduction: The ability of Streptococcus thermophilus to convert lactose into lactic acid has long been utilised by the dairy industry. A seemingly low-pathogenicity organism, there have been no previously published reports linking the consumption of foodstuffs to bacteraemia with this bacterium.\\ud Case Presentation: Here we present a case of a regular consumer of Activia yoghurt who developed S. thermophilus bacteraemia probably due to transient bowel ischaemia secondary to polycythaemia....
-
Delorme, Christine; Legravet, Nicolas; Jamet, Emmanuel; Hoarau, Caroline; Alexandre, Bolotin; El-Sharoud, Walid M; Darwish, Mohamed S; Renault, Pierre
2017-02-02
We analyzed 178 Streptococcus thermophilus strains isolated from diverse products, from around the world, over a 60-year period with a new multilocus sequence typing (MLST) scheme. This collection included isolates from two traditional cheese-making sites with different starter-use practices, in sampling campaigns carried out over a three years period. The nucleotide diversity of the S. thermophilus population was limited, but 116 sequence types (ST) were identified. Phylogenetic analysis of the concatenated sequences of the six housekeeping genes revealed the existence of groups confirmed by eBURST analysis. Deeper analyses performed on 25 strains by CRISPR and whole-genome analysis showed that phylogenies obtained by MLST and whole-genome analysis were in agreement but differed from that inferred by CRISPR analysis. Strains isolated from traditional products could cluster in specific groups indicating their origin, but also be mixed in groups containing industrial starter strains. In the traditional cheese-making sites, we found that S. thermophilus persisted on dairy equipment, but that occasionally added starter strains may become dominant. It underlined the impact of starter use that may reshape S. thermophilus populations including in traditional products. This new MLST scheme thus provides a framework for analyses of S. thermophilus populations and the management of its biodiversity. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
-
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
-
Arioli, Stefania; Della Scala, Giulia; Remagni, Maria Chiara; Stuknyte, Milda; Colombo, Stefano; Guglielmetti, Simone; De Noni, Ivano; Ragg, Enzio; Mora, Diego
2017-04-17
The proto-cooperation between Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus in the yogurt consortium enhances the growth rate and size of each population. In contrast, the independent growth of the two species in milk leads to a slower growth rate and a smaller population size. In this study, we report the first evidence that the urease activity of S. thermophilus increases the intracellular pH of L. delbrueckii in the absence of carbon source. However, in milk, in the presence of lactose the alkalizing effect of urea-derived ammonia was not detectable. Nevertheless, based on glucose consumption and lactic acid production at different pH in , L. delbrueckii showed an optimum of glycolysis and homolactic fermentation at alkaline pH values. In milk, we observed that ammonia provided by urea hydrolysis boosted lactic acid production in S. thermophilus and in L. delbrueckii when the species were grown alone or in combination. Therefore, we propose that urease activity acts as an altruistic cooperative trait, which is costly for urease-positive individuals but provides a local benefit because other individuals can take advantage of urease-dependent ammonia release. Copyright © 2016 Elsevier B.V. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Azat Gabdulkhakov
2017-02-01
Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.
-
International Nuclear Information System (INIS)
Wilkins, D.W.; Schmidt, R.H.; Shireman, R.B.; Smith, K.L.; Jezeski, J.J.
1986-01-01
To evaluate the synthesis of acetaldehyde from threonine during growth of yogurt cultures, Streptococcus thermophilus MS1 and Lactobacillus bulgaricus MR1 were grown in defined medium in which 10% of the total threonine was composed of L-[carbon-14(U)]threonine. Acetaldehyde production was monitored by formation of 2,4-dinitrophenylhydrazone followed by separation and analysis using high performance liquid chromatography. After growth for 8 h at 42 0 C, approximately 2.0% of the total acetaldehyde (780.4 nmol) produced was from L-[carbon-14]threonine. Threonine aldolase activity was determined in cell-free extracts from S. thermophilus and L. bulgaricus grown in Elliker broth. Increasing incubation temperature from 30 to 42 0 C decreased threonine aldolase activity in cells of the streptococcus harvested after 8 h of incubation. Effect of incubation temperature was more dramatic in cells harvested after 18 h where the activity of cells grown at 48 0 C was 89% lower than that of cells grown at 30 0 C. Cell extracts from S. thermophilus MS1 possessed higher threonine aldolase activity than did those from L. bulgaricus MR1. Increased assay temperature from 30 to 42 0 C increased threonine aldolase activity in S. thermophilus MS1
-
International Nuclear Information System (INIS)
Sun Xingmin; Goehler, Andre; Heller, Knut J.; Neve, Horst
2006-01-01
The ltp gene, located within the lysogeny module of temperate Streptococcus thermophilus phage TP-J34, has been shown to be expressed in lysogenic strain S. thermophilus J34. It codes for a lipoprotein, as demonstrated by inhibition of cleavage of the signal sequence by globomycin. Exposure of Ltp on the surface of Lactococcus lactis protoplasts bearing a plasmid-encoded copy of ltp has been demonstrated by immunogold labeling and electron microscopy. Expression of ltp in prophage- and plasmid-cured S. thermophilus J34-6f interfered with TP-J34 infection. While plating efficiency was reduced by a factor of about 40 and lysis of strain J34-6f in liquid medium was delayed considerably, phage adsorption was not affected at all. Intracellular accumulation of phage DNA was shown to be inhibited by Ltp. This indicates interference of Ltp with infection at the stage of triggering DNA release and injection into the cell, indicating a role of Ltp in superinfection exclusion. Expression of ltp in L. lactis Bu2-60 showed that the same superinfection exclusion mechanism was strongly effective against phage P008, a member of the lactococcal 936 phage species: no plaque-formation was detectable with even 10 9 phage per ml applied, and lysis in liquid medium did not occur. In Lactococcus also, Ltp apparently inhibited phage DNA release and/or injection. Ltp appears to be a member of a family of small, secreted proteins with a 42 amino acids repeat structure encoded by genes of Gram-positive bacteria. Some of these homologous genes are part of the genomes of prophages
-
Temperature Dependence of the Stability of Ion Pair Interactions ...
Indian Academy of Sciences (India)
The occurrence of bridging water molecules between the ions ensures that the ions are not ... The structural features that render this thermostability ..... dehydrogenase single site mutant T198I from Thermus thermophilus with PDB ID 1BDM.
-
Energy Technology Data Exchange (ETDEWEB)
Wilkins, D.W.; Schmidt, R.H.; Shireman, R.B.; Smith, K.L.; Jezeski, J.J.
1986-05-01
To evaluate the synthesis of acetaldehyde from threonine during growth of yogurt cultures, Streptococcus thermophilus MS1 and Lactobacillus bulgaricus MR1 were grown in defined medium in which 10% of the total threonine was composed of L-(carbon-14(U))threonine. Acetaldehyde production was monitored by formation of 2,4-dinitrophenylhydrazone followed by separation and analysis using high performance liquid chromatography. After growth for 8 h at 42/sup 0/C, approximately 2.0% of the total acetaldehyde (780.4 nmol) produced was from L-(carbon-14)threonine. Threonine aldolase activity was determined in cell-free extracts from S. thermophilus and L. bulgaricus grown in Elliker broth. Increasing incubation temperature from 30 to 42/sup 0/C decreased threonine aldolase activity in cells of the streptococcus harvested after 8 h of incubation. Effect of incubation temperature was more dramatic in cells harvested after 18 h where the activity of cells grown at 48/sup 0/C was 89% lower than that of cells grown at 30/sup 0/C. Cell extracts from S. thermophilus MS1 possessed higher threonine aldolase activity than did those from L. bulgaricus MR1. Increased assay temperature from 30 to 42/sup 0/C increased threonine aldolase activity in S. thermophilus MS1.
-
Sieuwerts, Sander; Molenaar, Douwe; van Hijum, Sacha A F T; Beerthuyzen, Marke; Stevens, Marc J A; Janssen, Patrick W M; Ingham, Colin J; de Bok, Frank A M; de Vos, Willem M; van Hylckama Vlieg, Johan E T
2010-12-01
Many food fermentations are performed using mixed cultures of lactic acid bacteria. Interactions between strains are of key importance for the performance of these fermentations. Yogurt fermentation by Streptococcus thermophilus and Lactobacillus bulgaricus (basonym, Lactobacillus delbrueckii subsp. bulgaricus) is one of the best-described mixed-culture fermentations. These species are believed to stimulate each other's growth by the exchange of metabolites such as folic acid and carbon dioxide. Recently, postgenomic studies revealed that an upregulation of biosynthesis pathways for nucleotides and sulfur-containing amino acids is part of the global physiological response to mixed-culture growth in S. thermophilus, but an in-depth molecular analysis of mixed-culture growth of both strains remains to be established. We report here the application of mixed-culture transcriptome profiling and a systematic analysis of the effect of interaction-related compounds on growth, which allowed us to unravel the molecular responses associated with batch mixed-culture growth in milk of S. thermophilus CNRZ1066 and L. bulgaricus ATCC BAA-365. The results indicate that interactions between these bacteria are primarily related to purine, amino acid, and long-chain fatty acid metabolism. The results support a model in which formic acid, folic acid, and fatty acids are provided by S. thermophilus. Proteolysis by L. bulgaricus supplies both strains with amino acids but is insufficient to meet the biosynthetic demands for sulfur and branched-chain amino acids, as becomes clear from the upregulation of genes associated with these amino acids in mixed culture. Moreover, genes involved in iron uptake in S. thermophilus are affected by mixed-culture growth, and genes coding for exopolysaccharide production were upregulated in both organisms in mixed culture compared to monocultures. The confirmation of previously identified responses in S. thermophilus using a different strain combination
-
DEFF Research Database (Denmark)
Duarte, Vinícius da Silva; Giaretta, Sabrina; Treu, Laura
2018-01-01
Streptococcus thermophilus, a very important dairy species, is constantly threatened by phage infection. We report the genome sequences of three S. thermophilus bacteriophages isolated from a dairy environment in the Veneto region of Italy. These sequences will be used for the development of new ...
-
International Nuclear Information System (INIS)
Neve, Horst; Freudenberg, Wiebke; Diestel-Feddersen, Frederike; Ehlert, Regina; Heller, Knut J.
2003-01-01
The temperate Streptococcus thermophilus bacteriophage TP-J34 was identified in the lysogenic host strain J34. The majority of phage particles produced upon induction was defective and noninfectious, consisting of DNA-filled heads lacking tails. A physical map (45.6 kb) was established. Analysis of minor restriction bands of the DNA isolated from phage particles as well as the analysis of the protein pattern indicated that phage TP-J34 is a pac-type phage. This was confirmed by immunoelectron microscopy using antisera raised against virulent cos- and pac-type S. thermophilus phages. The lysogenic host J34 but not its noninducible derivate J34-12 contained phage DNA in the nonintegrated state and exhibited autolysis at elevated temperatures. Prophage-carrying strains grew homogeneously while 16 of 20 prophage-cured derivatives aggregated and sedimented rapidly. When phage TP-J34 was propagated lytically on a prophage-cured host strain, a 2.7-kb site-specific deletion occurred in the phage genome. This deletion was also identified in the prophage DNAs of relysogenized strains
-
ORF Alignment: NC_005835 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available thermophilus HB8] pdb|1V9M|A Chain A, Crystal Structure ... Of The C Subunit Of V-Type Atpase From Th...ermus ... Thermophilus pdb|1R5Z|C Chain C, Crystal Structure Of ... Subunit C Of V-Atpase pdb|...1R5Z|B Chain B, Crystal ... Structure Of Subunit C Of V-Atpase pdb|1R5Z|A ...Chain A, ... Crystal Structure Of Subunit C Of V-Atpase ... Length = 319 ... Query: 5 ... FAYLNARVR
-
ORF Alignment: NC_006461 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available thermophilus HB8] pdb|1V9M|A Chain A, Crystal Structure ... Of The C Subunit Of V-Type Atpase From Th...ermus ... Thermophilus pdb|1R5Z|C Chain C, Crystal Structure Of ... Subunit C Of V-Atpase pdb|...1R5Z|B Chain B, Crystal ... Structure Of Subunit C Of V-Atpase pdb|1R5Z|A ...Chain A, ... Crystal Structure Of Subunit C Of V-Atpase ... Length = 319 ... Query: 5 ... FAYLNARVR
-
Horiuchi, H; Sasaki, Y
2012-06-01
Lactobacillus delbrueckii ssp. bulgaricus (L. bulgaricus) and Streptococcus thermophilus are traditionally used for the manufacture of yogurt. It is said that a symbiotic relationship exists between Strep. thermophilus and L. bulgaricus and this decreases fermentation time. It is well known that L. bulgaricus is stimulated by the formate produced by Strep. thermophilus, and Strep. thermophilus is stimulated by free amino acids and peptides liberated from milk proteins by L. bulgaricus in symbiotic fermentation. We found that acid production by starter culture LB81 composed of L. bulgaricus 2038 and Strep. thermophilus 1131 was greatly accelerated by decreasing dissolved oxygen (DO) to almost 0 mg/kg in the yogurt mix (reduced dissolved oxygen fermentation) and that DO interferes with the symbiotic relationship between L. bulgaricus 2038 and Strep. thermophilus 1131. We attributed the acceleration of acid production of LB81 by reduced dissolved oxygen fermentation mainly to the acceleration of formate production and the suppression of acid production of LB81 by DO mainly to the suppression of formate production. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
-
Liu, Mengjin; Siezen, Roland J; Nauta, Arjen
2009-06-01
Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions.
-
Sharp, Richard J.; Williams, Ralph A. D.
1988-01-01
Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714
-
Lick, Sonja; Drescher, Karsten; Heller, Knut J.
2001-01-01
The ability of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus administered in yogurt to survive the passage through the upper gastrointestinal tract was investigated with Göttingen minipigs that were fitted with ileum T-cannulas. After ingestion of yogurt containing viable microorganisms, ileostomy samples were collected nearly every hour beginning 3 h after food uptake. Living L. delbrueckii subsp. bulgaricus and S. thermophilus were detected in the magnitude of 106 to 107 per gram of intestinal contents (wet weight) in all animals under investigation. A calculation of the minimum amount of surviving bacteria that had been administered is presented. Total DNA extracted from ileostomy samples was subjected to PCR, which was species specific for L. delbrueckii and S. thermophilus and subspecies specific for L. delbrueckii subsp. bulgaricus. All three bacterial groups could be detected by PCR after yogurt uptake but not after uptake of a semisynthetic diet. One pig apparently had developed an endogenous L. delbrueckii flora. When heat-treated yogurt was administered, L. delbrueckii was detected in all animals. S. thermophilus or L. delbrueckii subsp. bulgaricus was not detected, indicating that heat-inactivated cells and their DNAs had already been digested and their own L. delbrueckii flora had been stimulated for growth. PMID:11526016
-
Directory of Open Access Journals (Sweden)
Esra Acar Soykut
2015-02-01
Full Text Available Bu çalışmada 25 adet S. thermophilus ve 25 adet L. bulgaricus fajının elektron mikroskobik incelemesi yapılarak morfolojik karakterizasyonu gerçekleştirilmiştir. S. thermophilus fajlarında izometrik, hegzagonal baş çapının 53-74 nm, kontraktil olmayan kuyruk uzunluğunun 182-290 nm ve kuyruk genişliğinin de 7-14 nm arasında değiştiği görülmüştür. Bu fajlarda yaka, kuyruk plağı ve fibril benzeri yapıya rastlanmamıştır. İncelenen tüm fajlar, elde edilen verilere dayanılarak diğer S. thermophilus fajları gibi Ackermann sınıflaması Siphoviridae familyasına ve/veya Bradley sınıflaması B grubuna dâhil edilmiştir. S. thermophilus fajlarında olduğu gibi Lb. bulgaricus fajlarında da izometrik, hegzagonal kapsit ve kontraktil olmayan kuyruk yapısı belirlenmiştir. Kapsit çapları 47-73 nm arasında değişirken, kontraktil olmayan kuyruk uzunlukları 117-162 nm ve kuyruk enleri 7-13 nm arasında bulunmuştur. Ackermann sınıflaması Siphoviridae familyasına ve/veya Bradley sınıflaması B grubuna dâhil edilen bu fajlarda yaka, kuyruk tablası ve fibril yapısının varlığı dikkat çekmiştir. S. thermophilus ve L. bulgaricus faj örneklerinin hazırlanmasındaki farklılıkların ve kullanılan elektron mikroskop tiplerinin kuyruk yapılarının görünebilirliğini etkilediği düşünülmüştür.
-
Directory of Open Access Journals (Sweden)
Ana Carolina Sampaio Dória Chaves
2003-11-01
Full Text Available The typical yogurt flavor is caused by acetaldehyde produced through many different pathways by the yogurt starter bacteria L. bulgaricus and S. thermophilus. The attention was focused on one specific reaction for acetaldehyde and folic acid formation catalyzed by serine hydroxymethyltransferase (SHMT, encoded by the glyA gene. In S. thermophilus, this enzyme SHMT also plays the typical role of the enzyme threonine aldolase (TA that is the interconvertion of threonine into glycine and acetaldehyde. The behavior of engineered S. thermophilus strains in milk fermentation is described, folic acid and acetaldehyde production were measured and pH and counts were followed. The engineered S. thermophilus strains StA2305 and StB2305, have the glyA gene (encoding the enzyme serine hydroxymethyltransferase overexpressed. These engineered strains showed normal growth in milk when it was supplemented with Casitione. When they were used in milk fermentation it was observed an increase in folic acid and in acetaldehyde production by StA2305 and for StB2305 it was noticed a significative increase in folic acid formation.O acetaldeído, responsável pelo sabor e aroma característicos de iogurte, é produzido por diferentes vias metabólicas pelas bactérias lácticas: Streptococcus thermophilus (S. thermophilus e Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus. Neste trabalho, a atenção foi focada especificamente na reação para a formação de acetaldeído e de ácido fólico, catalisada pela enzima serina hidroximetil transferase (SHMT, codificada pelo gene glyA. A enzima SHMT catalisa diversas reações e, no caso da bactéria S. thermophilus, ela exerce também a atividade característica da enzima treonina aldolase (TA, definida como a interconversão do aminoácido treonina em glicina e acetaldeído. Foram construídas linhagens de S. thermophilus (StA2305 e StB2305 com super expressão do gene glyA. Estas linhagens modificadas apresentaram
-
Liu, Mengjin; Siezen, Roland J.; Nauta, Arjen
2009-01-01
Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We performed an in silico analysis, combining gene composition and gene transfer mechanism-associated features, and predicted horizontally transferred genes in both L. bulgaricus and S. thermophilus. Putative horizontal gene transfer (HGT) events that have occurred between the two bacterial species include the transfer of exopolysaccharide (EPS) biosynthesis genes, transferred from S. thermophilus to L. bulgaricus, and the gene cluster cbs-cblB(cglB)-cysE for the metabolism of sulfur-containing amino acids, transferred from L. bulgaricus or Lactobacillus helveticus to S. thermophilus. The HGT event for the cbs-cblB(cglB)-cysE gene cluster was analyzed in detail, with respect to both evolutionary and functional aspects. It can be concluded that during the coexistence of both yogurt starter species in a milk environment, agonistic coevolution at the genetic level has probably been involved in the optimization of their combined growth and interactions. PMID:19395564
-
Dan, Tong; Wang, Dan; Wu, Shimei; Jin, Rulin; Ren, Weiyi; Sun, Tiansong
2017-09-29
Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus are key factors in the fermentation process and the final quality of dairy products worldwide. This study was performed to investigate the effects of the proportions of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus isolated from traditionally fermented dairy products in China and Mongolia on the profile of volatile compounds produced in samples. Six proportional combinations (1:1, 1:10, 1:50, 1:100, 1:1000, and 1:10,000) of L. delbrueckii subsp. bulgaricus IMAU20401 to S. thermophilus ND03 were considered, and the volatiles were identified and quantified by solid-phase microextraction and gas chromatography-mass spectrometry (SPME-GC-MS) against an internal standard. In total, 89 volatile flavor compounds, consisting of aldehydes, ketones, acids, alcohols, esters, and aromatic hydrocarbons, were identified. Among these, some key flavor volatile compounds were identified, including acetaldehyde, 3-methylbutanal, acetoin, 2-heptanone, acetic acid, butanoic acid, and 3-methyl-1-butanol. The of L. delbrueckii subsp. bulgaricus IMAU20401 to S. thermophilus ND03 influenced the type and concentration of volatiles produced. In particular, aldehydes and ketones were present at higher concentrations in the 1:1000 treatment combination than in the other combinations. Our findings emphasize the importance of selecting the appropriate proportions of L. delbrueckii subsp. bulgaricus and S. thermophilus for the starter culture in determining the final profile of volatiles and the overall flavor of dairy products.
-
Directory of Open Access Journals (Sweden)
Tong Dan
2017-09-01
Full Text Available Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus are key factors in the fermentation process and the final quality of dairy products worldwide. This study was performed to investigate the effects of the proportions of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus isolated from traditionally fermented dairy products in China and Mongolia on the profile of volatile compounds produced in samples. Six proportional combinations (1:1, 1:10, 1:50, 1:100, 1:1000, and 1:10,000 of L. delbrueckii subsp. bulgaricus IMAU20401 to S. thermophilus ND03 were considered, and the volatiles were identified and quantified by solid-phase microextraction and gas chromatography–mass spectrometry (SPME-GC-MS against an internal standard. In total, 89 volatile flavor compounds, consisting of aldehydes, ketones, acids, alcohols, esters, and aromatic hydrocarbons, were identified. Among these, some key flavor volatile compounds were identified, including acetaldehyde, 3-methylbutanal, acetoin, 2-heptanone, acetic acid, butanoic acid, and 3-methyl-1-butanol. The of L. delbrueckii subsp. bulgaricus IMAU20401 to S. thermophilus ND03 influenced the type and concentration of volatiles produced. In particular, aldehydes and ketones were present at higher concentrations in the 1:1000 treatment combination than in the other combinations. Our findings emphasize the importance of selecting the appropriate proportions of L. delbrueckii subsp. bulgaricus and S. thermophilus for the starter culture in determining the final profile of volatiles and the overall flavor of dairy products.
-
Settachaimongkon, S.; Nout, M.J.R.; Antunes Fernandes, E.C.; Hettinga, K.A.; Vervoort, J.J.M.; Hooijdonk, van A.C.M.; Zwietering, M.H.; Smid, E.J.; Valenberg, van H.J.F.
2014-01-01
Proto-cooperation between Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus is one of the key factors that determine the fermentation process and final quality of yoghurt. In this study, the interaction between different proteolytic strains of S. thermophilus and L.
-
SASAKI, Yasuko; HORIUCHI, Hiroshi; KAWASHIMA, Hiroko; MUKAI, Takao; YAMAMOTO, Yuji
2014-01-01
We previously reported that dissolved oxygen (DO) suppresses yogurt fermentation with an industrial starter culture composed of Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) 2038 and Streptococcus thermophilus 1131, and also found that reducing the DO in the medium prior to fermentation (deoxygenated fermentation) shortens the fermentation time. In this study, we found that deoxygenated fermentation primarily increased the cell number of S. thermophilus 1131 rather than that of ...
-
DEFF Research Database (Denmark)
Wong, Mei Mei Jaslyn Elizabeth; Midtgaard, Søren Roi; Gysel, Kira
2015-01-01
of multiple LysM domains in substrate binding has so far lacked support from high-resolution structures of ligand-bound complexes. Here, a structural study of the Thermus thermophilus NlpC/P60 endopeptidase containing two LysM domains is presented. The crystal structure and small-angle X-ray scattering...
-
Chang, Young-Cheol; Choi, DuBok; Kikuchi, Shintaro
2012-01-01
For biological extraction of heavy metals from chromated copper arsenate (CCA) treated wood, different bacteria were investigated. The extraction rates of heavy metals using Lactobacillusbulgaricus and Streptococcusthermophilus were highest. The chemical extraction rates were depended on the amounts of pyruvic acid and lactic acid. Especially, the extraction rates using mixed pyruvic acid and lactic acid were increased compared to those of sole one. They were also enhanced in the mixed culture of L. bulgaricus and S. thermophilus. To improve the extraction of CCA, a two-step processing procedure with the mixed culture of L. bulgaricus and S. thermophilus was conducted. A maximum of 93% of copper, 86.5% of chromium, and 97.8% of arsenic were extracted after 4 days. These results suggest that a two-step process with the mixed culture of L. bulgaricus and S. thermophilus is most effective to extract heavy metals from CCA treated wood. Copyright © 2011 Elsevier Ltd. All rights reserved.
-
Boutry, Céline; Delplace, Brigitte; Clippe, André; Fontaine, Laetitia; Hols, Pascal
2013-02-01
Streptococcus includes species that either contain or lack the LexA-like repressor (HdiR) of the classical SOS response. In Streptococcus pneumoniae, a species which belongs to the latter group, SOS response inducers (e.g., mitomycin C [Mc] and fluoroquinolones) were shown to induce natural transformation, leading to the hypothesis that DNA damage-induced competence could contribute to genomic plasticity and stress resistance. Using reporter strains and microarray experiments, we investigated the impact of the SOS response inducers mitomycin C and norfloxacin and the role of HdiR on competence development in Streptococcus thermophilus. We show that both the addition of SOS response inducers and HdiR inactivation have a dual effect, i.e., induction of the expression of SOS genes and reduction of transformability. Reduction of transformability results from two different mechanisms, since HdiR inactivation has no major effect on the expression of competence (com) genes, while mitomycin C downregulates the expression of early and late com genes in a dose-dependent manner. The downregulation of com genes by mitomycin C was shown to take place at the level of the activation of the ComRS signaling system by an unknown mechanism. Conversely, we show that a ComX-deficient strain is more resistant to mitomycin C and norfloxacin in a viability plate assay, which indicates that competence development negatively affects the resistance of S. thermophilus to DNA-damaging agents. Altogether, our results strongly suggest that SOS response activation and competence development are antagonistic processes in S. thermophilus.
-
Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.
2003-01-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance se...
-
Tayyarcan, Emine Kübra; Acar Soykut, Esra; Boyaci, Ismail Hakki
2018-04-11
In this study, a method combining Raman spectroscopy with chemometric analysis was developed for detection of phage presence in raw milk and discrimination of Streptococcus thermophilus and Lactobacillus bulgaricus phages which are among the main phages causing problems in dairy industry. For this purpose, S. thermophilus and L. bulgaricus phages were added into raw milk separately, and then some pretreatments such as fat separation, removal of casein, and filtration were applied to the raw milk samples. Raman spectra of the samples were collected and then analyzed using principal component analysis in order to discriminate these phages in raw milk. In the next step, dilutions of S. thermophilus phages in pretreated raw milk were prepared, and Raman spectra were collected. These spectra were analyzed by using partial least squares method to quantify phages in low titer. Consequently, it has been demonstrated that S. thermophilus and L. bulgaricus phages, which have titers sufficient to fail the fermentation (~ 10 7 pfu/mL) and have lower titers (10 2 -10 3 pfu/mL), could be discriminated from antibiotic and each other. Additionally, low concentrations of S. thermophilus phages (10 2 pfu/mL) could be detected through Raman spectroscopy with a short analysis time (60 min) and high coefficient of determination (R 2 ) values for both calibration (0.985) and validation (0.906) with a root mean square error of calibration of 70.54 and root mean square error of prediction of 165.47. However, a lower success was achieved with L. bulgaricus phages and the obtained coefficient of determination values were not sufficiently high (0.649).
-
2011-01-01
Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978
-
Functional consequences of T-stem mutations in E. coli tRNA Thr UGU in vitro and in vivo
DEFF Research Database (Denmark)
Saks, Margaret E; Sanderson, Lee E; Choi, Daniel S
2011-01-01
The binding affinities between Escherichia coli EF-Tu and 34 single and double base-pair changes in the T stem of E. coli tRNAThrUGU were compared with similar data obtained previously for several aa-tRNAs binding to Thermus thermophilus EF-Tu. With a single exception, the two proteins bound to m...
-
Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.
Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G
1987-11-01
Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.
-
Siletsky, Sergey A; Belevich, Ilya; Belevich, Nikolai P; Soulimane, Tewfik; Wikström, Mårten
2017-11-01
Two electrogenic phases with characteristic times of ~14μs and ~290μs are resolved in the kinetics of membrane potential generation coupled to single-electron reduction of the oxidized "relaxed" O state of ba 3 oxidase from T. thermophilus (O→E transition). The rapid phase reflects electron redistribution between Cu A and heme b. The slow phase includes electron redistribution from both Cu A and heme b to heme a 3 , and electrogenic proton transfer coupled to reduction of heme a 3 . The distance of proton translocation corresponds to uptake of a proton from the inner water phase into the binuclear center where heme a 3 is reduced, but there is no proton pumping and no reduction of Cu B . Single-electron reduction of the oxidized "unrelaxed" state (O H →E H transition) is accompanied by electrogenic reduction of the heme b/heme a 3 pair by Cu A in a "fast" phase (~22μs) and transfer of protons in "middle" and "slow" electrogenic phases (~0.185ms and ~0.78ms) coupled to electron redistribution from the heme b/heme a 3 pair to the Cu B site. The "middle" and "slow" electrogenic phases seem to be associated with transfer of protons to the proton-loading site (PLS) of the proton pump, but when all injected electrons reach Cu B the electronic charge appears to be compensated by back-leakage of the protons from the PLS into the binuclear site. Thus proton pumping occurs only to the extent of ~0.1 H + /e - , probably due to the formed membrane potential in the experiment. Copyright © 2017 Elsevier B.V. All rights reserved.
-
Wu, Qinglong; Law, Yee-Song; Shah, Nagendra P.
2015-01-01
Most high γ-aminobutyric acid (GABA) producers are Lactobacillus brevis of plant origin, which may be not able to ferment milk well due to its poor proteolytic nature as evidenced by the absence of genes encoding extracellular proteinases in its genome. In the present study, two glutamic acid decarboxylase (GAD) genes, gadA and gadB, were found in high GABA-producing L. brevis NPS-QW-145. Co-culturing of this organism with conventional dairy starters was carried out to manufacture GABA-rich fermented milk. It was observed that all the selected strains of Streptococcus thermophilus, but not Lactobacillus delbrueckii subsp. bulgaricus, improved the viability of L. brevis NPS-QW-145 in milk. Only certain strains of S. thermophilus improved the gadA mRNA level in L. brevis NPS-QW-145, thus enhanced GABA biosynthesis by the latter. These results suggest that certain S. thermophilus strains are highly recommended to co-culture with high GABA producer for manufacturing GABA-rich fermented milk. PMID:26245488
-
Wu, Qinglong; Law, Yee-Song; Shah, Nagendra P
2015-08-06
Most high γ-aminobutyric acid (GABA) producers are Lactobacillus brevis of plant origin, which may be not able to ferment milk well due to its poor proteolytic nature as evidenced by the absence of genes encoding extracellular proteinases in its genome. In the present study, two glutamic acid decarboxylase (GAD) genes, gadA and gadB, were found in high GABA-producing L. brevis NPS-QW-145. Co-culturing of this organism with conventional dairy starters was carried out to manufacture GABA-rich fermented milk. It was observed that all the selected strains of Streptococcus thermophilus, but not Lactobacillus delbrueckii subsp. bulgaricus, improved the viability of L. brevis NPS-QW-145 in milk. Only certain strains of S. thermophilus improved the gadA mRNA level in L. brevis NPS-QW-145, thus enhanced GABA biosynthesis by the latter. These results suggest that certain S. thermophilus strains are highly recommended to co-culture with high GABA producer for manufacturing GABA-rich fermented milk.
-
THE BIOMASS OF Streptococcus thermophilus AND Bifidobacterium longum IN DAIRY MEDIUM WITH BEE POLLEN
Directory of Open Access Journals (Sweden)
N. N. Lomova
2015-02-01
Full Text Available The present study was carried out to investigate the effect of adding different concentrations of bee pollen on the biomass of Streprococus thermophilus and B. longum in the dairy environment. Sampling, preparation and conducting of tests were performed by standard methods of analysis. The counts of Str. thermophilus and B. longum were carried out by using M17 and MRS agar media. The phases growth were determined graphically. Established, that bee pollen stimulates the accumulation of biomass Str. thermophilus on 9–15%, and B. longum – on 2,3–12,7% in an amount of up to 0.2–1.0%. Bee pollen reduces the duration of the lag phase for both types of microorganisms almost to its complete disappearance (1.0%. Pollen (1% prolong stationary phase for streptococci and bifidobacteria to 30% and 20%, respectively. And also, will provide the biomass in the amount of 6 ± 0,1·109 CFU/cm3 (Str. Thermophilus and 2,8 ± 0,1·108 CFU/cm3 (B. longum. Str. thermophilus and B. longum readily assimilate essential micronutrients pollen. Components of bee pollen can act growth stimulants (bifidogenic factor for the studied strains. The data obtained will form the basis of biotechnology dairy drink with bee products.
-
Goh, Yong Jun; Goin, Caitlin; O'Flaherty, Sarah; Altermann, Eric; Hutkins, Robert
2011-08-30
Streptococcus thermophilus represents the only species among the streptococci that has "Generally Regarded As Safe" status and that plays an economically important role in the fermentation of yogurt and cheeses. We conducted comparative genome analysis of S. thermophilus LMD-9 to identify unique gene features as well as features that contribute to its adaptation to the dairy environment. In addition, we investigated the transcriptome response of LMD-9 during growth in milk in the presence of Lactobacillus delbrueckii ssp. bulgaricus, a companion culture in yogurt fermentation, and during lytic bacteriophage infection. The S. thermophilus LMD-9 genome is comprised of a 1.8 Mbp circular chromosome (39.1% GC; 1,834 predicted open reading frames) and two small cryptic plasmids. Genome comparison with the previously sequenced LMG 18311 and CNRZ1066 strains revealed 114 kb of LMD-9 specific chromosomal region, including genes that encode for histidine biosynthetic pathway, a cell surface proteinase, various host defense mechanisms and a phage remnant. Interestingly, also unique to LMD-9 are genes encoding for a putative mucus-binding protein, a peptide transporter, and exopolysaccharide biosynthetic proteins that have close orthologs in human intestinal microorganisms. LMD-9 harbors a large number of pseudogenes (13% of ORFeome), indicating that like LMG 18311 and CNRZ1066, LMD-9 has also undergone major reductive evolution, with the loss of carbohydrate metabolic genes and virulence genes found in their streptococcal counterparts. Functional genome distribution analysis of ORFeomes among streptococci showed that all three S. thermophilus strains formed a distinct functional cluster, further establishing their specialized adaptation to the nutrient-rich milk niche. An upregulation of CRISPR1 expression in LMD-9 during lytic bacteriophage DT1 infection suggests its protective role against phage invasion. When co-cultured with L. bulgaricus, LMD-9 overexpressed genes
-
Honda, Kohsuke; Maya, Shohei; Omasa, Takeshi; Hirota, Ryuichi; Kuroda, Akio; Ohtake, Hisao
2010-08-02
Six thermophilic enzymes from Thermus thermophilus were used to construct an 'artificial bio-synthetic pathway' for the production of 2-deoxyribose 5-phosphate from fructose. By a simple operation using six recombinant Escherichia coli strains producing the thermophilic enzymes, respectively, fructose was converted to 2-deoxyribose 5-phosphate with a molar yield of 55%. Copyright 2010 Elsevier B.V. All rights reserved.
-
Lactose hydrolysis by free and fibre-entrapped β-galactosidase from Streptococcus thermophilus
Directory of Open Access Journals (Sweden)
Zhennai Yang
1993-09-01
Full Text Available To study lactose hydrolysis by β-galactosidase, this enzyme was produced from Streptococcus thermophilus strain 11F and partially purified by acetone and ammonium sulphate fractionation, and ion exchange chromatography on a Q Sepharose FF column. Lactose hydrolysis by the enzyme was affected by lactose concentrations, sugars and milk proteins. The maximum extent of lactose hydrolysis in buffer was obtained with a 15% lactose concentration. Addition of 2% of lactose, glucose, galactose or sucrose in milk inhibited the enzymatic hydrolysis. The enzyme was activated by bovine serum albumin and a combination of αs-casein and β-casein. Of the casein fractions, the principal fraction, αs-casein, was less effective than β-casein and κ-casein. The fibre entrapped enzyme had a temperature optimum of 57°C, and a pH optimum from 7.5 to at least 9.0 with O-nitrophenyl-β-D-galactopyranoside as substrate. By recycling with whey and skim milk through a jacketed glass column (1.6 cm x 30 cm loaded with fibre-entrapped enzyme at 55°C, a lactose hydrolysis of 49.5% and 47.9% was achieved in 11 h and 7 h respectively.
-
Wei, Da-Qiao; Yu, Tian-Tian; Yao, Ji-Cheng; Zhou, En-Min; Song, Zhao-Qi; Yin, Yi-Rui; Ming, Hong; Tang, Shu-Kun; Li, Wen-Jun
2012-11-01
A Gram-negative and aerobic bacterium, designated YIM 77875(T), was isolated from a geothermal soil sample collected at Rehai National Park, Tengchong, Yunnan Province, south-west China. Bacterial growth occurred from 37 to 65 °C (optimum 50 °C), pH 6.0-8.0 (optimum pH 7.0) and 0-1 % NaCl (w/v). Cells were rod-shaped and colonies were convex, circular, smooth, yellow and non-transparent. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain YIM 77875(T) belongs to the genus Lysobacter. The 16S rRNA gene sequence similarity values between strain YIM 77875(T) and other species of the genus Lysobacter were all below 94.7 %. The polar lipids of strain YIM 77875(T) were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and five unknown phospholipids. The predominant respiratory quinone was Q-8 and the G+C content was 68.8 mol%. Major fatty acids were iso-C(16:0), iso-C(15:0) and iso-C(11:0). On the basis of the morphological and chemotaxonomic characteristics, as well as genotypic data, strain YIM 77875(T) represents a novel species, Lysobacter thermophilus sp. nov., in the genus Lysobacter. The type strain is YIM 77875(T) (CCTCC AB 2012064(T) = KCTC 32020(T)).
-
Directory of Open Access Journals (Sweden)
Altermann Eric
2011-08-01
Full Text Available Abstract Background Streptococcus thermophilus represents the only species among the streptococci that has “Generally Regarded As Safe” status and that plays an economically important role in the fermentation of yogurt and cheeses. We conducted comparative genome analysis of S. thermophilus LMD-9 to identify unique gene features as well as features that contribute to its adaptation to the dairy environment. In addition, we investigated the transcriptome response of LMD-9 during growth in milk in the presence of Lactobacillus delbrueckii ssp. bulgaricus, a companion culture in yogurt fermentation, and during lytic bacteriophage infection. Results The S. thermophilus LMD-9 genome is comprised of a 1.8 Mbp circular chromosome (39.1% GC; 1,834 predicted open reading frames and two small cryptic plasmids. Genome comparison with the previously sequenced LMG 18311 and CNRZ1066 strains revealed 114 kb of LMD-9 specific chromosomal region, including genes that encode for histidine biosynthetic pathway, a cell surface proteinase, various host defense mechanisms and a phage remnant. Interestingly, also unique to LMD-9 are genes encoding for a putative mucus-binding protein, a peptide transporter, and exopolysaccharide biosynthetic proteins that have close orthologs in human intestinal microorganisms. LMD-9 harbors a large number of pseudogenes (13% of ORFeome, indicating that like LMG 18311 and CNRZ1066, LMD-9 has also undergone major reductive evolution, with the loss of carbohydrate metabolic genes and virulence genes found in their streptococcal counterparts. Functional genome distribution analysis of ORFeomes among streptococci showed that all three S. thermophilus strains formed a distinct functional cluster, further establishing their specialized adaptation to the nutrient-rich milk niche. An upregulation of CRISPR1 expression in LMD-9 during lytic bacteriophage DT1 infection suggests its protective role against phage invasion. When co
-
International Nuclear Information System (INIS)
Stanislawska-Sachadyn, Anna; Paszko, Zygmunt; Kluska, Anna; Skasko, Elzibieta; Sromek, Maria; Balabas, Aneta; Janiec-Jankowska, Aneta; Wisniewska, Alicja; Kur, Jozef; Sachadyn, Pawel
2005-01-01
MutS ability to bind DNA mismatches was applied to the detection of point mutations in PCR products. MutS recognized mismatches from single up to five nucleotides and retarded the electrophoretic migration of mismatched DNA. The electrophoretic detection of insertions/deletions above three nucleotides is also possible without MutS, thanks to the DNA mobility shift caused by the presence of large insertion/deletion loops in the heteroduplex DNA. Thus, the method enables the search for a broad range of mutations: from single up to several nucleotides. The mobility shift assays were carried out in polyacrylamide gels stained with SYBR-Gold. One assay required 50-200 ng of PCR product and 1-3 μg of Thermus thermophilus his 6 -MutS protein. The advantages of this approach are: the small amounts of DNA required for the examination, simple and fast staining, no demand for PCR product purification, no labelling and radioisotopes required. The method was tested in the detection of cancer predisposing mutations in RET, hMSH2, hMLH1, BRCA1, BRCA2 and NBS1 genes. The approach appears to be promising in screening for unknown point mutations
-
DEFF Research Database (Denmark)
Calles-Enríquez, Marina; Hjort, Benjamin Benn; Andersen, Pia Skov
2010-01-01
to produce histamine. The hdc clusters of S. thermophilus CHCC1524 and CHCC6483 were sequenced, and the factors that affect histamine biosynthesis and histidine-decarboxylating gene (hdcA) expression were studied. The hdc cluster began with the hdcA gene, was followed by a transporter (hdcP), and ended...... with the hdcB gene, which is of unknown function. The three genes were orientated in the same direction. The genetic organization of the hdc cluster showed a unique organization among the lactic acid bacterial group and resembled those of Staphylococcus and Clostridium species, thus indicating possible...... acquisition through a horizontal transfer mechanism. Transcriptional analysis of the hdc cluster revealed the existence of a polycistronic mRNA covering the three genes. The histidine-decarboxylating gene (hdcA) of S. thermophilus demonstrated maximum expression during the stationary growth phase, with high...
-
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...
-
Friesen, R.H.E.; Poolman, B.; Knol, J.
2000-01-01
The quaternary structure of LacS, the lactose transporter of Streptococcus thermophilus, has been determined for the detergent-solubilized and the membrane-reconstituted state of the protein. The quaternary structure of the n-dodecyl-β-D-maltoside-solubilized state was studied using a combination of
-
Ashraf, Rabia; Shah, Nagendra P
2011-10-03
Yoghurt is increasingly being used as a carrier of probiotic bacteria for their potential health benefits. To meet with a recommended level of ≥10(6) viable cells/g of a product, assessment of viability of probiotic bacteria in market preparations is crucial. This requires a working method for selective enumeration of these probiotic bacteria and lactic acid bacteria in yoghurt such as Streptococcus thermophilus, Lactobacillus delbrueckii subsp. bulgaricus, Lb. acidophilus, Lb. casei and Bifidobacterium. This chapter presents an overview of media that could be used for differential and selective enumerations of yoghurt bacteria. De Man Rogosa Sharpe agar containing fructose (MRSF), MRS agar pH 5.2 (MRS 5.2), reinforced clostridial prussian blue agar at pH 5.0 (RCPB 5.0) or reinforced clostridial agar at pH 5.3 (RCA 5.3) are suitable for enumeration of Lb. delbrueckii subsp. bulgaricus when the incubation is carried out at 45°C for 72h. S. thermophilus (ST) agar and M17 are recommended for selective enumeration of S. thermophilus. Selective enumeration of Lb. acidophilus in mixed culture could be made in Rogosa agar added with 5-bromo-4-chloro-3-indolyl-β-d-glucopyranoside (X-Glu) or MRS containing maltose (MRSM) and incubation in a 20% CO2 atmosphere. Lb. casei could be selectively enumerated on specially formulated Lb. casei (LC) agar from products containing yoghurt starter bacteria (S. thermophilus and Lb. delbrueckii subsp. bulgaricus), Lb. acidophilus, Bifidobacterium spp. and Lb. casei. Bifidobacterium could be enumerated on MRS agar supplemented with nalidixic acid, paromomycin, neomycin sulphate and lithium chloride (MRS-NPNL) under anaerobic incubation at 37°C for 72h. Copyright © 2011. Published by Elsevier B.V.
