Directory of Open Access Journals (Sweden)
Carola eSchröder
2015-06-01
Full Text Available Two genes tagh2 and tbgh2 coding for enzymes with hydrolytic activity towards esculin were identified from the extreme thermophilic, aerobic bacteria Thermus antranikianii (Ta and T. brockianus (Tb. Shortened conserved domains predicted a membership of the enzymes of glycoside hydrolase (GH family 2. At present, β-galactosidase activity is found frequently in GH family 2 but β-glucosidase activity has not been reported in this family before. The enzymes TaGH2 and TbGH2 preferred hydrolysis of nitrophenol-linked β-D-glucopyranosides with specific activities of 3,966 U/mg and 660 U/mg, respectively. Residual activities of 40 % (TaGH2 and 51 % (TbGH2 towards 4-NP-β-D-galactopyranoside were observed. Furthermore, TaGH2 hydrolyzed cellobiose. TbGH2, however, showed no activity on cellobiose or lactose. The enzymes exhibited highest activity at 95 °C (TaGH2 and 90 °C (TbGH2 at pH 6.5. Both enzymes were extremely thermostable and thermal activation up to 250 % was observed at temperatures between 50 and 60 °C. Accordingly, the first thermoactive glycoside hydrolase family 2 enzymes with β glucosidase activity have been identified and characterized. The hydrolysis of cellobiose is a unique property of TaGH2 when compared to the enzymes of GH family 2.
International Nuclear Information System (INIS)
Moureau, S.
1993-01-01
ITI-MOVATS provides a wide range of test devices to monitor the performance of valves: motor operated gate or globe valve, butterfly valve, air operated valve, and check valve. The ITI-MOVATS testing equipment is used in the following three areas: actuator setup/baseline testing, periodic/post-maintenance testing, and differential pressure testing. The parameters typically measured with the MOVATS diagnostic system as well as the devices used to measure them are described. (Z.S.)
Implementing ITI for urban development locally
Directory of Open Access Journals (Sweden)
Garyfallia Katsavounidou
2017-12-01
Full Text Available In the current Programming Period (2014-2020 the European Commission has introduced a new strategic instrument, the Integrated Territorial Investment (ITI, which shifts the decisions on allocation of funds to the local level and, most importantly, enables drawing of funds from several priority axes and from several European Structural and Investment Funds. Greece is one of EU member countries that has committed on using ITIs as a tool for urban development. In August 2016, in the Region of Central Macedonia, urban authorities with a population of over 10.000 inhabitants were invited by the Managing Authority of the Regional Operational Programme to submit a Strategy for Sustainable Urban Development (SUD, through the mandatory implementation of the ITI tool. The paper focuses on one of these municipalities, the city of Veria, where the ITI approach has been implemented for the design of an ITI of urban scale (ITI-SUD. The integrated approach prescribed by regional authorities forced Municipalities to adopt government approaches uncommon until now: to involve multiple stakeholders in the entire process, from strategy development to project selection and implementation. The paper describes the benefits and challenges of the new approach as applied in the local context, showing the vertical and horizontal connections of urban development strategies. Most importantly, in the context of ‘procedural learning’ happening in Europe in the field of territorial cohesion, it offers an insight on how European cohesion policy strategies and tools are tested at the local level.
Thermus arciformis sp. nov., a thermophilic species from a geothermal area.
Zhang, Xin-Qi; Ying, Yi; Ye, Ying; Xu, Xue-Wei; Zhu, Xu-Fen; Wu, Min
2010-04-01
Two aerobic, Gram-negative, non-motile, non-sporulating, yellow-pigmented bacteria, strains TH92(T) and TH91, were isolated from a hot spring located in Laibin, Guangxi, in the south-eastern geothermal area of China. The isolates grew at 40-77 degrees C (optimally at 70 degrees C) and at pH 6.0-9.5 (optimally at pH 7.5-8.0). Phylogenetic analysis of 16S rRNA gene sequences and levels of DNA-DNA relatedness together indicated that the new isolates represented a novel species of the genus Thermus with closest affinity to Thermus aquaticus, Thermus igniterrae and Thermus thermophilus. Compared with their closest relatives, strains TH92( T) and TH91 were able to assimilate a wider range of carbohydrates, amino acids and organic acids as sole carbon sources for growth, such as lactose and melibiose. The new isolates had lower combined levels of C(16 : 0 ) and iso-C(16 : 0) compared with their closest relatives. On the basis of polyphasic taxonomic characterization, strains TH92(T) and TH91 are considered to represent a single novel species of the genus Thermus, for which the name Thermus arciformis sp. nov. is proposed. The type strain is TH92(T) (=CGMCC 1.6992(T) =JCM 15153(T)).
Sequence of the hyperplastic genome of the naturally competent Thermus scotoductus SA-01
Directory of Open Access Journals (Sweden)
Gounder Kamini
2011-11-01
Full Text Available Abstract Background Many strains of Thermus have been isolated from hot environments around the world. Thermus scotoductus SA-01 was isolated from fissure water collected 3.2 km below surface in a South African gold mine. The isolate is capable of dissimilatory iron reduction, growth with oxygen and nitrate as terminal electron acceptors and the ability to reduce a variety of metal ions, including gold, chromate and uranium, was demonstrated. The genomes from two different Thermus thermophilus strains have been completed. This paper represents the completed genome from a second Thermus species - T. scotoductus. Results The genome of Thermus scotoductus SA-01 consists of a chromosome of 2,346,803 bp and a small plasmid which, together are about 11% larger than the Thermus thermophilus genomes. The T. thermophilus megaplasmid genes are part of the T. scotoductus chromosome and extensive rearrangement, deletion of nonessential genes and acquisition of gene islands have occurred, leading to a loss of synteny between the chromosomes of T. scotoductus and T. thermophilus. At least nine large inserts of which seven were identified as alien, were found, the most remarkable being a denitrification cluster and two operons relating to the metabolism of phenolics which appear to have been acquired from Meiothermus ruber. The majority of acquired genes are from closely related species of the Deinococcus-Thermus group, and many of the remaining genes are from microorganisms with a thermophilic or hyperthermophilic lifestyle. The natural competence of Thermus scotoductus was confirmed experimentally as expected as most of the proteins of the natural transformation system of Thermus thermophilus are present. Analysis of the metabolic capabilities revealed an extensive energy metabolism with many aerobic and anaerobic respiratory options. An abundance of sensor histidine kinases, response regulators and transporters for a wide variety of compounds are indicative
Directory of Open Access Journals (Sweden)
Charu Tripathi
2017-07-01
Full Text Available Thermophilic environments represent an interesting niche. Among thermophiles, the genus Thermus is among the most studied genera. In this study, we have sequenced the genome of Thermus parvatiensis strain RL, a thermophile isolated from Himalayan hot water springs (temperature >96°C using PacBio RSII SMRT technique. The small genome (2.01 Mbp comprises a chromosome (1.87 Mbp and a plasmid (143 Kbp, designated in this study as pTP143. Annotation revealed a high number of repair genes, a squeezed genome but containing highly plastic plasmid with transposases, integrases, mobile elements and hypothetical proteins (44%. We performed a comparative genomic study of the group Thermus with an aim of analysing the phylogenetic relatedness as well as niche specific attributes prevalent among the group. We compared the reference genome RL with 16 Thermus genomes to assess their phylogenetic relationships based on 16S rRNA gene sequences, average nucleotide identity (ANI, conserved marker genes (31 and 400, pan genome and tetranucleotide frequency. The core genome of the analyzed genomes contained 1,177 core genes and many singleton genes were detected in individual genomes, reflecting a conserved core but adaptive pan repertoire. We demonstrated the presence of metagenomic islands (chromosome:5, plasmid:5 by recruiting raw metagenomic data (from the same niche against the genomic replicons of T. parvatiensis. We also dissected the CRISPR loci wide all genomes and found widespread presence of this system across Thermus genomes. Additionally, we performed a comparative analysis of competence loci wide Thermus genomes and found evidence for recent horizontal acquisition of the locus and continued dispersal among members reflecting that natural competence is a beneficial survival trait among Thermus members and its acquisition depicts unending evolution in order to accomplish optimal fitness.
Kampers, Gerrit; Oberlack, Martin; Wacławczyk, Marta; Talamelli, Alessandro
2016-01-01
This volume collects the edited and reviewed contributions presented in the 6th iTi Conference in Bertinoro, covering fundamental and applied aspects in turbulence. In the spirit of the iTi conference, the volume has been produced after the conference so that the authors had the possibility to incorporate comments and discussions raised during the meeting. In the present book the contributions have been structured according to the topics : I Theory II Wall bounded flows III Particles in flows IV Free flows V Complex flows The volume is dedicated to the memory of Prof. Konrad Bajer who prematurely passed away in Warsaw on August 29, 2014. .
Directory of Open Access Journals (Sweden)
Hafez Salleh
2011-12-01
Full Text Available Most of the traditional IT/IS performance measures are based on productivity and process, which mainly focus on method of investment appraisal. There is a need to produce alternative holistic measurement models that enable soft and hard issues to be measured qualitatively. A New IT/IS Capability Evaluation (NICE framework has been designed to measure the capability of organisations to'successfully implement IT systems' and it is applicable across industries.The idea is to provide managers with measurement tools to enable them to identify where improvements are required within their organisations and to indicate their readiness prior to IT investment. The NICE framework investigates four organisational key elements: IT, Environment, Process and People, and is composed of six progressive stages of maturity that a company can achieve its IT/IS capabilities. For each maturity stage, the NICE framework describes a set of critical success factors that must be in place for the company to achieve each stage.
Building a Taxonomic Data Editor: ITIS Taxonomic Workbench 6.0
Mitchell,David; Bowman,Lisa; Brockmeier,Christopher
2017-01-01
The Integrated Taxonomic Information System (ITIS - www.itis.gov) provides a regularly updated global database that currently contains over 840,000 scientific names and their hierarchy. A new rich Internet application for adding and editing ITIS data, Taxonomic Workbench 6.0, is being developed using the AngularJS framework. AngularJS is designed to take advantage of many features that are fairly recent to the web platform, facilitates a well-structured product that is easier to maintain, and...
7th iTi Conference in Turbulence
Talamelli, Alessandro; Oberlack, Martin; Peinke, Joachim
2017-01-01
This volume collects the edited and reviewed contribution presented in the 7th iTi Conference in Bertinoro, covering fundamental and applied aspects in turbulence. In the spirit of the iTi conference, the volume is produced after the conference so that the authors had the opportunity to incorporate comments and discussions raised during the meeting. In the present book, the contributions have been structured according to the topics: I Theory II Wall bounded flows III Pipe flow IV Modelling V Experiments VII Miscellaneous topics.
Directory of Open Access Journals (Sweden)
Daly Michael J
2005-10-01
Full Text Available Abstract Background Thermus thermophilus and Deinococcus radiodurans belong to a distinct bacterial clade but have remarkably different phenotypes. T. thermophilus is a thermophile, which is relatively sensitive to ionizing radiation and desiccation, whereas D. radiodurans is a mesophile, which is highly radiation- and desiccation-resistant. Here we present an in-depth comparison of the genomes of these two related but differently adapted bacteria. Results By reconstructing the evolution of Thermus and Deinococcus after the divergence from their common ancestor, we demonstrate a high level of post-divergence gene flux in both lineages. Various aspects of the adaptation to high temperature in Thermus can be attributed to horizontal gene transfer from archaea and thermophilic bacteria; many of the horizontally transferred genes are located on the single megaplasmid of Thermus. In addition, the Thermus lineage has lost a set of genes that are still present in Deinococcus and many other mesophilic bacteria but are not common among thermophiles. By contrast, Deinococcus seems to have acquired numerous genes related to stress response systems from various bacteria. A comparison of the distribution of orthologous genes among the four partitions of the Deinococcus genome and the two partitions of the Thermus genome reveals homology between the Thermus megaplasmid (pTT27 and Deinococcus megaplasmid (DR177. Conclusion After the radiation from their common ancestor, the Thermus and Deinococcus lineages have taken divergent paths toward their distinct lifestyles. In addition to extensive gene loss, Thermus seems to have acquired numerous genes from thermophiles, which likely was the decisive contribution to its thermophilic adaptation. By contrast, Deinococcus lost few genes but seems to have acquired many bacterial genes that apparently enhanced its ability to survive different kinds of environmental stresses. Notwithstanding the accumulation of
Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.
Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian
2005-10-01
Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.
Sharp, Richard J.; Williams, Ralph A. D.
1988-01-01
Seventeen pink-pigmented strains of the genus Thermus were isolated from samples collected from thermal areas of Iceland. The strains were examined by using phenotypic characterization and DNA:DNA homology and were compared with recognized strains. Visually, the strains could be divided into three groups based on their pigmentation; however, spectroscopic studies of the pigments indicated little difference among them. Most strains required a vitamin supplement for growth and used fructose, maltose, mannose, or sucrose as the sole carbon source. In the presence of nitrate, two strains were able to grow under anaerobic conditions. The optimum growth temperature was 60°C; growth did not occur at 30 or 70°C. PMID:16347714
4th iTi Conference in Turbulence
Peinke, Joachim; Talamelli, Alessandro; Castillo, Luciano; Hölling, Michael
2012-01-01
This fourth issue on "progress in turbulence" is based on the fourth ITI conference (ITI interdisciplinary turbulence initiative), which took place in Bertinoro, North Italy. Leading researchers from the engineering and physical sciences presented latest results in turbulence research. Basic as well as applied research is driven by the rather notorious difficult and essentially unsolved problem of turbulence. In this collection of contributions clear progress can be seen in different aspects, ranging from new quality of numerical simulations to new concepts of experimental investigations and new theoretical developments. The importance of turbulence is shown for a wide range of applications including: combustion, energy, flow control, urban flows, are few examples found in this volume. A motivation was to bring fundamentals of turbulence in connection with renewable energy. This lead us to add a special topic relevant to the impact of turbulence on the wind energy conversion. The structure of the present book...
Integrated Inflammatory Stress (ITIS) Model
DEFF Research Database (Denmark)
Bangsgaard, Elisabeth O.; Hjorth, Poul G.; Olufsen, Mette S.
2017-01-01
maintains a long-term level of the stress hormone cortisol which is also anti-inflammatory. A new integrated model of the interaction between these two subsystems of the inflammatory system is proposed and coined the integrated inflammatory stress (ITIS) model. The coupling mechanisms describing....... A constant activation results in elevated levels of the variables in the model while a prolonged change of the oscillations in ACTH and cortisol concentrations is the most pronounced result of different LPS doses predicted by the model....
Thermus caliditerrae sp. nov., a novel thermophilic species isolated from a geothermal area.
