WorldWideScience

Sample records for thermus caldophilus gk24

  1. Crystallization of ribosomes from Thermus thermophilus

    International Nuclear Information System (INIS)

    Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.

    1987-01-01

    An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter

  2. Rhamnolipid-producing thermophilic bacteria of species Thermus and Meiothermus

    Czech Academy of Sciences Publication Activity Database

    Řezanka, Tomáš; Siřišťová, L.; Sigler, Karel

    2011-01-01

    Roč. 15, č. 6 (2011), s. 697-709 ISSN 1431-0651 R&D Projects: GA ČR(CZ) GAP503/11/0215 Institutional research plan: CEZ:AV0Z50200510 Keywords : Thermus sp * T. aquaticus * Meiothermus ruber Subject RIV: EE - Microbiology, Virology Impact factor: 2.941, year: 2011

  3. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    OpenAIRE

    Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...

  4. Properties of Thermus ruber Strains Isolated from Icelandic Hot Springs and DNA:DNA Homology of Thermus ruber and Thermus aquaticus

    Science.gov (United States)

    Sharp, Richard J.; Williams, Ralph A. D.

    1988-01-01

    Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714

  5. Complete Genome Analysis of Thermus parvatiensis and Comparative Genomics of Thermus spp. Provide Insights into Genetic Variability and Evolution of Natural Competence as Strategic Survival Attributes

    Directory of Open Access Journals (Sweden)

    Charu Tripathi

    2017-07-01

    Full Text Available Thermophilic environments represent an interesting niche. Among thermophiles, the genus Thermus is among the most studied genera. In this study, we have sequenced the genome of Thermus parvatiensis strain RL, a thermophile isolated from Himalayan hot water springs (temperature >96°C using PacBio RSII SMRT technique. The small genome (2.01 Mbp comprises a chromosome (1.87 Mbp and a plasmid (143 Kbp, designated in this study as pTP143. Annotation revealed a high number of repair genes, a squeezed genome but containing highly plastic plasmid with transposases, integrases, mobile elements and hypothetical proteins (44%. We performed a comparative genomic study of the group Thermus with an aim of analysing the phylogenetic relatedness as well as niche specific attributes prevalent among the group. We compared the reference genome RL with 16 Thermus genomes to assess their phylogenetic relationships based on 16S rRNA gene sequences, average nucleotide identity (ANI, conserved marker genes (31 and 400, pan genome and tetranucleotide frequency. The core genome of the analyzed genomes contained 1,177 core genes and many singleton genes were detected in individual genomes, reflecting a conserved core but adaptive pan repertoire. We demonstrated the presence of metagenomic islands (chromosome:5, plasmid:5 by recruiting raw metagenomic data (from the same niche against the genomic replicons of T. parvatiensis. We also dissected the CRISPR loci wide all genomes and found widespread presence of this system across Thermus genomes. Additionally, we performed a comparative analysis of competence loci wide Thermus genomes and found evidence for recent horizontal acquisition of the locus and continued dispersal among members reflecting that natural competence is a beneficial survival trait among Thermus members and its acquisition depicts unending evolution in order to accomplish optimal fitness.

  6. Sequence of the hyperplastic genome of the naturally competent Thermus scotoductus SA-01

    Directory of Open Access Journals (Sweden)

    Gounder Kamini

    2011-11-01

    Full Text Available Abstract Background Many strains of Thermus have been isolated from hot environments around the world. Thermus scotoductus SA-01 was isolated from fissure water collected 3.2 km below surface in a South African gold mine. The isolate is capable of dissimilatory iron reduction, growth with oxygen and nitrate as terminal electron acceptors and the ability to reduce a variety of metal ions, including gold, chromate and uranium, was demonstrated. The genomes from two different Thermus thermophilus strains have been completed. This paper represents the completed genome from a second Thermus species - T. scotoductus. Results The genome of Thermus scotoductus SA-01 consists of a chromosome of 2,346,803 bp and a small plasmid which, together are about 11% larger than the Thermus thermophilus genomes. The T. thermophilus megaplasmid genes are part of the T. scotoductus chromosome and extensive rearrangement, deletion of nonessential genes and acquisition of gene islands have occurred, leading to a loss of synteny between the chromosomes of T. scotoductus and T. thermophilus. At least nine large inserts of which seven were identified as alien, were found, the most remarkable being a denitrification cluster and two operons relating to the metabolism of phenolics which appear to have been acquired from Meiothermus ruber. The majority of acquired genes are from closely related species of the Deinococcus-Thermus group, and many of the remaining genes are from microorganisms with a thermophilic or hyperthermophilic lifestyle. The natural competence of Thermus scotoductus was confirmed experimentally as expected as most of the proteins of the natural transformation system of Thermus thermophilus are present. Analysis of the metabolic capabilities revealed an extensive energy metabolism with many aerobic and anaerobic respiratory options. An abundance of sensor histidine kinases, response regulators and transporters for a wide variety of compounds are indicative

  7. Thermus arciformis sp. nov., a thermophilic species from a geothermal area.

    Science.gov (United States)

    Zhang, Xin-Qi; Ying, Yi; Ye, Ying; Xu, Xue-Wei; Zhu, Xu-Fen; Wu, Min

    2010-04-01

    Two aerobic, Gram-negative, non-motile, non-sporulating, yellow-pigmented bacteria, strains TH92(T) and TH91, were isolated from a hot spring located in Laibin, Guangxi, in the south-eastern geothermal area of China. The isolates grew at 40-77 degrees C (optimally at 70 degrees C) and at pH 6.0-9.5 (optimally at pH 7.5-8.0). Phylogenetic analysis of 16S rRNA gene sequences and levels of DNA-DNA relatedness together indicated that the new isolates represented a novel species of the genus Thermus with closest affinity to Thermus aquaticus, Thermus igniterrae and Thermus thermophilus. Compared with their closest relatives, strains TH92( T) and TH91 were able to assimilate a wider range of carbohydrates, amino acids and organic acids as sole carbon sources for growth, such as lactose and melibiose. The new isolates had lower combined levels of C(16 : 0 ) and iso-C(16 : 0) compared with their closest relatives. On the basis of polyphasic taxonomic characterization, strains TH92(T) and TH91 are considered to represent a single novel species of the genus Thermus, for which the name Thermus arciformis sp. nov. is proposed. The type strain is TH92(T) (=CGMCC 1.6992(T) =JCM 15153(T)).

  8. Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis

    Science.gov (United States)

    Suo, Zucai

    2014-01-01

    Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550

  9. Cloning, purification and crystallization of Thermus thermophilus proline dehydrogenase

    Energy Technology Data Exchange (ETDEWEB)

    White, Tommi A.; Tanner, John J., E-mail: tannerjj@missouri.edu [Departments of Chemistry and Biochemistry, University of Missouri-Columbia, Columbia, Missouri 65211 (United States)

    2005-08-01

    Cloning, purification and crystallization of T. thermophilus proline dehydrogenase is reported. The detergent n-octyl β-d-glucopyranoside was used to reduce polydispersity, which enabled crystallization. Nature recycles l-proline by converting it to l-glutamate. This four-electron oxidation process is catalyzed by the two enzymes: proline dehydrogenase (PRODH) and Δ{sup 1}-pyrroline-5-carboxylate dehydrogenase. This note reports the cloning, purification and crystallization of Thermus thermophilus PRODH, which is the prototype of a newly discovered superfamily of bacterial monofunctional PRODHs. The results presented here include production of a monodisperse protein solution through use of the detergent n-octyl β-d-glucopyranoside and the growth of native crystals that diffracted to 2.3 Å resolution at Advanced Light Source beamline 4.2.2. The space group is P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 82.2, b = 89.6, c = 94.3 Å. The asymmetric unit is predicted to contain two protein molecules and 46% solvent. Molecular-replacement trials using a fragment of the PRODH domain of the multifunctional Escherichia coli PutA protein as the search model (24% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of T. thermophilus PRODH will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative.

  10. Cloning, purification and crystallization of Thermus thermophilus proline dehydrogenase

    International Nuclear Information System (INIS)

    White, Tommi A.; Tanner, John J.

    2005-01-01

    Cloning, purification and crystallization of T. thermophilus proline dehydrogenase is reported. The detergent n-octyl β-d-glucopyranoside was used to reduce polydispersity, which enabled crystallization. Nature recycles l-proline by converting it to l-glutamate. This four-electron oxidation process is catalyzed by the two enzymes: proline dehydrogenase (PRODH) and Δ 1 -pyrroline-5-carboxylate dehydrogenase. This note reports the cloning, purification and crystallization of Thermus thermophilus PRODH, which is the prototype of a newly discovered superfamily of bacterial monofunctional PRODHs. The results presented here include production of a monodisperse protein solution through use of the detergent n-octyl β-d-glucopyranoside and the growth of native crystals that diffracted to 2.3 Å resolution at Advanced Light Source beamline 4.2.2. The space group is P2 1 2 1 2 1 , with unit-cell parameters a = 82.2, b = 89.6, c = 94.3 Å. The asymmetric unit is predicted to contain two protein molecules and 46% solvent. Molecular-replacement trials using a fragment of the PRODH domain of the multifunctional Escherichia coli PutA protein as the search model (24% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of T. thermophilus PRODH will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative

  11. Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

    Science.gov (United States)

    Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

    2005-10-01

    Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

  12. Comparative genomics of Thermus thermophilus and Deinococcus radiodurans: divergent routes of adaptation to thermophily and radiation resistance

    Directory of Open Access Journals (Sweden)

    Daly Michael J

    2005-10-01

    Full Text Available Abstract Background Thermus thermophilus and Deinococcus radiodurans belong to a distinct bacterial clade but have remarkably different phenotypes. T. thermophilus is a thermophile, which is relatively sensitive to ionizing radiation and desiccation, whereas D. radiodurans is a mesophile, which is highly radiation- and desiccation-resistant. Here we present an in-depth comparison of the genomes of these two related but differently adapted bacteria. Results By reconstructing the evolution of Thermus and Deinococcus after the divergence from their common ancestor, we demonstrate a high level of post-divergence gene flux in both lineages. Various aspects of the adaptation to high temperature in Thermus can be attributed to horizontal gene transfer from archaea and thermophilic bacteria; many of the horizontally transferred genes are located on the single megaplasmid of Thermus. In addition, the Thermus lineage has lost a set of genes that are still present in Deinococcus and many other mesophilic bacteria but are not common among thermophiles. By contrast, Deinococcus seems to have acquired numerous genes related to stress response systems from various bacteria. A comparison of the distribution of orthologous genes among the four partitions of the Deinococcus genome and the two partitions of the Thermus genome reveals homology between the Thermus megaplasmid (pTT27 and Deinococcus megaplasmid (DR177. Conclusion After the radiation from their common ancestor, the Thermus and Deinococcus lineages have taken divergent paths toward their distinct lifestyles. In addition to extensive gene loss, Thermus seems to have acquired numerous genes from thermophiles, which likely was the decisive contribution to its thermophilic adaptation. By contrast, Deinococcus lost few genes but seems to have acquired many bacterial genes that apparently enhanced its ability to survive different kinds of environmental stresses. Notwithstanding the accumulation of

  13. First glycoside hydrolase family 2 enzymes from Thermus antranikianii and Thermus brockianus with β-glucosidase activity

    Directory of Open Access Journals (Sweden)

    Carola eSchröder

    2015-06-01

    Full Text Available Two genes tagh2 and tbgh2 coding for enzymes with hydrolytic activity towards esculin were identified from the extreme thermophilic, aerobic bacteria Thermus antranikianii (Ta and T. brockianus (Tb. Shortened conserved domains predicted a membership of the enzymes of glycoside hydrolase (GH family 2. At present, β-galactosidase activity is found frequently in GH family 2 but β-glucosidase activity has not been reported in this family before. The enzymes TaGH2 and TbGH2 preferred hydrolysis of nitrophenol-linked β-D-glucopyranosides with specific activities of 3,966 U/mg and 660 U/mg, respectively. Residual activities of 40 % (TaGH2 and 51 % (TbGH2 towards 4-NP-β-D-galactopyranoside were observed. Furthermore, TaGH2 hydrolyzed cellobiose. TbGH2, however, showed no activity on cellobiose or lactose. The enzymes exhibited highest activity at 95 °C (TaGH2 and 90 °C (TbGH2 at pH 6.5. Both enzymes were extremely thermostable and thermal activation up to 250 % was observed at temperatures between 50 and 60 °C. Accordingly, the first thermoactive glycoside hydrolase family 2 enzymes with β glucosidase activity have been identified and characterized. The hydrolysis of cellobiose is a unique property of TaGH2 when compared to the enzymes of GH family 2.

  14. Effects of Argonaute on Gene Expression in Thermus thermophilus.

    Directory of Open Access Journals (Sweden)

    Daan C Swarts

    Full Text Available Eukaryotic Argonaute proteins mediate RNA-guided RNA interference, allowing both regulation of host gene expression and defense against invading mobile genetic elements. Recently, it has become evident that prokaryotic Argonaute homologs mediate DNA-guided DNA interference, and play a role in host defense. Argonaute of the bacterium Thermus thermophilus (TtAgo targets invading plasmid DNA during and after transformation. Using small interfering DNA guides, TtAgo can cleave single and double stranded DNAs. Although TtAgo additionally has been demonstrated to cleave RNA targets complementary to its DNA guide in vitro, RNA targeting by TtAgo has not been demonstrated in vivo.To investigate if TtAgo also has the potential to control RNA levels, we analyzed RNA-seq data derived from cultures of four T. thermophilus strain HB27 variants: wild type, TtAgo knockout (Δago, and either strain transformed with a plasmid. Additionally we determined the effect of TtAgo on expression of plasmid-encoded RNA and plasmid DNA levels.In the absence of exogenous DNA (plasmid, TtAgo presence or absence had no effect on gene expression levels. When plasmid DNA is present, TtAgo reduces plasmid DNA levels 4-fold, and a corresponding reduction of plasmid gene transcript levels was observed. We therefore conclude that TtAgo interferes with plasmid DNA, but not with plasmid-encoded RNA. Interestingly, TtAgo presence stimulates expression of specific endogenous genes, but only when exogenous plasmid DNA was present. Specifically, the presence of TtAgo directly or indirectly stimulates expression of CRISPR loci and associated genes, some of which are involved in CRISPR adaptation. This suggests that TtAgo-mediated interference with plasmid DNA stimulates CRISPR adaptation.

  15. Thermus caliditerrae sp. nov., a novel thermophilic species isolated from a geothermal area.

    Science.gov (United States)

    Ming, Hong; Yin, Yi-Rui; Li, Shuai; Nie, Guo-Xing; Yu, Tian-Tian; Zhou, En-Min; Liu, Lan; Dong, Lei; Li, Wen-Jun

    2014-02-01

    Two thermophilic bacterial strains, designated YIM 77925(T) and YIM 77777, were isolated from two hot springs, one in the Hydrothermal Explosion (Shuirebaozhaqu) area and Frog Mouth Spring in Tengchong county, Yunnan province, south-western China. The taxonomic positions of the two isolates were investigated by a polyphasic approach. Cells of the two strains were Gram-stain-negative, aerobic and rod-shaped. They were able to grow at 50-70 °C, pH 6.0-8.0 and with a NaCl tolerance up to 0.5% (w/v). Colonies are circular, convex, non-transparent and produce yellow pigment. Phylogenetic analyses based on 16S rRNA gene sequences comparison clearly demonstrated that strains YIM 77925(T) and YIM 77777 represent members of the genus Thermus, and they also detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. Their predominant menaquinone was MK-8. The genomic DNA G+C contents of strains YIM 77925(T) and YIM 77777 were 65.6 mol% and 67.2 mol%, respectively. Based on the results of physiological and biochemical tests and phylogenetic analyses, strains YIM 77925(T) and YIM 77777 could not be classified as representing any species of the genus Thermus with a validly published name. Thus the two strains are considered to represent a novel species of the genus Thermus, for which the name Thermus caliditerrae sp. nov. is proposed. The type strain is YIM 77925(T) ( = DSM 25901(T) = CCTCC 2012061(T)).

  16. Properties and crystal structure of methylenetetrahydrofolate reductase from Thermus thermophilus HB8.

    Directory of Open Access Journals (Sweden)

    Sayaka Igari

    Full Text Available Methylenetetrahydrofolate reductase (MTHFR is one of the enzymes involved in homocysteine metabolism. Despite considerable genetic and clinical attention, the reaction mechanism and regulation of this enzyme are not fully understood because of difficult production and poor stability. While recombinant enzymes from thermophilic organisms are often stable and easy to prepare, properties of thermostable MTHFRs have not yet been reported.MTHFR from Thermus thermophilus HB8, a homologue of Escherichia coli MetF, has been expressed in E. coli and purified. The purified MTHFR was chiefly obtained as a heterodimer of apo- and holo-subunits, that is, one flavin adenine dinucleotide (FAD prosthetic group bound per dimer. The crystal structure of the holo-subunit was quite similar to the β(8α(8 barrel of E. coli MTHFR, while that of the apo-subunit was a previously unobserved closed form. In addition, the intersubunit interface of the dimer in the crystals was different from any of the subunit interfaces of the tetramer of E. coli MTHFR. Free FAD could be incorporated into the apo-subunit of the purified Thermus enzyme after purification, forming a homodimer of holo-subunits. Comparison of the crystal structures of the heterodimer and the homodimer revealed different intersubunit interfaces, indicating a large conformational change upon FAD binding. Most of the biochemical properties of the heterodimer and the homodimer were the same, except that the homodimer showed ≈50% activity per FAD-bound subunit in folate-dependent reactions.The different intersubunit interfaces and rearrangement of subunits of Thermus MTHFR may be related to human enzyme properties, such as the allosteric regulation by S-adenosylmethionine and the enhanced instability of the Ala222Val mutant upon loss of FAD. Whereas E. coli MTHFR was the only structural model for human MTHFR to date, our findings suggest that Thermus MTHFR will be another useful model for this important enzyme.

  17. Thermus tengchongensis sp. nov., isolated from a geothermally heated soil sample in Tengchong, Yunnan, south-west China.

    Science.gov (United States)

    Yu, Tian-Tian; Yao, Ji-Cheng; Ming, Hong; Yin, Yi-Rui; Zhou, En-Min; Liu, Min-Jiao; Tang, Shu-Kun; Li, Wen-Jun

    2013-03-01

    A Gram-stain negative aerobic bacterium, designated YIM 77924(T), was isolated from a geothermally heated soil sample collected at Rehai National Park, Tengchong, Yunnan province, south-west China. Growth was found to occur from 55 to 75 °C (optimum 65 °C), pH 6.0-8.0 (optimum pH 7.0) and 0-1 % NaCl (w/v). Cells were observed to be rod-shaped and the colonies convex, circular, smooth, yellow and non-transparent. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain YIM 77924(T) belongs to the genus Thermus. The 16S rRNA gene sequence similarity values between strain YIM 77924(T) and other species of the genus Thermus were all below 97 %. The polar lipids of strain YIM 77924(T) were determined to be aminophospholipid, phospholipid and glycolipid. The predominant respiratory quinone was determined to be MK-8 and the G+C content was 66.64 mol%. The major fatty acids identified were iso-C(16:0), iso-C(15:0), iso-C(17:0) and C(16:0). On the basis of the morphological and chemotaxonomic characteristics as well as genotypic data, strain YIM 77924(T) is proposed to represent a novel species, Thermus tengchongensis sp. nov., in the genus Thermus. The type strain is YIM 77924(T) (=KCTC 32025(T) = CCTCC AB2012063(T)).

  18. Thermophilic amylase from Thermus sp. isolation and its potential application for bioethanol production

    Directory of Open Access Journals (Sweden)

    Amin Fatoni

    2012-11-01

    Full Text Available Limited reserves of fossil energy stimulate researchers to explore for a new alternative energy, such as bioethanol.A thermophilic amylase producing bacterium was isolated from local hot-springs and its characteristic and potential applicationfor bioethanol production was determined. The obtained amylase was studied to determine its optimum temperature, pH,enzymatic reaction time, and substrate concentration. Tapioca waste was used as the substrate to find the potential of theamylase for degrading starch into glucose, and then the process was continued by fermentation to produce bioethanol. Theamylase producer bacterium was proposed as genus Thermus sp. The crude amylase that was obtained has the optimumtemperature of 60°C and optimum pH of 8.0, optimum substrate concentration at 10% (w/w and optimum enzymatic reactiontime of 45 minutes. These enzymes convert the starches of waste tapioca at optimum conditions, with the result of 2.9%ethanol produced from raw materials.

  19. Crystallization and preliminary crystallographic analysis of a putative glucokinase/hexokinase from Thermus thermophilus

    International Nuclear Information System (INIS)

    Nakamura, Tsutomu; Kashima, Yasuhiro; Mine, Shouhei; Oku, Takashi; Uegaki, Koichi

    2011-01-01

    In this study, a putative glucokinase/hexokinase from T. thermophilus was purified and crystallized. Diffraction data were collected and processed to 2.02 Å resolution. Glucokinase/hexokinase catalyzes the phosphorylation of glucose to glucose 6-phosphate, which is the first step of glycolysis. The open reading frame TTHA0299 of the extreme thermophile Thermus thermophilus encodes a putative glucokinase/hexokinase which contains the consensus sequence for proteins from the repressors, open reading frames and sugar kinases family. In this study, the glucokinase/hexokinase from T. thermophilus was purified and crystallized using polyethylene glycol 8000 as a precipitant. Diffraction data were collected and processed to 2.02 Å resolution. The crystal belonged to space group P2 1 , with unit-cell parameters a = 70.93, b = 138.14, c = 75.16 Å, β = 95.41°

  20. Three-dimensional structure of the enzyme dimanganese catalase from thermus thermophilus at 1 A resolution

    International Nuclear Information System (INIS)

    Antonyuk, S.V.; Melik-Adamyan, V.R.; Popov, A.N.; Lamzin, V.S.; Hempstead, P.D.; Harrison, P.M.; Artymyuk, P.J.; Barynin, V.V.

    2000-01-01

    The crystal structures of two forms of the enzyme dimanganese catalase from Thermus Thermophilus (native and inhibited by chloride) were studied by X-ray diffraction analysis at 1.05 and 0.98 A resolution, respectively. The atomic models of the molecules were refined to the R factors 9.8 and 10%, respectively. The three-dimensional molecular structures are characterized in detail. The analysis of electron-density distributions in the active centers of the native and inhibited enzyme forms revealed that the most flexible side chains of the amino acid residues Lys162 and Glu36 exist in two interrelated conformations. This allowed us to obtain the structural data necessary for understanding the mechanism of enzymatic activity of the dimanganese catalase

  1. The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.

    Science.gov (United States)

    Dong, Yongsheng; Ma, Lei; Duan, Yuanliang

    2016-01-01

    To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.

  2. Synthesis of rare sugars with L-fuculose-1-phosphate aldolase (FucA) from Thermus thermophilus HB8.

    Science.gov (United States)

    Li, Zijie; Cai, Li; Qi, Qingsheng; Styslinger, Thomas J; Zhao, Guohui; Wang, Peng George

    2011-09-01

    We report herein a one-pot four-enzyme approach for the synthesis of the rare sugars d-psicose, d-sorbose, l-tagatose, and l-fructose with aldolase FucA from a thermophilic source (Thermus thermophilus HB8). Importantly, the cheap starting material DL-GP (DL-glycerol 3-phosphate), was used to significantly reduce the synthetic cost. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  4. Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.

    Science.gov (United States)

    Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide

    2018-05-05

    Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Site-directed mutation of a laccase from Thermus thermophilus: Effect on the activity profile

    Directory of Open Access Journals (Sweden)

    Liu Xin

    2012-01-01

    Full Text Available A site-directed mutant R453T of a laccase from Thermus thermophilus HB27 (Tth-laccase was constructed in order to investigate the effect on laccase catalytic properties. The mutated gene was cloned and overexpressed in Escherichia coli. Nickel-affinity purification was achieved and followed by copper ion incorporation. The mature mutated enzyme was quantitatively equal to the wild type. A photometric assay based on the oxidation of the substrate 2,2-azino-bis-(3- ethylbenzthiazoline-6-sulfonate (ABTS was employed in comparison with the wild-type Tth-laccase on catalytic properties. The R453T mutant exhibited improvement in substrate affinity and specific activity at room temperature, whereas those parameters were not significantly influenced when the temperature increased up to 65°C or higher. The mutant had better catalytic activity than that of the wild type at acidic pH. Investigated by circular dichroism spectroscopy, the mutant Tth-laccase displayed similar profiles at low and high temperatures.

  6. Engineering the Substrate Specificity of a Thermophilic Penicillin Acylase from Thermus thermophilus

    Science.gov (United States)

    Torres, Leticia L.; Cantero, Ángel; del Valle, Mercedes; Marina, Anabel; López-Gallego, Fernando; Guisán, José M.

    2013-01-01

    A homologue of the Escherichia coli penicillin acylase is encoded in the genomes of several thermophiles, including in different Thermus thermophilus strains. Although the natural substrate of this enzyme is not known, this acylase shows a marked preference for penicillin K over penicillin G. Three-dimensional models were created in which the catalytic residues and the substrate binding pocket were identified. Through rational redesign, residues were replaced to mimic the aromatic binding site of the E. coli penicillin G acylase. A set of enzyme variants containing between one and four amino acid replacements was generated, with altered catalytic properties in the hydrolyses of penicillins K and G. The introduction of a single phenylalanine residue in position α188, α189, or β24 improved the Km for penicillin G between 9- and 12-fold, and the catalytic efficiency of these variants for penicillin G was improved up to 6.6-fold. Structural models, as well as docking analyses, can predict the positioning of penicillins G and K for catalysis and can demonstrate how binding in a productive pose is compromised when more than one bulky phenylalanine residue is introduced into the active site. PMID:23263966

  7. Crystallization and preliminary crystallographic analysis of molybdenum-cofactor biosynthesis protein C from Thermus thermophilus

    International Nuclear Information System (INIS)

    Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Baba, Seiki; Chen, Lirong; Liu, Zhi-Jie; Wang, Bi-Cheng; Nishida, Masami; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki

    2006-01-01

    The molybdenum-cofactor biosynthesis protein C from T. thermophilus has been crystallized in two different space groups, P2 1 and R32; the crystals diffracted to 1.9 and 1.75 Å resolution, respectively. The Gram-negative aerobic eubacterium Thermus thermophilus is an extremely important thermophilic microorganism that was originally isolated from a thermal vent environment in Japan. The molybdenum cofactor in this organism is considered to be an essential component required by enzymes that catalyze diverse key reactions in the global metabolism of carbon, nitrogen and sulfur. The molybdenum-cofactor biosynthesis protein C derived from T. thermophilus was crystallized in two different space groups. Crystals obtained using the first crystallization condition belong to the monoclinic space group P2 1 , with unit-cell parameters a = 64.81, b = 109.84, c = 115.19 Å, β = 104.9°; the crystal diffracted to a resolution of 1.9 Å. The other crystal form belonged to space group R32, with unit-cell parameters a = b = 106.57, c = 59.25 Å, and diffracted to 1.75 Å resolution. Preliminary calculations reveal that the asymmetric unit contains 12 monomers and one monomer for the crystals belonging to space group P2 1 and R32, respectively

  8. Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance

    Science.gov (United States)

    Gregory, Steven T.

    2018-03-01

    Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.

  9. Characterization of recombinant glyoxylate reductase from thermophile Thermus thermophilus HB27.

    Science.gov (United States)

    Ogino, Hiroyasu; Nakayama, Hitoshi; China, Hideyasu; Kawata, Takuya; Doukyu, Noriyuki; Yasuda, Masahiro

    2008-01-01

    A glyoxylate reductase gene from the thermophilic bacterium Thermus thermophilus HB27 (TthGR) was cloned and expressed in Escherichia coli cells. The recombinant enzyme was highly purified to homogeneity and characterized. The purified TthGR showed thermostability up to 70 degrees C. In contrast, the maximum reaction condition was relatively mild (45 degrees C and pH 6.7). Although the kcat values against co-enzyme NADH and NADPH were similar, the Km value against co-enzyme NADH was approximately 18 times higher than that against NADPH. TthGR prefers NADPH rather than NADH as an electron donor. These results indicate that a phosphate group of a co-enzyme affects the binding affinity rather than the reaction efficiency, and TthGR demands appropriate amount of phosphate for a high activity. Furthermore, it was found that the half-lives of TthGR in the presence of 25% dimethyl sulfoxide and diethylene glycol were significantly longer than that in the absence of an organic solvent.

  10. High-level expression, secretion, and purification of the thermostable aqualysin I from Thermus aquaticus YT-1 in Pichia pastoris

    DEFF Research Database (Denmark)

    Oledzka, G.; Dabrowski, Slawomir; Kur, J.

    2003-01-01

    Aqualysin I is a heat-stable subtilisin-type serine protease which is secreted into the culture medium by Thermus aquaticus YT-1, an extreme thermophile. We report the high-level expression of an aqualysin I protein using its native signal sequence for secretion in the methylotrophic yeast, Pichia...... to that of the native enzyme. We also explored the possibility of secreting the GAP expressed aqualysin I in P. pastoris by in-frame fusion of the Saccharomyces cerevisiae alpha-factor secretion signal. However, the levels of secreted pro-aqualysin I particles were approximately 10 times lower, possibly...

  11. Crystal Structure of the 30S Ribosomal Subunit from Thermus Thermophilus: Purification, Crystallization and Structure Determination

    International Nuclear Information System (INIS)

    Clemons, William M. Jr.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki

    2001-01-01

    We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 (angstrom) resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 (angstrom) resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.

  12. Crystal structure of a thermostable Old Yellow Enzyme from Thermus scotoductus SA-01

    International Nuclear Information System (INIS)

    Opperman, Diederik J.; Sewell, Bryan T.; Litthauer, Derek; Isupov, Mikhail N.; Littlechild, Jennifer A.; Heerden, Esta van

    2010-01-01

    Recent characterization of the chromate reductase (CrS) from the thermophile Thermus scotoductus SA-01 revealed this enzyme to be related to the Old Yellow Enzyme (OYE) family. Here, we report the structure of a thermostable OYE homolog in its holoform at 2.2 A as well as its complex with p-hydroxybenzaldehyde (pHBA). The enzyme crystallized as octamers with the monomers showing a classical TIM barrel fold which upon dimerization yields the biologically active form of the protein. A sulfate ion is bound above the si-side of the non-covalently bound FMN cofactor in the oxidized solved structure but is displaced upon pHBA binding. The active-site architecture is highly conserved as with other members of this enzyme family. The pHBA in the CrS complex is positioned by hydrogen bonding to the two conserved catalytic-site histidines. The most prominent structural difference between CrS and other OYE homologs is the size of the 'capping domain'. Thermostabilization of the enzyme is achieved in part through increased proline content within loops and turns as well as increased intersubunit interactions through hydrogen bonding and complex salt bridge networks. CrS is able to reduce the C=C bonds of α,β-unsaturated carbonyl compounds with a preference towards cyclic substrates however no activity was observed towards β-substituted substrates. Mutational studies have confirmed the role of Tyr177 as the proposed proton donor although reduction could still occur at a reduced rate when this residue was mutated to phenylalanine.

  13. Role of disulphide bonds in a thermophilic serine protease aqualysin I from Thermus aquaticus YT-1.

    Science.gov (United States)

    Sakaguchi, Masayoshi; Takezawa, Makoto; Nakazawa, Rie; Nozawa, Kazutaka; Kusakawa, Taro; Nagasawa, Takeshi; Sugahara, Yasusato; Kawakita, Masao

    2008-05-01

    A thermophilic serine protease, Aqualysin I, from Thermus aquaticus YT-1 has two disulphide bonds, which are also found in a psychrophilic serine protease from Vibrio sp. PA-44 and a proteinase K-like enzyme from Serratia sp. at corresponding positions. To understand the significance of these disulphide bonds in aqualysin I, we prepared mutants C99S, C194S and C99S/C194S (WSS), in which Cys69-Cys99, Cys163-Cys194 and both of these disulphide bonds, respectively, were disrupted by replacing Cys residues with Ser residues. All mutants were expressed stably in Escherichia coli. The C99S mutant was 68% as active as the wild-type enzyme at 40 degrees C in terms of k(cat) value, while C194S and WSS were only 6 and 3%, respectively, as active, indicating that disulphide bond Cys163-Cys194 is critically important for maintaining proper catalytic site conformation. Mutants C194S and WSS were less thermostable than wild-type enzyme, with a half-life at 90 degrees C of 10 min as compared to 45 min of the latter and with transition temperatures on differential scanning calorimetry of 86.7 degrees C and 86.9 degrees C, respectively. Mutant C99S was almost as stable as the wild-type aqualysin I. These results indicate that the disulphide bond Cys163-Cys194 is more important for catalytic activity and conformational stability of aqualysin I than Cys67-Cys99.

  14. Isolation and partial characterization of carotenoid underproducing and overproducing mutants from an extremely thermophilic Thermus thermophilus HB27

    International Nuclear Information System (INIS)

    Hoshino, T.; Yoshino, Y.; Guevarra, E.D.; Ishida, S.; Hiruta, T.; Fujii, R.; Nakahara, T.

    1994-01-01

    Twenty-two carotenoid underproducing and thirteen overproducing mutants were obtained from Thermus thermophilus HB27. The strain HB27 was found to produce at least seven colored carotenoids, believed to be identical to those produced by Thermus aquaticus YT1. Based on the results of the genetic analyses performed on twelve carotenoid underproducing mutants, they were classified into three groups; groups 1, 2 and 3. No colored carotenoid was extracted from the cells of mutants belonging to groups 2 and 3, although the accumulation of phytoene, a colorless carotenoid, was observed in group 2 strains. Group 1 was subdivided into groups 1-a and 1-b, where 1-a stains produced neither colored carotenoids nor phytoene and 1-b strains produced two polar colored carotenoids. All of the overproducing mutants produced about twelve times as much seven colored carotenoid mixtures as the parental strain. The mutation loci among all the overproducing mutants were very close to one another, possibly in the same gene. Carotenoid overproducing mutants showed an extensive resistance to UV-irradiation and showed poorer growth at higher temperatures. Carotenoid underproducing mutants were slightly more UV-sensitive but they grew almost normally at higher temperatures. These results suggest that carotenoids are secondary metabolites which are not essential for growth of T. thermophilus

  15. Insight into the transition between the open and closed conformations of Thermus thermophilus carboxypeptidase

    International Nuclear Information System (INIS)

    Okai, Masahiko; Yamamura, Akihiro; Hayakawa, Kou; Tsutsui, Shiho; Miyazono, Ken-ichi; Lee, Woo-Cheol; Nagata, Koji; Inoue, Yumiko; Tanokura, Masaru

    2017-01-01

    Carboxypeptidase cleaves the C-terminal amino acid residue from proteins and peptides. Here, we report the functional and structural characterizations of carboxypeptidase belonging to the M32 family from the thermophilic bacterium Thermus thermophilus HB8 (TthCP). TthCP exhibits a relatively broad specificity for both hydrophilic (neutral and basic) and hydrophobic (aliphatic and aromatic) residues at the C-terminus and shows optimal activity in the temperature range of 75–80 °C and in the pH range of 6.8–7.2. Enzyme activity was significantly enhanced by cobalt or cadmium and was moderately inhibited by Tris at 25 °C. We also determined the crystal structure of TthCP at 2.6 Å resolution. Two dimer types of TthCP are present in the crystal. One type consists of two subunits in different states, open and closed, with a C α RMSD value of 2.2 Å; the other type consists of two subunits in the same open state. This structure enables us to compare the open and closed states of an M32 carboxypeptidase. The TthCP subunit can be divided into two domains, L and S, which are separated by a substrate-binding groove. The L and S domains in the open state are almost identical to those in the closed state, with C α RMSD values of 0.84 and 0.53 Å, respectively, suggesting that the transition between the open and closed states proceeds with a large hinge-bending motion. The superimposition between the closed states of TthCP and BsuCP, another M32 family member, revealed that most putative substrate-binding residues in the grooves are oriented in the same direction. - Highlights: • The enzyme activity of TthCP was inhibited moderately by Tris molecule. • We solved the crystal structure of TthCP at 2.6 Å resolution. • The crystal structure of TthCP revealed both the open and closed conformations.

  16. Low molecular weight thiols and thioredoxins are important players in Hg(II) resistance in Thermus thermophilus HB27.

    Science.gov (United States)

    Norambuena, J; Wang, Y; Hanson, T; Boyd, J M; Barkay, T

    2017-11-17

    Mercury (Hg), one of the most toxic and widely distributed heavy metals, has a high affinity for thiol groups. Thiol groups reduce and sequester Hg. Therefore, low molecular weight and protein thiols may be important cell components used in Hg resistance. To date, the role of low molecular weight thiols in Hg-detoxification remains understudied. The mercury resistance ( mer ) operon of Thermus thermophilus suggests an evolutionary link between Hg(II) resistance and low molecular weight thiol metabolism. This mer operon encodes for an enzyme involved in methionine biosynthesis, Oah. Challenge with Hg(II) resulted in increased expression of genes involved in the biosynthesis of multiple low molecular weight thiols (cysteine, homocysteine, and bacillithiol), as well as the thioredoxin system. Phenotypic analysis of gene replacement mutants indicated that Oah contributes to Hg resistance under sulfur limiting conditions, and strains lacking bacillithiol and/or thioredoxins are more sensitive to Hg(II) than the wild type. Growth in presence of either a thiol oxidizing agent or a thiol alkylating agent increased sensitivity to Hg(II). Furthermore, exposure to 3 μM Hg(II) consumed all intracellular reduced bacillithiol and cysteine. Database searches indicate that oah2 is present in all Thermus spp. mer operons. The presence of a thiol related gene was also detected in some alphaprotobacterial mer operons, in which a glutathione reductase gene was present, supporting the role of thiols in Hg(II) detoxification. These results have led to a working model in which LMW thiols act as Hg(II) buffering agents while Hg is reduced by MerA. Importance The survival of microorganisms in presence of toxic metals is central to life's sustainability. The affinity of thiol groups to toxic heavy metals drives microbe-metal interactions and modulate metal toxicity. Mercury detoxification ( mer ) genes likely originated early in microbial evolution among geothermal environments. Little is

  17. Structure of TTHA1623, a novel metallo-β-lactamase superfamily protein from Thermus thermophilus HB8

    International Nuclear Information System (INIS)

    Yamamura, Akihiro; Okada, Akitoshi; Kameda, Yasuhiro; Ohtsuka, Jun; Nakagawa, Noriko; Ebihara, Akio; Nagata, Koji; Tanokura, Masaru

    2009-01-01

    The crystal structures of TTHA1623 from T. thermophilus HB8 in an iron-bound and a zinc-bound form have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 is a metallo-β-lactamase superfamily protein from the extremely thermophilic bacterium Thermus thermophilus HB8. Homologues of TTHA1623 exist in a wide range of bacteria and archaea and one eukaryote, Giardia lamblia, but their function remains unknown. To analyze the structural properties of TTHA1623, the crystal structures of its iron-bound and zinc-bound forms have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 possesses an αββα-fold similar to that of other metallo-β-lactamase superfamily proteins with glyoxalase II-type metal coordination. However, TTHA1623 exhibits a putative substrate-binding pocket with a unique shape

  18. Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

    Energy Technology Data Exchange (ETDEWEB)

    Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation); Muravieva, T. I.; Esipov, R. S., E-mail: espiov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)

    2016-11-15

    Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

  19. Cloning, expression, purification, crystallization and initial crystallographic analysis of the preprotein translocation ATPase SecA from Thermus thermophilus

    International Nuclear Information System (INIS)

    Vassylyeva, Marina N.; Mori, Hiroyuki; Tsukazaki, Tomoya; Yokoyama, Shigeyuki; Tahirov, Tahir H.; Ito, Koreaki; Vassylyev, Dmitry G.