-
Sørensen, Kim I; Curic-Bawden, Mirjana; Junge, Mette P; Janzen, Thomas; Johansen, Eric
2016-06-15
Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus are used in the fermentation of milk to produce yoghurt. These species normally metabolize only the glucose moiety of lactose, secreting galactose and producing lactic acid as the main metabolic end product. We used multiple serial selection steps to isolate spontaneous mutants of industrial strains of S. thermophilus and L. delbrueckii subsp. bulgaricus that secreted glucose rather than galactose when utilizing lactose as a carbon source. Sequencing revealed that the S. thermophilus strains had mutations in the galKTEM promoter, the glucokinase gene, and genes encoding elements of the glucose/mannose phosphotransferase system (PTS). These strains metabolize galactose but are unable to phosphorylate glucose internally or via the PTS. The L. delbrueckii subsp. bulgaricus mutants had mutations in genes of the glucose/mannose PTS and in the pyruvate kinase gene. These strains cannot grow on exogenous glucose but are proficient at metabolizing internal glucose released from lactose by β-galactosidase. The resulting strains can be combined to ferment milk, producing yoghurt with no detectable lactose, moderate levels of galactose, and high levels of glucose. Since glucose tastes considerably sweeter than either lactose or galactose, the sweetness of the yoghurt is perceptibly enhanced. These strains were produced without the use of recombinant DNA technology and can be used for the industrial production of yoghurt with enhanced intrinsic sweetness and low residual levels of lactose. Based on a good understanding of the physiology of the lactic acid bacteria Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, we were able, by selecting spontaneously occurring mutants, to change dramatically the metabolic products secreted into the growth medium. These mutants consume substantially more of the lactose, metabolize some of the galactose, and secrete the remaining galactose
-
Sozzi, Tommaso; Smiley, Martin B.
1980-01-01
Twenty-nine strains of Lactobacillus bulgaricus and 15 strains of Streptococcus thermophilus were tested for resistance to 35 antimicrobial agents by using commercially available sensitivity disks. Approximately 35% of the isolates had uncharacteristic resistance patterns.
-
Kort, Remco; Westerik, Nieke; Mariela Serrano, L; Douillard, François P; Gottstein, Willi; Mukisa, Ivan M; Tuijn, Coosje J; Basten, Lisa; Hafkamp, Bert; Meijer, Wilco C; Teusink, Bas; de Vos, Willem M; Reid, Gregor; Sybesma, Wilbert
2015-12-08
The lactic acid bacterium Lactobacillus rhamnosus GG is the most studied probiotic bacterium with proven health benefits upon oral intake, including the alleviation of diarrhea. The mission of the Yoba for Life foundation is to provide impoverished communities in Africa increased access to Lactobacillus rhamnosus GG under the name Lactobacillus rhamnosus yoba 2012, world's first generic probiotic strain. We have been able to overcome the strain's limitations to grow in food matrices like milk, by formulating a dried starter consortium with Streptococcus thermophilus that enables the propagation of both strains in milk and other food matrices. The affordable seed culture is used by people in resource-poor communities. We used S. thermophilus C106 as an adjuvant culture for the propagation of L. rhamnosus yoba 2012 in a variety of fermented foods up to concentrations, because of its endogenous proteolytic activity, ability to degrade lactose and other synergistic effects. Subsequently, L. rhamnosus could reach final titers of 1E+09 CFU ml(-1), which is sufficient to comply with the recommended daily dose for probiotics. The specific metabolic interactions between the two strains were derived from the full genome sequences of L. rhamnosus GG and S. thermophilus C106. The piliation of the L. rhamnosus yoba 2012, required for epithelial adhesion and inflammatory signaling in the human host, was stable during growth in milk for two rounds of fermentation. Sachets prepared with the two strains, yoba 2012 and C106, retained viability for at least 2 years. A stable dried seed culture has been developed which facilitates local and low-cost production of a wide range of fermented foods that subsequently act as delivery vehicles for beneficial bacteria to communities in east Africa.
-
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
The bacterium Thermus sp. TibetanG7, isolated from hot springs in Tibet, China, was examined for the ability to accumulate cesium from solutions. Environmental conditions were simulated and the effects of pH, K+, Na+ and K+-regimes were then studied to determine the possible role of the bacterium in the formation of cesium-bearing geyserite around these hot springs. In despite of the inhibition of K+ and Na+, the bacterium Thermus sp. TibetanG7 revealed noticeable accumulation of cesium from solutions, with maximum accumulations of 53.49 and 40.41 μmol Cesium/g cell dry weight in Na+ and K+ inhibition experiments, respectively. The accumulation of cesium by this microorganism is rapid, with 40%―50% accumulated within the first 5 min. K+-deficient cells showed a much higher capacity of cesium accumulation compared with K+-sufficient cells. It is evident that the bacteria within the genus thermus play a significant role in the cesium assembly. The formation of cesium-bearing geyserite is also considered.
-
García-Hernández, J; Moreno, Y; Chuan, C; Hernández, M
2012-10-01
Direct Viable Count (DVC) method has been recently combined with fluorescent in situ hybridization (FISH) for the specific detection of viable cells of Lactobacillus delbrueckii subsp. bulgaricus CECT 4005T and Streptococcus thermophilus CECT 801. This method has been used to determine their in vitro viability to gastrointestinal juices, being the resistance of L. delbrueckii subsp. bulgaricus and S. thermophilus 26.2% and 9.2%, respectively. On the other hand, an in vivo study has been carried out with the application of this technique for their detection in human feces, after consuming fermented milk. Cells of L. delbrueckii subsp. bulgaricus CECT 4005T were not detected, whereas viable cells of S. thermophilus CECT 801 were detected in a number higher than 10(3) cells per gram in a 30% of the samples after 4 wk of consumption. DVC-FISH is a quick and culture-independent useful method, which has been applied for the 1st time in an in vivo survival study of LAB. © 2012 Institute of Food Technologists®
-
Settanni, L; Di Grigoli, A; Tornambé, G; Bellina, V; Francesca, N; Moschetti, G; Bonanno, A
2012-04-02
The present work was undertaken to evaluate the influence of the wooden dairy plant equipment on the microbiological characteristics of curd to be transformed into Caciocavallo Palermitano cheese. Traditional raw milk productions were performed concomitantly with standard cheese making trials carried out in stainless steel vat inoculated with a commercial starter. Milk from two different farms (A and B) was separately processed. The wooden vat was found to be a reservoir of lactic acid bacteria (LAB), while unwanted (spoilage and/or pathogenic) microorganisms were not hosted or were present at very low levels. All microbial groups were numerically different in bulk milks, showing higher levels for the farm B. LAB, especially thermophilic cocci, dominated the whole cheese making process of all productions. Undesired microorganisms decreased in number or disappeared during transformation, particularly after curd stretching. LAB were isolated from the wooden vat surface and from all dairy samples, subjected to phenotypic and genetic characterization and identification. Streptococcus thermophilus was the species found at the highest concentration in all samples analyzed and it also dominated the microbial community of the wooden vat. Fourteen other LAB species belonging to six genera (Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Streptococcus and Weissella) were also detected. All S. thermophilus isolates were genetically differentiated and a consortium of four strains persisted during the whole traditional production process. As confirmed by pH and the total acidity after the acidification step, indigenous S. thermophilus strains acted as a mixed starter culture. Copyright © 2012 Elsevier B.V. All rights reserved.
-
PETROLEUM BIOREFINING FOR POLLUTION PREVENTION
Energy Technology Data Exchange (ETDEWEB)
John J. Kilbane II
2002-03-01
The objective of this project was to isolate and characterize thermophilic bacterial cultures that can be used for the selective removal of nitrogen, sulfur, and/or metals in the biorefining of petroleum. The project was completed on schedule and no major difficulties were encountered. Significant progress was made on multiple topics relevant to the development of a petroleum biorefining process capable of operating at thermophilic temperatures. New cultures capable of selectively cleaving C-N or C-S bonds in molecules relevant to petroleum were obtained, and the genes encoding the enzymes for these unique biochemical reactions were cloned and sequenced. Genetic tools were developed that enable the use of Thermus thermophilus as a host to express any gene of interest, and information was obtained regarding the optimum conditions for the growth of T. thermophilus. The development of a practical biorefining process still requires further research and the future research needs identified in this project include the development of new enzymes and pathways for the selective cleavage of C-N or C-S bonds that have higher specific activities, increased substrate range, and are capable of functioning at thermophilic temperatures. Additionally, there is a need for process engineering research to determine the maximum yield of biomass and cloned gene products that can be obtained in fed-batch cultures using T. thermophilus, and to determine the best configuration for a process employing biocatalysts to treat petroleum.
-
Directory of Open Access Journals (Sweden)
Zylicz-Stachula Agnieszka
2009-05-01
Full Text Available Abstract Background Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases, however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Results Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family – TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase and methyltransferase (MTase activities of wild type (wt TspGWI (either recombinant or isolated from Thermus sp. are dependent on the presence of divalent cations. Conclusion TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/EXK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module
-
Genome-scale model of Streptococcus thermophilus LMG18311 for metabolic comparison.
Pastink, M.I.; Teusink, B.; Hols, P.; Visser, S.; Vos, W.M.; Hugenholtz, J.
2009-01-01
In this report, we describe the amino acid metabolism and amino acid dependency of the dairy bacterium Streptococcus thermophilus LMG18311 and compare them with those of two other characterized lactic acid bacteria, Lactococcus lactis and Lactobacillus plantarum. Through the construction of a
-
Directory of Open Access Journals (Sweden)
Ana Lourdes Neves GÂNDARA
2000-04-01
Full Text Available Linhagem selvagem de Streptococcus thermophilus isolada de leite pasteurizado foi avaliada em modelo experimental quanto a adesão em superfície de aço inoxidável e comportamento frente à limpeza e sanificação. Em leite, a adesão do microrganismo em aço inoxidável foi estudada em 6h de contato a 45°C sob agitação e uma higienização com detergentes alcalino e ácido seguida de sanificação foi utilizada para avaliação do comportamento das células aderidas frente à higienização. Esse microrganismo aderiu a essa superfície produzindo uma carga de 10(4UFC/cm². Após a limpeza alcalina não foram detectadas células aderidas; em seguida a limpeza ácida 6 UFC/cm² ainda foram detectadas. A sanificação com hipoclorito de sódio, após a limpeza, foi suficiente para reduzir a carga de S. thermophilus selvagem aderida ao aço inoxidável. O modelo experimental mostrou-se adequado para o estudo, indicando que a cultura selvagem de Streptococcus thermophilus é produtora de biofilme em superfície de aço inoxidável. A limpeza da superfície de aço inoxidável por detergência alcalina remove mais que 99,9% das células aderidas. Pequenos números de células remanescentes são removidos na detergência ácida o que demonstra a necessidade das diferentes etapas e tipos de detergentes para a eficiência da limpeza. Melhores resultados na remoção desse biofilme são alcançadas com detergência alcalina seguida de detergência ácida e mais eficientemente quando se utiliza uma sanificação complementar com hipoclorito de sódio.A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process
-
Settachaimongkon, Sarn; Nout, M J Robert; Antunes Fernandes, Elsa C; Hettinga, Kasper A; Vervoort, Jacques M; van Hooijdonk, Toon C M; Zwietering, Marcel H; Smid, Eddy J; van Valenberg, Hein J F
2014-05-02
Proto-cooperation between Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus is one of the key factors that determine the fermentation process and final quality of yoghurt. In this study, the interaction between different proteolytic strains of S. thermophilus and L. delbrueckii subsp. bulgaricus was investigated in terms of microbial growth, acidification and changes in the biochemical composition of milk during set-yoghurt fermentation. A complementary metabolomics approach was applied for global characterization of volatile and non-volatile polar metabolite profiles of yoghurt associated with proteolytic activity of the individual strains in the starter cultures. The results demonstrated that only non-proteolytic S. thermophilus (Prt-) strain performed proto-cooperation with L. delbrueckii subsp. bulgaricus. The proto-cooperation resulted in significant higher populations of the two species, faster milk acidification, significant abundance of aroma volatiles and non-volatile metabolites desirable for a good organoleptic quality of yoghurt. Headspace SPME-GC/MS and (1)H NMR resulted in the identification of 35 volatiles and 43 non-volatile polar metabolites, respectively. Furthermore, multivariate statistical analysis allows discriminating set-yoghurts fermented by different types of starter cultures according to their metabolite profiles. Our finding underlines that selection of suitable strain combinations in yoghurt starters is important for achieving the best technological performance regarding the quality of product. Copyright © 2014 Elsevier B.V. All rights reserved.
-
Isolation and partial characterization of a biosurfactant produced by Streptococcus thermophilus A
Rodrigues, Ligia R.; Teixeira, Jose A.; van der Mei, Henny C.; Oliveira, Rosario
2006-01-01
Isolation and characterization of the surface active components from the crude biosurfactant produced by Streptococcus thermophilus A was studied. A fraction rich in glycolipids was obtained by the fractionation of crude biosurfactant using hydrophobic interaction chromatography. Molecular (by
-
Complete genome sequence of Hydrogenobacter thermophilus type strain (TK-6T)
Energy Technology Data Exchange (ETDEWEB)
Zeytun, Ahmet [Los Alamos National Laboratory (LANL); Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Han, James [Joint Genome Institute; Tice, Hope [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Ngatchou, Olivier Duplex [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Han, Cliff [Los Alamos National Laboratory (LANL); Detter, J. Chris [Joint Genome Institute, Walnut Creek, California; Ubler, Susanne [Universitat Regensburg, Regensburg, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Wirth, Reinhard [Universitat Regensburg, Regensburg, Germany; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California
2011-01-01
Hydrogenobacter thermophilus Kawasumi et al. 1984 is the type species of the genus Hydrogenobacter. H. thermophilus was the first obligate autotrophic organism reported among aerobic hydrogen-oxidizing bacteria. Strain TK-6T is of interest because of the unusually efficient hydrogen-oxidizing ability of this strain, which results in a faster generation time compared to other autotrophs. It is also able to grow anaerobically using nitrate as an electron acceptor when molecular hydrogen is used as the energy source, and able to aerobically fix CO2 via the reductive tricarboxylic acid cycle. This is the fifth completed genome sequence in the family Aquificaceae, and the second genome sequence determined from a strain derived from the original isolate. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 1,742,932 bp long genome with its 1,899 protein-coding and 49 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.
-
Genome Sequences of Four Italian Streptococcus thermophilus Strains of Dairy Origin
DEFF Research Database (Denmark)
Treu, Laura; Vendramin, Veronica; Bovo, Barbara
2014-01-01
This report describes the genome sequences of four Streptococcus thermophilus strains, namely, TH982, TH985, TH1477, and 1F8CT, isolated from different dairy environments from the Campania and the Veneto regions in Italy. These data are aimed at increasing the genomic information available on thi...
-
The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
Czworkowski, J; Wang, J; Steitz, T A; Moore, P B
1994-01-01
Elongation factor G (EF-G) catalyzes the translocation step of protein synthesis in bacteria, and like the other bacterial elongation factor, EF-Tu--whose structure is already known--it is a member of the GTPase superfamily. We have determined the crystal structure of EF-G--GDP from Thermus thermophilus. It is an elongated molecule whose large, N-terminal domain resembles the G domain of EF-Tu, except for a 90 residue insert, which covers a surface that is involved in nucleotide exchange in E...
-
Activation of silent gal genes in the lac-gal regulon of Streptococcus thermophilus
Vaughan, E.E.; Bogaard, van den P.T.C.; Catzeddu, P.; Kuipers, O.P.; Vos, de W.M.
2001-01-01
Streptococcus thermophilus strain CNRZ 302 is unable to ferment galactose, neither that generated intracellularly by lactose hydrolysis nor the free sugar. Nevertheless, sequence analysis and complementation studies with Escherichia coli demonstrated that strain CNRZ 302 contained structurally
-
Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.
1974-01-01
Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006
-
Randazzo, Cinzia L; Torriani, Sandra; Akkermans, Antoon D L; de Vos, Willem M; Vaughan, Elaine E
2002-04-01
The diversity and dynamics of the microbial communities during the manufacturing of Ragusano cheese, an artisanal cheese produced in Sicily (Italy), were investigated by a combination of classical and culture-independent approaches. The latter included PCR, reverse transcriptase-PCR (RT-PCR), and denaturing gradient gel electrophoresis (DGGE) of 16S rRNA genes (rDNA). Bacterial and Lactobacillus group-specific primers were used to amplify the V6 to V8 and V1 to V3 regions of the 16S rRNA gene, respectively. DGGE profiles from samples taken during cheese production indicated dramatic shifts in the microbial community structure. Cloning and sequencing of rDNA amplicons revealed that mesophilic lactic acid bacteria (LAB), including species of Leuconostoc, Lactococcus lactis, and Macrococcus caseolyticus were dominant in the raw milk, while Streptococcus thermophilus prevailed during lactic fermentation. Other thermophilic LAB, especially Lactobacillus delbrueckii and Lactobacillus fermentum, also flourished during ripening. Comparison of the rRNA-derived patterns obtained by RT-PCR to the rDNA DGGE patterns indicated a substantially different degree of metabolic activity for the microbial groups detected. Identification of cultivated LAB isolates by phenotypic characterization and 16S rDNA analysis indicated a variety of species, reflecting to a large extent the results obtained from the 16S rDNA clone libraries, with the significant exception of the Lactobacillus delbrueckii species, which dominated in the ripening cheese but was not detected by cultivation. The present molecular approaches combined with culture can effectively describe the complex ecosystem of natural fermented dairy products, giving useful information for starter culture design and preservation of artisanal fermented food technology.
-
Busscher, HJ; vanHoogmoed, CG; GeertsemaDoornbusch, GI; vanderKuijlBooij, M; vanderMei, HC
1997-01-01
The adhesion of yeasts, two Candida albicans and two Candida tropicalis strains isolated from naturally colonized voice prostheses, to silicone rubber with and without a salivary conditioning film in the absence and presence of adhering Streptococcus thermophilus B, a biosurfactant-releasing dairy
-
Vargas, Luis A; Olson, Douglas W; Aryana, Kayanush J
2015-04-01
Acid tolerance and bile tolerance are important probiotic characteristics. Whey proteins contain branched-chain amino acids, which play a role in muscle building and are popular among athletes. Increasing emphasis is being placed on diets containing less carbohydrate, less fat, and more protein. The effect of incremental additions of whey protein isolate (WPI) on probiotic characteristics of pure cultures is not known. The objective of this study was to determine the influence of added WPI on acid tolerance and bile tolerance of pure cultures of Streptococcus thermophilus ST-M5 and Lactobacillus bulgaricus LB-12. The WPI was used at 0 (control), 1, 2 and 3% (wt/vol). Assessment of acid tolerance was conducted on pure cultures at 30-min intervals for 2h of acid exposure and bile tolerance at 1-h intervals for 5h of bile exposure. Use of 1, 2, and 3% WPI improved acid tolerance of Strep. thermophilus ST-M5 and Lb. bulgaricus LB-12. The highest counts for acid tolerance of Strep. thermophilus ST-M5 and Lb. bulgaricus LB-12 were obtained when 3% WPI was used. Use of 2 and 3% WPI improved bile tolerance of Strep. thermophilus ST-M5 and Lb. bulgaricus LB-12 over 5h of bile exposure. The use of WPI is recommended to improve acid and bile tolerance of the yogurt culture bacteria Strep. thermophilus ST-M5 and Lb. bulgaricus LB-12. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
-
Linares, Daniel M; O'Callaghan, Tom F; O'Connor, Paula M; Ross, R P; Stanton, Catherine
2016-01-01
Consumer interest in health-promoting food products is a major driving force for the increasing global demand of functional (probiotic) dairy foods. Yogurt is considered the ideal medium for delivery of beneficial functional ingredients. Gamma-amino-butyric acid has potential as a bioactive ingredient in functional foods due to its health-promoting properties as an anti-stress, anti-hypertensive, and anti-diabetic agent. Here, we report the use of a novel Streptococcus thermophilus strain, isolated from the digestive tract of fish, for production of yogurt naturally enriched with 2 mg/ml of gamma-amino-butyric acid (200 mg in a standard yogurt volume of 100 ml), a dose in the same range as that provided by some commercially available gamma-amino-butyric acid supplements. The biotechnological suitability of this strain for industrial production of yogurt was demonstrated by comparison with the reference yogurt inoculated with the commercial CH1 starter (Chr. Hansen) widely used in the dairy industry. Both yogurts showed comparable pH curves [ΔpH/Δ t = 0.31-0.33 h -1 ], viscosity [0.49 Pa-s], water holding capacity [72-73%], and chemical composition [moisture (87-88%), protein (5.05-5.65%), fat (0.12-0.15%), sugar (4.8-5.8%), and ash (0.74-1.2%)]. Gamma-amino-butyric acid was not detected in the control yogurt. In conclusion, the S. thermophilus APC151 strain reported here provides a natural means for fortification of yogurt with gamma-amino-butyric acid.
-
DEFF Research Database (Denmark)
Tetens, Inge
of a health claim related to a combination of Lactobacillus delbrueckii subsp. bulgaricus AY/CSL (LMG P-17224) and Streptococcus thermophilus 9Y/CSL (LMG P-17225) and “beneficial modulation of intestinal microflora”. The scope of the application was proposed to fall under a health claim referring to children......’s development and health. The food constituent that is the subject of the health claim, a combination of L. delbrueckii subsp. bulgaricus AY/CSL (LMG P-17224) and S. thermophilus 9Y/CSL (LMG P-17225), has not been sufficiently characterised. The claimed effect is “beneficial modulation of the intestinal...... that a cause and effect relationship has not been established between the consumption of the food constituent, the combination of L. delbrueckii subsp. bulgaricus AY/CSL (LMG P-17224) and S. thermophilus 9Y/CSL (LMG P-17225), and a beneficial physiological effect related to “beneficial modulation...
-
International Nuclear Information System (INIS)
Hutkins, R.W.; Ponne, C.
1991-01-01
Galactose-nonfermenting (Gal - ) Streptococcus thermophilus TS2 releases galactose into the extracellular medium when grown in medium containing excess lactose. Starved and de-energized Gal - cells, however, could be loaded with galactose to levels approximately equal to the extracellular concentration (0 to 50 mM). When loaded cells were separated from the medium and resuspended in fresh broth containing 5 mM lactose, galactose efflux occurred. De-energized, galactose-loaded cells, resuspended in buffer or medium, accumulated [ 14 C]lactose at a greater rate and to significantly higher intracellular concentrations than unloaded cells. Uptake of lactose by loaded cells was inhibited more than that by unloaded cells in the presence of extracellular galactose, indicating that a galactose gradient was involved in the exchange system. When de-energized, galactose-loaded cells were resuspended in carbohydrate-free medium at pH 6.7, a proton motive force (Δp) of 86 to 90 mV was formed, whereas de-energized, nonloaded cells maintained a Δp of about 56 mV. However, uptake of lactose by loaded cells occurred when the proton motive force was abolished by the addition of an uncoupler or in the presence of a proton-translocating ATPase inhibitor. These results support the hypothesis that galactose efflux in Gal - S. thermophilus is electrogenic and that the exchange reaction (lactose uptake and galactose efflux) probably occurs via an antiporter system
-
Chen, Yujie; Kong, Qing; Chi, Chen; Shan, Shihua; Guan, Bin
2015-10-15
The purpose of this study was to explore the ability of anaerobic solid fermentation of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus to biotransform aflatoxins in peanut meal. The pH of the peanut meal was adjusted above 10, and then heated for 10 min at 100 °C, 115 °C and 121 °C. The S. thermophilus and L. delbrueckii subsp. bulgaricus were precultured together in MRS broth for 48 h at 37 °C. The heated peanut meal was mixed with precultured MRS broth containing 7.0×10(8) CFU/mL of S. thermophilus and 3.0×10(3) CFU/mL of L. delbrueckii subsp. bulgaricus with the ratio of 1 to 1 (weight to volume) and incubated in anaerobic jars at 37 °C for 3 days. The aflatoxin content in the peanut meal samples was determined by HPLC. The results showed that the peanut meal contained mainly aflatoxin B1 (AFB1) (10.5±0.64 μg/kg) and aflatoxin G1 (AFG1) (18.7±0.55 μg/kg). When heat treatment was combined with anaerobic solid fermentation, the biotransformation rate of aflatoxins in peanut meal could attain 100%. The cytotoxicity of fermented peanut meal to L929 mouse connective tissue fibroblast cells was determined by MTT assay and no significant toxicity was observed in the fermented peanut meal. Furthermore, heat treatment and anaerobic solid fermentation did not change the amino acid concentrations and profile in peanut meal. Copyright © 2015 Elsevier B.V. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Yahya eAli
2014-03-01
Full Text Available Lipoprotein Ltp encoded by temperate Streptococcus thermophilus phage TP-J34 is the prototype of the wide-spread family of host cell surface-exposed lipoproteins involved in superinfection exclusion. When screening for other S. thermophilus phages expressing this type of lipoprotein, three temperate phages - TP-EW, TP-DSM20617 and TP-778 - were isolated. In this communication we present the total nucleotide sequences of TP-J34 and TP-778L. For TP-EW, a phage almost identical to TP-J34, besides the ltp gene only the two regions of deviation from TP-J34 DNA were analyzed: the gene encoding the tail protein causing an assembly defect in TP-J34 and the gene encoding the lysin, which in TP-EW contains an intron. For TP-DSM20617 only the sequence of the lysogeny module containing the ltp gene was determined. The region showed high homology to the same region of TP-778. For TP-778 we could show that absence of the attR region resulted in aberrant excision of phage DNA. The amino acid sequence of mature LtpTP-EW was shown to be identical to that of mature LtpTP-J34, whereas the amino acid sequence of mature LtpTP-778 was shown to differ from mature LtpTP-J34 in eight amino acid positions. LtpTP-DSM20617 was shown to differ from LtpTP-778 in just one amino acid position. In contrast to LtpTP-J34, LtpTP-778 did not affect infection of lactococcal phage P008 instead increased activity against phage P001 was noticed.
-
DEFF Research Database (Denmark)
Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal
2008-01-01
The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...
-
Directory of Open Access Journals (Sweden)
Carola eSchröder
2015-06-01
Full Text Available Two genes tagh2 and tbgh2 coding for enzymes with hydrolytic activity towards esculin were identified from the extreme thermophilic, aerobic bacteria Thermus antranikianii (Ta and T. brockianus (Tb. Shortened conserved domains predicted a membership of the enzymes of glycoside hydrolase (GH family 2. At present, β-galactosidase activity is found frequently in GH family 2 but β-glucosidase activity has not been reported in this family before. The enzymes TaGH2 and TbGH2 preferred hydrolysis of nitrophenol-linked β-D-glucopyranosides with specific activities of 3,966 U/mg and 660 U/mg, respectively. Residual activities of 40 % (TaGH2 and 51 % (TbGH2 towards 4-NP-β-D-galactopyranoside were observed. Furthermore, TaGH2 hydrolyzed cellobiose. TbGH2, however, showed no activity on cellobiose or lactose. The enzymes exhibited highest activity at 95 °C (TaGH2 and 90 °C (TbGH2 at pH 6.5. Both enzymes were extremely thermostable and thermal activation up to 250 % was observed at temperatures between 50 and 60 °C. Accordingly, the first thermoactive glycoside hydrolase family 2 enzymes with β glucosidase activity have been identified and characterized. The hydrolysis of cellobiose is a unique property of TaGH2 when compared to the enzymes of GH family 2.
-
Linares, Daniel M.; O’Callaghan, Tom F.; O’Connor, Paula M.; Ross, R. P.; Stanton, Catherine
2016-01-01
Consumer interest in health-promoting food products is a major driving force for the increasing global demand of functional (probiotic) dairy foods. Yogurt is considered the ideal medium for delivery of beneficial functional ingredients. Gamma-amino-butyric acid has potential as a bioactive ingredient in functional foods due to its health-promoting properties as an anti-stress, anti-hypertensive, and anti-diabetic agent. Here, we report the use of a novel Streptococcus thermophilus strain, isolated from the digestive tract of fish, for production of yogurt naturally enriched with 2 mg/ml of gamma-amino-butyric acid (200 mg in a standard yogurt volume of 100 ml), a dose in the same range as that provided by some commercially available gamma-amino-butyric acid supplements. The biotechnological suitability of this strain for industrial production of yogurt was demonstrated by comparison with the reference yogurt inoculated with the commercial CH1 starter (Chr. Hansen) widely used in the dairy industry. Both yogurts showed comparable pH curves [ΔpH/Δt = 0.31-0.33 h-1], viscosity [0.49 Pa-s], water holding capacity [72–73%], and chemical composition [moisture (87–88%), protein (5.05–5.65%), fat (0.12–0.15%), sugar (4.8–5.8%), and ash (0.74–1.2%)]. Gamma-amino-butyric acid was not detected in the control yogurt. In conclusion, the S. thermophilus APC151 strain reported here provides a natural means for fortification of yogurt with gamma-amino-butyric acid. PMID:27920772
-
Directory of Open Access Journals (Sweden)
Daniel M. Linares
2016-11-01
Full Text Available Consumer interest in health-promoting food products is a major driving force for the increasing global demand of functional (probiotic dairy foods. Yoghurt is considered the ideal medium for delivery of beneficial functional ingredients. Gamma-amino-butyric acid has potential as a bioactive ingredient in functional foods due to its health-promoting properties as an anti-stress, anti-hypertensive and anti-diabetic agent. Here we report the use of a novel Streptococcus thermophilus strain, isolated from the digestive tract of fish, for production of yoghurt naturally enriched with 2 mg/ml of gamma-amino-butyric acid (250 mg in a standard yoghurt volume of 125 ml, a dose in the same range as that provided by some commercially available gamma-amino-butyric acid supplements. The biotechnological suitability of this strain for industrial production of yoghurt was demonstrated by comparison with the reference yoghurt inoculated with the commercial CH1 starter (Chr. Hansen widely used in the dairy industry. Both yoghurts showed comparable pH curves ΔpH/Δt = 0.31-0.33 h−1, viscosity 0.49 Pa.s, water holding capacity 72-73%, and chemical composition moisture (87-88 %, protein (5.05-5.65 %, fat (0.12-0.15 %, lactose (4.8-5.8 % and ash (0.74-1.2 %. Gamma-amino-butyric acid was not detected in the control yoghurt. In conclusion, the S. thermophilus APC151 strain reported here provides a natural means for fortification of yoghurt with gamma-amino-butyric acid.
-
Mulepati, Sabin; Bailey, Scott
2011-09-09
RNA transcribed from clustered regularly interspaced short palindromic repeats (CRISPRs) protects many prokaryotes from invasion by foreign DNA such as viruses, conjugative plasmids, and transposable elements. Cas3 (CRISPR-associated protein 3) is essential for this CRISPR protection and is thought to mediate cleavage of the foreign DNA through its N-terminal histidine-aspartate (HD) domain. We report here the 1.8 Å crystal structure of the HD domain of Cas3 from Thermus thermophilus HB8. Structural and biochemical studies predict that this enzyme binds two metal ions at its active site. We also demonstrate that the single-stranded DNA endonuclease activity of this T. thermophilus domain is activated not by magnesium but by transition metal ions such as manganese and nickel. Structure-guided mutagenesis confirms the importance of the metal-binding residues for the nuclease activity and identifies other active site residues. Overall, these results provide a framework for understanding the role of Cas3 in the CRISPR system.
-
Directory of Open Access Journals (Sweden)
Lijing Jiang
2017-12-01
Full Text Available Hydrogenovibrio bacteria are ubiquitous in global deep-sea hydrothermal vents. However, their adaptations enabling survival in these harsh environments are not well understood. In this study, we characterized the physiology and metabolic mechanisms of Hydrogenovibrio thermophilus strain S5, which was first isolated from an active hydrothermal vent chimney on the Southwest Indian Ridge. Physiological characterizations showed that it is a microaerobic chemolithomixotroph that can utilize sulfide, thiosulfate, elemental sulfur, tetrathionate, thiocyanate or hydrogen as energy sources and molecular oxygen as the sole electron acceptor. During thiosulfate oxidation, the strain produced extracellular sulfur globules 0.7–6.0 μm in diameter that were mainly composed of elemental sulfur and carbon. Some organic substrates including amino acids, tryptone, yeast extract, casamino acids, casein, acetate, formate, citrate, propionate, tartrate, succinate, glucose and fructose can also serve as carbon sources, but growth is weaker than under CO2 conditions, indicating that strain S5 prefers to be chemolithoautotrophic. None of the tested organic carbons could function as energy sources. Growth tests under various conditions confirmed its adaption to a mesophilic mixing zone of hydrothermal vents in which vent fluid was mixed with cold seawater, preferring moderate temperatures (optimal 37°C, alkaline pH (optimal pH 8.0, microaerobic conditions (optimal 4% O2, and reduced sulfur compounds (e.g., sulfide, optimal 100 μM. Comparative genomics showed that strain S5 possesses more complex sulfur metabolism systems than other members of genus Hydrogenovibrio. The genes encoding the intracellular sulfur oxidation protein (DsrEF and assimilatory sulfate reduction were first reported in the genus Hydrogenovibrio. In summary, the versatility in energy and carbon sources, and unique physiological properties of this bacterium have facilitated its adaptation to deep
-
Bogaard, Patrick T.C. van den; Kleerebezem, Michiel; Kuipers, Oscar P.; Vos, Willem M. de
2000-01-01
Streptococcus thermophilus, unlike many other gram-positive bacteria, prefers lactose over glucose as the primary carbon and energy source. Moreover, lactose is not taken up by a phosphoenolpyruvate-dependent phosphotransferase system (PTS) but by the dedicated transporter LacS. In this paper we
-
Karakaya, Mustafa; Kılıç, Aydın
1994-01-01
Bu araştırmada, L. bulgaricus, S. thermophilus yoğurt kültürleri ve değişik karbonhidrat kaynakları (sakkaroz, laktoz) kullanılarak, sucuğun fermantasyonu üzerine olan etkileri araştırılmıştır. Olgunlaşma sürelerinin belirlenmesinde sucukların belirli su miktarına (%35) ulaşmaları kriter olarak alınmış ve bu süre içerisinde periyodik olarak laktik asit üretimi ve pH değişimi kontrol edilmiştir. Kullanılan yoğurt kültürleri olgunlaşmanın 4. ve 7. günlerinde pH değişimi üzerine etkili olurken,...
-
Directory of Open Access Journals (Sweden)
Adriana M. Rojas
2015-09-01
Full Text Available The main objective of this research was to determine the proper growth conditions of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus for the production of lactic acid using serum as substract. This serum was obtain from the department of Cesar, Colombia. Lactic acid is the result of the extraction and purification of fermentation broths in which bacteria Lactobacillus delbrueckii subsp bulgaricus and Streptococcus thermophilus are used, which are usually used for the production of yogurt. The substrate was supplemented with yeast extract, ammonium phosphate as a nitrogen source, and calcium carbonate as a neutralizer, in order to optimize the consumption, by the bacteria, of the main carbohydrate present in serum (lactose. During the fermentation (up to 72 h the inoculums concentration, and temperature were controlled. Purification consisted in esterification, filtration of solids formed during the reaction, and removing of water by evaporation and nitrogen influx. Finally, lactic acid was obtained with 78,0% purity (36.7 g/L, which was characterized by infrared spectroscopy
-
Bioremediation potential of a newly isolate solvent tolerant strain Bacillus thermophilus PS11
Directory of Open Access Journals (Sweden)
PAYEL SARKAR
2012-01-01
Full Text Available The increased generation of solvent waste has been stated as one of the most critical environmental problems. Though microbial bioremediation has been widely used for waste treatment but their application in solvent waste treatment is limited since the solvents have toxic effects on the microbial cells. A solvent tolerant strain of Bacillus thermophilus PS11 was isolated from soil by cyclohexane enrichment. Transmission electron micrograph of PS11 showed convoluted cell membrane and accumulation of solvents in the cytoplasm, indicating the adaptation of the bacterial strain to the solvent after 48h of incubation. The strain was also capable of growing in presence of wide range of other hydrophobic solvents with log P-values below 3.5. The isolate could uptake 50 ng/ml of uranium in its initial 12h of growth, exhibiting both solvent tolerance and metal resistance property. This combination of solvent tolerance and metal resistance will make the isolated Bacillus thermophilus PS11 a potential tool for metal bioremediation in solvent rich wastewaters.
-
Tunnicliffe, Verena; Tyler, Jennifer; Dower, John F.
2013-08-01
Flatfish are a major component of the hydrothermal vent community on three seamounts of the northern Mariana Volcanic Arc in the northwest Pacific. Nikko, Kasuga-2 and Daikoku seamounts host vent fields between 375 and 480 m depth where high temperature vents release molten sulphur. The small cynoglossid tonguefish, Symphurus thermophilus Munroe and Hashimoto, is ubiquitous in all vent habitats observed on these seamounts: among extensive fields of tubeworms and mussels and on solid sulphur surfaces on Nikko; on sulphur-rich sediments and barnacle-covered boulders on Kasuga-2; and on recent sulphur flows and on broad areas of loose and semi-consolidated sediments on Daikoku. We recorded repeated forays by individuals onto flows of molten sulphur as these surfaces cooled. Based on observations using ROVs, the mean density is 90 fish/m2 with maximum counts over 200 fish/m2 on Daikoku sediments. Compared to collected tonguefish from Daikoku and Kasuga-2, those from Nikko have significantly greater lengths and, on average, six times the mass. Otolith data indicate upper ages of 13 years with Nikko tonguefish growing significantly faster. Diets of tonguefish on the three seamounts reflect the different habitats and prey availability; in Daikoku specimens, small crustaceans and polychaetes are most common while on Nikko, gut contents are predominantly larger shrimp. We made the unusual observation of stunned midwater fish falling to the seafloor near the vents where S. thermophilus immediately attacked them. This tonguefish has a wide diet range and foraging behaviour that likely influence the differing growth rates and sizes of fish inhabiting the different vent sites. Limited genetic data suggest that larval exchange probably occurs among sites where the common habitat factor is high levels of elemental sulphur forming hard and partly unconsolidated substrata. Here, in the northern range of the Mariana Trench Marine National Monument, S. thermophilus, despite having an
-
Crystal structure of a thermostable Old Yellow Enzyme from Thermus scotoductus SA-01
International Nuclear Information System (INIS)
Opperman, Diederik J.; Sewell, Bryan T.; Litthauer, Derek; Isupov, Mikhail N.; Littlechild, Jennifer A.; Heerden, Esta van
2010-01-01
Recent characterization of the chromate reductase (CrS) from the thermophile Thermus scotoductus SA-01 revealed this enzyme to be related to the Old Yellow Enzyme (OYE) family. Here, we report the structure of a thermostable OYE homolog in its holoform at 2.2 A as well as its complex with p-hydroxybenzaldehyde (pHBA). The enzyme crystallized as octamers with the monomers showing a classical TIM barrel fold which upon dimerization yields the biologically active form of the protein. A sulfate ion is bound above the si-side of the non-covalently bound FMN cofactor in the oxidized solved structure but is displaced upon pHBA binding. The active-site architecture is highly conserved as with other members of this enzyme family. The pHBA in the CrS complex is positioned by hydrogen bonding to the two conserved catalytic-site histidines. The most prominent structural difference between CrS and other OYE homologs is the size of the 'capping domain'. Thermostabilization of the enzyme is achieved in part through increased proline content within loops and turns as well as increased intersubunit interactions through hydrogen bonding and complex salt bridge networks. CrS is able to reduce the C=C bonds of α,β-unsaturated carbonyl compounds with a preference towards cyclic substrates however no activity was observed towards β-substituted substrates. Mutational studies have confirmed the role of Tyr177 as the proposed proton donor although reduction could still occur at a reduced rate when this residue was mutated to phenylalanine.
-
Gráczer, Eva; Varga, Andrea; Melnik, Bogdan; Semisotnov, Gennady; Závodszky, Péter; Vas, Mária
2009-02-10
The refolding mechanism of the homodimeric two-domain 3-isopropylmalate dehydrogenase (IPMDH) from the organisms adapted to different temperatures, Thermus thermophilus (Tt), Escherichia coli (Ec), and Vibrio sp. I5 (Vib), is described. In all three cases, instead of a self-template mechanism, the high extent of symmetry and cooperativity in folding of subunits and domains have been concluded from the following experimental findings: The complex time course of refolding, monitored by Trp fluorescence, consists of a fast (the rate constant varies as 16.5, 25.0, and 11.7 min-1 in the order of Tt, Ec, and Vib IPMDHs) and a slow (the rate constants are 0.11, 0.80, and 0.23 min-1 for the three different species) first-order process. However, a burst increase of Trp fluorescence anisotropy to the value of the native states indicates that in all three cases the association of the two polypeptide chains occurs at the beginning of refolding. This dimeric species binds the substrate IPM, but the native-like interactions of the tertiary and quaternary structures are only formed during the slow phase of refolding, accompanied by further increase of protein fluorescence and appearance of FRET between Trp side chain(s) and the bound NADH. Joining the contacting arms of each subunit also takes place exclusively during this slow phase. To monitor refolding of each domain within the intact molecule of T. thermophilus IPMDH, Trp's (located in separate domains) were systematically replaced with Phe's. The refolding processes of the mutants were followed by measuring changes in Trp fluorescence and in FRET between the particular Trp and NADH. The high similarity of time courses (both in biphasicity and in their rates) strongly suggests cooperative folding of the domains during formation of the native three-dimensional structure of IPMDH.
-
Stachelska, Milena A
2017-12-04
The aim of this paper was to detect Lactobacillus delbrueckii and Streptococcus thermophilus using real-time quantitative PCR assay in 7-day ripening cheese produced from unpasteurised milk. Real-time quantitative PCR assays were designed to identify and enumerate the chosen species of lactic acid bacteria (LAB) in ripened cheese. The results of molecular quantification and classic bacterial enumeration showed a high level of similarity proving that DNA extraction was carried out in a proper way and that genomic DNA solutions were free of PCR inhibitors. These methods revealed the presence of L. delbrueckii and S. thermophilus. The real-time PCR enabled quantification with a detection of 101-103 CFU/g of product. qPCR-standard curves were linear over seven log units down to 101 copies per reaction; efficiencies ranged from 77.9% to 93.6%. Cheese samples were analysed with plate count method and qPCR in parallel. Compared with the classic plate count method, the newly developed qPCR method provided faster and species specific identification of two dairy LAB and yielded comparable quantitative results.