Ming, Hong; Yin, Yi-Rui; Li, Shuai; Nie, Guo-Xing; Yu, Tian-Tian; Zhou, En-Min; Liu, Lan; Dong, Lei; Li, Wen-Jun
2014-02-01
Two thermophilic bacterial strains, designated YIM 77925(T) and YIM 77777, were isolated from two hot springs, one in the Hydrothermal Explosion (Shuirebaozhaqu) area and Frog Mouth Spring in Tengchong county, Yunnan province, south-western China. The taxonomic positions of the two isolates were investigated by a polyphasic approach. Cells of the two strains were Gram-stain-negative, aerobic and rod-shaped. They were able to grow at 50-70 °C, pH 6.0-8.0 and with a NaCl tolerance up to 0.5% (w/v). Colonies are circular, convex, non-transparent and produce yellow pigment. Phylogenetic analyses based on 16S rRNA gene sequences comparison clearly demonstrated that strains YIM 77925(T) and YIM 77777 represent members of the genus Thermus, and they also detected low-level similarities of 16S rRNA gene sequences (below 97%) compared with all other species in this genus. Their predominant menaquinone was MK-8. The genomic DNA G+C contents of strains YIM 77925(T) and YIM 77777 were 65.6 mol% and 67.2 mol%, respectively. Based on the results of physiological and biochemical tests and phylogenetic analyses, strains YIM 77925(T) and YIM 77777 could not be classified as representing any species of the genus Thermus with a validly published name. Thus the two strains are considered to represent a novel species of the genus Thermus, for which the name Thermus caliditerrae sp. nov. is proposed. The type strain is YIM 77925(T) ( = DSM 25901(T) = CCTCC 2012061(T)).
Rhamnolipid-producing thermophilic bacteria of species Thermus and Meiothermus
Czech Academy of Sciences Publication Activity Database
Řezanka, Tomáš; Siřišťová, L.; Sigler, Karel
2011-01-01
Roč. 15, č. 6 (2011), s. 697-709 ISSN 1431-0651 R&D Projects: GA ČR(CZ) GAP503/11/0215 Institutional research plan: CEZ:AV0Z50200510 Keywords : Thermus sp * T. aquaticus * Meiothermus ruber Subject RIV: EE - Microbiology, Virology Impact factor: 2.941, year: 2011
5th iTi Conference in Turbulence 2012
Oberlack, Martin; Peinke, Joachim
2014-01-01
This volume collects the edited and reviewed contributions presented in the 5th iTi Conference in Bertinoro. covering fundamental aspects in turbulent flows. In the spirit of the iTi initiative, the volume is produced after the conference so that the authors had the possibility to incorporate comments and discussions raised during the meeting. Turbulence presents a large number of aspects and problems, which are still unsolved and which challenge research communities in engineering and physical sciences both in basic and applied research. The book presents recent advances in theory related to new statistical approaches, effect of non-linearities and presence of symmetries. This edition presents new contributions related to the physics and control of laminar-turbulent transition in wall-bounded flows, which may have a significant impact on drag reduction applications. Turbulent boundary layers, at increasing Reynolds number, are the main subject of both computational and experimental long research programs ...
"Äiti, sä oot niin paras äiti" : - Ihmeelliset vuodet - ryhmän vaikutus vanhemmuustaitoihin
Pylkkönen, Taru
2011-01-01
”Äiti, sä oot niin paras äiti”: Ihmeelliset vuodet – ryhmän vaikutus vanhempien vanhem-muustaitoihin Vuosi 2011 Sivumäärä 51+ 12 Opinnäytetyön tarkoituksena oli selvittää miten Ihmeelliset vuodet koulussa – projektin yhteydessä toiminut vanhemmuusryhmä vaikutti siihen osallistuvien vanhempien vanhemmuustaitoihin. Ihmeelliset vuodet – ohjelman vanhemmuusryhmät ovat käytöshäiriöisten lasten vanhemmille suunnattuja perheinterventioita, joissa lasten käytökseen pyr...
Directory of Open Access Journals (Sweden)
Sayaka Igari
Full Text Available Methylenetetrahydrofolate reductase (MTHFR is one of the enzymes involved in homocysteine metabolism. Despite considerable genetic and clinical attention, the reaction mechanism and regulation of this enzyme are not fully understood because of difficult production and poor stability. While recombinant enzymes from thermophilic organisms are often stable and easy to prepare, properties of thermostable MTHFRs have not yet been reported.MTHFR from Thermus thermophilus HB8, a homologue of Escherichia coli MetF, has been expressed in E. coli and purified. The purified MTHFR was chiefly obtained as a heterodimer of apo- and holo-subunits, that is, one flavin adenine dinucleotide (FAD prosthetic group bound per dimer. The crystal structure of the holo-subunit was quite similar to the β(8α(8 barrel of E. coli MTHFR, while that of the apo-subunit was a previously unobserved closed form. In addition, the intersubunit interface of the dimer in the crystals was different from any of the subunit interfaces of the tetramer of E. coli MTHFR. Free FAD could be incorporated into the apo-subunit of the purified Thermus enzyme after purification, forming a homodimer of holo-subunits. Comparison of the crystal structures of the heterodimer and the homodimer revealed different intersubunit interfaces, indicating a large conformational change upon FAD binding. Most of the biochemical properties of the heterodimer and the homodimer were the same, except that the homodimer showed ≈50% activity per FAD-bound subunit in folate-dependent reactions.The different intersubunit interfaces and rearrangement of subunits of Thermus MTHFR may be related to human enzyme properties, such as the allosteric regulation by S-adenosylmethionine and the enhanced instability of the Ala222Val mutant upon loss of FAD. Whereas E. coli MTHFR was the only structural model for human MTHFR to date, our findings suggest that Thermus MTHFR will be another useful model for this important enzyme.
Yu, Tian-Tian; Yao, Ji-Cheng; Ming, Hong; Yin, Yi-Rui; Zhou, En-Min; Liu, Min-Jiao; Tang, Shu-Kun; Li, Wen-Jun
2013-03-01
A Gram-stain negative aerobic bacterium, designated YIM 77924(T), was isolated from a geothermally heated soil sample collected at Rehai National Park, Tengchong, Yunnan province, south-west China. Growth was found to occur from 55 to 75 °C (optimum 65 °C), pH 6.0-8.0 (optimum pH 7.0) and 0-1 % NaCl (w/v). Cells were observed to be rod-shaped and the colonies convex, circular, smooth, yellow and non-transparent. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that strain YIM 77924(T) belongs to the genus Thermus. The 16S rRNA gene sequence similarity values between strain YIM 77924(T) and other species of the genus Thermus were all below 97 %. The polar lipids of strain YIM 77924(T) were determined to be aminophospholipid, phospholipid and glycolipid. The predominant respiratory quinone was determined to be MK-8 and the G+C content was 66.64 mol%. The major fatty acids identified were iso-C(16:0), iso-C(15:0), iso-C(17:0) and C(16:0). On the basis of the morphological and chemotaxonomic characteristics as well as genotypic data, strain YIM 77924(T) is proposed to represent a novel species, Thermus tengchongensis sp. nov., in the genus Thermus. The type strain is YIM 77924(T) (=KCTC 32025(T) = CCTCC AB2012063(T)).
A genetic map of mouse chromosome 1 near the Lsh-Ity-Bcg disease resistance locus.
Mock, B; Krall, M; Blackwell, J; O'Brien, A; Schurr, E; Gros, P; Skamene, E; Potter, M
1990-05-01
Isozyme and restriction fragment length polymorphism (RFLP) analyses of backcross progeny, recombinant inbred strains, and congenic strains of mice positioned eight genetic markers with respect to the Lsh-Ity-Bcg disease resistance locus. Allelic isoforms of Idh-1 and Pep-3 and RFLPs detected by Southern hybridization for Myl-1, Cryg, Vil, Achrg, bcl-2, and Ren-1,2, between BALB/cAnPt and DBA/2NPt mice, were utilized to examine the cosegregation of these markers with the Lsh-Ity-Bcg resistance phenotype in 103 backcross progeny. An additional 47 backcross progeny from a cross between C57BL/10ScSn and B10.L-Lshr/s mice were examined for the cosegregation of Myl-1 and Vil RFLPs with Lsh phenotypic differences. Similarly, BXD recombinant inbred strains were typed for RFLPs upon hybridization with Vil and Achrg. Recombination frequencies generated in the different test systems were statistically similar, and villin (Vil) was identified as the molecular marker closest (1.7 +/- 0.8 cM) to the Lsh-Ity-Bcg locus. Two other DNA sequences, nebulin (Neb) and an anonymous DNA fragment (D2S3), which map to a region of human chromosome 2q that is homologous to proximal mouse chromosome 1, were not closely linked to the Lsh-Ity-Bcg locus. This multipoint linkage analysis of chromosome 1 surrounding the Lsh-Ity-Bcg locus provides a basis for the eventual isolation of the disease gene.
Directory of Open Access Journals (Sweden)
Kevin D Beck
2014-11-01
Full Text Available As a model of anxiety disorder vulnerability, male Wistar-Kyoto (WKY rats acquire lever-press avoidance behavior more readily than outbred Sprague Dawley rats, and their acquisition is enhanced by the presence of a discrete signal presented during the inter-trial intervals (ITIs, suggesting it is perceived as a safety signal. A series of experiments were conducted to determine if this is the case. Additional experiments investigated if the avoidance facilitation relies upon processing through medial prefrontal cortex (mPFC. The results suggest that the ITI-signal facilitates acquisition during the early stages of the avoidance acquisition process, when the rats are initially acquiring escape behavior and then transitioning to avoidance behavior. Post-avoidance introduction of the visual ITI-signal into other associative learning tasks failed to confirm that the visual stimulus had acquired the properties of a conditioned inhibitor. Shortening the signal from the entirety of the 3 min ITI to only the first 5 s of the 3 min ITI slowed acquisition during the first 4 sessions, suggesting the flashing light is not functioning as a feedback signal. The prelimbic (PL cortex showed greater activation during the period of training when the transition from escape responding to avoidance responding occurs. Only combined PL+infralimbic cortex lesions modestly slowed avoidance acquisition, but PL cortex lesions slowed avoidance response latencies. Thus, the flashing light ITI-signal is not likely perceived as a safety signal nor is it serving as a feedback signal. The functional role of the PL cortex appears to be to increase the drive towards responding to the threat of the warning signal. Hence, avoidance susceptibility displayed by male WKY rats may be driven, in part, both by external stimuli (ITI signal as well as by enhanced threat recognition to the warning signal via the PL cortex.
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...
ITI implants with overdentures: a prevention of bone loss in edentulous mandibles?
DEFF Research Database (Denmark)
von Wowern, N; Harder, F; Hjørting-Hansen, E
1990-01-01
Changes in the bone mineral content (BMC) of edentulous mandibles with osseointegrated ITI implants supporting overdentures were measured in vivo by dual-photon absorptiometry. The BMC measurements were performed 3 weeks postoperatively and at the 2-year follow-up visit. Measurements were made...
Peterson, V M; Madonna, G S; Vogel, S N
1992-04-01
Inheritance of the Ityr or the Itys allele of the Ity murine gene confers resistance or increased susceptibility, respectively, to Salmonella typhimurium infection. Recent studies have documented that Ity gene expression may determine net intracellular replication of S. typhimurium by modulating macrophage function. The purpose of this study was to determine if Ity gene expression modulated macrophage stem cell proliferation as well. To detect possible Ity-associated alterations in macrophage stem cell proliferation during endotoxin challenge or S. typhimurium infection, the congenic strain pair BALB/c (Itys) and C.D2-Idh-1, Pep-3 N20F8 (Ityr) were injected intraperitoneally with 25 micrograms of bacterial lipopolysaccharide (LPS) or approximately 10(3) S. typhimurium, and myelopoiesis was evaluated. At 72 h after LPS injection, both BALB/c and C.D2 mice developed comparable degrees of bone marrow hypocellularity and splenomegaly, and cell sizing profiles indicated a normal response to a single injection of LPS in both strains of mice. Although an inhibitor to colony-stimulating factor activity was detected in the sera and plasma of C.D2 mice, the number of myeloid stem cells cultured from the bone marrow and spleen of each mouse strain were comparable. S. typhimurium infection resulted in earlier symptoms, a larger bacterial load, a higher mortality rate, and a greater bone marrow hypocellularity and splenomegaly in BALB/c mice compared with those in C.D2 mice. Despite a dramatic increase in bacterial load, a decrease in both bone marrow and splenic myeloid stem cell numbers was noted in BALB/c mice, while stem cell numbers remained constant in C.D2 mice between days 3 and 5 and increased dramatically at day 7 after infection. These data suggest that BALB/c and C.D2 mice may exhibit a divergent myelopoietic response to S. typhimurium infection. It appears that a paradoxical failure of myelopoiesis in Itys mice during S. typhimurium infection may contribute to the
Lerchenmueller, Marc J; Sorenson, Olav
2016-01-01
We examined the usefulness (precision) and completeness (recall) of the Author-ity author disambiguation for PubMed articles by associating articles with scientists funded by the National Institutes of Health (NIH). In doing so, we exploited established unique identifiers-Principal Investigator (PI) IDs-that the NIH assigns to funded scientists. Analyzing a set of 36,987 NIH scientists who received their first R01 grant between 1985 and 2009, we identified 355,921 articles appearing in PubMed that would allow us to evaluate the precision and recall of the Author-ity disambiguation. We found that Author-ity identified the NIH scientists with 99.51% precision across the articles. It had a corresponding recall of 99.64%. Precision and recall, moreover, appeared stable across common and uncommon last names, across ethnic backgrounds, and across levels of scientist productivity.
Institute of Scientific and Technical Information of China (English)
无
2007-01-01
The bacterium Thermus sp. TibetanG7, isolated from hot springs in Tibet, China, was examined for the ability to accumulate cesium from solutions. Environmental conditions were simulated and the effects of pH, K+, Na+ and K+-regimes were then studied to determine the possible role of the bacterium in the formation of cesium-bearing geyserite around these hot springs. In despite of the inhibition of K+ and Na+, the bacterium Thermus sp. TibetanG7 revealed noticeable accumulation of cesium from solutions, with maximum accumulations of 53.49 and 40.41 μmol Cesium/g cell dry weight in Na+ and K+ inhibition experiments, respectively. The accumulation of cesium by this microorganism is rapid, with 40%―50% accumulated within the first 5 min. K+-deficient cells showed a much higher capacity of cesium accumulation compared with K+-sufficient cells. It is evident that the bacteria within the genus thermus play a significant role in the cesium assembly. The formation of cesium-bearing geyserite is also considered.
The Impact of Project Management Maturity upon IT/IS Project Management Outcomes
Carcillo, Anthony Joseph, Jr.
2013-01-01
Although it is assumed that increasing the institutionalization (or maturity) of project management in an organization leads to greater project success, the literature has diverse views. The purpose of this mixed methods study was to examine the correlation between project management maturity and IT/IS project outcomes. The sample consisted of two…
2010-10-01
... 47 Telecommunication 1 2010-10-01 2010-10-01 false Reports. 3.60 Section 3.60 Telecommunication... MARITIME AND MARITIME MOBILE-SATELLITE RADIO SERVICES Reporting Requirements § 3.60 Reports. (a) Initial... authority is required to submit to the FCC a report on additions, modifications or deletions to its list of...