    2006-01-01

    The SecA ATPase from T. thermophilus was cloned, expressed, purified and crystallized. Complete diffraction data sets were collected for two crystal forms at 2.8 and 3.5 Å resolution, respectively. Determination of the structure is now in progress. The Thermus thermophilus gene encoding the preprotein translocation ATPase SecA was cloned and expressed and the purified protein was crystallized by the hanging-drop vapour-diffusion technique in two different space groups P3 1(2) 21 (a = b = 168.6, c = 149.8 Å) and P6 1(5) 22 (a = b = 130.9, c = 564.6 Å). The crystals, improved by macroseeding, diffracted to beyond 2.8 and 3.5 Å resolution for the trigonal and hexagonal crystal forms, respectively. Structure determination using the multiple isomorphous replacement method is in progress

  20. The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

    Science.gov (United States)

    Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

    1989-01-01

    Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

  1. Purification, crystallization and preliminary X-ray diffraction study on pyrimidine nucleoside phosphorylase TTHA1771 from Thermus thermophilus HB8

    International Nuclear Information System (INIS)

    Shimizu, Katsumi; Kunishima, Naoki

    2007-01-01

    The pyrimidine nucleoside phosphorylase TTHA1771 from T. thermophilus HB8 has been overexpressed, purified and crystallized. The crystals diffract X-rays to 1.8 Å resolution using synchrotron radiation. Pyrimidine nucleoside phosphorylase (PYNP) catalyzes the reversible phosphorolysis of pyrimidines in the nucleotide-synthesis salvage pathway. In order to study the structure–thermostability relationship of this enzyme, PYNP from the extreme thermophile Thermus thermophilus HB8 (TTHA1771) has been cloned, overexpressed and purified. The TTHA1771 protein was crystallized at 291 K using the oil-microbatch method with PEG 4000 as a precipitant. A native data set was collected to 1.8 Å resolution using synchrotron radiation. The crystal belongs to the monoclinic space group P2 1 , with unit-cell parameters a = 58.83, b = 76.23, c = 103.86 Å, β = 91.3°

  2. Molecular docking and molecular dynamics simulation studies on Thermus thermophilus leucyl-tRNA synthetase complexed with different amino acids and pre-transfer editing substrates

    OpenAIRE

    Rayevsky A. V.; Tukalo M. A.

    2016-01-01

    Aim. To investigate the structural bases for the amino acid selectivity of the Thermus thermophilus leucyl-tRNA synthetase (LeuRSTT) aminoacylation site and to disclose the binding pattern of pre-transfer editing substrates. Methods. Eight amino acids proposed as semi-cognate substrates for aminoacylation and eight aminoacyl-adenylates (formed from AMP and eight amino acids) were prepared in zwitterions form. The protein structure with a co-crystallized substrate in the aminoacylation site [P...

  3. Cesium accumulation by bacterium Thermus sp.TibetanG7: hints for biomineralization of cesiumbearing geyserite in hot springs in Tibet, China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The bacterium Thermus sp. TibetanG7, isolated from hot springs in Tibet, China, was examined for the ability to accumulate cesium from solutions. Environmental conditions were simulated and the effects of pH, K+, Na+ and K+-regimes were then studied to determine the possible role of the bacterium in the formation of cesium-bearing geyserite around these hot springs. In despite of the inhibition of K+ and Na+, the bacterium Thermus sp. TibetanG7 revealed noticeable accumulation of cesium from solutions, with maximum accumulations of 53.49 and 40.41 μmol Cesium/g cell dry weight in Na+ and K+ inhibition experiments, respectively. The accumulation of cesium by this microorganism is rapid, with 40%―50% accumulated within the first 5 min. K+-deficient cells showed a much higher capacity of cesium accumulation compared with K+-sufficient cells. It is evident that the bacteria within the genus thermus play a significant role in the cesium assembly. The formation of cesium-bearing geyserite is also considered.

  4. Pb2+ Effects on Growth, Lipids, and Protein and DNA Profiles of the Thermophilic Bacterium Thermus Thermophilus

    Directory of Open Access Journals (Sweden)

    Barbara Nicolaus

    2016-12-01

    Full Text Available Extremophiles are organisms able to thrive in extreme environmental conditions and some of them show the ability to survive high doses of heavy metals thanks to defensive mechanisms provided by primary and secondary metabolic products, i.e., extremolytes, lipids, and extremozymes. This is why there is a growing scientific and industrial interest in the use of thermophilic bacteria in a host of tasks, from the environmental detoxification of heavy metal to industrial activities, such as bio-machining and bio-metallurgy. In this work Thermus thermophilus was challenged against increasing Pb2+ concentrations spanning from 0 to 300 ppm in order to ascertain the sensitiveness of this bacteria to the Pb environmental pollution and to give an insight on its heavy metal resistance mechanisms. Analysis of growth parameters, enzyme activities, protein profiles, and lipid membrane modifications were carried out. In addition, genotyping analysis of bacteria grown in the presence of Pb2+, using random amplified polymorphic DNA-PCR and DNA melting evaluation, were also performed. A better knowledge of the response of thermophilic bacteria to the different pollutants, as heavy metals, is necessary for optimizing their use in remediation or decontamination processes.

  5. Identification and characterization of preferred DNA-binding sites for the Thermus thermophilus transcriptional regulator FadR.

    Directory of Open Access Journals (Sweden)

    Minwoo Lee

    Full Text Available One of the primary transcriptional regulators of fatty acid homeostasis in many prokaryotes is the protein FadR. To better understand its biological function in the extreme thermophile Thermus thermophilus HB8, we sought to first determine its preferred DNA-binding sequences in vitro using the combinatorial selection method Restriction Endonuclease Protection, Selection, and Amplification (REPSA and then use this information to bioinformatically identify potential regulated genes. REPSA determined a consensus FadR-binding sequence 5´-TTRNACYNRGTNYAA-3´, which was further characterized using quantitative electrophoretic mobility shift assays. With this information, a search of the T. thermophilus HB8 genome found multiple operons potentially regulated by FadR. Several of these were identified as encoding proteins involved in fatty acid biosynthesis and degradation; however, others were novel and not previously identified as targets of FadR. The role of FadR in regulating these genes was validated by physical and functional methods, as well as comparative genomic approaches to further characterize regulons in related organisms. Taken together, our study demonstrates that a systematic approach involving REPSA, biophysical characterization of protein-DNA binding, and bioinformatics can be used to postulate biological roles for potential transcriptional regulators.

  6. Crystallization and preliminary X-ray diffraction analysis of recombinant phosphoribosylpyrophosphate synthetase from the Thermophilic thermus thermophilus strain HB27

    Energy Technology Data Exchange (ETDEWEB)

    Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation); Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S., E-mail: esipov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation)

    2017-01-15

    Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.

  7. Cloning, expression, purification, crystallization and preliminary X-ray crystallographic study of molybdopterin synthase from Thermus thermophilus HB8

    International Nuclear Information System (INIS)

    Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Ohmori, Miwa; Agari, Kazuko; Kitamura, Yoshiaki; Baba, Seiki; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki

    2007-01-01

    The molybdopterin synthase from T. thermophilus HB8 was cloned, expressed, purified and crystallized. The crystals belong to space group P2 1 and diffracted to a resolution of 1.64 Å. Thermus thermophilus is a Gram-negative aerobic thermophilic eubacterium which can grow at temperatures ranging from 323 to 355 K. In addition to their importance in thermostability or adaptation strategies for survival at high temperatures, the thermostable enzymes in thermophilic organisms contribute to a wide range of biotechnological applications. The molybdenum cofactor in all three kingdoms consists of a tricyclic pyranopterin termed molybdopterin that bears the cis-dithiolene group responsible for molybdenum ligation. The crystals of molybdopterin synthase from T. thermophilus HB8 belong to the primitive monoclinic space group P2 1 , with unit-cell parameters a = 33.94, b = 103.32, c = 59.59 Å, β = 101.3°. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetric unit

  8. Cloning, expression, purification, crystallization and preliminary X-ray analysis of Thermus aquaticus succinyl-CoA synthetase

    International Nuclear Information System (INIS)

    Joyce, Michael A.; Brownie, Edward R.; Hayakawa, Koto; Fraser, Marie E.

    2007-01-01

    Attempts to crystallize succinyl-CoA synthetase from the thermophile T. aquaticus were thwarted by proteolysis of the β-subunit and preferential crystallization of a truncated form. Crystals of the full-length enzyme were grown after the purification protocol was modified to include frequent additions of protease inhibitors. Succinyl-CoA synthetase (SCS) is an enzyme of the citric acid cycle and is thus found in most species. To date, there are no structures available of SCS from a thermophilic organism. To investigate how the enzyme adapts to higher temperatures, SCS from Thermus aquaticus was cloned, overexpressed, purified and crystallized. Attempts to crystallize the enzyme were thwarted by proteolysis of the β-subunit and preferential crystallization of the truncated form. Crystals of full-length SCS were grown after the purification protocol was modified to include frequent additions of protease inhibitors. The resulting crystals, which diffract to 2.35 Å resolution, are of the protein in complex with Mn 2+ -GDP

  9. Inactivation and unfolding of protein tyrosine phosphatase from Thermus thermophilus HB27 during urea and guanidine hydrochloride denaturation.

    Directory of Open Access Journals (Sweden)

    Yejing Wang

    Full Text Available The effects of urea and guanidine hydrochloride (GdnHCl on the activity, conformation and unfolding process of protein tyrosine phosphatase (PTPase, a thermostable low molecular weight protein from Thermus thermophilus HB27, have been studied. Enzymatic activity assays showed both urea and GdnHCl resulted in the inactivation of PTPase in a concentration and time-dependent manner. Inactivation kinetics analysis suggested that the inactivation of PTPase induced by urea and GdnHCl were both monophasic and reversible processes, and the effects of urea and GdnHCl on PTPase were similar to that of mixed-type reversible inhibitors. Far-ultraviolet (UV circular dichroism (CD, Tryptophan and 1-anilinonaphthalene -8-sulfonic acid (ANS fluorescence spectral analyses indicated the existence of a partially active and an inactive molten globule-like intermediate during the unfolding processes induced by urea and GdnHCl, respectively. Based on the sequence alignment and the homolog Tt1001 protein structure, we discussed the possible conformational transitions of PTPase induced by urea and GdnHCl and compared the conformations of these unfolding intermediates with the transient states in bovine PTPase and its complex structures in detail. Our results may be able to provide some valuable clues to reveal the relationship between the structure and enzymatic activity, and the unfolding pathway and mechanism of PTPase.

  10. A comparison of structural and evolutionary attributes of Escherichia coli and Thermus thermophilus small ribosomal subunits: signatures of thermal adaptation.

    Directory of Open Access Journals (Sweden)

    Saurav Mallik

    Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.

  11. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    Science.gov (United States)

    Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A

    2017-01-01

    CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  12. The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair.

    Science.gov (United States)

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2012-11-01

    Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Crystal structure studies of NADP{sup +} dependent isocitrate dehydrogenase from Thermus thermophilus exhibiting a novel terminal domain

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, S.M. [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India); Pampa, K.J. [Department of Studies in Microbiology, University of Mysore, Mysore 570 006 (India); Manjula, M. [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India); Abdoh, M.M.M. [Department of Physics, Faculty of Science, An-Najah National University, Nablus, West Bank, Palestine (Country Unknown); Kunishima, Naoki [Advanced Protein Crystallography Research Group, RIKEN SPring-8 Center, Harima Institute, Hyogo 679-5148 (Japan); Lokanath, N.K., E-mail: lokanath@physics.uni-mysore.ac.in [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India)

    2014-06-20

    Highlights: • We determined the structure of isocitrate dehydrogenase with citrate and cofactor. • The structure reveals a unique novel terminal domain involved in dimerization. • Clasp domain shows significant difference, and catalytic residues are conserved. • Oligomerization of the enzyme is quantized with subunit-subunit interactions. • Novel domain of this enzyme is classified as subfamily of the type IV. - Abstract: NADP{sup +} dependent isocitrate dehydrogenase (IDH) is an enzyme catalyzing oxidative decarboxylation of isocitrate into oxalosuccinate (intermediate) and finally the product α-ketoglutarate. The crystal structure of Thermus thermophilus isocitrate dehydrogenase (TtIDH) ternary complex with citrate and cofactor NADP{sup +} was determined using X-ray diffraction method to a resolution of 1.80 Å. The overall fold of this protein was resolved into large domain, small domain and a clasp domain. The monomeric structure reveals a novel terminal domain involved in dimerization, very unique and novel domain when compared to other IDH’s. And, small domain and clasp domain showing significant differences when compared to other IDH’s of the same sub-family. The structure of TtIDH reveals the absence of helix at the clasp domain, which is mainly involved in oligomerization in other IDH’s. Also, helices/beta sheets are absent in the small domain, when compared to other IDH’s of the same sub family. The overall TtIDH structure exhibits closed conformation with catalytic triad residues, Tyr144-Asp248-Lys191 are conserved. Oligomerization of the protein is quantized using interface area and subunit–subunit interactions between protomers. Overall, the TtIDH structure with novel terminal domain may be categorized as a first structure of subfamily of type IV.

  14. RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.

    Directory of Open Access Journals (Sweden)

    Tina Y Liu

    Full Text Available CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus Type III-A Csm complex (TthCsm with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.

  15. Cre/lox-based multiple markerless gene disruption in the genome of the extreme thermophile Thermus thermophilus.

    Science.gov (United States)

    Togawa, Yoichiro; Nunoshiba, Tatsuo; Hiratsu, Keiichiro

    2018-02-01

    Markerless gene-disruption technology is particularly useful for effective genetic analyses of Thermus thermophilus (T. thermophilus), which have a limited number of selectable markers. In an attempt to develop a novel system for the markerless disruption of genes in T. thermophilus, we applied a Cre/lox system to construct a triple gene disruptant. To achieve this, we constructed two genetic tools, a loxP-htk-loxP cassette and cre-expressing plasmid, pSH-Cre, for gene disruption and removal of the selectable marker by Cre-mediated recombination. We found that the Cre/lox system was compatible with the proliferation of the T. thermophilus HB27 strain at the lowest growth temperature (50 °C), and thus succeeded in establishing a triple gene disruptant, the (∆TTC1454::loxP, ∆TTC1535KpnI::loxP, ∆TTC1576::loxP) strain, without leaving behind a selectable marker. During the process of the sequential disruption of multiple genes, we observed the undesired deletion and inversion of the chromosomal region between multiple loxP sites that were induced by Cre-mediated recombination. Therefore, we examined the effects of a lox66-htk-lox71 cassette by exploiting the mutant lox sites, lox66 and lox71, instead of native loxP sites. We successfully constructed a (∆TTC1535::lox72, ∆TTC1537::lox72) double gene disruptant without inducing the undesired deletion of the 0.7-kbp region between the two directly oriented lox72 sites created by the Cre-mediated recombination of the lox66-htk-lox71 cassette. This is the first demonstration of a Cre/lox system being applicable to extreme thermophiles in a genetic manipulation. Our results indicate that this system is a powerful tool for multiple markerless gene disruption in T. thermophilus.

  16. Identification of novel esterase-active enzymes from hot environments by use of the host bacterium Thermus thermophilus

    Directory of Open Access Journals (Sweden)

    Benedikt eLeis

    2015-04-01

    Full Text Available Functional metagenomic screening strategies, which are independent of known sequence information, can lead to the identification of truly novel genes and enzymes. Since E. coli has been used exhaustively for this purpose as a host, it is important to establish alternative expression hosts and to use them for functional metagenomic screening for new enzymes. In this study we show that Thermus thermophilus HB27 is an excellent screening host and can be used as an alternative provider of truly novel biocatalysts. In a previous study we constructed the mutant strain BL03 that was no longer able to grow on defined minimal medium supplemented with tributyrin as the sole carbon source and could be used as a host to screen for metagenomic DNA fragments that could complement growth on tributyrin. Several thousand single fosmid clones from thermophilic metagenomic libraries from heated compost and hot spring water samples were subjected to a comparative screening for esterase activity in both T. thermophilus strain BL03 and E. coli EPI300. We scored a greater number of active clones in the thermophilic bacterium than in the mesophilic E. coli. From all clones functionally screened in E. coli, only two thermostable α/β-fold hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes were identifiable. In contrast, five further fosmids were found that conferred lipolytic activities in T. thermophilus. Four open reading frames (ORFs were found which did not share significant similarity to known esterase enzymes. Two of the genes were expressed in both hosts and the novel thermophilic esterases, which based on their primary structures could not be assigned to known esterase or lipase families, were purified and preliminarily characterized. Our work underscores the benefit of using additional screening hosts other than E. coli for the identification of novel biocatalysts with industrial relevance.

  17. Roles of conserved arginines in ATP-binding domains of AAA+ chaperone ClpB from Thermus thermophilus.

    Science.gov (United States)

    Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei

    2011-07-01

    ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.

  18. Functional expression of a penicillin acylase from the extreme thermophile Thermus thermophilus HB27 in Escherichia coli.

    Science.gov (United States)

    Torres, Leticia L; Ferreras, Eloy R; Cantero, Angel; Hidalgo, Aurelio; Berenguer, José

    2012-08-09

    Penicillin acylases (PACs) are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth) HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin) was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1). The optimum pH was aprox. 4 and the optimum temperature was 75 °C. The half-life of

  19. Functional expression of a penicillin acylase from the extreme thermophile Thermus thermophilus HB27 in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Torres Leticia L

    2012-08-01

    Full Text Available Abstract Background Penicillin acylases (PACs are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Results Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1. The optimum pH was aprox. 4 and the optimum

  20. High resolution structure of the ba3 cytochrome c oxidase from Thermus thermophilus in a lipidic environment.

    Directory of Open Access Journals (Sweden)

    Theresa Tiefenbrunn

    Full Text Available The fundamental chemistry underpinning aerobic life on Earth involves reduction of dioxygen to water with concomitant proton translocation. This process is catalyzed by members of the heme-copper oxidase (HCO superfamily. Despite the availability of crystal structures for all types of HCO, the mode of action for this enzyme is not understood at the atomic level, namely how vectorial H(+ and e(- transport are coupled. Toward addressing this problem, we report wild type and A120F mutant structures of the ba(3-type cytochrome c oxidase from Thermus thermophilus at 1.8 Å resolution. The enzyme has been crystallized from the lipidic cubic phase, which mimics the biological membrane environment. The structures reveal 20 ordered lipid molecules that occupy binding sites on the protein surface or mediate crystal packing interfaces. The interior of the protein encloses 53 water molecules, including 3 trapped in the designated K-path of proton transfer and 8 in a cluster seen also in A-type enzymes that likely functions in egress of product water and proton translocation. The hydrophobic O(2-uptake channel, connecting the active site to the lipid bilayer, contains a single water molecule nearest the Cu(B atom but otherwise exhibits no residual electron density. The active site contains strong electron density for a pair of bonded atoms bridging the heme Fe(a3 and Cu(B atoms that is best modeled as peroxide. The structure of ba(3-oxidase reveals new information about the positioning of the enzyme within the membrane and the nature of its interactions with lipid molecules. The atomic resolution details provide insight into the mechanisms of electron transfer, oxygen diffusion into the active site, reduction of oxygen to water, and pumping of protons across the membrane. The development of a robust system for production of ba(3-oxidase crystals diffracting to high resolution, together with an established expression system for generating mutants, opens the

  1. Cloning and analysis of a bifunctional methyltransferase/restriction endonuclease TspGWI, the prototype of a Thermus sp. enzyme family

    Directory of Open Access Journals (Sweden)

    Zylicz-Stachula Agnieszka

    2009-05-01

    Full Text Available Abstract Background Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases, however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Results Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family – TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase and methyltransferase (MTase activities of wild type (wt TspGWI (either recombinant or isolated from Thermus sp. are dependent on the presence of divalent cations. Conclusion TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/EXK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module

  2. Insight into the stereospecificity of short-chain thermus thermophilus alcohol dehydrogenase showing pro-S hydride transfer and prelog enantioselectivity.

    Science.gov (United States)

    Pennacchio, Angela; Giordano, Assunta; Esposito, Luciana; Langella, Emma; Rossi, Mosè; Raia, Carlo A

    2010-04-01

    The stereochemistry of the hydride transfer in reactions catalyzed by NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus HB27 was determined by means of (1)H-NMR spectroscopy. The enzyme transfers the pro-S hydrogen of [4R-(2)H]NADH and exhibits Prelog specificity. Enzyme-substrate docking calculations provided structural details about the enantioselectivity of this thermophilic enzyme. These results give additional insights into the diverse active site architectures of the largely versatile short-chain dehydrogenase superfamily enzymes. A feasible protocol for the synthesis of [4R-(2)H]NADH with high yield was also set up by enzymatic oxidation of 2-propanol-d(8) catalyzed by Bacillus stearothermophilus alcohol dehydrogenase.

  3. Interaction of Thermus thermophilus ArsC enzyme and gold nanoparticles naked-eye assays speciation between As(III) and As(V)

    International Nuclear Information System (INIS)

    Politi, Jane; De Stefano, Luca; Spadavecchia, Jolanda; Casale, Sandra; Fiorentino, Gabriella; Antonucci, Immacolata

    2015-01-01

    The thermophilic bacterium Thermus thermophilus HB27 encodes chromosomal arsenate reductase (TtArsC), the enzyme responsible for resistance to the harmful effects of arsenic. We report on adsorption of TtArsC onto gold nanoparticles for naked-eye monitoring of biomolecular interaction between the enzyme and arsenic species. Synthesis of hybrid biological–metallic nanoparticles has been characterized by transmission electron microscopy (TEM), ultraviolet-visible (UV–vis), dynamic light scattering (DLS) and phase modulated infrared reflection absorption (PM-IRRAS) spectroscopies. Molecular interactions have been monitored by UV–vis and Fourier transform-surface plasmon resonance (FT-SPR). Due to the nanoparticles’ aggregation on exposure to metal salts, pentavalent and trivalent arsenic solutions can be clearly distinguished by naked-eye assay, even at 85 μM concentration. Moreover, the assay shows partial selectivity against other heavy metals. (paper)

  4. Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3'-5' exonuclease activity.

    Science.gov (United States)

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2009-04-01

    The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.

  5. Arsenate reductase from Thermus thermophilus conjugated to polyethylene glycol-stabilized gold nanospheres allow trace sensing and speciation of arsenic ions.

    Science.gov (United States)

    Politi, Jane; Spadavecchia, Jolanda; Fiorentino, Gabriella; Antonucci, Immacolata; De Stefano, Luca

    2016-10-01

    Water sources pollution by arsenic ions is a serious environmental problem all around the world. Arsenate reductase enzyme (TtArsC) from Thermus thermophilus extremophile bacterium, naturally binds arsenic ions, As(V) and As (III), in aqueous solutions. In this research, TtArsC enzyme adsorption onto hybrid polyethylene glycol-stabilized gold nanoparticles (AuNPs) was studied at different pH values as an innovative nanobiosystem for metal concentration monitoring. Characterizations were performed by UV/Vis and circular dichroism spectroscopies, TEM images and in terms of surface charge changes. The molecular interaction between arsenic ions and the TtArsC-AuNPs nanobiosystem was also monitored at all pH values considered by UV/Vis spectroscopy. Tests performed revealed high sensitivities and limits of detection equal to 10 ± 3 M -12 and 7.7 ± 0.3 M -12 for As(III) and As(V), respectively. © 2016 The Author(s).

  6. Models for the a subunits of the Thermus thermophilus V/A-ATPase and Saccharomyces cerevisiae V-ATPase enzymes by cryo-EM and evolutionary covariance

    Science.gov (United States)

    Schep, Daniel G.; Rubinstein, John L.

    2016-01-01

    Rotary ATPases couple ATP synthesis or hydrolysis to proton translocation across a membrane. However, understanding proton translocation has been hampered by a lack of structural information for the membrane-embedded a subunit. The V/A-ATPase from the eubacterium Thermus thermophilus is similar in structure to the eukaryotic V-ATPase but has a simpler subunit composition and functions in vivo to synthesize ATP rather than pump protons. We determined the T. thermophilus V/A-ATPase structure by cryo-EM at 6.4 Å resolution. Evolutionary covariance analysis allowed tracing of the a subunit sequence within the map, providing a complete model of the rotary ATPase. Comparing the membrane-embedded regions of the T. thermophilus V/A-ATPase and eukaryotic V-ATPase from Saccharomyces cerevisiae allowed identification of the α-helices that belong to the a subunit and revealed the existence of previously unknown subunits in the eukaryotic enzyme. Subsequent evolutionary covariance analysis enabled construction of a model of the a subunit in the S. cerevisae V-ATPase that explains numerous biochemical studies of that enzyme. Comparing the two a subunit structures determined here with a structure of the distantly related a subunit from the bovine F-type ATP synthase revealed a conserved pattern of residues, suggesting a common mechanism for proton transport in all rotary ATPases. PMID:26951669

  7. Crystallization and preliminary X-ray diffraction study of recombinant adenine phosphoribosyltransferase from the thermophilic bacterium Thermus thermophilus strain HB27

    Science.gov (United States)

    Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.

    2017-07-01

    Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).

  8. A Flexible Domain-Domain Hinge Promotes an Induced-fit Dominant Mechanism for the Loading of Guide-DNA into Argonaute Protein in Thermus thermophilus

    KAUST Repository

    Zhu, Lizhe

    2016-02-24

    Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Agos but rigid for eukaryotic Agos. © 2016 American Chemical Society.

  9. Acarviosine-simmondsin, a novel compound obtained from acarviosine-glucose and simmondsin by Thermus maltogenic amylase and its in vivo effect on food intake and hyperglycemia.

    Science.gov (United States)

    Baek, Jin-Sook; Kim, Hye-Young; Abbott, Thomas P; Moon, Tae-Wha; Lee, Soo-Bok; Park, Cheon-Seok; Park, Kwan-Hwa

    2003-03-01

    Simmondsin was modified with acarviosine-glucose using the transglycosylation activity of Thermus maltogenic amylase to synthesize a novel compound with both antiobesity and hypoglycemic activity. The LC/MS and 13C NMR analyses confirmed that the structure of the major transglycosylation product was acarviosine-simmondsin (Acv-simmondsin), in which acarviosine was attached to the glucose moiety of simmondsin by an alpha-(1,6)-glycosidic linkage. It was found that Acv-simmondsin was a potent competitive inhibitor of alpha-glucosidase with the Ki value of 0.69 microM and a mixed type inhibitor of alpha-amylase with the Ki and KI of 20.78 microM and 26.31 microM, respectively. The administration of Acv-simmondsin (0.1 g/100 g diet/day) to mice for 5 days significantly reduced food intake by 35%, compared to 25% with simmondsin in control obese mice. Acv-simmondsin (50 mg/kg BW) suppressed the postprandial blood glucose response to sucrose (1 g/kg BW) by 74%, compared to 71% with acarbose, in normal rats.

  10. Properties of a novel thermostable glucose isomerase mined from Thermus oshimai and its application to preparation of high fructose corn syrup.

    Science.gov (United States)

    Jia, Dong-Xu; Zhou, Lin; Zheng, Yu-Guo

    2017-04-01

    Glucose isomerase (GI) is used in vitro to convert d-glucose to d-fructose, which is capable of commercial producing high fructose corn syrup (HFCS). To manufacture HFCS at elevated temperature and reduce the cost of enriching syrups, novel refractory GIs from Thermoanaerobacterium xylanolyticum (TxGI), Thermus oshimai (ToGI), Geobacillus thermocatenulatus (GtGI) and Thermoanaerobacter siderophilus (TsGI) were screened via genome mining approach. The enzymatic characteristics research showed that ToGI had higher catalytic efficiency and superior thermostability toward d-glucose among the screened GIs. Its optimum temperature reached 95°C and could retain more than 80% of initial activity in the presence of 20mM Mn 2+ at 85°C for 48h. The K m and k cat /K m values for ToGI were 81.46mM and 21.77min -1 mM -1 , respectively. Furthermore, the maximum conversion yield of 400g/L d-glucose to d-fructose at 85°C was 52.16%. Considering its excellent high thermostability and ameliorable application performance, ToGI might be promising for realization of future industrial production of HFCS at elevated temperature. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. A Flexible Domain-Domain Hinge Promotes an Induced-fit Dominant Mechanism for the Loading of Guide-DNA into Argonaute Protein in Thermus thermophilus.

    Science.gov (United States)

    Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Gao, Xin; Wang, Yanli; Huang, Xuhui

    2016-03-17

    Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Ago's but rigid for eukaryotic Ago's.

  12. Structures of a putative RNA 5-methyluridine methyltransferase, Thermus thermophilus TTHA1280, and its complex with S-adenosyl-l-homocysteine

    International Nuclear Information System (INIS)

    Pioszak, Augen A.; Murayama, Kazutaka; Nakagawa, Noriko; Ebihara, Akio; Kuramitsu, Seiki; Shirouzu, Mikako; Yokoyama, Shigeyuki

    2005-01-01

    Three structures of a putative RNA 5-methyluridine methyltransferase from T. thermophilus, including its complex with S-adenosyl-l-homocysteine, are presented. The structures reveal the mode of cofactor binding, architecture of the putative active site, and the presence of a deep cleft adjacent to the active site that may bind RNA. The Thermus thermophilus hypothetical protein TTHA1280 belongs to a family of predicted S-adenosyl-l-methionine (AdoMet) dependent RNA methyltransferases (MTases) present in many bacterial and archaeal species. Inspection of amino-acid sequence motifs common to class I Rossmann-fold-like MTases suggested a specific role as an RNA 5-methyluridine MTase. Selenomethionine (SeMet) labelled and native versions of the protein were expressed, purified and crystallized. Two crystal forms of the SeMet-labelled apoprotein were obtained: SeMet-ApoI and SeMet-ApoII. Cocrystallization of the native protein with S-adenosyl-l-homocysteine (AdoHcy) yielded a third crystal form, Native-AdoHcy. The SeMet-ApoI structure was solved by the multiple anomalous dispersion method and refined at 2.55 Å resolution. The SeMet-ApoII and Native-AdoHcy structures were solved by molecular replacement and refined at 1.80 and 2.60 Å, respectively. TTHA1280 formed a homodimer in the crystals and in solution. Each subunit folds into a three-domain structure composed of a small N-terminal PUA domain, a central α/β-domain and a C-terminal Rossmann-fold-like MTase domain. The three domains form an overall clamp-like shape, with the putative active site facing a deep cleft. The architecture of the active site is consistent with specific recognition of uridine and catalysis of methyl transfer to the 5-carbon position. The cleft is suitable in size and charge distribution for binding single-stranded RNA.

  13. Purification and characterization of a novel recombinant highly enantioselective short-chain NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus.

    Science.gov (United States)

    Pennacchio, Angela; Pucci, Biagio; Secundo, Francesco; La Cara, Francesco; Rossi, Mosè; Raia, Carlo A

    2008-07-01

    The gene encoding a novel alcohol dehydrogenase (ADH) that belongs to the short-chain dehydrogenase/reductase (SDR) superfamily was identified in the extremely thermophilic, halotolerant gram-negative eubacterium Thermus thermophilus HB27. The T. thermophilus ADH gene (adh(Tt)) was heterologously overexpressed in Escherichia coli, and the protein (ADH(Tt)) was purified to homogeneity and characterized. ADH(Tt) is a tetrameric enzyme consisting of identical 26,961-Da subunits composed of 256 amino acids. The enzyme has remarkable thermophilicity and thermal stability, displaying activity at temperatures up to approximately 73 degrees C and a 30-min half-inactivation temperature of approximately 90 degrees C, as well as good tolerance to common organic solvents. ADH(Tt) has a strict requirement for NAD(H) as the coenzyme, a preference for reduction of aromatic ketones and alpha-keto esters, and poor activity on aromatic alcohols and aldehydes. This thermophilic enzyme catalyzes the following reactions with Prelog specificity: the reduction of acetophenone, 2,2,2-trifluoroacetophenone, alpha-tetralone, and alpha-methyl and alpha-ethyl benzoylformates to (S)-(-)-1-phenylethanol (>99% enantiomeric excess [ee]), (R)-alpha-(trifluoromethyl)benzyl alcohol (93% ee), (S)-alpha-tetralol (>99% ee), methyl (R)-(-)-mandelate (92% ee), and ethyl (R)-(-)-mandelate (95% ee), respectively, by way of an efficient in situ NADH-recycling system involving 2-propanol and a second thermophilic ADH. This study further supports the critical role of the D37 residue in discriminating NAD(H) from NADP(H) in members of the SDR superfamily.

  14. A Key Enzyme of the NAD+ Salvage Pathway in Thermus thermophilus: Characterization of Nicotinamidase and the Impact of Its Gene Deletion at High Temperatures.

    Science.gov (United States)

    Taniguchi, Hironori; Sungwallek, Sathidaphorn; Chotchuang, Phatcharin; Okano, Kenji; Honda, Kohsuke

    2017-09-01

    NAD (NAD + ) is a cofactor related to many cellular processes. This cofactor is known to be unstable, especially at high temperatures, where it chemically decomposes to nicotinamide and ADP-ribose. Bacteria, yeast, and higher organisms possess the salvage pathway for reconstructing NAD + from these decomposition products; however, the importance of the salvage pathway for survival is not well elucidated, except for in pathogens lacking the NAD + de novo synthesis pathway. Herein, we report the importance of the NAD + salvage pathway in the thermophilic bacterium Thermus thermophilus HB8 at high temperatures. We identified the gene encoding nicotinamidase (TTHA0328), which catalyzes the first reaction of the NAD + salvage pathway. This recombinant enzyme has a high catalytic activity against nicotinamide ( K m of 17 μM, k cat of 50 s -1 , k cat / K m of 3.0 × 10 3 s -1 · mM -1 ). Deletion of this gene abolished nicotinamide deamination activity in crude extracts of T. thermophilus and disrupted the NAD + salvage pathway in T. thermophilus Disruption of the salvage pathway led to the severe growth retardation at a higher temperature (80°C), owing to the drastic decrease in the intracellular concentrations of NAD + and NADH. IMPORTANCE NAD + and other nicotinamide cofactors are essential for cell metabolism. These molecules are unstable and decompose, even under the physiological conditions in most organisms. Thermophiles can survive at high temperatures where NAD + decomposition is, in general, more rapid. This study emphasizes that NAD + instability and its homeostasis can be one of the important factors for thermophile survival in extreme temperatures. Copyright © 2017 American Society for Microbiology.

  15. Analysis of the cooperative ATPase cycle of the AAA+ chaperone ClpB from Thermus thermophilus by using ordered heterohexamers with an alternating subunit arrangement.

    Science.gov (United States)

    Yamasaki, Takashi; Oohata, Yukiko; Nakamura, Toshiki; Watanabe, Yo-hei

    2015-04-10

    The ClpB/Hsp104 chaperone solubilizes and reactivates protein aggregates in cooperation with DnaK/Hsp70 and its cofactors. The ClpB/Hsp104 protomer has two AAA+ modules, AAA-1 and AAA-2, and forms a homohexamer. In the hexamer, these modules form a two-tiered ring in which each tier consists of homotypic AAA+ modules. By ATP binding and its hydrolysis at these AAA+ modules, ClpB/Hsp104 exerts the mechanical power required for protein disaggregation. Although ATPase cycle of this chaperone has been studied by several groups, an integrated understanding of this cycle has not been obtained because of the complexity of the mechanism and differences between species. To improve our understanding of the ATPase cycle, we prepared many ordered heterohexamers of ClpB from Thermus thermophilus, in which two subunits having different mutations were cross-linked to each other and arranged alternately and measured their nucleotide binding, ATP hydrolysis, and disaggregation abilities. The results indicated that the ATPase cycle of ClpB proceeded as follows: (i) the 12 AAA+ modules randomly bound ATP, (ii) the binding of four or more ATP to one AAA+ ring was sensed by a conserved Arg residue and converted another AAA+ ring into the ATPase-active form, and (iii) ATP hydrolysis occurred cooperatively in each ring. We also found that cooperative ATP hydrolysis in at least one ring was needed for the disaggregation activity of ClpB. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Molecular docking and molecular dynamics simulation studies on Thermus thermophilus leucyl-tRNA synthetase complexed with different amino acids and pre-transfer editing substrates

    Directory of Open Access Journals (Sweden)

    Rayevsky A. V.

    2016-02-01

    Full Text Available Aim. To investigate the structural bases for the amino acid selectivity of the Thermus thermophilus leucyl-tRNA synthetase (LeuRSTT aminoacylation site and to disclose the binding pattern of pre-transfer editing substrates. Methods. Eight amino acids proposed as semi-cognate substrates for aminoacylation and eight aminoacyl-adenylates (formed from AMP and eight amino acids were prepared in zwitterions form. The protein structure with a co-crystallized substrate in the aminoacylation site [PDBID: 1OBH] was taken from RCSB. Docking settings and evaluation of substrate efficiency were followed by twofold docking function analysis for each conformation with Gold CCDC. The molecular dynamics simulation was performed using Gromacs. The procedures of relaxation and binding study were separated in two different subsequent simulations for 50ns and 5ns. Results. The evaluation of substrate efficiency for 8 amino acids by twofold docking function analysis, based on score values,has shown that the ligands of LeuRSTT can be positioned in the following order: Leu>Nva>Hcy>Nle>Met>Cys>Ile >Val. MD simulation has revealed lower electrostatic interactions of isoleucine with the active site of the enzyme compared with those for norvaline and leucine. In the case of aminoacyl-adenylates no significant differences were found based on score values for both GoldScore and Asp functions. Molecular dynamics of leucyl-, isoleucyl- and norvalyl-adenylates showed that the most stable and conformationally favorable is leucine, then follow norvaline and isoleucine. It has been also found that the TYR43 of the active site covers carboxyl group of leucine and norvaline like a shield and deflected towards isoleucine, allowing water molecules to come closer. Conclusions. In this study we revealed some structural basis for screening unfavorable substrates by shape, size and flexibility of a radical. The results obtained for different amino acids by molecular docking and MD studies

  17. Reaction of cyanide with cytochrome ba3 from Thermus thermophilus: spectroscopic characterization of the Fe(II)a3-CN.Cu(II)B-CN complex suggests four 14N atoms are coordinated to CuB.

    Science.gov (United States)

    Surerus, K K; Oertling, W A; Fan, C; Gurbiel, R J; Einarsdóttir, O; Antholine, W E; Dyer, R B; Hoffman, B M; Woodruff, W H; Fee, J A

    1992-01-01

    Cytochrome ba3 from Thermus thermophilus reacts slowly with excess HCN at pH 7.4 to create a form of the enzyme in which CuA, cytochrome b, and CuB remain oxidized, while cytochrome a3 is reduced by one electron, presumably with the formation of cyanogen. We have examined this form of the enzyme by UV-visible, resonance Raman, EPR, and electron nuclear double resonance spectroscopies in conjunction with permutations of 13C- and 15N-labeled cyanide. The results support a model in which one CN- binds through the carbon atom to ferrous a3, supporting a low-spin (S = 0) configuration on the Fe; bridging by this cyanide to the CuB is weak or absent. Four 14N atoms, presumably donated by histidine residues of the protein, provide a strong equatorial ligand field about CuB; a second CN- is coordinated through the carbon atom to CuB in an axial position. PMID:1314380

  18. Thermo-reversible inhibition makes aqualysin 1 from Thermus aquaticus a potent tool for studying the contribution of the wheat gluten network to the crumb texture of fresh bread.

    Science.gov (United States)

    Verbauwhede, Annelien E; Lambrecht, Marlies A; Fierens, Ellen; Hermans, Senne; Shegay, Oksana; Brijs, Kristof; Delcour, Jan A

    2018-10-30

    The thermo-active serine peptidase aqualysin 1 (Aq1) of Thermus aquaticus was applied in bread making to study the relative contribution of thermoset gluten to bread crumb texture. Aq1 is active between 30 °C and 90 °C with an optimum activity temperature of around 65 °C. It is inhibited by wheat endogenous serine peptidase inhibitors during dough mixing and fermentation and starts hydrolyzing gluten proteins during baking above 80 °C when the enzyme is no longer inhibited and most of the starch is gelatinized and contributes to structure formation. Aq1 activity reduced the molecular weight of gluten proteins and significantly increased their extractability in sodium dodecyl sulfate containing medium. While it had no impact on the specific bread volume and only limited impact on hardness, cohesiveness, springiness, resilience and chewiness, it impacted bread crumb coherence. We conclude that starch has a greater impact on crumb texture than thermoset gluten. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Overexpression of a novel thermostable and chloride-tolerant laccase from Thermus thermophilus SG0.5JP17-16 in Pichia pastoris and its application in synthetic dye decolorization.

    Directory of Open Access Journals (Sweden)

    Huiping Liu

    Full Text Available Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid (ABTS, syringaldazine (SGZ, guaiacol, and 2,6-dimethoxyphenol (2,6-DMP as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.

  20. ORF Alignment: NC_005835 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available [Thermus thermophilus HB8] pdb|1FP9|A Chain A, Structure ... Of Amylomaltase From Thermus Thermophilus Hb8 In Space... ... Amylomaltase From Thermus Thermophilus Hb8 In Space ... Group P21212 ... Length = 500 ... Query

  1. ORF Alignment: NC_006461 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available [Thermus thermophilus HB8] pdb|1FP9|A Chain A, Structure ... Of Amylomaltase From Thermus Thermophilus Hb8 In Space... ... Amylomaltase From Thermus Thermophilus Hb8 In Space ... Group P21212 ... Length = 500 ... Query

  2. Electron transfer among the CuA-, heme b- and a3-centers of Thermus thermophilus cytochrome ba3

    DEFF Research Database (Denmark)

    Farver, Ole; Chen, Ying; Fee, James A

    2006-01-01

    The 1-methyl-nicotinamide radical (MNA(*)), produced by pulse radiolysis has previously been shown to reduce the Cu(A)-site of cytochromes aa(3), a process followed by intramolecular electron transfer (ET) to the heme a but not to the heme a(3) [Farver, O., Grell, E., Ludwig, B., Michel, H. and P...