-
Sieuwerts, S.; Molenaar, D.; Hijum, van S.A.F.T.; Beerthuyzen, M.; Stevens, M.J.A.; Janssen, P.W.; Ingham, C.J.; Bok, de F.A.M.; Vos, de W.M.; Hylckama Vlieg, van J.E.T.
2010-01-01
Many food fermentations are performed using mixed cultures of lactic acid bacteria. Interactions between strains are of key importance for the performance of these fermentations. Yogurt fermentation by Streptococcus thermophilus and Lactobacillus bulgaricus (basonym, Lactobacillus delbrueckii subsp.
-
Linares, Daniel M; Arboleya, Silvia; Ross, R Paul; Stanton, Catherine
2017-04-27
Here is presented the whole-genome sequence of Streptococcus thermophilus APC151, isolated from a marine fish. This bacterium produces gamma-aminobutyric acid (GABA) in high yields and is biotechnologically suitable to produce naturally GABA-enriched biofunctional yogurt. Its complete genome comprises 2,097 genes and 1,839,134 nucleotides, with an average G+C content of 39.1%. Copyright © 2017 Linares et al.
-
Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.
Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane
2018-05-14
The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the
-
Greene, A C; Patel, B K; Sheehy, A J
1997-04-01
A thermophilic anaerobic bacterium, designated strain BMAT (T = type strain), was isolated from the production water of Beatrice oil field in the North Sea (United Kingdom). The cells were straight to bent rods (1 to 5 by 0.3 to 0.5 microns) which stained gram negative. Strain BMAT obtained energy from the reduction of manganese (IV), iron(III), and nitrate in the presence of yeast extract, peptone, Casamino Acids, tryptone, hydrogen, malate, acetate, citrate, pyruvate, lactate, succinate, and valerate. The isolate grew optimally at 60 degrees C (temperature range for growth, 50 to 65 degrees C) and in the presence of 2% (wt/vol) NaCl (NaCl range for growth, 0 to 5% [wt/vol]). The DNA base composition was 34 mol% G + C. Phylogenetic analyses of the 16S rRNA gene indicated that strain BMAT is a member of the domain Bacteria. The closest known bacterium is the moderate thermophile Flexistipes sinusarabici (similarity value, 88%). Strain BMAT possesses phenotypic and phylogenetic traits that do not allow its classification as a member of any previously described genus; therefore, we propose that this isolate should be described as a member of a novel species of a new genus, Deferribacter thermophilus gen. nov., sp. nov.
-
The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.
Dong, Yongsheng; Ma, Lei; Duan, Yuanliang
2016-01-01
To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.
-
Directory of Open Access Journals (Sweden)
Hui Tian
2018-04-01
Full Text Available The cell-envelope protease PrtS was proved to be efficient in optimal bacterial growth and fast acidification in pure culture, while its positive effect on the performance of mixed-cultures in milk fermentation was not defined. The aim was to analyze effects of the PrtS on the symbiosis between strains during yoghurt production and cold storage. Two Streptococcus thermophilus strains, KLDS3.1012 and KLDS SM, and two different proteolytic strains of Lactobacillus delbrueckii subsp. Bulgaricus, L7 and L12, were used. Technological properties (viability, acid production, and proteolysis were determined. Comparative genomics was used to analyze the proteolytic system (cell-envelope protease, transport system, intracellular peptidase of Streptococcus thermophilus strains. S. thermophilus KLDS SM possesses an intact gene encoding PrtS (A9497_00420, which was not found in the genome of S. thermophilus KLDS3.1012. This gene is the main difference in the proteolytic system between the two genomes. PrtS endowed KLDS SM high levels of viability during fermentation and cold storage. When combined with a weaker lactobacillus strain during fermentation, the acceleration of acid production of mixed-culture by KLDS SM would start at an earlier time. KLDS SM increased the post-acidification of yoghurts during cold storage, but the pH was steadily maintained during 14–28 days. Results suggest that strains of Streptococcus thermophilus with strong proteolytic ability could be used in a wide range of dairy production. The present study provided data for yoghurt starter development from the point of view of proteolysis.
-
Role of disulphide bonds in a thermophilic serine protease aqualysin I from Thermus aquaticus YT-1.
Sakaguchi, Masayoshi; Takezawa, Makoto; Nakazawa, Rie; Nozawa, Kazutaka; Kusakawa, Taro; Nagasawa, Takeshi; Sugahara, Yasusato; Kawakita, Masao
2008-05-01
A thermophilic serine protease, Aqualysin I, from Thermus aquaticus YT-1 has two disulphide bonds, which are also found in a psychrophilic serine protease from Vibrio sp. PA-44 and a proteinase K-like enzyme from Serratia sp. at corresponding positions. To understand the significance of these disulphide bonds in aqualysin I, we prepared mutants C99S, C194S and C99S/C194S (WSS), in which Cys69-Cys99, Cys163-Cys194 and both of these disulphide bonds, respectively, were disrupted by replacing Cys residues with Ser residues. All mutants were expressed stably in Escherichia coli. The C99S mutant was 68% as active as the wild-type enzyme at 40 degrees C in terms of k(cat) value, while C194S and WSS were only 6 and 3%, respectively, as active, indicating that disulphide bond Cys163-Cys194 is critically important for maintaining proper catalytic site conformation. Mutants C194S and WSS were less thermostable than wild-type enzyme, with a half-life at 90 degrees C of 10 min as compared to 45 min of the latter and with transition temperatures on differential scanning calorimetry of 86.7 degrees C and 86.9 degrees C, respectively. Mutant C99S was almost as stable as the wild-type aqualysin I. These results indicate that the disulphide bond Cys163-Cys194 is more important for catalytic activity and conformational stability of aqualysin I than Cys67-Cys99.
-
Directory of Open Access Journals (Sweden)
Elena Franciosi
2015-01-01
Full Text Available “Nostrano-cheeses” are traditional alpine cheeses made from raw cow’s milk in Trentino-Alto Adige, Italy. This study identified lactic acid bacteria (LAB developing during maturation of “Nostrano-cheeses” and evaluated their potential to produce γ-aminobutyric acid (GABA, an immunologically active compound and neurotransmitter. Cheese samples were collected on six cheese-making days, in three dairy factories located in different areas of Trentino and at different stages of cheese ripening (24 h, 15 days, and 1, 2, 3, 6, and 8 months. A total of 1,059 LAB isolates were screened using Random Amplified Polymorphic DNA-PCR (RAPD-PCR and differentiated into 583 clusters. LAB strains from dominant clusters (n=97 were genetically identified to species level by partial 16S rRNA gene sequencing. LAB species most frequently isolated were Lactobacillus paracasei, Streptococcus thermophilus, and Leuconostoc mesenteroides. The 97 dominant clusters were also characterized for their ability in producing GABA by high-performance liquid chromatography (HPLC. About 71% of the dominant bacteria clusters evolving during cheeses ripening were able to produce GABA. Most GABA producers were Lactobacillus paracasei but other GABA producing species included Lactococcus lactis, Lactobacillus plantarum, Lactobacillus rhamnosus, Pediococcus pentosaceus, and Streptococcus thermophilus. No Enterococcus faecalis or Sc. macedonicus isolates produced GABA. The isolate producing the highest amount of GABA (80.0±2.7 mg/kg was a Sc. thermophilus.
-
A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.
Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I
2016-01-01
We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.
-
Electron-mediating Cu(A) centers in proteins
DEFF Research Database (Denmark)
Epel, Boris; Slutter, Claire S; Neese, Frank
2002-01-01
High field (W-band, 95 GHz) pulsed electron-nuclear double resonance (ENDOR) measurements were carried out on a number of proteins that contain the mixed-valence, binuclear electron-mediating Cu(A) center. These include nitrous oxide reductase (N(2)OR), the recombinant water-soluble fragment...... of subunit II of Thermus thermophilus cytochrome c oxidase (COX) ba(3) (M160T9), its M160QT0 mutant, where the weak axial methionine ligand has been replaced by a glutamine, and the engineered "purple" azurin (purpAz). The three-dimensional (3-D) structures of these proteins, apart from the mutant, are known...... indicates differences in the positions of the imidazole rings relative to the Cu(2)S(2) core. Comparison of the spectral features of the weakly coupled protons of M160QT0 with those of the other investigated proteins shows that they are very similar to those of purpAz, where the Cu(A) center is the most...
-
16O + 16O molecular structures of superdeformed states in S isotopes
Taniguchi, Y.
2017-06-01
Structures of excited states in S isotopes are investigated by using the antisymmetrized molecular dynamics and generator coordinate method (GCM). The GCM basis wave functions are calculated via energy variation with a constraint on the quadrupole deformation parameter β. By applying the GCM after parity and angular momentum projections, the coexistence of positive- and negative-parity superdeformed (SD) bands are predicted in 33-36S except for negative-parity states in 36S. The SD bands have structures of 16O + 16O + valence neutron(s) in molecular orbitals around the two 16O cores in a cluster picture. The configurations of the valence neutron(s) in the SD states are δ and/or π molecular orbitals.
-
Secondary structures of rRNAs from all three domains of life.
Directory of Open Access Journals (Sweden)
Anton S Petrov
Full Text Available Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2° structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU 23S/28S and small subunit (SSU 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only, Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery. Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision.
-
Liu, M.; Siezen, R.J.; Nauta, A.
2009-01-01
Lactobacillus bulgaricus and Streptococcus thermophilus, used in yogurt starter cultures, are well known for their stability and protocooperation during their coexistence in milk. In this study, we show that a close interaction between the two species also takes place at the genetic level. We
-
Directory of Open Access Journals (Sweden)
Ralf Jäger
2016-10-01
Full Text Available Probiotics have immunomodulatory effects. However, little is known about the potential benefit of probiotics on the inflammation subsequent to strenuous exercise. In a double-blind, randomized, placebo controlled, crossover design separated by a 21-day washout, 15 healthy resistance-trained men ingested an encapsulated probiotic Streptococcus (S. thermophilus FP4 and Bifidobacterium (B. breve BR03 at 5 bn live cells (AFU concentration each, or a placebo, daily for 3 weeks prior to muscle-damaging exercise (ClinicalTrials.gov NCT02520583. Isometric strength, muscle soreness, range of motion and girth, and blood interleukin-6 (IL-6 and creatine kinase (CK concentrations were measured from pre- to 72 h post-exercise. Statistical analysis was via mixed models and magnitude-based inference to the standardized difference. Probiotic supplementation resulted in an overall decrease in circulating IL-6, which was sustained to 48 h post-exercise. In addition, probiotic supplementation likely enhanced isometric average peak torque production at 24 to 72 h into the recovery period following exercise (probiotic–placebo point effect ±90% CI: 24 h, 11% ± 7%; 48 h, 12% ± 18%; 72 h, 8% ± 8%. Probiotics also likely moderately increased resting arm angle at 24 h (2.4% ± 2.0% and 48 h (1.9% ± 1.9% following exercise, but effects on soreness and flexed arm angle and CK were unclear. These data suggest that dietary supplementation with probiotic strains S. thermophilus FP4 and B. breve BR03 attenuates performance decrements and muscle tension in the days following muscle-damaging exercise.
-
Jäger, Ralf; Purpura, Martin; Stone, Jason D; Turner, Stephanie M; Anzalone, Anthony J; Eimerbrink, Micah J; Pane, Marco; Amoruso, Angela; Rowlands, David S; Oliver, Jonathan M
2016-10-14
Probiotics have immunomodulatory effects. However, little is known about the potential benefit of probiotics on the inflammation subsequent to strenuous exercise. In a double-blind, randomized, placebo controlled, crossover design separated by a 21-day washout, 15 healthy resistance-trained men ingested an encapsulated probiotic Streptococcus ( S. ) thermophilus FP4 and Bifidobacterium ( B. ) breve BR03 at 5 bn live cells (AFU) concentration each, or a placebo, daily for 3 weeks prior to muscle-damaging exercise (ClinicalTrials.gov NCT02520583). Isometric strength, muscle soreness, range of motion and girth, and blood interleukin-6 (IL-6) and creatine kinase (CK) concentrations were measured from pre- to 72 h post-exercise. Statistical analysis was via mixed models and magnitude-based inference to the standardized difference. Probiotic supplementation resulted in an overall decrease in circulating IL-6, which was sustained to 48 h post-exercise. In addition, probiotic supplementation likely enhanced isometric average peak torque production at 24 to 72 h into the recovery period following exercise (probiotic-placebo point effect ±90% CI: 24 h, 11% ± 7%; 48 h, 12% ± 18%; 72 h, 8% ± 8%). Probiotics also likely moderately increased resting arm angle at 24 h (2.4% ± 2.0%) and 48 h (1.9% ± 1.9%) following exercise, but effects on soreness and flexed arm angle and CK were unclear. These data suggest that dietary supplementation with probiotic strains S. thermophilus FP4 and B. breve BR03 attenuates performance decrements and muscle tension in the days following muscle-damaging exercise.
-
Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A
2010-02-01
Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.
-
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
-
Characterization of Thermostable Cellulases Produced by Bacillus and Geobacillus Strains
Bacterial community composition of thermophilic (60 deg C) mixed cellulose-enrichment cultures was examined by constructing a 16S rDNA clone library which demonstrated major lineages affiliated to Actinobacteria, Bacteroidetes, Chloroflexi, Deinococcus-Thermus, Firmicutes, and Proteobacteria. A tot...
-
Junjua, M.; Galia, W.; Gaci, N.; Uriot, O.; Genay, M.; Bachmann, H.; Kleerebezem, M.; Dary, A.; Roussel, Y.
2014-01-01
Aims
To construct and validate the recombinase-based in vivo expression technology (R-IVET) tool in Streptococcus thermophilus (ST).
Methods and Results
The R-IVET system we constructed in the LMD-9 strain includes the plasmid pULNcreB allowing transcriptional fusion -
Jia, Dong-Xu; Zhou, Lin; Zheng, Yu-Guo
2017-04-01
Glucose isomerase (GI) is used in vitro to convert d-glucose to d-fructose, which is capable of commercial producing high fructose corn syrup (HFCS). To manufacture HFCS at elevated temperature and reduce the cost of enriching syrups, novel refractory GIs from Thermoanaerobacterium xylanolyticum (TxGI), Thermus oshimai (ToGI), Geobacillus thermocatenulatus (GtGI) and Thermoanaerobacter siderophilus (TsGI) were screened via genome mining approach. The enzymatic characteristics research showed that ToGI had higher catalytic efficiency and superior thermostability toward d-glucose among the screened GIs. Its optimum temperature reached 95°C and could retain more than 80% of initial activity in the presence of 20mM Mn 2+ at 85°C for 48h. The K m and k cat /K m values for ToGI were 81.46mM and 21.77min -1 mM -1 , respectively. Furthermore, the maximum conversion yield of 400g/L d-glucose to d-fructose at 85°C was 52.16%. Considering its excellent high thermostability and ameliorable application performance, ToGI might be promising for realization of future industrial production of HFCS at elevated temperature. Copyright © 2017 Elsevier Inc. All rights reserved.
-
Coherent 40 Gb/s SP-16QAM and 80 Gb/s PDM-16QAM in an Optimal Supercomputer Optical Switch Fabric
DEFF Research Database (Denmark)
Karinou, Fotini; Borkowski, Robert; Zibar, Darko
2013-01-01
We demonstrate, for the first time, the feasibility of using 40 Gb/s SP-16QAM and 80 Gb/s PDM-16QAM in an optimized cell switching supercomputer optical interconnect architecture based on semiconductor optical amplifiers as ON/OFF gates.......We demonstrate, for the first time, the feasibility of using 40 Gb/s SP-16QAM and 80 Gb/s PDM-16QAM in an optimized cell switching supercomputer optical interconnect architecture based on semiconductor optical amplifiers as ON/OFF gates....
-
Geertsma, Eric R.; Duurkens, Ria H.; Poolman, Bert
2005-01-01
The metabolism of lactose by Streptococcus thermophilus is highly regulated, allowing the bacterium to prefer lactose over glucose as main source of carbon and energy. In vitro analysis of the enzymes involved in transport and hydrolysis of lactose showed that the transport reaction benefits from
-
García-Hernández, J; Moreno, Y; Amorocho, C M; Hernández, M
2012-03-01
We have developed a direct viable count (DVC)-FISH procedure for quickly and easily discriminating between viable and nonviable cells of Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus strains, the traditional yogurt bacteria. direct viable count method has been modified and adapted for Lact. delbrueckii subsp. bulgaricus and Strep. thermophilus analysis by testing different times of incubation and concentrations of DNA-gyrase inhibitors. DVC procedure has been combined with fluorescent in situ hybridization (FISH) for the specific detection of viable cells of both bacteria with specific rRNA oligonucleotide probes (DVC-FISH). Of the four antibiotics tested (novobiocin, nalidixic acid, pipemidic acid and ciprofloxacin), novobiocin was the most effective for DVC method and the optimum incubation time was 7 h for both bacteria. The number of viable cells was obtained by the enumeration of specific hybridized cells that were elongated at least twice their original length for Lactobacillus and twice their original size for Streptococcus. This technique was successfully applied to detect viable cells in inoculated faeces. Results showed that this DVC-FISH procedure is a quick and culture-independent useful method to specifically detect viable Lact. delbrueckii subsp. bulgaricus and Strep. thermophilus in different samples, being applied for the first time to lactic acid bacteria. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.
-
Directory of Open Access Journals (Sweden)
Amin Fatoni
2012-11-01
Full Text Available Limited reserves of fossil energy stimulate researchers to explore for a new alternative energy, such as bioethanol.A thermophilic amylase producing bacterium was isolated from local hot-springs and its characteristic and potential applicationfor bioethanol production was determined. The obtained amylase was studied to determine its optimum temperature, pH,enzymatic reaction time, and substrate concentration. Tapioca waste was used as the substrate to find the potential of theamylase for degrading starch into glucose, and then the process was continued by fermentation to produce bioethanol. Theamylase producer bacterium was proposed as genus Thermus sp. The crude amylase that was obtained has the optimumtemperature of 60°C and optimum pH of 8.0, optimum substrate concentration at 10% (w/w and optimum enzymatic reactiontime of 45 minutes. These enzymes convert the starches of waste tapioca at optimum conditions, with the result of 2.9%ethanol produced from raw materials.
-
Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA
Energy Technology Data Exchange (ETDEWEB)
Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.
2007-01-01
Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.
-
DEFF Research Database (Denmark)
Oledzka, G.; Dabrowski, Slawomir; Kur, J.
2003-01-01
Aqualysin I is a heat-stable subtilisin-type serine protease which is secreted into the culture medium by Thermus aquaticus YT-1, an extreme thermophile. We report the high-level expression of an aqualysin I protein using its native signal sequence for secretion in the methylotrophic yeast, Pichia...... to that of the native enzyme. We also explored the possibility of secreting the GAP expressed aqualysin I in P. pastoris by in-frame fusion of the Saccharomyces cerevisiae alpha-factor secretion signal. However, the levels of secreted pro-aqualysin I particles were approximately 10 times lower, possibly...
-
Khanal, Som N; Lucey, John A
2017-09-01
The yield and chemical structures of exopolysaccharides (EPS) produced by many strains of Streptococcus thermophilus have been characterized. However, the kinetics (or production profile) for EPS during milk fermentation is not clear. In this study, we investigated whether any differences existed in the yield and molar mass of EPS when milk was fermented at the same acidification rate by 2 strains of S. thermophilus (St-143 and ST-10255y). The type of EPS produced by these 2 strains is different. Milk samples were analyzed for EPS concentration every 30 min during a fermentation period of 270 min (final pH 4.5) by using a modified quantification method, which was faster and validated for its recovery of added EPS. Rheological properties of milks during fermentation were also analyzed using small-strain dynamic oscillatory rheology. For the determination of molar mass, EPS extracts were isolated by ultrafiltration of whey obtained during fermentation of milk to pH values 5.2, 4.9, 4.7, and 4.5, and molar mass was analyzed using size-exclusion chromatography-multi-angle laser light scattering. During fermentation, both strains appeared to start producing significant amounts of EPS after about ∼150 min, which corresponded to pH ∼5.3, which was close to the point of gelation. During the remainder of the fermentation process (150-270 min), the EPS concentration from strains St-143 and ST-10255y significantly increased from 30 to 72 mg/L and from 26 to 56 mg/L, respectively. The quantity of EPS recovered by our modified method was estimated to represent ∼60% of the total EPS added to milk. The molar mass of EPS produced by both strains appeared to slightly decrease during fermentation. At pH 5.2, EPS from St-143 and ST-10255y had molar masses of 2.9 × 10 6 and 1.4 × 10 6 g/mol, respectively, which decreased to 1.6 × 10 6 and 0.8 × 10 6 g/mol, respectively, when the pH of milk was 4.5. Distinct differences were apparent in the rheological properties of gels
-
Baek, Jin-Sook; Kim, Hye-Young; Abbott, Thomas P; Moon, Tae-Wha; Lee, Soo-Bok; Park, Cheon-Seok; Park, Kwan-Hwa
2003-03-01
Simmondsin was modified with acarviosine-glucose using the transglycosylation activity of Thermus maltogenic amylase to synthesize a novel compound with both antiobesity and hypoglycemic activity. The LC/MS and 13C NMR analyses confirmed that the structure of the major transglycosylation product was acarviosine-simmondsin (Acv-simmondsin), in which acarviosine was attached to the glucose moiety of simmondsin by an alpha-(1,6)-glycosidic linkage. It was found that Acv-simmondsin was a potent competitive inhibitor of alpha-glucosidase with the Ki value of 0.69 microM and a mixed type inhibitor of alpha-amylase with the Ki and KI of 20.78 microM and 26.31 microM, respectively. The administration of Acv-simmondsin (0.1 g/100 g diet/day) to mice for 5 days significantly reduced food intake by 35%, compared to 25% with simmondsin in control obese mice. Acv-simmondsin (50 mg/kg BW) suppressed the postprandial blood glucose response to sucrose (1 g/kg BW) by 74%, compared to 71% with acarbose, in normal rats.
-
Zdenkova, Kamila; Alibayov, Babek; Karamonova, Ludmila; Purkrtova, Sabina; Karpiskova, Renata; Demnerova, Katerina
2016-09-01
Staphylococcus aureus is a major food-borne pathogen due to the production of enterotoxin and is particularly prevalent in contaminated milk and dairy products. The lactic acid bacteria (LAB) are widely used as biocontrol agents in fermented foods which can inhibit pathogenic flora. In our work, we investigated the influence of three strains of LAB (Lactobacillus plantarum, Streptococcus thermophilus and Enterococcus durans) on the relative expression of three enterotoxin genes (sea, sec, sell) and eight virulence and/or regulatory genes (sarA, saeS, codY, srrA, rot, hld/RNAIII, agrA/RNAII, sigB) in two S. aureus strains (MW2 and Sa1612) in TSB and reduced-fat milk (1.5 %) at 30 °C over a 24-h period. The tested LAB and S. aureus strains proved to be mutually non-competitive or only slightly competitive during co-cultivation. In addition, under the above-mentioned conditions, differential gene expression between the S. aureus MW2 and Sa1612 strains was well documented. S. aureus growth was changed in mixed culture with LAB; however, its effect on the repression of sea and sec expression correlated with production of these virulence factors. In comparison, the presence of LAB strains generally inhibited the expression of sec, sell, sarA, seaS, agrA/RNAII and hld/RNAIII genes. The effect of LAB strains presence on the expression of sea, codY, srrA, rot and sigB genes was medium, time, LAB and S. aureus strain specific. SEA and SEC production was significantly reduced in milk compared to TSB in pure culture. After the 24-h cultivation, S. aureus MW2 and Sa1612 SEC production was 187 and 331 times lower in milk compared to TSB, respectively (0.07 and 0.39 ng/mL in milk, versus 13.1 and 129.2 ng/mL in TSB, respectively). At the same time S. aureus MW2 and Sa1612 SEA production was 77 and 68 times lower in milk compared to TSB, respectively (0.99 and 0.17 ng/mL in milk, versus 76.4 and 11.5 ng/mL in TSB, respectively). This study has revealed new insights into the
-
Energy Technology Data Exchange (ETDEWEB)
Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation); Muravieva, T. I.; Esipov, R. S., E-mail: espiov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)
2016-11-15
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.
-
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550
-
Dodsworth, Jeremy A; Hungate, Bruce A; Hedlund, Brian P
2011-08-01
Many thermophiles catalyse free energy-yielding redox reactions involving nitrogenous compounds; however, little is known about these processes in natural thermal environments. Rates of ammonia oxidation, denitrification and dissimilatory nitrate reduction to ammonium (DNRA) were measured in source water and sediments of two ≈ 80°C springs in the US Great Basin. Ammonia oxidation and denitrification occurred mainly in sediments. Ammonia oxidation rates measured using (15)N-NO(3)(-) pool dilution ranged from 5.5 ± 0.8 to 8.6 ± 0.9 nmol N g(-1) h(-1) and were unaffected or only mildly stimulated by amendment with NH(4) Cl. Denitrification rates measured using acetylene block ranged from 15.8 ± 0.7 to 51 ± 12 nmol N g(-1) h(-1) and were stimulated by amendment with NO(3)(-) and complex organic compounds. The DNRA rate in one spring sediment measured using an (15)N-NO(3)(-) tracer was 315 ± 48 nmol N g(-1) h(-1). Both springs harboured distinct planktonic and sediment microbial communities. Close relatives of the autotrophic, ammonia-oxidizing archaeon 'Candidatus Nitrosocaldus yellowstonii' represented the most abundant OTU in both spring sediments by 16S rRNA gene pyrotag analysis. Quantitative PCR (qPCR) indicated that 'Ca. N. yellowstonii'amoA and 16S rRNA genes were present at 3.5-3.9 × 10(8) and 6.4-9.0 × 10(8) copies g(-1) sediment. Potential denitrifiers included members of the Aquificales and Thermales. Thermus spp. comprised <1% of 16S rRNA gene pyrotags in both sediments and qPCR for T. thermophilus narG revealed sediment populations of 1.3-1.7 × 10(6) copies g(-1) sediment. These data indicate a highly active nitrogen cycle (N-cycle) in these springs and suggest that ammonia oxidation may be a major source of energy fuelling primary production. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
-
Gezginc, Y; Topcal, F; Comertpay, S; Akyol, I
2015-03-01
The present study was conducted to evaluate the lactic acid- and acetaldehyde-producing abilities of lactic acid bacterial species isolated from traditionally manufactured Turkish yogurts using HPLC. The lactic acid bacterial species purified from the yogurts were the 2 most widely used species in industrial yogurt production: Streptococcus thermophilus and Lactobacillus bulgaricus. These bacteria have the ability to ferment hexose sugars homofermentatively to generate lactic acid and some carbonyl compounds, such as acetaldehyde through pyruvate metabolism. The levels of the compounds produced during fermentation influence the texture and the flavor of the yogurt and are themselves influenced by the chemical composition of the milk, processing conditions, and the metabolic activity of the starter culture. In the study, morphological, biochemical, and molecular characteristics were employed to identify the bacteria obtained from homemade yogurts produced in different regions of Turkey. A collection of 91 Strep. thermophilus and 35 L. bulgaricus strains were investigated for their lactic acid- and acetaldehyde-formation capabilities in various media such as cow milk, LM17 agar, and aerobic-anaerobic SM17 agar or de Man, Rogosa, and Sharpe agar. The amounts of the metabolites generated by each strain in all conditions were quantified by HPLC. The levels were found to vary depending on the species, the strain, and the growth conditions used. Whereas lactic acid production ranged between 0 and 77.9 mg/kg for Strep. thermophilus strains, it ranged from 0 to 103.5 mg/kg for L. bulgaricus. Correspondingly, the ability to generate acetaldehyde ranged from 0 to 105.9 mg/kg in Strep. thermophilus and from 0 to 126.9 mg/kg in L. bulgaricus. Our study constitutes the first attempt to determine characteristics of the wild strains isolated from traditional Turkish yogurts, and the approach presented here, which reveals the differences in metabolite production abilities of the
-
Energy Technology Data Exchange (ETDEWEB)
Wong, Jaslyn E. M. M. [Aarhus University, Gustav Wieds Vej 10C, 8000 Aarhus (Denmark); Midtgaard, Søren Roi [University of Copenhagen, Universitetsparken 5, 2100 Copenhagen (Denmark); Gysel, Kira [Aarhus University, Gustav Wieds Vej 10C, 8000 Aarhus (Denmark); Thygesen, Mikkel B.; Sørensen, Kasper K.; Jensen, Knud J. [University of Copenhagen, Thorvaldsensvej 40, 1871 Frederiksberg C (Denmark); Stougaard, Jens; Thirup, Søren; Blaise, Mickaël, E-mail: mickael.blaise@cpbs.cnrs.fr [Aarhus University, Gustav Wieds Vej 10C, 8000 Aarhus (Denmark)
2015-03-01
The crystal and solution structures of the T. thermophilus NlpC/P60 d, l-endopeptidase as well as the co-crystal structure of its N-terminal LysM domains bound to chitohexaose allow a proposal to be made regarding how the enzyme recognizes peptidoglycan. LysM domains, which are frequently present as repetitive entities in both bacterial and plant proteins, are known to interact with carbohydrates containing N-acetylglucosamine (GlcNAc) moieties, such as chitin and peptidoglycan. In bacteria, the functional significance of the involvement of multiple LysM domains in substrate binding has so far lacked support from high-resolution structures of ligand-bound complexes. Here, a structural study of the Thermus thermophilus NlpC/P60 endopeptidase containing two LysM domains is presented. The crystal structure and small-angle X-ray scattering solution studies of this endopeptidase revealed the presence of a homodimer. The structure of the two LysM domains co-crystallized with N-acetyl-chitohexaose revealed a new intermolecular binding mode that may explain the differential interaction between LysM domains and short or long chitin oligomers. By combining the structural information with the three-dimensional model of peptidoglycan, a model suggesting how protein dimerization enhances the recognition of peptidoglycan is proposed.
-
Directory of Open Access Journals (Sweden)
Shillito Bruce
2009-05-01
Full Text Available Abstract Background Hydrothermal vents and cold seeps represent oases of life in the deep-sea environment, but are also characterized by challenging physical and chemical conditions. The effect of temperature fluctuations on vent organisms in their habitat has not been well explored, in particular at a molecular level, most gene expression studies being conducted on coastal marine species. In order to better understand the response of hydrothermal organisms to different temperature regimes, differentially expressed genes (obtained by a subtractive suppression hybridization approach were identified in the mussel Bathymodiolus thermophilus and the annelid Paralvinella pandorae irlandei to characterize the physiological processes involved when animals are subjected to long term exposure (2 days at two contrasting temperatures (10° versus 20°C, while maintained at in situ pressures. To avoid a potential effect of pressure, the experimental animals were initially thermally acclimated for 24 hours in a pressurized vessel. Results For each species, we produced two subtractive cDNA libraries (forward and reverse from sets of deep-sea mussels and annelids exposed together to a thermal challenge under pressure. RNA extracted from the gills, adductor muscle, mantle and foot tissue were used for B. thermophilus. For the annelid model, whole animals (small individuals were used. For each of the four libraries, we sequenced 200 clones, resulting in 78 and 83 unique sequences in mussels and annelids (about 20% of the sequencing effort, respectively, with only half of them corresponding to known genes. Real-time PCR was used to validate differentially expressed genes identified in the corresponding libraries. Strong expression variations have been observed for some specific genes such as the intracellular hemoglobin, the nidogen protein, and Rab7 in P. pandorae, and the SPARC protein, cyclophilin, foot protein and adhesive plaque protein in B. thermophilus
-
Improved immobilization of laccase on a glassy carbon electrode by oriented covalent attachment
Directory of Open Access Journals (Sweden)
Liu Xin
2014-01-01
Full Text Available A laccase from Thermus thermophilus HB27 was reported to be potentially useful in the design of a temperature controlled biofuel cell. For enhancing its application in different thermal conditions, we engineered a laccase-oriented immobilized electrode. A site-directed mutant N323C of the laccase was constructed. A photometric assay was employed in order to compare the catalytic properties of wild-type laccase and mutant. The mutant was attached to a glass carbon electrode by covalent cross-linking. The electrochemical properties of the immobilized laccase were investigated by cyclic voltammetry. This immobilization allowed the active electrode to function at temperatures up to 95°C. The thermal and pH dependence profiles were similar to those of the soluble enzyme investigated by spectrophotometry.
-
Identification of exopolysaccharides-producing lactic acid bacteria ...
African Journals Online (AJOL)
Spacer region between 16S and 23 S rRNA genes of thirteen lactic acid bacteria strains from Burkina Faso fermented milk samples were amplified by the polymerase chain reaction (PCR). Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus fermentum, Streptococcus thermophilus, Pediococcus spp, ...
-
Cremonesi, Paola; Vanoni, Laura; Morandi, Stefano; Silvetti, Tiziana; Castiglioni, Bianca; Brasca, Milena
2011-03-30
A pentaplex PCR assay for the rapid, selective and simultaneous detection of Lactobacillus helveticus, L. delbrueckii subsp. lactis, L. delbrueckii subsp. bulgaricus, Streptococcus thermophilus, and L. fermentum, was developed. The target sequences were a group of genes coding for beta-galactosidase production (S. thermophilus and L. delbrueckii subsp. bulgaricus), for cell-enveloped associated proteinase synthesis (L. helveticus), for dipeptide transport system production (L. delbrueckii subsp. lactis) and for arginine-ornithine antiporter protein production (L. fermentum). The analytical specificity of the assay was evaluated with 5 reference strains and 140 lactic acid bacterial strains derived from raw milk cheeses and belonging to the Lactobacillus, Streptococcus, Lactococcus and Enterococcus genera. The identification limit for each target strain was 10(3)CFU/ml. This new molecular assay was used to investigate the LAB population by direct extraction of DNA from the 12 whey cultures for Grana Padano. The pentaplex PCR assay revealed a good correspondence with microbiological analyses and allowed to identify even minor LAB community members which, can be out-competed in vitro by numerically more abundant microbial species. Copyright © 2011 Elsevier B.V. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Yuya Sato
Full Text Available Rubrerythrin (Rbr is a non-heme iron protein composed of two distinctive domains and functions as a peroxidase in anaerobic organisms. A novel Rbr-like protein, ferriperoxin (Fpx, was identified in Hydrogenobacter thermophilus and was found not to possess the rubredoxin-like domain that is present in typical Rbrs. Although this protein is widely distributed among aerobic organisms, its function remains unknown. In this study, Fpx exhibited ferredoxin:NADPH oxidoreductase (FNR-dependent peroxidase activity and reduced both hydrogen peroxide (H(2O(2 and organic hydroperoxide in the presence of NADPH and FNR as electron donors. The calculated K(m and V(max values of Fpx for organic hydroperoxides were comparable to that for H(2O(2, demonstrating a multiple reactivity of Fpx towards hydroperoxides. An fpx gene disruptant was unable to grow under aerobic conditions, whereas its growth profiles were comparable to those of the wild-type strain under anaerobic and microaerobic conditions, clearly indicating the indispensability of Fpx as an antioxidant of H. thermophilus in aerobic environments. Structural analysis suggested that domain-swapping occurs in Fpx, and this domain-swapped structure is well conserved among thermophiles, implying the importance of structural stability of domain-swapped conformation for thermal environments. In addition, Fpx was located on a deep branch of the phylogenetic tree of Rbr and Rbr-like proteins. This finding, taken together with the wide distribution of Fpx among Bacteria and Archaea, suggests that Fpx is an ancestral type of Rbr homolog that functions as an essential antioxidant and may be part of an ancestral peroxide-detoxification system.
-
Directory of Open Access Journals (Sweden)
Maricê N. Oliveira
2003-12-01
Full Text Available Doze lotes de leites fermentados foram preparados a 42ºC nos quais as variáveis estudadas foram o teor de sólidos totais (12 e 15%, o teor de sacarose (0% e 8% e o tipo de co-cultura (Streptococcus thermophilus e Lactobacillus delbrueckii subsp. bulgaricus ; Streptococcus thermophilus e Lactobacillus acidophilus ; Streptococcus thermophilus e Lactobacillus rhamnosus. Parâmetros cinéticos para a diminuição do pH até 4,5 foram calculados. Determinações físico-químicas e microbiológicas foram realizadas após um e sete dias de armazenamento dos produtos a 4ºC. Com o aumento do teor de sólidos totais e adição de sacarose, a atividade de água do leite diminuiu e o tempo para atingir pH 4,5 variou conforme a co-cultura empregada. Os leites fermentados por S. thermophilus e L. acidphilus (STLA apresentaram pós-acidificação mais acentuada. Aqueles fermentados por S. thermophilus e L. rhamnosus (STLR foram mais estáveis. Os leites contendo maiores teores de sólidos totais foram aqueles com maior acidez total independente da co-cultura usada. Com o aumento do teor de sacarose e de sólidos solúveis houve um aumento da firmeza usando-se as co-culturas STLR e STLA. Após sete dias, o número de bactérias do iogurte e as probióticas não variou significativamente. Em todos os lotes, o número de bactérias probióticas ficou acima do sugerido pela literatura.Twelve batches of fermented milk were prepared at 42ºC where the studied variables were total solids content (12 and 15%, sucrose concentration (0 and 8%, and co-culture type (Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus ; Streptococcus thermophilus and Lactobacillus acidophilus ; Streptococcus thermophilus and Lactobacillus rhamnosus. Kinetic parameters to decrease pH until 4.5 were calculated. Physico-chemical and microbiological determinations were carried out on products after 1 and 7 days of storage at 4ºC. The increase in total solids and
-
Directory of Open Access Journals (Sweden)
Dian S. Kamara
2016-07-01
Full Text Available Exploitation of synthetic antibiotics compounds not only have positive effect for human, but also have side effect that can be unfavorable, therefore many researches are being conducted to find natural antibiotics compounds that are safer. Lactic acid bacteria has the abilitytoproduce antibacterial compound when used in fermentation process.For example, Lactobacillus acidophilus produces acidophilin and acidolin. The main purpose of the present study is to investigate antibacterial activity of yogurt fermented with mixed bacterial culture of L. bulgaricus, S. thermophilus and L. acidophilus against Escherichia coli (representing Gram negative bacteria and Bacillus subtilis (representing Gram positive bacteria. The antibacterial activity of the yogurt at three different time points (5, 7 and 9 hours were examined. We also investigate the fermentation parameters of the yogurt production. The results of the present study indicate that the crude yogurt extract has antibacterial activity, where the highest activity was observed at 7 hour of incubation, resulting 0.35 and 0.30 cm of clear zone against E. coli and B. subtilis, respectively. It is most likely that the compound is non protein compound.
-
Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W
2006-01-01
The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.
-
Förster, C; Limmer, S; Zeidler, W; Sprinzl, M
1994-01-01
tRNA(Val) from Escherichia coli was aminoacylated with [1-13C]valine and its complex with Thermus thermophilus elongation factor EF-Tu.GTP was analyzed by 13C NMR spectroscopy. The results suggest that the aminoacyl residue of the valyl-tRNA in ternary complex with bacterial EF-Tu and GTP is not attached to tRNA by a regular ester bond to either a 2'- or 3'-hydroxyl group; instead, an intermediate orthoester acid structure with covalent linkage to both vicinal hydroxyls of the terminal adenosine-76 is formed. Mutation of arginine-59 located in the effector region of EF-Tu, a conserved residue in protein elongation factors and the alpha subunits of heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins), abolishes the stabilization of the orthoester acid structure of aminoacyl-tRNA. PMID:8183898
-
Directory of Open Access Journals (Sweden)
Jing Gong
Full Text Available To investigate the effects of four strains, generally used in clinic, including Bifidobacterium longum, Lactobacillus acidophilus, Streptococcus thermophilus and Enterococcus faecalis, and their related products on human colonic smooth muscle in vitro.Human colonic circular muscle strips obtained from disease-free margins of resected segments from 25 patients with colorectal cancer were isometrically examined in a constant-temperature organ bath and exposed to different concentrations of living bacteria, sonicated cell fractions and cell-free supernatant (CFS. The area under the curve (AUC representing the contractility of smooth muscle strips was calculated.(1 The four living probiotics inhibited the contractility of human colonic muscle strips only at high concentration (1010 CFUs/mL, all P0.05.Four common probiotics related products, including the sonicated cell fractions and the CFS, obviously inhibited human colonic smooth muscles strips contraction in a dose-dependent manner. Only high concentration living probiotics (1010 CFUs/mL can inhibit the colonic smooth muscles strips contraction. The NO pathway may be partly involved in the inhibitory effect of CFS from Streptococcus thermophilus and Enterococcus faecalis.
-
Müller, C. S.; Auerbach, H.; Stegmaier, K.; Wolny, J. A.; Schünemann, V.; Pierik, A. J.
2017-11-01
The Thermus thermophilus Rieske protein ( TtRP) contains a 2Fe-2S cluster with one iron (Fe-Cys) coordinated by four sulfur atoms (2xS2- and 2xCys) and one iron (Fe-His) by two sulfur and two nitrogen atoms (2xS2-, His134 and His154). Here, the protein is investigated at three pH values (6.0, 8.5 and 10.5) in order to elucidate the protonation states of the His-ligands. Examination of the effect of protonation on the electronic structure of the cluster via Mössbauer spectroscopy gives a deeper understanding of the coupling of electron transfer to the protonation state of the His-ligands. Two components (1 referring to Fe-Cys and 2 to Fe-His) with parameters typical for a diamagnetic [2Fe-2S]2+ cluster are detected. The Mössbauer parameters and the protonation state clearly correlate: while δ remains almost pH-independent with δ 1 (pH6.0) = 0.23 (± 0.01) mms- 1 and δ 1 (pH10.5) = 0.24 (± 0.01) mms- 1 for Fe-Cys, it decreases for Fe-His from δ 2 (pH6.0) = 0.34 (± 0.01) mms- 1 to δ 2 (pH10.5) = 0.28 (± 0.01) mms- 1. Δ E Q changes from Δ E Q1 (pH6.0) = 0.57 (± 0.01) mms- 1 to Δ E Q1 (pH10.5) = 0.45 (± 0.01) mms- 1 and from Δ E Q2 (pH6.0) = 1.05 (± 0.01) mms- 1 to Δ E Q2 (pH10.5) = 0.71 (± 0.01) mms- 1. Density functional theory (DFT)-calculations based on the crystal structure (pdb 1NYK) (Hunsicker-Wang et al. Biochemistry 42, 7303, 2003) have been performed for the Rieske-cluster with different His-ligand protonation states, reproducing the experimentally observed trend.
-
International Nuclear Information System (INIS)
Joyce, Michael A.; Brownie, Edward R.; Hayakawa, Koto; Fraser, Marie E.