49 CFR 178.360-2 - Manufacture.
2010-10-01
... 49 Transportation 2 2010-10-01 2010-10-01 false Manufacture. 178.360-2 Section 178.360-2 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Specifications for Packagings for Class 7 (Radioactive) Materials § 178.360-2 Manufacture. The ends of the vessel...
Czech Academy of Sciences Publication Activity Database
Mansfeldová, Věra; Janda, Pavel; Tarábková, Hana
2015-01-01
Roč. 182, NOV 2015 (2015), s. 1053-1059 ISSN 0013-4686 Institutional support: RVO:61388955 Keywords : biomimetic liquid membrane * ion resolution potentiometry * ITIES Subject RIV: CG - Electrochemistry Impact factor: 4.803, year: 2015
Giraldo Valencia, Juan Carlos; Delgado, Liliana Claudia
2015-01-01
There are forces that are greater than the individual performance of each hospital institution and of the health system structural of each country. The world is changing and to face up to the future in the best possible way, we need to understand how contexts and emerging trends link up and how they affect the hospital sector. The Columbian Association of Hospitals and Clinics, ACHC, has thus come up with the Hospital 360° concept which uses hospitals capable of anticipating changing contexts by means of the transition between present and future and takes on board the experience of global, socio-economic, demographic, political, environmental and technological fields as its model. Hospital 360° is an invitation to reinvent processes and institution themselves allowing them to adapt and incorporate a high degree of functional flexibility. Hospital 360° purses goals of efficiency, effectiveness and relevance, but also of impact and sustainability, and is coherent with the internal needs of hospital institutions and society for long-term benefits.
19 CFR 360.102 - Online registration.
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Online registration. 360.102 Section 360.102... ANALYSIS SYSTEM § 360.102 Online registration. (a) In general. (1) Any importer, importing company, customs.... boxes will not be accepted. A user identification number will be issued within two business days...
Brånemark and ITI dental implants in the human bone-grafted maxilla: a comparative evaluation
DEFF Research Database (Denmark)
Pinholt, Else M
2003-01-01
. Twelve consecutive patients received machine-surfaced Brånemark fixtures and 13 consecutive patients received SLA-ITI fixtures. Gradual loading was applied after healing abutment application. After 6 months the permanent prosthetic reconstruction was provided to the patient, either as a fixed...
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Fire axes. 132.360 Section 132.360 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS FIRE-PROTECTION EQUIPMENT Miscellaneous § 132.360 Fire axes. (a) Each vessel of less than 100 gross tons must carry one fire axe. (b) Each...
Synthesis of rare sugars with L-fuculose-1-phosphate aldolase (FucA) from Thermus thermophilus HB8.
Li, Zijie; Cai, Li; Qi, Qingsheng; Styslinger, Thomas J; Zhao, Guohui; Wang, Peng George
2011-09-01
We report herein a one-pot four-enzyme approach for the synthesis of the rare sugars d-psicose, d-sorbose, l-tagatose, and l-fructose with aldolase FucA from a thermophilic source (Thermus thermophilus HB8). Importantly, the cheap starting material DL-GP (DL-glycerol 3-phosphate), was used to significantly reduce the synthetic cost. Copyright © 2011 Elsevier Ltd. All rights reserved.
46 CFR 183.360 - Semiconductor rectifier systems.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Semiconductor rectifier systems. 183.360 Section 183.360... TONS) ELECTRICAL INSTALLATION Power Sources and Distribution Systems § 183.360 Semiconductor rectifier systems. (a) Each semiconductor rectifier system must have an adequate heat removal system that prevents...
Kole, R. E.; Helmers, P. H.; Hotz, R. L.
1974-01-01
This is a reference document to be used in the process of getting HAL/S programs compiled and debugged on the IBM 360 computer. Topics from the operating system communication to interpretation of debugging aids are discussed. Features of HAL programming system that have specific system/360 dependencies are presented.
46 CFR 129.360 - Semiconductor-rectifier systems.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Semiconductor-rectifier systems. 129.360 Section 129.360... INSTALLATIONS Power Sources and Distribution Systems § 129.360 Semiconductor-rectifier systems. (a) Each semiconductor-rectifier system must have an adequate heat-removal system to prevent overheating. (b) If a...
46 CFR 120.360 - Semiconductor rectifier systems.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Semiconductor rectifier systems. 120.360 Section 120.360... INSTALLATION Power Sources and Distribution Systems § 120.360 Semiconductor rectifier systems. (a) Each semiconductor rectifier system must have an adequate heat removal system that prevents overheating. (b) Where a...
12 CFR 360.7 - Post-insolvency interest.
2010-01-01
... becomes proven. (4) Post-insolvency interest shall be determined using a simple interest method of... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Post-insolvency interest. 360.7 Section 360.7... RESOLUTION AND RECEIVERSHIP RULES § 360.7 Post-insolvency interest. (a) Purpose and scope. This section...
12 CFR 360.1 - Least-cost resolution.
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Least-cost resolution. 360.1 Section 360.1 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION REGULATIONS AND STATEMENTS OF GENERAL POLICY RESOLUTION AND RECEIVERSHIP RULES § 360.1 Least-cost resolution. (a) General rule. Except as provided in...
20 CFR 405.360 - Official record.
2010-04-01
... in making the decision under review and any additional evidence or written statements that the... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Official record. 405.360 Section 405.360 Employees' Benefits SOCIAL SECURITY ADMINISTRATION ADMINISTRATIVE REVIEW PROCESS FOR ADJUDICATING INITIAL...
International Nuclear Information System (INIS)
Hoshino, T.; Yoshino, Y.; Guevarra, E.D.; Ishida, S.; Hiruta, T.; Fujii, R.; Nakahara, T.
1994-01-01
Twenty-two carotenoid underproducing and thirteen overproducing mutants were obtained from Thermus thermophilus HB27. The strain HB27 was found to produce at least seven colored carotenoids, believed to be identical to those produced by Thermus aquaticus YT1. Based on the results of the genetic analyses performed on twelve carotenoid underproducing mutants, they were classified into three groups; groups 1, 2 and 3. No colored carotenoid was extracted from the cells of mutants belonging to groups 2 and 3, although the accumulation of phytoene, a colorless carotenoid, was observed in group 2 strains. Group 1 was subdivided into groups 1-a and 1-b, where 1-a stains produced neither colored carotenoids nor phytoene and 1-b strains produced two polar colored carotenoids. All of the overproducing mutants produced about twelve times as much seven colored carotenoid mixtures as the parental strain. The mutation loci among all the overproducing mutants were very close to one another, possibly in the same gene. Carotenoid overproducing mutants showed an extensive resistance to UV-irradiation and showed poorer growth at higher temperatures. Carotenoid underproducing mutants were slightly more UV-sensitive but they grew almost normally at higher temperatures. These results suggest that carotenoids are secondary metabolites which are not essential for growth of T. thermophilus
A Short Tale of the Black Sheep of -ITY
Computer Security Team
2013-01-01
Once upon a time, computer engineers of the ancient world used the abbreviation of “-ITY” ([eye-tee]) as a shorthand for “Information TechnologY”. It was an appropriate abbreviation as it reminded everyone of the core purposes and aspects of information technology, which made not only the computer engineers, but also their clients, happy. Whenever the engineers were programming a software application or setting up a computing service to cover the needs of their clients, they stuck to the four paradigms of -ITY: * “Functional-ITY”, i.e. ensuring that a service or application has a purpose and a justification of being; * “Avalabil-ITY”, i.e. ensuring that this service or application is functional whenever a client wants to use it; * “Usabil-ITY”, i.e. ensuring that this client does not get fed up by a badly designed user interface or disappointed by the service’s or application&am...
37 CFR 360.4 - Compliance with statutory dates.
2010-07-01
... dates. 360.4 Section 360.4 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Cable Claims § 360.4 Compliance with statutory dates. (a) Claims filed with the Copyright Royalty Board...
37 CFR 360.24 - Compliance with statutory dates.
2010-07-01
... dates. 360.24 Section 360.24 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Digital Audio Recording Devices and Media Royalty Claims § 360.24 Compliance with statutory dates. (a...
37 CFR 360.13 - Compliance with statutory dates.
2010-07-01
... dates. 360.13 Section 360.13 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Satellite Claims § 360.13 Compliance with statutory dates. (a) Claims filed with the Copyright Royalty Board...
44 CFR 360.4 - Administrative procedures.
2010-10-01
... of training as well as costs of delivery and student travel and per diem are to be estimated. Special.... 360.4 Section 360.4 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY...) Issuance of a request for application: Each State emergency management agency will receive a Request for...
46 CFR 185.360 - Use of auto pilot.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Use of auto pilot. 185.360 Section 185.360 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) OPERATIONS Miscellaneous Operating Requirements § 185.360 Use of auto pilot. Whenever an automatic pilot is...
31 CFR 360.1 - Official agencies.
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Official agencies. 360.1 Section 360.1 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... Bank of Kansas City, 925 Grand Boulevard, Kansas City, MO 64106 Dallas, San Francisco, Kansas City, St...
IR-360 nuclear power plant safety functions and component classification
International Nuclear Information System (INIS)
Yousefpour, F.; Shokri, F.; Soltani, H.
2010-01-01
The IR-360 nuclear power plant as a 2-loop PWR of 360 MWe power generation capacity is under design in MASNA Company. For design of the IR-360 structures, systems and components (SSCs), the codes and standards and their design requirements must be determined. It is a prerequisite to classify the IR-360 safety functions and safety grade of structures, systems and components correctly for selecting and adopting the suitable design codes and standards. This paper refers to the IAEA nuclear safety codes and standards as well as USNRC standard system to determine the IR-360 safety functions and to formulate the principles of the IR-360 component classification in accordance with the safety philosophy and feature of the IR-360. By implementation of defined classification procedures for the IR-360 SSCs, the appropriate design codes and standards are specified. The requirements of specific codes and standards are used in design process of IR-360 SSCs by design engineers of MASNA Company. In this paper, individual determination of the IR-360 safety functions and definition of the classification procedures and roles are presented. Implementation of this work which is described with example ensures the safety and reliability of the IR-360 nuclear power plant.
IR-360 nuclear power plant safety functions and component classification
Energy Technology Data Exchange (ETDEWEB)
Yousefpour, F., E-mail: fyousefpour@snira.co [Management of Nuclear Power Plant Construction Company (MASNA) (Iran, Islamic Republic of); Shokri, F.; Soltani, H. [Management of Nuclear Power Plant Construction Company (MASNA) (Iran, Islamic Republic of)
2010-10-15
The IR-360 nuclear power plant as a 2-loop PWR of 360 MWe power generation capacity is under design in MASNA Company. For design of the IR-360 structures, systems and components (SSCs), the codes and standards and their design requirements must be determined. It is a prerequisite to classify the IR-360 safety functions and safety grade of structures, systems and components correctly for selecting and adopting the suitable design codes and standards. This paper refers to the IAEA nuclear safety codes and standards as well as USNRC standard system to determine the IR-360 safety functions and to formulate the principles of the IR-360 component classification in accordance with the safety philosophy and feature of the IR-360. By implementation of defined classification procedures for the IR-360 SSCs, the appropriate design codes and standards are specified. The requirements of specific codes and standards are used in design process of IR-360 SSCs by design engineers of MASNA Company. In this paper, individual determination of the IR-360 safety functions and definition of the classification procedures and roles are presented. Implementation of this work which is described with example ensures the safety and reliability of the IR-360 nuclear power plant.
Void -spelprototyp för Xbox360 / Void -game prototype for Xbox360
Lindberg, Joakim; Gullbrandson, Fredrik; Nilsson, Bo Martin
2008-01-01
Detta examensarbete består utav av två delar, en produktionsdel och denna slutreflektion. Produktionsdelen varade i 15 veckor och gick ut på att utveckla en spelprototyp. Spelprototypen är ämnad för spelkonsolen Xbox360, som är den nya generationens tv-spel. För att kunna utveckla till denna konsol måste man använda sig av XNA, som är ett utvecklingsverktyg ämnat specifikt för Xbox360 och ett måste om man vill kunna utveckla till denna konsol som icke licensierad spelutvecklare. Denna rapport...
46 CFR 122.360 - Use of auto pilot.
2010-10-01
... 46 Shipping 4 2010-10-01 2010-10-01 false Use of auto pilot. 122.360 Section 122.360 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS CARRYING MORE THAN 150... Requirements § 122.360 Use of auto pilot. Whenever an automatic pilot is used the master shall ensure that: (a...
The effect of high pressure on the intracellular trehalose synthase activity of Thermus aquaticus.
Dong, Yongsheng; Ma, Lei; Duan, Yuanliang
2016-01-01
To understand the effect of high pressure on the intracellular trehalose synthase activity, Thermus aquaticus (T. aquaticus) in the logarithmic growth phase was treated with high-pressure air, and its intracellular trehalose synthase (TSase) activity was determined. Our results indicated that pressure is a factor strongly affecting the cell growth. High pressure significantly attenuated the growth rate of T. aquaticus and shortened the duration of stationary phase. However, after 2 h of culture under 1.0 MPa pressure, the activity of intracellular TSase in T. aquaticus reached its maximum value, indicating that pressure can significantly increase the activity of intracellular TSase in T. aquaticus. Thus the present study provides an important guide for the enzymatic production of trehalose.
Virtual displays for 360-degree video
Gilbert, Stephen; Boonsuk, Wutthigrai; Kelly, Jonathan W.
2012-03-01
In this paper we describe a novel approach for comparing users' spatial cognition when using different depictions of 360- degree video on a traditional 2D display. By using virtual cameras within a game engine and texture mapping of these camera feeds to an arbitrary shape, we were able to offer users a 360-degree interface composed of four 90-degree views, two 180-degree views, or one 360-degree view of the same interactive environment. An example experiment is described using these interfaces. This technique for creating alternative displays of wide-angle video facilitates the exploration of how compressed or fish-eye distortions affect spatial perception of the environment and can benefit the creation of interfaces for surveillance and remote system teleoperation.
31 CFR 360.48 - Restrictions on reissue; denominational exchange.
2010-07-01
...; denominational exchange. 360.48 Section 360.48 Money and Finance: Treasury Regulations Relating to Money and... GOVERNING DEFINITIVE UNITED STATES SAVINGS BONDS, SERIES I Reissue and Denominational Exchange § 360.48 Restrictions on reissue; denominational exchange. Reissue is not permitted solely to change denominations. ...
19 CFR 360.108 - Loss of electronic licensing privileges.
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Loss of electronic licensing privileges. 360.108 Section 360.108 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE STEEL IMPORT MONITORING AND ANALYSIS SYSTEM § 360.108 Loss of electronic licensing privileges. Should Commerce determine...
Characterization of recombinant glyoxylate reductase from thermophile Thermus thermophilus HB27.