  3. Pulse Radiolysis Studies of Temperature Dependent Electron Transfers among Redox Centers in ba(3)-Cytochrome c Oxidase from Thermus thermophilus

    DEFF Research Database (Denmark)

    Farver, Ole; Wherland, Scot; Antholine, William E

    2010-01-01

    The functioning of cytochrome c oxidases involves orchestration of long-range electron transfer (ET) events among the four redox active metal centers. We report the temperature dependence of electron transfer from the Cu(A)(r) site to the low-spin heme-(a)b(o) site, i.e., Cu(A)(r) + heme-a(b)(o) ......The functioning of cytochrome c oxidases involves orchestration of long-range electron transfer (ET) events among the four redox active metal centers. We report the temperature dependence of electron transfer from the Cu(A)(r) site to the low-spin heme-(a)b(o) site, i.e., Cu(A)(r) + heme...... in cytochrome ba(3) had no effect on the rate of this reaction whereas the II-Met160Leu Cu(A)-mutation was slower by an amount corresponding to a decreased driving force of ∼0.06 eV. The structures support the presence of a common, electron-conducting "wire" between Cu(A) and heme-a(b). The transfer...

  4. New biotechnological perspectives of a NADH oxidase variant from Thermus thermophilus HB27 as NAD+-recycling enzyme

    Directory of Open Access Journals (Sweden)

    Rocha-Martín Javier

    2011-11-01

    Full Text Available Abstract Background The number of biotransformations that use nicotinamide recycling systems is exponentially growing. For this reason one of the current challenges in biocatalysis is to develop and optimize more simple and efficient cofactor recycling systems. One promising approach to regenerate NAD+ pools is the use of NADH-oxidases that reduce oxygen to hydrogen peroxide while oxidizing NADH to NAD+. This class of enzymes may be applied to asymmetric reduction of prochiral substrates in order to obtain enantiopure compounds. Results The NADH-oxidase (NOX presented here is a flavoenzyme which needs exogenous FAD or FMN to reach its maximum velocity. Interestingly, this enzyme is 6-fold hyperactivated by incubation at high temperatures (80°C under limiting concentrations of flavin cofactor, a change that remains stable even at low temperatures (37°C. The hyperactivated form presented a high specific activity (37.5 U/mg at low temperatures despite isolation from a thermophile source. Immobilization of NOX onto agarose activated with glyoxyl groups yielded the most stable enzyme preparation (6-fold more stable than the hyperactivated soluble enzyme. The immobilized derivative was able to be reactivated under physiological conditions after inactivation by high solvent concentrations. The inactivation/reactivation cycle could be repeated at least three times, recovering full NOX activity in all cases after the reactivation step. This immobilized catalyst is presented as a recycling partner for a thermophile alcohol dehydrogenase in order to perform the kinetic resolution secondary alcohols. Conclusion We have designed, developed and characterized a heterogeneous and robust biocatalyst which has been used as recycling partner in the kinetic resolution of rac-1-phenylethanol. The high stability along with its capability to be reactivated makes this biocatalyst highly re-useable for cofactor recycling in redox biotransformations.

  5. Time-resolved generation of membrane potential by ba3 cytochrome c oxidase from Thermus thermophilus coupled to single electron injection into the O and OH states.

    Science.gov (United States)

    Siletsky, Sergey A; Belevich, Ilya; Belevich, Nikolai P; Soulimane, Tewfik; Wikström, Mårten

    2017-11-01

    Two electrogenic phases with characteristic times of ~14μs and ~290μs are resolved in the kinetics of membrane potential generation coupled to single-electron reduction of the oxidized "relaxed" O state of ba 3 oxidase from T. thermophilus (O→E transition). The rapid phase reflects electron redistribution between Cu A and heme b. The slow phase includes electron redistribution from both Cu A and heme b to heme a 3 , and electrogenic proton transfer coupled to reduction of heme a 3 . The distance of proton translocation corresponds to uptake of a proton from the inner water phase into the binuclear center where heme a 3 is reduced, but there is no proton pumping and no reduction of Cu B . Single-electron reduction of the oxidized "unrelaxed" state (O H →E H transition) is accompanied by electrogenic reduction of the heme b/heme a 3 pair by Cu A in a "fast" phase (~22μs) and transfer of protons in "middle" and "slow" electrogenic phases (~0.185ms and ~0.78ms) coupled to electron redistribution from the heme b/heme a 3 pair to the Cu B site. The "middle" and "slow" electrogenic phases seem to be associated with transfer of protons to the proton-loading site (PLS) of the proton pump, but when all injected electrons reach Cu B the electronic charge appears to be compensated by back-leakage of the protons from the PLS into the binuclear site. Thus proton pumping occurs only to the extent of ~0.1 H + /e - , probably due to the formed membrane potential in the experiment. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Crystal Structure of the Thermus thermophilus 16 S rRNA Methyltransferase RsmC in Complex with Cofactor and Substrate Guanosine

    Energy Technology Data Exchange (ETDEWEB)

    Demirci, H.; Gregory, S; Dahlberg, A; Jogl, G

    2008-01-01

    Post-transcriptional modification is a ubiquitous feature of ribosomal RNA in all kingdoms of life. Modified nucleotides are generally clustered in functionally important regions of the ribosome, but the functional contribution to protein synthesis is not well understood. Here we describe high resolution crystal structures for the N{sup 2}-guanine methyltransferase RsmC that modifies residue G1207 in 16 S rRNA near the decoding site of the 30 S ribosomal subunit. RsmC is a class I S-adenosyl-l-methionine-dependent methyltransferase composed of two methyltransferase domains. However, only one S-adenosyl-l-methionine molecule and one substrate molecule, guanosine, bind in the ternary complex. The N-terminal domain does not bind any cofactor. Two structures with bound S-adenosyl-l-methionine and S-adenosyl-l-homocysteine confirm that the cofactor binding mode is highly similar to other class I methyltransferases. Secondary structure elements of the N-terminal domain contribute to cofactor-binding interactions and restrict access to the cofactor-binding site. The orientation of guanosine in the active site reveals that G1207 has to disengage from its Watson-Crick base pairing interaction with C1051 in the 16 S rRNA and flip out into the active site prior to its modification. Inspection of the 30 S crystal structure indicates that access to G1207 by RsmC is incompatible with the native subunit structure, consistent with previous suggestions that this enzyme recognizes a subunit assembly intermediate.

  7. Mutations in conserved helix 69 of 23S rRNA of Thermus thermophilus that affect capreomycin resistance but not posttranscriptional modifications

    DEFF Research Database (Denmark)

    Monshupanee, Tanakarn; Gregory, Steven T; Douthwaite, Stephen

    2008-01-01

    of previously reported capreomycin resistance base substitutions. Capreomycin resistance in other bacteria has been shown to result from inactivation of the TlyA methyltransferase which 2'-O methylates C1920 of 23S rRNA. Inactivation of the tlyA gene in T. thermophilus does not affect its sensitivity...... for resistance to the tuberactinomycin antibiotic capreomycin. Two base substitutions, A1913U and mU1915G, and a single base deletion, DeltamU1915, were identified in helix 69 of 23S rRNA, a structural element that forms part of an interribosomal subunit bridge with the decoding center of 16S rRNA, the site...... to capreomycin. Finally, none of the mutations in helix 69 interferes with methylation at C1920 or with pseudouridylation at positions 1911 and 1917. We conclude that the resistance phenotype is a consequence of structural changes introduced by the mutations....

  8. NCBI nr-aa BLAST: CBRC-TBEL-01-0397 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-0397 ref|YP_005572.1| competence factor comEC [Thermus thermophilus HB...27] gb|AAG34707.1|AF319938_2 competence factor ComEC [Thermus thermophilus] gb|AAS81945.1| competence factor comEC [Thermus thermophilus HB27] YP_005572.1 0.10 31% ...

  9. NCBI nr-aa BLAST: CBRC-TBEL-01-0397 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-TBEL-01-0397 ref|YP_145234.1| competence protein ComEC [Thermus thermophilus HB8] dbj|BAD71791.1| compe...tence protein ComEC [Thermus thermophilus HB8] YP_145234.1 0.020 31% ...

  10. NCBI nr-aa BLAST: CBRC-MLUC-01-1078 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MLUC-01-1078 ref|ZP_03497741.1| DNA internalization-related competence protein... ComEC/Rec2 [Thermus aquaticus Y51MC23] gb|EED09156.1| DNA internalization-related competence protein ComEC/Rec2 [Thermus aquaticus Y51MC23] ZP_03497741.1 0.005 32% ...

  11. ORF Alignment: NC_005835 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available ine pdb|1FJG|S Chain S, Structure ... Of The Thermus Thermophilus 30s Ribosomal Subunit In ... Complex With The Antibioti...cs Streptomycin, ... Spectinomycin, And Paromomycin ... Length = 84 ... Q

  12. ORF Alignment: NC_006461 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available ine pdb|1FJG|S Chain S, Structure ... Of The Thermus Thermophilus 30s Ribosomal Subunit In ... Complex With The Antibioti...cs Streptomycin, ... Spectinomycin, And Paromomycin ... Length = 84 ... Q

  13. Temperature Dependence of the Stability of Ion Pair Interactions ...

    Indian Academy of Sciences (India)

    The occurrence of bridging water molecules between the ions ensures that the ions are not ... The structural features that render this thermostability ..... dehydrogenase single site mutant T198I from Thermus thermophilus with PDB ID 1BDM.

  14. Peroxiredoxins: A Model for a Self-Assembling Nanoscale System

    Science.gov (United States)

    2014-08-24

    Introduction 24 Chapter Three describes the identification of a potential peroxiredoxin enzyme in the genome of the thermophilic bacterium Thermus...Discussion (TaqPrx) 80 3.9 Summary of results Comparison of the sequences of thermophilic peroxiredoxins showed that the enzyme reported by Logan and...well as that of the other two variants. A second enzyme was also examined, a thermophilic peroxiredoxin from the bacterium Thermus aquaticus. This

  15. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  16. Purification and Characterization of Taq Polymerase: A 9-Week Biochemistry Laboratory Project for Undergraduate Students

    Science.gov (United States)

    Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.

    2010-01-01

    We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…

  17. Thermostabilization of desulfurization enzymes from Rhodococcos sp. IGTS8. Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    John J. Kilbane II

    2000-12-15

    The objective of this project was to develop thermophilic cultures capable of expressing the desulfurization (dsz) operon of Rhodococcus sp. IGTS8. The approaches taken in this project included the development of plasmid and integrative expression vectors that function well in Thermus thermophilus, the cloning of Rhodococcus dsz genes in Thermus expression vectors, and the isolation of bacterial cultures that express the dsz operon at thermophilic temperatures. This project has resulted in the development of plasmid and integrative expression vectors for use in T. thermophilus. The dsz genes have been expressed at moderately thermophilic temperatures (52 C) in Mycobacterium phlei and at temperatures as high as 72 C in T. thermophilus. The tools and methods developed in this project will be generally useful for the expression of heterologous genes in Thermus. Key developments in the project have been the isolation of a Mycobacterium phlei culture capable of expressing the desulfurization operon at 52 C, development of plasmid and integrative expression vectors for Thermus thermophilus, and the development of a host-vector system based on the malate dehydrogenase gene that allows plasmids to be stably maintained in T. thermophilus and provides a convenient reporter gene for the accurate quantification of gene expression. Publications have been prepared regarding each of these topics; these preprints are included.

  18. Diet-dependent depletion of queuosine in tRNAs in Caenorhabditis ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    1972). Apart from the known exceptions of yeast, Thermus .... Hypomodification can also be induced by .... Panels C and D show UV absorbance of the Q and manQ peaks, respectively. ... E. coli B105(Q–), a mutant strain lacking Q modification.

  19. Production of 2-deoxyribose 5-phosphate from fructose to demonstrate a potential of artificial bio-synthetic pathway using thermophilic enzymes.

    Science.gov (United States)

    Honda, Kohsuke; Maya, Shohei; Omasa, Takeshi; Hirota, Ryuichi; Kuroda, Akio; Ohtake, Hisao

    2010-08-02

    Six thermophilic enzymes from Thermus thermophilus were used to construct an 'artificial bio-synthetic pathway' for the production of 2-deoxyribose 5-phosphate from fructose. By a simple operation using six recombinant Escherichia coli strains producing the thermophilic enzymes, respectively, fructose was converted to 2-deoxyribose 5-phosphate with a molar yield of 55%. Copyright 2010 Elsevier B.V. All rights reserved.

  20. An intermolecular binding mechanism involving multiple LysM domains mediates carbohydrate recognition by an endopeptidase

    DEFF Research Database (Denmark)

    Wong, Mei Mei Jaslyn Elizabeth; Midtgaard, Søren Roi; Gysel, Kira

    2015-01-01

    of multiple LysM domains in substrate binding has so far lacked support from high-resolution structures of ligand-bound complexes. Here, a structural study of the Thermus thermophilus NlpC/P60 endopeptidase containing two LysM domains is presented. The crystal structure and small-angle X-ray scattering...

  1. Functional consequences of T-stem mutations in E. coli tRNA Thr UGU in vitro and in vivo

    DEFF Research Database (Denmark)

    Saks, Margaret E; Sanderson, Lee E; Choi, Daniel S

    2011-01-01

    The binding affinities between Escherichia coli EF-Tu and 34 single and double base-pair changes in the T stem of E. coli tRNAThrUGU were compared with similar data obtained previously for several aa-tRNAs binding to Thermus thermophilus EF-Tu. With a single exception, the two proteins bound to m...

  2. Characterization of Thermostable Cellulases Produced by Bacillus and Geobacillus Strains

    Science.gov (United States)

    Bacterial community composition of thermophilic (60 deg C) mixed cellulose-enrichment cultures was examined by constructing a 16S rDNA clone library which demonstrated major lineages affiliated to Actinobacteria, Bacteroidetes, Chloroflexi, Deinococcus-Thermus, Firmicutes, and Proteobacteria. A tot...

  3. THERMUS—A thermal model package for ROOT

    Science.gov (United States)

    Wheaton, S.; Cleymans, J.; Hauer, M.

    2009-01-01

    THERMUS is a package of C++ classes and functions allowing statistical-thermal model analyses of particle production in relativistic heavy-ion collisions to be performed within the ROOT framework of analysis. Calculations are possible within three statistical ensembles; a grand-canonical treatment of the conserved charges B, S and Q, a fully canonical treatment of the conserved charges, and a mixed-canonical ensemble combining a canonical treatment of strangeness with a grand-canonical treatment of baryon number and electric charge. THERMUS allows for the assignment of decay chains and detector efficiencies specific to each particle yield, which enables sensible fitting of model parameters to experimental data. Program summaryProgram title: THERMUS, version 2.1 Catalogue identifier: AEBW_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEBW_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 17 152 No. of bytes in distributed program, including test data, etc.: 93 581 Distribution format: tar.gz Programming language: C++ Computer: PC, Pentium 4, 1 GB RAM (not hardware dependent) Operating system: Linux: FEDORA, RedHat, etc. Classification: 17.7 External routines: Numerical Recipes in C [1], ROOT [2] Nature of problem: Statistical-thermal model analyses of heavy-ion collision data require the calculation of both primordial particle densities and contributions from resonance decay. A set of thermal parameters (the number depending on the particular model imposed) and a set of thermalized particles, with their decays specified, is required as input to these models. The output is then a complete set of primordial thermal quantities for each particle, together with the contributions to the final particle yields from resonance decay. In many applications of

  4. CarD uses a minor groove wedge mechanism to stabilize the RNA polymerase open promoter complex.

    Science.gov (United States)

    Bae, Brian; Chen, James; Davis, Elizabeth; Leon, Katherine; Darst, Seth A; Campbell, Elizabeth A

    2015-09-08

    A key point to regulate gene expression is at transcription initiation, and activators play a major role. CarD, an essential activator in Mycobacterium tuberculosis, is found in many bacteria, including Thermus species, but absent in Escherichia coli. To delineate the molecular mechanism of CarD, we determined crystal structures of Thermus transcription initiation complexes containing CarD. The structures show CarD interacts with the unique DNA topology presented by the upstream double-stranded/single-stranded DNA junction of the transcription bubble. We confirm that our structures correspond to functional activation complexes, and extend our understanding of the role of a conserved CarD Trp residue that serves as a minor groove wedge, preventing collapse of the transcription bubble to stabilize the transcription initiation complex. Unlike E. coli RNAP, many bacterial RNAPs form unstable promoter complexes, explaining the need for CarD.

  5. A review of the microbiology of the Rehai geothermal field in Tengchong, Yunnan Province, China

    Directory of Open Access Journals (Sweden)

    Brian P. Hedlund

    2012-05-01

    Full Text Available The Rehai Geothermal Field, located in Tengchong County, in central-western Yunnan Province, is the largest and most intensively studied geothermal field in China. A wide physicochemical diversity of springs (ambient to ∼97 °C; pH from ≤1.8 to ≥9.3 provides a multitude of niches for extremophilic microorganisms. A variety of studies have focused on the cultivation, identification, basic physiology, taxonomy, and biotechnological potential of thermophilic microorganisms from Rehai. Thermophilic bacteria isolated from Rehai belong to the phyla Firmicutes and Deinococcus-Thermus. Firmicutes include neutrophilic or alkaliphilic Anoxybacillus, Bacillus, Caldalkalibacillus, Caldanaerobacter, Laceyella, and Geobacillus, as well as thermoacidophilic Alicyclobacillus and Sulfobacillus. Isolates from the Deinococcus-Thermus phylum include several Meiothermus and Thermus species. Many of these bacteria synthesize thermostable polymer-degrading enzymes that may be useful for biotechnology. The thermoacidophilic archaea Acidianus, Metallosphaera, and Sulfolobus have also been isolated and studied. A few studies have reported the isolation of thermophilic viruses belonging to Siphoviridae (TTSP4 and TTSP10 and Fuselloviridae (STSV1 infecting Thermus spp. and Sulfolobus spp., respectively. More recently, cultivation-independent studies using 16S rRNA gene sequences, shotgun metagenomics, or “functional gene” sequences have revealed a much broader diversity of microorganisms than represented in culture. Studies of the gene and mRNA encoding the large subunit of the ammonia monooxygenase (amoA of ammonia-oxidizing Archaea (AOA and the tetraether lipid crenarchaeol, a potential biomarker for AOA, suggest a wide diversity, but possibly low abundance, of thermophilic AOA in Rehai. Finally, we introduce the Tengchong Partnerships in International Research and Education (PIRE project, an international collaboration between Chinese and U.S. scientists with

  6. A Metagenomic Analysis of Microbial Contamination in Aviation Fuels

    Science.gov (United States)

    2009-03-01

    classification by the RDP Classifier, sequences similar to members of the Acidobacteria, Actinobacteria , Bacteroidetes, Chloroflexi, Cyanobacteria... Actinobacteria 85 63 4 152 Bacteroidetes 5 0 0 5 Chloroflexi 7 0 0 7 Cyanobacteria 56 0 0 56 Deinococcus-Thermus 2 0 0 2 Firmicutes 83 99 2 184...Members of the Proteobacteria, Firmicutes and Actinobacteria were represented in all three fuel types; in Jet A and Biodiesel they were the only

  7. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    Science.gov (United States)

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  8. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    OpenAIRE

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-01-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in ...

  9. ORF Alignment: NC_005835 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available thermophilus HB8] pdb|1V9M|A Chain A, Crystal Structure ... Of The C Subunit Of V-Type Atpase From Th...ermus ... Thermophilus pdb|1R5Z|C Chain C, Crystal Structure Of ... Subunit C Of V-Atpase pdb|...1R5Z|B Chain B, Crystal ... Structure Of Subunit C Of V-Atpase pdb|1R5Z|A ...Chain A, ... Crystal Structure Of Subunit C Of V-Atpase ... Length = 319 ... Query: 5 ... FAYLNARVR

  10. ORF Alignment: NC_006461 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available thermophilus HB8] pdb|1V9M|A Chain A, Crystal Structure ... Of The C Subunit Of V-Type Atpase From Th...ermus ... Thermophilus pdb|1R5Z|C Chain C, Crystal Structure Of ... Subunit C Of V-Atpase pdb|...1R5Z|B Chain B, Crystal ... Structure Of Subunit C Of V-Atpase pdb|1R5Z|A ...Chain A, ... Crystal Structure Of Subunit C Of V-Atpase ... Length = 319 ... Query: 5 ... FAYLNARVR

  11. Mutational analysis of Escherichia coli elongation factor Tu in search of a role for the N-terminal region

    DEFF Research Database (Denmark)

    Mansilla, Francisco; Knudsen, Charlotte Rohde; Laurberg, M

    1998-01-01

    We have mutated lysine 2 and arginine 7 in elongation factor Tu from Escherichia coli separately either to alanine or glutamic acid. The aim of the work was to reveal the possible interactions between the conserved N-terminal part of the molecule, which is rich in basic residues and aminoacyl...... this activity. Furthermore, arginine 7 seems to play a role in regulating the binding of GTP. The three-dimensional structure of the ternary complex, EF-Tu:GTP:Phe-tRNAPhe, involving Thermus aquaticus EF-Tu and yeast Phe-tRNA(Phe), shows that Arg7 is in a position which permits salt bridge formation with Asp284...

  12. The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.

    OpenAIRE

    Czworkowski, J; Wang, J; Steitz, T A; Moore, P B

    1994-01-01

    Elongation factor G (EF-G) catalyzes the translocation step of protein synthesis in bacteria, and like the other bacterial elongation factor, EF-Tu--whose structure is already known--it is a member of the GTPase superfamily. We have determined the crystal structure of EF-G--GDP from Thermus thermophilus. It is an elongated molecule whose large, N-terminal domain resembles the G domain of EF-Tu, except for a 90 residue insert, which covers a surface that is involved in nucleotide exchange in E...

  13. Rheological and gelation properties of rice starch modified with 4-alpha-glucanotransferase.

    Science.gov (United States)

    Lee, Kwang Yeon; Kim, Yong-Ro; Park, Kwan Hwa; Lee, Hyeon Gyu

    2008-04-01

    Rheological measurements were performed to characterize rice starch modified with 4-alpha-glucanotransferase (4alphaGTase) isolated from Thermus scotoductus, in terms of effects of the enzyme and starch concentration on flow behavior, gel strength, and melting and gelling kinetics of the modified rice starch. Consistency index decreased and flow behavior index increased with the level of enzyme treatment, and at high level of enzyme treatment, it demonstrated Bingham plastic behavior. As the level of enzyme decreased and the starch concentration increased, gelation time decreased and the final gel strength increased significantly. Regardless of treatment variables, all the modified starch gels melted at similar temperature.

  14. Plants of the fynbos biome harbour host species-specific bacterial communities.

    Science.gov (United States)

    Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel

    2016-08-01

    The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Microbiological investigations on the water of a thermal bath at Budapest.

    Science.gov (United States)

    Szuróczki, Sára; Kéki, Zsuzsa; Káli, Szandra; Lippai, Anett; Márialigeti, Károly; Tóth, Erika

    2016-06-01

    Thermal baths are unique aquatic environments combining a wide variety of natural and anthropogenic ecological factors, which also appear in their microbiological state. There is limited information on the microbiology of thermal baths in their complexity, tracking community shifts from the thermal wells to the pools. In the present study, the natural microbial community of well and pool waters in Gellért bath was studied in detail by cultivation-based techniques. To isolate bacteria, 10% R2A and minimal synthetic media (with "bath water") with agar-agar and gellan gum were used after prolonged incubation time; moreover, polyurethane blocks covered with media were also applied. Strains were identified by sequencing their 16S rRNA gene after grouping them by amplified rDNA restriction analysis. From each sample, the dominance of Alphaproteobacteria was characteristic though their diversity differed among samples. Members of Actinobacteria, Firmicutes, Beta- and Gamma-proteobacteria, Deinococcus-Thermus, and Bacteroidetes were also identified. Representatives of Deinococcus-Thermus phylum appeared only in the pool water. The largest groups in the pool water belonged to the Tistrella and Chelatococcus genera. The most dominant member in the well water was a new taxon, its similarity to Hartmannibacter diazotrophicus as closest relative was 93.93%.

  16. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    Science.gov (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  17. Improved immobilization of laccase on a glassy carbon electrode by oriented covalent attachment

    Directory of Open Access Journals (Sweden)

    Liu Xin

    2014-01-01

    Full Text Available A laccase from Thermus thermophilus HB27 was reported to be potentially useful in the design of a temperature controlled biofuel cell. For enhancing its application in different thermal conditions, we engineered a laccase-oriented immobilized electrode. A site-directed mutant N323C of the laccase was constructed. A photometric assay was employed in order to compare the catalytic properties of wild-type laccase and mutant. The mutant was attached to a glass carbon electrode by covalent cross-linking. The electrochemical properties of the immobilized laccase were investigated by cyclic voltammetry. This immobilization allowed the active electrode to function at temperatures up to 95°C. The thermal and pH dependence profiles were similar to those of the soluble enzyme investigated by spectrophotometry.

  18. Complete genome sequence of Truepera radiovictrix type strain (RQ-24T)

    Energy Technology Data Exchange (ETDEWEB)

    Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Rohde, Christine [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Munk, Christine [Joint Genome Institute, Walnut Creek, California; Nolan, Matt [Joint Genome Institute, Walnut Creek, California; Lucas, Susan [Joint Genome Institute, Walnut Creek, California; Glavina Del Rio, Tijana [Joint Genome Institute, Walnut Creek, California; Tice, Hope [Joint Genome Institute, Walnut Creek, California; Deshpande, Shweta [Joint Genome Institute, Walnut Creek, California; Cheng, Jan-Fang [Joint Genome Institute, Walnut Creek, California; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [Joint Genome Institute, Walnut Creek, California; Liolios, Konstantinos [Joint Genome Institute, Walnut Creek, California; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [Joint Genome Institute, Walnut Creek, California; Palaniappan, Krishna [Joint Genome Institute, Walnut Creek, California; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Chang, Yun-Juan [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [Joint Genome Institute, Walnut Creek, California; Bristow, James [Joint Genome Institute, Walnut Creek, California; Eisen, Jonathan [Joint Genome Institute, Walnut Creek, California; Markowitz, Victor [Joint Genome Institute, Walnut Creek, California; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [Joint Genome Institute, Walnut Creek, California; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Lapidus, Alla L. [Joint Genome Institute, Walnut Creek, California

    2011-01-01

    Truepera radiovictrix Albuquerque et al. 2005 is the type species of the genus Truepera within the phylum Deinococcus/Thermus. T. radiovictrix is of special interest not only because of its isolated phylogenetic location in the order Deinococcales, but also because of its ability to grow under multiple extreme conditions in alkaline, moderately saline, and high temperature habitats. Of particular interest is the fact that, T. radiovictrix is also remarkably resistant to ionizing radiation, a feature it shares with members of the genus Deinococcus. This is the first completed genome sequence of a member of the family Trueperaceae and the fourth type strain genome sequence from a member of the order Deinococcales. The 3,260,398 bp long genome with its 2,994 protein-coding and 52 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  19. Complete genome sequence of the aerobic, heterotroph Marinithermus hydrothermalis type strain (T1T) from a deep-sea hydrothermal vent chimney

    Energy Technology Data Exchange (ETDEWEB)

    Copeland, A [U.S. Department of Energy, Joint Genome Institute; Gu, Wei [U.S. Department of Energy, Joint Genome Institute; Yasawong, Montri [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Pan, Chongle [ORNL; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Tindall, Brian [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Sikorski, Johannes [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute

    2012-01-01

    Marinithermus hydrothermalis Sako et al. 2003 is the type species of the monotypic genus Marinithermus. M. hydrothermalis T1 T was the first isolate within the phylum ThermusDeinococcus to exhibit optimal growth under a salinity equivalent to that of sea water and to have an absolute requirement for NaCl for growth. M. hydrothermalis T1 T is of interest because it may provide a new insight into the ecological significance of the aerobic, thermophilic decomposers in the circulation of organic compounds in deep-sea hydrothermal vent ecosystems. This is the first completed genome sequence of a member of the genus Marinithermus and the seventh sequence from the family Thermaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,269,167 bp long genome with its 2,251 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  20. Structure, function, and regulation of enzymes involved in amino acid metabolism of bacteria and archaea.

    Science.gov (United States)

    Tomita, Takeo

    2017-11-01

    Amino acids are essential components in all organisms because they are building blocks of proteins. They are also produced industrially and used for various purposes. For example, L-glutamate is used as the component of "umami" taste and lysine has been used as livestock feed. Recently, many kinds of amino acids have attracted attention as biological regulators and are used for a healthy life. Thus, to clarify the mechanism of how amino acids are biosynthesized and how they work as biological regulators will lead to further effective utilization of them. Here, I review the leucine-induced-allosteric activation of glutamate dehydrogenase (GDH) from Thermus thermophilus and the relationship with the allosteric regulation of GDH from mammals. Next, I describe structural insights into the efficient production of L-glutamate by GDH from an excellent L-glutamate producer, Corynebacterium glutamicum. Finally, I review the structural biology of lysine biosynthesis of thermophilic bacterium and archaea.

  1. Complete genome sequence of Truepera radiovictrix type strain (RQ-24).

    Science.gov (United States)

    Ivanova, Natalia; Rohde, Christine; Munk, Christine; Nolan, Matt; Lucas, Susan; Del Rio, Tijana Glavina; Tice, Hope; Deshpande, Shweta; Cheng, Jan-Fang; Tapia, Roxane; Han, Cliff; Goodwin, Lynne; Pitluck, Sam; Liolios, Konstantinos; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Hauser, Loren; Chang, Yun-Juan; Jeffries, Cynthia D; Brambilla, Evelyne; Rohde, Manfred; Göker, Markus; Tindall, Brian J; Woyke, Tanja; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Lapidus, Alla

    2011-02-22

    Truepera radiovictrix Albuquerque et al. 2005 is the type species of the genus Truepera within the phylum "Deinococcus/Thermus". T. radiovictrix is of special interest not only because of its isolated phylogenetic location in the order Deinococcales, but also because of its ability to grow under multiple extreme conditions in alkaline, moderately saline, and high temperature habitats. Of particular interest is the fact that, T. radiovictrix is also remarkably resistant to ionizing radiation, a feature it shares with members of the genus Deinococcus. This is the first completed genome sequence of a member of the family Trueperaceae and the fourth type strain genome sequence from a member of the order Deinococcales. The 3,260,398 bp long genome with its 2,994 protein-coding and 52 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  2. Complete genome sequence of the aerobic, heterotroph Marinithermus hydrothermalis type strain (T1(T)) from a deep-sea hydrothermal vent chimney.

    Science.gov (United States)

    Copeland, Alex; Gu, Wei; Yasawong, Montri; Lapidus, Alla; Lucas, Susan; Deshpande, Shweta; Pagani, Ioanna; Tapia, Roxanne; Cheng, Jan-Fang; Goodwin, Lynne A; Pitluck, Sam; Liolios, Konstantinos; Ivanova, Natalia; Mavromatis, Konstantinos; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Pan, Chongle; Brambilla, Evelyne-Marie; Rohde, Manfred; Tindall, Brian J; Sikorski, Johannes; Göker, Markus; Detter, John C; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Woyke, Tanja

    2012-03-19

    Marinithermus hydrothermalis Sako et al. 2003 is the type species of the monotypic genus Marinithermus. M. hydrothermalis T1(T) was the first isolate within the phylum "Thermus-Deinococcus" to exhibit optimal growth under a salinity equivalent to that of sea water and to have an absolute requirement for NaCl for growth. M. hydrothermalis T1(T) is of interest because it may provide a new insight into the ecological significance of the aerobic, thermophilic decomposers in the circulation of organic compounds in deep-sea hydrothermal vent ecosystems. This is the first completed genome sequence of a member of the genus Marinithermus and the seventh sequence from the family Thermaceae. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 2,269,167 bp long genome with its 2,251 protein-coding and 59 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  3. The role of Glu259 in Escherichia coli elongation factor Tu in ternary complex formation

    DEFF Research Database (Denmark)

    Nautrup Pedersen, Gitte; Rattenborg, Thomas; Knudsen, Charlotte Rohde

    1998-01-01

    Determination of the crystal structure of the ternary complex formed between elongation factor Tu:GTP and aminoacylated tRNA revealed three regions of interaction between elongation factor Tu and tRNA. The structure indicates that the conserved glutamic acid at position 271 in Thermus aquaticus EF-Tu...... could be involved in the binding of the 3' CCA-Phe end of the aminoacylated tRNA. Therefore, the corresponding residue, Glu259, of Escherichia coli EF-Tu was mutated into alanine, aspartic acid, glutamine and tyrosine, in order to substantiate the crystallographic structural evidence and to obtain...... of interaction with tRNA, while mutation to tyrosine abolished completely the interaction with tRNA. Finally, mutation to glutamine resulted in an elongation factor Tu variant behaving like the wild type. In conclusion, the environment around the site binding the CCA-Phe end of the tRNA is very restricted...

  4. Flexibility of cold- and heat-adapted subtilisin-like serine proteinases evaluated with fluorescence quenching and molecular dynamics

    DEFF Research Database (Denmark)

    Sigtryggsdóttir, Asta Rós; Papaleo, Elena; Thorbjarnardóttir, Sigríður H.

    2014-01-01

    activity of cold adapted enzymes when compared to homologues from thermophiles, reflects their higher molecular flexibility. To assess a potential difference in molecular flexibility between the two homologous proteinases, we have measured their Trp fluorescence quenching by acrylamide at different......The subtilisin-like serine proteinases, VPR, from a psychrotrophic Vibrio species and aqualysin I (AQUI) from the thermophile Thermus aquaticus, are structural homologues, but differ significantly with respect to stability and catalytic properties. It has been postulated that the higher catalytic...... to Trp (Y191W). A lower quenching effect of acrylamide on the intrinsic fluorescence of the thermophilic AQUI_Y191W was observed at all temperatures measured (10-55°C), suggesting that it possesses a more rigid structure than VPR. The MD analysis (Cα rmsf profiles) showed that even though VPR and AQUI...

  5. Microbial growth in domestic hot water systems with special emphasis on connections to district heating networks

    Energy Technology Data Exchange (ETDEWEB)

    Frederiksen, S [Lund Institute of Technology, Dept. of Heat and Power Engineering, Lund (SE); Krongaard Kristensen, K [Regional Food and Hygiene Authority, Koebenhavns Amt Vest, Glostrup (DK)

    1991-01-01

    It is by now well-estalished that domestic hot water systems often harbour Legionella bacteria. Measurements into a number of Danish systems have revealed many other bacteria, among them the thermophilic species Thermus, which is predominantly found on heating coils, where local temperatures are higher. This bacterium not only hampers heat transfer due to fouling, but may also be pathogenic, due to release of endotoxins. Its presence may explain a wide spectrum of symptoms experienced by people after hot baths, such as rashes and itching. The paper summarizes these findings, and on this basis engineering and microbiological considerations are presented in an effort to find ways of future control strategies that go beyond Legionella prevention. Special attention is given to district heating connections, in which low supply and return temperatures are generally wanted in the primary circuit. (author) 16 refs.

  6. Microbial community structure in a thermophilic aerobic digester used as a sludge pretreatment process for the mesophilic anaerobic digestion and the enhancement of methane production.

    Science.gov (United States)

    Jang, Hyun Min; Park, Sang Kyu; Ha, Jeong Hyub; Park, Jong Moon

    2013-10-01

    An effective two-stage sewage sludge digestion process, consisting of thermophilic aerobic digestion (TAD) followed by mesophilic anaerobic digestion (MAD), was developed for efficient sludge reduction and methane production. Using TAD as a biological pretreatment, the total volatile suspended solid reduction (VSSR) and methane production rate (MPR) in the MAD reactor were significantly improved. According to denaturing gradient gel electrophoresis (DGGE) analysis, the results indicated that the dominant bacteria species such as Ureibacillus thermophiles and Bacterium thermus in TAD were major routes for enhancing soluble organic matter. TAD pretreatment using a relatively short SRT of 1 day showed highly increased soluble organic products and positively affected an increment of bacteria populations which performed interrelated microbial metabolisms with methanogenic species in the MAD; consequently, a quantitative real-time PCR indicated greatly increased Methanosarcinales (acetate-utilizing methanogens) in the MAD, resulting in enhanced methane production. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. STUDI PENDAHULUAN ENZIM KITINASE EXTRASELULER YANG DIHASILKAN OLEH ISOLAT BAKTERI ASAL MANADO 1 [Preliminary Study of Extracellular Chitinase Produced by Bacteria Isolated from Manado

    Directory of Open Access Journals (Sweden)

    E.Y. Purwani 1

    2002-08-01

    Full Text Available Chitinolytic bacteria were isolated from several exotic area in Manado Province. The most potential isolate, namely 13.26, was isolated from Tompaso. The isolate was cultured in the thermus medium containing colloidal chitin as a carbon source for 5 days at 55°C to produce chitinase. It was observed that chitinase was most active at 65��C and the optimum pH was 8 in boric acid-borax buffer. Ammonium sulfate (50% saturation precipitation of the protein increased the specific activity of the enzyme from 0.20 unit/mg protein (in culture supernatant to 0.28 unit/mg protein. The molecular weight as estimated by zymogram analysis was180 kDa

  8. Effector region of the translation elongation factor EF-Tu.GTP complex stabilizes an orthoester acid intermediate structure of aminoacyl-tRNA in a ternary complex.

    Science.gov (United States)

    Förster, C; Limmer, S; Zeidler, W; Sprinzl, M

    1994-01-01

    tRNA(Val) from Escherichia coli was aminoacylated with [1-13C]valine and its complex with Thermus thermophilus elongation factor EF-Tu.GTP was analyzed by 13C NMR spectroscopy. The results suggest that the aminoacyl residue of the valyl-tRNA in ternary complex with bacterial EF-Tu and GTP is not attached to tRNA by a regular ester bond to either a 2'- or 3'-hydroxyl group; instead, an intermediate orthoester acid structure with covalent linkage to both vicinal hydroxyls of the terminal adenosine-76 is formed. Mutation of arginine-59 located in the effector region of EF-Tu, a conserved residue in protein elongation factors and the alpha subunits of heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins), abolishes the stabilization of the orthoester acid structure of aminoacyl-tRNA. PMID:8183898

  9. Exploration of freely available web-interfaces for comparative homology modelling of microbial proteins.

    Science.gov (United States)

    Nema, Vijay; Pal, Sudhir Kumar

    2013-01-01

    This study was conducted to find the best suited freely available software for modelling of proteins by taking a few sample proteins. The proteins used were small to big in size with available crystal structures for the purpose of benchmarking. Key players like Phyre2, Swiss-Model, CPHmodels-3.0, Homer, (PS)2, (PS)(2)-V(2), Modweb were used for the comparison and model generation. Benchmarking process was done for four proteins, Icl, InhA, and KatG of Mycobacterium tuberculosis and RpoB of Thermus Thermophilus to get the most suited software. Parameters compared during analysis gave relatively better values for Phyre2 and Swiss-Model. This comparative study gave the information that Phyre2 and Swiss-Model make good models of small and large proteins as compared to other screened software. Other software was also good but is often not very efficient in providing full-length and properly folded structure.

  10. Structural and Biochemical Studies of LysM Proteins

    DEFF Research Database (Denmark)

    Wong, Mei Mei Jaslyn Elizabeth

    2017-01-01

    . Most of the signalling components in the Nod factor signalling pathway have been identified through genetic approaches. The current symbiosis signalling model, however, lacks components that could link Nod factor perception at the plasma membrane to downstream responses, such as calcium influx and perinuclear calcium...... involved in peptidoglycan hydrolysis; the Cell Wall Lytic enzyme associated with cell Separation (CwlS) from Bacillus subtilis, and P60_Tth from Thermus thermopiles. Biochemical studies conducted on purified CwlS showed that multiple LysM modules function cooperatively to bind N-acetylglucosamine (NAG......-induced intermolecular dimerization was observed in the co-crystal structure of P60_2LysM and NAG6. Until today, this is the only structural evidence illustrating intermolecular dimerization of LysM proteins. Intermolecular dimerization of plant LysM receptor kinases (RK) has been proposed as a mechanism...

  11. Impact of SRT on the performance of MBRs for the treatment of high strength landfill leachate

    KAUST Repository

    El-Fadel, M.; Sleem, F.; Hashisho, J.; Saikaly, Pascal; Alameddine, I.; Ghanimeh, S.