2007-01-01
Attempts to crystallize succinyl-CoA synthetase from the thermophile T. aquaticus were thwarted by proteolysis of the β-subunit and preferential crystallization of a truncated form. Crystals of the full-length enzyme were grown after the purification protocol was modified to include frequent additions of protease inhibitors. Succinyl-CoA synthetase (SCS) is an enzyme of the citric acid cycle and is thus found in most species. To date, there are no structures available of SCS from a thermophilic organism. To investigate how the enzyme adapts to higher temperatures, SCS from Thermus aquaticus was cloned, overexpressed, purified and crystallized. Attempts to crystallize the enzyme were thwarted by proteolysis of the β-subunit and preferential crystallization of the truncated form. Crystals of full-length SCS were grown after the purification protocol was modified to include frequent additions of protease inhibitors. The resulting crystals, which diffract to 2.35 Å resolution, are of the protein in complex with Mn 2+ -GDP
-
Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich
1998-01-01
We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820
-
Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template
International Nuclear Information System (INIS)
Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.
1987-01-01
Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA
-
Energy Technology Data Exchange (ETDEWEB)
Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de [MPI for Medical Research, Heidelberg (Germany); Brosi, Richard W. W. [Freie Universitat Berlin, Berlin (Germany); Steinmetz, Andrea; Scherer, Anna; Hartmann, Elisabeth; Eschenbach, Jessica; Lorenz, Thorsten [MPI for Medical Research, Heidelberg (Germany); Seidel, Ralf [MPI for Molecular Physiology, Dortmund (Germany); Shoeman, Robert L.; Zimmermann, Sabine [MPI for Medical Research, Heidelberg (Germany); Bittl, Robert [Freie Universitat Berlin, Berlin (Germany); Schlichting, Ilme; Reinstein, Jochen [MPI for Medical Research, Heidelberg (Germany)
2013-08-01
The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein, but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.
-
[TYPING OF LEPTOSPIRA SPP. STRAINS BASED ON 16S rRNA].
Ostankova, Yu V; Semenov, A V; Stoyanova, N A; Tokarevich, N K; Lyubimova, N E; Petrova, O A; Ananina, Yu V; Petrov, E M
2016-01-01
Comparative typing of Leptospira spp. strain collection based on analysis of 16S RNA fragment. 2 pairs of primers were used for PCR, that jointly flank 1423b.p. sized fragment. Sequences of Leptospira spp. strain 16S rRNA, presented in the international database, were used for phylogenetic analysis. A high similarity, including interspecies, of the 16S fragment in Leptospira spp. strains was shown independently of the source, serovar and serogroup. Heterogeneity of the primary matrix, spontaneous mutations of hotspots and erroneous nucleotide couplings, characteristic for 16S sequence of pathogenic Leptospira spp. strains, are discussed. Molecular-genetic characteristic of certain reference Leptospira spp. strains by 16S sequence is obtained. Results of the studies give evidence on expedience of introduction into clinical practice of identification of Leptospira spp. by 16S sequence directly from the clinical material, that would allow to significantly reduce identification time, dismiss complex type-specific sera and other labor-intensive methods.
-
[Design of primers to DNA of lactic acid bacteria].
Lashchevskiĭ, V V; Kovalenko, N K
2003-01-01
Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.
-
Hu, Jing; Yang, Qi-Qi; Ren, Yi; Zhang, Wen-Wu; Zheng, Gang; Sun, Cong; Pan, Jie; Zhu, Xu-Fen; Zhang, Xin-Qi; Wu, Min
2015-01-01
A novel facultatively anaerobic, Gram-stain-negative bacterium, designated strain HT7-2(T), was isolated from Ulva prolifera collected from the intertidal zone of Qingdao sea area, China, during its bloom. Cells were rod-shaped (1.9-3.5×0.4-0.6 µm), non-sporulating and motile by gliding. Strain HT7-2(T) was able to grow at 4-50 °C (optimum 40-42 °C), pH 5.5-8.5 (optimum pH 7.0), 0-8 % (w/v) NaCl (optimum 2-3 %) and 0.5-10 % (w/v) sea salts (optimum 2.5 %). The genomic DNA G+C content was 38.8 mol%. The phylogenetic analysis based on 16S rRNA gene sequences revealed that strain HT7-2(T) belonged to the genus Maribacter with sequence similarity values of 94.5-96.6 %, and was most closely related to Maribacter aestuarii GY20(T) (96.6%). Chemotaxonomic analysis showed that the main isoprenoid quinone was MK-6 and the major fatty acids were iso-C15:0 and unknown equivalent chain-length 13.565. The polar lipids of strain HT7-2(T) consisted of one phosphatidylethanolamine, four unidentified lipids and one unidentified aminolipid. On the basis of the phenotypic, phylogenetic and chemotaxonomic characteristics, strain HT7-2(T) ( =CGMCC 1.12207(T) =JCM 18466(T)) is concluded to represent a novel species of the genus Maribacter, for which the name Maribacter thermophilus sp. nov. is proposed. An emended description of the genus Maribacter is also proposed. © 2015 IUMS.
-
International Nuclear Information System (INIS)
Kimura, Masaaki; Horiuchi, Hisashi
2004-01-01
The relation between the superdeformed band of 32 S and 16 O+ 16 O molecular bands is studied by the deformed-basis antisymmetrized molecular dynamics with the Gogny D1S force. It is found that the obtained superdeformed band members of S have a considerable amount of the 16 O+ 16 O component. Above the superdeformed band, we have obtained two excited rotational bands which have more prominent character of the 16 O+ 16 O molecular band. These three rotational bands are regarded as a series of 16 O+ 16 O molecular bands which were predicted by using the unique 16 O- 16 O optical potential. As the excitation energy and principal quantum number of the relative motion increase, the 16 O+ 16 O cluster structure becomes more prominent but at the same time, the band members are fragmented into several states
-
Pega, J; Rizzo, S; Pérez, C D; Rossetti, L; Díaz, G; Ruzal, S M; Nanni, M; Descalzo, A M
2016-09-02
The quality of functional food products designed for the prevention of degenerative diseases can be affected by the incorporation of bioactive compounds. In many types of cheese, the performance of starter microorganisms is critical for optimal elaboration and for providing potential probiotic benefits. Phytosterols are plant lipophilic triterpenes that have been used for the design of functional dairy products because of their ability to lower serum cholesterol levels in humans. However, their effect on the starter culture behavior during cheesemaking has not yet been studied. Here, we followed DNA and RNA kinetics of the bacterium Streptococcus thermophilus, an extensively used dairy starter with probiotic potential, during industrial production of a functional, semi-soft, reduced-fat cheese containing phytosterol esters and alpha-tocopherol as bioactive compounds. For this purpose, real-time quantitative PCR (qPCR) and reverse transcription-qPCR (RT-qPCR) assays were optimized and applied to samples obtained during the manufacture and ripening of functional and control cheeses. An experimental set-up was used to evaluate the detection threshold of free nucleic acids for extraction protocols based on pelleted microorganisms. To our knowledge, this straight-forward approach provides the first experimental evidence indicating that DNA is not a reliable marker of cell integrity, whereas RNA may constitute a more accurate molecular signature to estimate both bacterial viability and metabolic activity. Compositional analysis revealed that the bioactive molecules were effectively incorporated into the cheese matrix, at levels considered optimal to exert their biological action. The starter S. thermophilus was detected by qPCR and RT-qPCR during cheese production at the industrial level, from at least 30min after its inoculation until 81days of ripening, supporting the possible role of this species in shaping organoleptic profiles. We also showed for the first time that
-
SUMOylation of sPRDM16 promotes the progression of acute myeloid leukemia
International Nuclear Information System (INIS)
Dong, Song; Chen, Jieping
2015-01-01
In addition to genetic and epigenetic alteration, post-translational modification of proteins plays a critical role in the initiation, progression and maturation of acute myeloid leukemia (AML). The SUMOylation site of sPRDM16 at K568 was mutated to arginine by site-directed mutagenesis. THP-1 acute myeloid leukemia cells were transduced with a lentivirus containing wild type or K568 mutant sPRDM16. Proliferation, self-renewal and differentiation of transduced THP-1 cells were analyzed both in vitro cell culture and in mouse xenografts. Gene expression profiles were analyzed by RNA-seq. Overexpression of sPRDM16 promoted proliferation, enhanced self-renewal capacity, but inhibited differentiation of THP-1 acute myeloid leukemia cells. We further confirmed that K568 is a bona fide SUMOylation site on sPRDM16. Mutation of the sPRDM16 SUMOylation site at K568 partially abolished the capacity of sPRDM16 to promote proliferation and inhibit differentiation of acute myeloid leukemia cells both in vitro and in mouse xenografts. Furthermore, THP-1 cells overexpressing sPRDM16-K568R mutant exhibited a distinct gene expression profile from wild type sPRDM16 following incubation with PMA. Our results suggest that K568 SUMOylation of sPRDM16 plays an important role in the progression of acute myeloid leukemia
-
A selected core microbiome drives the early stages of three popular italian cheese manufactures.
Directory of Open Access Journals (Sweden)
Francesca De Filippis
Full Text Available Mozzarella (M, Grana Padano (GP and Parmigiano Reggiano (PR are three of the most important traditional Italian cheeses. In the three cheese manufactures the initial fermentation is carried out by adding natural whey cultures (NWCs according to a back-slopping procedure. In this study, NWCs and the corresponding curds from M, GP and PR manufactures were analyzed by culture-independent pyrosequencing of the amplified V1-V3 regions of the 16S rRNA gene, in order to provide insights into the microbiota involved in the curd acidification. Moreover, culture-independent high-throughput sequencing of lacS gene amplicons was carried out to evaluate the biodiversity occurring within the S. thermophilus species. Beta diversity analysis showed a species-based differentiation between GP-PR and M manufactures indicating differences between the preparations. Nevertheless, all the samples shared a naturally-selected core microbiome, that is involved in the curd acidification. Type-level variability within S. thermophilus species was also found and twenty-eight lacS gene sequence types were identified. Although lacS gene did not prove variable enough within S. thermophilus species to be used for quantitative biotype monitoring, the possibility of using non rRNA targets for quantitative biotype identification in food was highlighted.
-
International Nuclear Information System (INIS)
Saewen, Elin; Huttunen, Eine; Zhang Xue; Yang Zhennai; Widmalm, Goeran
2010-01-01
The use of lactic acid bacteria in fermentation of milk results in favorable physical and rheological properties due to in situ exopolysaccharide (EPS) production. The EPS from S. thermophilus ST1 produces highly viscous aqueous solutions and its structure has been investigated by NMR spectroscopy. Notably, all aspects of the elucidation of its primary structure including component analysis and absolute configuration of the constituent monosaccharides were carried out by NMR spectroscopy. An array of techniques was utilized including, inter alia, PANSY and NOESY-HSQC TILT experiments. The EPS is composed of hexasaccharide repeating units with the following structure: → 3)[α-d-Glcp-(1 → 4)]-β-d-Galp-(1 → 4)-β-d-Glcp-(1 → 4)[β-d-Galf-(1 → 6)]-β-d-Glcp-(1 → 6)-β-d-Glcp-(1 → , in which the residues in square brackets are terminal groups substituting backbone sugar residues that consequently are branch-points in the repeating unit of the polymer. Thus, the EPS consists of a backbone of four sugar residues with two terminal sugar residues making up two side-chains of the repeating unit. The molecular mass of the polymer was determined using translational diffusion experiments which resulted in M w = 62 kDa, corresponding to 64 repeating units in the EPS.
-
Characterization of 16S rRNA Processing with Pre-30S Subunit Assembly Intermediates from E. coli.
Smith, Brian A; Gupta, Neha; Denny, Kevin; Culver, Gloria M
2018-06-08
Ribosomal RNA (rRNA) is a major component of ribosomes and is fundamental to the process of translation. In bacteria, 16S rRNA is a component of the small ribosomal subunit and plays a critical role in mRNA decoding. rRNA maturation entails the removal of intervening spacer sequences contained within the pre-rRNA transcript by nucleolytic enzymes. Enzymatic activities involved in maturation of the 5'-end of 16S rRNA have been identified, but those involved in 3'-end maturation of 16S rRNA are more enigmatic. Here, we investigate molecular details of 16S rRNA maturation using purified in vivo-formed small subunit (SSU) assembly intermediates (pre-SSUs) from wild-type Escherichia coli that contain precursor 16S rRNA (17S rRNA). Upon incubation of pre-SSUs with E. coli S100 cell extracts or purified enzymes implicated in 16S rRNA processing, the 17S rRNA is processed into additional intermediates and mature 16S rRNA. These results illustrate that exonucleases RNase R, RNase II, PNPase, and RNase PH can process the 3'-end of pre-SSUs in vitro. However, the endonuclease YbeY did not exhibit nucleolytic activity with pre-SSUs under these conditions. Furthermore, these data demonstrate that multiple pathways facilitate 16S rRNA maturation with pre-SSUs in vitro, with the dominant pathways entailing complete processing of the 5'-end of 17S rRNA prior to 3'-end maturation or partial processing of the 5'-end with concomitant processing of the 3'-end. These results reveal the multifaceted nature of SSU biogenesis and suggest that E. coli may be able to escape inactivation of any one enzyme by using an existing complementary pathway. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
International Nuclear Information System (INIS)
Ehresmann, B.; Backendorf, C.; Ehresmann, C.; Ebel, J.P.
1977-01-01
The use of ultraviolet irradiation to form photochemical covalent bonds between the 16 S RNA and a ribosomal protein is a reliable method to check RNA regions which are interacting with the protein. This technique was successfully used to covalently link RNA or DNA and specific proteins in several cases. In the case of ribosome, it has been shown that the irradiation of 30 S and 50 S subunits using high doses of ultraviolet light allowed the covalent binding of almost all of the ribosomal proteins to the 16 S or 23 S RNAs. Using mild conditions, only proteins S7 and L4 could be covalently linked to the 16 S and 23 S RNAs, respectively, and the 16 S RNA region linked to protein S7 has now been characterized. The specificity of the photoreaction was demonstrated earlier and the tryptic peptides from proteins S4 and S7, photochemically linked to the 16 S RNA complexes, were identified. A report is presented on the sequences of the RNA regions which can be photochemically linked to proteins S4 and S7 after ultraviolet irradiation of the specific S4-16 S RNA and 20 S-16 S RNA complexes
-
Solution structure and elevator mechanism of the membrane electron transporter CcdA.
Zhou, Yunpeng; Bushweller, John H
2018-02-01
Membrane oxidoreductase CcdA plays a central role in supplying reducing equivalents from the bacterial cytoplasm to the envelope. It transports electrons across the membrane using a single pair of cysteines by a mechanism that has not yet been elucidated. Here we report an NMR structure of the Thermus thermophilus CcdA (TtCcdA) in an oxidized and outward-facing state. CcdA consists of two inverted structural repeats of three transmembrane helices (2 × 3-TM). We computationally modeled and experimentally validated an inward-facing state, which suggests that CcdA uses an elevator-type movement to shuttle the reactive cysteines across the membrane. CcdA belongs to the LysE superfamily, and thus its structure may be relevant to other LysE clan transporters. Structure comparisons of CcdA, semiSWEET, Pnu, and major facilitator superfamily (MFS) transporters provide insights into membrane transporter architecture and mechanism.
-
Guo, Lijun; Xu, Kun; Liu, Zhiyuan; Zhang, Cunfang; Xin, Ying; Zhang, Zhiying
2015-06-01
In addition to the advantages of scalable, affordable, and easy to engineer, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) technology is superior for multiplex targeting, which is laborious and inconvenient when achieved by cloning multiple gRNA expressing cassettes. Here, we report a simple CRISPR array assembling method which will facilitate multiplex targeting usage. First, the Streptococcus thermophilus CRISPR3/Cas locus was cloned. Second, different CRISPR arrays were assembled with different crRNA spacers. Transformation assays using different Escherichia coli strains demonstrated efficient plasmid DNA targeting, and we achieved targeting efficiency up to 95% with an assembled CRISPR array with three crRNA spacers. Copyright © 2015 Elsevier Inc. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Morteza Shojaei Moghadam
2010-01-01
Full Text Available Six strains of bacteriocinogenic Lactobacillus plantarum (TL1, RG11, RS5, UL4, RG14 and RI11 isolated from Malaysian foods were investigated for their structural bacteriocin genes. A new combination of plantaricin EF and plantaricin W bacteriocin structural genes was successfully amplified from all studied strains, suggesting that they were novel bacteriocin-producing L. plantarum strains. A four-base pair variable region was detected in the short 16S-23S intergenic spacer regions of the studied strains by a comparative analysis with 17 L. plantarum strains deposited in the GenBank, implying they were new genotypes. The studied L. plantarum strains were subsequently differentiated into four groups on the basis of the detected four-base pair variable region of the short 16S-23S intergenic spacer region. Further analysis of the DNA sequence of 23S-5S intergenic spacer region revealed only one type of 23S-5S intergenic spacer region present in the studied strains, indicating it was highly conserved among the studied L. plantarum strains. Three randomly amplified polymorphic DNA experiments using three different combinations of arbitrary primers successfully differentiated the studied L. plantarum strains from each other, confirming they were different strains. In conclusion, the studied L. plantarum strains were shown to be novel bacteriocin producers and high level of strain discrimination could be achieved with a combination of randomly amplified polymorphic DNA analysis and the analysis of the variable region of short 16S-23S intergenic spacer region present in L. plantarum strains.
-
Directory of Open Access Journals (Sweden)
О. І. Гордієнко
2015-10-01
Full Text Available The process of bacterial adhesion is usually discussed in terms of the two-stage sorption model. According to the model, at the first stage the bacteria fastly attaches to the surface by weak physical interactions, while at the second stage irreversible molecular and cellular adhesion process takes place. An important factor, influencing the adhesion processes, is physical-chemical characteristics of the medium, in particular, the presence of monovalent cations therein. The aim of this work is to assess the role of electrostatic component of the intercellular interactions at the first reversible stage of adhesion. Comparison of experimental data of adhesion of lactobacilli S. thermophilus on human erythrocytes and theoretical definition of the Debye radius and the erythrocytes surface potential in the experimental solutions showed that with decreasing ionic strength of the solution the change in the adhesion index in our experiments is fully in line with the theory DLVO predictions.
-
Microcalorimetric study of the growth of Streptococcus thermophilus in renneted milk
Directory of Open Access Journals (Sweden)
Irina eStulova
2015-02-01
Full Text Available The growth of Streptococcus thermophilus ST12 (ST12 in liquid milk, reconstituted from low-heat skim milk powder (RSM and in RSM with rennet addition (r-RSM at 40°C was monitored by microcalorimetry. It was shown that the growth rate of bacteria decreased in renneted samples in comparison with liquid RSM starting from certain sizes of the colonies (deviation moments, which depended on the inoculation rates. The hydrolysis of lactose was delayed for about 1 h in the r-RSM in comparison with RSM but otherwise the metabolism of carbohydrates in the renneted and non-renneted milks was similar. The total free amino acids content by the end of fermentations was higher in r-RSM than in RSM presumably due to the enzymatic hydrolytic activity of rennet. The quantitatively dominating amino acids were remarkably different in the r-RSM and RSM indicating that the hydrolysis cascade of caseins and/or metabolism of amino acids by the bacteria functioned differently in the two cases. The data obtained showed potential of microcalorimetry to characterize quantitative differences of growth and metabolism of the bacteria in renneted and liquid samples of milk.
-
The interaction effect of mixing starter cultures on homemade natural yogurt’s pH and viscosity
Directory of Open Access Journals (Sweden)
Hadi A. Dahlan
2017-10-01
Full Text Available Dairy yogurts are common food products consumed by people all over the world. Due to the simple process, many people have made their own natural yogurt at home. The fermentation due to the starter culture causes the textural properties of dairy yogurt. However, the literature is surprisingly scarce on the topic of starter culture interactions in the development of textural properties of dairy yogurt. This study investigated the interaction effect of three common starter cultures, Lactobacillus acidophilus, Lactobacillus bulgaricus and Streptococcus thermophiles, on the viscosity of homemade yogurt. Using Design Expert software, a 10-run mixture model experiment was designed to examine the textural properties developed by single or multiple inoculation of these starter cultures. All yogurt formulations reached the isoelectric point of milk and had pHs in the range 3.97 to 4.32. Yogurt formulations with L. acidophilus and S. thermophilus resulted in viscosities which were similar to commercial yogurt viscosity (1.77 Pa.s, while L. bulgaricus resulted in yogurt with a lower viscosity. Based on the mixture model, L. acidophilus had most influence on the yogurt viscosity, followed by S. thermophilus and L. bulgaricus. In conclusion, L. acidophilus can be used as a single starter culture or combined with other starter cultures to develop high viscosity homemade yogurt. A Combination of S. thermophilus and L. acidphilus can also be used to develop high viscosity yogurts. However, L. bulgaricus should not be inoculated alone or become a dominant ratio in multiple starter culture inoculation as it will decrease the overall homemade yogurt viscosity.
-
Energy Technology Data Exchange (ETDEWEB)
Saewen, Elin [Arrhenius Laboratory, Stockholm University, Department of Organic Chemistry (Sweden); Huttunen, Eine; Zhang Xue [University of Helsinki, Department of Food Technology (Finland); Yang Zhennai [Northeast Agricultural Research Center of China, Center of Agro-food Technology (China); Widmalm, Goeran, E-mail: gw@organ.su.s [Arrhenius Laboratory, Stockholm University, Department of Organic Chemistry (Sweden)
2010-06-15
The use of lactic acid bacteria in fermentation of milk results in favorable physical and rheological properties due to in situ exopolysaccharide (EPS) production. The EPS from S. thermophilus ST1 produces highly viscous aqueous solutions and its structure has been investigated by NMR spectroscopy. Notably, all aspects of the elucidation of its primary structure including component analysis and absolute configuration of the constituent monosaccharides were carried out by NMR spectroscopy. An array of techniques was utilized including, inter alia, PANSY and NOESY-HSQC TILT experiments. The EPS is composed of hexasaccharide repeating units with the following structure: {yields} 3)[{alpha}-d-Glcp-(1 {yields} 4)]-{beta}-d-Galp-(1 {yields} 4)-{beta}-d-Glcp-(1 {yields} 4)[{beta}-d-Galf-(1 {yields} 6)]-{beta}-d-Glcp-(1 {yields} 6)-{beta}-d-Glcp-(1 {sup {yields}}, in which the residues in square brackets are terminal groups substituting backbone sugar residues that consequently are branch-points in the repeating unit of the polymer. Thus, the EPS consists of a backbone of four sugar residues with two terminal sugar residues making up two side-chains of the repeating unit. The molecular mass of the polymer was determined using translational diffusion experiments which resulted in M{sub w} = 62 kDa, corresponding to 64 repeating units in the EPS.
-
Fermentation and storage of probiotic yoghurt from goat’s milk
Directory of Open Access Journals (Sweden)
Rajka Božanić
2002-04-01
Full Text Available Cow’s and goat’s milk supplemented with inulin were fermented withABT4 culture. The population growth of Streptococcus thermophilus,Lactobacillus acidophilus and Bifidobacterium ssp. in plain and inulinsupplemented goat’s milk during fermentation was evaluated. The survival of strains during 28 d of storage was followed in comparison with that of cow’s milk. The time required to reach the desired pH of 4.6 during fermentation was 6 h for both types of milk. At that time the proportion of viable cells of Streptococcus thermophilus, Lactobacillus acidophilus and Bifidobacterium ssp. in all fermented samples was comparable 40 : 33 : 27, respectively. During the storage viable count of streptococci and bifidobacteria have not decreased. In supplemented samples viable counts of bifidobacteria were increased and during 28th day of storage were higher for 0.6 logarithms compared to the non supplemented samples. Surviving of lactobacilli was poorer in fermented goat's milk than in fermented cow's milk during storage. The addition of inulin improved the firmness of fermented goat’s and cow’s milks products. Inulin addition partly masked the goat’s flavour of produced yoghurt. During storage the fermented goat's samples were scored better in comparison with cow's samples. Goat’s milk fermented with probiotic bacteria and fortified with inulin complies with the requirements of functional food.
-
Prevalence of 16S rRNA methylase genes among b-lactamase ...
African Journals Online (AJOL)
2014-07-07
Jul 7, 2014 ... School of Life Sciences, Pondicherry University, Pondicherry, India ... Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and .... Isolates positive for bla or 16S rRNA methylase genes.
-
Tomita, Takeo
2017-11-01
Amino acids are essential components in all organisms because they are building blocks of proteins. They are also produced industrially and used for various purposes. For example, L-glutamate is used as the component of "umami" taste and lysine has been used as livestock feed. Recently, many kinds of amino acids have attracted attention as biological regulators and are used for a healthy life. Thus, to clarify the mechanism of how amino acids are biosynthesized and how they work as biological regulators will lead to further effective utilization of them. Here, I review the leucine-induced-allosteric activation of glutamate dehydrogenase (GDH) from Thermus thermophilus and the relationship with the allosteric regulation of GDH from mammals. Next, I describe structural insights into the efficient production of L-glutamate by GDH from an excellent L-glutamate producer, Corynebacterium glutamicum. Finally, I review the structural biology of lysine biosynthesis of thermophilic bacterium and archaea.
-
Structure of Vibrio cholerae ribosome hibernation promoting factor
International Nuclear Information System (INIS)
De Bari, Heather; Berry, Edward A.
2013-01-01
The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding
-
Nema, Vijay; Pal, Sudhir Kumar
2013-01-01
This study was conducted to find the best suited freely available software for modelling of proteins by taking a few sample proteins. The proteins used were small to big in size with available crystal structures for the purpose of benchmarking. Key players like Phyre2, Swiss-Model, CPHmodels-3.0, Homer, (PS)2, (PS)(2)-V(2), Modweb were used for the comparison and model generation. Benchmarking process was done for four proteins, Icl, InhA, and KatG of Mycobacterium tuberculosis and RpoB of Thermus Thermophilus to get the most suited software. Parameters compared during analysis gave relatively better values for Phyre2 and Swiss-Model. This comparative study gave the information that Phyre2 and Swiss-Model make good models of small and large proteins as compared to other screened software. Other software was also good but is often not very efficient in providing full-length and properly folded structure.
-
Javidi-Parsijani, Parisa; Niu, Guoguang; Davis, Meghan; Lu, Pin; Atala, Anthony; Lu, Baisong
2017-01-01
The argonaute protein from the thermophilic bacterium Thermus thermophilus shows DNA-guided DNA interfering activity at high temperatures, complicating its application in mammalian cells. A recent work reported that the argonaute protein from Natronobacterium gregoryi (NgAgo) had DNA-guided genome editing activity in mammalian cells. We compared the genome editing activities of NgAgo and Staphylococcus aureus Cas9 (SaCas9) in human HEK293T cells side by side. EGFP reporter assays and DNA sequencing consistently revealed high genome editing activity from SaCas9. However, these assays did not demonstrate genome editing activity by NgAgo. We confirmed that the conditions allowed simultaneous transfection of the NgAgo expressing plasmid DNA and DNA guides, as well as heterologous expression of NgAgo in the HEK293T cells. Our data show that NgAgo is not a robust genome editing tool, although it may have such activity under other conditions.
-
Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.
Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I
2013-05-01
All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
-
A review of the microbiology of the Rehai geothermal field in Tengchong, Yunnan Province, China
Directory of Open Access Journals (Sweden)
Brian P. Hedlund
2012-05-01
Full Text Available The Rehai Geothermal Field, located in Tengchong County, in central-western Yunnan Province, is the largest and most intensively studied geothermal field in China. A wide physicochemical diversity of springs (ambient to ∼97 °C; pH from ≤1.8 to ≥9.3 provides a multitude of niches for extremophilic microorganisms. A variety of studies have focused on the cultivation, identification, basic physiology, taxonomy, and biotechnological potential of thermophilic microorganisms from Rehai. Thermophilic bacteria isolated from Rehai belong to the phyla Firmicutes and Deinococcus-Thermus. Firmicutes include neutrophilic or alkaliphilic Anoxybacillus, Bacillus, Caldalkalibacillus, Caldanaerobacter, Laceyella, and Geobacillus, as well as thermoacidophilic Alicyclobacillus and Sulfobacillus. Isolates from the Deinococcus-Thermus phylum include several Meiothermus and Thermus species. Many of these bacteria synthesize thermostable polymer-degrading enzymes that may be useful for biotechnology. The thermoacidophilic archaea Acidianus, Metallosphaera, and Sulfolobus have also been isolated and studied. A few studies have reported the isolation of thermophilic viruses belonging to Siphoviridae (TTSP4 and TTSP10 and Fuselloviridae (STSV1 infecting Thermus spp. and Sulfolobus spp., respectively. More recently, cultivation-independent studies using 16S rRNA gene sequences, shotgun metagenomics, or “functional gene” sequences have revealed a much broader diversity of microorganisms than represented in culture. Studies of the gene and mRNA encoding the large subunit of the ammonia monooxygenase (amoA of ammonia-oxidizing Archaea (AOA and the tetraether lipid crenarchaeol, a potential biomarker for AOA, suggest a wide diversity, but possibly low abundance, of thermophilic AOA in Rehai. Finally, we introduce the Tengchong Partnerships in International Research and Education (PIRE project, an international collaboration between Chinese and U.S. scientists with
-
Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.
Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly
2016-11-01
Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.
-
Controllable synthesis and enhanced photocatalytic properties of Cu2O/Cu31S16 composites
International Nuclear Information System (INIS)
Liu, Xueqin; Li, Zhen; Zhang, Qiang; Li, Fei
2012-01-01
Highlights: ► Facile sonochemical route. ► The content of Cu 31 S 16 in the Cu 2 O/Cu 31 S 16 can be easily controlled. ► Structure and optical properties of Cu 2 O/Cu 31 S 16 were discussed. ► Enhanced photocatalytic property of Cu 2 O/Cu 31 S 16 . ► Cu 2 O/Cu 31 S 16 core/shell structures were more stable than single Cu 2 O particles. -- Abstract: The controlled synthesis of Cu 2 O/Cu 31 S 16 microcomposites with hierarchical structures had been prepared via a convenient sonochemical route. Ultrasonic irradiation of a mixture of Cu 2 O and (NH 2 ) 2 CS in an aqueous medium yielded Cu 2 O/Cu 31 S 16 composites. The content of Cu 31 S 16 in the Cu 2 O/Cu 31 S 16 can be easily controlled by adjusting the synthesis time. The Cu 31 S 16 layer not only protected and stabilized Cu 2 O particles, but also prohibited the recombination of photogenerated electrons–holes pair between Cu 31 S 16 and Cu 2 O. X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FTIR) spectra, ultraviolet–visible (UV–Vis) spectroscopy and photoluminescence (PL) spectroscopy were used to characterize the products. Photocatalytic performance of the Cu 2 O/Cu 31 S 16 hierarchical structures was evaluated by measuring the decomposition rate of methyl orange solution under natural light. To the best of our knowledge, this is the first report on the preparation and photocatalytic activity of Cu 2 O/Cu 31 S 16 microcomposite. Additionally, the Cu 2 O/Cu 31 S 16 core/shell structures were more stable than single Cu 2 O particles during photocatalytic process since the photocatalytic activity of the second reused architecture sample was much higher than that of pure Cu 2 O. The Cu 2 O/Cu 31 S 16 microcomposites may be a good promising candidate for wastewater treatment.
-
Prevalence of 16S rRNA methylase genes among β-lactamase ...
African Journals Online (AJOL)
Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...
-
Fermentation and storage of probiotic yoghurt from goat’s milk
Rajka Božanić; Irena Rogelj; Ljubica Tratnik
2002-01-01
Cow’s and goat’s milk supplemented with inulin were fermented withABT4 culture. The population growth of Streptococcus thermophilus,Lactobacillus acidophilus and Bifidobacterium ssp. in plain and inulinsupplemented goat’s milk during fermentation was evaluated. The survival of strains during 28 d of storage was followed in comparison with that of cow’s milk. The time required to reach the desired pH of 4.6 during fermentation was 6 h for both types of milk. At that time the proportion of viab...
-
Directory of Open Access Journals (Sweden)
Andrew Macrae
2000-06-01
Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.
-
Wang, Yong; Qian, Pei-Yuan
2009-01-01
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions
-
Single-molecule analysis of inhibitory pausing states of V1-ATPase.
Uner, Naciye Esma; Nishikawa, Yoshihiro; Okuno, Daichi; Nakano, Masahiro; Yokoyama, Ken; Noji, Hiroyuki
2012-08-17
V(1)-ATPase, the hydrophilic V-ATPase domain, is a rotary motor fueled by ATP hydrolysis. Here, we found that Thermus thermophilus V(1)-ATPase shows two types of inhibitory pauses interrupting continuous rotation: a short pause (SP, 4.2 s) that occurred frequently during rotation, and a long inhibitory pause (LP, >30 min) that terminated all active rotations. Both pauses occurred at the same angle for ATP binding and hydrolysis. Kinetic analysis revealed that the time constants of inactivation into and activation from the SP were too short to represent biochemically predicted ADP inhibition, suggesting that SP is a newly identified inhibitory state of V(1)-ATPase. The time constant of inactivation into LP was 17 min, consistent with one of the two time constants governing the inactivation process observed in bulk ATPase assay. When forcibly rotated in the forward direction, V(1) in LP resumed active rotation. Solution ADP suppressed the probability of mechanical activation, suggesting that mechanical rotation enhanced inhibitory ADP release. These features were highly consistent with mechanical activation of ADP-inhibited F(1), suggesting that LP represents the ADP-inhibited state of V(1)-ATPase. Mechanical activation largely depended on the direction and angular displacement of forced rotation, implying that V(1)-ATPase rotation modulates the off rate of ADP.
-
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.
Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C
2016-01-29
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
-
Tóbiás, Roland; Furtenbacher, Tibor; Császár, Attila G.; Naumenko, Olga V.; Tennyson, Jonathan; Flaud, Jean-Marie; Kumar, Praveen; Poirier, Bill
2018-03-01
A critical evaluation and validation of the complete set of previously published experimental rotational-vibrational line positions is reported for the four stable sulphur isotopologues of the semirigid SO2 molecule - i.e., 32S16O2, 33S16O2, 34S16O2, and 36S16O2. The experimentally measured, assigned, and labeled transitions are collated from 43 sources. The 32S16O2, 33S16O2, 34S16O2, and 36S16O2 datasets contain 40,269, 15,628, 31,080, and 31 lines, respectively. Of the datasets collated, only the extremely limited 36S16O2 dataset is not subjected to a detailed analysis. As part of a detailed analysis of the experimental spectroscopic networks corresponding to the ground electronic states of the 32S16O2, 33S16O2, and 34S16O2 isotopologues, the MARVEL (Measured Active Rotational-Vibrational Energy Levels) procedure is used to determine the rovibrational energy levels. The rovibrational levels and their vibrational parent and asymmetric-top quantum numbers are compared to ones obtained from accurate variational nuclear-motion computations as well as to results of carefully designed effective Hamiltonian models. The rovibrational energy levels of the three isotopologues having the same labels are also compared against each other to ensure self-consistency. This careful, multifaceted analysis gives rise to 15,130, 5852, and 10,893 validated rovibrational energy levels, with a typical accuracy of a few 0.0001 cm-1 , for 32S16O2, 33S16O2, and 34S16O2, respectively. The extensive list of validated experimental lines and empirical (MARVEL) energy levels of the S16O2 isotopologues studied are deposited in the Supplementary Material of this article, as well as in the distributed information system ReSpecTh (http://respecth.hu).
-
High throughput 16S rRNA gene amplicon sequencing
DEFF Research Database (Denmark)
Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup
S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...
-
Dingman, Douglas W
2012-07-01
Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc
-
DEFF Research Database (Denmark)
Khakimov, Bekzod; Christiansen, Lene D.; Heins, Anna-Lena
2017-01-01
An industrial scale biomass production using batch or fed-batch fermentations usually optimized by selection of bacterial strains, tuning fermentation media, feeding strategy, and temperature. However, in-depth investigation of the biomass metabolome during the production may reveal new knowledge...... shows that in-depth metabolic analysis of fermentation broth provides a new tool for advanced optimization of high-volume-low-cost biomass production by lowering the cost, increase the yield, and augment the product quality....... for better optimization. In this study, for the first time, the authors investigated seven fermentation batches performed on five Streptoccoccus thermophilus strains during the biomass production at Chr. Hansen (Denmark) in a real life large scale fermentation process. The study is designed to investigate...
-
Directory of Open Access Journals (Sweden)
Widya Paramita Lokapirnasari
2017-04-01
Full Text Available This study aimed to identified cellulolytic inoculant code WPL 214 isolated from bovine rumen fluid waste of Ongole Cross Breed of Surabaya Slaughter house. A single colony of isolates celulolytic grown on 5 mL of liquid media Luria Bertani (LB consist of 1 % NaCl , 1% tripton , 0.5 % yeast extract, containing1 % carboxymethyl cellulose (CMC at temperature 37°C, using a shaker of incubator during 16-18 hours. That isolate determined by 16S DNA gen analysis using High Fidelity Platinum Taq DNA Polymerase with primer forward PB36 5’-AGR GTT TGA TCM TGG CTC AG-3’ and primer reverse PB38 5’-GMT ACCTTG TTA CGA CTT-3’ for PCR. Nucleotide sequence of 16S DNA fragment was determined through the sequencing method. The result was then compared with GenBank database to recognize the type of the sample bacteria. DNA isolation and 16S DNA coding genes amplification were carried out using Kit High Fidelity Platinum Taq DNA Polymerase. Afterward, BLAST was applied to identify the phylogenetic tree. The bacteria was capable of indicating the existence of clear zone in a media CMC by congo red staining. The existence of the clear zone associated with the activity of microbes to degrade cellulose. The conclusión of this research based on the results was the sequencing nucleotides genome 16S DNA showed that cellulolytic inoculant was identified as Enterobacter cloacae WPL 214. ABSTRAK Penelitian ini bertujuan untuk mengidentifikasi lebih lanjut isolat selulolitik kode WPL 214 yang telah diisolasi dari cairan rumen sapi peranakan ongole dari limbah Rumah Potong Hewan Surabaya. Koloni tunggal dari isolat selulolitik ditumbuhkan pada 5 mL media cair Luria Bertani (LB dengan komposisisi 1% NaCl, 1% tripton, 0,5% yeast ekstrak, yang mengandung 1% substrat carboxymethyl cellulose (CMC pada suhu 37°C, dengan pengocokan menggunakan shaker incubator selama ±16-18 jam. Penelitian ini terdiri dari dua tahap, tahap pertama dilakukan isolasi DNA, tahap kedua
-
[Detection of CRSPR-Cas system in Streptococcus thermophiles].
Li, Wan; Liang, Hongzhang; Zhang, Danqing; Wang, Nana; Tang, Yaru; Li, Bailiang; Huo, Guicheng
2016-04-14
We aimed to detect the CRSPR-Cas system of six Streptococcus thermophilus. Bioinformatics method was used to predict CRSPR-Cas system of nine S. thermophilus that published in National Center for Biotechnology Information. Four primers were designed according to the flanking sequences of standard strains and the CRISPR-Cas system of six S. thermophilus have been detected by PCR method. S. thermophilus S4 had a Cas9 gene, others all had Cas9 gene, Cas10 gene and Cas9* gene. In addition, 79 and KLDS3.0207 still had Cas3 gene. Signature genes amplification of CRSPR-Cas system could predict the type of CRSPR-Cas system in unsequenced strains, these findings will help establish the foundation for the study of CRSPR-Cas system in lactic acid bacteria.
-
Improvement of production performance of functional fermented whey-based beverage
Directory of Open Access Journals (Sweden)
Bulatović Maja Lj.
2014-01-01
Full Text Available The aim of this study was improvement of the performances for the production of whey-based beverages with highly productive strains of Lactobacillus. Individual or mixed culture containing Lactobacillus helveticus ATCC 15009, Lactobacillus delbrueckii ssp. lactis NRRL B-4525 and Streptococcus thermophilus S3 were studied. The scientific hypothesis was that production performances, especially aroma and viable cell count, are positively affected by the strains combination and temperature. Based on the results, beverages obtained by mixed cultures Lb. helveticus ATCC 15009 - S. thermophilus S3 and Lb. delbrueckii ssp. lactis - S. thermophilus S3 had higher aroma values than beverages obtained by individual strains. The symbiosis of tested strains has positive impact on the aroma of produced beverage. In addition, the temperature has significant influence on cell viability during the storage and fermentation dynamic. The beverages produced by mixed cultures Lb. helveticus ATCC 15009 - S. thermophilus S3 and Lb. delbrueckii ssp. lactis - S. thermophilus S3 at 42 oC achieved higher storage stability (19 to 22 days than beverages produced at 37°C and 45°C (13 to 19 days. Subsequently, at 42 °C fermentation time for both mixed cultures was 1.5 h shorter, compared to the time achieved at 37°C.
-
Directory of Open Access Journals (Sweden)
Rocha-Martín Javier
2011-11-01
Full Text Available Abstract Background The number of biotransformations that use nicotinamide recycling systems is exponentially growing. For this reason one of the current challenges in biocatalysis is to develop and optimize more simple and efficient cofactor recycling systems. One promising approach to regenerate NAD+ pools is the use of NADH-oxidases that reduce oxygen to hydrogen peroxide while oxidizing NADH to NAD+. This class of enzymes may be applied to asymmetric reduction of prochiral substrates in order to obtain enantiopure compounds. Results The NADH-oxidase (NOX presented here is a flavoenzyme which needs exogenous FAD or FMN to reach its maximum velocity. Interestingly, this enzyme is 6-fold hyperactivated by incubation at high temperatures (80°C under limiting concentrations of flavin cofactor, a change that remains stable even at low temperatures (37°C. The hyperactivated form presented a high specific activity (37.5 U/mg at low temperatures despite isolation from a thermophile source. Immobilization of NOX onto agarose activated with glyoxyl groups yielded the most stable enzyme preparation (6-fold more stable than the hyperactivated soluble enzyme. The immobilized derivative was able to be reactivated under physiological conditions after inactivation by high solvent concentrations. The inactivation/reactivation cycle could be repeated at least three times, recovering full NOX activity in all cases after the reactivation step. This immobilized catalyst is presented as a recycling partner for a thermophile alcohol dehydrogenase in order to perform the kinetic resolution secondary alcohols. Conclusion We have designed, developed and characterized a heterogeneous and robust biocatalyst which has been used as recycling partner in the kinetic resolution of rac-1-phenylethanol. The high stability along with its capability to be reactivated makes this biocatalyst highly re-useable for cofactor recycling in redox biotransformations.
-
Comparison of two approaches for the classification of 16S rRNA gene sequences.
Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan
2014-10-01
The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.
-
Microbial community dynamics in thermophilic undefined milk starter cultures.