Ogino, Hiroyasu; Nakayama, Hitoshi; China, Hideyasu; Kawata, Takuya; Doukyu, Noriyuki; Yasuda, Masahiro
2008-01-01
A glyoxylate reductase gene from the thermophilic bacterium Thermus thermophilus HB27 (TthGR) was cloned and expressed in Escherichia coli cells. The recombinant enzyme was highly purified to homogeneity and characterized. The purified TthGR showed thermostability up to 70 degrees C. In contrast, the maximum reaction condition was relatively mild (45 degrees C and pH 6.7). Although the kcat values against co-enzyme NADH and NADPH were similar, the Km value against co-enzyme NADH was approximately 18 times higher than that against NADPH. TthGR prefers NADPH rather than NADH as an electron donor. These results indicate that a phosphate group of a co-enzyme affects the binding affinity rather than the reaction efficiency, and TthGR demands appropriate amount of phosphate for a high activity. Furthermore, it was found that the half-lives of TthGR in the presence of 25% dimethyl sulfoxide and diethylene glycol were significantly longer than that in the absence of an organic solvent.
37 CFR 360.22 - Form and content of claims.
2010-07-01
.... 360.22 Section 360.22 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Digital Audio Recording Devices and Media Royalty Claims § 360.22 Form and content of claims. (a) Forms. (1...
Our Journey to Summon and 360: The KAUST experience
Ramli, Rindra M.
2017-09-12
Depicts the journey undertaken by KAUST (King Abdullah University of Science and Technology), an international graduate research university located on the shores of the Red Sea, in implementing Summon as its new webscale discovery layer. We will also describe the implementation of 360 suite of products namely: 360 Core & 360 LINK, 360 Marc. The presentation will cover the early days of library’s foray into discovery layers and the difficulties faced by the library that gave the impetus to embark on the project to evaluate, assess and recommend for a new and robust discovery layer. On top of that, the presenters would elaborate the project timeline (which also include the implementation phase for Summon and 360 Core), the challenges faced by the project team and lessons learnt.
Directory of Open Access Journals (Sweden)
Zylicz-Stachula Agnieszka
2009-05-01
Full Text Available Abstract Background Restriction-modification systems are a diverse class of enzymes. They are classified into four major types: I, II, III and IV. We have previously proposed the existence of a Thermus sp. enzyme family, which belongs to type II restriction endonucleases (REases, however, it features also some characteristics of types I and III. Members include related thermophilic endonucleases: TspGWI, TaqII, TspDTI, and Tth111II. Results Here we describe cloning, mutagenesis and analysis of the prototype TspGWI enzyme that recognises the 5'-ACGGA-3' site and cleaves 11/9 nt downstream. We cloned, expressed, and mutagenised the tspgwi gene and investigated the properties of its product, the bifunctional TspGWI restriction/modification enzyme. Since TspGWI does not cleave DNA completely, a cloning method was devised, based on amino acid sequencing of internal proteolytic fragments. The deduced amino acid sequence of the enzyme shares significant sequence similarity with another representative of the Thermus sp. family – TaqII. Interestingly, these enzymes recognise similar, yet different sequences in the DNA. Both enzymes cleave DNA at the same distance, but differ in their ability to cleave single sites and in the requirement of S-adenosylmethionine as an allosteric activator for cleavage. Both the restriction endonuclease (REase and methyltransferase (MTase activities of wild type (wt TspGWI (either recombinant or isolated from Thermus sp. are dependent on the presence of divalent cations. Conclusion TspGWI is a bifunctional protein comprising a tandem arrangement of Type I-like domains; particularly noticeable is the central HsdM-like module comprising a helical domain and a highly conserved S-adenosylmethionine-binding/catalytic MTase domain, containing DPAVGTG and NPPY motifs. TspGWI also possesses an N-terminal PD-(D/EXK nuclease domain related to the corresponding domains in HsdR subunits, but lacks the ATP-dependent translocase module
37 CFR 360.25 - Copies of claims.
2010-07-01
... Section 360.25 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Digital Audio Recording Devices and Media Royalty Claims § 360.25 Copies of claims. A claimant shall, for each claim...
International Nuclear Information System (INIS)
Nakamura, Tsutomu; Kashima, Yasuhiro; Mine, Shouhei; Oku, Takashi; Uegaki, Koichi
2011-01-01
In this study, a putative glucokinase/hexokinase from T. thermophilus was purified and crystallized. Diffraction data were collected and processed to 2.02 Å resolution. Glucokinase/hexokinase catalyzes the phosphorylation of glucose to glucose 6-phosphate, which is the first step of glycolysis. The open reading frame TTHA0299 of the extreme thermophile Thermus thermophilus encodes a putative glucokinase/hexokinase which contains the consensus sequence for proteins from the repressors, open reading frames and sugar kinases family. In this study, the glucokinase/hexokinase from T. thermophilus was purified and crystallized using polyethylene glycol 8000 as a precipitant. Diffraction data were collected and processed to 2.02 Å resolution. The crystal belonged to space group P2 1 , with unit-cell parameters a = 70.93, b = 138.14, c = 75.16 Å, β = 95.41°
24 CFR 1006.360 - Conflict of interest.
2010-04-01
... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Conflict of interest. 1006.360... DEVELOPMENT NATIVE HAWAIIAN HOUSING BLOCK GRANT PROGRAM Program Requirements § 1006.360 Conflict of interest. In the procurement of property and services by the DHHL and contractors, the conflict of interest...
31 CFR 360.29 - Adjudication of claims.
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Adjudication of claims. 360.29 Section 360.29 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL... the ordinary course of business. (b) Claims filed 10 years after payment. Any claim filed 10 years or...
31 CFR 360.61 - Payment after death.
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Payment after death. 360.61 Section 360.61 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL... after death. After the death of the ward, and at any time prior to the representative's discharge, the...
Norambuena, J; Wang, Y; Hanson, T; Boyd, J M; Barkay, T
2017-11-17
Mercury (Hg), one of the most toxic and widely distributed heavy metals, has a high affinity for thiol groups. Thiol groups reduce and sequester Hg. Therefore, low molecular weight and protein thiols may be important cell components used in Hg resistance. To date, the role of low molecular weight thiols in Hg-detoxification remains understudied. The mercury resistance ( mer ) operon of Thermus thermophilus suggests an evolutionary link between Hg(II) resistance and low molecular weight thiol metabolism. This mer operon encodes for an enzyme involved in methionine biosynthesis, Oah. Challenge with Hg(II) resulted in increased expression of genes involved in the biosynthesis of multiple low molecular weight thiols (cysteine, homocysteine, and bacillithiol), as well as the thioredoxin system. Phenotypic analysis of gene replacement mutants indicated that Oah contributes to Hg resistance under sulfur limiting conditions, and strains lacking bacillithiol and/or thioredoxins are more sensitive to Hg(II) than the wild type. Growth in presence of either a thiol oxidizing agent or a thiol alkylating agent increased sensitivity to Hg(II). Furthermore, exposure to 3 μM Hg(II) consumed all intracellular reduced bacillithiol and cysteine. Database searches indicate that oah2 is present in all Thermus spp. mer operons. The presence of a thiol related gene was also detected in some alphaprotobacterial mer operons, in which a glutathione reductase gene was present, supporting the role of thiols in Hg(II) detoxification. These results have led to a working model in which LMW thiols act as Hg(II) buffering agents while Hg is reduced by MerA. Importance The survival of microorganisms in presence of toxic metals is central to life's sustainability. The affinity of thiol groups to toxic heavy metals drives microbe-metal interactions and modulate metal toxicity. Mercury detoxification ( mer ) genes likely originated early in microbial evolution among geothermal environments. Little is
McDougall, Christie M.
2013-01-01
The purpose of the mixed methods study was to develop and validate the CSIS-360, a 360-degree feedback assessment to measure competencies of school improvement specialists from multiple perspectives. The study consisted of eight practicing school improvement specialists from a variety of settings. The specialists nominated 23 constituents to…
Directory of Open Access Journals (Sweden)
Accarat Chaoumead
2012-01-01
Full Text Available Transparent conductive titanium-doped indium oxide (ITiO films were deposited on corning glass substrates by RF magnetron sputtering method. The effects of RF sputtering power and Ar gas pressure on the structural and electrical properties of the films were investigated experimentally, using a 2.5 wt% TiO2-doped In2O3 target. The deposition rate was in the range of around 20~60 nm/min under the experimental conditions of 5~20 mTorr of gas pressure and 220~350 W of RF power. The lowest volume resistivity of 1.2×10−4 Ω-cm and the average optical transmittance of 75% were obtained for the ITiO film, prepared at RF power of 300 W and Ar gas pressure of 15 mTorr. This volume resistivity of 1.2×10−4 Ω-cm is low enough as a transparent conducting layer in various electrooptical devices, and it is comparable with that of ITO or ZnO:Al conducting layer.
Crystallization of ribosomes from Thermus thermophilus
International Nuclear Information System (INIS)
Karpova, E.A.; Serdyuk, I.N.; Tarkhovskii, Yu.S.; Orlova, E.V.; Borovyagin, V.L.
1987-01-01
An understanding of the molecular bases of the process of protein biosynthesis on the ribosome requires a knowledge of its structure with high three-dimensional resolution involving the method of x-ray crystallographic analysis. The authors report on the production of crystals of the 70S ribosomes from a new source - the highly thermophilic bacterium Thermus thermophilus. Ribosomes for crystallization were obtained from Th. thermophilus strain HB8 by two washings in buffer with high ionic strength. The ribosome preparation was investigated for homogeneity by the method of high-speed sedimentation in a buffer containing 15 mM MgCl 2 , 50 mM NH 4 Cl, and 10 MM Tris-HCl, pH 7.5. Analysis showed that the preparation if homogeneous. The same preparation was investigated for intactness of ribosomal RNA by the method of gel electrophoresis in 2.75% acrylamide 0.5% agarose gel in a buffer containing 30 mM Tris, 30 mM NaH 2 PO 4 , 10 mM EDTA, 1-2% SDS, and 6 M urea. Analysis showed that the preparation possesses intact 16S and 23S RNA. The latter did not degrade, at least in a week of exposure of the ribosomes in buffer solution at 5 0 C. The ribosome preparation had no appreciable RNase activity, which was verified by incubating 4.5 micrograms of ribosomes with 3 micrograms of 14 C-labeled 16S rRna (50 0 C, 90 min) in a buffer containing 10 mM MgCl 2 , 100 mM NH 4 Cl, and 10 mM Tris-HCl, pH/sub 20 0 / 7.5. The incubated nonhydrolyzed RNA was precipitated with 5% trichloroacetic acid and applied on a GF/C filter. The radioactivity was determined in a toluene scintillator on an LS-100C counter
Cloning, purification and crystallization of Thermus thermophilus proline dehydrogenase
International Nuclear Information System (INIS)
White, Tommi A.; Tanner, John J.
2005-01-01
Cloning, purification and crystallization of T. thermophilus proline dehydrogenase is reported. The detergent n-octyl β-d-glucopyranoside was used to reduce polydispersity, which enabled crystallization. Nature recycles l-proline by converting it to l-glutamate. This four-electron oxidation process is catalyzed by the two enzymes: proline dehydrogenase (PRODH) and Δ 1 -pyrroline-5-carboxylate dehydrogenase. This note reports the cloning, purification and crystallization of Thermus thermophilus PRODH, which is the prototype of a newly discovered superfamily of bacterial monofunctional PRODHs. The results presented here include production of a monodisperse protein solution through use of the detergent n-octyl β-d-glucopyranoside and the growth of native crystals that diffracted to 2.3 Å resolution at Advanced Light Source beamline 4.2.2. The space group is P2 1 2 1 2 1 , with unit-cell parameters a = 82.2, b = 89.6, c = 94.3 Å. The asymmetric unit is predicted to contain two protein molecules and 46% solvent. Molecular-replacement trials using a fragment of the PRODH domain of the multifunctional Escherichia coli PutA protein as the search model (24% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of T. thermophilus PRODH will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative
37 CFR 360.23 - Content of notices regarding independent administrators.
2010-07-01
... independent administrators. 360.23 Section 360.23 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Digital Audio Recording Devices and Media Royalty Claims § 360.23 Content of notices...
20 CFR 416.360 - Cancellation of a request to withdraw.
2010-04-01
....360 Section 416.360 Employees' Benefits SOCIAL SECURITY ADMINISTRATION SUPPLEMENTAL SECURITY INCOME FOR THE AGED, BLIND, AND DISABLED Filing of Applications Withdrawal of Application § 416.360... received after we have approved the withdrawal, the cancellation request is filed no later than 60 days...
Hämmerle, C H; Brägger, U; Bürgin, W; Lang, N P
1996-06-01
In order to achieve esthetically more satisfying results, it has been proposed to place ITI implants with their border between the rough and smooth surfaces below the level of the alveolar crest, thereby obtaining a submucosally located implant shoulder following healing. The aim of the present experimental study was to clinically and radiographically evaluate the tissue response to the placement of one-stage transmucosal implants with the border between the rough and the smooth surfaces sunk by 1 mm into a subcrestal location. 11 patients underwent comprehensive dental care including the placement of 2 implants of the ITI Dental Implant System in the same quadrant (test and control). Randomly assigned control implants were placed according to the manufacturer's instructions, i.e. the border between the rough titanium plasma-sprayed and the smooth polished surfaces precisely at the alveolar crest. At the test implant the apical border of the polished surface was placed approximately 1 mm below the alveolar crest. Probing bone levels were assessed at implant placement (baseline), 4 and 12 months later. Modified plaque and modified gingival indices were recorded at 1, 2, 3, 4 and 12 months. Clinical probing depth and "attachment" levels were measured at 4 and 12 months. All parameters were assessed at 6 sites around each implant. The mean for each implant was calculated and used for analysis. The Wilcoxon matched pairs signed rank test and the Student t-test were applied to detect differences over time and between the test and control implants. At baseline, a mean difference in probing bone level of -0.86 mm (SD 0.43 mm, p placed more deeply. Both test and control implants lost a significant amount of clinical bone height during the first 4 months (test 1.16 mm, p placed under standard conditions, the bone adjacent to the polished surface of more deeply placed ITI implants is also lost over time. From a biological point of view, the placement of the border between
Developing 360 degree feedback system for KINS
Energy Technology Data Exchange (ETDEWEB)
Han, In Soo; Cheon, B. M.; Kim, T. H.; Ryu, J. H. [Chungman National Univ., Daejeon (Korea, Republic of)
2003-12-15
This project aims to investigate the feasibility of a 360 degree feedback systems for KINS and to design guiding rules and structures in implementing that systems. Literature survey, environmental analysis and questionnaire survey were made to ensure that 360 degree feedback is the right tool to improve performance in KINS. That review leads to conclusion that more readiness and careful feasibility review are needed before implementation of 360 degree feedback in KINS. Further the project suggests some guiding rules that can be helpful for successful implementation of that system in KINS. Those include : start with development, experiment with one department, tie it to a clear organization's goal, train everyone involve, make sure to try that system in an atmosphere of trust.
Developing 360 degree feedback system for KINS
International Nuclear Information System (INIS)
Han, In Soo; Cheon, B. M.; Kim, T. H.; Ryu, J. H.