    2017-01-01

    This study examines the performance and fouling potential of flat sheet (FS) and hollow fiber (HF) membrane bioreactors (MBRs) during the treatment of high strength landfill leachate under varying solid retention times (SRT = 5–20 days). Mixed-liquor bacterial communities were examined over time using 16S rRNA gene sequence analysis in an attempt to define linkages between the system performance and the microbial community composition. Similarly, biofilm samples were collected at the end of each SRT to characterize the microbial communities that evolved on the surface of the FS and HF membranes. In general, both systems exhibited comparable removal efficiencies that dropped significantly as SRT was decreased down to 5 days. Noticeably, ammonia and nitrite oxidizing bacteria were not detected at the tested SRTs. This suggests that the nitrifiers were not enriched, possibly due to the high organic and ammonium content of the leachate that led to low TN and NH3 removal efficiency. The steady-state fouling rate of both membranes increased linearly with the decrease in SRT at an estimated factor of 1.1 and 1.2 for the FS- and HF-MBR, respectively, when the SRT was reduced from 15 to 10 days and from 10 to 5 days. Similar dominant genera were detected in both MBRs, including Pseudomonas, Aequorivita, Ulvibacter, Taibaiella, and Thermus. Aequorivita, Taibaiella; Thermus were the dominant genera in the biofilms. Hierarchical clustering and non-metric multidimensional scaling revealed that while the mixed liquor communities in the FS-MBR and HF-MBRs were dynamic, they clustered separately. Similarly, biofilm communities on the FS and HF membranes differed in the dynamic bacterial community structure, especially for the FS-MBR; however this was less dynamic than the mixed liquor community.

  12. Synthetic metabolic engineering-a novel, simple technology for designing a chimeric metabolic pathway

    Directory of Open Access Journals (Sweden)

    Ye Xiaoting

    2012-09-01

    Full Text Available Abstract Background The integration of biotechnology into chemical manufacturing has been recognized as a key technology to build a sustainable society. However, the practical applications of biocatalytic chemical conversions are often restricted due to their complexities involving the unpredictability of product yield and the troublesome controls in fermentation processes. One of the possible strategies to overcome these limitations is to eliminate the use of living microorganisms and to use only enzymes involved in the metabolic pathway. Use of recombinant mesophiles producing thermophilic enzymes at high temperature results in denaturation of indigenous proteins and elimination of undesired side reactions; consequently, highly selective and stable biocatalytic modules can be readily prepared. By rationally combining those modules together, artificial synthetic pathways specialized for chemical manufacturing could be designed and constructed. Results A chimeric Embden-Meyerhof (EM pathway with balanced consumption and regeneration of ATP and ADP was constructed by using nine recombinant E. coli strains overproducing either one of the seven glycolytic enzymes of Thermus thermophilus, the cofactor-independent phosphoglycerate mutase of Pyrococcus horikoshii, or the non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase of Thermococcus kodakarensis. By coupling this pathway with the Thermus malate/lactate dehydrogenase, a stoichiometric amount of lactate was produced from glucose with an overall ATP turnover number of 31. Conclusions In this study, a novel and simple technology for flexible design of a bespoke metabolic pathway was developed. The concept has been testified via a non-ATP-forming chimeric EM pathway. We designated this technology as “synthetic metabolic engineering”. Our technology is, in principle, applicable to all thermophilic enzymes as long as they can be functionally expressed in the host, and thus would be

  13. Gammasphaerolipovirus, a newly proposed bacteriophage genus, unifies viruses of halophilic archaea and thermophilic bacteria within the novel family Sphaerolipoviridae.

    Science.gov (United States)

    Pawlowski, Alice; Rissanen, Ilona; Bamford, Jaana K H; Krupovic, Mart; Jalasvuori, Matti

    2014-06-01

    A new family of viruses named Sphaerolipoviridae has been proposed recently. It comprises icosahedral, tailless haloarchaeal viruses with an internal lipid membrane located between the protein capsid and the dsDNA genome. The proposed family Sphaerolipoviridae was divided into two genera: Alphasphaerolipovirus, including Haloarcula hispanica viruses SH1, PH1 and HHIV-2, and Betasphaerolipovirus, including Natrinema virus SNJ1. Here, we propose to expand the family Sphaerolipoviridae to include a group of bacteriophages infecting extreme thermophilic Thermus thermophilus and sharing a number of structural and genomic properties with archaeal sphaerolipoviruses. This new group comprises two members, lytic phage P23-77 and temperate phage IN93, as well as putative members P23-72 and P23-65H. In addition, several related proviruses have been discovered as integrated elements in bacterial genomes of the families Thermus and Meiothermus. Morphology of the virus particles and the overall capsid architecture of these bacteriophages resembles that of archaeal members of the Sphaerolipoviridae, including an unusual capsid arrangement in a T = 28 dextro lattice. Alpha- and betasphaerolipoviruses share with P23-77-like bacteriophages a conserved block of core genes that encode a putative genome-packaging ATPase and the two major capsid proteins (MCPs). The recently determined X-ray structure of the small and large MCPs of P23-77 revealed a single beta-barrel (jelly-roll) fold that is superimposable with the cryo-EM density maps of the SH1 capsomers. Given the common features of these viruses, we propose to include the so far unclassified P23-77-like bacteriophages into a new genus, "Gammasphaerolipovirus", within the family Sphaerolipoviridae.

  14. Stable isotope labeling confirms mixotrophic nature of streamer biofilm communities at alkaline hot springs

    Directory of Open Access Journals (Sweden)

    Florence eSchubotz

    2015-02-01

    Full Text Available Streamer biofilm communities (SBC are often observed within chemosynthetic zones of Yellowstone hot spring outflow channels, where temperatures exceed those conducive to photosynthesis. Nearest the hydrothermal source (75-88°C SBC comprise thermophilic Archaea and Bacteria, often mixed communities including Desulfurococcales and uncultured Crenarchaeota, as well as Aquificae, Thermus, each carrying diagnostic membrane lipid biomarkers. We tested the hypothesis that SBC can alternate their metabolism between autotrophy and heterotrophy depending on substrate availability. Feeding experiments were performed at two alkaline hot springs in Yellowstone National Park: Octopus Spring and ‘Bison Pool’, using various 13C-labeled substrates (bicarbonate, formate, acetate and glucose to determine the relative uptake of these different carbon sources. Highest 13C uptake, at both sites, was from acetate into almost all bacterial fatty acids, particularly into methyl-branched C15, C17 and C19 fatty acids that are diagnostic for Thermus/Meiothermus and some Firmicutes as well as into universally common C16:0 and C18:0 fatty acids. 13C-glucose showed a similar, but a 10 to 30 times lower uptake across most fatty acids. 13C bicarbonate uptake, signifying the presence of autotrophic communities was only significant at ‘Bison Pool’ and was observed predominantly in non-specific saturated C16, C18, C20 and C22 fatty acids. Incorporation of 13C-formate occurred only at very low rates at ‘Bison Pool’ and was almost undetectable at Octopus Spring, suggesting that formate is not an important carbon source for SBC. 13C uptake into archaeal lipids occurred predominantly with 13C acetate, suggesting also that archaeal communities at both springs have primarily heterotrophic carbon assimilation pathways. We hypothesize that these communities are energy-limited and predominantly nurtured by input of exogenous organic material, with only a small fraction being

  15. Micro-organisms and divers exposure to radioactivity in spent fuel pools at nuclear power plants

    Energy Technology Data Exchange (ETDEWEB)

    Muniz de A, D. [Underwater Construction Corporation, Latin America, Fortaleza, Ceara (Brazil); Silva, R. [Universidade Federal do Rio de Janeiro, Instituto de Biofisica Carlos Chagas Filho, 21941-902 Rio de Janeiro (Brazil); Gomes N, C. A., E-mail: dmuniz@uccdive.com [Universidade Federal do Rio de Janeiro, Instituto de Biologia, Environmental Engineering Program, 21941-902 Rio de Janeiro (Brazil)

    2017-09-15

    Many nuclear power plants (NPPs) around the world are in the process of extending their lifespan from 40 to 60 years of operation. The NPP; Angra 1 (Brazil) has performed a thorough evaluation of its Life Extension Engineering project. In this context, the spent fuel pool (SFP) was one of the areas studied in order to demonstrate the plants integrity for a life extension. Micro-organisms growing on the liner of the fuel transfer channel (Ftc) and SFP can form a film of bacteria, which is highly resistant to radiation. This paper aims to compare the micro-organisms found in NPP Angra 1 with those reported to other NPPs and also relates their occurrence with the radiation levels at the sites. It also compares divers exposure to radioactivity during underwater activities in the SFP. Fourteen samples were collected on the surface of the liners of the Ftc, the SFP and the drains within the fuel building (FB) of Angra 1. For the identification of the micro-organisms, a metagenomics analysis was performed by random sequencing (Shotgun) and the use of Ion Torrent PGM Sequence r. Twelve micro-organisms phyla were identified; Acido-bacteria, Actino-bacteria, Bacteroidetes, Chlamydiae, Chlorobi, Chloroflexi, Cyano-bacteria, Deinococcus-Thermus, Firmicutes, Planctomycetes, Proteo-bacteria, and Verrucomicrobia as well as organisms not classified. In the SFP of Angra 1, the bacteria survived the exposure to a radiation of 0.416 Gy/h (high radiation). Deinococcus-thermus, bacteria identified in Angra 1, has resisted an exposure to 30,000 Gy/h in another plant. (Author)

  16. Micro-organisms and divers exposure to radioactivity in spent fuel pools at nuclear power plants

    International Nuclear Information System (INIS)

    Muniz de A, D.; Silva, R.; Gomes N, C. A.

    2017-09-01

    Many nuclear power plants (NPPs) around the world are in the process of extending their lifespan from 40 to 60 years of operation. The NPP; Angra 1 (Brazil) has performed a thorough evaluation of its Life Extension Engineering project. In this context, the spent fuel pool (SFP) was one of the areas studied in order to demonstrate the plants integrity for a life extension. Micro-organisms growing on the liner of the fuel transfer channel (Ftc) and SFP can form a film of bacteria, which is highly resistant to radiation. This paper aims to compare the micro-organisms found in NPP Angra 1 with those reported to other NPPs and also relates their occurrence with the radiation levels at the sites. It also compares divers exposure to radioactivity during underwater activities in the SFP. Fourteen samples were collected on the surface of the liners of the Ftc, the SFP and the drains within the fuel building (FB) of Angra 1. For the identification of the micro-organisms, a metagenomics analysis was performed by random sequencing (Shotgun) and the use of Ion Torrent PGM Sequence r. Twelve micro-organisms phyla were identified; Acido-bacteria, Actino-bacteria, Bacteroidetes, Chlamydiae, Chlorobi, Chloroflexi, Cyano-bacteria, Deinococcus-Thermus, Firmicutes, Planctomycetes, Proteo-bacteria, and Verrucomicrobia as well as organisms not classified. In the SFP of Angra 1, the bacteria survived the exposure to a radiation of 0.416 Gy/h (high radiation). Deinococcus-thermus, bacteria identified in Angra 1, has resisted an exposure to 30,000 Gy/h in another plant. (Author)

  17. Impact of SRT on the performance of MBRs for the treatment of high strength landfill leachate

    KAUST Repository

    El-Fadel, M.

    2017-12-14

    This study examines the performance and fouling potential of flat sheet (FS) and hollow fiber (HF) membrane bioreactors (MBRs) during the treatment of high strength landfill leachate under varying solid retention times (SRT = 5–20 days). Mixed-liquor bacterial communities were examined over time using 16S rRNA gene sequence analysis in an attempt to define linkages between the system performance and the microbial community composition. Similarly, biofilm samples were collected at the end of each SRT to characterize the microbial communities that evolved on the surface of the FS and HF membranes. In general, both systems exhibited comparable removal efficiencies that dropped significantly as SRT was decreased down to 5 days. Noticeably, ammonia and nitrite oxidizing bacteria were not detected at the tested SRTs. This suggests that the nitrifiers were not enriched, possibly due to the high organic and ammonium content of the leachate that led to low TN and NH3 removal efficiency. The steady-state fouling rate of both membranes increased linearly with the decrease in SRT at an estimated factor of 1.1 and 1.2 for the FS- and HF-MBR, respectively, when the SRT was reduced from 15 to 10 days and from 10 to 5 days. Similar dominant genera were detected in both MBRs, including Pseudomonas, Aequorivita, Ulvibacter, Taibaiella, and Thermus. Aequorivita, Taibaiella; Thermus were the dominant genera in the biofilms. Hierarchical clustering and non-metric multidimensional scaling revealed that while the mixed liquor communities in the FS-MBR and HF-MBRs were dynamic, they clustered separately. Similarly, biofilm communities on the FS and HF membranes differed in the dynamic bacterial community structure, especially for the FS-MBR; however this was less dynamic than the mixed liquor community.

  18. Final Report for Grant No. DE-FG02-98ER62583 ''Functional Analysis of the Genome Sequence of Deinococcus radiodurans''

    International Nuclear Information System (INIS)

    Daly, Michael J.

    2003-01-01

    Extremophiles are nearly always defined with singular characteristics that allow existence within a singular extreme environment. The bacterium Deinococcus radiodurans qualifies as a polyextremeophile, showing remarkable resistance to a range of damage caused by ionizing radiation, dessication, ultraviolet radiation, oxidizing agents, and electrophilic mutagens. D. radiodurans is most famous for its extreme resistance to ionizing radiation; it not only can grow continuously in the presence of chronic radiation (6,000 rad per hour), but it can survive acute exposures to gamma radiation that exceed 1,500,000 rads without lethality or induced mutation. These characteristics were the impetus for sequencing its genome. We completed an extensive comparative sequence analysis of the Deinococcus radiodurans (strain R1) genome. Deinococcus is the first representative with a completely sequenced genome from a bacterial branch of extremophiles - the Thermus/Deinococcus group. Phylogenetic tree analysis, combined with the identification of several synapomorphies between Thermus and Deinococcus, support that it is a very ancient branch localized in the vicinity of the bacterial tree root. Distinctive features of the Deinoccoccus genome as well as features shared with other free-living bacteria were revealed by comparison of its proteome to a collection of Clusters of Orthologous Groups of proteins (COGs). Analysis of paralogs in Deinococcus has revealed some unique protein families. In addition, specific expansions of several protein families including phosphatases, proteases, acyl transferases and MutT pyrophosphohydrolases, were detected. Genes that potentially affect DNA repair and recombination were investigated in detail. Some proteins appear to have been horizontally transferred from eukaryotes, and are not present in other bacteria. For example, three proteins homologous to plant desiccation-resistance proteins were identified and these are particularly interesting

  19. Coupling of anaerobic waste treatment to produce protein- and lipid-rich bacterial biomass

    Science.gov (United States)

    Steinberg, Lisa M.; Kronyak, Rachel E.; House, Christopher H.

    2017-11-01

    Future long-term manned space missions will require effective recycling of water and nutrients as part of a life support system. Biological waste treatment is less energy intensive than physicochemical treatment methods, yet anaerobic methanogenic waste treatment has been largely avoided due to slow treatment rates and safety issues concerning methane production. However, methane is generated during atmosphere regeneration on the ISS. Here we propose waste treatment via anaerobic digestion followed by methanotrophic growth of Methylococcus capsulatus to produce a protein- and lipid-rich biomass that can be directly consumed, or used to produce other high-protein food sources such as fish. To achieve more rapid methanogenic waste treatment, we built and tested a fixed-film, flow-through, anaerobic reactor to treat an ersatz wastewater. During steady-state operation, the reactor achieved a 97% chemical oxygen demand (COD) removal rate with an organic loading rate of 1740 g d-1 m-3 and a hydraulic retention time of 12.25 d. The reactor was also tested on three occasions by feeding ca. 500 g COD in less than 12 h, representing 50x the daily feeding rate, with COD removal rates ranging from 56-70%, demonstrating the ability of the reactor to respond to overfeeding events. While investigating the storage of treated reactor effluent at a pH of 12, we isolated a strain of Halomonas desiderata capable of acetate degradation under high pH conditions. We then tested the nutritional content of the alkaliphilic Halomonas desiderata strain, as well as the thermophile Thermus aquaticus, as supplemental protein and lipid sources that grow in conditions that should preclude pathogens. The M. capsulatus biomass consisted of 52% protein and 36% lipids, the H. desiderata biomass consisted of 15% protein and 7% lipids, and the Thermus aquaticus biomass consisted of 61% protein and 16% lipids. This work demonstrates the feasibility of rapid waste treatment in a compact reactor design

  20. Bacterial Diversity in Bentonites, Engineered Barrier for Deep Geological Disposal of Radioactive Wastes.

    Science.gov (United States)

    Lopez-Fernandez, Margarita; Cherkouk, Andrea; Vilchez-Vargas, Ramiro; Jauregui, Ruy; Pieper, Dietmar; Boon, Nico; Sanchez-Castro, Ivan; Merroun, Mohamed L

    2015-11-01

    The long-term disposal of radioactive wastes in a deep geological repository is the accepted international solution for the treatment and management of these special residues. The microbial community of the selected host rocks and engineered barriers for the deep geological repository may affect the performance and the safety of the radioactive waste disposal. In this work, the bacterial population of bentonite formations of Almeria (Spain), selected as a reference material for bentonite-engineered barriers in the disposal of radioactive wastes, was studied. 16S ribosomal RNA (rRNA) gene-based approaches were used to study the bacterial community of the bentonite samples by traditional clone libraries and Illumina sequencing. Using both techniques, the bacterial diversity analysis revealed similar results, with phylotypes belonging to 14 different bacterial phyla: Acidobacteria, Actinobacteria, Armatimonadetes, Bacteroidetes, Chloroflexi, Cyanobacteria, Deinococcus-Thermus, Firmicutes, Gemmatimonadetes, Planctomycetes, Proteobacteria, Nitrospirae, Verrucomicrobia and an unknown phylum. The dominant groups of the community were represented by Proteobacteria and Bacteroidetes. A high diversity was found in three of the studied samples. However, two samples were less diverse and dominated by Betaproteobacteria.

  1. Spatial distribution of microbial communities in the shallow submarine alkaline hydrothermal field of the Prony Bay, New Caledonia.

    Science.gov (United States)

    Quéméneur, Marianne; Bes, Méline; Postec, Anne; Mei, Nan; Hamelin, Jérôme; Monnin, Christophe; Chavagnac, Valérie; Payri, Claude; Pelletier, Bernard; Guentas-Dombrowsky, Linda; Gérard, Martine; Pisapia, Céline; Gérard, Emmanuelle; Ménez, Bénédicte; Ollivier, Bernard; Erauso, Gaël

    2014-12-01

    The shallow submarine hydrothermal field of the Prony Bay (New Caledonia) discharges hydrogen- and methane-rich fluids with low salinity, temperature (serpentinization reactions of the ultramafic basement into the lagoon seawater. They are responsible for the formation of carbonate chimneys at the lagoon seafloor. Capillary electrophoresis single-strand conformation polymorphism fingerprinting, quantitative polymerase chain reaction and sequence analysis of 16S rRNA genes revealed changes in microbial community structure, abundance and diversity depending on the location, water depth, and structure of the carbonate chimneys. The low archaeal diversity was dominated by few uncultured Methanosarcinales similar to those found in other serpentinization-driven submarine and subterrestrial ecosystems (e.g. Lost City, The Cedars). The most abundant and diverse bacterial communities were mainly composed of Chloroflexi, Deinococcus-Thermus, Firmicutes and Proteobacteria. Functional gene analysis revealed similar abundance and diversity of both Methanosarcinales methanoarchaea, and Desulfovibrionales and Desulfobacterales sulfate-reducers in the studied sites. Molecular studies suggest that redox reactions involving hydrogen, methane and sulfur compounds (e.g. sulfate) are the energy driving forces of the microbial communities inhabiting the Prony hydrothermal system.

  2. Detailed analysis of RNA-protein interactions within the bacterial ribosomal protein L5/5S rRNA complex.

    Science.gov (United States)

    Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav

    2002-12-01

    The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.

  3. Detecting protein-protein interactions in the intact cell of Bacillus subtilis (ATCC 6633).

    Science.gov (United States)

    Winters, Michael S; Day, R A

    2003-07-01

    The salt bridge, paired group-specific reagent cyanogen (ethanedinitrile; C(2)N(2)) converts naturally occurring pairs of functional groups into covalently linked products. Cyanogen readily permeates cell walls and membranes. When the paired groups are shared between associated proteins, isolation of the covalently linked proteins allows their identity to be assigned. Examination of organisms of known genome sequence permits identification of the linked proteins by mass spectrometric techniques applied to peptides derived from them. The cyanogen-linked proteins were isolated by polyacrylamide gel electrophoresis. Digestion of the isolated proteins with proteases of known specificity afforded sets of peptides that could be analyzed by mass spectrometry. These data were compared with those derived theoretically from the Swiss Protein Database by computer-based comparisons (Protein Prospector; http://prospector.ucsf.edu). Identification of associated proteins in the ribosome of Bacillus subtilis strain ATCC 6633 showed that there is an association homology with the association patterns of the ribosomal proteins of Haloarcula marismortui and Thermus thermophilus. In addition, other proteins involved in protein biosynthesis were shown to be associated with ribosomal proteins.

  4. Bacterial and archaeal diversities in Yunnan and Tibetan hot springs, China.

    Science.gov (United States)

    Song, Zhao-Qi; Wang, Feng-Ping; Zhi, Xiao-Yang; Chen, Jin-Quan; Zhou, En-Min; Liang, Feng; Xiao, Xiang; Tang, Shu-Kun; Jiang, Hong-Chen; Zhang, Chuanlun L; Dong, Hailiang; Li, Wen-Jun

    2013-04-01

    Thousands of hot springs are located in the north-eastern part of the Yunnan-Tibet geothermal zone, which is one of the most active geothermal areas in the world. However, a comprehensive and detailed understanding of microbial diversity in these hot springs is still lacking. In this study, bacterial and archaeal diversities were investigated in 16 hot springs (pH 3.2-8.6; temperature 47-96°C) in Yunnan Province and Tibet, China by using a barcoded 16S rRNA gene-pyrosequencing approach. Aquificae, Proteobacteria, Firmicutes, Deinococcus-Thermus and Bacteroidetes comprised the large portion of the bacterial communities in acidic hot springs. Non-acidic hot springs harboured more and variable bacterial phyla than acidic springs. Desulfurococcales and unclassified Crenarchaeota were the dominated groups in archaeal populations from most of the non-acidic hot springs; whereas, the archaeal community structure in acidic hot springs was simpler and characterized by Sulfolobales and Thermoplasmata. The phylogenetic analyses showed that Aquificae and Crenarchaeota were predominant in the investigated springs and possessed many phylogenetic lineages that have never been detected in other hot springs in the world. Thus findings from this study significantly improve our understanding of microbial diversity in terrestrial hot springs. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. Bacterial community in ancient permafrost alluvium at the Mammoth Mountain (Eastern Siberia).

    Science.gov (United States)

    Brouchkov, Anatoli; Kabilov, Marsel; Filippova, Svetlana; Baturina, Olga; Rogov, Victor; Galchenko, Valery; Mulyukin, Andrey; Fursova, Oksana; Pogorelko, Gennady

    2017-12-15

    Permanently frozen (approx. 3.5Ma) alluvial Neogene sediments exposed in the Aldan river valley at the Mammoth Mountain (Eastern Siberia) are unique, ancient, and poorly studied permafrost environments. So far, the structure of the indigenous bacterial community has remained unknown. Use of 16S metagenomic analysis with total DNA isolation using DNA Spin Kit for Soil (MO-Bio) and QIAamp DNA Stool Mini Kit (Qiagen) has revealed the major and minor bacterial lineages in the permafrost alluvium sediments. In sum, 61 Operational Taxonomic Units (OTUs) with 31,239 reads (Qiagen kit) and 15,404 reads (Mo-Bio kit) could be assigned to the known taxa. Only three phyla, Bacteroidetes, Proteobacteria and Firmicutes, comprised >5% of the OTUs abundance and accounted for 99% of the total reads. OTUs pertaining to the top families (Chitinophagaceae, Caulobacteraceae, Sphingomonadaceae, Bradyrhizobiaceae, Halomonadaceae) held >90% of reads. The abundance of Actinobacteria was less (0.7%), whereas members of other phyla (Deinococcus-Thermus, Cyanobacteria/Chloroplast, Fusobacteria, and Acidobacteria) constituted a minor fraction of reads. The bacterial community in the studied ancient alluvium differs from other permafrost sediments, mainly by predominance of Bacteroidetes (>52%). The diversity of this preserved bacterial community has the potential to cause effects unknown if prompted to thaw and spread with changing climate. Therefore, this study elicits further reason to study how reintroduction of these ancient bacteria could affect the surrounding ecosystem, including current bacterial species. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Protease activity of PprI facilitates DNA damage response: Mn2+-dependence and substrate sequence-specificity of the proteolytic reaction.

    Directory of Open Access Journals (Sweden)

    Yunguang Wang

    Full Text Available The extremophilic bacterium Deinococcus radiodurans exhibits an extraordinary resistance to ionizing radiation. Previous studies established that a protein named PprI, which exists only in the Deinococcus-Thermus family, acts as a general switch to orchestrate the expression of a number of DNA damage response (DDR proteins involved in cellular radio-resistance. Here we show that the regulatory mechanism of PprI depends on its Mn(2+-dependent protease activity toward DdrO, a transcription factor that suppresses DDR genes' expression. Recognition sequence-specificity around the PprI cleavage site is essential for DNA damage repair in vivo. PprI and DdrO mediate a novel DNA damage response pathway differing from the classic LexA-mediated SOS response system found in radiation-sensitive bacterium Escherichia coli. This PprI-mediated pathway in D. radiodurans is indispensable for its extreme radio-resistance and therefore its elucidation significantly advances our understanding of the DNA damage repair mechanism in this amazing organism.

  7. The diversity and abundance of bacteria and oxygenic phototrophs in saline biological desert crusts in Xinjiang, northwest China.

    Science.gov (United States)

    Li, Ke; Liu, Ruyin; Zhang, Hongxun; Yun, Juanli

    2013-07-01

    Although microorganisms, particularly oxygenic phototrophs, are known as the major players in the biogeochemical cycles of elements in desert soil ecosystems and have received extensive attention, still little is known about the effects of salinity on the composition and abundances of microbial community in desert soils. In this study, the diversity and abundance of bacteria and oxygenic phototrophs in biological desert crusts from Xinjiang province, which were under different salinity conditions, were investigated by using clone library and quantitative PCR (qPCR). The 16S rRNA gene phylogenetic analysis showed that cyanobacteria, mainly Microcoleus vagnitus of the order Oscillatoriales, were predominant in the low saline crusts, while other phototrophs, such as diatom, were the main microorganism group responsible for the oxygenic photosynthesis in the high saline crusts. Furthermore, the higher salt content in crusts may stimulate the growth of other bacteria, including Deinococcus-Thermus, Bacteroidetes, and some subdivisions of Proteobacteria (β-, γ-, and δ-Proteobacteria). The cpcBA-IGS gene analysis revealed the existence of novel M. vagnitus strains in this area. The qPCR results showed that the abundance of oxygenic phototrophs was significantly higher under lower saline condition than that in the higher saline crusts, suggesting that the higher salinity in desert crusts could suppress the numbers of total bacteria and phototrophic bacteria but did highly improve the diversity of salt-tolerant bacteria.

  8. Solution structure and elevator mechanism of the membrane electron transporter CcdA.

    Science.gov (United States)

    Zhou, Yunpeng; Bushweller, John H

    2018-02-01

    Membrane oxidoreductase CcdA plays a central role in supplying reducing equivalents from the bacterial cytoplasm to the envelope. It transports electrons across the membrane using a single pair of cysteines by a mechanism that has not yet been elucidated. Here we report an NMR structure of the Thermus thermophilus CcdA (TtCcdA) in an oxidized and outward-facing state. CcdA consists of two inverted structural repeats of three transmembrane helices (2 × 3-TM). We computationally modeled and experimentally validated an inward-facing state, which suggests that CcdA uses an elevator-type movement to shuttle the reactive cysteines across the membrane. CcdA belongs to the LysE superfamily, and thus its structure may be relevant to other LysE clan transporters. Structure comparisons of CcdA, semiSWEET, Pnu, and major facilitator superfamily (MFS) transporters provide insights into membrane transporter architecture and mechanism.

  9. Compositional profile of α / β-hydrolase fold proteins in mangrove soil metagenomes: prevalence of epoxide hydrolases and haloalkane dehalogenases in oil-contaminated sites.

    Science.gov (United States)

    Jiménez, Diego Javier; Dini-Andreote, Francisco; Ottoni, Júlia Ronzella; de Oliveira, Valéria Maia; van Elsas, Jan Dirk; Andreote, Fernando Dini

    2015-05-01

    The occurrence of genes encoding biotechnologically relevant α/β-hydrolases in mangrove soil microbial communities was assessed using data obtained by whole-metagenome sequencing of four mangroves areas, denoted BrMgv01 to BrMgv04, in São Paulo, Brazil. The sequences (215 Mb in total) were filtered based on local amino acid alignments against the Lipase Engineering Database. In total, 5923 unassembled sequences were affiliated with 30 different α/β-hydrolase fold superfamilies. The most abundant predicted proteins encompassed cytosolic hydrolases (abH08; ∼ 23%), microsomal hydrolases (abH09; ∼ 12%) and Moraxella lipase-like proteins (abH04 and abH01; mangroves BrMgv01-02-03. This suggested selection and putative involvement in local degradation/detoxification of the pollutants. Seven sequences that were annotated as genes for putative epoxide hydrolases and five for putative haloalkane dehalogenases were found in a fosmid library generated from BrMgv02 DNA. The latter enzymes were predicted to belong to Actinobacteria, Deinococcus-Thermus, Planctomycetes and Proteobacteria. Our integrated approach thus identified 12 genes (complete and/or partial) that may encode hitherto undescribed enzymes. The low amino acid identity (< 60%) with already-described genes opens perspectives for both production in an expression host and genetic screening of metagenomes. © 2014 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

  10. Compositional profile of α/β-hydrolase fold proteins in mangrove soil metagenomes: prevalence of epoxide hydrolases and haloalkane dehalogenases in oil-contaminated sites

    Science.gov (United States)

    Jiménez, Diego Javier; Dini-Andreote, Francisco; Ottoni, Júlia Ronzella; de Oliveira, Valéria Maia; van Elsas, Jan Dirk; Andreote, Fernando Dini

    2015-01-01

    The occurrence of genes encoding biotechnologically relevant α/β-hydrolases in mangrove soil microbial communities was assessed using data obtained by whole-metagenome sequencing of four mangroves areas, denoted BrMgv01 to BrMgv04, in São Paulo, Brazil. The sequences (215 Mb in total) were filtered based on local amino acid alignments against the Lipase Engineering Database. In total, 5923 unassembled sequences were affiliated with 30 different α/β-hydrolase fold superfamilies. The most abundant predicted proteins encompassed cytosolic hydrolases (abH08; ∼ 23%), microsomal hydrolases (abH09; ∼ 12%) and Moraxella lipase-like proteins (abH04 and abH01; mangroves BrMgv01-02-03. This suggested selection and putative involvement in local degradation/detoxification of the pollutants. Seven sequences that were annotated as genes for putative epoxide hydrolases and five for putative haloalkane dehalogenases were found in a fosmid library generated from BrMgv02 DNA. The latter enzymes were predicted to belong to Actinobacteria, Deinococcus-Thermus, Planctomycetes and Proteobacteria. Our integrated approach thus identified 12 genes (complete and/or partial) that may encode hitherto undescribed enzymes. The low amino acid identity (< 60%) with already-described genes opens perspectives for both production in an expression host and genetic screening of metagenomes. PMID:25171437

  11. PETROLEUM BIOREFINING FOR POLLUTION PREVENTION

    Energy Technology Data Exchange (ETDEWEB)

    John J. Kilbane II

    2002-03-01

    The objective of this project was to isolate and characterize thermophilic bacterial cultures that can be used for the selective removal of nitrogen, sulfur, and/or metals in the biorefining of petroleum. The project was completed on schedule and no major difficulties were encountered. Significant progress was made on multiple topics relevant to the development of a petroleum biorefining process capable of operating at thermophilic temperatures. New cultures capable of selectively cleaving C-N or C-S bonds in molecules relevant to petroleum were obtained, and the genes encoding the enzymes for these unique biochemical reactions were cloned and sequenced. Genetic tools were developed that enable the use of Thermus thermophilus as a host to express any gene of interest, and information was obtained regarding the optimum conditions for the growth of T. thermophilus. The development of a practical biorefining process still requires further research and the future research needs identified in this project include the development of new enzymes and pathways for the selective cleavage of C-N or C-S bonds that have higher specific activities, increased substrate range, and are capable of functioning at thermophilic temperatures. Additionally, there is a need for process engineering research to determine the maximum yield of biomass and cloned gene products that can be obtained in fed-batch cultures using T. thermophilus, and to determine the best configuration for a process employing biocatalysts to treat petroleum.

  12. Structure of Vibrio cholerae ribosome hibernation promoting factor

    International Nuclear Information System (INIS)

    De Bari, Heather; Berry, Edward A.

    2013-01-01

    The X-ray crystal structure of ribosome hibernation promoting factor from V. cholerae has been determined at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The X-ray crystal structure of ribosome hibernation promoting factor (HPF) from Vibrio cholerae is presented at 2.0 Å resolution. The crystal was phased by two-wavelength MAD using cocrystallized cobalt. The asymmetric unit contained two molecules of HPF linked by four Co atoms. The metal-binding sites observed in the crystal are probably not related to biological function. The structure of HPF has a typical β–α–β–β–β–α fold consistent with previous structures of YfiA and HPF from Escherichia coli. Comparison of the new structure with that of HPF from E. coli bound to the Thermus thermophilus ribosome [Polikanov et al. (2012 ▶), Science, 336, 915–918] shows that no significant structural changes are induced in HPF by binding

  13. Enzymatic production of dietary nucleotides from low-soluble purine bases by an efficient, thermostable and alkali-tolerant biocatalyst.

    Science.gov (United States)

    Del Arco, J; Cejudo-Sanches, J; Esteban, I; Clemente-Suárez, V J; Hormigo, D; Perona, A; Fernández-Lucas, J

    2017-12-15

    Traditionally, enzymatic synthesis of nucleoside-5'-monophosphates (5'-NMPs) using low water-soluble purine bases has been described as less efficient due to their low solubility in aqueous media. The use of enzymes from extremophiles, such as thermophiles or alkaliphiles, offers the potential to increase solubilisation of these bases by employing high temperatures or alkaline pH. This study describes the cloning, expression and purification of hypoxanthine-guanine-xanthine phosphoribosyltransferase from Thermus thermophilus (TtHGXPRT). Biochemical characterization indicates TtHGXPRT as a homotetramer with excellent activity and stability across a broad range of temperatures (50-90°C) and ionic strengths (0-500mMNaCl), but it also reveals an unusually high activity and stability under alkaline conditions (pH range 8-11). In order to explore the potential of TtHGXPRT as an industrial biocatalyst, enzymatic production of several dietary 5'-NMPs, such as 5'-GMP and 5'-IMP, was carried out at high concentrations of guanine and hypoxanthine. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. The formation of illite from nontronite by mesophilic and thermophilic bacterial reaction

    Science.gov (United States)

    Jaisi, Deb P.; Eberl, Dennis D.; Dong, Hailiang; Kim, Jinwook

    2011-01-01

    The formation of illite through the smectite-to-illite (S-I) reaction is considered to be one of the most important mineral reactions occurring during diagenesis. In biologically catalyzed systems, however, this transformation has been suggested to be rapid and to bypass the high temperature and long time requirements. To understand the factors that promote the S-I reaction, the present study focused on the effects of pH, temperature, solution chemistry, and aging on the S-I reaction in microbially mediated systems. Fe(III)-reduction experiments were performed in both growth and non-growth media with two types of bacteria: mesophilic (Shewanella putrefaciens CN32) and thermophilic (Thermus scotoductus SA-01). Reductive dissolution of NAu-2 was observed and the formation of illite in treatment with thermophilic SA-01 was indicated by X-ray diffraction (XRD) and high-resolution transmission electron microscopy (HRTEM). A basic pH (8.4) and high temperature (65°C) were the most favorable conditions for the formation of illite. A long incubation time was also found to enhance the formation of illite. K-nontronite (non-permanent fixation of K) was also detected and differentiated from the discrete illite in the XRD profiles. These results collectively suggested that the formation of illite associated with the biologically catalyzed smectite-to-illite reaction pathway may bypass the prolonged time and high temperature required for the S-I reaction in the absence of microbial activity.

  15. An intermolecular binding mechanism involving multiple LysM domains mediates carbohydrate recognition by an endopeptidase

    Energy Technology Data Exchange (ETDEWEB)

    Wong, Jaslyn E. M. M. [Aarhus University, Gustav Wieds Vej 10C, 8000 Aarhus (Denmark); Midtgaard, Søren Roi [University of Copenhagen, Universitetsparken 5, 2100 Copenhagen (Denmark); Gysel, Kira [Aarhus University, Gustav Wieds Vej 10C, 8000 Aarhus (Denmark); Thygesen, Mikkel B.; Sørensen, Kasper K.; Jensen, Knud J. [University of Copenhagen, Thorvaldsensvej 40, 1871 Frederiksberg C (Denmark); Stougaard, Jens; Thirup, Søren; Blaise, Mickaël, E-mail: mickael.blaise@cpbs.cnrs.fr [Aarhus University, Gustav Wieds Vej 10C, 8000 Aarhus (Denmark)

    2015-03-01

    The crystal and solution structures of the T. thermophilus NlpC/P60 d, l-endopeptidase as well as the co-crystal structure of its N-terminal LysM domains bound to chitohexaose allow a proposal to be made regarding how the enzyme recognizes peptidoglycan. LysM domains, which are frequently present as repetitive entities in both bacterial and plant proteins, are known to interact with carbohydrates containing N-acetylglucosamine (GlcNAc) moieties, such as chitin and peptidoglycan. In bacteria, the functional significance of the involvement of multiple LysM domains in substrate binding has so far lacked support from high-resolution structures of ligand-bound complexes. Here, a structural study of the Thermus thermophilus NlpC/P60 endopeptidase containing two LysM domains is presented. The crystal structure and small-angle X-ray scattering solution studies of this endopeptidase revealed the presence of a homodimer. The structure of the two LysM domains co-crystallized with N-acetyl-chitohexaose revealed a new intermolecular binding mode that may explain the differential interaction between LysM domains and short or long chitin oligomers. By combining the structural information with the three-dimensional model of peptidoglycan, a model suggesting how protein dimerization enhances the recognition of peptidoglycan is proposed.

  16. Combining crystallography and EPR: crystal and solution structures of the multidomain cochaperone DnaJ

    Energy Technology Data Exchange (ETDEWEB)

    Barends, Thomas R. M., E-mail: thomas.barends@mpimf-heidelberg.mpg.de [MPI for Medical Research, Heidelberg (Germany); Brosi, Richard W. W. [Freie Universitat Berlin, Berlin (Germany); Steinmetz, Andrea; Scherer, Anna; Hartmann, Elisabeth; Eschenbach, Jessica; Lorenz, Thorsten [MPI for Medical Research, Heidelberg (Germany); Seidel, Ralf [MPI for Molecular Physiology, Dortmund (Germany); Shoeman, Robert L.; Zimmermann, Sabine [MPI for Medical Research, Heidelberg (Germany); Bittl, Robert [Freie Universitat Berlin, Berlin (Germany); Schlichting, Ilme; Reinstein, Jochen [MPI for Medical Research, Heidelberg (Germany)

    2013-08-01

    The crystal structure of the N-terminal part of T. thermophilus DnaJ unexpectedly showed an ordered GF domain and guided the design of a construct enabling the first structure determination of a complete DnaJ cochaperone molecule. By combining the crystal structures with spin-labelling EPR and cross-linking in solution, a dynamic view of this flexible molecule was developed. Hsp70 chaperones assist in a large variety of protein-folding processes in the cell. Crucial for these activities is the regulation of Hsp70 by Hsp40 cochaperones. DnaJ, the bacterial homologue of Hsp40, stimulates ATP hydrolysis by DnaK (Hsp70) and thus mediates capture of substrate protein, but is also known to possess chaperone activity of its own. The first structure of a complete functional dimeric DnaJ was determined and the mobility of its individual domains in solution was investigated. Crystal structures of the complete molecular cochaperone DnaJ from Thermus thermophilus comprising the J, GF and C-terminal domains and of the J and GF domains alone showed an ordered GF domain interacting with the J domain. Structure-based EPR spin-labelling studies as well as cross-linking results showed the existence of multiple states of DnaJ in solution with different arrangements of the various domains, which has implications for the function of DnaJ.