Parente, Eugenio; Guidone, Angela; Matera, Attilio; De Filippis, Francesca; Mauriello, Gianluigi; Ricciardi, Annamaria
2016-01-18
Model undefined thermophilic starter cultures were produced from raw milk of nine pasta-filata cheesemaking plants using a selective procedure based on pasteurization and incubation at high temperature with the objective of studying the microbial community dynamics and the variability in performances under repeated (7-13) reproduction cycles with backslopping. The traditional culture-dependent approach, based on random isolation and molecular characterization of isolates was coupled to the determination of pH and the evaluation of the ability to produce acid and fermentation metabolites. Moreover, a culture-independent approach based on amplicon-targeted next-generation sequencing was employed. The microbial diversity was evaluated by 16S rRNA gene sequencing (V1-V3 regions), while the microdiversity of Streptococcus thermophilus populations was explored by using novel approach based on sequencing of partial amplicons of the phosphoserine phosphatase gene (serB). In addition, the occurrence of bacteriophages was evaluated by qPCR and by multiplex PCR. Although it was relatively easy to select for a community dominated by thermophilic lactic acid bacteria (LAB) within a single reproduction cycle, final pH, LAB populations and acid production activity fluctuated over reproduction cycles. Both culture-dependent and -independent methods showed that the cultures were dominated by either S. thermophilus or Lactobacillus delbrueckii subsp. lactis or by both species. Nevertheless, subdominant mesophilic species, including lactococci and spoilage organisms, persisted at low levels. A limited number of serB sequence types (ST) were present in S. thermophilus populations. L. delbrueckii and Lactococcus lactis bacteriophages were below the detection limit of the method used and high titres of cos type S. thermophilus bacteriophages were detected in only two cases. In one case a high titre of bacteriophages was concurrent with a S. thermophilus biotype shift in the culture
-
A renaissance for the pioneering 16S rRNA gene
Energy Technology Data Exchange (ETDEWEB)
Tringe, Susannah; Hugenholtz, Philip
2008-09-07
Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.
-
Production of Synbiotic Yogurt-Like Using Indigenous Lactic Acid Bacteria as Functional Food
Directory of Open Access Journals (Sweden)
M. Astawan
2012-04-01
Full Text Available Yoghurt is a product of fermented milk using Lactobacillus bulgaricus and Streptococcus thermophilus as culture starter. Indigenous probiotic lactic acid bacteria, Lactobacillus plantarum 2C12 or Lactobacillus acidophilus 2B4, were applied in the making of functional synbiotic yoghurt-like with 5% of fructo-oligosaccharide (FOS as a prebiotic source. The aim of this study was to determine the best formula of functional synbiotic yoghurt-like among four formulas: F1 (L. bulgaricus + S. thermophilus, F2 (L. bulgaricus + S. thermophilus + L. plantarum 2C12, F3 (L. bulgaricus+ S. thermophilus + L. acidophilus 2B4, and F4 (L. bulgaricus + S. thermophilus + L. plantarum 2C12 + L. acidophilus 2B4 to be choosen and followed detection of it’s flavor to improve the product quality and consumer acceptance. The results showed that the F3 synbiotic yogurt made from mixed culture L. bulgaricus, S. thermophilus, and L. acidophilus 2B4 had the highest antibacterial effect against Enteropathogenic Escherichia coli (EPEC. Addition of 1.75% natural corn starch as a stabilizer produced optimum improvement in yoghurt consistency and minimize whey separation. Result of sensory evaluation indicated that the yoghurt with addition of 1% strawberry flavor and 0.1% vanilla flavor were ranked at first and second. Yoghurts were still good to be consumed after 15 d storage period at the refrigeration temperature (10 oC.
-
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
-
The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.
Jay, Zackary J; Inskeep, William P
2015-07-09
Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.
-
Detecting 16S rRNA Methyltransferases in Enterobacteriaceae by Use of Arbekacin.
McGann, Patrick; Chahine, Sarah; Okafor, Darius; Ong, Ana C; Maybank, Rosslyn; Kwak, Yoon I; Wilson, Kerry; Zapor, Michael; Lesho, Emil; Hinkle, Mary
2016-01-01
16S rRNA methyltransferases confer resistance to most aminoglycosides, but discriminating their activity from that of aminoglycoside-modifying enzymes (AMEs) is challenging using phenotypic methods. We demonstrate that arbekacin, an aminoglycoside refractory to most AMEs, can rapidly detect 16S methyltransferase activity in Enterobacteriaceae with high specificity using the standard disk susceptibility test. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
-
Enhanced radiative Auger emission from lithiumlike 16S13+
International Nuclear Information System (INIS)
Bernstein, E.M.; Clark, M.W.; Oglesby, C.S.; Tanis, J.A.; Graham, W.G.; McFarland, R.H.; Morgan, T.J.; Johnson, B.M.; Jones, K.W.
1990-01-01
The radiative Auger emission (RAE) from 0.94--6.25-MeV/u 16 S 13+ (lithiumlike) projectiles excited in collisions with He target atoms has been measured. For these highly stripped ions the intensity of RAE photons relative to Kα x-ray emission is enhanced by about a factor of five compared with theoretical calculations and an earlier experimental measurement for S ions with few electron vacancies. The enhancement of RAE for S 13+ is qualitatively similar to results reported previously for lithiumlike 23 V 20+ ; however, some differences between S and V are evident
-
Pawlowski, Alice; Rissanen, Ilona; Bamford, Jaana K H; Krupovic, Mart; Jalasvuori, Matti
2014-06-01
A new family of viruses named Sphaerolipoviridae has been proposed recently. It comprises icosahedral, tailless haloarchaeal viruses with an internal lipid membrane located between the protein capsid and the dsDNA genome. The proposed family Sphaerolipoviridae was divided into two genera: Alphasphaerolipovirus, including Haloarcula hispanica viruses SH1, PH1 and HHIV-2, and Betasphaerolipovirus, including Natrinema virus SNJ1. Here, we propose to expand the family Sphaerolipoviridae to include a group of bacteriophages infecting extreme thermophilic Thermus thermophilus and sharing a number of structural and genomic properties with archaeal sphaerolipoviruses. This new group comprises two members, lytic phage P23-77 and temperate phage IN93, as well as putative members P23-72 and P23-65H. In addition, several related proviruses have been discovered as integrated elements in bacterial genomes of the families Thermus and Meiothermus. Morphology of the virus particles and the overall capsid architecture of these bacteriophages resembles that of archaeal members of the Sphaerolipoviridae, including an unusual capsid arrangement in a T = 28 dextro lattice. Alpha- and betasphaerolipoviruses share with P23-77-like bacteriophages a conserved block of core genes that encode a putative genome-packaging ATPase and the two major capsid proteins (MCPs). The recently determined X-ray structure of the small and large MCPs of P23-77 revealed a single beta-barrel (jelly-roll) fold that is superimposable with the cryo-EM density maps of the SH1 capsomers. Given the common features of these viruses, we propose to include the so far unclassified P23-77-like bacteriophages into a new genus, "Gammasphaerolipovirus", within the family Sphaerolipoviridae.
-
Cross-linking of streptomycin to the 16S ribosomal RNA of Escherichia coli
International Nuclear Information System (INIS)
Gravel, M.; Melancon, P.; Barkier-Gingras, L.
1987-01-01
[ 3 H]Dihydrostreptomycin was cross-linked to the 30S ribosomal subunit from Escherichia coli with the bifunctional reagent nitrogen mustard. The cross-linking primarily involved the 16S RNA. To localize the site of cross-linking of streptomycin to the 16S RNA, the authors hybridized RNA labeled with streptomycin to restriction fragments of the 16S RNA gene. Labeled RNA hybridized to DNA fragments corresponding to bases 892-917 and bases 1394-1415. These two segments of the ribosomal RNA must by juxtaposed in the ribosome, since there is a single binding site for streptomycin. This region has been implicated both in the decoding site and in the binding of initiation factor IF-3, indicating its functional importance
-
Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jeffrey R Johansen
Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.
-
Del Arco, J; Cejudo-Sanches, J; Esteban, I; Clemente-Suárez, V J; Hormigo, D; Perona, A; Fernández-Lucas, J
2017-12-15
Traditionally, enzymatic synthesis of nucleoside-5'-monophosphates (5'-NMPs) using low water-soluble purine bases has been described as less efficient due to their low solubility in aqueous media. The use of enzymes from extremophiles, such as thermophiles or alkaliphiles, offers the potential to increase solubilisation of these bases by employing high temperatures or alkaline pH. This study describes the cloning, expression and purification of hypoxanthine-guanine-xanthine phosphoribosyltransferase from Thermus thermophilus (TtHGXPRT). Biochemical characterization indicates TtHGXPRT as a homotetramer with excellent activity and stability across a broad range of temperatures (50-90°C) and ionic strengths (0-500mMNaCl), but it also reveals an unusually high activity and stability under alkaline conditions (pH range 8-11). In order to explore the potential of TtHGXPRT as an industrial biocatalyst, enzymatic production of several dietary 5'-NMPs, such as 5'-GMP and 5'-IMP, was carried out at high concentrations of guanine and hypoxanthine. Copyright © 2017 Elsevier Ltd. All rights reserved.
-
Detecting protein-protein interactions in the intact cell of Bacillus subtilis (ATCC 6633).
Winters, Michael S; Day, R A
2003-07-01
The salt bridge, paired group-specific reagent cyanogen (ethanedinitrile; C(2)N(2)) converts naturally occurring pairs of functional groups into covalently linked products. Cyanogen readily permeates cell walls and membranes. When the paired groups are shared between associated proteins, isolation of the covalently linked proteins allows their identity to be assigned. Examination of organisms of known genome sequence permits identification of the linked proteins by mass spectrometric techniques applied to peptides derived from them. The cyanogen-linked proteins were isolated by polyacrylamide gel electrophoresis. Digestion of the isolated proteins with proteases of known specificity afforded sets of peptides that could be analyzed by mass spectrometry. These data were compared with those derived theoretically from the Swiss Protein Database by computer-based comparisons (Protein Prospector; http://prospector.ucsf.edu). Identification of associated proteins in the ribosome of Bacillus subtilis strain ATCC 6633 showed that there is an association homology with the association patterns of the ribosomal proteins of Haloarcula marismortui and Thermus thermophilus. In addition, other proteins involved in protein biosynthesis were shown to be associated with ribosomal proteins.
-
Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes
Zhu, Lizhe
2016-10-05
At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms.
-
Reconstitution of β-carotene hydroxylase activity of thermostable CYP175A1 monooxygenase
International Nuclear Information System (INIS)
Momoi, Kyoko; Hofmann, Ute; Schmid, Rolf D.; Urlacher, Vlada B.
2006-01-01
CYP175A1 is a thermostable P450 Monooxygenase from Thermus thermophilus HB27, demonstrating in vivo activity towards β-carotene. Activity of CYP175A1 was reconstituted in vitro using artificial electron transport proteins. First results were obtained in the mixture with a crude Escherichia coli cell extract at 37 o C. In this system, β-carotene was hydroxylated to β-cryptoxanthin. The result indicated the presence of electron transport enzymes among the E. coli proteins, which are suitable for CYP175A1. However, upon in vitro reconstitution of CYP175A1 activity with purified recombinant flavodoxin and flavodoxin reductase from E. coli, only very low β-cryptoxanthin production was observed. Remarkably, with another artificial electron transport system, putidaredoxin and putidaredoxin reductase from Pseudomonas putida, purified CYP175A1 enzyme hydroxylated β-carotene at 3- and also 3'-positions, resulting in β-cryptoxanthin and zeaxanthin. Under the optimal reaction conditions, the turnover rate of the enzyme reached 0.23 nmol β-cryptoxanthin produced per nmol P450 per min
-
Directory of Open Access Journals (Sweden)
Moore JE
2006-01-01
Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.
-
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
-
Directory of Open Access Journals (Sweden)
Zehra Nur Yuksekdag
2008-06-01
Full Text Available Exopolysaccharides (EPSs production was studied by Lactobacillus delbrueckii subsp. bulgaricus (B3, G12 and Streptococcus thermophilus (W22 in the medium containing various carbon sources (glucose, fructose, sucrose or lactose. For all the strains, glucose was the most efficient carbon source and B3, G12 and W22 strains produced 211, 175 and 120 EPS mg/L respectively. Also, the influence of different concentrations of glucose (5,10,15,20,25,30 g/L on EPS production and growth was studied. The results indicated that EPS production and growth were stimulated by the high glucose concentration (30 g/L.
-
Li, Yongjie; Tang, Aiwei; Liu, Zhenyang; Peng, Lan; Yuan, Yi; Shi, Xifeng; Yang, Chunhe; Teng, Feng
2018-01-07
A simple two-phase strategy was developed to prepare Cu 31 S 16 -CuInS 2 heterostructures (HNS) at the oil/aqueous interface, in which the In(OH) 3 phase was often obtained in the products due to the reaction between indium ions and hydroxyl ions in the aqueous phase. To prevent the formation of the In(OH) 3 phase, citric acid was incorporated into the aqueous phase to assist in the synthesis of uniform carrot-like Cu 31 S 16 -CuInS 2 semiconductor HNS at the oil/aqueous interface for the first time. By manipulating the dosage of citric acid and Cu/In precursor ratios, the morphology of the Cu 31 S 16 -CuInS 2 HNS could be tailored from mushroom to carrot-like, and the presence of citric acid played a critical role in the synthesis of high-quality Cu 31 S 16 -CuInS 2 HNS, which inhibited the formation of the In(OH) 3 phase due to the formation of the indium(iii)-citric acid complex. The formation mechanism was studied by monitoring the morphology and phase evolution of the Cu 31 S 16 -CuInS 2 HNS with reaction time, which revealed that the Cu 31 S 16 seeds were first formed and then the cation-exchange reaction directed the subsequent anisotropic growth of the Cu 31 S 16 -CuInS 2 HNS.
-
Engineering an ATP-dependent D-Ala:D-Ala ligase for synthesizing amino acid amides from amino acids.
Miki, Yuta; Okazaki, Seiji; Asano, Yasuhisa
2017-05-01
We successfully engineered a new enzyme that catalyzes the formation of D-Ala amide (D-AlaNH 2 ) from D-Ala by modifying ATP-dependent D-Ala:D-Ala ligase (EC 6.3.2.4) from Thermus thermophilus, which catalyzes the formation of D-Ala-D-Ala from two molecules of D-Ala. The new enzyme was created by the replacement of the Ser293 residue with acidic amino acids, as it was speculated to bind to the second D-Ala of D-Ala-D-Ala. In addition, a replacement of the position with Glu performed better than that with Asp with regards to specificity for D-AlaNH 2 production. The S293E variant, which was selected as the best enzyme for D-AlaNH 2 production, exhibited an optimal activity at pH 9.0 and 40 °C for D-AlaNH 2 production. The apparent K m values of this variant for D-Ala and NH 3 were 7.35 mM and 1.58 M, respectively. The S293E variant could catalyze the synthesis of 9.3 and 35.7 mM of D-AlaNH 2 from 10 and 50 mM D-Ala and 3 M NH 4 Cl with conversion yields of 93 and 71.4 %, respectively. This is the first report showing the enzymatic formation of amino acid amides from amino acids.
-
Occurrence, isolation and DNA identification of Streptococcus ...
African Journals Online (AJOL)
ajl yemi
2011-11-28
Nov 28, 2011 ... Streptococcus thermophilus involved in Algerian ... among reference, and wild strains of S. thermophilus and for their differentiation from Enterococcus spp. ..... Isolation and characterization of Lactobacillus delbrueckii ssp.
-
Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians
Directory of Open Access Journals (Sweden)
Chiari Ylenia
2005-03-01
Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.
-
Problem-Based Test: Functional Analysis of Mutant 16S rRNAs
Szeberenyi, Jozsef
2010-01-01
Terms to be familiar with before you start to solve the test: ribosome, ribosomal subunits, antibiotics, point mutation, 16S, 5S, and 23S rRNA, Shine-Dalgarno sequence, mRNA, tRNA, palindrome, hairpin, restriction endonuclease, fMet-tRNA, peptidyl transferase, initiation, elongation, termination of translation, expression plasmid, transformation,…
-
Directory of Open Access Journals (Sweden)
Sun Yu
2011-11-01
Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.
-
A renaissance for the pioneering 16S rRNA gene.
Tringe, Susannah G; Hugenholtz, Philip
2008-10-01
Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the past quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata, and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.
-
Data for molecular dynamics simulations of B-type cytochrome c oxidase with the Amber force field
Directory of Open Access Journals (Sweden)
Longhua Yang
2016-09-01
Full Text Available Cytochrome c oxidase (CcO is a vital enzyme that catalyzes the reduction of molecular oxygen to water and pumps protons across mitochondrial and bacterial membranes. This article presents parameters for the cofactors of ba3-type CcO that are compatible with the all-atom Amber ff12SB and ff14SB force fields. Specifically, parameters were developed for the CuA pair, heme b, and the dinuclear center that consists of heme a3 and CuB bridged by a hydroperoxo group. The data includes geometries in XYZ coordinate format for cluster models that were employed to compute proton transfer energies and derive bond parameters and point charges for the force field using density functional theory. Also included are the final parameter files that can be employed with the Amber leap program to generate input files for molecular dynamics simulations with the Amber software package. Based on the high resolution (1.8 Å X-ray crystal structure of the ba3-type CcO from Thermus thermophilus (Protein Data Bank ID number PDB: 3S8F, we built a model that is embedded in a POPC lipid bilayer membrane and solvated with TIP3P water molecules and counterions. We provide PDB data files of the initial model and the equilibrated model that can be used for further studies.
-
Utility of 16S rRNA PCR performed on clinical specimens in patient management
Directory of Open Access Journals (Sweden)
A. Akram
2017-04-01
Conclusions: Despite the low diagnostic yield, results of 16S rRNA PCR can still have a significant impact on patient management due to rationalization or cessation of the antimicrobial therapy. The yield of 16S rRNA PCR was highest for heart valves.
-
Inhibition of Escherichia coli precursor-16S rRNA processing by mouse intestinal contents
DEFF Research Database (Denmark)
Licht, Tine Rask; Tolker-Nielsen, Tim; Holmstrøm, Kim
1999-01-01
. We have applied fluorescence in situ hybridization of pre-16S rRNA to Escherichia coli cells growing in vitro in extracts from two different compartments of the mouse intestine: the caecal mucus layer, where E. coli grew rapidly, and the contents of the caecum, which supported much slower bacterial...... content of pre-16S rRNA than cultures of the same strain growing rapidly in rich media. We present results suggesting that the mouse intestinal contents contain an agent that inhibits the growth of E. coli by disturbing its ability to process pre-16S rRNA....
-
Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli
DEFF Research Database (Denmark)
Triman, K; Becker, E; Dammel, C
1989-01-01
Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance....... The mutations were localized by in vitro restriction fragment replacement followed by in vivo marker rescue and were identified by DNA sequence analysis. We report here seven single-base alterations in 16 S rRNA (A146, U153, A350, A359, A538, A1292 and U1293), five of which produce temperature......-sensitive spectinomycin resistance and two that produce unconditional loss of resistance. In each case, loss of ribosomal function can be accounted for by disruption of base-pairing in the secondary structure of 16 S rRNA. For the temperature-sensitive mutants, there is a lag period of about two generations between...
-
Directory of Open Access Journals (Sweden)
A. Alunno
2016-02-01
Full Text Available The interferon (IFN signature, namely the overexpression of IFN-inducible genes is a crucial aspect in the pathogenesis of primary Sjögren’s syndrome (pSS. The IFN-inducible IFI16 protein, normally expressed in cell nuclei, may be overexpressed, mislocalized in the cytoplasm and secreted in the extracellular milieu in several autoimmune disorders including pSS. This leads to tolerance breaking to this self-protein and development of anti-IFI16 antibodies. The aim of this study was to identify pathogenic and clinical significance of IFI16 and anti-IFI16 autoantibodies in pSS. IFI16 and anti-IFI16 were assessed in the serum of 30 pSS patients and one-hundred healthy donors (HD by ELISA. IFI16 was also evaluated in 5 minor salivary glands (MSGs of pSS patients and 5 MSGs of non-pSS patients with sicca symptoms by immunohistochemistry. Normal MSGs do not constitutively express IFI16. Conversely, in pSS-MSGs a marked expression and cytoplasmic mislocalization of IFI16 by epithelial cells was observed with infiltrations in lymphocytes and peri/ intra-lesional endothelium. pSS patients display higher serum levels of both IFI16 and anti-IFI16 autoantibodies compared to HD. Our data suggest that IFI16 protein may be involved in the initiation and perpetuation of glandular inflammation occurring in pSS.
-
Histopathology of Kaposi\\'s sarcoma in Jos: A 16-year review ...
African Journals Online (AJOL)
Background/objective: To study the pathology of Kaposi\\'s sarcoma and review relevant literature on this condition. Method: A retrospective analysis of histologically confirmed cases of Kaposi\\'s sarcoma over a period of 16 years was undertaken. Fresh sections of slides were reviewed independently by two pathologists.
-
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
-
How conserved are the conserved 16S-rRNA regions?
Directory of Open Access Journals (Sweden)
Marcel Martinez-Porchas
2017-02-01
Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.
-
Electron transfer among the CuA-, heme b- and a3-centers of Thermus thermophilus cytochrome ba3
DEFF Research Database (Denmark)
Farver, Ole; Chen, Ying; Fee, James A
2006-01-01
The 1-methyl-nicotinamide radical (MNA(*)), produced by pulse radiolysis has previously been shown to reduce the Cu(A)-site of cytochromes aa(3), a process followed by intramolecular electron transfer (ET) to the heme a but not to the heme a(3) [Farver, O., Grell, E., Ludwig, B., Michel, H. and P...
-
Analysis of bacterial genetic diversity in biofloc by using ARDRA 16S-rRNA gene
Directory of Open Access Journals (Sweden)
, Widanarni
2015-05-01
Full Text Available ABSTRACT This study aimed to analyze the genetic diversity of bacteria associated in bioflocs using 16S-rRNA polymerase chain reaction (PCR with ARDRA technique. A total of 38 dominant bacterial isolates was obtained from bioflocs samples and of these isolates, 16S-rRNA gene was then isolated and amplified using PCR. The 16S-rRNA gene of the isolates was then cut using HaeIII (5’-GG↓CC and HhaI (5’-GCG↓C restriction enzymes resulting an ARDRA pattern which was further used as the binary data for the construction of phylogenetics tree that was used to estimate the group of bacteria. The result with HaeIII cut restriction enzyme from biofloc-associated bacteria gave 11 ARDRA patterns, while with the restriction enzyme HhaI gave eight ARDRA patterns. Phylogenetics of bacterial populations from biofloc-based cultivation system water consisted of at least 13 different bacterial species. Result of sequencing from two gene sample 16S-rRNA were identified as Microbacterium foliorumand and Pseudomonas putida. Keywords: bacterial diversity, ARDRA, biofloc, phylogeny ABSTRAK Penelitian ini bertujuan untuk menganalisis keragaman genetika bakteri bioflok menggunakan metode polymerase chain reaction (PCR 16S-rRNA dengan teknik ARDRA. Sebanyak 38 isolat bakteri dominan yang diperoleh diamplifikasi gen 16S-rRNAnya dengan PCR, kemudian dipotong dengan enzim restriksi HaeIII (5’-GG↓CC dan HhaI (5’-GCG↓C. Pola ARDRA ini dijadikan data biner sebagai input untuk konstruksi pohon filogenetika yang dapat digunakan untuk memerkirakan jenis bakteri yang ada. Gen 16S-rRNA hasil PCR setelah dipotong dengan enzim restriksi HaeIII didapatkan 11 pola ARDRA, sedangkan dengan enzim restriksi HhaI menghasilkan delapan pola ARDRA. Berdasarkan pohon filogenetika, diketahui populasi bakteri pada air sistem budidaya bioflok sedikitnya terdiri atas 13 jenis bakteri. Berdasarkan sekuensing dari dua sampel gen 16S-rRNA teridentifikasi jenis bakteri Microbacterium
-
Glušac, J; Stijepić, M; Đurđević-Milošević, D; Milanović, S; Kanurić, K; Vukić, V
2015-01-01
The ability of whey protein concentrate (WPC) (1% w/v) and/or honey (2% and 4% w⁄v) to improve lactic acid bacteria (Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus) growth and viability in yoghurt during a 21 day period of storage was investigated. Another focus of this study was to examine fermentation kinetics and post-acidification rates through pH and lactic acid content measurements over the 21 day period. The addition of WPC and acacia honey accelerated fermentation and improved lactic acid bacteria (LAB) growth over the 21 days, but honey proportion did not significantly affect the viability of LAB. Moreover, adding honey and WPC did not support the overproduction of lactic acid, which positively influenced yoghurt stability during the 21 day storage period.
-
16S pan-bacterial PCR can accurately identify patients with ventilator-associated pneumonia.
Conway Morris, Andrew; Gadsby, Naomi; McKenna, James P; Hellyer, Thomas P; Dark, Paul; Singh, Suveer; Walsh, Timothy S; McAuley, Danny F; Templeton, Kate; Simpson, A John; McMullan, Ronan
2017-11-01
Ventilator-associated pneumonia (VAP) remains a challenge to intensive care units, with secure diagnosis relying on microbiological cultures that take up to 72 hours to provide a result. We sought to derive and validate a novel, real-time 16S rRNA gene PCR for rapid exclusion of VAP. Bronchoalveolar lavage (BAL) was obtained from two independent cohorts of patients with suspected VAP. Patients were recruited in a 2-centre derivation cohort and a 12-centre confirmation cohort. Confirmed VAP was defined as growth of >10 4 colony forming units/ml on semiquantitative culture and compared with a 16S PCR assay. Samples were tested from 67 patients in the derivation cohort, 10 (15%) of whom had confirmed VAP. Using cycles to cross threshold (C t ) values as the result of the 16S PCR test, the area under the receiver operating characteristic (ROC) curve (AUROC) was 0.94 (95% CI 0.86 to 1.0, p<0.0001). Samples from 92 patients were available from the confirmation cohort, 26 (28%) of whom had confirmed VAP. The AUROC for C t in this cohort was 0.89 (95% CI 0.83 to 0.95, p<0.0001). This study has derived and assessed the diagnostic accuracy of a novel application for 16S PCR. This suggests that 16S PCR in BAL could be used as a rapid test in suspected VAP and may allow better stewardship of antibiotics. VAPRAPID trial ref NCT01972425. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.
-
Delgado, Susana; Rachid, Caio T C C; Fernández, Elena; Rychlik, Tomasz; Alegría, Angel; Peixoto, Raquel S; Mayo, Baltasar
2013-10-01
Thermophilic lactic acid bacteria (LAB) species, such as Streptococcus thermophilus, Lactobacillus delbrueckii and Lactobacillus helveticus, enjoy worldwide economic importance as dairy starters. To assess the diversity of thermophilic bacteria in milk, milk samples were enriched in thermophilic organisms through a stepwise procedure which included pasteurization of milk at 63 °C for 30 min (PM samples) and pasteurization followed by incubation at 42 °C for 24 h (IPM samples). The microbial composition of these samples was analyzed by culture-dependent (at 42 °C) and culture-independent (PCR-DGGE and pyrosequencing of 16S rRNA gene amplicons) microbial techniques. The results were then compared to those obtained for their corresponding starting raw milk counterparts (RM samples). Twenty different species were scored by culturing among 352 isolates purified from the counting plates and identified by molecular methods. Mesophilic LAB species (Lactococcus lactis, Lactococcus garvieae) were dominant (87% of the isolates) among the RM samples. However, S. thermophilus and Lb. delbrueckii were found to be the dominant recoverable organisms in both PM and IPM samples. The DGGE profiles of RM and PM samples were found to be very similar; the most prominent bands belonging to Lactococcus, Leuconostoc and Streptococcus species. In contrast, just three DGGE bands were obtained for IPM samples, two of which were assigned to S. thermophilus. The pyrosequencing results scored 95 operational taxonomic units (OTUs) at 3% sequence divergence in an RM sample, while only 13 were encountered in two IPM samples. This technique identified Leuconostoc citreum as the dominant microorganism in the RM sample, while S. thermophilus constituted more than 98% of the reads in the IPM samples. The procedure followed in this study allowed to estimate the bacterial diversity in milk and afford a suitable strategy for the isolation of new thermophilic LAB strains, among which adequate
-
Directory of Open Access Journals (Sweden)
Ye Xiaoting
2012-09-01
Full Text Available Abstract Background The integration of biotechnology into chemical manufacturing has been recognized as a key technology to build a sustainable society. However, the practical applications of biocatalytic chemical conversions are often restricted due to their complexities involving the unpredictability of product yield and the troublesome controls in fermentation processes. One of the possible strategies to overcome these limitations is to eliminate the use of living microorganisms and to use only enzymes involved in the metabolic pathway. Use of recombinant mesophiles producing thermophilic enzymes at high temperature results in denaturation of indigenous proteins and elimination of undesired side reactions; consequently, highly selective and stable biocatalytic modules can be readily prepared. By rationally combining those modules together, artificial synthetic pathways specialized for chemical manufacturing could be designed and constructed. Results A chimeric Embden-Meyerhof (EM pathway with balanced consumption and regeneration of ATP and ADP was constructed by using nine recombinant E. coli strains overproducing either one of the seven glycolytic enzymes of Thermus thermophilus, the cofactor-independent phosphoglycerate mutase of Pyrococcus horikoshii, or the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase of Thermococcus kodakarensis. By coupling this pathway with the Thermus malate/lactate dehydrogenase, a stoichiometric amount of lactate was produced from glucose with an overall ATP turnover number of 31. Conclusions In this study, a novel and simple technology for flexible design of a bespoke metabolic pathway was developed. The concept has been testified via a non-ATP-forming chimeric EM pathway. We designated this technology as “synthetic metabolic engineering”. Our technology is, in principle, applicable to all thermophilic enzymes as long as they can be functionally expressed in the host, and thus would be
-
Directory of Open Access Journals (Sweden)
Harsi Dewantari Kusumaningrum
2016-08-01
Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2, the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.
-
Directory of Open Access Journals (Sweden)
Brittany Burton
Full Text Available Assembly of the ribosome from its protein and RNA constituents has been studied extensively over the past 50 years, and experimental evidence suggests that prokaryotic ribosomal proteins undergo conformational changes during assembly. However, to date, no studies have attempted to elucidate these conformational changes. The present work utilizes computational methods to analyze protein dynamics and to investigate the linkage between dynamics and binding of these proteins during the assembly of the ribosome. Ribosomal proteins are known to be positively charged and we find the percentage of positive residues in r-proteins to be about twice that of the average protein: Lys+Arg is 18.7% for E. coli and 21.2% for T. thermophilus. Also, positive residues constitute a large proportion of RNA contacting residues: 39% for E. coli and 46% for T. thermophilus. This affirms the known importance of charge-charge interactions in the assembly of the ribosome. We studied the dynamics of three primary proteins from E. coli and T. thermophilus 30S subunits that bind early in the assembly (S15, S17, and S20 with atomic molecular dynamic simulations, followed by a study of all r-proteins using elastic network models. Molecular dynamics simulations show that solvent-exposed proteins (S15 and S17 tend to adopt more stable solution conformations than an RNA-embedded protein (S20. We also find protein residues that contact the 16S rRNA are generally more mobile in comparison with the other residues. This is because there is a larger proportion of contacting residues located in flexible loop regions. By the use of elastic network models, which are computationally more efficient, we show that this trend holds for most of the 30S r-proteins.
-
Directory of Open Access Journals (Sweden)
Hee-jung Lim
2016-10-01
Full Text Available Background: Production of wheat bran (WB for human consumption is estimated to be about 90 million tons per year. WB contains an abundant source of dietary fiber, minerals, vitamins, and bioactive compounds. WB is a by-product of milling and contains an abundant source of carbohydrate (60%, protein (12%, fat (0.5%, minerals (2%, and bioactive compounds such as phenolic acids, arabinoxylans, flavonoids, caroteinoids alkylresorcinol and phytosterols. These are known for health promoting properties such as controlling glycemic index, reducing plasma cholesterol level, antioxidant, anti-inflammatory, and anticarcinogenic activities. Several terpene glycosides such as mogroside V, paenoiflorin, geniposide, rubusoside (Ru, stevioside (Ste, rebaudioside A (RebA, steviol monoside, and stevioside glucoside have been discovered to enhance the solubility of a number of pharmaceutically and medically important compounds that normally show poor solubility in water. Context and purpose of this study: In this study, in order to increase soluble extraction of polyphenol compounds of WB using Ru, the expression of β-galactosidase from Thermus thermophilus (T. thermophilus was optimized using different E. coli hosts and a different concentration of lactose inducer rather than of isopropyl-1- thio-β-D-galactopyranoside (IPTG for industrial production. Additionally, the effect of different steviol glucosides (Ru, Ste, RebA, and SG on the enhancement of polyphenol compounds extraction from wheat bran was studied. Results: β-galactosidase from T. thermophilus was used for the specific conversion of stevioside (Ste to rubusoside (Ru with 92% productivity. The enzyme was optimized to be expressed in E. coli. With 7 mM lactose, the β-galactosidase activity expressed was 34.3, 14.2, or 34.4 ± 0.5 U/mL in E. coli BL21(DE3pLysS, Rosetta(DE3pLysS, or BL21(DE3 at 37°C, and 9.8 ± 0.2, 7.0 ± 0.5, or 7.4 ± 0.2 U/mL at 28°C respectively. The expression of
-
Directory of Open Access Journals (Sweden)
Lucia Emy Octavia
2016-06-01
Full Text Available Penelitian ini dilakukan untuk mengetahui ragam alel masyarakat Dayak Kaharingan di Kota Palangka Raya. DNA diekstraksi dari sel epitel mukosa mulut, dari 26 individu dengan metode fenol kloroform. DNA mikrosatelitautosom lokus D2S1338, D13S317 dan D16S539 diamplifikasi pada mesin PCR. Pengamatan hasil PCR dilakukan dengan Polyacrylamide Gel Electrophoresis (PAGE dan visualisasi DNA hasil PCR dengan pewarnaan perak nitrat. Hasil penelitian ini menunjukkan terdapat 29 alel dari ketiga lokus yaitu lokus D2S1338 sebanyak 11 alel, serta masing-masing sembilan alel pada lokus D13S317 dan lokus D16S539. Nilai heterozigositas tertinggi terdapat pada lokus D2S1338 yaitu 0,8971 dengan kekuatan pembeda (PD 0,9682, diikuti lokus D13S317 dengan kekuatan pembeda 0,9339 dan lokus D16S539 dengan kekuatan pembeda 0,9226.
-
The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.
Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R
As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.
-
Nigerian indigenous yoghurt (kindirmo) production using ...
African Journals Online (AJOL)
user
2011-01-24
Jan 24, 2011 ... The production of Nigerian indigenous yoghurt (kindirmo) using Lactobacillus bulgaricus and. Streptococcus thermophilus mutants as starter culture was investigated. The results of milk fermentations using L. bulgaricus and S. thermophilus mutant isolates when compared with their wild- type strains ...
-
Nigerian indigenous yoghurt (kindirmo) production using ...
African Journals Online (AJOL)
The production of Nigerian indigenous yoghurt (kindirmo) using Lactobacillus bulgaricus and Streptococcus thermophilus mutants as starter culture was investigated. The results of milk fermentations using L. bulgaricus and S. thermophilus mutant isolates when compared with their wildtype strains (control) indicated that the ...
-
Rasoul-Amini, S; Ghasemi, Y; Morowvat, M H; Ghoshoon, M B; Raee, M J; Mosavi-Azam, S B; Montazeri-Najafabady, N; Nouri, F; Parvizi, R; Negintaji, N; Khoubani, S
2010-01-01
A unicellular cyanobacterium, Synechococcus nidulans (Pringsheim) Komárek, was isolated from paddy-fields and applied in the biotransformation experiment of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The obtained products were chromatographically purified followed by their characterization using spectroscopic methods. 11beta,17beta-dihydroxyandrost-4-en-3-one (2), 11beta-hydroxyandrost-4-en-3,17-dione (3), and androst-4-ene-3,17-dione (4) were the main bioproducts in the hydrocortisone bioconversion. The observed bioreaction characteristics were the side chain degradation of the substrate to prepare compounds (2) and (3) following the 11beta-dehydroxylation for accumulation of the compound (4). Time course study showed the accumulation of the product (2) from the second day of the fermentation and compounds (3) and (4) from the third day. All the metabolites reached their maximum concentration in seven days. Cyanobacterial 16S rRNA gene was also amplified by PCR. Sequences were amplified using the universal prokaryotic primers which amplify a approximately 400-bp region of the 16S rRNA gene. PCR products were sequenced to confirm their authenticity as 16S rRNA gene of cyanobacteria. The result of PCR blasted with other sequenced cyanobacteria in NCBI showed 99% identity to the 16S small subunit rRNA of seven Synechococcus species.
-
International Nuclear Information System (INIS)
Kuznichenko, A.V.; Onishchenko, G.M.; Pilipenko, V.V.; Dem'yanova, A.S.; Burtebaev, N.
2003-01-01
The analysis of the cross sections of the 16 O + 16 O nuclei elastic scattering by the energy of 124, 145, 250, 350, 480, 704 and 1120 MeV is carried out on the basis of the phenomenological S-matrix model. It is shown, that by high energy the refraction behavior of the opalescent-type cross sections is well described by the simple smooth dependence of the S-matrix on the angular moment and by the energy E ≤ 480 MeV the opalescent-type structures are strongly effected by the Regge poles and S-matrix zeroes, close to the actual axis. The comparison with the results of the cross sections by the optical model is carried out [ru
-
Directory of Open Access Journals (Sweden)
Céline Brochier-Armanet
2006-01-01
Full Text Available Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 °C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.
-
Brochier-Armanet, Céline; Forterre, Patrick
2007-05-01
Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT) to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 degrees C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.
-
Zuki, Ameyra Aman; Mohammed, Muhamad Azmi; Md-Zain, Badrul Munir; Yaakop, Salmah
2018-04-01
The phylogenetic relationships of Microgastrinae remains unclear though some studies have been conducted to resolve it. The function of Microgastrinae as endoparasitoids of Lepidopteran larvae makes this subfamily an ideal and potential species to be applied as biological control agent of infesting crops. In this study, a total of 13 microgastrine samples under 13 genera were collected from nine localities throughout Peninsular Malaysia. Two molecular regions, 28S nuclear marker and 16S mitochondrial marker were utilized in this study to examine the effectiveness of those regions in resolving the relationships within Microgastrinae. Total of 36 sequences were implemented in the analyses of NJ, MP and Bayesian for both markers. Results obtained from this study were supported by morphological and biological characters. Henceforth, the outcome from this study provides a proof of effectiveness of 28S and 16S molecular markers in studying the phylogenetic relationships of Microgastrinae from Malaysia exclusively and Oriental generally.
-
Marcial, Guillermo; Messing, Jutta; Menchicchi, Bianca; Goycoolea, Francisco M; Faller, Gerhard; Graciela, Font de Valdez; Hensel, Andreas
2013-11-01
EPS1190 was isolated from skim milk fermented with Stretococcus thermophilus CRL1190. The polysaccharide consisted of 33% glucose and 66% galactose with 1,4- and 1,4,6-galactose residues as main building blocks beside a high amount of 1,4-linked glucose. The polymer was characterized additionally concerning viscosity and zeta potential. EPS1190 stimulated cellular vitality and proliferation of human stomach AGS cells and human buccal KB cells significantly. EPS1190 stimulated phagocytosis rate of murine macrophages RAW264.7 significantly. NO-release or anti-inflammatory effects by inhibition of LPS-induced NO release were not observed. Confocal laser scanning microscopy revealed that EPS1190 is partially internalized into AGS cells via endosomes. The bioadhesive absorption of FITC-labeled EPS1190 into the mucus layer on the apical side of the epithelium using histological tissue sections from human stomach was observed. Specific interaction of EPS1190 with mucin can be excluded as shown by microviscosimetry studies. EPS1190 increased the adhesion of H. pylori to AGS cells, which resulted in increased secretion of proinflammatory cytokines TNFa, IL-6 and IL-8. Summarizing, EPS1190 seems to stimulate epithelial cell regeneration and immunological innate defense mechanisms, which again can rationalized the use of this polysaccharide as cytoprotective compound in probiotioc preparations. Copyright © 2013 Elsevier B.V. All rights reserved.
-
Directory of Open Access Journals (Sweden)
Grauman Peter L
2007-07-01
Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.
-
Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons
Haas, Brian J.; Gevers, Dirk; Earl, Ashlee M.; Feldgarden, Mike; Ward, Doyle V.; Giannoukos, Georgia; Ciulla, Dawn; Tabbaa, Diana; Highlander, Sarah K.; Sodergren, Erica; Methé, Barbara; DeSantis, Todd Z.; Petrosino, Joseph F.; Knight, Rob; Birren, Bruce W.
2011-01-01
Bacterial diversity among environmental samples is commonly assessed with PCR-amplified 16S rRNA gene (16S) sequences. Perceived diversity, however, can be influenced by sample preparation, primer selection, and formation of chimeric 16S amplification products. Chimeras are hybrid products between multiple parent sequences that can be falsely interpreted as novel organisms, thus inflating apparent diversity. We developed a new chimera detection tool called Chimera Slayer (CS). CS detects chimeras with greater sensitivity than previous methods, performs well on short sequences such as those produced by the 454 Life Sciences (Roche) Genome Sequencer, and can scale to large data sets. By benchmarking CS performance against sequences derived from a controlled DNA mixture of known organisms and a simulated chimera set, we provide insights into the factors that affect chimera formation such as sequence abundance, the extent of similarity between 16S genes, and PCR conditions. Chimeras were found to reproducibly form among independent amplifications and contributed to false perceptions of sample diversity and the false identification of novel taxa, with less-abundant species exhibiting chimera rates exceeding 70%. Shotgun metagenomic sequences of our mock community appear to be devoid of 16S chimeras, supporting a role for shotgun metagenomics in validating novel organisms discovered in targeted sequence surveys. PMID:21212162
-
Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.
Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E
1999-09-01
Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.
-
Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.
Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V
2003-01-01
Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).
-
International Nuclear Information System (INIS)
Simonetti, Angelita; Marzi, Stefano; Fabbretti, Attilio; Hazemann, Isabelle; Jenner, Lasse; Urzhumtsev, Alexandre; Gualerzi, Claudio O.; Klaholz, Bruno P.
2013-01-01
The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2 is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue
-
Energy Technology Data Exchange (ETDEWEB)
Simonetti, Angelita [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Marzi, Stefano [Architecture et Réactivité de l’ARN, UPR 9002 CNRS, IBMC (Institute of Molecular and Cellular Biology), 15 Rue R. Descartes, 67084 Strasbourg, France, Université de Strasbourg, 67000 Strasbourg (France); Fabbretti, Attilio [University of Camerino, 62032 Camerino (Monaco) (Italy); Hazemann, Isabelle; Jenner, Lasse [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale -INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Urzhumtsev, Alexandre [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Université de Lorraine, 54506 Vandoeuvre-lès-Nancy (France); Gualerzi, Claudio O. [University of Camerino, 62032 Camerino (Monaco) (Italy); Klaholz, Bruno P., E-mail: klaholz@igbmc.fr [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France)
2013-06-01
The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2 is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue.