2003-12-01
This project aims to investigate the feasibility of a 360 degree feedback systems for KINS and to design guiding rules and structures in implementing that systems. Literature survey, environmental analysis and questionnaire survey were made to ensure that 360 degree feedback is the right tool to improve performance in KINS. That review leads to conclusion that more readiness and careful feasibility review are needed before implementation of 360 degree feedback in KINS. Further the project suggests some guiding rules that can be helpful for successful implementation of that system in KINS. Those include : start with development, experiment with one department, tie it to a clear organization's goal, train everyone involve, make sure to try that system in an atmosphere of trust
31 CFR 360.22 - Payment or reissue pursuant to divorce.
2010-07-01
... divorce. 360.22 Section 360.22 Money and Finance: Treasury Regulations Relating to Money and Finance... divorce. (a) Divorce. (1) The Department of the Treasury will recognize a divorce decree that ratifies or.... (2) The evidence required under § 360.23 must be submitted in every case. When the divorce decree...
42 CFR 495.360 - Software and ownership rights.
2010-10-01
... 42 Public Health 5 2010-10-01 2010-10-01 false Software and ownership rights. 495.360 Section 495.360 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) STANDARDS AND CERTIFICATION STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE...
International Nuclear Information System (INIS)
Antonyuk, S.V.; Melik-Adamyan, V.R.; Popov, A.N.; Lamzin, V.S.; Hempstead, P.D.; Harrison, P.M.; Artymyuk, P.J.; Barynin, V.V.
2000-01-01
The crystal structures of two forms of the enzyme dimanganese catalase from Thermus Thermophilus (native and inhibited by chloride) were studied by X-ray diffraction analysis at 1.05 and 0.98 A resolution, respectively. The atomic models of the molecules were refined to the R factors 9.8 and 10%, respectively. The three-dimensional molecular structures are characterized in detail. The analysis of electron-density distributions in the active centers of the native and inhibited enzyme forms revealed that the most flexible side chains of the amino acid residues Lys162 and Glu36 exist in two interrelated conformations. This allowed us to obtain the structural data necessary for understanding the mechanism of enzymatic activity of the dimanganese catalase
12 CFR Appendix C to Part 360 - Deposit File Structure
2010-01-01
.... • STATE = State government. • COMM = Commercial. • CORP = Corporate. • BANK = Bank Owned. • DUE TO = Other... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Deposit File Structure C Appendix C to Part 360... RESOLUTION AND RECEIVERSHIP RULES Pt. 360, App. C Appendix C to Part 360—Deposit File Structure This is the...
31 CFR 360.55 - Individuals authorized to certify.
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Individuals authorized to certify. 360.55 Section 360.55 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued... imprint of either the corporate seal of the institution or of the issuing or paying agent's stamp. The...
TIC360. Concepto, Conclusiones y Líneas Abiertas.
Prado, Andrés
2015-01-01
TIC360. Concepto, conclusiones y líneas abiertas derivadas de las jornadas de la sectorial TIC de CRUE celebradas en el campus de Toledo de la UCLM. En estas jornadas se trazó una visión 360º de las TIC en la Universidad, contando con todos los agentes implicados
20 CFR 410.360 - Determination of dependency; widow.
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Determination of dependency; widow. 410.360... OF 1969, TITLE IV-BLACK LUNG BENEFITS (1969- ) Relationship and Dependency § 410.360 Determination of dependency; widow. (a) General. An individual who is the miner's widow (see § 410.320) will be determined to...
Cloning, purification and crystallization of Thermus thermophilus proline dehydrogenase
Energy Technology Data Exchange (ETDEWEB)
White, Tommi A.; Tanner, John J., E-mail: tannerjj@missouri.edu [Departments of Chemistry and Biochemistry, University of Missouri-Columbia, Columbia, Missouri 65211 (United States)
2005-08-01
Cloning, purification and crystallization of T. thermophilus proline dehydrogenase is reported. The detergent n-octyl β-d-glucopyranoside was used to reduce polydispersity, which enabled crystallization. Nature recycles l-proline by converting it to l-glutamate. This four-electron oxidation process is catalyzed by the two enzymes: proline dehydrogenase (PRODH) and Δ{sup 1}-pyrroline-5-carboxylate dehydrogenase. This note reports the cloning, purification and crystallization of Thermus thermophilus PRODH, which is the prototype of a newly discovered superfamily of bacterial monofunctional PRODHs. The results presented here include production of a monodisperse protein solution through use of the detergent n-octyl β-d-glucopyranoside and the growth of native crystals that diffracted to 2.3 Å resolution at Advanced Light Source beamline 4.2.2. The space group is P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 82.2, b = 89.6, c = 94.3 Å. The asymmetric unit is predicted to contain two protein molecules and 46% solvent. Molecular-replacement trials using a fragment of the PRODH domain of the multifunctional Escherichia coli PutA protein as the search model (24% amino-acid sequence identity) did not produce a satisfactory solution. Therefore, the structure of T. thermophilus PRODH will be determined by multiwavelength anomalous dispersion phasing using a selenomethionyl derivative.
360° FILM BRINGS BOMBED CHURCH TO LIFE
Directory of Open Access Journals (Sweden)
K. Kwiatek
2012-09-01
Full Text Available This paper explores how a computer-generated reconstruction of a church can be adapted to create a panoramic film that is presented in a panoramic viewer and also on a wrap-around projection system. It focuses on the fundamental principles of creating 360º films, not only in 3D modelling software, but also presents how to record 360º video using panoramic cameras inside the heritage site. These issues are explored in a case study of Charles Church in Plymouth, UK that was bombed in 1941 and has never been rebuilt. The generation of a 3D model of the bombed church started from the creation of five spherical panoramas and through the use of Autodesk ImageModeler software. The processed files were imported and merged together in Autodesk 3ds Max where a visualisation of the ruin was produced. A number of historical images were found and this collection enabled the process of a virtual reconstruction of the site. The aspect of merging two still or two video panoramas (one from 3D modelling software, the other one recorded on the site from the same locations or with the same trajectories is also discussed. The prototype of 360º non-linear film tells a narrative of a wartime wedding that occurred in this church. The film was presented on two 360º screens where members of the audience could make decisions on whether to continue the ceremony or whether to run away when the bombing of the church starts. 3D modelling software made this possible to render a number of different alternati ves (360º images and 360º video. Immersive environments empower the visitor to imagine the building before it was destroyed.
360° Film Brings Bombed Church to Life
Kwiatek, K.
2011-09-01
This paper explores how a computer-generated reconstruction of a church can be adapted to create a panoramic film that is presented in a panoramic viewer and also on a wrap-around projection system. It focuses on the fundamental principles of creating 360º films, not only in 3D modelling software, but also presents how to record 360º video using panoramic cameras inside the heritage site. These issues are explored in a case study of Charles Church in Plymouth, UK that was bombed in 1941 and has never been rebuilt. The generation of a 3D model of the bombed church started from the creation of five spherical panoramas and through the use of Autodesk ImageModeler software. The processed files were imported and merged together in Autodesk 3ds Max where a visualisation of the ruin was produced. A number of historical images were found and this collection enabled the process of a virtual reconstruction of the site. The aspect of merging two still or two video panoramas (one from 3D modelling software, the other one recorded on the site) from the same locations or with the same trajectories is also discussed. The prototype of 360º non-linear film tells a narrative of a wartime wedding that occurred in this church. The film was presented on two 360º screens where members of the audience could make decisions on whether to continue the ceremony or whether to run away when the bombing of the church starts. 3D modelling software made this possible to render a number of different alternati ves (360º images and 360º video). Immersive environments empower the visitor to imagine the building before it was destroyed.
D Modelling with the Samsung Gear 360
Barazzetti, L.; Previtali, M.; Roncoroni, F.
2017-02-01
The Samsung Gear 360 is a consumer grade spherical camera able to capture photos and videos. The aim of this work is to test the metric accuracy and the level of detail achievable with the Samsung Gear 360 coupled with digital modelling techniques based on photogrammetry/computer vision algorithms. Results demonstrate that the direct use of the projection generated inside the mobile phone or with Gear 360 Action Direction (the desktop software for post-processing) have a relatively low metric accuracy. As results were in contrast with the accuracy achieved by using the original fisheye images (front and rear facing images) in photogrammetric reconstructions, an alternative solution to generate the equirectangular projections was developed. A calibration aimed at understanding the intrinsic parameters of the two lenses camera, as well as their relative orientation, allowed one to generate new equirectangular projections from which a significant improvement of geometric accuracy has been achieved.
Directory of Open Access Journals (Sweden)
Amin Fatoni
2012-11-01
Full Text Available Limited reserves of fossil energy stimulate researchers to explore for a new alternative energy, such as bioethanol.A thermophilic amylase producing bacterium was isolated from local hot-springs and its characteristic and potential applicationfor bioethanol production was determined. The obtained amylase was studied to determine its optimum temperature, pH,enzymatic reaction time, and substrate concentration. Tapioca waste was used as the substrate to find the potential of theamylase for degrading starch into glucose, and then the process was continued by fermentation to produce bioethanol. Theamylase producer bacterium was proposed as genus Thermus sp. The crude amylase that was obtained has the optimumtemperature of 60°C and optimum pH of 8.0, optimum substrate concentration at 10% (w/w and optimum enzymatic reactiontime of 45 minutes. These enzymes convert the starches of waste tapioca at optimum conditions, with the result of 2.9%ethanol produced from raw materials.
Hacking 360 Link: A hybrid approach
Directory of Open Access Journals (Sweden)
John Durno
2012-10-01
Full Text Available When the University of Victoria Libraries switched from a locally-hosted link resolver (SFX to a vendor-hosted link resolver (360Link, new strategies were required to effectively integrate the vendor-hosted link resolver with the Libraries' other systems and services. Custom javascript is used to add links to the 360Link page; these links then point at local PHP code running on UVic servers, which can then redirect to appropriate local service or display a form directly. An open source PHP OpenURL parser class is announced. Consideration is given to the importance of maintaining open protocols and standards in the transition to vendor-hosted services.
COPD360social Online Community: A Social Media Review.
Stellefson, Michael; Paige, Samantha R; Alber, Julia M; Stewart, Margaret
2018-06-01
People living with chronic obstructive pulmonary disease (COPD) commonly report feelings of loneliness and social isolation due to lack of support from family, friends, and health care providers. COPD360social is an interactive and disease-specific online community and social network dedicated to connecting people living with COPD to evidence-based resources. Through free access to collaborative forums, members can explore, engage, and discuss an array of disease-related topics, such as symptom management. This social media review provides an overview of COPD360social, specifically its features that practitioners can leverage to facilitate patient-provider communication, knowledge translation, and community building. The potential of COPD360social for chronic disease self-management is maximized through community recognition programming and interactive friend-finding tools that encourage members to share their own stories through blogs and multimedia (e.g., images, videos). The platform also fosters collaborative knowledge dissemination and helping relationships among patients, family members, friends, and health care providers. Successful implementation of COPD360social has dramatically expanded patient education and self-management support resources for people affected by COPD. Practitioners should refer patients and their families to online social networks such as COPD360social to increase knowledge and awareness of evidence-based chronic disease management practices.
DEFF Research Database (Denmark)
Oledzka, G.; Dabrowski, Slawomir; Kur, J.
2003-01-01
Aqualysin I is a heat-stable subtilisin-type serine protease which is secreted into the culture medium by Thermus aquaticus YT-1, an extreme thermophile. We report the high-level expression of an aqualysin I protein using its native signal sequence for secretion in the methylotrophic yeast, Pichia...... to that of the native enzyme. We also explored the possibility of secreting the GAP expressed aqualysin I in P. pastoris by in-frame fusion of the Saccharomyces cerevisiae alpha-factor secretion signal. However, the levels of secreted pro-aqualysin I particles were approximately 10 times lower, possibly...
Autodesk Infraworks 360 and Autodesk Infraworks 360 LT essentials
Chappell, Eric
2015-01-01
Get up to speed and get to work quickly with the official InfraWorks handbook Autodesk InfraWorks and InfraWorks 360 Essentials, 2nd Edition is your comprehensive, hands-on guide to this popular civil engineering software. This unique guide features concise, straightforward explanations and real world exercises to bring you up to speed on InfraWorks' core features and functions, giving you the skills you need to quickly become productive. Following a workflow-based approach that mirrors how projects progress in the real world, this book walks you through the process of designing a residential
Editorial for special issue of AJIS on Green IT/IS (Sustainable computing
Directory of Open Access Journals (Sweden)
Michael Steven Lane
2011-03-01
Full Text Available We are pleased to present this AJIS Special issue on Green IT/IS (Sustainable Computing. There are five papers published in this special issue of the AJIS which reflect the diversity of this emerging and important area of research in Information Systems. Environmental sustainability is one of if not the most important challenge facing organisations and society in the 21st century. Information systems and information technology have a major role to play in both reducing its environmental impact and providing the systems and technological innovation to reduce the environmental impact of organisations. Currently there is a lack of rigorous empirical studies which are theory and evidence based to provide a sound basis for understanding IT green best practices and how these can be best adopted in organisations. This special issue of the AJIS contributes this current gap in the knowledge concerning green IS and IT with five empirical research papers which examined five different aspects of green IS and IT.
360-degree videos: a new visualization technique for astrophysical simulations
Russell, Christopher M. P.
2017-11-01
360-degree videos are a new type of movie that renders over all 4π steradian. Video sharing sites such as YouTube now allow this unique content to be shared via virtual reality (VR) goggles, hand-held smartphones/tablets, and computers. Creating 360° videos from astrophysical simulations is not only a new way to view these simulations as you are immersed in them, but is also a way to create engaging content for outreach to the public. We present what we believe is the first 360° video of an astrophysical simulation: a hydrodynamics calculation of the central parsec of the Galactic centre. We also describe how to create such movies, and briefly comment on what new science can be extracted from astrophysical simulations using 360° videos.
24 CFR 3282.360 - PIA acceptance of product certification programs or listings.
2010-04-01
... ENFORCEMENT REGULATIONS Primary Inspection Agencies § 3282.360 PIA acceptance of product certification... 24 Housing and Urban Development 5 2010-04-01 2010-04-01 false PIA acceptance of product certification programs or listings. 3282.360 Section 3282.360 Housing and Urban Development Regulations Relating...
Energy Technology Data Exchange (ETDEWEB)
Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation); Muravieva, T. I.; Esipov, R. S., E-mail: espiov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics,” (Russian Federation)
2016-11-15
Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.
2010-07-01
....10 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Satellite Claims § 360... to be entitled to compulsory license royalty fees for secondary transmissions by satellite carriers...
14 CFR 121.360 - Ground proximity warning-glide slope deviation alerting system.
2010-01-01
... deviation alerting system. 121.360 Section 121.360 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION... Equipment Requirements § 121.360 Ground proximity warning-glide slope deviation alerting system. (a) No... system that meets the performance and environmental standards of TSO-C92 (available from the FAA, 800...
Rayevsky A. V.; Tukalo M. A.