  17. Crystal Structure of the 23S rRNA Fragment Specific to r-Protein L1 and Designed Model of the Ribosomal L1 Stalk from Haloarcula marismortui

    Directory of Open Access Journals (Sweden)

    Azat Gabdulkhakov

    2017-02-01

    Full Text Available The crystal structure of the 92-nucleotide L1-specific fragment of 23S rRNA from Haloarcula marismortui (Hma has been determined at 3.3 Å resolution. Similar to the corresponding bacterial rRNA fragments, this structure contains joined helix 76-77 topped by an approximately globular structure formed by the residual part of the L1 stalk rRNA. The position of HmaL1 relative to the rRNA was found by its docking to the rRNA fragment using the L1-rRNA complex from Thermus thermophilus as a guide model. In spite of the anomalous negative charge of the halophilic archaeal protein, the conformation of the HmaL1-rRNA interface appeared to be very close to that observed in all known L1-rRNA complexes. The designed structure of the L1 stalk was incorporated into the H. marismortui 50S ribosomal subunit. Comparison of relative positions of L1 stalks in 50S subunits from H. marismortui and T. thermophilus made it possible to reveal the site of inflection of rRNA during the ribosome function.

  18. Community dynamics and glycoside hydrolase activities of thermophilic bacterial consortia adapted to switchgrass

    Energy Technology Data Exchange (ETDEWEB)

    Gladden, J.M.; Allgaier, M.; Miller, C.S.; Hazen, T.C.; VanderGheynst, J.S.; Hugenholtz, P.; Simmons, B.A.; Singer, S.W.

    2011-05-01

    Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60 C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80 C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions.

  19. Thermophilic prokaryotic communities inhabiting the biofilm and well water of a thermal karst system located in Budapest (Hungary).

    Science.gov (United States)

    Anda, Dóra; Makk, Judit; Krett, Gergely; Jurecska, Laura; Márialigeti, Károly; Mádl-Szőnyi, Judit; Borsodi, Andrea K

    2015-07-01

    In this study, scanning electron microscopy (SEM) and 16S rRNA gene-based phylogenetic approach were applied to reveal the morphological structure and genetic diversity of thermophilic prokaryotic communities of a thermal karst well located in Budapest (Hungary). Bacterial and archaeal diversity of the well water (73.7 °C) and the biofilm developed on the inner surface of an outflow pipeline of the well were studied by molecular cloning method. According to the SEM images calcium carbonate minerals serve as a surface for colonization of bacterial aggregates. The vast majority of the bacterial and archaeal clones showed the highest sequence similarities to chemolithoautotrophic species. The bacterial clone libraries were dominated by sulfur oxidizer Thiobacillus (Betaproteobacteria) in the water and Sulfurihydrogenibium (Aquificae) in the biofilm. A relatively high proportion of molecular clones represented genera Thermus and Bellilinea in the biofilm library. The most abundant phylotypes both in water and biofilm archaeal clone libraries were closely related to thermophilic ammonia oxidizer Nitrosocaldus and Nitrososphaera but phylotypes belonging to methanogens were also detected. The results show that in addition to the bacterial sulfur and hydrogen oxidation, mainly archaeal ammonia oxidation may play a decisive role in the studied thermal karst system.

  20. Recognition of Ribosomal Protein L11 by the Protein Trimethyltransferase PrmA

    Energy Technology Data Exchange (ETDEWEB)

    Demirci,H.; Gregory, S.; Dahlberg, A.; Jogl, G.

    2007-01-01

    Bacterial ribosomal protein L11 is post-translationally trimethylated at multiple residues by a single methyltransferase, PrmA. Here, we describe four structures of PrmA from the extreme thermophile Thermus thermophilus. Two apo-PrmA structures at 1.59 and 2.3 {angstrom} resolution and a third with bound cofactor S-adenosyl-L-methionine at 1.75 {angstrom} each exhibit distinct relative positions of the substrate recognition and catalytic domains, revealing how PrmA can position the L11 substrate for multiple, consecutive side-chain methylation reactions. The fourth structure, the PrmA-L11 enzyme-substrate complex at 2.4 {angstrom} resolution, illustrates the highly specific interaction of the N-terminal domain with its substrate and places Lys39 in the PrmA active site. The presence of a unique flexible loop in the cofactor-binding site suggests how exchange of AdoMet with the reaction product S-adenosyl-L-homocysteine can occur without necessitating the dissociation of PrmA from L11. Finally, the mode of interaction of PrmA with L11 explains its observed preference for L11 as substrate before its assembly into the 50S ribosomal subunit.

  1. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  2. Electron-mediating Cu(A) centers in proteins

    DEFF Research Database (Denmark)

    Epel, Boris; Slutter, Claire S; Neese, Frank

    2002-01-01

    High field (W-band, 95 GHz) pulsed electron-nuclear double resonance (ENDOR) measurements were carried out on a number of proteins that contain the mixed-valence, binuclear electron-mediating Cu(A) center. These include nitrous oxide reductase (N(2)OR), the recombinant water-soluble fragment...... of subunit II of Thermus thermophilus cytochrome c oxidase (COX) ba(3) (M160T9), its M160QT0 mutant, where the weak axial methionine ligand has been replaced by a glutamine, and the engineered "purple" azurin (purpAz). The three-dimensional (3-D) structures of these proteins, apart from the mutant, are known...... indicates differences in the positions of the imidazole rings relative to the Cu(2)S(2) core. Comparison of the spectral features of the weakly coupled protons of M160QT0 with those of the other investigated proteins shows that they are very similar to those of purpAz, where the Cu(A) center is the most...

  3. HCIV-1 and Other Tailless Icosahedral Internal Membrane-Containing Viruses of the Family Sphaerolipoviridae

    Directory of Open Access Journals (Sweden)

    Tatiana A. Demina

    2017-02-01

    Full Text Available Members of the virus family Sphaerolipoviridae include both archaeal viruses and bacteriophages that possess a tailless icosahedral capsid with an internal membrane. The genera Alpha- and Betasphaerolipovirus comprise viruses that infect halophilic euryarchaea, whereas viruses of thermophilic Thermus bacteria belong to the genus Gammasphaerolipovirus. Both sequence-based and structural clustering of the major capsid proteins and ATPases of sphaerolipoviruses yield three distinct clades corresponding to these three genera. Conserved virion architectural principles observed in sphaerolipoviruses suggest that these viruses belong to the PRD1-adenovirus structural lineage. Here we focus on archaeal alphasphaerolipoviruses and their related putative proviruses. The highest sequence similarities among alphasphaerolipoviruses are observed in the core structural elements of their virions: the two major capsid proteins, the major membrane protein, and a putative packaging ATPase. A recently described tailless icosahedral haloarchaeal virus, Haloarcula californiae icosahedral virus 1 (HCIV-1, has a double-stranded DNA genome and an internal membrane lining the capsid. HCIV-1 shares significant similarities with the other tailless icosahedral internal membrane-containing haloarchaeal viruses of the family Sphaerolipoviridae. The proposal to include a new virus species, Haloarcula virus HCIV1, into the genus Alphasphaerolipovirus was submitted to the International Committee on Taxonomy of Viruses (ICTV in 2016.

  4. Stability of the 'L12 stalk' in ribosomes from mesophilic and (hyper)thermophilic Archaea and Bacteria.

    Science.gov (United States)

    Shcherbakov, D; Dontsova, M; Tribus, M; Garber, M; Piendl, W

    2006-01-01

    The ribosomal stalk complex, consisting of one molecule of L10 and four or six molecules of L12, is attached to 23S rRNA via protein L10. This complex forms the so-called 'L12 stalk' on the 50S ribosomal subunit. Ribosomal protein L11 binds to the same region of 23S rRNA and is located at the base of the 'L12 stalk'. The 'L12 stalk' plays a key role in the interaction of the ribosome with translation factors. In this study stalk complexes from mesophilic and (hyper)thermophilic species of the archaeal genus Methanococcus and from the Archaeon Sulfolobus solfataricus, as well as from the Bacteria Escherichia coli, Geobacillus stearothermophilus and Thermus thermophilus, were overproduced in E.coli and purified under non-denaturing conditions. Using filter-binding assays the affinities of the archaeal and bacterial complexes to their specific 23S rRNA target site were analyzed at different pH, ionic strength and temperature. Affinities of both archaeal and bacterial complexes for 23S rRNA vary by more than two orders of magnitude, correlating very well with the growth temperatures of the organisms. A cooperative effect of binding to 23S rRNA of protein L11 and the L10/L12(4) complex from mesophilic and thermophilic Archaea was shown to be temperature-dependent.

  5. Microbiological studies of hot springs in India: a review.

    Science.gov (United States)

    Poddar, Abhijit; Das, Subrata K

    2018-01-01

    The earliest microbiological studies on hot springs in India date from 2003, a much later date compared to global attention in this striking field of study. As of today, 28 out of 400 geothermal springs have been explored following both culturable and non-culturable approaches. The temperatures and pH of the springs are 37-99 °C and 6.8-10, respectively. Several studies have been performed on the description of novel genera and species, characterization of different bio-resources, metagenomics of hot spring microbiome and whole genome analysis of few isolates. 17 strains representing novel species and many thermostable enzymes, including lipase, protease, chitinase, amylase, etc. with potential biotechnological applications have been reported by several authors. Influence of physico-chemical conditions, especially that of temperature, on shaping the hot spring microbiome has been established by metagenomic investigations. Bacteria are the predominant life forms in all the springs with an abundance of phyla Firmicutes, Proteobacteria, Actinobacteria, Thermi, Bacteroidetes, Deinococcus-Thermus and Chloroflexi. In this review, we have discussed the findings on all microbiological studies that have been carried out to date, on the 28 hot springs. Further, the possibilities of extrapolating these studies for practical applications and environmental impact assessment towards protection of natural ecosystem of hot springs have also been discussed.

  6. Microbial Diversity, Distribution and Insight into Their Role in S, Fe and N Biogeochemical Cycling in the Hot Springs at Tengchong Geothermal Fields, Southwest China

    Science.gov (United States)

    Li, J.; Peng, X.; Zhang, L.

    2014-12-01

    Ten sediment samples collected from one acidic and three alkaline high temperature hot springs at Tengchong terrestrial geothermal field, Southwest China, were examined by the mineralogical, geochemical, and molecular biological techniques. The mineralogical and geochemical analyses suggested that these hot springs contain relative high concentrations of S, Fe and N chemical species. Specifically, the acidic hot spring was rich in Fe2+, SO42- and NH4+, while the alkaline hot springs were high in NO3-, H2S and S2O3-. Analyses of 16S rRNA sequences showed their bacterial communities were dominated by Aquificae, Cyanobacteria, Deinococci-Thermus, Firmicutes, Proteobacteria, and Thermodesulfobacteria, while the archeal clone libraries were dominated by Desulfurococcales, Sulfolobales, and Thermoproteales. Among them, the potential S-, N- and Fe-related oxidizing and reducing prokaryote were presenting as a relative high proportion but with a great difference in diversity and metabolic approaches of each sample. These findings provide some significant implications for the microbial function in element biogeochemical cycles within the Tengchong geothermal environments: i). the distinct differences in abundance and diversity of microbial communities of geothermal sediments were related to in situ different physicochemical conditions; ii). the S-, N- and Fe-related prokaryote would take advantage of the strong chemical disequilibria in the hot springs; iii). in return, their metabolic activities can promote the transformation of S, Fe and N chemical species, thus founded the bases of biogeochemical cycles in the terrestrial geothermal environments.

  7. Bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong, China.

    Science.gov (United States)

    Pagaling, Eulyn; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

    2012-07-01

    We investigated the bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong in the Yunnan Province, China, using direct molecular analyses. The Langpu (LP) laminated mat was found by the side of a boiling pool with temperature of 60-65 °C and a pH of 8.5, while the Tengchong (TC) streamer mat consisted of white streamers in a slightly acidic (pH 6.5) hot pool outflow with a temperature of 72 °C. Four 16S rRNA gene clone libraries were constructed and restriction enzyme analysis of the inserts was used to identify unique sequences and clone frequencies. From almost 200 clones screened, 55 unique sequences were retrieved. Phylogenetic analysis showed that the LP mat consisted of a diverse bacterial population [Cyanobacteria, Chloroflexi, Chlorobia, Nitrospirae, 'Deinococcus-Thermus', Proteobacteria (alpha, beta and delta subdivisions), Firmicutes, Bacteroidetes and Actinobacteria], while the archaeal population was dominated by methanogenic Euryarchaeota and Crenarchaeota. In contrast, the TC streamer mat consisted of a bacterial population dominated by Aquificae, while the archaeal population also contained Korarchaeota as well as Crenarchaeota and methanogenic Euryarchaeota. These mats harboured clone sequences affiliated to unidentified lineages, suggesting that they are a potential source for discovering novel bacteria and archaea.

  8. Diversity and structure of soil bacterial communities in the Fildes Region (maritime Antarctica as revealed by 454 pyrosequencing

    Directory of Open Access Journals (Sweden)

    Neng Fei eWang

    2015-10-01

    Full Text Available This study assessed the diversity and composition of bacterial communities in four different soils (human-, penguin-, seal-colony impacted soils and pristine soil in the Fildes Region (King George Island, Antarctica using 454 pyrosequencing with bacterial-specific primers targeting the 16S rRNA gene. Proteobacteria, Actinobacteria, Acidobacteria, and Verrucomicrobia were abundant phyla in almost all the soil samples. The four types of soils were significantly different in geochemical properties and bacterial community structure. Thermotogae, Cyanobacteria, Fibrobacteres, Deinococcus-Thermus, and Chlorobi obviously varied in their abundance among the 4 soil types. Considering all the samples together, members of the genera Gaiella, Chloracidobacterium, Nitrospira, Polaromonas, Gemmatimonas, Sphingomonas and Chthoniobacter were found to predominate, whereas members of the genera Chamaesiphon, Herbaspirillum, Hirschia, Nevskia, Nitrosococcus, Rhodococcus, Rhodomicrobium, and Xanthomonas varied obviously in their abundance among the four soil types. Distance-based redundancy analysis revealed that pH (p < 0.01, phosphate phosphorus (p < 0.01, organic carbon (p < 0.05, and organic nitrogen (p < 0.05 were the most significant factors that correlated with the community distribution of soil bacteria. To our knowledge, this is the first study to explore the soil bacterial communities in human-, penguin-, and seal- colony impacted soils from ice-free areas in maritime Antarctica using high-throughput pyrosequencing.

  9. Single-molecule analysis of inhibitory pausing states of V1-ATPase.

    Science.gov (United States)

    Uner, Naciye Esma; Nishikawa, Yoshihiro; Okuno, Daichi; Nakano, Masahiro; Yokoyama, Ken; Noji, Hiroyuki

    2012-08-17

    V(1)-ATPase, the hydrophilic V-ATPase domain, is a rotary motor fueled by ATP hydrolysis. Here, we found that Thermus thermophilus V(1)-ATPase shows two types of inhibitory pauses interrupting continuous rotation: a short pause (SP, 4.2 s) that occurred frequently during rotation, and a long inhibitory pause (LP, >30 min) that terminated all active rotations. Both pauses occurred at the same angle for ATP binding and hydrolysis. Kinetic analysis revealed that the time constants of inactivation into and activation from the SP were too short to represent biochemically predicted ADP inhibition, suggesting that SP is a newly identified inhibitory state of V(1)-ATPase. The time constant of inactivation into LP was 17 min, consistent with one of the two time constants governing the inactivation process observed in bulk ATPase assay. When forcibly rotated in the forward direction, V(1) in LP resumed active rotation. Solution ADP suppressed the probability of mechanical activation, suggesting that mechanical rotation enhanced inhibitory ADP release. These features were highly consistent with mechanical activation of ADP-inhibited F(1), suggesting that LP represents the ADP-inhibited state of V(1)-ATPase. Mechanical activation largely depended on the direction and angular displacement of forced rotation, implying that V(1)-ATPase rotation modulates the off rate of ADP.

  10. Microbial and viral-like rhodopsins present in coastal marine sediments from four polar and subpolar regions

    Energy Technology Data Exchange (ETDEWEB)

    López, José L.; Golemba, Marcelo; Hernández, Edgardo; Lozada, Mariana; Dionisi, Hebe; Jansson, Janet K.; Carroll, Jolynn; Lundgren, Leif; Sjöling, Sara; Mac Cormack, Walter P.; Sobecky, Patricia

    2016-11-03

    Rhodopsins are broadly distributed. In this work, we analyzed 23 metagenomes corresponding to marine sediment samples from four regions that share cold climate conditions (Norway; Sweden; Argentina and Antarctica). In order to investigate the genes evolution of viral rhodopsins, an initial set of 6224 bacterial rhodopsin sequences according to COG5524 were retrieved from the 23 metagenomes. After selection by the presence of transmembrane domains and alignment, 123 viral (51) and non-viral (72) sequences (>50 amino acids) were finally included in further analysis. Viral rhodopsin genes were homologs of Phaeocystis globosa virus and Organic lake Phycodnavirus. Non-viral microbial rhodopsin genes were ascribed to Bacteroidetes, Planctomycetes, Firmicutes, Actinobacteria, Cyanobacteria, Proteobacteria, Deinococcus-Thermus and Cryptophyta and Fungi. A rescreening using Blastp, using as queries the viral sequences previously described, retrieved 30 sequences (>100 amino acids). Phylogeographic analysis revealed a geographical clustering of the sequences affiliated to the viral group. This clustering was not observed for the microbial non-viral sequences. The phylogenetic reconstruction allowed us to propose the existence of a putative ancestor of viral rhodopsin genes related to Actinobacteria and Chloroflexi. This is the first report about the existence of a phylogeographic association of the viral rhodopsin sequences from marine sediments.

  11. Identification of Multiple Soluble Fe(III Reductases in Gram-Positive Thermophilic Bacterium Thermoanaerobacter indiensis BSB-33

    Directory of Open Access Journals (Sweden)

    Subrata Pal

    2014-01-01

    Full Text Available Thermoanaerobacter indiensis BSB-33 has been earlier shown to reduce Fe(III and Cr(VI anaerobically at 60°C optimally. Further, the Gram-positive thermophilic bacterium contains Cr(VI reduction activity in both the membrane and cytoplasm. The soluble fraction prepared from T. indiensis cells grown at 60°C was found to contain the majority of Fe(III reduction activity of the microorganism and produced four distinct bands in nondenaturing Fe(III reductase activity gel. Proteins from each of these bands were partially purified by chromatography and identified by mass spectrometry (MS with the help of T. indiensis proteome sequences. Two paralogous dihydrolipoamide dehydrogenases (LPDs, thioredoxin reductase (Trx, NADP(H-nitrite reductase (Ntr, and thioredoxin disulfide reductase (Tdr were determined to be responsible for Fe(III reductase activity. Amino acid sequence and three-dimensional (3D structural similarity analyses of the T. indiensis Fe(III reductases were carried out with Cr(VI reducing proteins from other bacteria. The two LPDs and Tdr showed very significant sequence and structural identity, respectively, with Cr(VI reducing dihydrolipoamide dehydrogenase from Thermus scotoductus and thioredoxin disulfide reductase from Desulfovibrio desulfuricans. It appears that in addition to their iron reducing activity T. indiensis LPDs and Tdr are possibly involved in Cr(VI reduction as well.

  12. Molecular assessment of the bacterial community associated with Cassava (Manihot esculenta Crantz) cultivation in Cameroon.

    Science.gov (United States)

    Sarr, Papa Saliou; Sugiyama, Akifumi; Begoude, Aime Didier Boyogueno; Yazaki, Kazufumi; Araki, Shigeru; Nawata, Eiji

    2017-04-01

    Bacterial communities play an important role in nutrient cycles and plant development. Their distribution and activity may depend on location and environmental heterogeneity. This study characterized soil bacterial communities in cassava fields of Eastern (Andom) and Southern (Bityili) Cameroon using molecular tools. In both sites, two improved varieties (TMS-96/1414; TMS-92/0326) and a local variety (Local) were grown in a randomized block design. Composite bulk soils were collected at 10months after planting from cassava plots. The 16S rDNA region was amplified, MiSeq was performed and sequence data analyzed. The same 17 bacterial phyla were present in both Andom and Bityili, while Chlorobi and Deinococcus-Thermus were only specific to Andom. The phyla Proteobacteria, Planctomycetes, Actinobacteria and Acidobacteria were dominant. Although both sites shared similar phyla, the principal coordinate analysis revealed significant variations in their composition, suggesting that the functions of the bacteria in nutrients cycling are likely to differ between Andom and Bityili. Cassava yields were generally higher in Andom which also displayed a higher diversity of bacterial communities. This study provides useful information on the composition of bacterial communities in cassava fields in two agro-ecologies of Cameroon. It constitutes to our knowledge the first report describing soil bacterial communities in association with cassava growth in the country, using molecular tools. Copyright © 2017 Elsevier GmbH. All rights reserved.

  13. Ribosomal synthesis of polylysine from individual lysyl-tRNA/sup Lys/ in the absence of a template

    International Nuclear Information System (INIS)

    Yusupova, G.Z.; Remme, Y.L.; Belitsina, N.B.; Spirin, A.S.

    1987-01-01

    Earlier studies showed that ribosomes of Escherichia coli, in the absence of a template, can synthesize oligolysine, using lysyl-tRNA as a substrate. The authors present results on the use of preparations of individual lysyl-tRNA/sup Lys/ and phenylalanyl-tRNA/sup Phe/ in a system of templateless peptide synthesis. For these studies, the authors used ribosomes of E. coli MRE 600, washed four times with 1 M NH 4 Cl with 10 MM MgCl 2 . The purified ribosomes were stored at -70 0 C in standard buffer, containing 20 mM Tris-HCl, 100 mM NH 4 Cl, 10 mM MgCl 2 , 0.1 mM ethylenediamine tetraacetate (EDTA), and 10% glycerin, pH/sub 37 0 C/7.6. A preparation of [ 14 C]lysyl-tRNA/sup Lys/ was produced by affinity chromatography on immobilized factor EF-T/sub u/ from Thermus thermophilus HB8. The elongation factor EF-T/sub u/ from T. thermophilus and immobilized on BrCN-activated Sepharose 4B. The initial preparation of total tRNA of E. coli, enzymatically acylated by [ 14 C]lysine (348 Ci/mole, Amersham), was produced as described earlier. The degree of aminoacylation was 52-59 pmoles [ 14 C]lysine per unit of A 260 of tRNA

  14. Reconstitution of β-carotene hydroxylase activity of thermostable CYP175A1 monooxygenase

    International Nuclear Information System (INIS)

    Momoi, Kyoko; Hofmann, Ute; Schmid, Rolf D.; Urlacher, Vlada B.

    2006-01-01

    CYP175A1 is a thermostable P450 Monooxygenase from Thermus thermophilus HB27, demonstrating in vivo activity towards β-carotene. Activity of CYP175A1 was reconstituted in vitro using artificial electron transport proteins. First results were obtained in the mixture with a crude Escherichia coli cell extract at 37 o C. In this system, β-carotene was hydroxylated to β-cryptoxanthin. The result indicated the presence of electron transport enzymes among the E. coli proteins, which are suitable for CYP175A1. However, upon in vitro reconstitution of CYP175A1 activity with purified recombinant flavodoxin and flavodoxin reductase from E. coli, only very low β-cryptoxanthin production was observed. Remarkably, with another artificial electron transport system, putidaredoxin and putidaredoxin reductase from Pseudomonas putida, purified CYP175A1 enzyme hydroxylated β-carotene at 3- and also 3'-positions, resulting in β-cryptoxanthin and zeaxanthin. Under the optimal reaction conditions, the turnover rate of the enzyme reached 0.23 nmol β-cryptoxanthin produced per nmol P450 per min

  15. Glycoside hydrolase activities of thermophilic bacterial consortia adapted to switchgrass.

    Science.gov (United States)

    Gladden, John M; Allgaier, Martin; Miller, Christopher S; Hazen, Terry C; VanderGheynst, Jean S; Hugenholtz, Philip; Simmons, Blake A; Singer, Steven W

    2011-08-15

    Industrial-scale biofuel production requires robust enzymatic cocktails to produce fermentable sugars from lignocellulosic biomass. Thermophilic bacterial consortia are a potential source of cellulases and hemicellulases adapted to harsher reaction conditions than commercial fungal enzymes. Compost-derived microbial consortia were adapted to switchgrass at 60°C to develop thermophilic biomass-degrading consortia for detailed studies. Microbial community analysis using small-subunit rRNA gene amplicon pyrosequencing and short-read metagenomic sequencing demonstrated that thermophilic adaptation to switchgrass resulted in low-diversity bacterial consortia with a high abundance of bacteria related to thermophilic paenibacilli, Rhodothermus marinus, and Thermus thermophilus. At lower abundance, thermophilic Chloroflexi and an uncultivated lineage of the Gemmatimonadetes phylum were observed. Supernatants isolated from these consortia had high levels of xylanase and endoglucanase activities. Compared to commercial enzyme preparations, the endoglucanase enzymes had a higher thermotolerance and were more stable in the presence of 1-ethyl-3-methylimidazolium acetate ([C2mim][OAc]), an ionic liquid used for biomass pretreatment. The supernatants were used to saccharify [C2mim][OAc]-pretreated switchgrass at elevated temperatures (up to 80°C), demonstrating that these consortia are an excellent source of enzymes for the development of enzymatic cocktails tailored to more extreme reaction conditions.

  16. Development of a continuous bioconversion system using a thermophilic whole-cell biocatalyst.

    Science.gov (United States)

    Ninh, Pham Huynh; Honda, Kohsuke; Yokohigashi, Yukako; Okano, Kenji; Omasa, Takeshi; Ohtake, Hisao

    2013-03-01

    The heat treatment of recombinant mesophilic cells having heterologous thermophilic enzymes results in the denaturation of indigenous mesophilic enzymes and the elimination of undesired side reactions; therefore, highly selective whole-cell catalysts comparable to purified enzymes can be readily prepared. However, the thermolysis of host cells leads to the heat-induced leakage of thermophilic enzymes, which are produced as soluble proteins, limiting the exploitation of their excellent stability in repeated and continuous reactions. In this study, Escherichia coli cells having the thermophilic fumarase from Thermus thermophilus (TtFTA) were treated with glutaraldehyde to prevent the heat-induced leakage of the enzyme, and the resulting cells were used as a whole-cell catalyst in repeated and continuous reactions. Interestingly, although electron microscopic observations revealed that the cellular structure of glutaraldehyde-treated E. coli was not apparently changed by the heat treatment, the membrane permeability of the heated cells to relatively small molecules (up to at least 3 kDa) was significantly improved. By applying the glutaraldehyde-treated E. coli having TtFTA to a continuous reactor equipped with a cell-separation membrane filter, the enzymatic hydration of fumarate to malate could be operated for more than 600 min with a molar conversion yield of 60% or higher.

  17. Fatty acids and survival of bacteria in Hammam Pharaon springs, Egypt

    Directory of Open Access Journals (Sweden)

    Yehia A. Osman

    2018-06-01

    Full Text Available A great lack of knowledge of Hammam Pharaon's microbial community; the most famous hot spring in Sinai, Egypt, derived this work. Three different hyperthermophilic bacterial were isolated from vents in the area, where the temperature was above 80 °C. Response Surface Methodology algorithm such as Central Composite Design determined the optimum cultivation conditions for these isolates. Accordingly, the best growth conditions were at 70 °C and at neutral to slightly acidic pH values. The constructed phylogenetic tree built using the 16S rRNA gene sequences has shown that the isolated strains (HM101, HM102 and HM103 belong to Geobacillus, Rhodothermus and Thermus bacteria, respectively. The fatty acid profiles, an indicative of thermotolerance, dominated by the short chain Dodecanoic acid (Lauric acid; (12:0, which represented about 40% of the total fatty acid contents for each of the three isolates. The enzymatic capabilities of the three strains were determined and α-amylase was found to be the most prominent one. Our own data had led us to conclude that the length of the fatty acid chain and the degree of saturation could be species specific. Moreover, the biotechnological potentials of these local isolates could contribute to fighting viral diseases and/or improve their amylolytic activities for sugar industry; where thermotolerance is really an important factor.

  18. Understanding the core of RNA interference: The dynamic aspects of Argonaute-mediated processes

    KAUST Repository

    Zhu, Lizhe

    2016-10-05

    At the core of RNA interference, the Argonaute proteins (Ago) load and utilize small guide nucleic acids to silence mRNAs or cleave foreign nucleic acids in a sequence specific manner. In recent years, based on extensive structural studies of Ago and its interaction with the nucleic acids, considerable progress has been made to reveal the dynamic aspects of various Ago-mediated processes. Here we review these novel insights into the guide-strand loading, duplex unwinding, and effects of seed mismatch, with a focus on two representative Agos, the human Ago 2 (hAgo2) and the bacterial Thermus thermophilus Ago (TtAgo). In particular, comprehensive molecular simulation studies revealed that although sharing similar overall structures, the two Agos have vastly different conformational landscapes and guide-strand loading mechanisms because of the distinct rigidity of their L1-PAZ hinge. Given the central role of the PAZ motions in regulating the exposure of the nucleic acid binding channel, these findings exemplify the importance of protein motions in distinguishing the overlapping, yet distinct, mechanisms of Ago-mediated processes in different organisms.

  19. Cloning, expression, and homology modeling of GroEL protein from Leptospira interrogans serovar autumnalis strain N2.

    Science.gov (United States)

    Natarajaseenivasan, Kalimuthusamy; Shanmughapriya, Santhanam; Velineni, Sridhar; Artiushin, Sergey C; Timoney, John F

    2011-10-01

    Leptospirosis is an infectious bacterial disease caused by Leptospira species. In this study, we cloned and sequenced the gene encoding the immunodominant protein GroEL from L. interrogans serovar Autumnalis strain N2, which was isolated from the urine of a patient during an outbreak of leptospirosis in Chennai, India. This groEL gene encodes a protein of 60 kDa with a high degree of homology (99% similarity) to those of other leptospiral serovars. Recombinant GroEL was overexpressed in Escherichia coli. Immunoblot analysis indicated that the sera from confirmed leptospirosis patients showed strong reactivity with the recombinant GroEL while no reactivity was observed with the sera from seronegative control patient. In addition, the 3D structure of GroEL was constructed using chaperonin complex cpn60 from Thermus thermophilus as template and validated. The results indicated a Z-score of -8.35, which is in good agreement with the expected value for a protein. The superposition of the Ca traces of cpn60 structure and predicted structure of leptospiral GroEL indicates good agreement of secondary structure elements with an RMSD value of 1.5 Å. Further study is necessary to evaluate GroEL for serological diagnosis of leptospirosis and for its potential as a vaccine component. Copyright © 2011 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.

  20. Crystal structure of the catalytic domain of PigE: a transaminase involved in the biosynthesis of 2-methyl-3-n-amyl-pyrrole (MAP) from Serratia sp. FS14.

    Science.gov (United States)

    Lou, Xiangdi; Ran, Tingting; Han, Ning; Gao, Yanyan; He, Jianhua; Tang, Lin; Xu, Dongqing; Wang, Weiwu

    2014-04-25

    Prodigiosin, a tripyrrole red pigment synthesized by Serratia and some other microbes through a bifurcated biosynthesis pathway, MBC (4-methoxy-2,2'-bipyrrole-5-carbaldehyde) and MAP (2-methyl-3-n-amyl-pyrrole) are synthesized separately and then condensed by PigC to form prodigiosin. MAP is synthesized sequentially by PigD, PigE and PigB. PigE catalyzes the transamination of an amino group to the aldehyde group of 3-acetyloctanal, resulting in an aminoketone, which spontaneously cyclizes to form H2MAP. Here we report the crystal structure of the catalytic domain of PigE which involved in the biosynthesis of prodigiosin precursor MAP for the first time to a resolution of 2.3Å with a homodimer in the asymmetric unit. The monomer of PigE catalytic domain is composed of three domains with PLP as cofactor: a small N-terminal domain connecting the catalytic domain with the front part of PigE, a large PLP-binding domain and a C-terminal domain. The residues from both monomers build the PLP binding site at the interface of the dimer which resembles the other PLP-dependent enzymes. Structural comparison of PigE with Thermus thermophilus AcOAT showed a higher hydrophobic and smaller active site of PigE, these differences may be the reason for substrate specificity. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Data for molecular dynamics simulations of B-type cytochrome c oxidase with the Amber force field

    Directory of Open Access Journals (Sweden)

    Longhua Yang

    2016-09-01

    Full Text Available Cytochrome c oxidase (CcO is a vital enzyme that catalyzes the reduction of molecular oxygen to water and pumps protons across mitochondrial and bacterial membranes. This article presents parameters for the cofactors of ba3-type CcO that are compatible with the all-atom Amber ff12SB and ff14SB force fields. Specifically, parameters were developed for the CuA pair, heme b, and the dinuclear center that consists of heme a3 and CuB bridged by a hydroperoxo group. The data includes geometries in XYZ coordinate format for cluster models that were employed to compute proton transfer energies and derive bond parameters and point charges for the force field using density functional theory. Also included are the final parameter files that can be employed with the Amber leap program to generate input files for molecular dynamics simulations with the Amber software package. Based on the high resolution (1.8 Å X-ray crystal structure of the ba3-type CcO from Thermus thermophilus (Protein Data Bank ID number PDB: 3S8F, we built a model that is embedded in a POPC lipid bilayer membrane and solvated with TIP3P water molecules and counterions. We provide PDB data files of the initial model and the equilibrated model that can be used for further studies.

  2. Structure of the protein core of translation initiation factor 2 in apo, GTP-bound and GDP-bound forms

    International Nuclear Information System (INIS)

    Simonetti, Angelita; Marzi, Stefano; Fabbretti, Attilio; Hazemann, Isabelle; Jenner, Lasse; Urzhumtsev, Alexandre; Gualerzi, Claudio O.; Klaholz, Bruno P.

    2013-01-01

    The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2 is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue

  3. Preliminary studies on DNA retardation by MutS applied to the detection of point mutations in clinical samples

    International Nuclear Information System (INIS)

    Stanislawska-Sachadyn, Anna; Paszko, Zygmunt; Kluska, Anna; Skasko, Elzibieta; Sromek, Maria; Balabas, Aneta; Janiec-Jankowska, Aneta; Wisniewska, Alicja; Kur, Jozef; Sachadyn, Pawel

    2005-01-01

    MutS ability to bind DNA mismatches was applied to the detection of point mutations in PCR products. MutS recognized mismatches from single up to five nucleotides and retarded the electrophoretic migration of mismatched DNA. The electrophoretic detection of insertions/deletions above three nucleotides is also possible without MutS, thanks to the DNA mobility shift caused by the presence of large insertion/deletion loops in the heteroduplex DNA. Thus, the method enables the search for a broad range of mutations: from single up to several nucleotides. The mobility shift assays were carried out in polyacrylamide gels stained with SYBR-Gold. One assay required 50-200 ng of PCR product and 1-3 μg of Thermus thermophilus his 6 -MutS protein. The advantages of this approach are: the small amounts of DNA required for the examination, simple and fast staining, no demand for PCR product purification, no labelling and radioisotopes required. The method was tested in the detection of cancer predisposing mutations in RET, hMSH2, hMLH1, BRCA1, BRCA2 and NBS1 genes. The approach appears to be promising in screening for unknown point mutations

  4. O-Alkyl Hydroxamates as Metaphors of Enzyme-Bound Enolate Intermediates in Hydroxy Acid Dehydrogenases. Inhibitors of Isopropylmalate Dehydrogenase, Isocitrate Dehydrogenase, and Tartrate Dehydrogenase(1).

    Science.gov (United States)

    Pirrung, Michael C.; Han, Hyunsoo; Chen, Jrlung

    1996-07-12

    The inhibition of Thermus thermophilus isopropylmalate dehydrogenase by O-methyl oxalohydroxamate was studied for comparison to earlier results of Schloss with the Salmonella enzyme. It is a fairly potent (1.2 &mgr;M), slow-binding, uncompetitive inhibitor against isopropylmalate and is far superior to an oxamide (25 mM K(i) competitive) that is isosteric with the ketoisocaproate product of the enzyme. This improvement in inhibition was attributed to its increased NH acidity, which presumably is due to the inductive effect of the hydroxylamine oxygen. This principle was extended to the structurally homologous enzyme isocitrate dehydrogenase from E. coli, for which the compound O-(carboxymethyl) oxalohydroxamate is a 30 nM inhibitor, uncompetitive against isocitrate. The pH dependence of its inhibition supports the idea that it is bound to the enzyme in the anionic form. Another recently discovered homologous enzyme, tartrate dehydrogenase from Pseudomonas putida, was studied with oxalylhydroxamate. It has a relatively low affinity for the enzyme, though it is superior to tartrate. On the basis of these leads, squaric hydroxamates with increased acidity compared to squaric amides directed toward two of these enzymes were prepared, and they also show increased inhibitory potency, though not approaching the nanomolar levels of the oxalylhydroxamates.

  5. Ribosome reinitiation at leader peptides increases translation of bacterial proteins.

    Science.gov (United States)

    Korolev, Semen A; Zverkov, Oleg A; Seliverstov, Alexandr V; Lyubetsky, Vassily A

    2016-04-16

    Short leader genes usually do not encode stable proteins, although their importance in expression control of bacterial genomes is widely accepted. Such genes are often involved in the control of attenuation regulation. However, the abundance of leader genes suggests that their role in bacteria is not limited to regulation. Specifically, we hypothesize that leader genes increase the expression of protein-coding (structural) genes via ribosome reinitiation at the leader peptide in the case of a short distance between the stop codon of the leader gene and the start codon of the structural gene. For instance, in Actinobacteria, the frequency of leader genes at a distance of 10-11 bp is about 70 % higher than the mean frequency within the 1 to 65 bp range; and it gradually decreases as the range grows longer. A pronounced peak of this frequency-distance relationship is also observed in Proteobacteria, Bacteroidetes, Spirochaetales, Acidobacteria, the Deinococcus-Thermus group, and Planctomycetes. In contrast, this peak falls to the distance of 15-16 bp and is not very pronounced in Firmicutes; and no such peak is observed in cyanobacteria and tenericutes. Generally, this peak is typical for many bacteria. Some leader genes located close to a structural gene probably play a regulatory role as well.

  6. Whole cell immobilization of refractory glucose isomerase using tris(hydroxymethyl)phosphine as crosslinker for preparation of high fructose corn syrup at elevated temperature.

    Science.gov (United States)

    Jia, Dong-Xu; Wang, Teng; Liu, Zi-Jian; Jin, Li-Qun; Li, Jia-Jia; Liao, Cheng-Jun; Chen, De-Shui; Zheng, Yu-Guo

    2018-04-04

    Glucose isomerase (GI) responsible for catalyzing the isomerization from d-glucose to d-fructose, was an important enzyme for producing high fructose corn syrup (HFCS). In a quest to prepare HFCS at elevated temperature and facilitate enzymatic recovery, an effective procedure for whole cell immobilization of refractory Thermus oshimai glucose isomerase (ToGI) onto Celite 545 using tris(hydroxymethyl)phosphine (THP) as crosslinker was established. The immobilized biocatalyst showed an activity of approximate 127.3 U/(g·immobilized product) via optimization in terms of cells loading, crosslinker concentration and crosslinking time. The pH optimum of the immobilized biocatalyst was displaced from pH 8.0 of native enzyme to neutral pH 7.0. Compared with conventional glutaraldehyde (GLU)-immobilized cells, it possessed the enhanced thermostability with 70.1% residual activity retaining after incubation at 90°C for 72 h. Moreover, the THP-immobilized biocatalyst exhibited superior operational stability, in which it retained 85.8% of initial activity after 15 batches of bioconversion at 85°C. This study paved a way for reducing catalysis cost for upscale preparation of HFCS with higher d-fructose concentration. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  7. Inhibition of NADH-ubiquinone reductase activity by N,N'-dicyclohexylcarbodiimide and correlation of this inhibition with the occurrence of energy-coupling site 1 in various organisms

    International Nuclear Information System (INIS)

    Yagi, T.

    1987-01-01

    The NADH-ubiquinone reductase activity of the respiratory chains of several organisms was inhibited by the carboxyl-modifying reagent N,N'-dicyclohexylcarbodiimide (DCCD). This inhibition correlated with the presence of an energy-transducing site in this segment of the respiratory chain. Where the NADH-quinone reductase segment involved an energy-coupling site (e.g., in bovine heart and rat liver mitochondria, and in Paracoccus denitrificans, Escherichia coli, and Thermus thermophilus HB-8 membranes), DCCD acted as an inhibitor of ubiquinone reduction by NADH. By contrast, where energy-coupling site 1 was absent (e.g., in Saccharomyces cerevisiae mitochondria and BacilLus subtilis membranes), there was no inhibition of NADH-ubiquinone reductase activity by DCCD. In the bovine and P. denitrificans systems, DCCD inhibition was pseudo first order with respect to incubation time, and reaction order with respect to inhibitor concentration was close to unity, indicating that inhibition resulted from the binding of one inhibitor molecule per active unit of NADH-ubiquinone reductase. In the bovine NADH-ubiquinone reductase complex (complex I), [ 14 C]DCCD was preferentially incorporated into two subunits of molecular weight 49,000 and 29,000. The time course of labeling of the 29,000 molecular weight subunit with [ 14 C]DCCD paralleled the time course of inhibition of NADH-ubiquinone reductase activity

  8. Structural and biochemical analysis of nuclease domain of clustered regularly interspaced short palindromic repeat (CRISPR)-associated protein 3 (Cas3).