-
Dec, Marta; Puchalski, Andrzej; Urban-Chmiel, Renata; Wernicki, Andrzej
2016-06-13
The objective of our study is to evaluate the potential use of Amplified 16S Ribosomal DNA Restriction Analysis (16S-ARDRA) and MALDI-TOF mass spectrometry (MS) as methods for species identification of Lactobacillus strains in poultry. A total of 80 Lactobacillus strains isolated from the cloaca of chicken, geese and turkeys were identified to the species level by MALDI-TOF MS (on-plate extraction method) and 16S-ARDRA. The two techniques produced comparable classification results, some of which were additionally confirmed by sequencing of 16S rDNA. MALDI-TOF MS enabled rapid species identification but produced more than one reliable identification result for 16.25 % of examined strains (mainly of the species L. johnsonii). For 30 % of isolates intermediate log(scores) of 1.70-1.99 were obtained, indicating correct genus identification but only presumptive species identification. The 16S-ARDRA protocol was based on digestion of 16S rDNA with the restriction enzymes MseI, HinfI, MboI and AluI. This technique was able to distinguish 17 of the 19 Lactobacillus reference species tested and enabled identification of all 80 wild isolates. L. salivarius dominated among the 15 recognized species, followed by L. johnsonii and L. ingluviei. The MALDI-TOF MS and 16S-ARDRA assays are valuable tools for the identification of avian lactobacilli to the species level. MALDI-TOF MS is a fast, simple and cost-effective technique, and despite generating a high percentage of results with a log(score) Lactobacillus bacteria from different habitats.
-
Directory of Open Access Journals (Sweden)
Raden Haryo Bimo Setiarto
2017-09-01
Full Text Available Fructooligosaccharides are prebiotic source that widely used in food products, such as: fermented milk and infant formula. Prebiotics are food components that cannot be digested in the digestive tract enzymatically. However, they can be fermented by probiotic bacteria in the colon. This study aimed to determine the optimum concentrations of fructooligosaccharides in order to increase the growth of lactic acid bacteria yogurt starter (Lactobacillus acidophillus, Lactobacillus bulgaricus, Streptococcus thermophillus. Optimation concentration of fructooligosaccharides on the growth of Lactobacillus acidophilus, Lactobacillus bulgaricus, Streptococcus thermophillus can be determined based on OD (optical density, TPC (Total Plate Count, total lactic acid content and pH value. Suplementation of fructooligosaccharides 1 % (w/v on the media MRSB increased significantly the growth of L. acidophilus, L.bulgaricus, S. thermophilus. Furthermore, L. acidophilus, L. bulgaricus and S. thermophilus experienced exponential growth phase during incubation period from 6 to 18 hours. Fermentation of L. acidophilus, L. bulgaricus, S. thermophilus in MRSB medium supplemented by fructooligosaccharides decreased the pH value of the formation of organic acids from 6.00 to 4.00. ABSTRAK Fruktooligosakarida adalah sumber prebiotik yang banyak digunakan dalam produk pangan olahan seperti susu fermentasi dan susu formula. Prebiotik adalah komponen bahan pangan fungsional yang tidak dapat dicerna di dalam saluran pencernaan secara enzimatik sehingga akan difermentasi oleh bakteri probiotik dalam usus besar. Penelitian ini bertujuan menentukan konsentrasi optimum fruktooligosakarida untuk meningkatkan pertumbuhan bakteri asam laktat starter yoghurt (Lactobacillus acidophillus, Lactobacillus bulgaricus, Streptococcus thermophillus. Konsentrasi optimum fruktooligosakarida pada pertumbuhan Lactobacillus acidophilus, Lactobacillus bulgaricus, Streptococcus thermophillus dapat
-
Effect of specialized combined strains on reconstituted milk reduced ...
African Journals Online (AJOL)
Yomi
2012-01-16
Jan 16, 2012 ... improving the quality of low fat cheese, for example, ... independent replicates of cheese manufacturing were performed on different days. ..... Streptococcus thermophilus in the manufacture of Mexican Panela cheese.
-
Sub-Coulomb α Transfers on C12 and the C12(α, γ)O16 S Factor
International Nuclear Information System (INIS)
Brune, C. R.; Geist, W. H.; Kavanagh, R. W.; Veal, K. D.
1999-01-01
The 12 C( α, γ) 16 O reaction is crucial for the understanding of He burning in massive stars, but the low-energy cross section is highly uncertain. To address this problem we have measured at sub-Coulomb energies total cross sections for the 12 C( 6 Li, d) 16 O and 12 C( 7 Li, t) 16 O reactions to the bound 2 + and 1 - states of 16 O . The data are analyzed to obtain the reduced α widths of these states. Together with capture and phase-shift data, these results provide for a more accurate determination of the low-energy 12C(α, γ) 16 O S factor: S E1 (0.3 MeV) =101±17 keV b and S E2 (0.3 MeV) =42 +16 -23 keV b for the E1 and E2 multipole components of the reaction. (c) 1999 The American Physical Society
-
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
-
Directory of Open Access Journals (Sweden)
Nathan D. Olson
2015-03-01
Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.
-
International Nuclear Information System (INIS)
Taniguchi, Yasutaka
2015-01-01
The structures of superdeformed (SD) states in 34 S have been investigated using the antisymmetrized molecular dynamics and generator coordinate method (GCM). The GCM basis wave functions are calculated via energy variation with a constraint on the quadrupole deformation parameter β. By applying the GCM after parity and angular momentum projections, the coexistence of two positive- and one negative-parity SD bands are predicted, and low-lying states and other deformed bands are obtained. The SD bands have structures of 16 O + 16 O + two valence neutrons in molecular orbitals around the two 16 O cores in a cluster picture. The configurations of the two valence neutrons are δ 2 and π 2 for the positive-parity SD bands and π 1 δ 1 for the negative-parity SD band. (author)
-
International Nuclear Information System (INIS)
Taniguchi, Yasutaka
2014-01-01
The structures of superdeformed (SD) states in 34 S are investigated using the antisymmetrized molecular dynamics and generator coordinate method (GCM). The GCM basis wave functions are calculated via energy variation with a constraint on the quadrupole deformation parameter β. By applying the GCM after parity and angular momentum projections, the coexistence of two positive- and one negative-parity SD bands are predicted, and low-lying states and other deformed bands are obtained. The SD bands have structures of 16 O + 16 O + two valence neutrons in molecular orbitals around the two 16 O cores in a cluster picture. The configurations of the two valence neutrons are δ 2 and π 2 for the positive-parity SD bands and π 1 δ 1 for the negative-parity SD band
-
Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo
2014-08-01
Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.
-
Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects
Directory of Open Access Journals (Sweden)
Vasco Elbrecht
2016-04-01
Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.
-
2010-01-01
..., Benchmark Survey of U.S. Direct Investment Abroad-2004. 806.16 Section 806.16 Commerce and Foreign Trade... COMMERCE DIRECT INVESTMENT SURVEYS § 806.16 Rules and regulations for BE-10, Benchmark Survey of U.S. Direct Investment Abroad—2004. A BE-10, Benchmark Survey of U.S. Direct Investment Abroad will be...
-
16S rRNA gene sequence and phylogenetic tree of lactobacillus ...
African Journals Online (AJOL)
... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...
-
International Nuclear Information System (INIS)
Sapkota, Dipak; Bruland, Ove; Parajuli, Himalaya; Osman, Tarig A.; Teh, Muy-Teck; Johannessen, Anne C.; Costea, Daniela Elena
2015-01-01
Altered expression of S100A16 has been reported in human cancers, but its biological role in tumorigenesis is not fully understood. This study aimed to investigate the clinical significance and functional role of S100A16 in oral squamous cell carcinoma (OSCC) suppression. S100A16 mRNA and/or protein levels were examined by quantitative RT-PCR and immunohistochemistry in whole- and laser microdissected-specimens of normal human oral mucosa (NHOM, n = 65), oral dysplastic lesions (ODL, n = 21), OSCCs (n = 132) and positive cervical nodes (n = 17). S100A16 protein expression in OSCC was examined for correlations with clinicopathological variables and patient survival. S100A16 was over-expressed and knocked-down in OSCC-derived (CaLH3 and H357) cells by employing retroviral constructs to investigate its effects on cell proliferation, sphere formation and three dimensional (3D)-organotypic invasive abilities in vitro and tumorigenesis in a mouse xenograft model. Both S100A16 mRNA and protein levels were found to be progressively down-regulated from NHOM to ODL and OSCC. Low S100A16 protein levels in OSCC significantly correlated with reduced 10-year overall survival and poor tumor differentiation. Analysis of two external OSCC microarray datasets showed a positive correlation between the mRNA expression levels of S100A16 and keratinocyte differentiation markers. CaLH3 and H357 cell fractions enriched for differentiated cells either by lack of adherence to collagen IV or FACS sorting for low p75NTR expression expressed significantly higher S100A16 mRNA levels than the subpopulations enriched for less differentiated cells. Corroborating these findings, retroviral mediated S100A16 over-expression and knock-down in CaLH3 and H357 cells led to respective up- and down-regulation of differentiation markers. In vitro functional studies showed significant reduction in cell proliferation, sphere formation and 3D-invasive abilities of CaLH3 and H357 cells upon S100A16 over
-
Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan
2015-04-01
Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite
-
Usui, Yuki; Kimura, Yasumasa; Satoh, Takeshi; Takemura, Naoki; Ouchi, Yasuo; Ohmiya, Hiroko; Kobayashi, Kyosuke; Suzuki, Hiromi; Koyama, Satomi; Hagiwara, Satoko; Tanaka, Hirotoshi; Imoto, Seiya; Eberl, Gérard; Asami, Yukio; Fujimoto, Kosuke; Uematsu, Satoshi
2018-05-15
The gut is an extremely complicated ecosystem where microorganisms, nutrients and host cells interact vigorously. Although the function of the intestine and its barrier system weakens with age, some probiotics can potentially prevent age-related intestinal dysfunction. Lactobacillus delbrueckii subsp. bulgaricus 2038 and Streptococcus thermophilus 1131, which are the constituents of LB81 yogurt, are representative probiotics. However, it is unclear whether their long-term intake has a beneficial influence on systemic function. Here, we examined the gut microbiome, fecal metabolites and gene expression profiles of various organs in mice. Although age-related alterations were apparent in them, long-term LB81 yogurt intake led to an increased Bacteroidetes to Firmicutes ratio and elevated abundance of the bacterial family S24-7 (Bacteroidetes), which is known to be associated with butyrate and propanoate production. According to our fecal metabolite analysis to detect enrichment, long-term LB81 yogurt intake altered the intestinal metabolic pathways associated with propanoate and butanoate in the mice. Gene ontology analysis also revealed that long-term LB81 yogurt intake influenced many physiological functions related to the defense response. The profiles of various genes associated with antimicrobial peptides-, tight junctions-, adherens junctions- and mucus-associated intestinal barrier functions were also drastically altered in the LB81 yogurt-fed mice. Thus, long-term intake of LB81 yogurt has the potential to maintain systemic homeostasis, such as the gut barrier function, by controlling the intestinal microbiome and its metabolites.
-
Single Channel 106 Gbit/s 16QAM Wireless Transmission in the 0.4 THz Band
DEFF Research Database (Denmark)
Pang, Xiaodan; Jia, Shi; Ozolins, Oskars
2017-01-01
We experimentally demonstrate a single channel 32-GBd 16QAM THz wireless link operating in the 0.4 THz band. Post-FEC net data rate of 106 Gbit/s is successfully achieved without any spatial/frequency multiplexing.......We experimentally demonstrate a single channel 32-GBd 16QAM THz wireless link operating in the 0.4 THz band. Post-FEC net data rate of 106 Gbit/s is successfully achieved without any spatial/frequency multiplexing....
-
Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping
Czech Academy of Sciences Publication Activity Database
Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.
2013-01-01
Roč. 114, č. 2 (2013), s. 433-447 ISSN 1364-5072 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013
-
Effects of Streptococcus thermophilus TH-4 in a rat model of doxorubicin-induced mucositis.
Wang, Hanru; Brook, Caitlin L; Whittaker, Alexandra L; Lawrence, Andrew; Yazbeck, Roger; Howarth, Gordon S
2013-08-01
Mucositis is a debilitating intestinal side effect of chemotherapeutic regimens. Probiotics have been considered a possible preventative treatment for mucositis. Streptococcus thermophilus TH-4 (TH-4), a newly identified probiotic, has been shown to partially alleviate mucositis induced by administration of the antimetabolite chemotherapy drug, methotrexate in rats; likely mediated through a mechanism of folate production. However, its effects against other classes of chemotherapy drug have yet to be determined. The authors investigated the effects of TH-4 in a rat model of mucositis induced by the anthracycline chemotherapy drug, doxorubicin. Gastrointestinal damage was induced in female Dark Agouti rats (148.3 ± 1.5 g) by intraperitoneal injection of doxorubicin (20 mg/kg). Animals recieved a daily oral gavage of TH-4 at 10(9) cfu/ml or skim milk (vehicle) from days 0 to 8. At day 6, rats were injected with either saline or doxorubicin. At kill, small intestinal tissues were collected for determination of sucrase and myeloperoxidase (MPO) activities and histological assessment. Body weight was significantly decreased by doxorubicin compared with normal controls (p TH-4 partially prevented the loss of body weight induced by doxorubicin (2.3% compared with 4%), but provided no further therapeutic benefit. The minimal amelioration of doxorubicin-induced mucositis by TH-4 further supports folate production as a likely mechanism of TH-4 action against methotrexate-induced mucositis. Further studies into TH-4 are required to confirm its applicability to other conventional chemotherapy regimens.
-
Franciosi, Elena; Carafa, Ilaria; Nardin, Tiziana; Schiavon, Silvia; Poznanski, Elisa; Cavazza, Agostino; Larcher, Roberto; Tuohy, Kieran M
2015-01-01
"Nostrano-cheeses" are traditional alpine cheeses made from raw cow's milk in Trentino-Alto Adige, Italy. This study identified lactic acid bacteria (LAB) developing during maturation of "Nostrano-cheeses" and evaluated their potential to produce γ-aminobutyric acid (GABA), an immunologically active compound and neurotransmitter. Cheese samples were collected on six cheese-making days, in three dairy factories located in different areas of Trentino and at different stages of cheese ripening (24 h, 15 days, and 1, 2, 3, 6, and 8 months). A total of 1,059 LAB isolates were screened using Random Amplified Polymorphic DNA-PCR (RAPD-PCR) and differentiated into 583 clusters. LAB strains from dominant clusters (n = 97) were genetically identified to species level by partial 16S rRNA gene sequencing. LAB species most frequently isolated were Lactobacillus paracasei, Streptococcus thermophilus, and Leuconostoc mesenteroides. The 97 dominant clusters were also characterized for their ability in producing GABA by high-performance liquid chromatography (HPLC). About 71% of the dominant bacteria clusters evolving during cheeses ripening were able to produce GABA. Most GABA producers were Lactobacillus paracasei but other GABA producing species included Lactococcus lactis, Lactobacillus plantarum, Lactobacillus rhamnosus, Pediococcus pentosaceus, and Streptococcus thermophilus. No Enterococcus faecalis or Sc. macedonicus isolates produced GABA. The isolate producing the highest amount of GABA (80.0±2.7 mg/kg) was a Sc. thermophilus.
-
Criticality safety evaluation for TWR-S fuel assembly transportation using TK-S16 containers
International Nuclear Information System (INIS)
Pesic, M.P.; Steljic, M.M.; Antic, D.P.
2002-01-01
Criticality safety issues, concerning transportation of fresh high-enriched uranium fuel elements (TWR-S fuel assembly type) with Russian containers TK-S16, are objects of study in this paper. Three-dimensional (3D) models of fuel element and container were made, based upon their well-known geometry and material structure. The way to pack fuel elements in a bundle inside of the container is proposed. Calculations were done by MCNP4B2 computer code. This Monte Carlo criticality code determined the effective multiplication factor from the cross-section data and specific geometry data. This evaluation demonstrated the subcriticality of a single package and an array of packages during normal conditions of transport and various hypothetical accident conditions. (author)
-
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.
Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina
2015-11-13
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.
-
Directory of Open Access Journals (Sweden)
Weijun Wang
2012-12-01
Full Text Available The application of the exopolysaccharide-producing strains for improving the texture and technical properties of reduced-fat cheese looks very promising. Streptococcus thermophilus TM11 was evaluated for production of reduced-fat cheese using reconstituted milk powder (CRMP. The physicochemical analysis of fresh and stored cheeses showed that this strain slightly increased moisture content resulting in cheese with higher yield and lower protein content compared to the direct acidified cheese. The volatiles of cheese were determined by SPME and GC equipped with a mass spectrometer. The results indicated that the major compounds included aldehydes, ketones and acids, whereas, alcohols and branched-chain aldehydes that contribute to exciting and harsh flavors were not found in CRMP. By the textural profile analysis, we found the cheese made with S. thermophilus TM11 had lower cohesiveness, resilience and higher adhesiveness than the direct acidified cheese, and had similar hardness. Further, S. thermophilus TM11 greatly changed the protein matrix with more opened cavities according to observation by scanning electron microscopy. Consequently, use of S. thermophilus TM11 could endow CRMP with the novel and suitable flavor properties and improved texture quality.
-
Transport properties of S0.8Se16M0.2 (M = Al, Ag or Cu) system
International Nuclear Information System (INIS)
Wahab, L.A.
2003-01-01
The results are presented of a study of the electrical and optical properties of vacuum evaporated amorphous thin films in the S 0.8 Se 16 M 0.2 (M=Al, Ag or Cu) system. The activation energy and the pre-exponential factor which appear in the dc conductivity are found to be higher in case of Cu than in case of Ag and Al. The reflectance and transmission are used to measure the optical gap. The glass S 0.8 Se 16 Cu 0.2 behaves as a quasi intrinsic semiconductor (the electrical activation energy is about half of the optical gap). The electrical activation energy is about one-third of the optical gap for the chalcogenide glasses S 0.8 Se 16 Al 0.2 and S 0.8 Se 16 Ag 0.2 . The variation in the refractive index and the imaginary part of the dielectric constant with photon energy have also been reported. The influence of composition on the investigated parameters is reported
-
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
-
Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent
2012-01-01
Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126
-
Li, J.; Peng, X.; Zhang, L.
2014-12-01
Ten sediment samples collected from one acidic and three alkaline high temperature hot springs at Tengchong terrestrial geothermal field, Southwest China, were examined by the mineralogical, geochemical, and molecular biological techniques. The mineralogical and geochemical analyses suggested that these hot springs contain relative high concentrations of S, Fe and N chemical species. Specifically, the acidic hot spring was rich in Fe2+, SO42- and NH4+, while the alkaline hot springs were high in NO3-, H2S and S2O3-. Analyses of 16S rRNA sequences showed their bacterial communities were dominated by Aquificae, Cyanobacteria, Deinococci-Thermus, Firmicutes, Proteobacteria, and Thermodesulfobacteria, while the archeal clone libraries were dominated by Desulfurococcales, Sulfolobales, and Thermoproteales. Among them, the potential S-, N- and Fe-related oxidizing and reducing prokaryote were presenting as a relative high proportion but with a great difference in diversity and metabolic approaches of each sample. These findings provide some significant implications for the microbial function in element biogeochemical cycles within the Tengchong geothermal environments: i). the distinct differences in abundance and diversity of microbial communities of geothermal sediments were related to in situ different physicochemical conditions; ii). the S-, N- and Fe-related prokaryote would take advantage of the strong chemical disequilibria in the hot springs; iii). in return, their metabolic activities can promote the transformation of S, Fe and N chemical species, thus founded the bases of biogeochemical cycles in the terrestrial geothermal environments.
-
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
-
16QAM transmission with 5.2 bits/s/Hz spectral efficiency over transoceanic distance.
Zhang, H; Cai, J-X; Batshon, H G; Davidson, C R; Sun, Y; Mazurczyk, M; Foursa, D G; Pilipetskii, A; Mohs, G; Bergano, Neal S
2012-05-21
We transmit 160 x 100 G PDM RZ 16 QAM channels with 5.2 bits/s/Hz spectral efficiency over 6,860 km. There are more than 3 billion 16 QAM symbols, i.e., 12 billion bits, processed in total. Using coded modulation and iterative decoding between a MAP decoder and an LDPC based FEC all channels are decoded with no remaining errors.
-
Recognition of tRNAs with a long variable arm by aminoacyl-tRNA synthetases
Directory of Open Access Journals (Sweden)
Tukalo M. A.
2013-07-01
Full Text Available In prokaryotic cells three tRNA species, tRNASer, tRNALeu and tRNATyr, possess a long variable arm of 11–20 nucleotides (type 2 tRNA rather than usual 4 or 5 nucleotides (type 1 tRNA. In this review we have summarized the results of our research on the structural basis for recognition and discrimination of type 2 tRNAs by Thermus thermophilus seryl-, tyrosyl- and leucyl-tRNA synthetases (SerRS, TyrRS and LeuRS obtained by X-ray crystallography and chemical probing tRNA in solution. Crystal structures are now known of all three aminoacyl-tRNA synthetases complexed with type 2 tRNAs and the different modes of tRNA recognition represented by these structures will be discussed. In particular, emphasis will be given to the results on recognition of characteristic shape of type 2 tRNAs by cognate synthetases. In tRNASer, tRNATyr and tRNALeu the orientation of the long variable arm with respect to the body of the tRNA is different and is controlled by different packing of the core. In the case of SerRS the N-terminal domain and in the case of TyrRS, the C-terminal domain, bind to the characteristic long variable arm of the cognate RNA, thus recognizing the unique shape of the tRNA. The core of T. thermophilus tRNALeu has several layers of unusual base-pairs, which are revealed by the crystal structure of tRNALeu complexed with T. thermophilus LeuRS and by probing a ligand-free tRNA by specific chemical reagents in solution. In the crystal structure of the LeuRS-tRNALeu complex the unique D-stem structure is recognized by the C-terminal domain of LeuRS and these data are in good agreement with those obtained in solution. LeuRS has canonical class I mode of tRNA recognition, approaching the tRNA acceptor stem from the D-stem and minor groove of the acceptor stem side. SerRS also has canonical class II mode of tRNA recognition and approaches tRNASer from opposite, variable stem and major groove of acceptor stem site. And finally, TyrRS in strong
-
Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.
2010-01-01
N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261
-
Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A
2007-02-23
N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.
-
Adaptive Radio Resource Allocation in Hierarchical QoS Scheduling for IEEE 802.16 Systems
DEFF Research Database (Denmark)
Wang, Hua; Dittmann, Lars
2007-01-01
Future mobile communication systems such as IEEE 802.16 are expected to deliver a variety of multimedia services with diverse QoS requirements. To guarantee the QoS provision, appropriate scheduler architecture and scheduling algorithms have to be carefully designed. In this paper, we propose...
-
211At-Rh(16-S4-diol) complex as a precursor for astatine radiopharmaceuticals
International Nuclear Information System (INIS)
Pruszynski, M.; Bilewicz, A.
2006-01-01
211 At is one of the most promising radionuclides in α-radioimmunotherapy (α-RIT). Unfortunately, biomolecules labeled by direct electrophilic astatination are unstable due to the rapid loss of 211 At under both in vitro and in vivo conditions. The present paper describes the results of our studies on attaching At - to the rhodium(III) complex with thioether ligand: 1,5,9,13-etrathiacyclohexadecane-3,11-diol (16-S4-diol). Rh 3+ was chosen as a moderately soft metal cation which should form very strong bonds with soft At - anions, but first of all because of the kinetic inertness of low spin rhodium(III) d 6 complexes. The 16-S4-diol ligand was selected due to formation of stable complexes with Rh 3+ . The experiments related to optimization of the reaction conditions were performed with the 131 I, basing on a chemical similarity of I - to At - . The experiments with 211 At were then carried out under the conditions found optimal for I - . The preliminary results are promising, and indicate a possibility for astatination of biomolecules by using the 211 At-Rh(16-S4-diol) complex
-
Natural exopolysaccharides enhance survival of lactic acid bacteria in frozen dairy desserts.
Hong, S H; Marshall, R T
2001-06-01
Viable lactic acid-producing bacteria in frozen dairy desserts can be a source of beta-galactosidase for persons who absorb lactose insufficiently. However, freezing kills many of the cells, causing loss of enzymatic activity. Cultures selected for high beta-galactosidase activities and high survival rates in the presence of bile were examined for survivability during freezing in reduced-fat ice cream. Encapsulated S. thermophilus strains survived better than their nonencapsulated mutants in reduced-fat ice cream after freezing and frozen storage at -29 degrees C for 16 d (28 vs. 19%). However, a small nonencapsulated strain of Lactobacillus delbrueckii sp. bulgaricus survived better than the large encapsulated strain in reduced-fat ice cream. Factors that improved survival of encapsulated S. thermophilus 1068 in ice cream were 1) harvest of cells in the late-log phase of growth at 37 degrees C rather than at 40, 42.5, or 45 degrees C; 2) overrun at 50% rather than 100%; and 3) storage at -17 degrees C rather than -23 or -29 degrees C. Survival of strain ST1068 was unaffected by 1) neutralization of acid during growth or 2) substitution of nitrogen for air in building overrun.
-
Daneshparvar, Afrooz; Mowlavi, Gholamreza; Mirjalali, Hamed; Hajjaran, Homa; Mobedi, Iraj; Naddaf, Saeed Reza; Shidfar, Mohammadreza; Sadat Makki, Mahsa
2017-01-01
Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct and transmits through close contact with an infested host. This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, already obtained from four different patients and identified morphologically though clearing with 10% Potassium hydroxide (KOH) and microscopical examination. Amplified fragments from the isolates were compared with GeneBank database and phylogenetic analysis was carried out using MEGA6 software. A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs) in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.
-
Directory of Open Access Journals (Sweden)
Afrooz DANESHPARVAR
2017-06-01
Full Text Available Background: Demodicosis is one of the most prevalent skin diseases resulting from infestation by Demodex mites. This parasite usually inhabits in follicular infundibulum or sebaceous duct transmitted through close contact with an infested host.Methods: This study was carried from September 2014 to January 2016 at Tehran University of Medical Sciences, Tehran, Iran. DNA extraction and amplification of 16S ribosomal RNA was performed on four isolates, obtained from four patients and identified morphologically through clearing with 10% Potassium hydroxide (KOH and microscopical examination. Amplified fragments from the isolates were compared with GenBank database and phylogenetic analysis was carried out using MEGA6 software.Results: A 390 bp fragment of 16S rDNA was obtained in all isolates and analysis of generated sequences showed high similarity with those submitted to GenBank, previously. Intra-species similarity and distance also showed 99.983% and 0.017, respectively, for the studied isolates. Multiple alignments of the isolates showed Single Nucleotide Polymorphisms (SNPs in 16S rRNA fragment. Phylogenetic analysis revealed that all 4 isolates clustered with other D. folliculorum, recovered from GenBank database. Our accession numbers KF875587 and KF875589 showed more similarity together in comparison with two other studied isolates. Conclusion: Mitochondrial 16S rDNA is one of the most suitable molecular barcodes for identification D. folliculorum and this fragment can use for intra-species characterization of the most human-infected mites.
-
DEFF Research Database (Denmark)
Farver, Ole; Wherland, Scot; Antholine, William E
2010-01-01
The functioning of cytochrome c oxidases involves orchestration of long-range electron transfer (ET) events among the four redox active metal centers. We report the temperature dependence of electron transfer from the Cu(A)(r) site to the low-spin heme-(a)b(o) site, i.e., Cu(A)(r) + heme-a(b)(o) ......The functioning of cytochrome c oxidases involves orchestration of long-range electron transfer (ET) events among the four redox active metal centers. We report the temperature dependence of electron transfer from the Cu(A)(r) site to the low-spin heme-(a)b(o) site, i.e., Cu(A)(r) + heme...... in cytochrome ba(3) had no effect on the rate of this reaction whereas the II-Met160Leu Cu(A)-mutation was slower by an amount corresponding to a decreased driving force of ∼0.06 eV. The structures support the presence of a common, electron-conducting "wire" between Cu(A) and heme-a(b). The transfer...
-
Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong
2015-01-01
Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were
-
Phylogenetic inference of Coxiella burnetii by 16S rRNA gene sequencing.
Directory of Open Access Journals (Sweden)
Heather P McLaughlin
Full Text Available Coxiella burnetii is a human pathogen that causes the serious zoonotic disease Q fever. It is ubiquitous in the environment and due to its wide host range, long-range dispersal potential and classification as a bioterrorism agent, this microorganism is considered an HHS Select Agent. In the event of an outbreak or intentional release, laboratory strain typing methods can contribute to epidemiological investigations, law enforcement investigation and the public health response by providing critical information about the relatedness between C. burnetii isolates collected from different sources. Laboratory cultivation of C. burnetii is both time-consuming and challenging. Availability of strain collections is often limited and while several strain typing methods have been described over the years, a true gold-standard method is still elusive. Building upon epidemiological knowledge from limited, historical strain collections and typing data is essential to more accurately infer C. burnetii phylogeny. Harmonization of auspicious high-resolution laboratory typing techniques is critical to support epidemiological and law enforcement investigation. The single nucleotide polymorphism (SNP -based genotyping approach offers simplicity, rapidity and robustness. Herein, we demonstrate SNPs identified within 16S rRNA gene sequences can differentiate C. burnetii strains. Using this method, 55 isolates were assigned to six groups based on six polymorphisms. These 16S rRNA SNP-based genotyping results were largely congruent with those obtained by analyzing restriction-endonuclease (RE-digested DNA separated by SDS-PAGE and by the high-resolution approach based on SNPs within multispacer sequence typing (MST loci. The SNPs identified within the 16S rRNA gene can be used as targets for the development of additional SNP-based genotyping assays for C. burnetii.
-
Directory of Open Access Journals (Sweden)
Érico Leandro da Silveira
2006-10-01
Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi
-
Zhang, Qingli; Yang, Bao; Brashears, Mindy M; Yu, Zhimin; Zhao, Mouming; Liu, Ning; Li, Yinjuan
2014-05-01
A lot of interesting research has been undertaken to enhance the yield of exopolysaccharides (EPS) produced by lactic acid bacteria (LAB). The objective of this study was to determine the influence of casein hydrolysates (CH) with molecular weight less than 3 kDa on cell viability, EPS synthesis and the enzyme activity involved in EPS synthesis during the co-culturing of Streptococcus thermophilus and Lactobacillus delbrueckii ssp. bulgaricus in MRS broth for 72 h at 37 ± 0.1 °C. The highest EPS yield (150.1 mg L⁻¹) was obtained on CH prepared with papain (CHP) at 48 h. At 24 h, EPS were composed of galactose, glucose and rhamnose in a molar ratio of 1.0:2.4:1.5. The monosaccharide composition changed with extension of the fermentation time. The activities of α-phosphoglucomutase, uridine 5'-diphosphate (UDP)-glucose pyrophosphorylase and UDP-galactose 4-epimerase were associated with EPS synthesis. Moreover, the activities of β-phosphoglucomutase and deoxythymadine 5'-diphosphate (dTDP)-glucose pyrophosphorylase involved in rhamnose synthesis were very low at the exponential growth phase and could not be detected during other given periods. The influence of different CH (<3 kDa) on LAB viability, EPS production, EPS monomeric composition and activity levels of key metabolic enzymes was distinct. Besides, their influence was related to the distribution of amino acids. © 2013 Society of Chemical Industry.
-
Ana Lourdes Neves Gandara
1995-01-01
Resumo: Microrganismo selvagem isolado de leite pasteurizado, obtido de processo contínuo de pasteurização HTST com 4 h de operação foi identificado como Streptococcus thermophilus, formando a maior densidade celular em caldo M11 a 45°C em 6h. O número de células viáveis desse microrganismo foi avaliado em meios de cultura PCA, APT, MRS e Ml1 sendo os meios M11 e MRS os que permitiram melhor crescimento. Menores contagens do microrganismo foram observadas no meio APT em relação aos meios ante...
-
Directory of Open Access Journals (Sweden)
Manal Helal
Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra
-
Draft Genome Sequence of Lactobacillus delbrueckii subsp. bulgaricus LBB.B5.
Urshev, Zoltan; Hajo, Karima; Lenoci, Leonardo; Bron, Peter A; Dijkstra, Annereinou; Alkema, Wynand; Wels, Michiel; Siezen, Roland J; Minkova, Svetlana; van Hijum, Sacha A F T
2016-10-06
Lactobacillus delbrueckii subsp. bulgaricus LBB.B5 originates from homemade Bulgarian yogurt and was selected for its ability to form a strong association with Streptococcus thermophilus The genome sequence will facilitate elucidating the genetic background behind the contribution of LBB.B5 to the taste and aroma of yogurt and its exceptional protocooperation with S. thermophilus. Copyright © 2016 Urshev et al.
-
Salzman, NH; de Jong, H; Paterson, Y; Harmsen, HJM; Welling, GW; Bos, NA
2002-01-01
Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of
-
Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing
DEFF Research Database (Denmark)
Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen
2007-01-01
Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...
-
Zhao, Ya-E; Wu, Li-Ping
2012-09-01
To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.
-
73.7 Tb/s (96x3x256-Gb/s) mode-division-multiplexed DP-16QAM transmission with inline MM-EDFA
Sleiffer, V.A.J.M.; Jung, Y.; Veljanovski, V.; Uden, van R.G.H.; Kuschnerov, M.; Kang, Q.; Grüner-Nielsen, L.; Sun, Y.; Richardson, D.J.; Alam, S.U.; Poletti, F.; Sahu, J.K.; Dhar, A.; Chen, H.; Inan, B.; Koonen, A.M.J.; Corbett, B.; Winfield, R.; Ellis, A.D.; Waardt, de H.
2012-01-01
We show transmission of a 73.7 Tb/s (96x3x256-Gb/s) DP-16QAM mode-division- multiplexed signal over 119km of few-mode fiber with inline multi-mode EDFA, using 6x6 MIMO digital signal processing. The total demonstrated net capacity is 57.6 Tb/s (SE 12 bits/s/Hz).
-
Lin, Sen; Wen, Lingrong; Yang, Bao; Jiang, Guoxiang; Shi, John; Chen, Feng; Jiang, Yueming
2013-01-01
This study was conducted to increase the bioactivity of litchi pericarp polysaccharides (LPPs) biotransformed by Aspergillus awamori. Compared to the non-A. awamori-fermented LPP, the growth effects of A. awamori-fermented LPP on Lactobacillus bulgaricus and Streptococcus thermophilus were four and two times higher after 3 days of fermentation, respectively. Increased 1,1-diphenyl-2-picrylhydrazyl radical scavenging activity and DNA protection activity of litchi pericarp polysaccharides were also achieved after A. awamori fermentation. Moreover, the relative content of glucose and arabinose in LPP after fermentation decreased from 58.82% to 22.60% and from 18.82% to 10.09%, respectively, with a concomitant increase in the relative contents of galactose, rhamnose, xylose, and mannose. Furthermore, lower molecular weight polysaccharides were obtained after A. awamori fermentation. It can be concluded that A. awamori was effective in biotransforming LPP into a bioactive mixture with lower molecular weight polysaccharides and higher antioxidant activity and relative galactose content.
-
Directory of Open Access Journals (Sweden)
Sen Lin
2013-01-01
Full Text Available This study was conducted to increase the bioactivity of litchi pericarp polysaccharides (LPPs biotransformed by Aspergillus awamori. Compared to the non-A. awamori-fermented LPP, the growth effects of A. awamori-fermented LPP on Lactobacillus bulgaricus and Streptococcus thermophilus were four and two times higher after 3 days of fermentation, respectively. Increased 1,1-diphenyl-2-picrylhydrazyl radical scavenging activity and DNA protection activity of litchi pericarp polysaccharides were also achieved after A. awamori fermentation. Moreover, the relative content of glucose and arabinose in LPP after fermentation decreased from 58.82% to 22.60% and from 18.82% to 10.09%, respectively, with a concomitant increase in the relative contents of galactose, rhamnose, xylose, and mannose. Furthermore, lower molecular weight polysaccharides were obtained after A. awamori fermentation. It can be concluded that A. awamori was effective in biotransforming LPP into a bioactive mixture with lower molecular weight polysaccharides and higher antioxidant activity and relative galactose content.
-
DEFF Research Database (Denmark)
Topa, Dan; Balic-Zunic, Tonci; Makovicky, Emil
2000-01-01
Cu1.6Pb1.6Bi6.4S12, aikinite-bismuthinite derivative, crystal structure, Felbertal, scheelite deposit, Austria......Cu1.6Pb1.6Bi6.4S12, aikinite-bismuthinite derivative, crystal structure, Felbertal, scheelite deposit, Austria...
-
Evaluation report on SCTF Core-III tests S3-14, S3-15 and S3-16
International Nuclear Information System (INIS)
Iwamura, Takamichi; Iguchi, Tadashi; Akimoto, Hajime; Okubo, Tsutomu; Ohnuki, Akira; Sakaki, Isao; Adachi, Hiromichi; Murao, Yoshio
1988-03-01
It was revealed from previous reflood tests using Slab Core Test Facility (SCTF) that the heat transfer was enhanced in high power bundles and degraded in low power bundles due to the radial power distribution. In the present study, the effects of local power ratio itself and the shape of radial power distribution were separately investigated by comparing three tests: S3-14 (flat power distribution), S3-15 (inclined power distribution) and S3-16 (steep power distribution). Those three tests were performed under the same boundary conditions, total power and initial stored energy. The emergency core cooling (ECC) water was injected into the lower plenum. The test results indicated that the heat transfer enhancement and degradation was governed mainly by the bundlewise radial power ratio and less dependent on the shape of radial power distribution when the difference in power ratios between adjacent bundles is less than 0.44. The degree of heat transfer enhancement at high power bundles was increased with the radial peak power ratio. Even at an average power bundle, the heat transfer was enhanced in the non-uniform radial power distribution tests. (author)
-
Regulatory RNAs in the Less Studied Streptococcal Species: from Nomenclature to Identification
Directory of Open Access Journals (Sweden)
Mohamed Amine Zorgani
2016-07-01
Full Text Available Streptococcal species are Gram-positive bacteria involved in severe and invasive diseases in humans and animals. Although this group includes different pathogenic species involved in life-threatening infections for humans, it also includes beneficial species, such as Streptococcus thermophilus, which is used in yogurt production. In bacteria virulence factors are controlled by various regulatory networks including regulatory RNAs. For clearness and to develop logical thinking, we start this review with a revision of regulatory RNAs nomenclature. Previous reviews are mostly dealing with Streptococcus pyogenes and Streptococcus pneumoniae regulatory RNAs. We especially focused our analysis on regulatory RNAs in Streptococcus agalactiae, Streptococcus mutans, Streptococcus thermophilus and other less studied Streptococcus species. Although S. agalactiae RNome remains largely unknown, sRNAs (small RNAs are supposed to mediate regulation during environmental adaptation and host infection. In the case of S. mutans, sRNAs are suggested to be involved in competence regulation, carbohydrate metabolism and Toxin-Antitoxin systems. A new category of miRNA-size small RNAs (msRNAs was also identified for the first time in this species. The analysis of S. thermophilus sRNome shows that many sRNAs are associated to the bacterial immune system known as CRISPR-Cas system. Only few of the other different Streptococcus species have been the subject of studies pointed toward the characterization of regulatory RNAs. Finally, understanding bacterial sRNome can constitute one step forward to the elaboration of new strategies in therapy such as substitution of antibiotics in the management of S. agalactiae neonatal infections, prevention of S. mutans dental caries or use of S. thermophilus CRISPR-Cas system in genome editing applications.
-
Energy Technology Data Exchange (ETDEWEB)
Gladden, J.M.; Allgaier, M.; Miller, C.S.; Hazen, T.C.; VanderGheynst, J.S.; Hugenholtz, P.; Simmons, B.A.; Singer, S.W.
2011-05-01
Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60 C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80 C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions.
-
Glycoside hydrolase activities of thermophilic bacterial consortia adapted to switchgrass.
Gladden, John M; Allgaier, Martin; Miller, Christopher S; Hazen, Terry C; VanderGheynst, Jean S; Hugenholtz, Philip; Simmons, Blake A; Singer, Steven W
2011-08-15
Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60°C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80°C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions.
-
Development of a continuous bioconversion system using a thermophilic whole-cell biocatalyst.
Ninh, Pham Huynh; Honda, Kohsuke; Yokohigashi, Yukako; Okano, Kenji; Omasa, Takeshi; Ohtake, Hisao
2013-03-01
The heat treatment of recombinant mesophilic cells having heterologous thermophilic enzymes results in the denaturation of indigenous mesophilic enzymes and the elimination of undesired side reactions; therefore, highly selective whole-cell catalysts comparable to purified enzymes can be readily prepared. However, the thermolysis of host cells leads to the heat-induced leakage of thermophilic enzymes, which are produced as soluble proteins, limiting the exploitation of their excellent stability in repeated and continuous reactions. In this study, Escherichia coli cells having the thermophilic fumarase from Thermus thermophilus (TtFTA) were treated with glutaraldehyde to prevent the heat-induced leakage of the enzyme, and the resulting cells were used as a whole-cell catalyst in repeated and continuous reactions. Interestingly, although electron microscopic observations revealed that the cellular structure of glutaraldehyde-treated E. coli was not apparently changed by the heat treatment, the membrane permeability of the heated cells to relatively small molecules (up to at least 3 kDa) was significantly improved. By applying the glutaraldehyde-treated E. coli having TtFTA to a continuous reactor equipped with a cell-separation membrane filter, the enzymatic hydration of fumarate to malate could be operated for more than 600 min with a molar conversion yield of 60% or higher.
-
Pirrung, Michael C.; Han, Hyunsoo; Chen, Jrlung
1996-07-12
The inhibition of Thermus thermophilus isopropylmalate dehydrogenase by O-methyl oxalohydroxamate was studied for comparison to earlier results of Schloss with the Salmonella enzyme. It is a fairly potent (1.2 &mgr;M), slow-binding, uncompetitive inhibitor against isopropylmalate and is far superior to an oxamide (25 mM K(i) competitive) that is isosteric with the ketoisocaproate product of the enzyme. This improvement in inhibition was attributed to its increased NH acidity, which presumably is due to the inductive effect of the hydroxylamine oxygen. This principle was extended to the structurally homologous enzyme isocitrate dehydrogenase from E. coli, for which the compound O-(carboxymethyl) oxalohydroxamate is a 30 nM inhibitor, uncompetitive against isocitrate. The pH dependence of its inhibition supports the idea that it is bound to the enzyme in the anionic form. Another recently discovered homologous enzyme, tartrate dehydrogenase from Pseudomonas putida, was studied with oxalylhydroxamate. It has a relatively low affinity for the enzyme, though it is superior to tartrate. On the basis of these leads, squaric hydroxamates with increased acidity compared to squaric amides directed toward two of these enzymes were prepared, and they also show increased inhibitory potency, though not approaching the nanomolar levels of the oxalylhydroxamates.
-
International Nuclear Information System (INIS)
Yagi, T.
1987-01-01
The NADH-ubiquinone reductase activity of the respiratory chains of several organisms was inhibited by the carboxyl-modifying reagent N,N'-dicyclohexylcarbodiimide (DCCD). This inhibition correlated with the presence of an energy-transducing site in this segment of the respiratory chain. Where the NADH-quinone reductase segment involved an energy-coupling site (e.g., in bovine heart and rat liver mitochondria, and in Paracoccus denitrificans, Escherichia coli, and Thermus thermophilus HB-8 membranes), DCCD acted as an inhibitor of ubiquinone reduction by NADH. By contrast, where energy-coupling site 1 was absent (e.g., in Saccharomyces cerevisiae mitochondria and BacilLus subtilis membranes), there was no inhibition of NADH-ubiquinone reductase activity by DCCD. In the bovine and P. denitrificans systems, DCCD inhibition was pseudo first order with respect to incubation time, and reaction order with respect to inhibitor concentration was close to unity, indicating that inhibition resulted from the binding of one inhibitor molecule per active unit of NADH-ubiquinone reductase. In the bovine NADH-ubiquinone reductase complex (complex I), [ 14 C]DCCD was preferentially incorporated into two subunits of molecular weight 49,000 and 29,000. The time course of labeling of the 29,000 molecular weight subunit with [ 14 C]DCCD paralleled the time course of inhibition of NADH-ubiquinone reductase activity
-
Mallik, Saurav; Kundu, Sudip
2015-01-01
Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.