2016-01-01
Aim. To investigate the structural bases for the amino acid selectivity of the Thermus thermophilus leucyl-tRNA synthetase (LeuRSTT) aminoacylation site and to disclose the binding pattern of pre-transfer editing substrates. Methods. Eight amino acids proposed as semi-cognate substrates for aminoacylation and eight aminoacyl-adenylates (formed from AMP and eight amino acids) were prepared in zwitterions form. The protein structure with a co-crystallized substrate in the aminoacylation site [P...
High sensitivity broadband 360GHz passive receiver for TeraSCREEN
Wang, Hui; Oldfield, Matthew; Maestrojuán, Itziar; Platt, Duncan; Brewster, Nick; Viegas, Colin; Alderman, Byron; Ellison, Brian N.
2016-05-01
TeraSCREEN is an EU FP7 Security project aimed at developing a combined active, with frequency channel centered at 360 GHz, and passive, with frequency channels centered at 94, 220 and 360 GHz, imaging system for border controls in airport and commercial ferry ports. The system will include automatic threat detection and classification and has been designed with a strong focus on the ethical, legal and practical aspects of operating in these environments and with the potential threats in mind. Furthermore, both the passive and active systems are based on array receivers with the active system consisting of a 16 element MIMO FMCW radar centered at 360 GHz with a bandwidth of 30 GHz utilizing a custom made direct digital synthesizer. The 16 element passive receiver system at 360 GHz uses commercial Gunn diode oscillators at 90 GHz followed by custom made 90 to 180 GHz frequency doublers supplying the local oscillator for 360 GHz sub-harmonic mixers. This paper describes the development of the passive antenna module, local oscillator chain, frequency mixers and detectors used in the passive receiver array of this system. The complete passive receiver chain is characterized in this paper.
Penilaian Kinerja dengan Menggunakan Konsep 360 Derajat Feedback
Widya, Rita
2004-01-01
The concept of 360 degree appraisal is straight forward enough. In the systems, individuals evalute themselves and receive feedback from other employees and organizational members. The feedback comes from an individuals immediate supervisor and peers, and if the individual is manager from his or her direct subordinates. Employees performance can improved through feedback with evaluate themselves and receives feedback from other employees. With apply the concept of 360 degree feedback for gett...
IT/IS plus E: exploring the need for e-integration
Miele, Renato; Gunasekaran, Angappa; Yusuf, Yahaya Y.
2000-10-01
The change in IT/IS strategy is about the Internet becoming a major part of the corporate environment and driving decisions more and more. Companies of all sizes and industries can fully engage employees, customers and partners to capitalize upon the new Internet economy. They can optimize supply chains, managing strategic relationships, reducing time to market, sharing vital information, and increasing productivity and shareholder value. Remaining competitive in today's rapidly changing global marketplace requires fast action. The problem is now how much, how soon, and what kind of Internet based components are essential for companies to be successful, and how the adoption of E-Integration can become a critical component of company's survival in an increasingly competitive environment. How information, knowledge and innovation processes can drive business success are fundamental notions for the information- based economy, which have been extensively researched and confirmed throughout the IT revolution. The new capabilities to use the Internet to supply large amounts of relevant information from multiple internal and external sources give the possibility to move from isolate Information Systems toward an integrated environment in every business organization. The article addresses how E-Integration must link together data from multiple sources, providing a seamless system, fully interoperable with pre-existing IT environment, totally scalable and upgradeable.
2010-07-01
... Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Cable Claims § 360.1 General... to cable compulsory license royalty fees shall file claims with the Copyright Royalty Board. ...
2010-10-01
... intergovernmental endeavor which combines financial and human resources to fill the unique training needs of local... PREPAREDNESS STATE ASSISTANCE PROGRAMS FOR TRAINING AND EDUCATION IN COMPREHENSIVE EMERGENCY MANAGEMENT § 360.1 Purpose. The Emergency Management Training Program is designed to enhance the States' emergency management...
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550
Site-directed mutation of a laccase from Thermus thermophilus: Effect on the activity profile
Directory of Open Access Journals (Sweden)
Liu Xin
2012-01-01
Full Text Available A site-directed mutant R453T of a laccase from Thermus thermophilus HB27 (Tth-laccase was constructed in order to investigate the effect on laccase catalytic properties. The mutated gene was cloned and overexpressed in Escherichia coli. Nickel-affinity purification was achieved and followed by copper ion incorporation. The mature mutated enzyme was quantitatively equal to the wild type. A photometric assay based on the oxidation of the substrate 2,2-azino-bis-(3- ethylbenzthiazoline-6-sulfonate (ABTS was employed in comparison with the wild-type Tth-laccase on catalytic properties. The R453T mutant exhibited improvement in substrate affinity and specific activity at room temperature, whereas those parameters were not significantly influenced when the temperature increased up to 65°C or higher. The mutant had better catalytic activity than that of the wild type at acidic pH. Investigated by circular dichroism spectroscopy, the mutant Tth-laccase displayed similar profiles at low and high temperatures.
2010-07-01
....20 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Digital Audio Recording Devices and Media Royalty Claims § 360.20 General. This subpart prescribes procedures pursuant to 17 U.S.C...
The Applicability of 360 Degree Feedback Performance Appraisal System: A Brigade Sample
Directory of Open Access Journals (Sweden)
Hakan TURGUT
2012-03-01
Full Text Available On the subject of measuring individual performances, which considered to be one of the fundamental functions of the human resources management process, 360 Degree Feedback Performance Appraisal System (360 DFPAS preferred for taking into account more than one aspect while providing opportunities in order to achieve more objective results. It’s been thought that the applicability of the above mentioned method is not investigated enough in the public sector where most of the employments take place in Turkey. The purpose of this study is to probe into the applicability of the 360 DFPAS on low and mid-level managers in a brigade. Within this framework, differences between the raters (manager, subordinate, peer, client, self-evaluation have been examined and comparisons made between traditional performance appraisal and 360 DFPAS. There are meaningful differences only inner client between two different evaluation methods (Traditional manager evalution-360 DFPAS within evaluation raters. But there aren’t any meaningful differences between traditional performance appraisal and 360 DFPAS as whole method.
21 CFR 111.360 - What are the requirements for sanitation?
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false What are the requirements for sanitation? 111.360... for Manufacturing Operations § 111.360 What are the requirements for sanitation? You must conduct all manufacturing operations in accordance with adequate sanitation principles. ...
Thermus Thermophilus as a Model System for the Study of Ribosomal Antibiotic Resistance
Gregory, Steven T.
2018-03-01
Ribosomes are the intracellular ribonucleoprotein machines responsible for the translation of mRNA sequence into protein sequence. As an essential cell component, the ribosome is the target of numerous antibiotics that bind to critical functional sites to impair protein synthesis. Mutations causing resistance to antibiotics arise in antibiotic binding sites, and an understanding of the basis of resistance will be an essential component of efforts to develop new antibiotics by rational drug design. We have identified a number of antibiotic-resistance mutations in ribosomal genes of the thermophilic bacterium Thermus thermophilus. This species offers two primary advantages for examining the structural basis of antibiotic-resistance, in particular, its potential for genetic manipulation and the suitability of its ribosomes for analysis by X-ray crystallography. Mutations we have identified in this organism are in many instances identical to those found in other bacterial species, including important pathogens, a result of the extreme conservation of ribosome functional sites. Here I summarize the advantages of this organism as a model system to study antibiotic-resistance mechanisms at the molecular level.
Segment scheduling method for reducing 360° video streaming latency
Gudumasu, Srinivas; Asbun, Eduardo; He, Yong; Ye, Yan
2017-09-01
360° video is an emerging new format in the media industry enabled by the growing availability of virtual reality devices. It provides the viewer a new sense of presence and immersion. Compared to conventional rectilinear video (2D or 3D), 360° video poses a new and difficult set of engineering challenges on video processing and delivery. Enabling comfortable and immersive user experience requires very high video quality and very low latency, while the large video file size poses a challenge to delivering 360° video in a quality manner at scale. Conventionally, 360° video represented in equirectangular or other projection formats can be encoded as a single standards-compliant bitstream using existing video codecs such as H.264/AVC or H.265/HEVC. Such method usually needs very high bandwidth to provide an immersive user experience. While at the client side, much of such high bandwidth and the computational power used to decode the video are wasted because the user only watches a small portion (i.e., viewport) of the entire picture. Viewport dependent 360°video processing and delivery approaches spend more bandwidth on the viewport than on non-viewports and are therefore able to reduce the overall transmission bandwidth. This paper proposes a dual buffer segment scheduling algorithm for viewport adaptive streaming methods to reduce latency when switching between high quality viewports in 360° video streaming. The approach decouples the scheduling of viewport segments and non-viewport segments to ensure the viewport segment requested matches the latest user head orientation. A base layer buffer stores all lower quality segments, and a viewport buffer stores high quality viewport segments corresponding to the most recent viewer's head orientation. The scheduling scheme determines viewport requesting time based on the buffer status and the head orientation. This paper also discusses how to deploy the proposed scheduling design for various viewport adaptive video
46 CFR 174.360 - Calculations.
2010-10-01
... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SUBDIVISION AND STABILITY SPECIAL RULES PERTAINING TO SPECIFIC VESSEL TYPES Special Rules Pertaining to Dry Cargo Ships § 174.360 Calculations. Each ship to... for that ship by the International Convention for the Safety of Life at Sea, 1974, as amended, chapter...
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.
Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide
2018-05-05
Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
Engineering the Substrate Specificity of a Thermophilic Penicillin Acylase from Thermus thermophilus
Torres, Leticia L.; Cantero, Ángel; del Valle, Mercedes; Marina, Anabel; López-Gallego, Fernando; Guisán, José M.
2013-01-01
A homologue of the Escherichia coli penicillin acylase is encoded in the genomes of several thermophiles, including in different Thermus thermophilus strains. Although the natural substrate of this enzyme is not known, this acylase shows a marked preference for penicillin K over penicillin G. Three-dimensional models were created in which the catalytic residues and the substrate binding pocket were identified. Through rational redesign, residues were replaced to mimic the aromatic binding site of the E. coli penicillin G acylase. A set of enzyme variants containing between one and four amino acid replacements was generated, with altered catalytic properties in the hydrolyses of penicillins K and G. The introduction of a single phenylalanine residue in position α188, α189, or β24 improved the Km for penicillin G between 9- and 12-fold, and the catalytic efficiency of these variants for penicillin G was improved up to 6.6-fold. Structural models, as well as docking analyses, can predict the positioning of penicillins G and K for catalysis and can demonstrate how binding in a productive pose is compromised when more than one bulky phenylalanine residue is introduced into the active site. PMID:23263966
The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction
Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.
1989-01-01
Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.
3D MODELLING WITH THE SAMSUNG GEAR 360
Directory of Open Access Journals (Sweden)
L. Barazzetti
2017-02-01
Full Text Available The Samsung Gear 360 is a consumer grade spherical camera able to capture photos and videos. The aim of this work is to test the metric accuracy and the level of detail achievable with the Samsung Gear 360 coupled with digital modelling techniques based on photogrammetry/computer vision algorithms. Results demonstrate that the direct use of the projection generated inside the mobile phone or with Gear 360 Action Direction (the desktop software for post-processing have a relatively low metric accuracy. As results were in contrast with the accuracy achieved by using the original fisheye images (front and rear facing images in photogrammetric reconstructions, an alternative solution to generate the equirectangular projections was developed. A calibration aimed at understanding the intrinsic parameters of the two lenses camera, as well as their relative orientation, allowed one to generate new equirectangular projections from which a significant improvement of geometric accuracy has been achieved.
360-MAM-Affect: Sentiment Analysis with the Google Prediction API and EmoSenticNet
Directory of Open Access Journals (Sweden)
Eleanor Mulholland
2015-08-01
Full Text Available Online recommender systems are useful for media asset management where they select the best content from a set of media assets. We have developed an architecture for 360-MAM- Select, a recommender system for educational video content. 360-MAM-Select will utilise sentiment analysis and gamification techniques for the recommendation of media assets. 360-MAM-Select will increase user participation with digital content through improved video recommendations. Here, we discuss the architecture of 360-MAM-Select and the use of the Google Prediction API and EmoSenticNet for 360-MAM-Affect, 360-MAM-Select's sentiment analysis module. Results from testing two models for sentiment analysis, Sentiment Classifier (Google Prediction API and EmoSenticNetClassifer (Google Prediction API + EmoSenticNet are promising. Future work includes the implementation and testing of 360-MAM-Select on video data from YouTube EDU and Head Squeeze.
Structure of TTHA1623, a novel metallo-β-lactamase superfamily protein from Thermus thermophilus HB8
International Nuclear Information System (INIS)
Yamamura, Akihiro; Okada, Akitoshi; Kameda, Yasuhiro; Ohtsuka, Jun; Nakagawa, Noriko; Ebihara, Akio; Nagata, Koji; Tanokura, Masaru
2009-01-01
The crystal structures of TTHA1623 from T. thermophilus HB8 in an iron-bound and a zinc-bound form have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 is a metallo-β-lactamase superfamily protein from the extremely thermophilic bacterium Thermus thermophilus HB8. Homologues of TTHA1623 exist in a wide range of bacteria and archaea and one eukaryote, Giardia lamblia, but their function remains unknown. To analyze the structural properties of TTHA1623, the crystal structures of its iron-bound and zinc-bound forms have been determined to 2.8 and 2.2 Å resolution, respectively. TTHA1623 possesses an αββα-fold similar to that of other metallo-β-lactamase superfamily proteins with glyoxalase II-type metal coordination. However, TTHA1623 exhibits a putative substrate-binding pocket with a unique shape
20 CFR 408.360 - Can you cancel your request to withdraw your application?
2010-04-01
... application? 408.360 Section 408.360 Employees' Benefits SOCIAL SECURITY ADMINISTRATION SPECIAL BENEFITS FOR CERTAIN WORLD WAR II VETERANS Filing Applications Withdrawal of Application § 408.360 Can you cancel your... (c) A cancellation request received after we have approved your withdrawal must be filed no later...
31 CFR 360.60 - Payment to representative of an estate.
2010-07-01
... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Payment to representative of an estate. 360.60 Section 360.60 Money and Finance: Treasury Regulations Relating to Money and Finance... court, other proof of qualification. (2) Except in the case of corporate fiduciaries, the evidence must...
21 CFR 1.360 - What are the record retention requirements?
2010-04-01
... food, including foods preserved by freezing, dehydrating, or being placed in a hermetically sealed... 21 Food and Drugs 1 2010-04-01 2010-04-01 false What are the record retention requirements? 1.360 Section 1.360 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL...
29 CFR 779.360 - Classification of liquefied-petroleum-gas sales.
2010-07-01
... 29 Labor 3 2010-07-01 2010-07-01 false Classification of liquefied-petroleum-gas sales. 779.360... Establishments Liquefied-Petroleum-Gas and Fuel Oil Dealers § 779.360 Classification of liquefied-petroleum-gas... ultimate consumer of liquefied-petroleum-gas, whether delivered in portable cylinders or in bulk to the...