    Science.gov (United States)

    Mulepati, Sabin; Bailey, Scott

    2011-09-09

    RNA transcribed from clustered regularly interspaced short palindromic repeats (CRISPRs) protects many prokaryotes from invasion by foreign DNA such as viruses, conjugative plasmids, and transposable elements. Cas3 (CRISPR-associated protein 3) is essential for this CRISPR protection and is thought to mediate cleavage of the foreign DNA through its N-terminal histidine-aspartate (HD) domain. We report here the 1.8 Å crystal structure of the HD domain of Cas3 from Thermus thermophilus HB8. Structural and biochemical studies predict that this enzyme binds two metal ions at its active site. We also demonstrate that the single-stranded DNA endonuclease activity of this T. thermophilus domain is activated not by magnesium but by transition metal ions such as manganese and nickel. Structure-guided mutagenesis confirms the importance of the metal-binding residues for the nuclease activity and identifies other active site residues. Overall, these results provide a framework for understanding the role of Cas3 in the CRISPR system.

  9. Structure of the protein core of translation initiation factor 2 in apo, GTP-bound and GDP-bound forms

    Energy Technology Data Exchange (ETDEWEB)

    Simonetti, Angelita [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Marzi, Stefano [Architecture et Réactivité de l’ARN, UPR 9002 CNRS, IBMC (Institute of Molecular and Cellular Biology), 15 Rue R. Descartes, 67084 Strasbourg, France, Université de Strasbourg, 67000 Strasbourg (France); Fabbretti, Attilio [University of Camerino, 62032 Camerino (Monaco) (Italy); Hazemann, Isabelle; Jenner, Lasse [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale -INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Urzhumtsev, Alexandre [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Université de Lorraine, 54506 Vandoeuvre-lès-Nancy (France); Gualerzi, Claudio O. [University of Camerino, 62032 Camerino (Monaco) (Italy); Klaholz, Bruno P., E-mail: klaholz@igbmc.fr [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France)

    2013-06-01

    The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2 is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue.

  10. Complex sputum microbial composition in patients with pulmonary tuberculosis

    Science.gov (United States)

    2012-01-01

    Background An increasing number of studies have implicated the microbiome in certain diseases, especially chronic diseases. In this study, the bacterial communities in the sputum of pulmonary tuberculosis patients were explored. Total DNA was extracted from sputum samples from 31 pulmonary tuberculosis patients and respiratory secretions of 24 healthy participants. The 16S rRNA V3 hyper-variable regions were amplified using bar-coded primers and pyro-sequenced using Roche 454 FLX. Results The results showed that the microbiota in the sputum of pulmonary tuberculosis patients were more diverse than those of healthy participants (ppulmonary tuberculosis patients and 17 of which were found in healthy participants. Furthermore, many foreign bacteria, such as Stenotrophomonas, Cupriavidus, Pseudomonas, Thermus, Sphingomonas, Methylobacterium, Diaphorobacter, Comamonas, and Mobilicoccus, were unique to pulmonary tuberculosis patients. Conclusions This study concluded that the microbial composition of the respiratory tract of pulmonary tuberculosis patients is more complicated than that of healthy participants, and many foreign bacteria were found in the sputum of pulmonary tuberculosis patients. The roles of these foreign bacteria in the onset or development of pulmonary tuberculosis shoud be considered by clinicians. PMID:23176186

  11. No evidence of genome editing activity from Natronobacterium gregoryi Argonaute (NgAgo) in human cells.

    Science.gov (United States)

    Javidi-Parsijani, Parisa; Niu, Guoguang; Davis, Meghan; Lu, Pin; Atala, Anthony; Lu, Baisong

    2017-01-01

    The argonaute protein from the thermophilic bacterium Thermus thermophilus shows DNA-guided DNA interfering activity at high temperatures, complicating its application in mammalian cells. A recent work reported that the argonaute protein from Natronobacterium gregoryi (NgAgo) had DNA-guided genome editing activity in mammalian cells. We compared the genome editing activities of NgAgo and Staphylococcus aureus Cas9 (SaCas9) in human HEK293T cells side by side. EGFP reporter assays and DNA sequencing consistently revealed high genome editing activity from SaCas9. However, these assays did not demonstrate genome editing activity by NgAgo. We confirmed that the conditions allowed simultaneous transfection of the NgAgo expressing plasmid DNA and DNA guides, as well as heterologous expression of NgAgo in the HEK293T cells. Our data show that NgAgo is not a robust genome editing tool, although it may have such activity under other conditions.

  12. Substrate-Specific Development of Thermophilic Bacterial Consortia by Using Chemically Pretreated Switchgrass.

    Science.gov (United States)

    Eichorst, Stephanie A; Joshua, Chijioke; Sathitsuksanoh, Noppadon; Singh, Seema; Simmons, Blake A; Singer, Steven W

    2014-12-01

    Microbial communities that deconstruct plant biomass have broad relevance in biofuel production and global carbon cycling. Biomass pretreatments reduce plant biomass recalcitrance for increased efficiency of enzymatic hydrolysis. We exploited these chemical pretreatments to study how thermophilic bacterial consortia adapt to deconstruct switchgrass (SG) biomass of various compositions. Microbial communities were adapted to untreated, ammonium fiber expansion (AFEX)-pretreated, and ionic-liquid (IL)-pretreated SG under aerobic, thermophilic conditions using green waste compost as the inoculum to study biomass deconstruction by microbial consortia. After microbial cultivation, gravimetric analysis of the residual biomass demonstrated that both AFEX and IL pretreatment enhanced the deconstruction of the SG biomass approximately 2-fold. Two-dimensional nuclear magnetic resonance (2D-NMR) experiments and acetyl bromide-reactive-lignin analysis indicated that polysaccharide hydrolysis was the dominant process occurring during microbial biomass deconstruction, and lignin remaining in the residual biomass was largely unmodified. Small-subunit (SSU) rRNA gene amplicon libraries revealed that although the dominant taxa across these chemical pretreatments were consistently represented by members of the Firmicutes, the Bacteroidetes, and Deinococcus-Thermus, the abundance of selected operational taxonomic units (OTUs) varied, suggesting adaptations to the different substrates. Combining the observations of differences in the community structure and the chemical and physical structure of the biomass, we hypothesize specific roles for individual community members in biomass deconstruction. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  13. A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.

    Science.gov (United States)

    Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C

    2016-01-29

    DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Comparative metagenomic analysis of the microbial communities in the surroundings of Iheya north and Iheya ridge hydrothermal fields reveals insights into the survival strategy of microorganisms in deep-sea environments

    Science.gov (United States)

    Wang, Hai-liang; Sun, Li

    2018-04-01

    In this study, metagenomic analysis was performed to investigate the taxonomic compositions and metabolic profiles of the microbial communities inhabiting the sediments in the surroundings of Iheya North and Iheya Ridge hydrothermal fields. The microbial communities in four different samples were found to be dominated by bacteria and, to a much lesser extent, archaea belonging to the phyla Proteobacteria, Actinobacteria, Planctomycetes, Firmicutes, Deinococcus-Thermus, and Nitrospirae, which play important roles in the cycling of carbon, nitrogen, and sulfur. All four microbial communities (i) contained chemoautotrophs and heterotrophs, the former probably fixed CO2 via various carbon fixation pathways, and the latter may degrade organic matters using nitrate and sulfate as electron acceptors, (ii) exhibited an abundance of DNA repair genes and bacterial sulfur oxidation mediated by reverse sulfate reduction, and (iii) harbored bacteria and archaea involved in anaerobic methane oxidation via intra-aerobic denitrification and reverse methanogenesis, which were found for the first time in hydrothermal areas. Furthermore, genes involved in DNA repair, reductive acetyl-CoA pathway, and ammonia metabolism were possibly affected by distance to the vent fields. These findings facilitate our understanding of the strategies of the microbial communities to adapt to the environments in deep sea areas associated with hydrothermal vents.

  15. Effect of postharvest practices including degreening on citrus carpoplane microbial biomes.

    Science.gov (United States)

    Gomba, A; Chidamba, L; Korsten, L

    2017-04-01

    To investigate the effect of commercial citrus packhouse processing steps on the fruit surface microbiome of Clementines and Palmer navel oranges. Viable bacteria, yeast and fungi counts, and the pyrosequencing analysis of the 16S rRNA and ITS were used to evaluate the community structure and population dynamics of phylloepiphytic bacteria and fungi associated with commercial postharvest processing. Drenching significantly reduced microbial counts in all cases except for yeasts on navels, while the extent of degreening effects varied between the citrus varieties. Pyrosequencing analysis showed a total of 4409 bacteria and 5792 fungi nonchimeric unique sequences with an average of 1102 bacteria and 1448 fungi reads per sample. Dominant phyla on the citrus carpoplane were Proteobacteria (53·5%), Actinobacteria (19·9%), Bacteroidetes (5·6%) and Deinococcus-Thermus (5·4%) for bacteria and Ascomycota (80·5%) and Basidiomycota (9·8%) for fungi. Beginning with freshly harvested fruit fungal diversity declined significantly after drenching, but had little effect on bacteria and populations recovered during degreening treatments, including those for Penicillium sp. Packhouse processing greatly influences microbial communities on the citrus carpoplane. A broad orange biome was described with pyrosequencing and gave insight into the likely survival and persistence of pathogens, especially as they may affect the quality and safety of the packed product. A close examination of the microbiota of fruit and the impact of intervention strategies on the ecological balance may provide a more durable approach to reduce losses and spoilage. © 2017 The Society for Applied Microbiology.

  16. Microbial mat of the thermal springs Kuchiger Republic of Buryatia: species composition, biochemical properties and electrogenic activity in biofuel cell

    Science.gov (United States)

    Aleksandrovich Yuriev, Denis; Viktorovna Zaitseva, Svetlana; Olegovna Zhdanova, Galina; Yurievich Tolstoy, Mikhail; Dondokovna Barkhutova, Darima; Feodorovna Vyatchina, Olga; Yuryevna Konovalova, Elena; Iosifovich Stom, Devard

    2018-02-01

    Electrogenic, molecular and some other properties of a microbial mat isolated from the Kuchiger hot spring (Kurumkansky District, Republic of Buryatia) were studied. Molecular analysis showed that representatives of Proteobacteria (85.5 % of the number of classified bacterial sequences) prevailed in the microbial mat of the Kuchiger springs, among which sulfur bacteria of the genus Thiothrix were the most numerous. In the microbial mat there were bacteria from the families Rhodocyclaceae, Comamonadaceae and Flavobacteriaceae. Phylum Bacteroidetes, Cyanobacteria/Chloroplast, Fusobacteria, Fibrobacteres, Acidobacteria, Chlorobi, Spirochaetes, Verrucomicrobia, Firmicutes, Deinococcus-Thermus, Chloroflexi and Actinobacteria are also noted in the composition of the microbial mat. Under the experimental conditions using Kuchiger-mat 16 as bioagents, glucose and peptone as substrates, the power of BFC was 240 and 221 mW / m2, respectively. When replacing the substrate with sodium acetate, the efficiency of the BFC was reduced by a factor of 10 (20 mW / m2). The prospects of using a microbial mat “Kuchiger-16” as an electrogen in BFC when utilizing alkaline waste water components to generate electricity are discussed.

  17. Hydrothermal Fluid Permeability, Temperature, and Nutrient Fluxes: Three Controls on the Structure and the Dynamics of Subsurface Extremophilic Microbe Communities

    Science.gov (United States)

    Ryan, M. P.; Yang, J.

    2002-05-01

    We continue to develop a set of models whose aim is to provide broad constraints on the range of possible community structures for subsurface thermally-tolerant microbes. We combine studies of the three-dimensional internal structure of the dike and sill complexes of active volcanoes, studies of the scale- and direction-dependent 3-D in-situ permeability of intrusive and extrusive rocks from in-situ and laboratory data, numerical modelling of hydrothermal convection in volcanic interiors, data on the optimal metabolic and life-limiting thermal requirements of extremophilic microbes, with the set of nutrients and nutrient pathways required for the survival of given species of thermophiles and hyperthermophiles. With this mix of data bases and analysis tools, we can begin to divine a set of broad theoretical guidelines for constraining the structure and dynamics of extremophilic communities in the subsurface environments of volcanoes. We are searching for the first-order controls on transport. The effects of mineral attachment, detachment, and microbial reproduction may be incorporated in refinements of this basic model. Critical thermal intervals and/or isotherms that correlate with (1) optimal metabolic and (2) life-limiting temperatures for thermophilic microbes are, e.g., in degrees Celcius: Thermus thermophilius [70, 85]; Thermomicrobium roseum [70-75, 85]; Thermus aquaticus [70, 79]; and Sulfolobus acidocaldarius [70-75, 90]. Numerical models of the convective migration of thermophilic (50-80 C), and hyperthermophilic (80-113 C) microbes and their macromolecular amino acid building blocks (113- ~200 C) have been developed that explicitly incorporate the roles of fractures and fluid properties. Fluid transport properties are evaluated through the optimal metabolic and life-limiting temperate ranges and beyond. These models quantify our intuition with respect to controls on community structure and dynamics. Important relationships appear to be: (1) Great

  18. Bioinformatic analysis of an unusual gene-enzyme relationship in the arginine biosynthetic pathway among marine gamma proteobacteria: implications concerning the formation of N-acetylated intermediates in prokaryotes

    Directory of Open Access Journals (Sweden)

    Labedan Bernard

    2006-01-01

    Full Text Available Abstract Background The N-acetylation of L-glutamate is regarded as a universal metabolic strategy to commit glutamate towards arginine biosynthesis. Until recently, this reaction was thought to be catalyzed by either of two enzymes: (i the classical N-acetylglutamate synthase (NAGS, gene argA first characterized in Escherichia coli and Pseudomonas aeruginosa several decades ago and also present in vertebrates, or (ii the bifunctional version of ornithine acetyltransferase (OAT, gene argJ present in Bacteria, Archaea and many Eukaryotes. This paper focuses on a new and surprising aspect of glutamate acetylation. We recently showed that in Moritella abyssi and M. profunda, two marine gamma proteobacteria, the gene for the last enzyme in arginine biosynthesis (argH is fused to a short sequence that corresponds to the C-terminal, N-acetyltransferase-encoding domain of NAGS and is able to complement an argA mutant of E. coli. Very recently, other authors identified in Mycobacterium tuberculosis an independent gene corresponding to this short C-terminal domain and coding for a new type of NAGS. We have investigated the two prokaryotic Domains for patterns of gene-enzyme relationships in the first committed step of arginine biosynthesis. Results The argH-A fusion, designated argH(A, and discovered in Moritella was found to be present in (and confined to marine gamma proteobacteria of the Alteromonas- and Vibrio-like group. Most of them have a classical NAGS with the exception of Idiomarina loihiensis and Pseudoalteromonas haloplanktis which nevertheless can grow in the absence of arginine and therefore appear to rely on the arg(A sequence for arginine biosynthesis. Screening prokaryotic genomes for virtual argH-X 'fusions' where X stands for a homologue of arg(A, we retrieved a large number of Bacteria and several Archaea, all of them devoid of a classical NAGS. In the case of Thermus thermophilus and Deinococcus radiodurans, the arg(A-like sequence

  19. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  20. One-Pot, One-Step Production of Dietary Nucleotides by Magnetic Biocatalysts

    Directory of Open Access Journals (Sweden)

    Jon del Arco

    2018-04-01

    Full Text Available The enzymatic synthesis of nucleotides offers several advantages over traditional multistep chemical methods, such as stereoselectivity, regioselectivity, enantioselectivity, simple downstream processing, and the use of mild reaction conditions. However, in order to scale up these bioprocesses, several drawbacks, such as the low enzyme stability and recycling, must be considered. Enzyme immobilization may overcome these cost-related problems by enhancing protein stability and facilitating the separation of products. In this regard, tetrameric hypoxanthine–guanine–xanthine phosphoribosyltransferase (HGXPRT from Thermus thermophilus HB8 was covalently immobilized onto glutaraldehyde-activated MagReSyn®Amine magnetic iron oxide porous microparticles (MTtHGXPRT. In this context, two different strategies were followed: (a an enzyme immobilization through its N-terminus residues at pH 8.5 (derivatives MTtHGXPRT1-3; and (b a multipoint covalent immobilization through the surface lysine residues at pH 10 (derivatives MTtHGXPRT4-5. The immobilized derivatives of MTtHGXPRT3 (activity 1581 international units per gram of support, IU/g; retained activity 29% and MTtHGXPRT5 (activity 1108 IU/g; retained activity 23% displayed the best wet biocatalyst activity, and retained activity values in the enzymatic synthesis of inosine-5′-monophosphate (IMP. In addition, the dependence of the activities and stabilities of both derivatives on pH and temperature was tested, as well as their reusability potential. Taking these results into account, MTtHGXPRT3 was chosen as the best biocatalyst (negligible loss of activity at 60 °C during 24 h; reusable up to seven cycles. Finally, as proof of concept, the enzymatic production of dietary nucleotides from high concentrations of low soluble bases was achieved.

  1. Molecular interactions within the halophilic, thermophilic, and mesophilic prokaryotic ribosomal complexes: clues to environmental adaptation.

    Science.gov (United States)

    Mallik, Saurav; Kundu, Sudip

    2015-01-01

    Using the available crystal structures of 50S ribosomal subunits from three prokaryotic species: Escherichia coli (mesophilic), Thermus thermophilus (thermophilic), and Haloarcula marismortui (halophilic), we have analyzed different structural features of ribosomal RNAs (rRNAs), proteins, and of their interfaces. We have correlated these structural features with the environmental adaptation strategies of the corresponding species. While dense intra-rRNA packing is observed in thermophilic, loose intra-rRNA packing is observed in halophilic (both compared to mesophilic). Interestingly, protein-rRNA interfaces of both the extremophiles are densely packed compared to that of the mesophilic. The intersubunit bridge regions are almost devoid of cavities, probably ensuring the proper formation of each bridge (by not allowing any loosely packed region nearby). During rRNA binding, the ribosomal proteins experience some structural transitions. Here, we have analyzed the intrinsically disordered and ordered regions of the ribosomal proteins, which are subjected to such transitions. The intrinsically disordered and disorder-to-order transition sites of the thermophilic and mesophilic ribosomal proteins are simultaneously (i) highly conserved and (ii) slowly evolving compared to rest of the protein structure. Although high conservation is observed at such sites of halophilic ribosomal proteins, but slow rate of evolution is absent. Such differences between thermophilic, mesophilic, and halophilic can be explained from their environmental adaptation strategy. Interestingly, a universal biophysical principle evident by a linear relationship between the free energy of interface formation, interface area, and structural changes of r-proteins during assembly is always maintained, irrespective of the environmental conditions.

  2. A nonsense mutation causing decreased levels of insulin receptor mRNA: Detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction

    International Nuclear Information System (INIS)

    Kadowaki, T.; Kadowaki, H.; Taylor, S.I.

    1990-01-01

    Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. The authors have studied a patient with leprechaunism (leprechaun/Minn-1), a genetic syndrome associated with intrauterine growth retardation and extreme insulin resistance. Genomic DNA from the patient was amplified by the polymerase chain reaction catalyzed by Thermus aquaticus (Taq) DNA polymerase, and the amplified DNA was directly sequenced. A nonsense mutations was identified at codon 897 in exon 14 in the paternal allele of the patient's insulin receptor gene. Levels of insulin receptor mRNA are decreased to <10% of normal in Epstein-Barr virus-transformed lymphoblasts and cultured skin fibroblasts from this patient. Thus, this nonsense mutation appears to cause a decrease in the levels of insulin receptor mRNA. In addition, they have obtained indirect evidence that the patient's maternal allele of the insulin receptor gene contains a cis-acting dominant mutation that also decreases the level of mRNA, but by a different mechanism. The nucleotide sequence of the entire protein-coding domain and the sequences of the intron-exon boundaries for all 22 exons of the maternal allele were normal. Presumably, the mutation in the maternal allele maps elsewhere in the insulin receptor gene. Thus, they conclude that the patient is a compound heterozygote for two cis-acting dominant mutations in the insulin receptor gene: (i) a nonsense mutation in the paternal allel that reduces the level of insulin receptor mRNA and (ii) an as yet unidentified mutation in the maternal allele that either decreases the rate of transcription or decreases the stability of the mRNA

  3. Molecular evolution of the lysine biosynthetic pathways.

    Science.gov (United States)

    Velasco, A M; Leguina, J I; Lazcano, A

    2002-10-01

    Among the different biosynthetic pathways found in extant organisms, lysine biosynthesis is peculiar because it has two different anabolic routes. One is the diaminopimelic acid pathway (DAP), and the other over the a-aminoadipic acid route (AAA). A variant of the AAA route that includes some enzymes involved in arginine and leucine biosyntheses has been recently reported in Thermus thermophilus (Nishida et al. 1999). Here we describe the results of a detailed genomic analysis of each of the sequences involved in the two lysine anabolic routes, as well as of genes from other routes related to them. No evidence was found of an evolutionary relationship between the DAP and AAA enzymes. Our results suggest that the DAP pathway is related to arginine metabolism, since the lysC, asd, dapC, dapE, and lysA genes from lysine biosynthesis are related to the argB, argC, argD, argE, and speAC genes, respectively, whose products catalyze different steps in arginine metabolism. This work supports previous reports on the relationship between AAA gene products and some enzymes involved in leucine biosynthesis and the tricarboxylic acid cycle (Irvin and Bhattacharjee 1998; Miyazaki et al. 2001). Here we discuss the significance of the recent finding that several genes involved in the arginine (Arg) and leucine (Leu) biosynthesis participate in a new alternative route of the AAA pathway (Miyazaki et al. 2001). Our results demonstrate a clear relationship between the DAP and Arg routes, and between the AAA and Leu pathways.

  4. Evolving a polymerase for hydrophobic base analogues.

    Science.gov (United States)

    Loakes, David; Gallego, José; Pinheiro, Vitor B; Kool, Eric T; Holliger, Philipp

    2009-10-21

    Hydrophobic base analogues (HBAs) have shown great promise for the expansion of the chemical and coding potential of nucleic acids but are generally poor polymerase substrates. While extensive synthetic efforts have yielded examples of HBAs with favorable substrate properties, their discovery has remained challenging. Here we describe a complementary strategy for improving HBA substrate properties by directed evolution of a dedicated polymerase using compartmentalized self-replication (CSR) with the archetypal HBA 5-nitroindole (d5NI) and its derivative 5-nitroindole-3-carboxamide (d5NIC) as selection substrates. Starting from a repertoire of chimeric polymerases generated by molecular breeding of DNA polymerase genes from the genus Thermus, we isolated a polymerase (5D4) with a generically enhanced ability to utilize HBAs. The selected polymerase. 5D4 was able to form and extend d5NI and d5NIC (d5NI(C)) self-pairs as well as d5NI(C) heteropairs with all four bases with efficiencies approaching, or exceeding, those of the cognate Watson-Crick pairs, despite significant distortions caused by the intercalation of the d5NI(C) heterocycles into the opposing strand base stack, as shown by nuclear magnetic resonance spectroscopy (NMR). Unlike Taq polymerase, 5D4 was also able to extend HBA pairs such as Pyrene: varphi (abasic site), d5NI: varphi, and isocarbostyril (ICS): 7-azaindole (7AI), allowed bypass of a chemically diverse spectrum of HBAs, and enabled PCR amplification with primers comprising multiple d5NI(C)-substitutions, while maintaining high levels of catalytic activity and fidelity. The selected polymerase 5D4 promises to expand the range of nucleobase analogues amenable to replication and should find numerous applications, including the synthesis and replication of nucleic acid polymers with expanded chemical and functional diversity.

  5. Diversity of ionizing radiation-resistant bacteria obtained from the Taklimakan Desert.

    Science.gov (United States)

    Yu, Li Zhi-Han; Luo, Xue-Song; Liu, Ming; Huang, Qiaoyun

    2015-01-01

    So far, little is known about the diversity of the radiation-resistant microbes of the hyperarid Taklimakan Desert. In this study, ionizing radiation (IR)-resistant bacteria from two sites in Xinjiang were investigated. After exposing the arid (water content of 0.8 ± 0.3%) and non-arid (water content of 21.3 ± 0.9%) sediment samples to IR of 3000 Gy using a (60)Co source, a total of 52 γ-radiation-resistant bacteria were isolated from the desert sample. The 16S rRNA genes of all isolates were sequenced. The phylogenetic tree places these isolates into five groups: Cytophaga-Flavobacterium-Bacteroides, Proteobacteria, Deinococcus-Thermus, Firmicutes, and Actinobacteria. Interestingly, this is the first report of radiation-resistant bacteria belonging to the genera Knoellia, Lysobacter, Nocardioides, Paracoccus, Pontibacter, Rufibacter and Microvirga. The 16s rRNA genes of four isolates showed low sequence similarities to those of the published species. Phenotypic analysis showed that all bacteria in this study are able to produce catalase, suggesting that these bacteria possess reactive oxygen species (ROS)-scavenging enzymes. These radiation-resistant bacteria also displayed diverse metabolic properties. Moreover, their radiation resistances were found to differ. The diversity of the radiation-resistant bacteria in the desert provides further ecological support for the hypothesis that the ionizing-radiation resistance phenotype is a consequence of the evolution of ROS-scavenging systems that protect cells against oxidative damage caused by desiccation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. High taxonomic diversity of cultivation-recalcitrant endophytic bacteria in grapevine field shoots, their in vitro introduction, and unsuspected persistence.

    Science.gov (United States)

    Thomas, Pious; Sekhar, Aparna C; Shaik, Sadiq Pasha

    2017-11-01

    Molecular and microscopic analyses reveal enormous non-cultivable endophytic bacteria in grapevine field shoots with functional significance. Diverse bacteria enter tissue cultures through surface-sterilized tissues and survive surreptitiously with varying taxonomic realignments. The study was envisaged to assess the extent of endophytic bacterial association with field shoot tissues of grapevine and the likelihood of introduction of such internally colonizing bacteria in vitro adopting molecular techniques targeting the non-cultivable bacterial community. PowerFood ® -kit derived DNA from surface-sterilized field shoot tips of grapevine Flame Seedless was employed in a preliminary bacterial class-specific PCR screening proving positive for major prokaryotic taxa including Archaea. Taxonomic and functional diversity were analyzed through whole metagenome profiling (WMG) which revealed predominantly phylum Actinobacteria, Proteobacteria, and minor shares of Firmicutes, Bacteroidetes, and Deinococcus-Thermus with varying functional roles ascribable to the whole bacterial community. Field shoot tip tissues and callus derived from stem segments were further employed in 16S rRNA V3-V4 amplicon taxonomic profiling. This revealed elevated taxonomic diversity in field shoots over WMG, predominantly Proteobacteria succeeded by Actinobacteria, Firmicutes, Bacteroidetes, and 15 other phyla including several candidate phyla (135 families, 179 genera). Callus stocks also displayed broad bacterial diversity (16 phyla; 96 families; 141 genera) bearing resemblance to field tissues with Proteobacterial dominance but a reduction in its share, enrichment of Actinobacteria and Firmicutes, disappearance of some field-associated phyla and detection of a few additional taxonomic groups over field community. Similar results were documented during 16S V3-V4 amplicon taxonomic profiling on Thompson Seedless field shoot tip and callus tissues. Video microscopy on tissue homogenates

  7. Detection of a Usp-like gene in Calotropis procera plant from the de novo assembled genome contigs of the high-throughput sequencing dataset

    KAUST Repository

    Shokry, Ahmed M.

    2014-02-01

    The wild plant species Calotropis procera (C. procera) has many potential applications and beneficial uses in medicine, industry and ornamental field. It also represents an excellent source of genes for drought and salt tolerance. Genes encoding proteins that contain the conserved universal stress protein (USP) domain are known to provide organisms like bacteria, archaea, fungi, protozoa and plants with the ability to respond to a plethora of environmental stresses. However, information on the possible occurrence of Usp in C. procera is not available. In this study, we uncovered and characterized a one-class A Usp-like (UspA-like, NCBI accession No. KC954274) gene in this medicinal plant from the de novo assembled genome contigs of the high-throughput sequencing dataset. A number of GenBank accessions for Usp sequences were blasted with the recovered de novo assembled contigs. Homology modelling of the deduced amino acids (NCBI accession No. AGT02387) was further carried out using Swiss-Model, accessible via the EXPASY. Superimposition of C. procera USPA-like full sequence model on Thermus thermophilus USP UniProt protein (PDB accession No. Q5SJV7) was constructed using RasMol and Deep-View programs. The functional domains of the novel USPA-like amino acids sequence were identified from the NCBI conserved domain database (CDD) that provide insights into sequence structure/function relationships, as well as domain models imported from a number of external source databases (Pfam, SMART, COG, PRK, TIGRFAM). © 2014 Académie des sciences.

  8. Exploring bacterial diversity in hospital environments by GS-FLX Titanium pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Margarita Poza

    Full Text Available Understanding microbial populations in hospital environments is crucial for improving human health. Hospital-acquired infections are an increasing problem in intensive care units (ICU. In this work we present an exploration of bacterial diversity at inanimate surfaces of the ICU wards of the University Hospital A Coruña (Spain, as an example of confined hospital environment subjected to selective pressure, taking the entrance hall of the hospital, an open and crowded environment, as reference. Surface swab samples were collected from both locations and recovered DNA used as template to amplify a hypervariable region of the bacterial 16S rRNA gene. Sequencing of the amplicons was performed at the Roche 454 Sequencing Center using GS-FLX Titanium procedures. Reads were pre-processed and clustered into OTUs (operational taxonomic units, which were further classified. A total of 16 canonical bacterial phyla were detected in both locations. Members of the phyla Firmicutes (mainly Staphylococcus and Streptococcus and Actinobacteria (mainly Micrococcaceae, Corynebacteriaceae and Brevibacteriaceae were over-represented in the ICU with respect to the Hall. The phyllum Proteobacteria was also well represented in the ICU, mainly by members of the families Enterobacteriaceae, Methylobacteriaceae and Sphingomonadaceae. In the Hall sample, the phyla Proteobacteria, Bacteroidetes, Deinococcus-Thermus and Cyanobacteria were over-represented with respect to the ICU. Over-representation of Proteobacteria was mainly due to the high abundance of Enterobacteriaceae members. The presented results demonstrate that bacterial diversity differs at the ICU and entrance hall locations. Reduced diversity detected at ICU, relative to the entrance hall, can be explained by its confined character and by the existence of antimicrobial selective pressure. This is the first study using deep sequencing techniques made in hospital wards showing substantial hospital microbial

  9. Exploring bacterial diversity in hospital environments by GS-FLX Titanium pyrosequencing.

    Science.gov (United States)

    Poza, Margarita; Gayoso, Carmen; Gómez, Manuel J; Rumbo-Feal, Soraya; Tomás, María; Aranda, Jesús; Fernández, Ana; Bou, Germán

    2012-01-01

    Understanding microbial populations in hospital environments is crucial for improving human health. Hospital-acquired infections are an increasing problem in intensive care units (ICU). In this work we present an exploration of bacterial diversity at inanimate surfaces of the ICU wards of the University Hospital A Coruña (Spain), as an example of confined hospital environment subjected to selective pressure, taking the entrance hall of the hospital, an open and crowded environment, as reference. Surface swab samples were collected from both locations and recovered DNA used as template to amplify a hypervariable region of the bacterial 16S rRNA gene. Sequencing of the amplicons was performed at the Roche 454 Sequencing Center using GS-FLX Titanium procedures. Reads were pre-processed and clustered into OTUs (operational taxonomic units), which were further classified. A total of 16 canonical bacterial phyla were detected in both locations. Members of the phyla Firmicutes (mainly Staphylococcus and Streptococcus) and Actinobacteria (mainly Micrococcaceae, Corynebacteriaceae and Brevibacteriaceae) were over-represented in the ICU with respect to the Hall. The phyllum Proteobacteria was also well represented in the ICU, mainly by members of the families Enterobacteriaceae, Methylobacteriaceae and Sphingomonadaceae. In the Hall sample, the phyla Proteobacteria, Bacteroidetes, Deinococcus-Thermus and Cyanobacteria were over-represented with respect to the ICU. Over-representation of Proteobacteria was mainly due to the high abundance of Enterobacteriaceae members. The presented results demonstrate that bacterial diversity differs at the ICU and entrance hall locations. Reduced diversity detected at ICU, relative to the entrance hall, can be explained by its confined character and by the existence of antimicrobial selective pressure. This is the first study using deep sequencing techniques made in hospital wards showing substantial hospital microbial diversity.

  10. Hippophae leaf extract (SBL-1) countered radiation induced dysbiosis in jejunum of total body 60Cobalt gamma - irradiated mice

    International Nuclear Information System (INIS)

    Beniwal, C.S.; Madhu Bala

    2014-01-01

    Single dose of SBL-1 administered at the rate 30 mg/kg body weight (b.w.) 30 min prior to whole body 60 Co-gamma-irradiation at lethal dose (10 Gy), rendered >90% survival in comparison to zero survival in the non-SBL-1 treated 60 Co-gamma-irradiated (10 Gy) mice population (J Herbs Spices Med Plants, 2009; 15(2): 203-215). Present study investigated the effect of SBL-1 on jejunal microbiota in lethally irradiated mice. Study was performed with inbred Swiss albino Strain 'A' male mice (age 9 weeks) weighing 28±2 g. The animals were maintained under controlled environment at 26±2℃; 12 h light/dark cycle and offered standard animal food (Golden feed, Delhi) as well as tap water ad libitum. Metagenomic DNA was extracted, purified and quantified from jejunum of the mice. Universal primers (27f and 1492r) were used to amplify the 16S rRNA DNA from the metagenomic DNA. Amplicons were sequenced, vector contamination and chimeras were removed. The sequences (GenBank Accession No: KF681283 to KF681351) were taxonomically classified by using Sequence Match program, Ribosomal Database Project as well as by nucleotide-BLAST (E-value: 10, database: 16S rRNA gene sequences, Bacteria and Archea). Phylogenetic Tree was prepared using MEGA 5.2 package, using maximum likelihood algorithm after sequence alignment by MUSCLE. Thermus aquaticus was used as out-group to construct rooted tree. Branch stability was assessed by bootstrap analysis. Untreated animals and the animals treated with SBL-1 had 100% Lactobacillus; 60 Co gamma-irradiated animals had 55% Cohaesibacter (Alphaproteobacteria); 27% Mycoplasma (Tenericutes) and only 18% Lactobacillus; animals treated with SBL-1 prior to irradiation had 89% Lactobacillus and 11% Clostridium. This study demonstrated that treatment with SBL-1 at radioprotective doses before total body irradiation with lethal dose (10 Gy) countered the jejunal dysbiosis. (author)

  11. Redox-flexible NADH oxidase biosensor: A platform for various dehydrogenase bioassays and biosensors

    International Nuclear Information System (INIS)

    Serban, Simona; El Murr, Nabil

    2006-01-01

    A generic amperometric bioassay based on the enzymatic oxidation catalysed by the stable NADH oxidase (NAox) from Thermus thermophilus has been developed for NADH measurements. The NAox uses O 2 as its natural electron acceptor and produces H 2 O 2 in a two-electron process. Electrochemical and spectrophotometric experiments showed that the NAox used in this work, presents a very good activity towards its substrate and, in contrary to previously mentioned NADH oxidases, does not require the addition of any exogenous flavin cofactor neither to promote nor to maintain its activity. In addition, the NAox used also works with artificial electron acceptors like ferrocene derivatives. O 2 was successfully replaced by redox mediators such as hydroxymethyl ferrocene (FcCH 2 OH) for the regeneration of the active enzyme. Combining the NAox with the mediator and the horseradish peroxidase we developed an original, high sensitive 'redox-flexible' NADH amperometric bioassay working in a large window of applied potentials in both oxidation and reduction modes. The biosensor has a continuous and complementary linearity range permitting to measure NADH concentrations starting from 5 x 10 -6 M in reduction until 2 x 10 3 M in oxidation. This redox-flexibility allows choosing the applied potential in order to avoid electrochemical interferences. The association of the 'redox-flexible' concept with NADH dependent enzymes opens a novel strategy for dehydrogenases based bioassays and biosensors. The great number of dehydrogenases available makes the concept applicable for numerous substrates to analyse. Moreover it allows the development of a wide range of biosensors on the basis of a generic platform. This gives several advantages over the previous manufacturing techniques and offers a general and flexible scheme for the fabrication of biosensors presenting high sensitivities, wide calibration ranges and less affected by electrochemical interferences

  12. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers

    Directory of Open Access Journals (Sweden)

    Céline Brochier-Armanet

    2006-01-01

    Full Text Available Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 °C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  13. Evolution and thermodynamics of the slow unfolding of hyperstable monomeric proteins

    Directory of Open Access Journals (Sweden)

    Koga Yuichi

    2010-07-01

    Full Text Available Abstract Background The unfolding speed of some hyperthermophilic proteins is dramatically lower than that of their mesostable homologs. Ribonuclease HII from the hyperthermophilic archaeon Thermococcus kodakaraensis (Tk-RNase HII is stabilized by its remarkably slow unfolding rate, whereas RNase HI from the thermophilic bacterium Thermus thermophilus (Tt-RNase HI unfolds rapidly, comparable with to that of RNase HI from Escherichia coli (Ec-RNase HI. Results To clarify whether the difference in the unfolding rate is due to differences in the types of RNase H or differences in proteins from archaea and bacteria, we examined the equilibrium stability and unfolding reaction of RNases HII from the hyperthermophilic bacteria Thermotoga maritima (Tm-RNase HII and Aquifex aeolicus (Aa-RNase HII and RNase HI from the hyperthermophilic archaeon Sulfolobus tokodaii (Sto-RNase HI. These proteins from hyperthermophiles are more stable than Ec-RNase HI over all the temperature ranges examined. The observed unfolding speeds of all hyperstable proteins at the different denaturant concentrations studied are much lower than those of Ec-RNase HI, which is in accordance with the familiar slow unfolding of hyperstable proteins. However, the unfolding rate constants of these RNases H in water are dispersed, and the unfolding rate constant of thermophilic archaeal proteins is lower than that of thermophilic bacterial proteins. Conclusions These results suggest that the nature of slow unfolding of thermophilic proteins is determined by the evolutionary history of the organisms involved. The unfolding rate constants in water are related to the amount of buried hydrophobic residues in the tertiary structure.

  14. Widespread distribution of archaeal reverse gyrase in thermophilic bacteria suggests a complex history of vertical inheritance and lateral gene transfers.

    Science.gov (United States)

    Brochier-Armanet, Céline; Forterre, Patrick

    2007-05-01

    Reverse gyrase, an enzyme of uncertain funtion, is present in all hyperthermophilic archaea and bacteria. Previous phylogenetic studies have suggested that the gene for reverse gyrase has an archaeal origin and was transferred laterally (LGT) to the ancestors of the two bacterial hyperthermophilic phyla, Thermotogales and Aquificales. Here, we performed an in-depth analysis of the evolutionary history of reverse gyrase in light of genomic progress. We found genes coding for reverse gyrase in the genomes of several thermophilic bacteria that belong to phyla other than Aquificales and Thermotogales. Several of these bacteria are not, strictly speaking, hyperthermophiles because their reported optimal growth temperatures are below 80 degrees C. Furthermore, we detected a reverse gyrase gene in the sequence of the large plasmid of Thermus thermophilus strain HB8, suggesting a possible mechanism of transfer to the T. thermophilus strain HB8 involving plasmids and transposases. The archaeal part of the reverse gyrase tree is congruent with recent phylogenies of the archaeal domain based on ribosomal proteins or RNA polymerase subunits. Although poorly resolved, the complete reverse gyrase phylogeny suggests an ancient acquisition of the gene by bacteria via one or two LGT events, followed by its secondary distribution by LGT within bacteria. Finally, several genes of archaeal origin located in proximity to the reverse gyrase gene in bacterial genomes have bacterial homologues mostly in thermophiles or hyperthermophiles, raising the possibility that they were co-transferred with the reverse gyrase gene. Our new analysis of the reverse gyrase history strengthens the hypothesis that the acquisition of reverse gyrase may have been a crucial evolutionary step in the adaptation of bacteria to high-temperature environments. However, it also questions the role of this enzyme in thermophilic bacteria and the selective advantage its presence could provide.