-
Plants of the fynbos biome harbour host species-specific bacterial communities.
Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel
2016-08-01
The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
-
Microbiological investigations on the water of a thermal bath at Budapest.
Szuróczki, Sára; Kéki, Zsuzsa; Káli, Szandra; Lippai, Anett; Márialigeti, Károly; Tóth, Erika
2016-06-01
Thermal baths are unique aquatic environments combining a wide variety of natural and anthropogenic ecological factors, which also appear in their microbiological state. There is limited information on the microbiology of thermal baths in their complexity, tracking community shifts from the thermal wells to the pools. In the present study, the natural microbial community of well and pool waters in Gellért bath was studied in detail by cultivation-based techniques. To isolate bacteria, 10% R2A and minimal synthetic media (with "bath water") with agar-agar and gellan gum were used after prolonged incubation time; moreover, polyurethane blocks covered with media were also applied. Strains were identified by sequencing their 16S rRNA gene after grouping them by amplified rDNA restriction analysis. From each sample, the dominance of Alphaproteobacteria was characteristic though their diversity differed among samples. Members of Actinobacteria, Firmicutes, Beta- and Gamma-proteobacteria, Deinococcus-Thermus, and Bacteroidetes were also identified. Representatives of Deinococcus-Thermus phylum appeared only in the pool water. The largest groups in the pool water belonged to the Tistrella and Chelatococcus genera. The most dominant member in the well water was a new taxon, its similarity to Hartmannibacter diazotrophicus as closest relative was 93.93%.
-
Pressure-induced magnetic collapse and metallization of TlF e1.6S e2
Naumov, P. G.; Filsinger, K.; Shylin, S. I.; Barkalov, O. I.; Ksenofontov, V.; Qi, Y.; Palasyuk, T.; Schnelle, W.; Medvedev, S. A.; Greenblatt, M.; Felser, C.
2017-08-01
The crystal structure, magnetic ordering, and electrical resistivity of TlF e1.6S e2 were studied at high pressures. Below ˜7 GPa , TlF e1.6S e2 is an antiferromagnetically ordered semiconductor with a ThC r2S i2 -type structure. The insulator-to-metal transformation observed at a pressure of ˜7 GPa is accompanied by a loss of magnetic ordering and an isostructural phase transition. In the pressure range ˜7.5 -11 GPa a remarkable downturn in resistivity, which resembles a superconducting transition, is observed below 15 K. We discuss this feature as the possible onset of superconductivity originating from a phase separation in a small fraction of the sample in the vicinity of the magnetic transition.
-
DEFF Research Database (Denmark)
Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon
2018-01-01
Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...
-
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....
-
Czech Academy of Sciences Publication Activity Database
Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.
2015-01-01
Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015
-
THERMUS—A thermal model package for ROOT
Wheaton, S.; Cleymans, J.; Hauer, M.
2009-01-01
THERMUS is a package of C++ classes and functions allowing statistical-thermal model analyses of particle production in relativistic heavy-ion collisions to be performed within the ROOT framework of analysis. Calculations are possible within three statistical ensembles; a grand-canonical treatment of the conserved charges B, S and Q, a fully canonical treatment of the conserved charges, and a mixed-canonical ensemble combining a canonical treatment of strangeness with a grand-canonical treatment of baryon number and electric charge. THERMUS allows for the assignment of decay chains and detector efficiencies specific to each particle yield, which enables sensible fitting of model parameters to experimental data. Program summaryProgram title: THERMUS, version 2.1 Catalogue identifier: AEBW_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEBW_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 17 152 No. of bytes in distributed program, including test data, etc.: 93 581 Distribution format: tar.gz Programming language: C++ Computer: PC, Pentium 4, 1 GB RAM (not hardware dependent) Operating system: Linux: FEDORA, RedHat, etc. Classification: 17.7 External routines: Numerical Recipes in C [1], ROOT [2] Nature of problem: Statistical-thermal model analyses of heavy-ion collision data require the calculation of both primordial particle densities and contributions from resonance decay. A set of thermal parameters (the number depending on the particular model imposed) and a set of thermalized particles, with their decays specified, is required as input to these models. The output is then a complete set of primordial thermal quantities for each particle, together with the contributions to the final particle yields from resonance decay. In many applications of
-
Comparison of ViTEK 2, MALDI-TOF and Partial Sequencing of 16S ...
African Journals Online (AJOL)
All the strains were susceptible to Vancomycin, Linezolid and Rifampicin while they were all resistant to Penicillin, Fusidic acid, and Trimethoprim. Brevibacterium epidermidis were generally resistant to Erythromycin and Clindamycin while B. iodinum and B. oceani were susceptible. Conclusion - 16S rRNA identification is ...
-
Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification
Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.
2015-01-01
To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this
-
Complete fusion excitation function for the 16O + natS reaction
International Nuclear Information System (INIS)
Wang Sufang; Zheng Jiwen; Liu Guoxing
1994-01-01
The complete fusion excitation function for the 16 O + nat S reaction has been measured in the range of 50-75 MeV with a step of 1.0 MeV by using a position sensitive ΔE-E telescope system. The model parameters have been extracted from data analysis. The striking gross structure of the excitation function has been observed. The energies of peaks are at E CM 38,43 and 48 MeV respectively
-
Mallek-Fakhfakh, Hanen; Fakhfakh, Jawhar; Walha, Kamel; Hassairi, Hajer; Gargouri, Ali; Belghith, Hafedh
2017-10-01
This work aims at realizing an optimal hydrolysis of pretreated Alfa fibers (Stipa tenacissima) through the use of enzymes produced from Talaromyces thermophilus AX4, namely β-d-glucosidase and xylanase, by a solid state fermentation process of an agro-industrial waste (wheat bran supplemented with lactose). The carbon source was firstly selected and the optimal values of three other parameters were determined: substrate loading (10g), moisture content (85%) and production time (10days); which led to an optimized enzymatic juice. The outcome was then supplemented with cellulases of T. reesei and used to optimize the enzymatic saccharification of alkali-pretreated Alfa fibers (PAF). The maximum saccharification yield of 83.23% was achieved under optimized conditions (substrate concentration 3.7% (w/v), time 144h and enzyme loading of 0.8 FPU, 15U CMCase, 60U β-d-glucosidase and 125U xylanase).The structural modification of PAF due to enzymatic saccharification was supported by the changes of morphologic and chemical composition observed through macroscopic representation, FTIR and X-Ray analysis. Copyright © 2017 Elsevier B.V. All rights reserved.
-
DEFF Research Database (Denmark)
Mygind, T; Birkelund, Svend; Christiansen, Gunna
1998-01-01
To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...
-
Verbauwhede, Annelien E; Lambrecht, Marlies A; Fierens, Ellen; Hermans, Senne; Shegay, Oksana; Brijs, Kristof; Delcour, Jan A
2018-10-30
The thermo-active serine peptidase aqualysin 1 (Aq1) of Thermus aquaticus was applied in bread making to study the relative contribution of thermoset gluten to bread crumb texture. Aq1 is active between 30 °C and 90 °C with an optimum activity temperature of around 65 °C. It is inhibited by wheat endogenous serine peptidase inhibitors during dough mixing and fermentation and starts hydrolyzing gluten proteins during baking above 80 °C when the enzyme is no longer inhibited and most of the starch is gelatinized and contributes to structure formation. Aq1 activity reduced the molecular weight of gluten proteins and significantly increased their extractability in sodium dodecyl sulfate containing medium. While it had no impact on the specific bread volume and only limited impact on hardness, cohesiveness, springiness, resilience and chewiness, it impacted bread crumb coherence. We conclude that starch has a greater impact on crumb texture than thermoset gluten. Copyright © 2018 Elsevier Ltd. All rights reserved.
-
[Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence
Ortega, Maya
2010-01-01
My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.
-
Energy Technology Data Exchange (ETDEWEB)
Lemoine, Pierric, E-mail: pierric.lemoine@univ-rennes1.fr [Institut des Sciences Chimiques de Rennes, UMR-CNRS 6226, 263 Avenue du Général Leclerc, CS 74205, 35042 Rennes Cedex (France); Bourgès, Cédric; Barbier, Tristan [Laboratoire CRISMAT, UMR-CNRS 6508, ENSICAEN, 6 Boulevard du Maréchal Juin, 14050 Caen Cedex 04 (France); Nassif, Vivian [CNRS Institut NEEL, F-38000 Grenoble (France); Université de Grenoble Alpes, Institut NEEL, F-38000 Grenoble (France); Cordier, Stéphane [Institut des Sciences Chimiques de Rennes, UMR-CNRS 6226, 263 Avenue du Général Leclerc, CS 74205, 35042 Rennes Cedex (France); Guilmeau, Emmanuel [Laboratoire CRISMAT, UMR-CNRS 6508, ENSICAEN, 6 Boulevard du Maréchal Juin, 14050 Caen Cedex 04 (France)
2017-03-15
Ternary copper-containing sulfides Cu{sub 12}Sb{sub 4}S{sub 13} and Cu{sub 4}Sn{sub 7}S{sub 16} have attracted considerable interest since few years due to their high-efficiency conversion as absorbers for solar energy and promising thermoelectric materials. We report therein on the decomposition study of Cu{sub 12}Sb{sub 4}S{sub 13} and Cu{sub 4}Sn{sub 7}S{sub 16} phases using high temperature in situ neutron powder diffraction. Our results obtained at a heating rate of 2.5 K/min indicate that: (i) Cu{sub 12}Sb{sub 4}S{sub 13} decomposes above ≈792 K into Cu{sub 3}SbS{sub 3}, and (ii) Cu{sub 4}Sn{sub 7}S{sub 16} decomposes above ≈891 K into Sn{sub 2}S{sub 3} and a copper-rich sulfide phase of sphalerite ZnS-type structure with an assumed Cu{sub 3}SnS{sub 4} stoichiometry. Both phase decompositions are associated to a sulfur volatilization. While the results on Cu{sub 12}Sb{sub 4}S{sub 13} are in fair agreement with recent published data, the decomposition behavior of Cu{sub 4}Sn{sub 7}S{sub 16} differs from other studies in terms of decomposition temperature, thermal stability and products of reaction. Finally, the crystal structure refinements from neutron powder diffraction data are reported and discussed for the Cu{sub 4}Sn{sub 7}S{sub 16} and tetrahedrite Cu{sub 12}Sb{sub 4}S{sub 13} phases at 300 K, and for the high temperature form of skinnerite Cu{sub 3}SbS{sub 3} at 843 K. - Graphical abstract: In situ neutron powder diffraction data (heating rate of 2.5 K/min) indicates that (i) the ternary Cu{sub 12}Sb{sub 4}S{sub 13} phase is stable up to 792 K and decomposes at higher temperature into Cu{sub 3}SbS{sub 3} and Cu{sub 1.5}Sb{sub 0.5}S{sub 2}, and (ii) the Cu{sub 4}Sn{sub 7}S{sub 16} phase is stable up to 891 K and decomposes at higher temperature into Sn{sub 2}S{sub 3} and a cubic phase of sphalerite ZnS-type structure. Sulfur volatilization likely occurs in order to balance the overall stoichiometry.
-
50 CFR 23.16 - What are the U.S. CITES requirements for urine, feces, and synthetically derived DNA?
2010-10-01
... urine, feces, and synthetically derived DNA? 23.16 Section 23.16 Wildlife and Fisheries UNITED STATES... Requirements § 23.16 What are the U.S. CITES requirements for urine, feces, and synthetically derived DNA? (a... DNA. (1) You must obtain any collection permit and CITES document required by the foreign country. (2...
-
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
-
Directory of Open Access Journals (Sweden)
Eric W. Triplett
2010-07-01
Full Text Available The high level of conservation of 16S ribosomal RNA gene (16S rRNA in all Prokaryotes makes this gene an ideal tool for the rapid identification and classification of these microorganisms. Databases such as the Ribosomal Database Project II (RDP-II and the Greengenes Project offer access to sets of ribosomal RNA sequence databases useful in identification of microbes in a culture-independent analysis of microbial communities. However, these databases do not contain all of the taxonomic levels attached to the published names of the bacterial and archaeal sequences. TaxCollector is a set of scripts developed in Python language that attaches taxonomic information to all 16S rRNA sequences in the RDP-II and Greengenes databases. These modified databases are referred to as TaxCollector databases, which when used in conjunction with BLAST allow for rapid classification of sequences from any environmental or clinical source at six different taxonomic levels, from domain to species. The TaxCollector database prepared from the RDP-II database is an important component of a new 16S rRNA pipeline called PANGEA. The usefulness of TaxCollector databases is demonstrated with two very different datasets obtained using samples from a clinical setting and an agricultural soil. The six TaxCollector scripts are freely available on http://taxcollector.sourceforge.net and on http://www.microgator.org.
-
Directory of Open Access Journals (Sweden)
Xiao Li Shi
Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.
-
The U.S. M-16 rifle versus the Russian AK-47 rifle. A comparison of terminal ballistics.
Swan, K G; Swan, R C; Levine, M G; Rocko, J M
1983-09-01
The standard U.S. military rifle (M-16) is substantially more destructive than its Russian counterpart (AK-47) when fired at short range into clay blocks, despite the fact that the AK-47 is of larger caliber and fires a much heavier bullet with a kinetic energy (muzzle) 25% greater when compared to the M-16. The decisive factor is the 40% greater muzzle velocity of the M-16.
-
Antibacterial Activity of Some Lactic Acid Bacteria Isolated from an Algerian Dairy Product
Directory of Open Access Journals (Sweden)
Abdelkader Mezaini
2009-01-01
Full Text Available In the present study, the antibacterial effect of 20 lactic acid bacteria isolates from a traditional cheese was investigated. 6 isolates showed antibacterial effect against Gram positive bacteria. Streptococcus thermophilus T2 strain showed the wide inhibitory spectrum against the Gram positive bacteria. Growth and bacteriocin production profiles showed that the maximal bacteriocin production, by S. thermophilus T2 cells, was measured by the end of the late-log phase (90 AU ml−1 with a bacteriocine production rate of 9.3 (AU ml−1 h−1. In addition, our findings showed that the bacteriocin, produced by S. thermophilus T2, was stable over a wide pH range (4–8; this indicates that such bacteriocin may be useful in acidic as well as nonacidic food. This preliminarily work shows the potential application of autochthonous lactic acid bacteria to improve safety of traditional fermented food.
-
Antibacterial Activity of Some Lactic Acid Bacteria Isolated from an Algerian Dairy Product
International Nuclear Information System (INIS)
Mezaini, A.; Bouras, A.D.; Mezaini, A.; Chihib, N.; Nedjar-Arroume, N.; Hornez, J.P.
2010-01-01
In the present study, the antibacterial effect of 20 lactic acid bacteria isolates from a traditional cheese was investigated. 6 isolates showed antibacterial effect against Gram positive bacteria. Streptococcus thermophilus T2 strain showed the wide inhibitory spectrum against the Gram positive bacteria. Growth and bacitracin production profiles showed that the maximal bacitracin production, by S. thermophilus T2 cells, was measured by the end of the late-log phase (90 AU ml -1 ) with a bacterio cine production rate of 9.3 (AU ml -1 ) h -1 . In addition, our findings showed that the bacitracin, produced by S. thermophilus T2, was stable over a wide ph range (4-8); this indicates that such bacitracin may be useful in acidic as well as non acidic food. This preliminarily work shows the potential application of autochthonous lactic acid bacteria to improve safety of traditional fermented food.
-
Li, Wan; Bian, Xin; Evivie, Smith Etareri; Huo, Gui-Cheng
2016-09-01
The CRISPR-Cas (CRISPR together with CRISPR-associated proteins) modules are the adaptive immune system, acting as an adaptive and heritable immune system in bacteria and archaea. CRISPR-based immunity acts by integrating short virus sequences in the cell's CRISPR locus, allowing the cell to remember, recognize, and clear infections. In this study, the homology of CRISPRs sequence in BIMs (bacteriophage-insensitive mutants) of Streptococcus thermophilus St-I were analyzed. Secondary structures of the repeats and the PAMs (protospacer-associated motif) of each CRISPR locus were also predicted. Results showed that CRISPR1 has 27 repeat-spacer units, 5 of them had duplicates; CRISPR2 has one repeat-spacer unit; CRISPR3 has 28 repeat-spacer units. Only BIM1 had a new spacer acquisition in CRISPR3, while BIM2 and BIM3 had no new spacers' insertion, thus indicating that while most CRISPR1 were more active than CRISPR3, new spacer acquisition occurred just in CRSPR3 in some situations. These findings will help establish the foundation for the study of CRSPR-Cas systems in lactic acid bacteria.
-
International Nuclear Information System (INIS)
La Cognata, M.; Spitaleri, C.; Trippella, O.; Kiss, G. G.; Guardo, G. L.; Puglia, S. M. R.; Romano, S.; Spartà, R.; Rogachev, G. V.; Avila, M.; Koshchiy, E.; Kuchera, A.; Santiago, D.; Mukhamedzhanov, A. M.; Lamia, L.
2013-01-01
The 13 C(α, n) 16 O reaction is the neutron source for the main component of the s-process, responsible for the production of most of the nuclei in the mass range 90 ∼ 8 K, corresponding to an energy interval where the 13 C(α, n) 16 O reaction is effective in the range of 140-230 keV. In this regime, the astrophysical S(E)-factor is dominated by the –3 keV sub-threshold resonance due to the 6.356 MeV level in 17 O, giving rise to a steep increase in the S-factor. Its contribution is still controversial as extrapolations, e.g., through the R-matrix and indirect techniques such as the asymptotic normalization coefficient (ANC), yield inconsistent results. The discrepancy amounts to a factor of three or more precisely at astrophysical energies. To provide a more accurate S-factor at these energies, we have applied the Trojan horse method (THM) to the 13 C( 6 Li, n 16 O)d quasi-free reaction. The ANC for the 6.356 MeV level has been deduced through the THM as well as the n-partial width, allowing us to attain unprecedented accuracy for the 13 C(α, n) 16 O astrophysical factor. A larger ANC for the 6.356 MeV level is measured with respect to the ones in the literature, (C-tilde α 13 C 17O(1/2+)2 = 7.7 ± 0.3 stat -1.5 +1. |6 norm fm –1 , yet in agreement with the preliminary result given in our preceding letter, indicating an increase of the 13 C(α, n) 16 O reaction rate below about 8 × 10 7 K if compared with the recommended values. At ∼10 8 K, our reaction rate agrees with most of the results in the literature and the accuracy is greatly enhanced thanks to this innovative approach
-
Wu, Zhengcui; Wu, Yaqin; Pei, Tonghui; Wang, Huan; Geng, Baoyou
2014-02-01
Novel hierarchical heteronanostructures of ZnO nanorods/ZnS.(HDA)0.5 (HDA = 1,6-hexanediamine) hybrid nanoplates on a zinc substrate are successfully synthesized on a large scale by combining hydrothermal growth (for ZnO nanorods) and liquid chemical conversion (for ZnS.(HDA)0.5 nanoplates) techniques. The formation of ZnS.(HDA)0.5 hybrid nanoplates branches takes advantage of the preferential binding of 1,6-hexanediamine on specific facets of ZnS, which makes the thickening rate much lower than the lateral growth rate. The ZnS.(HDA)0.5 hybrid nanoplates have a layered structure with 1,6-hexanediamine inserted into interlayers of wurtzite ZnS through the bonding of nitrogen. The number density and thickness of the secondary ZnS.(HDA)0.5 nanoplates can be conveniently engineered by variation of the sulfur source and straightforward adjustment of reactant concentrations such as 1,6-hexanediamine and the sulfur source. The fabricated ZnO/ZnS.(HDA)0.5 heteronanostructures show improved electrochemical catalytic properties for hydrazine compared with the primary ZnO nanorods. Due to its simplicity and efficiency, this approach could be similarly used to fabricate varieties of hybrid heterostructures made of materials with an intrinsic large lattice mismatch.Novel hierarchical heteronanostructures of ZnO nanorods/ZnS.(HDA)0.5 (HDA = 1,6-hexanediamine) hybrid nanoplates on a zinc substrate are successfully synthesized on a large scale by combining hydrothermal growth (for ZnO nanorods) and liquid chemical conversion (for ZnS.(HDA)0.5 nanoplates) techniques. The formation of ZnS.(HDA)0.5 hybrid nanoplates branches takes advantage of the preferential binding of 1,6-hexanediamine on specific facets of ZnS, which makes the thickening rate much lower than the lateral growth rate. The ZnS.(HDA)0.5 hybrid nanoplates have a layered structure with 1,6-hexanediamine inserted into interlayers of wurtzite ZnS through the bonding of nitrogen. The number density and thickness of the
-
Vasconcelos, Elton J R; Billeter, Sarah A; Jett, Lindsey A; Meinersmann, Richard J; Barr, Margaret C; Diniz, Pedro P V P; Oakley, Brian B
2018-06-12
Flea-borne diseases (FBDs) impact both human and animal health worldwide. Because adult fleas are obligately hematophagous and can harbor potential pathogens, fleas act as ectoparasites of vertebrates, as well as zoonotic disease vectors. Cat fleas (Ctenocephalides felis) are important vectors of two zoonotic bacterial genera listed as priority pathogens by the National Institute of Allergy and Infectious Diseases (NIAID-USA): Bartonella spp. and Rickettsia spp., causative agents of bartonelloses and rickettsioses, respectively. In this study, we introduce the first microbiome analysis of C. felis samples from California, determining the presence and abundance of relevant pathogenic genera by characterizing the cat flea microbiome through 16S rRNA next-generation sequencing (16S-NGS). Samples from both northern (NoCal) and southern (SoCal) California were assessed to expand current knowledge regarding FBDs in the state. We identified Rickettsia and Bartonella, as well as the endosymbiont Wolbachia, as the most abundant genera, followed by less abundant taxa. In comparison to our previous study screening Californian cat fleas for rickettsiae using PCR/digestion/sequencing of the ompB gene, the 16S-NGS approach applied herein showed a 95% level of agreement in detecting Rickettsia spp. There was no overall difference in microbiome diversity between NoCal and SoCal samples. Bacterial taxa identified by 16S-NGS in this study may help to improve epidemiological investigations, pathogen surveillance efforts, and clinical diagnostics of FBDs in California and elsewhere.
-
DEFF Research Database (Denmark)
Harrington, C.S.; On, Stephen L.W.
1999-01-01
Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...
-
Metagenomic Analysis of Slovak Bryndza Cheese Using Next-Generation 16S rDNA Amplicon Sequencing
Directory of Open Access Journals (Sweden)
Planý Matej
2016-06-01
Full Text Available Knowledge about diversity and taxonomic structure of the microbial population present in traditional fermented foods plays a key role in starter culture selection, safety improvement and quality enhancement of the end product. Aim of this study was to investigate microbial consortia composition in Slovak bryndza cheese. For this purpose, we used culture-independent approach based on 16S rDNA amplicon sequencing using next generation sequencing platform. Results obtained by the analysis of three commercial (produced on industrial scale in winter season and one traditional (artisanal, most valued, produced in May Slovak bryndza cheese sample were compared. A diverse prokaryotic microflora composed mostly of the genera Lactococcus, Streptococcus, Lactobacillus, and Enterococcus was identified. Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris were the dominant taxons in all tested samples. Second most abundant species, detected in all bryndza cheeses, were Lactococcus fujiensis and Lactococcus taiwanensis, independently by two different approaches, using different reference 16S rRNA genes databases (Greengenes and NCBI respectively. They have been detected in bryndza cheese samples in substantial amount for the first time. The narrowest microbial diversity was observed in a sample made with a starter culture from pasteurised milk. Metagenomic analysis by high-throughput sequencing using 16S rRNA genes seems to be a powerful tool for studying the structure of the microbial population in cheeses.
-
Directory of Open Access Journals (Sweden)
Bryan E. Dutton
2002-12-01
Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.
-
Jung, Jieun; Paik, Hyun-Dong; Yoon, Hyun Joo; Jang, Hye Ji; Jeewanthi, Renda Kankanamge Chaturika; Jee, Hee-Sook; Li, Xiang; Lee, Na-Kyoung; Lee, Si-Kyung
2016-01-01
The objective of this study was to investigate characteristics and functionality of yogurt applied red ginseng extract. Yogurts added with red ginseng extract (0.5, 1, 1.5, and 2%) were produced using Lactobacillus acidophilus and Streptococcus thermophilus and stored at refrigerated temperature. During fermentation, pH was decreased whereas titratable aicidity and viable cell counts of L. acidophilus and S. thermophilus were increased. The composition of yogurt samples was measured on day 1,...
-
Wang, R F; Cao, W W; Cerniglia, C E
1996-01-01
In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).
-
Efficacy of HIV antiviral polyanionic carbosilane dendrimer G2-S16 in the presence of semen
Directory of Open Access Journals (Sweden)
Ceña-Diez R
2016-05-01
Full Text Available Rafael Ceña-Diez,1–4,* Pilar García-Broncano,1–5,* Francisco Javier de la Mata,4,6 Rafael Gómez,4,6 Mª Ángeles Muñoz-Fernández1–4 1Hospital General Universitario Gregorio Marañon, 2Instituto de Investigación Sanitaria Gregorio Marañon, 3Spanish HIV HGM Biobank, 4Networking Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN, 5Laboratory of Viral Infection and Immunity, National Center of Microbiology, Health Institute of Carlos III, Majadahonda, 6Department of Organic Chemistry and Inorganic Chemistry, University of Alcalá, Alcalá de Henares, Madrid, Spain *These authors contributed equally to this work Abstract: The development of a safe and effective microbicide to prevent the sexual transmission of human immunodeficiency virus (HIV-1 is urgently needed. Unfortunately, the majority of microbicides, such as poly(L-lysine-dendrimers, anionic polymers, or antiretrovirals, have proved inactive or even increased the risk of HIV infection in clinical trials, most probably due to the fact that these compounds failed to prevent semen-exposed HIV infection. We showed that G2-S16 dendrimer exerts anti-HIV-1 activity at an early stage of viral replication, blocking the gp120/CD4/CCR5 interaction and providing a barrier to infection for long periods, confirming its multifactorial and nonspecific ability. Previously, we demonstrated that topical administration of G2-S16 prevents HIV transmission in humanized BLT mice without irritation or vaginal lesions. Here, we demonstrated that G2-S16 is active against mock- and semen-exposed HIV-1 and could be a promising microbicide against HIV infection. Keywords: G2-S16, dendrimer, HIV-1, SEVI, microbicide, antiretrovirals
-
Resource management framework for QoS scheduling in IEEE 802.16 WiMAX networks
DEFF Research Database (Denmark)
Wang, Hua; Dittmann, Lars
2009-01-01
IEEE 802.16, also known as WiMAX, has received much attention recently for its capability to support multiple types of applications with diverse Quality-of-Service (QoS) requirements. Beyond what the standard has defined, radio resource management (RRM) still remains an open issue, which plays...... an important role in QoS provisioning for different types of services. In this chapter, we propose a downlink resource management framework for QoS scheduling in OFDMA based WiMAX systems. Our framework consists of a dynamic resource allocation (DRA) module and a connection admission control (CAC) module...
-
Downlink resource management for QoS scheduling in IEEE 802.16 WiMAX networks
DEFF Research Database (Denmark)
Wang, Hua; Dittmann, Lars
2010-01-01
IEEE 802.16, also known as WiMAX, has received much attention recently for its capability to support multiple types of applications with diverse Quality-of-Service (QoS) requirements. Beyond what the standard has defined, radio resource management (RRM) still remains an open issue, which plays...... an important role in QoS provisioning for different types of services. In this paper, we propose a downlink resource management framework for QoS scheduling in OFDMA based WiMAX systems. Our framework consists of a dynamic resource allocation (DRA) module and a connection admission control (CAC) module. A two...
-
Salzman, Nita H; de Jong, Hendrik; Paterson, Yvonne; Harmsen, Hermie J M; Welling, Gjalt W; Bos, Nicolaas A
2002-11-01
Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of these sequences, 25% (10/40) corresponded to described intestinal organisms of the mouse, including Lactobacillus spp., Helicobacter spp., segmented filamentous bacteria and members of the altered Schaedler flora (ASF360, ASF361, ASF502 and ASF519); 75% (30/40) represented novel sequences. A large number (11/40) of the novel sequences revealed a new operational taxonomic unit (OTU) belonging to the Cytophaga-Flavobacter-Bacteroides phylum, which the authors named 'mouse intestinal bacteria'. 16S rRNA probes were developed for this new OTU. Upon analysis of the novel sequences, eight were found to cluster within the Eubacterium rectale-Clostridium coccoides group and three clustered within the Bacteroides group. One of the novel sequences was distantly related to Verrucomicrobium spinosum and one was distantly related to Bacillus mycoides. Oligonucleotide probes specific for the 16S rRNA of these novel clones were generated. Using a combination of four previously described and four newly designed probes, approximately 80% of bacteria recovered from the murine large intestine and 71% of bacteria recovered from the murine caecum could be identified by fluorescence in situ hybridization (FISH).
-
Demostration of 520 Gb/s/λ pre-equalized DFT-spread PDM-16QAM-OFDM signal transmission.
Li, Fan; Yu, Jianjun; Cao, Zizheng; Chen, Ming; Zhang, Junwen; Li, Xinying
2016-02-08
In this paper, we successfully transmit 8 × 520 Gb/s pre-equalized DFT-spread PDM-16QAM orthogonal frequency-division multiplexing (OFDM) signal over 840 km SMF with BER under 2.4 × 10(-2). We discuss how to obtain accurate tranceivers' response during pre-equalization for DFT-spread OFDM with coherent detection and we find conventional OFDM symbols training sequences (TSs) outperform DFT-spread OFDM symbols TSs in obtaining channel response for pre-equalization and equalization. Additionally, the optimal IFFT/FFT size is explored for the pre-equalized DFT-spread PDM-16QAM-OFDM transmission systems. It is the first time to realize 400 Gb/s/λ net rate OFDM signal transmission.
-
A comprehensive evaluation of the sl1p pipeline for 16S rRNA gene sequencing analysis.
Whelan, Fiona J; Surette, Michael G
2017-08-14
Advances in next-generation sequencing technologies have allowed for detailed, molecular-based studies of microbial communities such as the human gut, soil, and ocean waters. Sequencing of the 16S rRNA gene, specific to prokaryotes, using universal PCR primers has become a common approach to studying the composition of these microbiota. However, the bioinformatic processing of the resulting millions of DNA sequences can be challenging, and a standardized protocol would aid in reproducible analyses. The short-read library 16S rRNA gene sequencing pipeline (sl1p, pronounced "slip") was designed with the purpose of mitigating this lack of reproducibility by combining pre-existing tools into a computational pipeline. This pipeline automates the processing of raw 16S rRNA gene sequencing data to create human-readable tables, graphs, and figures to make the collected data more readily accessible. Data generated from mock communities were compared using eight OTU clustering algorithms, two taxon assignment approaches, and three 16S rRNA gene reference databases. While all of these algorithms and options are available to sl1p users, through testing with human-associated mock communities, AbundantOTU+, the RDP Classifier, and the Greengenes 2011 reference database were chosen as sl1p's defaults based on their ability to best represent the known input communities. sl1p promotes reproducible research by providing a comprehensive log file, and reduces the computational knowledge needed by the user to process next-generation sequencing data. sl1p is freely available at https://bitbucket.org/fwhelan/sl1p .
-
CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.
Directory of Open Access Journals (Sweden)
Ann L Griffen
2011-04-01
Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.
-
Nakamura, Moriya; Kamio, Yukiyoshi; Miyazaki, Tetsuya
2008-07-07
We experimentally demonstrated linewidth-tolerant 10-Gbit/s (2.5-Gsymbol/s) 16-quadrature amplitude modulation (QAM) by using a distributed-feedback laser diode (DFB-LD) with a linewidth of 30 MHz. Error-free operation, a bit-error rate (BER) of noise canceling capability provided by a pilot-carrier and standard electronic pre-equalization to suppress inter-symbol interference (ISI) gave clear 16-QAM constellations and floor-less BER characteristics. We evaluated the BER characteristics by real-time measurement of six (three different thresholds for each I- and Q-component) symbol error rates (SERs) with simultaneous constellation observation.
-
International Nuclear Information System (INIS)
Denman, R.; Krzyzosiak, W.; Nurse, K.; Ofengand, J.
1987-01-01
The gene coding for E. coli 16S rRNA was placed in pUC19 under the control of the strong class III T7 promoter, phi 10, by ligation of the 1490 bp BclI/BstEII fragment of the rrnB operon with appropriate synthetic oligodeoxynucleotides. Such constructs allowed efficient in vitro synthesis of full-length transcripts (up to 900 mol RNA/mol template) free of modified bases. The synthetic RNA could be assembled into 30S subunits upon addition of E. coli 30S ribosomal proteins. The particles co-sedimented with authentic 30S particles and were electron microscopically indistinguishable from them. Upon addition of 50S subunits, codon-dependent P-site binding of tRNA and codon-dependent polypeptide synthesis were >80% of 30S reconstituted from natural 16S RNA and >50% of isolated 30S. UV-induced crosslinking of P-site bound AcVal-tRNA to residue C 1400 was preserved. Changing C 1400 to A had little effect on reconstitution, P-site binding, or polypeptide synthesis. However, the substitution of C 1499 by G markedly inhibited assembly. The effect on P-site binding and polypeptide synthesis is under study. These results show (1) none of the modified bases of 16S RNA are essential for protein synthesis, (2) substitution of A for C 1400 has little functional effect, and (3) position 1400 may be important for ribosome assembly
-
Partial trisomy 16p in an adolescent with autistic disorder and Tourette`s syndrome
Energy Technology Data Exchange (ETDEWEB)
Hebebrand, J.; Martin, M.; Remschmidt, H. [Philipps-Univ., Marburg (Germany)] [and others
1994-09-15
A partial trisomy 16p was identified in a 14-year-old male adolescent with autistic disorder. He additionally showed complex motor and vocal phenomena, including some simple tics which had first appeared in childhood. Whereas these simple tics were of subclinical significance, an additional diagnosis of Tourette`s syndrome (TS) appears justified. The case report illustrates the diagnostic difficulties in assessing psychiatric symptomatology associated with both disorders, especially complex motor and vocal phenomena. The cytogenetic finding is discussed critically in the light of other chromosome abnormalities reported in both TS and autistic disorder. Chromosome 16p should be considered as a candidate region especially for autistic disorder. 21 refs.
-
80 Gbit/s 16-QAM Multicarrier THz Wireless Communication Link in the 400 GHz Band
DEFF Research Database (Denmark)
Jia, Shi; Yu, Xianbin; Hu, Hao
2016-01-01
We experimentally demonstrate a high-speed multicarrier THz wireless communication system operating in the 400 GHz band. The use of spectrally efficient 16-QAM modulation and broadband THz transceivers enable link data rates up to 80 Gbit/s....
-
Directory of Open Access Journals (Sweden)
Áurea Marcela de Souza Pereira
2018-01-01
Full Text Available The effects of Lactobacillus casei BGP93 used as adjunct culture on the physicochemical, textural and sensory characteristics of a dairy beverage processed with goat Coalho cheese whey powder and Streptococcus thermophilus TA-40 as starter (ST-LC beverage were investigated in comparison to a control product (ST beverage without L. casei. No significant differences were observed between the ST and ST-LC trials concerning the acidification pattern throughout the fermentation process (P>0.05. Post-acidification was also not observed for both trials since their pH values were maintained stable, without significant differences during 21 days at 4 ± 1 °C. This pH stability reinforced the maintenance of firmness, consistency, cohesiveness and viscosity index without significant differences between the sampling periods throughout the whole storage in both trials, and also that no significant difference was verified between the ST and ST-LC beverages in the sensory evaluation (P>0.05.
-
Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin
2007-11-01
Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.
-
Electromagnetic dissociation of target nuclei by $^{16}$O and $^{32}$S projectiles
2002-01-01
We have measured the inclusive cross sections for electromagnetic dissociation (ED) of $^{197}$Au targets by 60 and 200 GeV/nucleon $^{16}$O and $^{32}$S projectiles. This is an extension of similar measurements carried out earlier at 2 GeV/nucleon. ED is a purely electromagnetic process occuring when a virtual photon is exchanged between projectile and target. The experiment emphasized precise measurement of total one-neutron-out cross sections. A secondary goal was to test the applicability of the concepts of factorization and limiting fragmentation at ultrarelativistic energies.\\\\ \\\\ Each individual target will be irradiated upstream and parasitic to experiment NA38 on the dimuon spectrometer. Cross sections for reactions of interest will be determined by off-line counting of the appropriate residual $\\gamma$ ray activities in Ames, Iowa, USA. Preliminary results indicate an ED one-neutron removal cross section for 200 GeV/nucleon $^{16}$O projectiles on $^{197}$Au of approximately 0.45~barns. The result i...
-
Detection of Microbial 16S rRNA Gene in the Blood of Patients With Parkinson’s Disease
Directory of Open Access Journals (Sweden)
Yiwei Qian
2018-05-01
Full Text Available Emerging evidence suggests that the microbiota present in feces plays a role in Parkinson’s disease (PD. However, the alterations of the microbiome in the blood of PD patients remain unknown. To test this hypothesis, we conducted this case-control study to explore the microbiota compositions in the blood of Chinese PD patients. Microbiota communities in the blood of 45 patients and their healthy spouses were investigated using high-throughput Illumina HiSeq sequencing targeting the V3-V4 region of 16S ribosomal RNA (rRNA gene. The relationships between the microbiota in the blood and PD clinical characteristics were analyzed. No difference was detected in the structure and richness between PD patients and healthy controls. The following genera were enriched in the blood of PD patients: Isoptericola, Cloacibacterium, Enhydrobacter and Microbacterium; whereas genus Limnobacter was enriched in the healthy controls after adjusting for age, gender, body mass index (BMI and constipation. Additionally, the findings regarding these genera were validated in another independent group of 58 PD patients and 57 healthy controls using real-time PCR targeting genus-specific 16S rRNA genes. Furthermore, not only the genera Cloacibacterium and Isoptericola (which were identified as enriched in PD patients but also the genera Paludibacter and Saccharofermentans were positively associated with disease duration. Some specific genera in the blood were related to mood disorders. We believe this is the first report to provide direct evidence to support the hypothesis that the identified microbiota in the blood are associated with PD. Additionally, some microbiota in the blood are closely associated with the clinical characteristics of PD. Elucidating these differences in blood microbiomes will provide a foundation to improve our understanding of the role of microbiota in the pathogenesis of PD.
-
Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas
2009-06-01
The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.
-
Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries
DEFF Research Database (Denmark)
Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.
2004-01-01
for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting...... FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes. ...
-
Directory of Open Access Journals (Sweden)
Jennifer J Barb
Full Text Available There is much speculation on which hypervariable region provides the highest bacterial specificity in 16S rRNA sequencing. The optimum solution to prevent bias and to obtain a comprehensive view of complex bacterial communities would be to sequence the entire 16S rRNA gene; however, this is not possible with second generation standard library design and short-read next-generation sequencing technology.This paper examines a new process using seven hypervariable or V regions of the 16S rRNA (six amplicons: V2, V3, V4, V6-7, V8, and V9 processed simultaneously on the Ion Torrent Personal Genome Machine (Life Technologies, Grand Island, NY. Four mock samples were amplified using the 16S Ion Metagenomics Kit™ (Life Technologies and their sequencing data is subjected to a novel analytical pipeline.Results are presented at family and genus level. The Kullback-Leibler divergence (DKL, a measure of the departure of the computed from the nominal bacterial distribution in the mock samples, was used to infer which region performed best at the family and genus levels. Three different hypervariable regions, V2, V4, and V6-7, produced the lowest divergence compared to the known mock sample. The V9 region gave the highest (worst average DKL while the V4 gave the lowest (best average DKL. In addition to having a high DKL, the V9 region in both the forward and reverse directions performed the worst finding only 17% and 53% of the known family level and 12% and 47% of the genus level bacteria, while results from the forward and reverse V4 region identified all 17 family level bacteria.The results of our analysis have shown that our sequencing methods using 6 hypervariable regions of the 16S rRNA and subsequent analysis is valid. This method also allowed for the assessment of how well each of the variable regions might perform simultaneously. Our findings will provide the basis for future work intended to assess microbial abundance at different time points
-
Rbaihi, E.; Belafhal, A.; Vander Auwera, J.; Naı̈m, S.; Fayt, A.
1998-09-01
We have measured the FT spectrum of natural OCS from 4800 to 8000 cm-1with a near Doppler resolution and a line-position accuracy between 2 and 8 × 10-4cm-1. For the normal isotopic species16O12C32S, 37 vibrational transitions have been analyzed for both frequencies and intensities. We also report six bands of16O12C34S, five bands of16O13C32S, two bands of16O12C33S, and two bands of18O12C32S. Important effective Herman-Wallis terms are explained by the anharmonic resonances between closely spaced states. As those results complete the study of the Fourier transform spectra of natural carbonyl sulfide from 1800 to 8000 cm-1, a new global rovibrational analysis of16O12C32S has been performed. We have determined a set of 148 molecular parameters, and a statistical agreement is obtained with all the available experimental data.
-
Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami
2017-01-01
Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...
-
Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo
2009-04-01
For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.
-
Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio
2001-01-01
Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127
-
16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments
DEFF Research Database (Denmark)
Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain
2015-01-01
communities in meat and the meat process environment with special focus on the Enterobacteriaceae family as a subpopulation comprising enteropathogens including Salmonella. Samples were analyzed by a nested PCR approach combined with MiSeq® Illumina®16S DNA sequencing and standardized culture methods as cross...... reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very reproducible when the same...
-
Felske, A; Akkermans, A D; De Vos, W M
1998-11-01
A novel approach was developed to quantify rRNA sequences in complex bacterial communities. The main bacterial 16S rRNAs in Drentse A grassland soils (The Netherlands) were amplified by reverse transcription (RT)-PCR with bacterium-specific primers and were separated by temperature gradient gel electrophoresis (TGGE). The primer pair used (primers U968-GC and L1401) was found to amplify with the same efficiency 16S rRNAs from bacterial cultures containing different taxa and cloned 16S ribosomal DNA amplicons from uncultured soil bacteria. The sequence-specific efficiency of amplification was determined by monitoring the amplification kinetics by kinetic PCR. The primer-specific amplification efficiency was assessed by competitive PCR and RT-PCR, and identical input amounts of different 16S rRNAs resulted in identical amplicon yields. The sequence-specific detection system used for competitive amplifications was TGGE, which also has been found to be suitable for simultaneous quantification of more than one sequence. We demonstrate that this approach can be applied to TGGE fingerprints of soil bacteria to estimate the ratios of the bacterial 16S rRNAs.