2010-07-01
... than six months prior to the presentation of the bond. (c) Receiver in equity or similar court officer... BONDS, SERIES I Judicial Proceedings § 360.23 Evidence. (a) General. To establish the validity of... months prior to the presentation of the bond, there must also be submitted a certification from the clerk...
31 CFR 360.64 - Payment or reinvestment-voluntary guardian of an incapacitated person.
2010-07-01
... guardian of an incapacitated person. 360.64 Section 360.64 Money and Finance: Treasury Regulations Relating..., Absentees, et al. § 360.64 Payment or reinvestment—voluntary guardian of an incapacitated person. (a..., responsible for the owner's care and support may submit an application for recognition as voluntary guardian...
Pennacchio, Angela; Giordano, Assunta; Esposito, Luciana; Langella, Emma; Rossi, Mosè; Raia, Carlo A
2010-04-01
The stereochemistry of the hydride transfer in reactions catalyzed by NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus HB27 was determined by means of (1)H-NMR spectroscopy. The enzyme transfers the pro-S hydrogen of [4R-(2)H]NADH and exhibits Prelog specificity. Enzyme-substrate docking calculations provided structural details about the enantioselectivity of this thermophilic enzyme. These results give additional insights into the diverse active site architectures of the largely versatile short-chain dehydrogenase superfamily enzymes. A feasible protocol for the synthesis of [4R-(2)H]NADH with high yield was also set up by enzymatic oxidation of 2-propanol-d(8) catalyzed by Bacillus stearothermophilus alcohol dehydrogenase.
Should 360-Degree Feedback Be Used Only for Developmental Purposes?
Bracken, David W.; Dalton, Maxine A.; Jako, Robert A.; McCauley, Cynthia D.; Pollman, Victoria A.
This booklet presents five papers that address the issue of whether 360-degree feedback (in which a manager or executive receives feedback on how bosses, peers, and direct reports see him or her) should be used only for development, or whether 360-degree feedback (also known as multi-rater feedback) should be used for administrative purposes such…
12 CFR Appendix F to Part 360 - Customer File Structure
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Customer File Structure F Appendix F to Part... POLICY RESOLUTION AND RECEIVERSHIP RULES Pt. 360, App. F Appendix F to Part 360—Customer File Structure This is the structure of the data file to provide to the FDIC information related to each customer who...
WebVR meets WebRTC: Towards 360-degree social VR experiences
Gunkel, S.; Prins, M.J.; Stokking, H.M.; Niamut, O.A.
2017-01-01
Virtual Reality (VR) and 360-degree video are reshaping the media landscape, creating a fertile business environment. During 2016 new 360-degree cameras and VR headsets entered the consumer market, distribution platforms are being established and new production studios are emerging. VR is evermore
37 CFR 360.14 - Copies of claims.
2010-07-01
... Section 360.14 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Satellite... royalty fees. ...
Wismeijer, D; van Waas, MAJ; Mulder, J; Vermeeren, JIJF; Kalk, W
In a randomized controlled clinical trial carried out at the Ignatius teaching hospital in Breda, The Netherlands, 110 edentulous patients with severe mandibular bone loss were treated with implants of the ITI(R) Dental Implant System using 3 different treatment strategies: a mandibular overdenture
21 CFR 175.360 - Vinylidene chloride copolymer coatings for nylon film.
2010-04-01
... film. 175.360 Section 175.360 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND... coatings for nylon film. Vinylidene chloride copolymer coatings identified in this section and applied on nylon film may be safely used as food-contact surfaces, in accordance with the following prescribed...
International Nuclear Information System (INIS)
Vassylyeva, Marina N.; Mori, Hiroyuki; Tsukazaki, Tomoya; Yokoyama, Shigeyuki; Tahirov, Tahir H.; Ito, Koreaki; Vassylyev, Dmitry G.
2006-01-01
The SecA ATPase from T. thermophilus was cloned, expressed, purified and crystallized. Complete diffraction data sets were collected for two crystal forms at 2.8 and 3.5 Å resolution, respectively. Determination of the structure is now in progress. The Thermus thermophilus gene encoding the preprotein translocation ATPase SecA was cloned and expressed and the purified protein was crystallized by the hanging-drop vapour-diffusion technique in two different space groups P3 1(2) 21 (a = b = 168.6, c = 149.8 Å) and P6 1(5) 22 (a = b = 130.9, c = 564.6 Å). The crystals, improved by macroseeding, diffracted to beyond 2.8 and 3.5 Å resolution for the trigonal and hexagonal crystal forms, respectively. Structure determination using the multiple isomorphous replacement method is in progress
Florkowska, Lucyna; Bryt-Nitarska, Izabela
2018-04-01
The notion of Integrated Territorial Investments (ITI) appears more and more frequently in contemporary regional development strategies. Formulating the main assumptions of ITI is a response to a growing need for a co-ordinated, multi-dimensional regional development suitable for the characteristics of a given area. Activities are mainly aimed at improving people's quality of life with their significant participation. These activities include implementing the Sustainable development Goals (SDGs). Territorial investments include, among others, projects in areas where land and building use is governed not only by general regulations (Spatial Planning and Land Development Act) but also by separate legal acts. This issue also concerns areas with active mines and post-mining areas undergoing revitalization. For the areas specified above land development and in particular making building investments is subject to the requirements set forth in the Geological and Mining Law and in the general regulations. In practice this means that factors connected with the present and future mining impacts must be taken into consideration in planning the investment process. This article discusses the role of proper assessment of local geological conditions as well as the current and future mining situation in the context of proper planning and performance of the Integrated Territorial Investment programme and also in the context of implementing the SDGs. It also describes the technical and legislative factors which need to be taken into consideration in areas where mining is planned or where it took place in the past.
31 CFR 360.90 - Waiver of regulations.
2010-07-01
... STATES SAVINGS BONDS, SERIES I Miscellaneous Provisions § 360.90 Waiver of regulations. The Commissioner... unnecessary hardship: (a) If such action would not be inconsistent with law or equity; (b) If it does not...
Do 360-degree feedback survey results relate to patient satisfaction measures?
Hageman, Michiel G J S; Ring, David C; Gregory, Paul J; Rubash, Harry E; Harmon, Larry
2015-05-01
There is evidence that feedback from 360-degree surveys-combined with coaching-can improve physician team performance and quality of patient care. The Physicians Universal Leadership-Teamwork Skills Education (PULSE) 360 is one such survey tool that is used to assess work colleagues' and coworkers' perceptions of a physician's leadership, teamwork, and clinical practice style. The Clinician & Group-Consumer Assessment of Healthcare Providers and System (CG-CAHPS), developed by the US Department of Health and Human Services to serve as the benchmark for quality health care, is a survey tool for patients to provide feedback that is based on their recent experiences with staff and clinicians and soon will be tied to Medicare-based compensation of participating physicians. Prior research has indicated that patients and coworkers often agree in their assessment of physicians' behavioral patterns. The goal of the current study was to determine whether 360-degree, also called multisource, feedback provided by coworkers could predict patient satisfaction/experience ratings. A significant relationship between these two forms of feedback could enable physicians to take a more proactive approach to reinforce their strengths and identify any improvement opportunities in their patient interactions by reviewing feedback from team members. An automated 360-degree software process may be a faster, simpler, and less resource-intensive approach than telephoning and interviewing patients for survey responses, and it potentially could facilitate a more rapid credentialing or quality improvement process leading to greater fiscal and professional development gains for physicians. Our primary research question was to determine if PULSE 360 coworkers' ratings correlate with CG-CAHPS patients' ratings of overall satisfaction, recommendation of the physician, surgeon respect, and clarity of the surgeon's explanation. Our secondary research questions were to determine whether CG-CAHPS scores
International Nuclear Information System (INIS)
Joyce, Michael A.; Brownie, Edward R.; Hayakawa, Koto; Fraser, Marie E.
2007-01-01
Attempts to crystallize succinyl-CoA synthetase from the thermophile T. aquaticus were thwarted by proteolysis of the β-subunit and preferential crystallization of a truncated form. Crystals of the full-length enzyme were grown after the purification protocol was modified to include frequent additions of protease inhibitors. Succinyl-CoA synthetase (SCS) is an enzyme of the citric acid cycle and is thus found in most species. To date, there are no structures available of SCS from a thermophilic organism. To investigate how the enzyme adapts to higher temperatures, SCS from Thermus aquaticus was cloned, overexpressed, purified and crystallized. Attempts to crystallize the enzyme were thwarted by proteolysis of the β-subunit and preferential crystallization of the truncated form. Crystals of full-length SCS were grown after the purification protocol was modified to include frequent additions of protease inhibitors. The resulting crystals, which diffract to 2.35 Å resolution, are of the protein in complex with Mn 2+ -GDP
Effects of Argonaute on Gene Expression in Thermus thermophilus.
Directory of Open Access Journals (Sweden)
Daan C Swarts
Full Text Available Eukaryotic Argonaute proteins mediate RNA-guided RNA interference, allowing both regulation of host gene expression and defense against invading mobile genetic elements. Recently, it has become evident that prokaryotic Argonaute homologs mediate DNA-guided DNA interference, and play a role in host defense. Argonaute of the bacterium Thermus thermophilus (TtAgo targets invading plasmid DNA during and after transformation. Using small interfering DNA guides, TtAgo can cleave single and double stranded DNAs. Although TtAgo additionally has been demonstrated to cleave RNA targets complementary to its DNA guide in vitro, RNA targeting by TtAgo has not been demonstrated in vivo.To investigate if TtAgo also has the potential to control RNA levels, we analyzed RNA-seq data derived from cultures of four T. thermophilus strain HB27 variants: wild type, TtAgo knockout (Δago, and either strain transformed with a plasmid. Additionally we determined the effect of TtAgo on expression of plasmid-encoded RNA and plasmid DNA levels.In the absence of exogenous DNA (plasmid, TtAgo presence or absence had no effect on gene expression levels. When plasmid DNA is present, TtAgo reduces plasmid DNA levels 4-fold, and a corresponding reduction of plasmid gene transcript levels was observed. We therefore conclude that TtAgo interferes with plasmid DNA, but not with plasmid-encoded RNA. Interestingly, TtAgo presence stimulates expression of specific endogenous genes, but only when exogenous plasmid DNA was present. Specifically, the presence of TtAgo directly or indirectly stimulates expression of CRISPR loci and associated genes, some of which are involved in CRISPR adaptation. This suggests that TtAgo-mediated interference with plasmid DNA stimulates CRISPR adaptation.
Reflux and Belching After 270 Degree Versus 360 Degree Laparoscopic Posterior Fundoplication
Broeders, Joris A.; Bredenoord, Albert J.; Hazebroek, Eric J.; Broeders, Ivo A.; Gooszen, Hein G.; Smout, André J.
2012-01-01
Objective: To investigate differences in effects of 270 degrees (270 degrees LPF) and 360 degrees laparoscopic posterior fundoplication (360 degrees LPF) on reflux characteristics and belching. Background: Three hundred sixty degrees LPF greatly reduces the ability of the stomach to vent ingested
Czech Academy of Sciences Publication Activity Database
Silver, Barry Richard; Holub, Karel; Mareček, Vladimír
2017-01-01
Roč. 784, JAN 2017 (2017), s. 1-5 ISSN 1572-6657 R&D Projects: GA ČR GA13-04630S Institutional support: RVO:61388955 Keywords : Ion transfer kinetics * ITIES * Tetraethylammonium ion Subject RIV: CG - Electrochemistry OBOR OECD: Electrochemistry (dry cells, batteries, fuel cells, corrosion metals, electrolysis) Impact factor: 3.012, year: 2016
Ling, Guangming; Rijmen, Frank
2011-01-01
The factorial structure of the Time Management (TM) scale of the Student 360: Insight Program (S360) was evaluated based on a national sample. A general procedure with a variety of methods was introduced and implemented, including the computation of descriptive statistics, exploratory factor analysis (EFA), and confirmatory factor analysis (CFA).…
Can we Use Low-Cost 360 Degree Cameras to Create Accurate 3d Models?
Barazzetti, L.; Previtali, M.; Roncoroni, F.
2018-05-01
360 degree cameras capture the whole scene around a photographer in a single shot. Cheap 360 cameras are a new paradigm in photogrammetry. The camera can be pointed to any direction, and the large field of view reduces the number of photographs. This paper aims to show that accurate metric reconstructions can be achieved with affordable sensors (less than 300 euro). The camera used in this work is the Xiaomi Mijia Mi Sphere 360, which has a cost of about 300 USD (January 2018). Experiments demonstrate that millimeter-level accuracy can be obtained during the image orientation and surface reconstruction steps, in which the solution from 360° images was compared to check points measured with a total station and laser scanning point clouds. The paper will summarize some practical rules for image acquisition as well as the importance of ground control points to remove possible deformations of the network during bundle adjustment, especially for long sequences with unfavorable geometry. The generation of orthophotos from images having a 360° field of view (that captures the entire scene around the camera) is discussed. Finally, the paper illustrates some case studies where the use of a 360° camera could be a better choice than a project based on central perspective cameras. Basically, 360° cameras become very useful in the survey of long and narrow spaces, as well as interior areas like small rooms.
44 CFR 360.2 - Description of program.
2010-10-01
... for travel and per diem expenses of students selected by the States for courses reflecting... Section 360.2 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF... costs and participant's travel and per diem. These specifics of date, place, and costs will be required...
12 CFR Appendix G to Part 360 - Deposit-Customer Join File Structure
2010-01-01
..._Code Relationship CodeThe code indicating how the customer is related to the account. Possible values... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Deposit-Customer Join File Structure G Appendix... GENERAL POLICY RESOLUTION AND RECEIVERSHIP RULES Pt. 360, App. G Appendix G to Part 360—Deposit-Customer...
37 CFR 360.5 - Copies of claims.
2010-07-01
... Section 360.5 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Cable Claims... hand delivery or by mail, file an original and one copy of the claim to cable royalty fees. ...
International Nuclear Information System (INIS)
Shimizu, Katsumi; Kunishima, Naoki
2007-01-01
The pyrimidine nucleoside phosphorylase TTHA1771 from T. thermophilus HB8 has been overexpressed, purified and crystallized. The crystals diffract X-rays to 1.8 Å resolution using synchrotron radiation. Pyrimidine nucleoside phosphorylase (PYNP) catalyzes the reversible phosphorolysis of pyrimidines in the nucleotide-synthesis salvage pathway. In order to study the structure–thermostability relationship of this enzyme, PYNP from the extreme thermophile Thermus thermophilus HB8 (TTHA1771) has been cloned, overexpressed and purified. The TTHA1771 protein was crystallized at 291 K using the oil-microbatch method with PEG 4000 as a precipitant. A native data set was collected to 1.8 Å resolution using synchrotron radiation. The crystal belongs to the monoclinic space group P2 1 , with unit-cell parameters a = 58.83, b = 76.23, c = 103.86 Å, β = 91.3°
19 CFR 360.104 - Steel import monitoring.
2010-04-01
... ANALYSIS SYSTEM § 360.104 Steel import monitoring. (a) Throughout the duration of the licensing requirement... include import quantity (metric tons), import Customs value (U.S. $), and average unit value ($/metric ton... and will also present a range of historical data for comparison purposes. Provision of this aggregate...