  15. Diversity, biological roles and biosynthetic pathways for sugar-glycerate containing compatible solutes in bacteria and archaea.

    Science.gov (United States)

    Empadinhas, Nuno; da Costa, Milton S

    2011-08-01

    A decade ago the compatible solutes mannosylglycerate (MG) and glucosylglycerate (GG) were considered to be rare in nature. Apart from two species of thermophilic bacteria, Thermus thermophilus and Rhodothermus marinus, and a restricted group of hyperthermophilic archaea, the Thermococcales, MG had only been identified in a few red algae. Glucosylglycerate was considered to be even rarer and had only been detected as an insignificant solute in two halophilic microorganisms, a cyanobacterium, as a component of a polysaccharide and of a glycolipid in two actinobacteria. Unlike the hyper/thermophilic MG-accumulating microorganisms, branching close to the root of the Tree of Life, those harbouring GG shared a mesophilic lifestyle. Exceptionally, the thermophilic bacterium Persephonella marina was reported to accumulate GG. However, and especially owing to the identification of the key-genes for MG and GG synthesis and to the escalating numbers of genomes available, a plethora of new organisms with the resources to synthesize these solutes has been recognized. The accumulation of GG as an 'emergency' compatible solute under combined salt stress and nitrogen-deficient conditions now seems to be a disseminated survival strategy from enterobacteria to marine cyanobacteria. In contrast, the thermophilic and extremely radiation-resistant bacterium Rubrobacter xylanophilus is the only actinobacterium known to accumulate MG, and under all growth conditions tested. This review addresses the environmental factors underlying the accumulation of MG, GG and derivatives in bacteria and archaea and their roles during stress adaptation or as precursors for more elaborated macromolecules. The diversity of pathways for MG and GG synthesis as well as those for some of their derivatives is also discussed. The importance of glycerate-derived organic solutes in the microbial world is only now being recognized. Their stress-dependent accumulation and the molecular aspects of their

  16. Taxonomic and functional characteristics of microbial communities and their correlation with physicochemical properties of four geothermal springs in Odisha, India.

    Science.gov (United States)

    Badhai, Jhasketan; Ghosh, Tarini S; Das, Subrata K

    2015-01-01

    This study describes microbial diversity in four tropical hot springs representing moderately thermophilic environments (temperature range: 40-58°C; pH: 7.2-7.4) with discrete geochemistry. Metagenome sequence data showed a dominance of Bacteria over Archaea; the most abundant phyla were Chloroflexi and Proteobacteria, although other phyla were also present, such as Acetothermia, Nitrospirae, Acidobacteria, Firmicutes, Deinococcus-Thermus, Bacteroidetes, Thermotogae, Euryarchaeota, Verrucomicrobia, Ignavibacteriae, Cyanobacteria, Actinobacteria, Planctomycetes, Spirochaetes, Armatimonadetes, Crenarchaeota, and Aquificae. The distribution of major genera and their statistical correlation analyses with the physicochemical parameters predicted that the temperature, aqueous concentrations of ions (such as sodium, chloride, sulfate, and bicarbonate), total hardness, dissolved solids and conductivity were the main environmental variables influencing microbial community composition and diversity. Despite the observed high taxonomic diversity, there were only little variations in the overall functional profiles of the microbial communities in the four springs. Genes involved in the metabolism of carbohydrates and carbon fixation were the most abundant functional class of genes present in these hot springs. The distribution of genes involved in carbon fixation predicted the presence of all the six known autotrophic pathways in the metagenomes. A high prevalence of genes involved in membrane transport, signal transduction, stress response, bacterial chemotaxis, and flagellar assembly were observed along with genes involved in the pathways of xenobiotic degradation and metabolism. The analysis of the metagenomic sequences affiliated to the candidate phylum Acetothermia from spring TB-3 provided new insight into the metabolism and physiology of yet-unknown members of this lineage of bacteria.

  17. Microbial community composition of transiently wetted Antarctic Dry Valley soils.

    Science.gov (United States)

    Niederberger, Thomas D; Sohm, Jill A; Gunderson, Troy E; Parker, Alexander E; Tirindelli, Joëlle; Capone, Douglas G; Carpenter, Edward J; Cary, Stephen C

    2015-01-01

    During the summer months, wet (hyporheic) soils associated with ephemeral streams and lake edges in the Antarctic Dry Valleys (DVs) become hotspots of biological activity and are hypothesized to be an important source of carbon and nitrogen for arid DV soils. Recent research in the DV has focused on the geochemistry and microbial ecology of lakes and arid soils, with substantially less information being available on hyporheic soils. Here, we determined the unique properties of hyporheic microbial communities, resolved their relationship to environmental parameters and compared them to archetypal arid DV soils. Generally, pH increased and chlorophyll a concentrations decreased along transects from wet to arid soils (9.0 to ~7.0 for pH and ~0.8 to ~5 μg/cm(3) for chlorophyll a, respectively). Soil water content decreased to below ~3% in the arid soils. Community fingerprinting-based principle component analyses revealed that bacterial communities formed distinct clusters specific to arid and wet soils; however, eukaryotic communities that clustered together did not have similar soil moisture content nor did they group together based on sampling location. Collectively, rRNA pyrosequencing indicated a considerably higher abundance of Cyanobacteria in wet soils and a higher abundance of Acidobacterial, Actinobacterial, Deinococcus/Thermus, Bacteroidetes, Firmicutes, Gemmatimonadetes, Nitrospira, and Planctomycetes in arid soils. The two most significant differences at the genus level were Gillisia signatures present in arid soils and chloroplast signatures related to Streptophyta that were common in wet soils. Fungal dominance was observed in arid soils and Viridiplantae were more common in wet soils. This research represents an in-depth characterization of microbial communities inhabiting wet DV soils. Results indicate that the repeated wetting of hyporheic zones has a profound impact on the bacterial and eukaryotic communities inhabiting in these areas.

  18. Bacterial diversity at different stages of the composting process

    Directory of Open Access Journals (Sweden)

    Paulin Lars

    2010-03-01

    Full Text Available Abstract Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants.

  19. Unraveling the evolutionary history of the phosphoryl-transfer chain of the phosphoenolpyruvate:phosphotransferase system through phylogenetic analyses and genome context

    Directory of Open Access Journals (Sweden)

    Zúñiga Manuel

    2008-05-01

    Full Text Available Abstract Background The phosphoenolpyruvate phosphotransferase system (PTS plays a major role in sugar transport and in the regulation of essential physiological processes in many bacteria. The PTS couples solute transport to its phosphorylation at the expense of phosphoenolpyruvate (PEP and it consists of general cytoplasmic phosphoryl transfer proteins and specific enzyme II complexes which catalyze the uptake and phosphorylation of solutes. Previous studies have suggested that the evolution of the constituents of the enzyme II complexes has been driven largely by horizontal gene transfer whereas vertical inheritance has been prevalent in the general phosphoryl transfer proteins in some bacterial groups. The aim of this work is to test this hypothesis by studying the evolution of the phosphoryl transfer proteins of the PTS. Results We have analyzed the evolutionary history of the PTS phosphoryl transfer chain (PTS-ptc components in 222 complete genomes by combining phylogenetic methods and analysis of genomic context. Phylogenetic analyses alone were not conclusive for the deepest nodes but when complemented with analyses of genomic context and functional information, the main evolutionary trends of this system could be depicted. Conclusion The PTS-ptc evolved in bacteria after the divergence of early lineages such as Aquificales, Thermotogales and Thermus/Deinococcus. The subsequent evolutionary history of the PTS-ptc varied in different bacterial lineages: vertical inheritance and lineage-specific gene losses mainly explain the current situation in Actinobacteria and Firmicutes whereas horizontal gene transfer (HGT also played a major role in Proteobacteria. Most remarkably, we have identified a HGT event from Firmicutes or Fusobacteria to the last common ancestor of the Enterobacteriaceae, Pasteurellaceae, Shewanellaceae and Vibrionaceae. This transfer led to extensive changes in the metabolic and regulatory networks of these bacteria

  20. Symmetrical refolding of protein domains and subunits: example of the dimeric two-domain 3-isopropylmalate dehydrogenases.

    Science.gov (United States)

    Gráczer, Eva; Varga, Andrea; Melnik, Bogdan; Semisotnov, Gennady; Závodszky, Péter; Vas, Mária

    2009-02-10

    The refolding mechanism of the homodimeric two-domain 3-isopropylmalate dehydrogenase (IPMDH) from the organisms adapted to different temperatures, Thermus thermophilus (Tt), Escherichia coli (Ec), and Vibrio sp. I5 (Vib), is described. In all three cases, instead of a self-template mechanism, the high extent of symmetry and cooperativity in folding of subunits and domains have been concluded from the following experimental findings: The complex time course of refolding, monitored by Trp fluorescence, consists of a fast (the rate constant varies as 16.5, 25.0, and 11.7 min-1 in the order of Tt, Ec, and Vib IPMDHs) and a slow (the rate constants are 0.11, 0.80, and 0.23 min-1 for the three different species) first-order process. However, a burst increase of Trp fluorescence anisotropy to the value of the native states indicates that in all three cases the association of the two polypeptide chains occurs at the beginning of refolding. This dimeric species binds the substrate IPM, but the native-like interactions of the tertiary and quaternary structures are only formed during the slow phase of refolding, accompanied by further increase of protein fluorescence and appearance of FRET between Trp side chain(s) and the bound NADH. Joining the contacting arms of each subunit also takes place exclusively during this slow phase. To monitor refolding of each domain within the intact molecule of T. thermophilus IPMDH, Trp's (located in separate domains) were systematically replaced with Phe's. The refolding processes of the mutants were followed by measuring changes in Trp fluorescence and in FRET between the particular Trp and NADH. The high similarity of time courses (both in biphasicity and in their rates) strongly suggests cooperative folding of the domains during formation of the native three-dimensional structure of IPMDH.

  1. Genomic footprinting in mammalian cells with ultraviolet light

    International Nuclear Information System (INIS)

    Becker, M.M.; Wang, Z.; Grossmann, G.; Becherer, K.A.

    1989-01-01

    A simple and accurate genomic primer extension method has been developed to detect ultraviolet footprinting patterns of regulatory protein-DNA interactions in mammalian genomic DNA. The technique can also detect footprinting or sequencing patterns introduced into genomic DNA by other methods. Purified genomic DNA, containing either damaged bases or strand breaks introduced by footprinting or sequencing reactions, is first cut with a convenient restriction enzyme to reduce its molecular weight. A highly radioactive single-stranded DNA primer that is complementary to a region of genomic DNA whose sequence or footprint one wishes to examine is then mixed with 50 micrograms of restriction enzyme-cut genomic DNA. The primer is approximately 100 bases long and contains 85 radioactive phosphates, each of specific activity 3000 Ci/mmol (1 Ci = 37 GBq). A simple and fast method for preparing such primers is described. Following brief heat denaturation at 100 degrees C, the solution of genomic DNA and primer is cooled to 74 degrees C and a second solution containing Taq polymerase (Thermus aquaticus DNA polymerase) and the four deoxynucleotide triphosphates is added to initiate primer extension of genomic DNA. Taq polymerase extends genomic hybridized primer until its polymerization reaction is terminated either by a damaged base or strand break in genomic DNA or by the addition of dideoxynucleotide triphosphates in the polymerization reaction. The concurrent primer hybridization-extension reaction is terminated after 5 hr and unhybridized primer is digested away by mung bean nuclease. Primer-extended genomic DNA is then denatured and electrophoresed on a polyacrylamide sequencing gel, and radioactive primer extension products are revealed by autoradiography

  2. The role of bacterial antizyme: From an inhibitory protein to AtoC transcriptional regulator

    Directory of Open Access Journals (Sweden)

    Kyriakidis Dimitrios A

    2004-06-01

    Full Text Available Abstract This review considers the role of bacterial antizyme in the regulation of polyamine biosynthesis and gives new perspectives on the involvement of antizyme in other significant cellular mechanisms. Antizyme is a protein molecule induced by the end product of the enzymic reaction that it inhibits, in a non-competitive manner. The bacterial ornithine decarboxylase is regulated by nucleotides, phosphorylation and antizyme. The inhibition of ornithine decarboxylase by antizyme can be relieved to different degrees by DNA or by a variety of synthetic nucleic acid polymers, attributed to a specific interaction between nucleic acid and antizyme. Recently, this interplay between bacterial antizyme and nucleic acid was determined by discerning an additional function to antizyme that proved to be the atoC gene product, encoding the response regulator of the bacterial two-component system AtoS-AtoC. The gene located just upstream of atoC encodes the sensor kinase, named AtoS, that modulates AtoC activity. AtoC regulates expression of atoDAEB operon which is involved in short-chain fatty acid metabolism. Antizyme is thus referred to as AtoC, functioning both as a post-translational and transcriptional regulator. Also, the AtoS-AtoC signal transduction system in E. coli has a positive regulatory role on poly-(R-3-hydroxybutyrate biosynthesis. The properties and gene structural similarities of antizymes from different organisms were compared. It was revealed that conserved domains are present mostly in the C-domain of all antizymes. BLAST analysis of the E. coli antizyme protein (AtoC showed similarities around 69–58% among proteobacteria, g-proteobacteria, enterobacteria and the thermophilic bacterium Thermus thermophilus. A working hypothesis is proposed for the metabolic role of antizyme (AtoC describing the significant biological implications of this protein molecule. Whether antizymes exist to other enzymes in different tissues, meeting the

  3. Non-complexed four cascade enzyme mixture: simple purification and synergetic co-stabilization.

    Directory of Open Access Journals (Sweden)

    Suwan Myung

    Full Text Available Cell-free biosystems comprised of synthetic enzymatic pathways would be a promising biomanufacturing platform due to several advantages, such as high product yield, fast reaction rate, easy control and access, and so on. However, it was essential to produce (purified enzymes at low costs and stabilize them for a long time so to decrease biocatalyst costs. We studied the stability of the four recombinant enzyme mixtures, all of which originated from thermophilic microorganisms: triosephosphate isomerase (TIM from Thermus thermophiles, fructose bisphosphate aldolase (ALD from Thermotoga maritima, fructose bisphosphatase (FBP from T. maritima, and phosphoglucose isomerase (PGI from Clostridium thermocellum. It was found that TIM and ALD were very stable at evaluated temperature so that they were purified by heat precipitation followed by gradient ammonia sulfate precipitation. In contrast, PGI was not stable enough for heat treatment. In addition, the stability of a low concentration PGI was enhanced by more than 25 times in the presence of 20 mg/L bovine serum albumin or the other three enzymes. At a practical enzyme loading of 1000 U/L for each enzyme, the half-life time of free PGI was prolong to 433 h in the presence of the other three enzymes, resulting in a great increase in the total turn-over number of PGI to 6.2×10(9 mole of product per mole of enzyme. This study clearly suggested that the presence of other proteins had a strong synergetic effect on the stabilization of the thermolabile enzyme PGI due to in vitro macromolecular crowding effect. Also, this result could be used to explain why not all enzymes isolated from thermophilic microorganisms are stable in vitro because of a lack of the macromolecular crowding environment.

  4. Taxonomic and functional characteristics of microbial communities and their correlation with physicochemical properties of four geothermal springs in Odisha, India

    Directory of Open Access Journals (Sweden)

    Subrata K Das

    2015-10-01

    Full Text Available This study describes microbial diversity in four tropical hot springs representing moderately thermophilic environments (temperature range: 40-58 °C; pH: 7.2-7.4 with discrete geochemistry. Metagenome sequence data showed a dominance of Bacteria over Archaea; the most abundant phyla were Chloroflexi and Proteobacteria, although other phyla were also present, such as Acetothermia, Nitrospirae, Acidobacteria, Firmicutes, Deinococcus-Thermus, Bacteroidetes, Thermotogae, Euryarchaeota, Verrucomicrobia, Ignavibacteriae, Cyanobacteria, Actinobacteria, Planctomycetes, Spirochaetes, Armatimonadetes, Crenarchaeota, and Aquificae. The distribution of major genera and their statistical correlation analyses with the physicochemical parameters predicted that the temperature, aqueous concentrations of ions (such as sodium, chloride, sulfate, and bicarbonate, total hardness, dissolved solids and conductivity were the main environmental variables influencing microbial community composition and diversity. Despite the observed high taxonomic diversity, there were only little variations in the overall functional profiles of the microbial communities in the four springs. Genes involved in the metabolism of carbohydrates and carbon fixation were the most abundant functional class of genes present in these hot springs. The distribution of genes involved in carbon fixation predicted the presence of all the six known autotrophic pathways in the metagenomes. A high prevalence of genes involved in membrane transport, signal transduction, stress response, bacterial chemotaxis and flagellar assembly were observed along with genes involved in the pathways of xenobiotic degradation and metabolism. The analysis of the metagenomic sequences affiliated to the candidate phylum Acetothermia from spring TB-3 provided new insight into the metabolism and physiology of yet-unknown members of this lineage of bacteria.

  5. Microbiological monitoring in geothermal plants and a cold storage

    Science.gov (United States)

    Alawi, Mashal; Lerm, Stephanie; Vieth, Andrea; Vetter, Alexandra; Miethling-Graff, Rona; Seibt, Andrea; Wolfgramm, Markus; Würdemann, Hilke

    2010-05-01

    Enhanced process understanding of engineered geothermal systems is mandatory to optimize plant reliability and economy. In the scope of the research project 'AquiScreen' we investigated geothermally used groundwater systems under microbial, geochemical, mineralogical and petrological aspects. Geothermal systems located in the North German Basin and the Molasse Basin were analyzed by sampling of fluids and solid phases. The investigated sites were characterized by different temperatures, salinities and potential microbial substrates. The microbial population was analyzed by the use of genetic fingerprinting techniques based on PCR-amplified 16S rRNA genes. Sequencing of dominant bands of fingerprints from different sites and the subsequent comparison on public databases enables a correlation to metabolic classes and provides information about the biochemical processes. In all investigated geothermal plants covering a temperature range from 45° to 120° C microorganisms were found. Phylogenetic gene analyses indicate a broad diversity of microorganisms adapted to the specific conditions in the engineered system. Beside characterized bacteria like Thermus scotoductus, Siderooxidans lithoautotrophicus and the archaeon Methanothermobacter thermoautotrophicus a high number of so far uncultivated microorganisms was detected. As it is known that -in addition to abiotic factors- microbes like sulfate-reducing bacteria (SRB) are involved in the processes of corrosion and scaling in plant components we identified SRB by specific analyses of dissimilatoric sulfite reductase genes. The SRB detected are closely related to thermotolerant and thermophilic species of Desulfotomaculum, Thermodesulfovibrio and Thermodesulfobacterium, respectively. Overall, the detection of microbes known to be involved in biocorrosion and examined precipitation products like iron sulfides are indicating that microorganisms play an important role for the understanding of processes in engineered

  6. Microbiological Monitoring in Geothermal Plants

    Science.gov (United States)

    Alawi, M.; Lerm, S.; Linder, R.; Vetter, A.; Vieth-Hillebrand, A.; Miethling-Graff, R.; Seibt, A.; Wolfgramm, M.; Wuerdemann, H.

    2010-12-01

    In the scope of the research projects “AquiScreen” and “MiProTherm” we investigated geothermally used groundwater systems under microbial, geochemical, mineralogical and petrological aspects. On one side an enhanced process understanding of engineered geothermal systems is mandatory to optimize plant reliability and economy, on the other side this study provides insights into the microbiology of terrestrial thermal systems. Geothermal systems located in the North German Basin and the Molasse Basin were analyzed by sampling of fluids and solid phases. The investigated sites were characterized by different temperatures, salinities and potential microbial substrates. The microbial population was monitored by the use of genetic fingerprinting techniques and PCR-cloning based on PCR-amplified 16S rRNA and dissimilatory sulfite reductase (DSR) genes. DNA-sequences of fingerprints and cloned PCR-products were compared to public databases and correlated with metabolic classes to provide information about the biogeochemical processes. In all investigated geothermal plants, covering a temperature range from 5° to 120°C, microorganisms were found. Phylogenetic gene analyses indicate a broad diversity of microorganisms adapted to the specific conditions in the engineered system. Beside characterized bacteria like Thermus scotoductus, Siderooxidans lithoautotrophicus and the archaeon Methanothermobacter thermoautotrophicus a high number of so far uncultivated microorganisms was detected. As it is known that - in addition to abiotic factors - microbes like sulfate-reducing bacteria (SRB) are involved in the processes of corrosion and scaling in plant components, we identified SRB by specific analyses of DSR genes. The SRB detected are closely related to thermotolerant and thermophilic species of Desulfotomaculum, Thermodesulfovibrio, Desulfohalobium and Thermodesulfobacterium, respectively. Overall, the detection of microbes known to be involved in biocorrosion and the

  7. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  8. Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.

    Science.gov (United States)

    Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane

    2018-05-14

    The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the

  9. The distribution of active β-glucosidase-producing microbial communities in composting.

    Science.gov (United States)

    Zang, Xiangyun; Liu, Meiting; Wang, Han; Fan, Yihong; Zhang, Haichang; Liu, Jiawen; Xing, Enlu; Xu, Xiuhong; Li, Hongtao

    2017-12-01

    The composting ecosystem is a suitable source for the discovery of novel microorganisms and secondary metabolites. Cellulose degradation is an important part of the global carbon cycle, and β-glucosidases complete the final step of cellulose hydrolysis by converting cellobiose to glucose. This work analyzes the succession of β-glucosidase-producing microbial communities that persist throughout cattle manure - rice straw composting, and evaluates their metabolic activities and community advantage during the various phases of composting. Fungal and bacterial β-glucosidase genes belonging to glycoside hydrolase families 1 and 3 (GH1 and GH3) amplified from DNA were classified and gene abundance levels were analyzed. The major reservoirs of β-glucosidase genes were the fungal phylum Ascomycota and the bacterial phyla Firmicutes, Actinobacteria, Proteobacteria, and Deinococcus-Thermus. This indicates that a diverse microbial community utilizes cellobiose. The succession of dominant bacteria was also detected during composting. Firmicutes was the dominant bacteria in the thermophilic phase of composting; there was a shift to Actinomycetes in the maturing stage. Proteobacteria accounted for the highest proportions during the heating and thermophilic phases of composting. By contrast, the fungal phylum Ascomycota was a minor microbial community constituent in thermophilic phase of composting. Combined with the analysis of the temperature, cellulose degradation rate and the carboxymethyl cellulase and β-glucosidase activities showed that the bacterial GH1 family β-glucosidase genes make greater contribution in cellulose degradation at the later thermophilic stage of composting. In summary, even GH1 bacteria families β-glucosidase genes showing low abundance in DNA may be functionally important in the later thermophilic phase of composting. The results indicate that a complex community of bacteria and fungi expresses β-glucosidases in compost. Several

  10. A selection that reports on protein-protein interactions within a thermophilic bacterium.

    Science.gov (United States)

    Nguyen, Peter Q; Silberg, Jonathan J

    2010-07-01

    Many proteins can be split into fragments that exhibit enhanced function upon fusion to interacting proteins. While this strategy has been widely used to create protein-fragment complementation assays (PCAs) for discovering protein-protein interactions within mesophilic organisms, similar assays have not yet been developed for studying natural and engineered protein complexes at the temperatures where thermophilic microbes grow. We describe the development of a selection for protein-protein interactions within Thermus thermophilus that is based upon growth complementation by fragments of Thermotoga neapolitana adenylate kinase (AK(Tn)). Complementation studies with an engineered thermophile (PQN1) that is not viable above 75 degrees C because its adk gene has been replaced by a Geobacillus stearothermophilus ortholog revealed that growth could be restored at 78 degrees C by a vector that coexpresses polypeptides corresponding to residues 1-79 and 80-220 of AK(Tn). In contrast, PQN1 growth was not complemented by AK(Tn) fragments harboring a C156A mutation within the zinc-binding tetracysteine motif unless these fragments were fused to Thermotoga maritima chemotaxis proteins that heterodimerize (CheA and CheY) or homodimerize (CheX). This enhanced complementation is interpreted as arising from chemotaxis protein-protein interactions, since AK(Tn)-C156A fragments having only one polypeptide fused to a chemotaxis protein did not complement PQN1 to the same extent. This selection increases the maximum temperature where a PCA can be used to engineer thermostable protein complexes and to map protein-protein interactions.

  11. The oral and conjunctival microbiotas in cats with and without feline immunodeficiency virus infection.

    Science.gov (United States)

    Weese, Scott J; Nichols, Jamieson; Jalali, Mohammad; Litster, Annette

    2015-03-03

    The oral and conjunctival microbiotas likely play important roles in protection from opportunistic infections, while also being the source of potential pathogens. Yet, there has been limited investigation in cats, and the impact of comorbidities such as feline immunodeficiency virus (FIV) infection has not been reported. Oral and conjunctival swabs were collected from cats with FIV infection and FIV-uninfected controls, and subjected to 16S rRNA gene (V4) PCR and next generation sequencing. 9,249 OTUs were identified from conjunctival swabs, yet the most common 20 (0.22%) OTUs accounted for 76% of sequences. The two most abundant OTUs both belonged to Staphylococcus, and accounted for 37% of sequences. Cats with FIV infection had significantly lower relative abundances of Verrucomicrobia, Fibrobacteres, Spirochaetes, Bacteroidetes and Tenericutes, and a higher relative abundance of Deinococcus-Thermus. There were significant differences in both community membership (P = 0.006) and community structure (P = 0.02) between FIV-infected and FIV-uninfected cats. FIV-infected cats had significantly higher relative abundances of Fusobacteria and Actinobacteria in the oral cavity, and significantly higher relative abundances of several bacterial classes including Fusobacteria (0.022 vs 0.007, P = 0.006), Actinobacteria (0.017 vs 0.003, P = 0.003), Sphingobacteria (0.00015 vs 0.00003, P = 0.0013) and Flavobacteria (0.0073 vs 0.0034, P = 0.030). The feline conjunctival and oral microbiotas are complex polymicrobial communities but dominated by a limited number of genera. There is an apparent impact of FIV infection on various components of the microbiota, and assessment of the clinical relevance of these alterations in required.

  12. Post-translational modifications near the quinone binding site of mammalian complex I.

    Science.gov (United States)

    Carroll, Joe; Ding, Shujing; Fearnley, Ian M; Walker, John E

    2013-08-23

    Complex I (NADH:ubiquinone oxidoreductase) in mammalian mitochondria is an L-shaped assembly of 44 protein subunits with one arm buried in the inner membrane of the mitochondrion and the orthogonal arm protruding about 100 Å into the matrix. The protruding arm contains the binding sites for NADH, the primary acceptor of electrons flavin mononucleotide (FMN), and a chain of seven iron-sulfur clusters that carries the electrons one at a time from FMN to a coenzyme Q molecule bound in the vicinity of the junction between the two arms. In the structure of the closely related bacterial enzyme from Thermus thermophilus, the quinone is thought to bind in a tunnel that spans the interface between the two arms, with the quinone head group close to the terminal iron-sulfur cluster, N2. The tail of the bound quinone is thought to extend from the tunnel into the lipid bilayer. In the mammalian enzyme, it is likely that this tunnel involves three of the subunits of the complex, ND1, PSST, and the 49-kDa subunit. An arginine residue in the 49-kDa subunit is symmetrically dimethylated on the ω-N(G) and ω-N(G') nitrogen atoms of the guanidino group and is likely to be close to cluster N2 and to influence its properties. Another arginine residue in the PSST subunit is hydroxylated and probably lies near to the quinone. Both modifications are conserved in mammalian enzymes, and the former is additionally conserved in Pichia pastoris and Paracoccus denitrificans, suggesting that they are functionally significant.

  13. Diets Alter the Gut Microbiome of Crocodile Lizards

    Directory of Open Access Journals (Sweden)

    Hai-Ying Jiang

    2017-10-01

    Full Text Available The crocodile lizard is a critically endangered reptile, and serious diseases have been found in this species in recent years, especially in captive lizards. Whether these diseases are caused by changes in the gut microbiota and the effect of captivity on disease remains to be determined. Here, we examined the relationship between the gut microbiota and diet and disease by comparing the fecal microbiota of wild lizards with those of sick and healthy lizards in captivity. The gut microbiota in wild crocodile lizards was consistently dominated by Proteobacteria (∼56.4% and Bacteroidetes (∼19.1%. However, the abundance of Firmicutes (∼2.6% in the intestine of the wild crocodile lizards was distinctly lower than that in other vertebrates. In addition, the wild samples from Guangdong Luokeng Shinisaurus crocodilurus National Nature Reserve also had a high abundance of Deinococcus–Thermus while the wild samples from Guangxi Daguishan Crocodile Lizard National Nature Reserve had a high abundance of Tenericutes. The gut microbial community in loach-fed crocodile lizards was significantly different from the gut microbial community in the earthworm-fed and wild lizards. In addition, significant differences in specific bacteria were detected among groups. Notably, in the gut microbiota, the captive lizards fed earthworms resulted in enrichment of Fusobacterium, and the captive lizards fed loaches had higher abundances of Elizabethkingia, Halomonas, Morganella, and Salmonella, all of which are pathogens or opportunistic pathogens in human or other animals. However, there is no sufficient evidence that the gut microbiota contributes to either disease A or disease B. These results provide a reference for the conservation of endangered crocodile lizards and the first insight into the relationship between disease and the gut microbiota in lizards.

  14. Engineering an ATP-dependent D-Ala:D-Ala ligase for synthesizing amino acid amides from amino acids.

    Science.gov (United States)

    Miki, Yuta; Okazaki, Seiji; Asano, Yasuhisa

    2017-05-01

    We successfully engineered a new enzyme that catalyzes the formation of D-Ala amide (D-AlaNH 2 ) from D-Ala by modifying ATP-dependent D-Ala:D-Ala ligase (EC 6.3.2.4) from Thermus thermophilus, which catalyzes the formation of D-Ala-D-Ala from two molecules of D-Ala. The new enzyme was created by the replacement of the Ser293 residue with acidic amino acids, as it was speculated to bind to the second D-Ala of D-Ala-D-Ala. In addition, a replacement of the position with Glu performed better than that with Asp with regards to specificity for D-AlaNH 2 production. The S293E variant, which was selected as the best enzyme for D-AlaNH 2 production, exhibited an optimal activity at pH 9.0 and 40 °C for D-AlaNH 2 production. The apparent K m values of this variant for D-Ala and NH 3 were 7.35 mM and 1.58 M, respectively. The S293E variant could catalyze the synthesis of 9.3 and 35.7 mM of D-AlaNH 2 from 10 and 50 mM D-Ala and 3 M NH 4 Cl with conversion yields of 93 and 71.4 %, respectively. This is the first report showing the enzymatic formation of amino acid amides from amino acids.

  15. Secondary structures of rRNAs from all three domains of life.

    Directory of Open Access Journals (Sweden)

    Anton S Petrov

    Full Text Available Accurate secondary structures are important for understanding ribosomes, which are extremely large and highly complex. Using 3D structures of ribosomes as input, we have revised and corrected traditional secondary (2° structures of rRNAs. We identify helices by specific geometric and molecular interaction criteria, not by co-variation. The structural approach allows us to incorporate non-canonical base pairs on parity with Watson-Crick base pairs. The resulting rRNA 2° structures are up-to-date and consistent with three-dimensional structures, and are information-rich. These 2° structures are relatively simple to understand and are amenable to reproduction and modification by end-users. The 2° structures made available here broadly sample the phylogenetic tree and are mapped with a variety of data related to molecular interactions and geometry, phylogeny and evolution. We have generated 2° structures for both large subunit (LSU 23S/28S and small subunit (SSU 16S/18S rRNAs of Escherichia coli, Thermus thermophilus, Haloarcula marismortui (LSU rRNA only, Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens. We provide high-resolution editable versions of the 2° structures in several file formats. For the SSU rRNA, the 2° structures use an intuitive representation of the central pseudoknot where base triples are presented as pairs of base pairs. Both LSU and SSU secondary maps are available (http://apollo.chemistry.gatech.edu/RibosomeGallery. Mapping of data onto 2° structures was performed on the RiboVision server (http://apollo.chemistry.gatech.edu/RiboVision.

  16. Diversity and abundance of the bacterial community of the red Macroalga Porphyra umbilicalis: did bacterial farmers produce macroalgae?

    Directory of Open Access Journals (Sweden)

    Lilibeth N Miranda

    Full Text Available Macroalgae harbor microbial communities whose bacterial biodiversity remains largely uncharacterized. The goals of this study were 1 to examine the composition of the bacterial community associated with Porphyra umbilicalis Kützing from Schoodic Point, ME, 2 determine whether there are seasonal trends in species diversity but a core group of bacteria that are always present, and 3 to determine how the microbial community associated with a laboratory strain (P.um.1 established in the presence of antibiotics has changed. P. umbilicalis blades (n = 5, fall 2010; n = 5, winter 2011; n = 2, clonal P.um.1 were analyzed by pyrosequencing over two variable regions of the 16 S rDNA (V5-V6 and V8; 147,880 total reads. The bacterial taxa present were classified at an 80% confidence threshold into eight phyla (Bacteroidetes, Proteobacteria, Planctomycetes, Chloroflexi, Actinobacteria, Deinococcus-Thermus, Firmicutes, and the candidate division TM7. The Bacteroidetes comprised the majority of bacterial sequences on both field and lab blades, but the Proteobacteria (Alphaproteobacteria, Gammaproteobacteria were also abundant. Sphingobacteria (Bacteroidetes and Flavobacteria (Bacteroidetes had inverse abundances on natural versus P.um.1 blades. Bacterial communities were richer and more diverse on blades sampled in fall compared to winter. Significant differences were observed between microbial communities among all three groups of blades examined. Only two OTUs were found on all 12 blades, and only one of these, belonging to the Saprospiraceae (Bacteroidetes, was abundant. Lewinella (as 66 OTUs was found on all field blades and was the most abundant genus. Bacteria from the Bacteroidetes, Proteobacteria and Planctomycetes that are known to digest the galactan sulfates of red algal cell walls were well-represented. Some of these taxa likely provide essential morphogenetic and beneficial nutritive factors to P. umbilicalis and may have had

  17. Biochemical and Structural Characterization of WlbA from Bordetella pertussis and Chromobacterium violaceum: Enzymes Required for the Biosynthesis of 2,3-Diacetamido-2,3-dideoxy-d-mannuronic Acid

    Energy Technology Data Exchange (ETDEWEB)

    Thoden, James B.; Holden, Hazel M. (UW)

    2011-12-22

    The unusual sugar 2,3-diacetamido-2,3-dideoxy-d-mannuronic acid, or ManNAc3NAcA, has been observed in the lipopolysaccharides of both pathogenic and nonpathogenic Gram-negative bacteria. It is added to the lipopolysaccharides of these organisms by glycosyltransferases that use as substrates UDP-ManNAc3NAcA. Five enzymes are ultimately required for the biosynthesis of UDP-ManNAc3NAcA starting from UDP-N-acetylglucosamine. The second enzyme in the pathway, encoded by the wlba gene and referred to as WlbA, catalyzes the NAD-dependent oxidation of the C-3' hydroxyl group of the UDP-linked sugar. Here we describe a combined structural and functional investigation of the WlbA enzymes from Bordetella pertussis and Chromobacterium violaceum. For this investigation, ternary structures were determined in the presence of NAD(H) and substrate to 2.13 and 1.5 {angstrom} resolution, respectively. Both of the enzymes display octameric quaternary structures with their active sites positioned far apart. The octamers can be envisioned as tetramers of dimers. Kinetic studies demonstrate that the reaction mechanisms for these enzymes are sequential and that they do not require {alpha}-ketoglutarate for activity. These results are in sharp contrast to those recently reported for the WlbA enzymes from Pseudomonas aeruginosa and Thermus thermophilus, which function via ping-pong mechanisms that involve {alpha}-ketoglutarate. Taken together, the results reported here demonstrate that there are two distinct families of WlbA enzymes, which differ with respect to amino acid sequences, quaternary structures, active site architectures, and kinetic mechanisms.

  18. The complete genome and proteome of Laribacter hongkongensis reveal potential mechanisms for adaptations to different temperatures and habitats.

    Science.gov (United States)

    Woo, Patrick C Y; Lau, Susanna K P; Tse, Herman; Teng, Jade L L; Curreem, Shirly O T; Tsang, Alan K L; Fan, Rachel Y Y; Wong, Gilman K M; Huang, Yi; Loman, Nicholas J; Snyder, Lori A S; Cai, James J; Huang, Jian-Dong; Mak, William; Pallen, Mark J; Lok, Si; Yuen, Kwok-Yung

    2009-03-01

    Laribacter hongkongensis is a newly discovered Gram-negative bacillus of the Neisseriaceae family associated with freshwater fish-borne gastroenteritis and traveler's diarrhea. The complete genome sequence of L. hongkongensis HLHK9, recovered from an immunocompetent patient with severe gastroenteritis, consists of a 3,169-kb chromosome with G+C content of 62.35%. Genome analysis reveals different mechanisms potentially important for its adaptation to diverse habitats of human and freshwater fish intestines and freshwater environments. The gene contents support its phenotypic properties and suggest that amino acids and fatty acids can be used as carbon sources. The extensive variety of transporters, including multidrug efflux and heavy metal transporters as well as genes involved in chemotaxis, may enable L. hongkongensis to survive in different environmental niches. Genes encoding urease, bile salts efflux pump, adhesin, catalase, superoxide dismutase, and other putative virulence factors-such as hemolysins, RTX toxins, patatin-like proteins, phospholipase A1, and collagenases-are present. Proteomes of L. hongkongensis HLHK9 cultured at 37 degrees C (human body temperature) and 20 degrees C (freshwater habitat temperature) showed differential gene expression, including two homologous copies of argB, argB-20, and argB-37, which encode two isoenzymes of N-acetyl-L-glutamate kinase (NAGK)-NAGK-20 and NAGK-37-in the arginine biosynthesis pathway. NAGK-20 showed higher expression at 20 degrees C, whereas NAGK-37 showed higher expression at 37 degrees C. NAGK-20 also had a lower optimal temperature for enzymatic activities and was inhibited by arginine probably as negative-feedback control. Similar duplicated copies of argB are also observed in bacteria from hot springs such as Thermus thermophilus, Deinococcus geothermalis, Deinococcus radiodurans, and Roseiflexus castenholzii, suggesting that similar mechanisms for temperature adaptation may be employed by other

  19. [Unique properties of highly radioresistant bacteria].

    Science.gov (United States)

    Romanovskaia, V A; Rokitko, P V; Malashenko, Iu R

    2000-01-01

    In connection with the Chernobyl Nuclear Power Plant (ChNPP) accident and the negative ecological after-effects for biota in this zone the interest has arisen to radioresistant bacteria, as to the most dynamic model of the given ecosystem, and to mechanisms which provide resistance of bacteria to ionizing radiation. The analysis of published data has shown that the radioresistant bacteria are not interrelated taxonomically and phylogenetically. The extreme radioresistant bacteria are represented by the Deinococcus species, which form a group phylogenetically close to the line Thermus-Meiothermus. Other radioresistant bacteria are the representatives of the genera Rubrobacter, Methylobacterium, Kocuria, Bacillus and some archebacteria. Data on natural habitats, of radioresistant bacteria are not numerous. In a number of cases it is difficult to distinguish their natural habitats, as they were isolated from the samples which were previously exposed to X-ray or gamma-irradiation, or from the ecosystems with the naturally raised radioactivity. To understand the strategy of survival of radioresistant bacteria, we briefly reviewed the mechanism of action of various species of radiation on cells and macromolecules; physiological signs of the cell damage caused by radiation; mechanisms eliminating (repairing) these damages. More details on mechanisms of the DNA repair in D. radiodurans are described. The extreme resistance of D. radiodurans to the DNA damaging factors is defined by 1) repair mechanisms which fundamentally differ from those in other procaryotes; 2) ability to increase the efficiency of a standard set of the DNA repairing proteins. Literary and own data on the effect of radiation on survival of various groups of bacteria in natural ecosystems are summarized. The ecological consequences of the ChNPP accident for soil bacteria in this region were estimated. The reduction of the number of soil bacteria and recession of microbial diversity under the effect of

  20. Profile Changes in the Soil Microbial Community When Desert Becomes Oasis.

    Directory of Open Access Journals (Sweden)

    Chen-hua Li

    Full Text Available The conversion of virgin desert into oasis farmland creates two contrasting types of land-cover. During oasis formation with irrigation and fertilizer application, however, the changes in the soil microbial population, which play critical roles in the ecosystem, remain poorly understood. We applied high-throughput pyrosequencing to investigate bacterial and archaeal communities throughout the profile (0-3 m in an experimental field, where irrigation and fertilization began in 1990 and cropped with winter wheat since then. To assess the effects of cultivation, the following treatments were compared with the virgin desert: CK (no fertilizer, PK, NK, NP, NPK, NPKR, and NPKM (R: straw residue; M: manure fertilizer. Irrigation had a greater impact on the overall microbial community than fertilizer application. The greatest impact occurred in topsoil (0-0.2 m, e.g., Cyanobacteria (25% total abundance were most abundant in desert soil, while Actinobacteria (26% were most abundant in oasis soil. The proportions of extremophilic and photosynthetic groups (e.g., Deinococcus-Thermus and Cyanobacteria decreased, while the proportions of R-strategy (e.g., Gammaproteobacteria including Xanthomonadales, nitrifying (e.g., Nitrospirae, and anaerobic bacteria (e.g., Anaerolineae increased throughout the oasis profile. Archaea occurred only in oasis soil. The impact of fertilizer application was mainly reflected in the non-dominant communities or finer taxonomic divisions. Oasis formation led to a dramatic shift in microbial community and enhanced soil enzyme activities. The rapidly increased soil moisture and decreased salt caused by irrigation were responsible for this shift. Furthermore, difference in fertilization and crop growth altered the organic carbon contents in the soil, which resulted in differences of microbial communities within oasis.