-
Helbling, Damian E; Johnson, David R; Lee, Tae Kwon; Scheidegger, Andreas; Fenner, Kathrin
2015-03-01
The rates at which wastewater treatment plant (WWTP) microbial communities biotransform specific substrates can differ by orders of magnitude among WWTP communities. Differences in taxonomic compositions among WWTP communities may predict differences in the rates of some types of biotransformations. In this work, we present a novel framework for establishing predictive relationships between specific bacterial 16S rRNA sequence abundances and biotransformation rates. We selected ten WWTPs with substantial variation in their environmental and operational metrics and measured the in situ ammonia biotransformation rate constants in nine of them. We isolated total RNA from samples from each WWTP and analyzed 16S rRNA sequence reads. We then developed multivariate models between the measured abundances of specific bacterial 16S rRNA sequence reads and the ammonia biotransformation rate constants. We constructed model scenarios that systematically explored the effects of model regularization, model linearity and non-linearity, and aggregation of 16S rRNA sequences into operational taxonomic units (OTUs) as a function of sequence dissimilarity threshold (SDT). A large percentage (greater than 80%) of model scenarios resulted in well-performing and significant models at intermediate SDTs of 0.13-0.14 and 0.26. The 16S rRNA sequences consistently selected into the well-performing and significant models at those SDTs were classified as Nitrosomonas and Nitrospira groups. We then extend the framework by applying it to the biotransformation rate constants of ten micropollutants measured in batch reactors seeded with the ten WWTP communities. We identified phylogenetic groups that were robustly selected into all well-performing and significant models constructed with biotransformation rates of isoproturon, propachlor, ranitidine, and venlafaxine. These phylogenetic groups can be used as predictive biomarkers of WWTP microbial community activity towards these specific
-
Natarajaseenivasan, Kalimuthusamy; Shanmughapriya, Santhanam; Velineni, Sridhar; Artiushin, Sergey C; Timoney, John F
2011-10-01
Leptospirosis is an infectious bacterial disease caused by Leptospira species. In this study, we cloned and sequenced the gene encoding the immunodominant protein GroEL from L. interrogans serovar Autumnalis strain N2, which was isolated from the urine of a patient during an outbreak of leptospirosis in Chennai, India. This groEL gene encodes a protein of 60 kDa with a high degree of homology (99% similarity) to those of other leptospiral serovars. Recombinant GroEL was overexpressed in Escherichia coli. Immunoblot analysis indicated that the sera from confirmed leptospirosis patients showed strong reactivity with the recombinant GroEL while no reactivity was observed with the sera from seronegative control patient. In addition, the 3D structure of GroEL was constructed using chaperonin complex cpn60 from Thermus thermophilus as template and validated. The results indicated a Z-score of -8.35, which is in good agreement with the expected value for a protein. The superposition of the Ca traces of cpn60 structure and predicted structure of leptospiral GroEL indicates good agreement of secondary structure elements with an RMSD value of 1.5 Å. Further study is necessary to evaluate GroEL for serological diagnosis of leptospirosis and for its potential as a vaccine component. Copyright © 2011 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.
-
Lou, Xiangdi; Ran, Tingting; Han, Ning; Gao, Yanyan; He, Jianhua; Tang, Lin; Xu, Dongqing; Wang, Weiwu
2014-04-25
Prodigiosin, a tripyrrole red pigment synthesized by Serratia and some other microbes through a bifurcated biosynthesis pathway, MBC (4-methoxy-2,2'-bipyrrole-5-carbaldehyde) and MAP (2-methyl-3-n-amyl-pyrrole) are synthesized separately and then condensed by PigC to form prodigiosin. MAP is synthesized sequentially by PigD, PigE and PigB. PigE catalyzes the transamination of an amino group to the aldehyde group of 3-acetyloctanal, resulting in an aminoketone, which spontaneously cyclizes to form H2MAP. Here we report the crystal structure of the catalytic domain of PigE which involved in the biosynthesis of prodigiosin precursor MAP for the first time to a resolution of 2.3Å with a homodimer in the asymmetric unit. The monomer of PigE catalytic domain is composed of three domains with PLP as cofactor: a small N-terminal domain connecting the catalytic domain with the front part of PigE, a large PLP-binding domain and a C-terminal domain. The residues from both monomers build the PLP binding site at the interface of the dimer which resembles the other PLP-dependent enzymes. Structural comparison of PigE with Thermus thermophilus AcOAT showed a higher hydrophobic and smaller active site of PigE, these differences may be the reason for substrate specificity. Copyright © 2014 Elsevier Inc. All rights reserved.
-
Czech Academy of Sciences Publication Activity Database
Řeháková, Klára; Johansen, J. R.; Bowen, M.B.; Martin, M.P.; Sheil, C.A.
2014-01-01
Roč. 14, č. 2 (2014), s. 161-178 ISSN 1802-5439 Institutional support: RVO:60077344 Keywords : 16S rRNA secondary structure * cyanobacteria * phylogeny Subject RIV: EE - Microbiology, Virology Impact factor: 1.930, year: 2014
-
Energy Technology Data Exchange (ETDEWEB)
La Cognata, M.; Spitaleri, C.; Trippella, O.; Kiss, G. G.; Guardo, G. L.; Puglia, S. M. R.; Romano, S.; Spartà, R. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali del Sud, I-95123, Catania (Italy); Rogachev, G. V.; Avila, M.; Koshchiy, E.; Kuchera, A.; Santiago, D. [Department of Physics, Florida State University, Tallahassee, FL (United States); Mukhamedzhanov, A. M. [Cyclotron Institute, Texas A and M University, College Station, TX (United States); Lamia, L., E-mail: lacognata@lns.infn.it [Dipartimento di Fisica e Astronomia, Università di Catania, I-95123 Catania (Italy)
2013-11-10
The {sup 13}C(α, n){sup 16}O reaction is the neutron source for the main component of the s-process, responsible for the production of most of the nuclei in the mass range 90 ∼< A ∼< 208. This reaction takes place inside the helium-burning shell of asymptotic giant branch stars, at temperatures ∼< 10{sup 8} K, corresponding to an energy interval where the {sup 13}C(α, n){sup 16}O reaction is effective in the range of 140-230 keV. In this regime, the astrophysical S(E)-factor is dominated by the –3 keV sub-threshold resonance due to the 6.356 MeV level in {sup 17}O, giving rise to a steep increase in the S-factor. Its contribution is still controversial as extrapolations, e.g., through the R-matrix and indirect techniques such as the asymptotic normalization coefficient (ANC), yield inconsistent results. The discrepancy amounts to a factor of three or more precisely at astrophysical energies. To provide a more accurate S-factor at these energies, we have applied the Trojan horse method (THM) to the {sup 13}C({sup 6}Li, n {sup 16}O)d quasi-free reaction. The ANC for the 6.356 MeV level has been deduced through the THM as well as the n-partial width, allowing us to attain unprecedented accuracy for the {sup 13}C(α, n){sup 16}O astrophysical factor. A larger ANC for the 6.356 MeV level is measured with respect to the ones in the literature, (C-tilde{sub α{sup 1}{sup 3}C}{sup 17O(1/2+)2} = 7.7 ± 0.3{sub stat} {sub -1.5}{sup +1.}|6 norm fm{sup –1}, yet in agreement with the preliminary result given in our preceding letter, indicating an increase of the {sup 13}C(α, n){sup 16}O reaction rate below about 8 × 10{sup 7} K if compared with the recommended values. At ∼10{sup 8} K, our reaction rate agrees with most of the results in the literature and the accuracy is greatly enhanced thanks to this innovative approach.
-
Gandhi, Akanksha; Shah, Nagendra P
2014-12-01
The present investigation examined the effects of supplementation of milk peptide fractions produced by enzymatic hydrolysis on the fermentation of reconstituted skim milk (RSM). Changes in pH, cell growth, proteolytic activity, and angiotensin-converting enzyme (ACE)-inhibitory activity were monitored during fermentation of RSM by pure cultures of Lactobacillus acidophilus, Lactobacillus helveticus, Lactobacillus delbrueckii ssp. bulgaricus, and Streptococcus thermophilus. The study showed that supplementation with peptide fractions of different molecular weights did not significantly affect the bacterial growth in RSM. All bacteria showed an increased proteolytic activity in RSM supplemented with large peptides (>10 kDa), and L. helveticus in general exhibited the highest proteolytic activity among the bacteria studied. The ACE-inhibitory activity was observed to be the maximum in RSM supplemented with larger peptides (>10 kDa) for all bacteria. The results suggest that proteolysis by bacteria leads to increased production of ACE-inhibitory peptides compared to the supplemented peptides produced by enzymatic hydrolysis.
-
Directory of Open Access Journals (Sweden)
Fábio Bueno dos Reis Junior
2006-03-01
Full Text Available O objetivo deste trabalho foi avaliar a diversidade intra-específica de isolados de Azospirillum amazonense e estabelecer a possível influência de diferentes espécies de Brachiaria ssp. e diferentes condições edafoclimáticas. A caracterização da diversidade desses isolados foi conduzida, utilizando-se a análise de restrição da região intergênica 16S-23S DNAr. As estirpes estudadas separaram-se em dois grupos, definidos a 56% de similaridade. As espécies de Brachiaria ssp. influenciaram a diversidade de estirpes. A maioria dos isolados oriundos de B. decumbens e B. brizantha está inserida no primeiro grupo, enquanto os oriundos de B. humidicola concentram-se no segundo grupo.The aim of this work was to study the intra-specific diversity of Azospirillum amazonense isolates and to establish possible influences of different Brachiaria spp. and edaphoclimatic conditions. The characterization of the diversity among the isolates of A. amazonense studied was conducted using restriction analysis of the 16S-23S rDNA intergenic spacer region. The evaluated strains were separated in two groups, defined at 56% of similarity. Brachiaria spp. showed effects on strain diversity. Most part of the isolates from B. decumbens and B. brizantha are inserted in the first group, while B. humidicola isolates concentrate in the second group.
-
Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB
Energy Technology Data Exchange (ETDEWEB)
DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.
2006-02-01
A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.
-
Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J
A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased
-
Hashavya, S; Gross, I; Michael-Gayego, A; Simanovsky, N; Lamdan, R
2018-04-01
Musculoskeletal infections are among the most common bacterial infections in children leading to hospitalization, invasive procedures and prolonged antibiotic administration. Blood, synovial and sometimes tissue cultures are essential for the diagnosis and treatment of musculoskeletal infections; 16S ribosomal DNA (rDNA) sequencing is a novel diagnostic tool for the detection of bacteria.While the yield of 16S rDNA sequencing in synovial fluid was previously assessed, data regarding the efficacy of this method from blood samples or partially treated children with suspected musculoskeletal infections is lacking.In this study we assessed the yield of 16S rDNA sequencing in blood, bone and synovial samples of children with musculoskeletal infections. Blood, synovial and bone samples were collected from children with suspected musculoskeletal infections and analyzed for the presence of 16S rDNA, the results were then compared with the benchmark microbial cultures. During the study period, 41 children (18 boys and 23 girls) with suspected acute musculoskeletal infection were enrolled. A positive blood culture was found in 6/31 cases (19.4%) with methicillin-susceptible Staphylococcus aureus being the most commonly isolated bacterium. No significant 16S rDNA detection in blood samples was recorded.Synovial fluid culture was positive in 6/28 samples (21%), Kingella kingae being the most common pathogen. When using the 16S rDNA sequencing method, the rate of positive results in synovial fluid was higher with bacterial detection in 12/23 (52%) samples. The 16S rDNA sequencing method was also able to identify pathogens in samples taken from partially treated children where cultures were negative with 16S rDNA detection in 5/5 samples. Although 16S rDNA sequencing may increase the yield of bacterial detection in synovial samples of patients with musculoskeletal infections, there is no benefit from applying this method on blood samples. The 16S rDNA sequencing method may be
-
Cibik, R; Lepage, E; Talliez, P
2000-06-01
For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.
-
Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K
1999-03-01
Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.
-
Directory of Open Access Journals (Sweden)
Antonio Jesús Serrato
2018-04-01
Full Text Available Redox regulation is of great importance in chloroplasts. Many chloroplast enzymes, such as those belonging to the Calvin-Benson cycle (CBC, have conserved regulatory cysteines which form inhibitory disulphide bridges when physiological conditions become unfavourable. Amongst these enzymes, cFBP1, the CBC fructose-1,6-bisphosphatase (FBPase isoform, is well known to be redox activated by thioredoxin f through the reduction of a disulphide bridge involving Cys153 and Cys173. Moreover, data obtained during recent years point to S-nitrosylation as another redox post-translational modification putatively regulating an increasing number of plant enzymes, including cFBP1. In this study we have shown that the Pisum sativum cFBP1 can be efficiently S-nitrosylated by GSNO and SNAP, triggering the formation of the regulatory disulphide. Using in vivo experiments with P. sativum we have established that cFBP1 S-nitrosylation only occurs during the light period and we have elucidated by activity assays with Cys-to-Ser mutants that this enzyme may be inactivated through the S-nitrosylation of Cys153. Finally, in the light of the new data, we have proposed an extended redox-regulation model by integrating the S-nitrosylation and the TRX f-mediated regulation of cFBP1. Keywords: S-nitrosylation, GSNO, Redox regulation, Fructose-1,6-bisphosphatase, Pisum sativum, Calvin-Benson cycle
-
Drago, Lorenzo; De Vecchi, Elena; Toscano, Marco; Vassena, Christian; Altomare, Gianfranco; Pigatto, Paolo
2014-01-01
To evaluate the efficacy of a highly concentrated Lactobacillus salivarius preparation containing a gelling complex formed by Streptococcus thermophilus ST10 and tara gum in the treatment of atopic dermatitis (AD). Previous studies have demonstrated an improvement in AD symptoms after administration of the probiotic strain L. salivarius LS01. S. thermophilus ST10 and tara gum create a gelling complex that adheres to intestinal mucus and improves barrier function. A prospective, controlled pilot trial was carried out to evaluate how the association of S. thermophilus ST10 and tara gum could improve the activity of L. salivarius LS01 administered at high doses to adults with AD. Twenty-five patients were included into the study: 13 were treated for 1 month with the active formulation, whereas 12 represented the placebo group. Scoring Atopic Dermatitis index was determined before and at the end of probiotic administration. Fecal samples were also collected to evaluate changes in bacterial counts of Staphylococcus aureus and clostridia. A significant improvement in SCORAD index was observed in the probiotic group after 1 month of treatment, whereas no significant changes occurred in placebo patients. A slight decrease in fecal S. aureus count was observed in probiotic-treated patients. Data obtained in this study suggest a potential role for L. salivarius LS01 in the treatment of AD. The addition of tara gum and S. thermophilus ST10 seems to improve the overall efficacy of the probiotic strain, in particular shortening the time required for the onset of the positive effects. Further studies to investigate the activity of this preparation are advisable.
-
The 16S rRNA and gyrB genes of 22 Streptomyces species belonging to the Streptomyces griseus cluster were sequenced, and their taxonomic positions were re-evaluated. For correct analysis, all of the publicly available sequences of the species were collected and compared with those obtained in this s...
-
Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...
-
Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions
International Nuclear Information System (INIS)
Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia
2013-01-01
16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.
-
2018-01-01
The inclusive $\\Upsilon$ production in p-Pb interactions at the centre-of-mass energy per nucleon-nucleon collision $\\sqrt{s_{\\rm NN}} = 8.16$ TeV is studied with the ALICE detector at the CERN LHC. The measurement has been performed reconstructing $\\Upsilon$(1S) and $\\Upsilon$(2S) mesons via their dimuon decay channel, in the centre-of-mass rapidities $2.03 < y_{\\rm cms} < 3.53$ and $-4.46 < y_{\\rm cms} < -2.96$, down to zero transverse momentum. Preliminary results on the inclusive $\\Upsilon$(1S) nuclear modification factors ($R_{\\rm pPb}$) as a function of rapidity, transverse momentum ($p_{\\rm T}$) and centrality of the collisions will be presented. The results will be compared with those obtained by ALICE in p-Pb collisions at $\\sqrt{s_{\\rm NN}} = 8.16$ TeV and with theoretical model calculations. The inclusive $\\Upsilon$(2S) $R_{\\rm pPb}$ will also be discussed and compared to the corresponding $\\Upsilon(1S)$ measurement.
-
Directory of Open Access Journals (Sweden)
Shafipour1, M.
2014-11-01
Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.
-
PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor
Directory of Open Access Journals (Sweden)
Leyla Esfandiari
2016-07-01
Full Text Available A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.
-
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
-
Lysogeny and mechanisms fagorresistencia native lactic bacteria present in wild and commercial
Maciel, Natalia Elisabet; Maciel, Natalia Elisabet
2012-01-01
El objetivo de esta tesis fue ampliar el conocimiento sobre la interacción entre bacterias lácticas (BAL) constituyentes de fermentos lácticos con sus fagos específicos. Se estudió la difusión de la fagorresistencia de cepas autóctonas de Streptococcus thermophilus y Lactococcus lactis frente a fagos autóctonos. Además se verificaron los mecanismos de fagorresistencia dominantes para cada especie. Las cepas salvajes de Streptococcus thermophilus estudiadas, en su mayoría, mostraron una elevad...
-
Arfken, Ann M; Song, Bongkeun; Mallin, Michael A
2015-09-01
Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.
-
Directory of Open Access Journals (Sweden)
Hideyuki Tamaki
Full Text Available BACKGROUND: 16S rRNA gene pyrosequencing approach has revolutionized studies in microbial ecology. While primer selection and short read length can affect the resulting microbial community profile, little is known about the influence of pyrosequencing methods on the sequencing throughput and the outcome of microbial community analyses. The aim of this study is to compare differences in output, ease, and cost among three different amplicon pyrosequencing methods for the Roche/454 Titanium platform METHODOLOGY/PRINCIPAL FINDINGS: The following three pyrosequencing methods for 16S rRNA genes were selected in this study: Method-1 (standard method is the recommended method for bi-directional sequencing using the LIB-A kit; Method-2 is a new option designed in this study for unidirectional sequencing with the LIB-A kit; and Method-3 uses the LIB-L kit for unidirectional sequencing. In our comparison among these three methods using 10 different environmental samples, Method-2 and Method-3 produced 1.5-1.6 times more useable reads than the standard method (Method-1, after quality-based trimming, and did not compromise the outcome of microbial community analyses. Specifically, Method-3 is the most cost-effective unidirectional amplicon sequencing method as it provided the most reads and required the least effort in consumables management. CONCLUSIONS: Our findings clearly demonstrated that alternative pyrosequencing methods for 16S rRNA genes could drastically affect sequencing output (e.g. number of reads before and after trimming but have little effect on the outcomes of microbial community analysis. This finding is important for both researchers and sequencing facilities utilizing 16S rRNA gene pyrosequencing for microbial ecological studies.
-
Accuracy of taxonomy prediction for 16S rRNA and fungal ITS sequences
Directory of Open Access Journals (Sweden)
Robert C. Edgar
2018-04-01
Full Text Available Prediction of taxonomy for marker gene sequences such as 16S ribosomal RNA (rRNA is a fundamental task in microbiology. Most experimentally observed sequences are diverged from reference sequences of authoritatively named organisms, creating a challenge for prediction methods. I assessed the accuracy of several algorithms using cross-validation by identity, a new benchmark strategy which explicitly models the variation in distances between query sequences and the closest entry in a reference database. When the accuracy of genus predictions was averaged over a representative range of identities with the reference database (100%, 99%, 97%, 95% and 90%, all tested methods had ≤50% accuracy on the currently-popular V4 region of 16S rRNA. Accuracy was found to fall rapidly with identity; for example, better methods were found to have V4 genus prediction accuracy of ∼100% at 100% identity but ∼50% at 97% identity. The relationship between identity and taxonomy was quantified as the probability that a rank is the lowest shared by a pair of sequences with a given pair-wise identity. With the V4 region, 95% identity was found to be a twilight zone where taxonomy is highly ambiguous because the probabilities that the lowest shared rank between pairs of sequences is genus, family, order or class are approximately equal.
-
A Web-Hosted R Workflow to Simplify and Automate the Analysis of 16S NGS Data
Next-Generation Sequencing (NGS) produces large data sets that include tens-of-thousands of sequence reads per sample. For analysis of bacterial diversity, 16S NGS sequences are typically analyzed in a workflow that containing best-of-breed bioinformatics packages that may levera...
-
DEFF Research Database (Denmark)
Kirkegaard, Rasmus Hansen; McIlroy, Simon Jon; Larsen, Poul
A reliable and reproducible method for identification and quantification of the microorganisms involved in biogas production is important for the study and understanding of the microbial communities responsible for the function of anaerobic digester systems. DNA based identification using 16S rRN...
-
DEFF Research Database (Denmark)
Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa
2010-01-01
A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...
-
The role of bacterial antizyme: From an inhibitory protein to AtoC transcriptional regulator
Directory of Open Access Journals (Sweden)
Kyriakidis Dimitrios A
2004-06-01
Full Text Available Abstract This review considers the role of bacterial antizyme in the regulation of polyamine biosynthesis and gives new perspectives on the involvement of antizyme in other significant cellular mechanisms. Antizyme is a protein molecule induced by the end product of the enzymic reaction that it inhibits, in a non-competitive manner. The bacterial ornithine decarboxylase is regulated by nucleotides, phosphorylation and antizyme. The inhibition of ornithine decarboxylase by antizyme can be relieved to different degrees by DNA or by a variety of synthetic nucleic acid polymers, attributed to a specific interaction between nucleic acid and antizyme. Recently, this interplay between bacterial antizyme and nucleic acid was determined by discerning an additional function to antizyme that proved to be the atoC gene product, encoding the response regulator of the bacterial two-component system AtoS-AtoC. The gene located just upstream of atoC encodes the sensor kinase, named AtoS, that modulates AtoC activity. AtoC regulates expression of atoDAEB operon which is involved in short-chain fatty acid metabolism. Antizyme is thus referred to as AtoC, functioning both as a post-translational and transcriptional regulator. Also, the AtoS-AtoC signal transduction system in E. coli has a positive regulatory role on poly-(R-3-hydroxybutyrate biosynthesis. The properties and gene structural similarities of antizymes from different organisms were compared. It was revealed that conserved domains are present mostly in the C-domain of all antizymes. BLAST analysis of the E. coli antizyme protein (AtoC showed similarities around 69–58% among proteobacteria, g-proteobacteria, enterobacteria and the thermophilic bacterium Thermus thermophilus. A working hypothesis is proposed for the metabolic role of antizyme (AtoC describing the significant biological implications of this protein molecule. Whether antizymes exist to other enzymes in different tissues, meeting the
-
Góes, Andrea Carla de Souza; Silva, Dayse Aparecida da; Gil, Érica Helena Fonseca; Silva, Márcia Teixeira Desidério; Pereira, Rinaldo Wellerson; Carvalho, Elizeu Fagundes de
2004-01-01
Allele frequencies for 16 short tandem repeats (STR) loci were determined with a sample of 230–300 unrelated individuals from the population of Rio de Janeiro, Brazil. The loci are the most commonly used in forensic and paternity testing, being analysed by the Identifiler (Applied Biosystems) and PowerPlex 2.1 (Promega) commercial kits. It was proved that Penta E and D18S51 are the most polymorphic loci.
-
Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X
2008-06-01
Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.
-
Ritari, Jarmo; Salojärvi, Jarkko; Lahti, Leo; Vos, de Willem M.
2015-01-01
Background: Current sequencing technology enables taxonomic profiling of microbial ecosystems at high resolution and depth by using the 16S rRNA gene as a phylogenetic marker. Taxonomic assignation of newly acquired data is based on sequence comparisons with comprehensive reference databases to
-
Directory of Open Access Journals (Sweden)
Eni Kusrini
2016-11-01
Full Text Available Penelitian ini dilakukan untuk mengetahui hubungan kekerabatan stok udang jerbung Indonesia sebagai informasi dasar bagi program pemuliaan. Udang jerbung uji berasal dari Pantai Bengkulu, Selat Sunda (Banten, Pantai Cilacap (Jawa Tengah, Selat Lombok (NTB, dan Pontianak (Kalimantan Barat. Amplifikasi PCR dan sekuensing daerah 16S-rRNA DNA mitokondria dilakukan menggunakan primer 5’-CGCCTGTTTAAC-AAAAACAT-3’ dan 5’-CCGGTCTGAACTCAGATCATGT-3’. Hasil analisis homologi susunan nukleotida 16S-rRNA DNA mitokondria menunjukkan bahwa udang jerbung yang digunakan dalam penelitian merupakan Fenneropenaeus merguiensis. Hasil analisis kekerabatan menunjukkan bahwa 5 populasi udang jerbung uji dapat dibagi menjadi 2 kelompok besar, yaitu kelompok Kalimantan Barat dan kelompok Bengkulu-Banten-Jawa Tengah-NTB. Populasi udang jerbung Kalimantan dan Bengkulu masing-masing memiliki sekuens spesifik, yaitu ACTGACT dan C-GAC di terminal 5. Sekuens tersebut mungkin dapat digunakan sebagai penanda dalam program pemuliaan udang jerbung Indonesia. The experiment was conducted to understand the family relationship of banana prawn in Indonesia and to provide basic information for breeding program. Prawns were obtained from Bengkulu Coast, Sunda Strait (Banten, Cilacap Coast (Central Java, Lombok Strait (West Nusa Tenggara, Pontianak Coast (West Kalimantan. PCR amplification and sequencing of 16S-rRNA mitochondrial DNA region were performed using 5’-CGCCTGTTTAAC-AAAAACAT-3’ and 5’-CCGGTCTGAACTCAGATCATGT-3’. Analysis of homology sequences of 16S-rRNA mtDNA showed that banana prawn used in this study was Fenneropenaeus merguiensis. Result of family relationship analysis indicated that five populations of banana prawn can be divided into two groups, i.e. West Kalimantan and Bengkulu-Banten-Central Java-NTB groups. Banana prawns from West Kalimantan and Bengkulu have specific sequences at 5’ terminal, ACTGACT and C-GAC, respectively. Those sequences can
-
International Nuclear Information System (INIS)
Tan Jianguo; Soderlund, David M.
2010-01-01
We expressed rat Na v 1.6 sodium channels in combination with the rat β 1 and β 2 auxiliary subunits in Xenopus laevis oocytes and evaluated the effects of the pyrethroid insecticides S-bioallethrin, deltamethrin, and tefluthrin on expressed sodium currents using the two-electrode voltage clamp technique. S-Bioallethrin, a type I structure, produced transient modification evident in the induction of rapidly decaying sodium tail currents, weak resting modification (5.7% modification at 100 μM), and no further enhancement of modification upon repetitive activation by high-frequency trains of depolarizing pulses. By contrast deltamethrin, a type II structure, produced sodium tail currents that were ∼ 9-fold more persistent than those caused by S-bioallethrin, barely detectable resting modification (2.5% modification at 100 μM), and 3.7-fold enhancement of modification upon repetitive activation. Tefluthrin, a type I structure with high mammalian toxicity, exhibited properties intermediate between S-bioallethrin and deltamethrin: intermediate tail current decay kinetics, much greater resting modification (14.1% at 100 μM), and 2.8-fold enhancement of resting modification upon repetitive activation. Comparison of concentration-effect data showed that repetitive depolarization increased the potency of tefluthrin ∼ 15-fold and that tefluthrin was ∼ 10-fold more potent than deltamethrin as a use-dependent modifier of Na v 1.6 sodium channels. Concentration-effect data from parallel experiments with the rat Na v 1.2 sodium channel coexpressed with the rat β 1 and β 2 subunits in oocytes showed that the Na v 1.6 isoform was at least 15-fold more sensitive to tefluthrin and deltamethrin than the Na v 1.2 isoform. These results implicate sodium channels containing the Na v 1.6 isoform as potential targets for the central neurotoxic effects of pyrethroids.
-
Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes
2016-03-01
Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.
-
Directory of Open Access Journals (Sweden)
Muhammad Naveed
2014-09-01
Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.
-
25 Tb/s transmission over 5,530 km using 16QAM at 5.2 b/s/Hz spectral efficiency.
Cai, J-X; Batshon, H G; Zhang, H; Davidson, C R; Sun, Y; Mazurczyk, M; Foursa, D G; Sinkin, O; Pilipetskii, A; Mohs, G; Bergano, Neal S
2013-01-28
We transmit 250x100G PDM RZ-16QAM channels with 5.2 b/s/Hz spectral efficiency over 5,530 km using single-stage C-band EDFAs equalized to 40 nm. We use single parity check coded modulation and all channels are decoded with no errors after iterative decoding between a MAP decoder and an LDPC based FEC algorithm. We also observe that the optimum power spectral density is nearly independent of SE, signal baud rate or modulation format in a dispersion uncompensated system.
-
International Nuclear Information System (INIS)
Wei-hsing, M.; Si-wen, W.; Gao-you, Z.; Chung-Kuang, C.; Zhen-rong, Y.; Shu-ping, Z.
1986-01-01
We proposed six possible reason exchange current mechanism for pion induced non-analog double charge exchange transition on /sup 12/C(π/sup +/, π/sup -/)/sup 12/O(g.s.) and /sup 16/O(π/sup +/, π/sup -/)/sup 16/N/sub e/(g.s.). Under the model, the authors calculated 164 MeV angular distribution. The theoretical results are compared with the existed data and are in a good agreement with the experimental data available. It strongly indicates that the non-analog DCX process is basically a diffractive process through double isobar excitation on a single nucleon and the dominant contribution to the process comes from one of the six diagrams, that is a π/sup +/ collides with a neutron to excite this neutron into an isobar Δ(1232) with charge of one unit; subsequently, the Δ/sup +/ decays to give π/sup +/Δ/sup o/ and then produced π/sup +/ is absorbed by the second target neutron which will be then turned to a proton. Meanwhile the traveling Δ/sup o/ finally decays into π/sup -/P so that the course of the process under consideration here is ended
-
Adaptive QoS provision for IEEE 802.16e BWA networks based on cross-layer design
Directory of Open Access Journals (Sweden)
Kuo GS
2011-01-01
Full Text Available Abstract This article proposes an integrated framework for adaptive QoS provision in IEEE 802.16e broadband wireless access networks based on cross-layer design. On one hand, an efficient admission control (AC algorithm is proposed along with a semi-reservation scheme to guarantee the connection-level QoS. First, to guarantee the service continuity for handoff connections and resource efficiency, our semi-reservation scheme considers both users' handoff probability and average resource consumption together, which effectively avoids resource over-reservation and insufficient reservation. For AC, a new/handoff connection is accepted only when the target cell has enough resource to afford both instantaneous and average resource consumption to meet the average source rate request. On the other hand, a joint resource allocation and packet scheduling scheme is designed to provide packet-level QoS guarantee in term of "QoS rate", which can ensure fairness for the services with identical priority level in case of bandwidth shortage. Particularly, an enhanced bandwidth request scheme is designed to reduce unnecessary BR delay and redundant signaling overhead caused by the existing one in IEEE 802.16e, which further improves the packet-level QoS performance and resource efficiency for uplink transmission. Simulation results show that the proposed approach not only balances the tradeoff among connection blocking rate, connection dropping rate, and connection failure rate, but also achieves low mean packet dropping rate (PDR, small deviation of PDR, and low QoS outage rate. Moreover, high resource efficiency is ensured.
-
Wang, Yong
2009-10-09
Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.
-
Mundus, D; Wollenzien, P
1998-01-01
Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was...
-
Directory of Open Access Journals (Sweden)
Zhang Xue-qing
2010-06-01
Full Text Available Abstract Background Recently, production of 16S rRNA methylases by Gram-negative bacilli has emerged as a novel mechanism for high-level resistance to aminoglycosides by these organisms in a variety of geographic locations. Therefore, the spread of high-level aminoglycoside resistance determinants has become a great concern. Methods Between January 2006 and July 2008, 680 distinct Escherichia coli clinical isolates were collected from a teaching hospital in Wenzhou, China. PCR and DNA sequencing were used to identify 16S rRNA methylase and extended-spectrum β-lactamase (ESBL genes, including armA and rmtB, and in situ hybridization was performed to determine the location of 16S rRNA methylase genes. Conjugation experiments were subsequently performed to determine whether aminoglycoside resistance was transferable from the E. coli isolates via 16S rRNA methylase-bearing plasmids. Homology of the isolates harboring 16S rRNA methylase genes was determined using pulse-field gel electrophoresis (PFGE. Results Among the 680 E. coli isolates, 357 (52.5%, 346 (50.9% and 44 (6.5% isolates were resistant to gentamicin, tobramycin and amikacin, respectively. Thirty-seven of 44 amikacin-resistant isolates harbored 16S rRNA methylase genes, with 36 of 37 harboring the rmtB gene and only one harboring armA. The positive rates of 16S rRNA methylase genes among all isolates and amikacin-resistant isolates were 5.4% (37/680 and 84.1% (37/44, respectively. Thirty-one isolates harboring 16S rRNA methylase genes also produced ESBLs. In addition, high-level aminoglycoside resistance could be transferred by conjugation from four rmtB-positive donors. The plasmids of incompatibility groups IncF, IncK and IncN were detected in 34, 3 and 3 isolates, respectively. Upstream regions of the armA gene contained ISCR1 and tnpU, the latter a putative transposase gene,. Another putative transposase gene, tnpD, was located within a region downstream of armA. Moreover, a
-
Directory of Open Access Journals (Sweden)
Rhoads Daniel D
2012-11-01
Full Text Available Abstract Background Chronic wounds affect millions of people and cost billions of dollars in the United States each year. These wounds harbor polymicrobial biofilm communities, which can be difficult to elucidate using culturing methods. Clinical molecular microbiological methods are increasingly being employed to investigate the microbiota of chronic infections, including wounds, as part of standard patient care. However, molecular testing is more sensitive than culturing, which results in markedly different results being reported to clinicians. This study compares the results of aerobic culturing and molecular testing (culture-free 16S ribosomal DNA sequencing, and it examines the relative abundance score that is generated by the molecular test and the usefulness of the relative abundance score in predicting the likelihood that the same organism would be detected by culture. Methods Parallel samples from 51 chronic wounds were studied using aerobic culturing and 16S DNA sequencing for the identification of bacteria. Results One hundred forty-five (145 unique genera were identified using molecular methods, and 68 of these genera were aerotolerant. Fourteen (14 unique genera were identified using aerobic culture methods. One-third (31/92 of the cultures were determined to be Staphylococcus aureus, Pseudomonas aeruginosa, and Enterococcus faecalis with higher relative abundance scores were more likely to be detected by culture as demonstrated with regression modeling. Conclusion Discordance between molecular and culture testing is often observed. However, culture-free 16S ribosomal DNA sequencing and its relative abundance score can provide clinicians with insight into which bacteria are most abundant in a sample and which are most likely to be detected by culture.
-
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
-
Ennahar, Saïd; Cai, Yimin; Fujita, Yasuhito
2003-01-01
A total of 161 low-G+C-content gram-positive bacteria isolated from whole-crop paddy rice silage were classified and subjected to phenotypic and genetic analyses. Based on morphological and biochemical characters, these presumptive lactic acid bacterium (LAB) isolates were divided into 10 groups that included members of the genera Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, and WEISSELLA: Analysis of the 16S ribosomal DNA (rDNA) was used to confirm the presence of the predominant groups indicated by phenotypic analysis and to determine the phylogenetic affiliation of representative strains. The virtually complete 16S rRNA gene was PCR amplified and sequenced. The sequences from the various LAB isolates showed high degrees of similarity to those of the GenBank reference strains (between 98.7 and 99.8%). Phylogenetic trees based on the 16S rDNA sequence displayed high consistency, with nodes supported by high bootstrap values. With the exception of one species, the genetic data was in agreement with the phenotypic identification. The prevalent LAB, predominantly homofermentative (66%), consisted of Lactobacillus plantarum (24%), Lactococcus lactis (22%), Leuconostoc pseudomesenteroides (20%), Pediococcus acidilactici (11%), Lactobacillus brevis (11%), Enterococcus faecalis (7%), Weissella kimchii (3%), and Pediococcus pentosaceus (2%). The present study, the first to fully document rice-associated LAB, showed a very diverse community of LAB with a relatively high number of species involved in the fermentation process of paddy rice silage. The comprehensive 16S rDNA-based approach to describing LAB community structure was valuable in revealing the large diversity of bacteria inhabiting paddy rice silage and enabling the future design of appropriate inoculants aimed at improving its fermentation quality.
-
DEFF Research Database (Denmark)
Hartmeyer, Gitte N; Justesen, Ulrik S
2010-01-01
Two cases involving polymicrobial culture-negative samples were investigated by 16S rRNA gene sequencing, with analysis of mixed chromatograms. Fusobacterium necrophorum, Prevotella intermedia and Streptococcus constellatus were identified from pleural fluid in a patient with Lemierre's syndrome...
-
Johnston, Dayle; Earley, Bernadette; Cormican, Paul; Murray, Gerard; Kenny, David Anthony; Waters, Sinead Mary; McGee, Mark; Kelly, Alan Kieran; McCabe, Matthew Sean
2017-05-02
Bovine respiratory disease (BRD) is caused by growth of single or multiple species of pathogenic bacteria in lung tissue following stress and/or viral infection. Next generation sequencing of 16S ribosomal RNA gene PCR amplicons (NGS 16S amplicon analysis) is a powerful culture-independent open reference method that has recently been used to increase understanding of BRD-associated bacteria in the upper respiratory tract of BRD cattle. However, it has not yet been used to examine the microbiome of the bovine lower respiratory tract. The objective of this study was to use NGS 16S amplicon analysis to identify bacteria in post-mortem lung and lymph node tissue samples harvested from fatal BRD cases and clinically healthy animals. Cranial lobe and corresponding mediastinal lymph node post-mortem tissue samples were collected from calves diagnosed as BRD cases by veterinary laboratory pathologists and from clinically healthy calves. NGS 16S amplicon libraries, targeting the V3-V4 region of the bacterial 16S rRNA gene were prepared and sequenced on an Illumina MiSeq. Quantitative insights into microbial ecology (QIIME) was used to determine operational taxonomic units (OTUs) which corresponded to the 16S rRNA gene sequences. Leptotrichiaceae, Mycoplasma, Pasteurellaceae, and Fusobacterium were the most abundant OTUs identified in the lungs and lymph nodes of the calves which died from BRD. Leptotrichiaceae, Fusobacterium, Mycoplasma, Trueperella and Bacteroides had greater relative abundances in post-mortem lung samples collected from fatal cases of BRD in dairy calves, compared with clinically healthy calves without lung lesions. Leptotrichiaceae, Mycoplasma and Pasteurellaceae showed higher relative abundances in post-mortem lymph node samples collected from fatal cases of BRD in dairy calves, compared with clinically healthy calves without lung lesions. Two Leptotrichiaceae sequence contigs were subsequently assembled from bacterial DNA-enriched shotgun sequences
-
Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy
2005-03-01
Chloroplast metabolism is rapidly affected by salt stress. Photosynthesis is one of the first processes known to be affected by salinity. Here, we report that salinity inhibits chloroplast post-transcriptional RNA processing. A differentially expressed 680-bp cDNA, containing the 3' sequence of 16S rRNA, transcribed intergenic spacer, exon 1 and intron of tRNA(Ile), was isolated by differential display reverse transcriptase PCR from salt-grown jojoba (Simmondsia chinesis) shoot cultures. Northern blot analysis indicated that although most rRNA appears to be fully processed, partially processed chloroplast 16S rRNA accumulates in salt-grown cultures. Thus, salinity appears to decrease the processing of the rrn transcript. The possible effect of this decreased processing on physiological processes is, as yet, unknown.
-
Kinoshita, Yuta; Niwa, Hidekazu; Katayama, Yoshinari; Hariu, Kazuhisa
2014-04-01
Obligate anaerobes are important etiological agents in pneumonia or pleuropneumonia in horses, because they are isolated more commonly from ill horses that have died or been euthanized than from those that survive. We performed bacterial identification and antimicrobial susceptibility testing for obligate anaerobes to establish effective antimicrobial therapy. We used 16S rRNA gene sequencing to identify 58 obligate anaerobes and compared the results with those from a phenotypic identification kit. The identification results of 16S rRNA gene sequencing were more reliable than those of the commercial kit. We concluded that genera Bacteroides and Prevotella-especially B. fragilis and P. heparinolytica-are dominant anaerobes in lower respiratory tract infection in horses; these organisms were susceptible to metronidazole, imipenem and clindamycin.
-
DEFF Research Database (Denmark)
Larsen, Lone Heimann; Khalid, Vesal; Xu, Yijuan
2018-01-01
Prosthetic joint failure is mainly caused by infection, aseptic failure (AF), and mechanical problems. Infection detection has been improved with modified culture methods and molecular diagnostics. However, comparisons between modified and conventional microbiology methods are difficult due...... to variations in specimen sampling. In this prospective, multidisciplinary study of hip or knee prosthetic failures, we assessed the contributions of different specimen types, extended culture incubations, and 16S rRNA sequencing for diagnosing prosthetic joint infections (PJI). Project specimens included joint...... fluid (JF), bone biopsy specimens (BB), soft-tissue biopsy specimens (STB), and swabs (SW) from the prosthesis, collected in situ, and sonication fluid collected from prosthetic components (PC). Specimens were cultured for 6 (conventional) or 14 days, and 16S rRNA sequencing was performed at study...
-
Bogovič Matijašić, Bojana; Obermajer, Tanja; Lipoglavšek, Luka; Sernel, Tjaša; Locatelli, Igor; Kos, Mitja; Šmid, Alenka; Rogelj, Irena
2016-07-01
We conducted a randomized double-blind, placebo-controlled multicentric study to investigate the influence of a synbiotic fermented milk on the fecal microbiota composition of 30 adults with irritable bowel syndrome (IBS). The synbiotic product contained Lactobacillus acidophilus La-5, Bifidobacterium animalis ssp. lactis BB-12, Streptococcus thermophilus, and dietary fiber (90% inulin, 10% oligofructose), and a heat-treated fermented milk without probiotic bacteria or dietary fiber served as placebo. Stool samples were collected after a run-in period, a 4-wk consumption period, and a 1-wk follow-up period, and were subjected to real-time PCR and 16S rDNA profiling by next-generation sequencing. After 4wk of synbiotic (11 subjects) or placebo (19 subjects) consumption, a greater increase in DNA specific for L. acidophilus La-5 and Bifidobacterium animalis ssp. lactis was detected in the feces of the synbiotic group compared with the placebo group by quantitative real-time PCR. After 1wk of follow-up, the content of L. acidophilus La-5 and B. animalis ssp. lactis decreased to levels close to initial levels. No significant changes with time or differences between the groups were observed for Lactobacillus, Enterobacteriaceae, Bifidobacterium, or all bacteria. The presence of viable BB-12- and La-5-like bacteria in the feces resulting from the intake of synbiotic product was confirmed by random amplification of polymorphic DNA (RAPD)-PCR. At the end of consumption period, the feces of all subjects assigned to the synbiotic group contained viable bacteria with a BB-12-like RAPD profile, and after 1wk of follow-up, BB-12-like bacteria remained in the feces of 87.5% of these subjects. The presence of La-5-like colonies was observed less frequently (37.5 and 25% of subjects, respectively). Next-generation sequencing of 16S rDNA amplicons revealed that only the percentage of sequences assigned to Strep. thermophilus was temporarily increased in both groups, whereas the