  1. Mechanism-based fluorescent labeling of beta-galactosidases. An efficient method in proteomics for glycoside hydrolases.

    Science.gov (United States)

    Kurogochi, Masaki; Nishimura, Shin-Ichiro; Lee, Yuan Chuan

    2004-10-22

    (4-N-5-Dimethylaminonaphthalene-1-sulfonyl-2-difluoromethylphenyl)-beta-d-galactopyranoside was synthesized and successfully tested on beta-galactosidases from Xanthomonas manihotis (Wong-Madden, S. T., and Landry, D. Glycobiology (1995) 5, 19-28 and Taron, C. H., Benner, J. S., Hornstra, L. J., and Guthrie, E. P. (1995) Glycobiology 5, 603-610), Escherichia coli (Jacobson, R. H., Zhang, X. J., DuBose, R. F., and Matthews, B. W. (1994) Nature 369, 761-766), and Bacillus circulans (Fujimoto, H., Miyasato, M., Ito, Y., Sasaki, T., and Ajisaka, K. (1988) Glycoconj. J. 15, 155-160) for the rapid identification of the catalytic site. Reaction of the irreversible inhibitor with enzymes proceeded to afford a fluorescence-labeled protein suitable for further high throughput characterization by using antidansyl antibody and matrix-assisted laser desorption ionization time-of-flight/time-of-flight (MALDI-TOF/TOF). Specific probing by a fluorescent aglycon greatly facilitated identification of the labeled peptide fragments from beta-galactosidases. It was demonstrated by using X. manihotis beta-galactosidase that the Arg-58 residue, which is located within a sequence of 56IPRAYWKD63, was labeled by nucleophilic attack of the guanidinyl group. This sequence including Arg-58 (Leu-46 to Tyr-194) was similar to that (Met-1 to Tyr-151) of Thermus thermophilus A4, which is the first known structure of glycoside hydrolases family 42 (Hidaka, M., Fushinobu, S., Ohtsu, N., Motoshima, H., Matsuzawa, H., Shoun, H., and Wakagi, T. (2002) J. Mol. Biol. 322, 79-91). A catalytic glutamic acid (Glu-537) of E. coli beta-galactosidase was proved to be labeled by the same procedure, suggesting that the modification site with this irreversible substrate might depend both on the nucleophilicity of the amino acids and their spatial arrangement in the individual catalytic cavity. Similarly, a Glu-259 in 257TLEE260 was selectively labeled using B. circulans beta-galactosidase, indicating that Glu

  2. Desert farming benefits from microbial potential in arid soils and promotes diversity and plant health.

    Directory of Open Access Journals (Sweden)

    Martina Köberl

    Full Text Available BACKGROUND: To convert deserts into arable, green landscapes is a global vision, and desert farming is a strong growing area of agriculture world-wide. However, its effect on diversity of soil microbial communities, which are responsible for important ecosystem services like plant health, is still not known. METHODOLOGY/PRINCIPAL FINDINGS: We studied the impact of long-term agriculture on desert soil in one of the most prominent examples for organic desert farming in Sekem (Egypt. Using a polyphasic methodological approach to analyse microbial communities in soil as well as associated with cultivated plants, drastic effects caused by 30 years of agriculture were detected. Analysing bacterial fingerprints, we found statistically significant differences between agricultural and native desert soil of about 60%. A pyrosequencing-based analysis of the 16S rRNA gene regions showed higher diversity in agricultural than in desert soil (Shannon diversity indices: 11.21/7.90, and displayed structural differences. The proportion of Firmicutes in field soil was significantly higher (37% than in the desert (11%. Bacillus and Paenibacillus play the key role: they represented 96% of the antagonists towards phytopathogens, and identical 16S rRNA sequences in the amplicon library and for isolates were detected. The proportion of antagonistic strains was doubled in field in comparison to desert soil (21.6%/12.4%; disease-suppressive bacteria were especially enriched in plant roots. On the opposite, several extremophilic bacterial groups, e.g., Acidimicrobium, Rubellimicrobium and Deinococcus-Thermus, disappeared from soil after agricultural use. The N-fixing Herbaspirillum group only occurred in desert soil. Soil bacterial communities were strongly driven by the a-biotic factors water supply and pH. CONCLUSIONS/SIGNIFICANCE: After long-term farming, a drastic shift in the bacterial communities in desert soil was observed. Bacterial communities in agricultural

  3. Adenosine triphosphate stimulates Aquifex aeolicus MutL endonuclease activity.

    Directory of Open Access Journals (Sweden)

    Jerome Mauris

    2009-09-01

    Full Text Available Human PMS2 (hPMS2 homologues act to nick 5' and 3' to misincorporated nucleotides during mismatch repair in organisms that lack MutH. Mn(++ was previously found to stimulate the endonuclease activity of these homologues. ATP was required for the nicking activity of hPMS2 and yPMS1, but was reported to inhibit bacterial MutL proteins from Thermus thermophilus and Aquifex aeolicus that displayed homology to hPMS2. Mutational analysis has identified the DQHA(X(2E(X(4E motif present in the C-terminus of PMS2 homologues as important for endonuclease activity.We examined the effect ATP had on the Mn(++ induced nicking of supercoiled pBR322 by full-length and mutant A. aeolicus MutL (Aae MutL proteins. Assays were single time point, enzyme titration experiments or reaction time courses. The maximum velocity for MutL nicking was determined to be 1.6+/-0.08x10(-5 s(-1 and 4.2+/-0.3x10(-5 s(-1 in the absence and presence of ATP, respectively. AMPPNP stimulated the nicking activity to a similar extent as ATP. A truncated Aae MutL protein composed of only the C-terminal 123 amino acid residues was found to nick supercoiled DNA. Furthermore, mutations in the conserved C-terminal DQHA(X(2E(X(4E and CPHGRP motifs were shown to abolish Aae MutL endonuclease activity.ATP stimulated the Mn(++ induced endonuclease activity of Aae MutL. Experiments utilizing AMPPNP implied that the stimulation did not require ATP hydrolysis. A mutation in the DQHA(X(2E(X(4E motif of Aae MutL further supported the role of this region in endonclease activity. For the first time, to our knowledge, we demonstrate that changing the histidine residue in the conserved CPHGRP motif abolishes endonucleolytic activity of a hPMS2 homologue. Finally, the C-terminal 123 amino acid residues of Aae MutL were sufficient to display Mn(++ induced nicking activity.

  4. Mössbauer spectroscopy and DFT calculations on all protonation states of the 2Fe-2S cluster of the Rieske protein

    Science.gov (United States)

    Müller, C. S.; Auerbach, H.; Stegmaier, K.; Wolny, J. A.; Schünemann, V.; Pierik, A. J.

    2017-11-01

    The Thermus thermophilus Rieske protein ( TtRP) contains a 2Fe-2S cluster with one iron (Fe-Cys) coordinated by four sulfur atoms (2xS2- and 2xCys) and one iron (Fe-His) by two sulfur and two nitrogen atoms (2xS2-, His134 and His154). Here, the protein is investigated at three pH values (6.0, 8.5 and 10.5) in order to elucidate the protonation states of the His-ligands. Examination of the effect of protonation on the electronic structure of the cluster via Mössbauer spectroscopy gives a deeper understanding of the coupling of electron transfer to the protonation state of the His-ligands. Two components (1 referring to Fe-Cys and 2 to Fe-His) with parameters typical for a diamagnetic [2Fe-2S]2+ cluster are detected. The Mössbauer parameters and the protonation state clearly correlate: while δ remains almost pH-independent with δ 1 (pH6.0) = 0.23 (± 0.01) mms- 1 and δ 1 (pH10.5) = 0.24 (± 0.01) mms- 1 for Fe-Cys, it decreases for Fe-His from δ 2 (pH6.0) = 0.34 (± 0.01) mms- 1 to δ 2 (pH10.5) = 0.28 (± 0.01) mms- 1. Δ E Q changes from Δ E Q1 (pH6.0) = 0.57 (± 0.01) mms- 1 to Δ E Q1 (pH10.5) = 0.45 (± 0.01) mms- 1 and from Δ E Q2 (pH6.0) = 1.05 (± 0.01) mms- 1 to Δ E Q2 (pH10.5) = 0.71 (± 0.01) mms- 1. Density functional theory (DFT)-calculations based on the crystal structure (pdb 1NYK) (Hunsicker-Wang et al. Biochemistry 42, 7303, 2003) have been performed for the Rieske-cluster with different His-ligand protonation states, reproducing the experimentally observed trend.

  5. Recognition of tRNAs with a long variable arm by aminoacyl-tRNA synthetases

    Directory of Open Access Journals (Sweden)

    Tukalo M. A.

    2013-07-01

    Full Text Available In prokaryotic cells three tRNA species, tRNASer, tRNALeu and tRNATyr, possess a long variable arm of 11–20 nucleotides (type 2 tRNA rather than usual 4 or 5 nucleotides (type 1 tRNA. In this review we have summarized the results of our research on the structural basis for recognition and discrimination of type 2 tRNAs by Thermus thermophilus seryl-, tyrosyl- and leucyl-tRNA synthetases (SerRS, TyrRS and LeuRS obtained by X-ray crystallography and chemical probing tRNA in solution. Crystal structures are now known of all three aminoacyl-tRNA synthetases complexed with type 2 tRNAs and the different modes of tRNA recognition represented by these structures will be discussed. In particular, emphasis will be given to the results on recognition of characteristic shape of type 2 tRNAs by cognate synthetases. In tRNASer, tRNATyr and tRNALeu the orientation of the long variable arm with respect to the body of the tRNA is different and is controlled by different packing of the core. In the case of SerRS the N-terminal domain and in the case of TyrRS, the C-terminal domain, bind to the characteristic long variable arm of the cognate RNA, thus recognizing the unique shape of the tRNA. The core of T. thermophilus tRNALeu has several layers of unusual base-pairs, which are revealed by the crystal structure of tRNALeu complexed with T. thermophilus LeuRS and by probing a ligand-free tRNA by specific chemical reagents in solution. In the crystal structure of the LeuRS-tRNALeu complex the unique D-stem structure is recognized by the C-terminal domain of LeuRS and these data are in good agreement with those obtained in solution. LeuRS has canonical class I mode of tRNA recognition, approaching the tRNA acceptor stem from the D-stem and minor groove of the acceptor stem side. SerRS also has canonical class II mode of tRNA recognition and approaches tRNASer from opposite, variable stem and major groove of acceptor stem site. And finally, TyrRS in strong

  6. A two-domain elevator mechanism for sodium/proton antiport.

    Science.gov (United States)

    Lee, Chiara; Kang, Hae Joo; von Ballmoos, Christoph; Newstead, Simon; Uzdavinys, Povilas; Dotson, David L; Iwata, So; Beckstein, Oliver; Cameron, Alexander D; Drew, David

    2013-09-26

    Sodium/proton (Na(+)/H(+)) antiporters, located at the plasma membrane in every cell, are vital for cell homeostasis. In humans, their dysfunction has been linked to diseases, such as hypertension, heart failure and epilepsy, and they are well-established drug targets. The best understood model system for Na(+)/H(+) antiport is NhaA from Escherichia coli, for which both electron microscopy and crystal structures are available. NhaA is made up of two distinct domains: a core domain and a dimerization domain. In the NhaA crystal structure a cavity is located between the two domains, providing access to the ion-binding site from the inward-facing surface of the protein. Like many Na(+)/H(+) antiporters, the activity of NhaA is regulated by pH, only becoming active above pH 6.5, at which point a conformational change is thought to occur. The only reported NhaA crystal structure so far is of the low pH inactivated form. Here we describe the active-state structure of a Na(+)/H(+) antiporter, NapA from Thermus thermophilus, at 3 Å resolution, solved from crystals grown at pH 7.8. In the NapA structure, the core and dimerization domains are in different positions to those seen in NhaA, and a negatively charged cavity has now opened to the outside. The extracellular cavity allows access to a strictly conserved aspartate residue thought to coordinate ion binding directly, a role supported here by molecular dynamics simulations. To alternate access to this ion-binding site, however, requires a surprisingly large rotation of the core domain, some 20° against the dimerization interface. We conclude that despite their fast transport rates of up to 1,500 ions per second, Na(+)/H(+) antiporters operate by a two-domain rocking bundle model, revealing themes relevant to secondary-active transporters in general.

  7. Ammonia oxidation, denitrification and dissimilatory nitrate reduction to ammonium in two US Great Basin hot springs with abundant ammonia-oxidizing archaea.

    Science.gov (United States)

    Dodsworth, Jeremy A; Hungate, Bruce A; Hedlund, Brian P

    2011-08-01

    Many thermophiles catalyse free energy-yielding redox reactions involving nitrogenous compounds; however, little is known about these processes in natural thermal environments. Rates of ammonia oxidation, denitrification and dissimilatory nitrate reduction to ammonium (DNRA) were measured in source water and sediments of two ≈ 80°C springs in the US Great Basin. Ammonia oxidation and denitrification occurred mainly in sediments. Ammonia oxidation rates measured using (15)N-NO(3)(-) pool dilution ranged from 5.5 ± 0.8 to 8.6 ± 0.9 nmol N g(-1) h(-1) and were unaffected or only mildly stimulated by amendment with NH(4) Cl. Denitrification rates measured using acetylene block ranged from 15.8 ± 0.7 to 51 ± 12 nmol N g(-1) h(-1) and were stimulated by amendment with NO(3)(-) and complex organic compounds. The DNRA rate in one spring sediment measured using an (15)N-NO(3)(-) tracer was 315 ± 48 nmol N g(-1) h(-1). Both springs harboured distinct planktonic and sediment microbial communities. Close relatives of the autotrophic, ammonia-oxidizing archaeon 'Candidatus Nitrosocaldus yellowstonii' represented the most abundant OTU in both spring sediments by 16S rRNA gene pyrotag analysis. Quantitative PCR (qPCR) indicated that 'Ca. N. yellowstonii'amoA and 16S rRNA genes were present at 3.5-3.9 × 10(8) and 6.4-9.0 × 10(8) copies g(-1) sediment. Potential denitrifiers included members of the Aquificales and Thermales. Thermus spp. comprised <1% of 16S rRNA gene pyrotags in both sediments and qPCR for T. thermophilus narG revealed sediment populations of 1.3-1.7 × 10(6) copies g(-1) sediment. These data indicate a highly active nitrogen cycle (N-cycle) in these springs and suggest that ammonia oxidation may be a major source of energy fuelling primary production. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  8. Bacterial biodiversity analysis of a contaminated soil from the Chernobyl exclusion zone and characterization of the committed interaction of a Microbacterium strain with uranium

    International Nuclear Information System (INIS)

    Theodorakopoulos, Nicolas

    2013-01-01

    The nuclear power plants accidents of Chernobyl and Fukushima demonstrate the importance of the understanding of the transfer of the radioactive contamination in the environment and its ecological consequences. Although certain studies have been realized on superior organisms of the food chain, studies on telluric bacterial communities are scarce. The latter play nevertheless an essential role in the mobility of contaminants in soils by decreasing or improving their transfer towards other compartments (water, vegetables and animals). Moreover radionuclides (RNs) can have toxic effects on bacteria, leading to an inhibition of their participation in such transfer. The objectives of this study were (1) to estimate the impact of the radioactive contamination on bacterial communities belonging to a soil of the Chernobyl exclusion zone (trench T22) and (2) to study the uranium-bacteria interactions of a resistant strain, isolated from this soil. The various techniques used to characterize the bacterial diversity (culture of bacteria, DGGE, 454 pyro-sequencing) all testified of the multiplicity and the abundance of the bacterial communities in spite of the contamination. An impact on the community structure was difficult to assess by DGGE or cultural approach, but was nevertheless highlighted by the use of pyro-sequencing, suggesting the presence of species more adapted to the contaminated soil conditions. A specific molecular tool dedicated to the search of bacteria affiliated to the known radiation resistant Deinococcus-Thermus phylum (for example the Deinococcus radiodurans specie survives after an irradiation of several kGy) was developed. However it did not reveal the presence of bacteria affiliated to such a phylum in the studied soil. In parallel to the study of the bacterial biodiversity, about fifty culturable bacteria were isolated from this site and were used as a support to select a species (Microbacterium) capable to survive strong U(VI) concentrations. The

  9. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    Science.gov (United States)

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  10. Identification of a new family of putative PD-(D/EXK nucleases with unusual phylogenomic distribution and a new type of the active site

    Directory of Open Access Journals (Sweden)

    Bujnicki Janusz M

    2005-02-01

    ; Idaka, M., Wada, T., Murayama, K., Terada, T., Kuramitsu, S., Shirouzu, M., Yokoyama, S.: Crystal structure of Tt1808 from Thermus thermophilus Hb8, to be published. Our analysis of the Tt1808 structure reveals that we correctly predicted all functionally important features of the COG4636 family, including the membership in the PD-(D/ExK superfamily of nucleases, the three-dimensional fold, the putative catalytic residues, and the unusual configuration of the active site.

  11. Hexavalent uranium reduction from solid phase by thermophilic bacterium Thermoterrabacterium ferrireducens

    International Nuclear Information System (INIS)

    Khijniak, T.V.; Slobodkin, A.I.; Bonch-Osmolovskaya, E.A.; Medvedeva-Lyalikova, N.N.; Coker, V.; Lloyd, J.R.; Birkeland, N.K.

    2005-01-01

    Full text of publication follows: It has been reported that in uranium-contaminated sites, solid-phase U(VI) present in sediments is resistant to microbial reduction. Also, it was demonstrated that mesophilic iron and sulfate-reducing bacteria can reduce hexavalent uranium and sulphate-reducing bacteria were able to grow via uranium reduction. Among thermophilic microorganisms reduction of hexavalent uranium has been demonstrated only for cell suspensions of two genera: Pyrobaculum and Thermus. In the present study, Thermoterrabacterium ferrireducens was tested for reduction of U(VI), a thermophilic, gram-positive anaerobic bacterium capable for growth with the reduction of various electron acceptors including Fe(III). Kinetic of bacterial growth, uranium reduction and influence of different uranium concentrations were investigated at 65 deg. C. Due to presence of phosphate in the basal medium yellow uranium phosphate precipitate was formed after addition of uranyl acetate. After 68 h of incubation control tubes without bacteria were contained yellow precipitate whereas in presence of bacteria precipitate turned to the grey color. In the control tubes uranium phosphates and other elements formed a uniform mixture of crystals, but in presence of bacteria the round shape particles, containing uranium, were found by Environmental Scan Electron Microscopy of air-dried or frozen samples. To determine valent state speciation spectroscopic investigations were performed also. Initial yellow uranium phosphate precipitate was separated and identified as uramphite - (NH 4 )(UO 2 )(PO 4 )*3H 2 O by X-Ray Powder Diffraction. Grey precipitate, which was formed by bacterial reduction, was identified as ningyoite - CaU(PO 4 ) 2 *H 2 O. The fact that final grey precipitate contain U(IV) was also confirmed by EXAFS investigation. High concentration of uranium has toxic effect. 1 and 2.5 mM of uranium (VI) support bacterial growth and bacterial biomass was accumulated, but if 5 or 10

  12. Microbiological monitoring in geothermal plants

    Science.gov (United States)

    Alawi, M.; Lerm, S.; Vetter, A.; Vieth, A.; Seibt, A.; Wolfgramm, M.; Würdemann, H.

    2009-12-01

    In times of increasing relevance of alternative energy resources the utilization of geothermal energy and subsurface energy storage gains importance and arouses increasing interest of scientists. The research project “AquiScreen” investigates the operational reliability of geothermally used groundwater systems under microbial, geochemical, mineralogical and petrological aspects. Microbiological analyses based on fluid and solid phases of geothermal systems are conducted to evaluate the impact of microbial populations on these systems. The presentation focuses on first results obtained from microbiological monitoring of geothermal plants located in two different regions of Germany: the North German Basin and the Molasse Basin in the southern part characterized by different salinities and temperatures. Fluid and filter samples taken during regular plant operation were investigated using genetic fingerprinting based on PCR-amplified 16S rRNA genes to characterize the microbial biocenosis of the geothermal aquifer. Sequencing of dominant bands of the fingerprints and the subsequent comparison to 16S rRNA genes from public databases enables a correlation to metabolic classes and provides information about the biochemical processes in the deep biosphere. The genetic profiles revealed significant differences in microbiological community structures of geothermal aquifers investigated. Phylogenetic analyses indicate broad metabolical diversity adapted to the specific conditions in the aquifers. Additionally a high amount of so far uncultivated microorganisms was detected indicating very specific indigenous biocenosis. However, in all geothermal plants bacteria were detected despite of fluid temperatures from 45° to 120°C. The identified microorganisms are closely related to thermophilic and hyperthermophilic species detectable in hot wells and hot springs, like Thermus scotoductus and Thermodesulfovibrio yellowstonii, respectively. Halophilic species were detected in

  13. Redox balancing in recombinant strains of Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Anderlund, M

    1998-09-01

    In metabolically engineered Saccharomyces cerevisiae expressing Pichia stipitis XYL1 and XYL2 genes, encoding xylose reductase (XR) and xylitol dehydrogenase (XDH), respectively, xylitol is excreted as the major product during anaerobic xylose fermentation and only low yields of ethanol are produced. This has been interpreted as a result of the dual cofactor dependence of XR and the exclusive use of NAD{sup +} by XDH. The excretion of xylitol was completely stopped and the formation of glycerol and acetic acid were reduced in xylose utilising S. cerevisiae strains cultivated in oxygen-limited conditions by expressing lower levels of XR than of XDH. The expression level of XYL1 and XYL2 were controlled by changing the promoters and transcription directions of the genes. A new functional metabolic pathway was established when Thermus thermophilus xylA gene was expressed in S. cerevisiae. The recombinant strain was able to ferment xylose to ethanol when cultivated on a minimal medium containing xylose as only carbon source. In order to create a channeled metabolic transfer in the two first steps of the xylose metabolism, XYL1 and XYL2 were fused in-frame and expressed in S. cerevisiae. When the fusion protein, containing a linker of three amino acids, was co expressed together with native XR and XDH monomers, enzyme complexes consisting of chimeric and native subunits were formed. The total activity of these complexes exhibited 10 and 9 times higher XR and XDH activity, respectively, than the original conjugates, consisting of only chimeric subunits. This strain produced less xylitol and the xylitol yield was lower than with strains only expressing native XR and XDH monomers. In addition, more ethanol and less acetic acid were formed. A new gene encoding the cytoplasmic transhydrogenase from Azotobacter vinelandii was cloned. The enzyme showed high similarity to the family of pyridine nucleotide-disulphide oxidoreductase. To analyse the physiological effect of

  14. Molecular modeling and molecular dynamics simulation study of archaeal leucyl-tRNA synthetase in complex with different mischarged tRNA in editing conformation.

    Science.gov (United States)

    Rayevsky, A V; Sharifi, M; Tukalo, M A

    2017-09-01

    Aminoacyl-tRNA synthetases (aaRSs) play important roles in maintaining the accuracy of protein synthesis. Some aaRSs accomplish this via editing mechanisms, among which leucyl-tRNA synthetase (LeuRS) edits non-cognate amino acid norvaline mainly by post-transfer editing. However, the molecular basis for this pathway for eukaryotic and archaeal LeuRS remain unclear. In this study, a complex of archaeal P. horikoshii LeuRS (PhLeuRS) with misacylated tRNA Leu was modeled wherever tRNA's acceptor stem was oriented directly into the editing site. To understand the distinctive features of organization we reconstructed a complex of PhLeuRS with tRNA and visualize post-transfer editing interactions mode by performing molecular dynamics (MD) simulation studies. To study molecular basis for substrate selectivity by PhLeuRS's editing site we utilized MD simulation of the entire LeuRS complexes using a diverse charged form of tRNAs, namely norvalyl-tRNA Leu and isoleucyl-tRNA Leu . In general, the editing site organization of LeuRS from P.horikoshii has much in common with bacterial LeuRS. The MD simulation results revealed that the post-transfer editing substrate norvalyl-A76, binds more strongly than isoleucyl-A76. Moreover, the branched side chain of isoleucine prevents water molecules from being closer and hence the hydrolysis reaction slows significantly. To investigate a possible mechanism of the post-transfer editing reaction, by PhLeuRS we have determined that two water molecules (the attacking and assisting water molecules) are localized near the carbonyl group of the amino acid to be cleaved off. These water molecules approach the substrate from the opposite side to that observed for Thermus thermophilus LeuRS (TtLeuRS). Based on the results obtained, it was suggested that the post-transfer editing mechanism of PhLeuRS differs from that of prokaryotic TtLeuRS. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Association of ω with the C-terminal region of β' subunit is essential for assembly of RNA polymerase in Mycobacterium tuberculosis.

    Science.gov (United States)

    Mao, Chunyou; Zhu, Yan; Lu, Pei; Feng, Lipeng; Chen, Shiyun; Hu, Yangbo

    2018-04-09

    The ω subunit is the smallest subunit of bacterial RNA polymerase (RNAP). Although homologs of ω are essential in both eukaryotes and archaea, this subunit has been known to be dispensable for RNAP in Escherichia coli ( Eco ) and in other bacteria. In this study, we characterized an indispensable role of the ω subunit in Mycobacterium tuberculosis ( Mtb ). Unlike the well-studied Eco RNAP, the Mtb RNAP core enzyme cannot be functionally assembled in the absence of the ω subunit. Importantly, substitution of Mtb ω with ω subunits from Eco or Thermus thermophiles ( Tth ) cannot restore the assembly of Mtb RNAP. Furthermore, by replacing different regions in Mtb ω with the corresponding regions from Eco ω, we found a non-conserved loop region in Mtb ω essential for its function in RNAP assembly. From RNAP structures, we noticed that the location of the C-terminal region of the β' subunit (β'CTD) in Mtb RNAP but not in Eco or Tth RNAP is close to the ω loop region. Deletion of this β'CTD in Mtb RNAP destabilized the binding of Mtb ω on RNAP and compromised Mtb core assembly, suggesting that these two regions may function together to play a role in ω-dependent RNAP assembly in Mtb Sequence alignment of the ω loop and the β'CTD regions suggests that the essential role of ω is probably restricted to mycobacteria. Together, our study characterized an essential role of Mtb ω and highlighted the importance of the ω loop region in Mtb RNAP assembly. Importance DNA-dependent RNA polymerase (RNAP), which is consisted of a multi-subunit core enzyme (α 2 ββ'ω) and a dissociable σ subunit, is the only enzyme in charge of transcription in bacteria. As the smallest subunit, the roles of ω remain the least well-studied. In Escherichia coli ( Eco ) and some other bacteria, the ω subunit is known to be non-essential for RNAP. In this study, we revealed an essential role of the ω subunit for RNAP assembly in the human pathogen Mycobacterium tuberculosis , and

  16. Are ionic liquids extremophiles cell wall breakers? Esther Gutiérrez, M. Ángeles Sanromán, Ana Rodríguez, Francisco J. Deive * Department of Chemical Engineering, University of Vigo, 36310, Vigo, Spain * Corresponding author: Tel.: +34986818723; E-mail address: deive@uvigo.es

    Directory of Open Access Journals (Sweden)

    Esther Gutiérrez

    2014-06-01

    , 2005; Institute Français Du Pétrole, 2001. In this work, we have exploited their structural modularity to apply them as thermophiles cell wall disruptor, hypothesizing that the variation in polarity or hydrophobicity are crucial to interact with the lipidic bilayer of the cell membranes, even up to a complete solubilization. We have bet in this study in the bacterium Thermus thermophilus HB27, whose lipolytic enzymes are mostly located intracellularly and attached to membrane. The interest of this new approach is supported by the fact that these enzymes are already being commercialized by top-companies such as Sigma-Aldrich but with very low levels of activity, as a consequence of the low levels of extracellular enzyme expression. First, flask cultures of Thermus thermophilus HB27 were cultivated for 24h at 70°C. Then, six different ionic liquids (C2MIMCl, C6MIMCl, C10MIMCl, C2MIMC2SO4, C2MIMHSO4 and C2MIM(C2H52PO4 were added to the culture medium at concentrations of 1g/L, and the effect of these molten salts pressure was analyzed by monitoring both the cell growth and the lipolytic enzyme distribution for 6 hours (from 24 to 30 h. The enzyme activity data were obtained from spectrometric measurement of the enzymatic hydrolysis of p-nitrophenyl laurate (Deive et al., 2009, and allowed concluding a great lytic effect of C10MIMCl, since a drastic increase of the extracellular activity of 308% was observed, to the detriment of the intracellular and membrane bound enzyme. In parallel, the cell growth was monitored by turbidimetric measurements at 600 nm and showed 43% of decay, thus confirming the excellent lytic effect provided by the ionic liquid.

  17. Impact on the deep biosphere of CO2 geological sequestration in (ultra)mafic rocks and retroactive consequences on its fate

    Science.gov (United States)

    Ménez, Bénédicte; Gérard, Emmanuelle; Rommevaux-Jestin, Céline; Dupraz, Sébastien; Guyot, François; Arnar Alfreősson, Helgi; Reynir Gíslason, Sigurőur; Sigurőardóttir, Hólmfríiur

    2010-05-01

    amplification of small subunit ribosomal RNA genes (SSU rDNAs). The stratigraphic levels targeted to store the injected CO2 as aqueous phase harbor numerous new species close to cultivable species belonging to the genus Thermus or Proteobacteria species known to be linked in particular with the hydrogen and iron cycles. After injection, the evolution of these microbial communities will be monitored using the Denaturing Gradient Gel Electrophoresis technique. Beyond the ecological impact of storing high levels of CO2 in deep environments, particularly important is the ability of intraterrestrial microbes to potentially interact with the injected fluids. For example, carbonation has been shown to be strongly influenced by microbiological activities that can locally modify pH and induce nucleation of solid carbonates. To improve the understanding of these processes and to better constrain the influence of deep biota on the evolving chemical and petrophysical properties of the reservoir, an experimental and numerical modeling is carried out in parallel, using model strains representative of the subsurface (including acetogens, sulphate and iron reducing bacteria), as single-species or consortia. A set of batch experiments in presence of crushed olivine or basalts was especially designed to evaluate how microbial activity could overcome the slow kinetics of mineral-fluid reactions and reduce the energy needed to hasten the carbonation process.

  18. Deep Microbial Ecosystems in the U.S. Great Basin: A Second Home for Desulforudis audaxviator?

    Science.gov (United States)

    Moser, D. P.

    2012-12-01

    Deep subsurface microbial ecosystems have attracted scientific and public interest in recent years. Of deep habitats so far investigated, continental hard rock environments may be the least understood. Our Census of Deep Life (CoDL) project targets deep microbial ecosystems of three little explored (for microbiology), North American geological provinces: the Basin and Range, Black Hills, and Canadian Shield. Here we focus on the Basin and Range, specifically radioactive fluids from nuclear device test cavities (U12N.10 tunnel and ER-EC-11) at the Nevada National Security Site (NNSS) and non-radioactive samples from a deep dolomite aquifer associated with Death Valley, CA (BLM-1 and Nevares Deep Well 2). Six pyrotag sequencing runs were attempted at the Marine Biology Lab (MBL) (bacterial v6v4 amplification for all sites and archaeal v6v4 amplification for BLM-1 and Nevares DW2). Of these, DNA extracts from five samples (all but Nevares DW2 Arch) successfully amplified. Bacterial libraries were generally dominated by Proteobacteria, Firmicutes, and Nitrospirae (ER-EC-11: Proteobacteria (45%), Deinococcus-Thermus (35%), Firmicutes (15%); U12N.10: Proteobacteria (37%), Firmicutes (32%), Nitrospirae (15%), Bacteroidetes (11%); BLM-1 (Bact): Firmicutes (93%); and Nevares DW2: Firmicutes (51%), Proteobacteria (16%), Nitrospirae (15%)). The BLM-1 (Arch) library contained >99% Euryarchaeota, with 98% of sequences represented by a single uncharacterized species of Methanothermobacter. Alpha diversity was calculated using the MBL VAMPS (Visualization and Analysis of Microbial Population Structures) system; showing the highest richness at both the phylum and genus levels in U12N.10 (Sp = 42; Sg = 341), and the lowest (Sp = 3; Sg = 11) in the BLM-1(Arch) library. Diversity was covered well at this depth of sequencing (~20,000 reads per sample) based on rarefaction analysis. One Firmicute lineage, candidatus D. audaxviator, has been shown to dominate microbial communities from

  19. Enhancement of water soluble wheat bran polyphenolic compounds using different steviol glucosides prepared by thermostable β-galactosidase

    Directory of Open Access Journals (Sweden)

    Hee-jung Lim

    2016-10-01

    Full Text Available Background: Production of wheat bran (WB for human consumption is estimated to be about 90 million tons per year. WB contains an abundant source of dietary fiber, minerals, vitamins, and bioactive compounds. WB is a by-product of milling and contains an abundant source of carbohydrate (60%, protein (12%, fat (0.5%, minerals (2%, and bioactive compounds such as phenolic acids, arabinoxylans, flavonoids, caroteinoids alkylresorcinol and phytosterols. These are known for health promoting properties such as controlling glycemic index, reducing plasma cholesterol level, antioxidant, anti-inflammatory, and anticarcinogenic activities. Several terpene glycosides such as mogroside V, paenoiflorin, geniposide, rubusoside (Ru, stevioside (Ste, rebaudioside A (RebA, steviol monoside, and stevioside glucoside have been discovered to enhance the solubility of a number of pharmaceutically and medically important compounds that normally show poor solubility in water. Context and purpose of this study: In this study, in order to increase soluble extraction of polyphenol compounds of WB using Ru, the expression of β-galactosidase from Thermus thermophilus (T. thermophilus was optimized using different E. coli hosts and a different concentration of lactose inducer rather than of isopropyl-1- thio-β-D-galactopyranoside (IPTG for industrial production. Additionally, the effect of different steviol glucosides (Ru, Ste, RebA, and SG on the enhancement of polyphenol compounds extraction from wheat bran was studied. Results: β-galactosidase from T. thermophilus was used for the specific conversion of stevioside (Ste to rubusoside (Ru with 92% productivity. The enzyme was optimized to be expressed in E. coli. With 7 mM lactose, the β-galactosidase activity expressed was 34.3, 14.2, or 34.4 ± 0.5 U/mL in E. coli BL21(DE3pLysS, Rosetta(DE3pLysS, or BL21(DE3 at 37°C, and 9.8 ± 0.2, 7.0 ± 0.5, or 7.4 ± 0.2 U/mL at 28°C respectively. The expression of

  20. Boom clay pore water, home of a diverse microbial community

    International Nuclear Information System (INIS)

    Wouters, Katinka; Moors, Hugo; Leys, Natalie

    2012-01-01

    Document available in extended abstract form only. Boom Clay pore water (BCPW) has been studied in the framework of geological disposal of nuclear waste for over two decades, thereby mainly addressing its geochemical properties. A reference composition for synthetic clay water has been derived earlier by modelling and spatial calibration efforts, mainly based on interstitial water sampled from different layers within the Boom clay. However, since microbial activity is found in a range of extreme circumstances, the possibility of microbes interacting with future radioactive waste in a host formation like Boom Clay, cannot be ignored. In this respect, BCPW was sampled from different Boom Clay layers using the Morpheus piezometer and subsequently analysed by a complementary set of microbiological and molecular techniques, in search for overall shared and abundant microorganisms. Similar to the previous characterization of the 'average' BCPW chemical composition, the primary aim of this microbiological study is to determine a representative BCPW microbial community which can be used in laboratory studies. Secondly, the in situ activity and the metabolic properties of members of this community were addressed, aiming to assess their survival and proliferation chances in repository conditions. In a first approach, total microbial DNA of the community was extracted from the BCPW samples. This molecular approach allows a broad insight in the total microbial ecology of the BCPW samples. By polymerase chain reaction (PCR) on the highly conserved 16S rRNA genes in this DNA pool and subsequent sequencing and bio-informatics analysis, operational taxonomic units (OTUs) could be assigned to the microbial community. The bacterial community was found to be quite diverse, with OTUs belonging to 8 different phyla (Proteobacteria, Actinobacteria, Firmicutes, Bacteroidetes, Chlorobi, Spirochetes, Chloroflexi and Deinococcus-Thermus). These results provide an overall view of the

  1. Boom clay pore water, home of a diverse microbial community

    Energy Technology Data Exchange (ETDEWEB)

    Wouters, Katinka; Moors, Hugo; Leys, Natalie [SCK.CEN, Environment, Health and Safety Institute, B-2400 Mol (Belgium)

    2012-10-15

    Document available in extended abstract form only. Boom Clay pore water (BCPW) has been studied in the framework of geological disposal of nuclear waste for over two decades, thereby mainly addressing its geochemical properties. A reference composition for synthetic clay water has been derived earlier by modelling and spatial calibration efforts, mainly based on interstitial water sampled from different layers within the Boom clay. However, since microbial activity is found in a range of extreme circumstances, the possibility of microbes interacting with future radioactive waste in a host formation like Boom Clay, cannot be ignored. In this respect, BCPW was sampled from different Boom Clay layers using the Morpheus piezometer and subsequently analysed by a complementary set of microbiological and molecular techniques, in search for overall shared and abundant microorganisms. Similar to the previous characterization of the 'average' BCPW chemical composition, the primary aim of this microbiological study is to determine a representative BCPW microbial community which can be used in laboratory studies. Secondly, the in situ activity and the metabolic properties of members of this community were addressed, aiming to assess their survival and proliferation chances in repository conditions. In a first approach, total microbial DNA of the community was extracted from the BCPW samples. This molecular approach allows a broad insight in the total microbial ecology of the BCPW samples. By polymerase chain reaction (PCR) on the highly conserved 16S rRNA genes in this DNA pool and subsequent sequencing and bio-informatics analysis, operational taxonomic units (OTUs) could be assigned to the microbial community. The bacterial community was found to be quite diverse, with OTUs belonging to 8 different phyla (Proteobacteria, Actinobacteria, Firmicutes, Bacteroidetes, Chlorobi, Spirochetes, Chloroflexi and Deinococcus-Thermus). These results provide an overall view of the

  2. Astrobiology - The New Synthesis

    Science.gov (United States)

    Sik, A.; Simon, T.

    . They research intensified for more reason: by analyzing their biochemistry and genetics we can get closer the understanding of formation and early evolution of life; their special enzymes ("extremozymes") have more and more significant scien- tific and industrial applications [13]; and terrestrial extremophile-analogies can help to understand the possible extreme ecosystems of other planets or moons. Most of the extremophiles are bacteria (eubacteria and archaea-bacteria as well) but in some extreme ecosystems eukaryotes also can be found. The base of their classification is the environmental factor that is tolerated extremely. - Thermophiles and hyperther- mophiles: the best known group and probably the most important in the understand- ing of life. Mainly prokaryotes that tolerate temperatures higher than 45C (if this is higher than 80C, the organism is hyperthermophile). The first species with higher optimum than 70C, Thermus aquaticus, an eubacterium was found in the thermal 3 springs of Yellowstone National Park (DNA polymerase enzyme was produced from it, which has revolutionized many aspects of genetics through the Polymerase Chain Reaction). However the first hyperthermophile was an archaea-bacteria (Sulfolobus acidocaldarius). After 1970 a lot of other species was found near to black smokers, so today approximately 50 hyperthermophiles are known. The record is 121C (Pyrod- ictium occultum) and the upper limit of tolerable temperature-range is not uncertain, 150C is the estimated value. - Psychrofiles: they can live in the polar ice layers, in glacier-ice and in permafrost soils also. - Acidophiles: pH-tolerance between value 5-2, lot of them are hyperthermophiles as well and lives in black smokers. The most ancient genome sequences are from these organisms signing that the first terrestrial organisms were acidophiles- hyperthermophiles. - Alkaliphiles: life functions above 9 pH value, general in soda-lakes. Together with the acidophiles they way of life is not