Managing "Academic Value": The 360-Degree Perspective
Wilson, Margaret R.; Corr, Philip J.
2018-01-01
The "raison d'etre" of all universities is to create and deliver "academic value", which we define as the sum total of the contributions from the 360-degree "angles" of the academic community, including all categories of staff, as well as external stakeholders (e.g. regulatory, commercial, professional and community…
37 CFR 360.2 - Time of filing.
2010-07-01
... ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Cable Claims § 360.2... compulsory license royalty fees for secondary transmissions of one or more of its works during the preceding calendar year shall file a claim to such fees with the Copyright Royalty Board. No royalty fees shall be...
International Nuclear Information System (INIS)
Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Baba, Seiki; Chen, Lirong; Liu, Zhi-Jie; Wang, Bi-Cheng; Nishida, Masami; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki
2006-01-01
The molybdenum-cofactor biosynthesis protein C from T. thermophilus has been crystallized in two different space groups, P2 1 and R32; the crystals diffracted to 1.9 and 1.75 Å resolution, respectively. The Gram-negative aerobic eubacterium Thermus thermophilus is an extremely important thermophilic microorganism that was originally isolated from a thermal vent environment in Japan. The molybdenum cofactor in this organism is considered to be an essential component required by enzymes that catalyze diverse key reactions in the global metabolism of carbon, nitrogen and sulfur. The molybdenum-cofactor biosynthesis protein C derived from T. thermophilus was crystallized in two different space groups. Crystals obtained using the first crystallization condition belong to the monoclinic space group P2 1 , with unit-cell parameters a = 64.81, b = 109.84, c = 115.19 Å, β = 104.9°; the crystal diffracted to a resolution of 1.9 Å. The other crystal form belonged to space group R32, with unit-cell parameters a = b = 106.57, c = 59.25 Å, and diffracted to 1.75 Å resolution. Preliminary calculations reveal that the asymmetric unit contains 12 monomers and one monomer for the crystals belonging to space group P2 1 and R32, respectively
International Nuclear Information System (INIS)
Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman; Ohmori, Miwa; Agari, Kazuko; Kitamura, Yoshiaki; Baba, Seiki; Ebihara, Akio; Shinkai, Akeo; Kuramitsu, Seiki; Shiro, Yoshitsugu; Sekar, Kanagaraj; Yokoyama, Shigeyuki
2007-01-01
The molybdopterin synthase from T. thermophilus HB8 was cloned, expressed, purified and crystallized. The crystals belong to space group P2 1 and diffracted to a resolution of 1.64 Å. Thermus thermophilus is a Gram-negative aerobic thermophilic eubacterium which can grow at temperatures ranging from 323 to 355 K. In addition to their importance in thermostability or adaptation strategies for survival at high temperatures, the thermostable enzymes in thermophilic organisms contribute to a wide range of biotechnological applications. The molybdenum cofactor in all three kingdoms consists of a tricyclic pyranopterin termed molybdopterin that bears the cis-dithiolene group responsible for molybdenum ligation. The crystals of molybdopterin synthase from T. thermophilus HB8 belong to the primitive monoclinic space group P2 1 , with unit-cell parameters a = 33.94, b = 103.32, c = 59.59 Å, β = 101.3°. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetric unit
International Nuclear Information System (INIS)
Politi, Jane; De Stefano, Luca; Spadavecchia, Jolanda; Casale, Sandra; Fiorentino, Gabriella; Antonucci, Immacolata
2015-01-01
The thermophilic bacterium Thermus thermophilus HB27 encodes chromosomal arsenate reductase (TtArsC), the enzyme responsible for resistance to the harmful effects of arsenic. We report on adsorption of TtArsC onto gold nanoparticles for naked-eye monitoring of biomolecular interaction between the enzyme and arsenic species. Synthesis of hybrid biological–metallic nanoparticles has been characterized by transmission electron microscopy (TEM), ultraviolet-visible (UV–vis), dynamic light scattering (DLS) and phase modulated infrared reflection absorption (PM-IRRAS) spectroscopies. Molecular interactions have been monitored by UV–vis and Fourier transform-surface plasmon resonance (FT-SPR). Due to the nanoparticles’ aggregation on exposure to metal salts, pentavalent and trivalent arsenic solutions can be clearly distinguished by naked-eye assay, even at 85 μM concentration. Moreover, the assay shows partial selectivity against other heavy metals. (paper)
2 CFR 180.360 - What happens if I fail to disclose information required under § 180.355?
2010-01-01
... Doing Business With Other Persons Disclosing Information-Lower Tier Participants § 180.360 What happens... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false What happens if I fail to disclose information required under § 180.355? 180.360 Section 180.360 Grants and Agreements OFFICE OF MANAGEMENT AND...
Harrington, Cuan M; Kavanagh, Dara O; Wright Ballester, Gemma; Wright Ballester, Athena; Dicker, Patrick; Traynor, Oscar; Hill, Arnold; Tierney, Sean
2017-11-06
Although two-dimensional (2D) and three-dimensional videos have traditionally provided foundations for reviewing operative procedures, the recent 360º format may provide new dimensions to surgical education. This study sought to describe the production of a high quality 360º video for an index-operation (augmented with educational material), while evaluating for variances in attentiveness, information retention, and appraisal compared to 2D. A 6-camera synchronised array (GoPro Omni, [California, United States]) was suspended inverted and recorded an elective laparoscopic cholecystectomy in 2016. A single-blinded randomised cross-over study was performed to evaluate this video in 360º vs 2D formats. Group A experienced the 360º video using Samsung (Suwon, South-Korea) GearVR virtual-reality headsets, followed by the 2D experience on a 75-inch television. Group B were reversed. Each video was probed at designated time points for engagement levels and task-unrelated images or thoughts. Alternating question banks were administered following each video experience. Feedback was obtained via a short survey at study completion. The New Academic and Education Building (NAEB) in Dublin, Royal College of Surgeons in Ireland, July 2017. Preclinical undergraduate students from a medical university in Ireland. Forty students participated with a mean age of 23.2 ± 4.5 years and equal sex involvement. The 360º video demonstrated significantly higher engagement (p video as their learning platform of choice. Mean appraisal levels for the 360º platform were positive with mean responses of >8/10 for the platform for learning, immersion, and entertainment. This study describes the successful development and evaluation of a 360º operative video. This new video format demonstrated significant engagement and attentiveness benefits compared to traditional 2D formats. This requires further evaluation in the field of technology enhanced learning. Copyright © 2017 Association of
33 CFR 96.360 - Interim Safety Management Certificate: what is it and when can it be used?
2010-07-01
...? § 96.360 Interim Safety Management Certificate: what is it and when can it be used? (a) A responsible... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Interim Safety Management Certificate: what is it and when can it be used? 96.360 Section 96.360 Navigation and Navigable Waters COAST...
Russell, Christopher
2018-01-01
360-degree videos are a new type of movie that renders over all 4π steradian. Video sharing sites such as YouTube now allow this unique content to be shared via virtual reality (VR) goggles, hand-held smartphones/tablets, and computers. Creating 360-degree videos from astrophysical simulations not only provide a new way to view these simulations due to their immersive nature, but also yield engaging content for outreach to the public. We present our 360-degree video of an astrophysical simulation of the Galactic center: a hydrodynamics calculation of the colliding and accreting winds of the 30 Wolf-Rayet stars orbiting within the central parsec. Viewing the movie, which renders column density, from the location of the supermassive black hole gives a unique and immersive perspective of the shocked wind material inspiraling and tidally stretching as it plummets toward the black hole. We also describe how to create such movies, discuss what type of content does and does not look appealing in 360-degree format, and briefly comment on what new science can be extracted from astrophysical simulations using 360-degree videos.
HAL/S-360 compiler system specification
Johnson, A. E.; Newbold, P. N.; Schulenberg, C. W.; Avakian, A. E.; Varga, S.; Helmers, P. H.; Helmers, C. T., Jr.; Hotz, R. L.
1974-01-01
A three phase language compiler is described which produces IBM 360/370 compatible object modules and a set of simulation tables to aid in run time verification. A link edit step augments the standard OS linkage editor. A comprehensive run time system and library provide the HAL/S operating environment, error handling, a pseudo real time executive, and an extensive set of mathematical, conversion, I/O, and diagnostic routines. The specifications of the information flow and content for this system are also considered.
Research and Application of Autodesk Fusion360 in Industrial Design
Song, P. P.; Qi, Y. M.; Cai, D. C.
2018-05-01
In 2016, Fusion 360, a productintroduced byAutodesk and integrating industrial design, structural design, mechanical simulation, and CAM, turns out a design platform supportingcollaboration and sharing both cross-platform and via the cloud. In previous products, design and manufacturing use to be isolated. In the course of design, research and development, the communication between designers and engineers used to go on through different software products, tool commands, and even industry terms. Moreover, difficulty also lies with the communication between design thoughts and machining strategies. Naturally, a difficult product design and R & D process would trigger a noticeable gap between the design model and the actual product. A complete product development process tends to cover several major areas, such as industrial design, mechanical design, rendering and animation, computer aided emulation (CAE), and computer aided manufacturing (CAM). Fusion 360, a perfect design solving the technical problems of cross-platform data exchange, realizes the effective control of cross-regional collaboration and presents an overview of collaboration and breaks the barriers between art and manufacturing, andblocks between design and processing. The “Eco-development of Fusion360 Industrial Chain” is both a significant means to and an inevitable trend forthe manufacturers and industrial designers to carry out innovation in China.
A novel 360-degree shape measurement using a simple setup with two mirrors and a laser MEMS scanner
Jin, Rui; Zhou, Xiang; Yang, Tao; Li, Dong; Wang, Chao
2017-09-01
There is no denying that 360-degree shape measurement technology plays an important role in the field of threedimensional optical metrology. Traditional optical 360-degree shape measurement methods are mainly two kinds: the first kind, by placing multiple scanners to achieve 360-degree measurements; the second kind, through the high-precision rotating device to get 360-degree shape model. The former increases the number of scanners and costly, while the latter using rotating devices lead to time consuming. This paper presents a low cost and fast optical 360-degree shape measurement method, which possesses the advantages of full static, fast and low cost. The measuring system consists of two mirrors with a certain angle, a laser projection system, a stereoscopic calibration block, and two cameras. And most of all, laser MEMS scanner can achieve precise movement of laser stripes without any movement mechanism, improving the measurement accuracy and efficiency. What's more, a novel stereo calibration technology presented in this paper can achieve point clouds data registration, and then get the 360-degree model of objects. A stereoscopic calibration block with special coded patterns on six sides is used in this novel stereo calibration method. Through this novel stereo calibration technology we can quickly get the 360-degree models of objects.
360-degree video and X-ray modeling of the Galactic center's inner parsec
Russell, Christopher Michael Post; Wang, Daniel; Cuadra, Jorge
2017-08-01
360-degree videos, which render an image over all 4pi steradian, provide a unique and immersive way to visualize astrophysical simulations. Video sharing sites such as YouTube allow these videos to be shared with the masses; they can be viewed in their 360° nature on computer screens, with smartphones, or, best of all, in virtual-reality (VR) goggles. We present the first such 360° video of an astrophysical simulation: a hydrodynamics calculation of the Wolf-Rayet stars and their ejected winds in the inner parsec of the Galactic center. Viewed from the perspective of the super-massive black hole (SMBH), the most striking aspect of the video, which renders column density, is the inspiraling and stretching of clumps of WR-wind material as they makes their way towards the SMBH. We will brielfy describe how to make 360° videos and how to publish them online in their desired 360° format. Additionally we discuss computing the thermal X-ray emission from a suite of Galactic-center hydrodynamic simulations that have various SMBH feedback mechanisms, which are compared to Chandra X-ray Visionary Program observations of the region. Over a 2-5” ring centered on Sgr A*, the spectral shape is well matched, indicating that the WR winds are the dominant source of the thermal X-ray emission. Furthermore, the X-ray flux depends on the SMBH feedback due to the feedback's ability to clear out material from the central parsec. A moderate outburst is necessary to explain the current thermal X-ray flux, even though the outburst ended ˜100 yr ago.
FitKids360: Design, Conduct, and Outcomes of a Stage 2 Pediatric Obesity Program
Directory of Open Access Journals (Sweden)
Jared M. Tucker
2014-01-01
Full Text Available This paper describes FitKids360, a stage 2 pediatric weight management program. FitKids360 is a physician-referred, multicomponent, low-cost healthy lifestyle program for overweight and obese youth 5–16 years of age and their families. FitKids360 provides an evidence-based approach to the treatment of pediatric overweight by targeting patients’ physical activity, screen time, and dietary behaviors using a family-centered approach. The intervention begins with a two-hour orientation and assessment period followed by six weekly sessions. Assessments include lifestyle behaviors, anthropometry, and the Family Nutrition and Physical Activity (FNPA survey, which screens for obesogenic risk factors in the home environment. Outcomes are presented from 258 patients who completed one of 33 FitKids360 classes. After completing FitKids360, patients increased moderate to vigorous physical activity by 14 minutes (P=0.019, reduced screen time by 44 minutes (P<0.001, and improved key dietary behaviors. Overall, FNPA scores increased by 9% (P<0.001 and 69% of patients with “high risk” FNPA scores at baseline dropped below the “high risk” range by followup. Patients also lowered BMIs (P=0.011 and age- and sex-adjusted BMI z-scores (P<0.001 after completing the 7-week program. We hope this report will be useful to medical and public health professionals seeking to develop stage 2 pediatric obesity programs.
Our Journey to Summon and 360: The KAUST experience
Ramli, Rindra M.
2017-01-01
to embark on the project to evaluate, assess and recommend for a new and robust discovery layer. On top of that, the presenters would elaborate the project timeline (which also include the implementation phase for Summon and 360 Core), the challenges faced
360-degrees profilometry using strip-light projection coupled to Fourier phase-demodulation.
Servin, Manuel; Padilla, Moises; Garnica, Guillermo
2016-01-11
360 degrees (360°) digitalization of three dimensional (3D) solids using a projected light-strip is a well-established technique in academic and commercial profilometers. These profilometers project a light-strip over the digitizing solid while the solid is rotated a full revolution or 360-degrees. Then, a computer program typically extracts the centroid of this light-strip, and by triangulation one obtains the shape of the solid. Here instead of using intensity-based light-strip centroid estimation, we propose to use Fourier phase-demodulation for 360° solid digitalization. The advantage of Fourier demodulation over strip-centroid estimation is that the accuracy of phase-demodulation linearly-increases with the fringe density, while in strip-light the centroid-estimation errors are independent. Here we proposed first to construct a carrier-frequency fringe-pattern by closely adding the individual light-strip images recorded while the solid is being rotated. Next, this high-density fringe-pattern is phase-demodulated using the standard Fourier technique. To test the feasibility of this Fourier demodulation approach, we have digitized two solids with increasing topographic complexity: a Rubik's cube and a plastic model of a human-skull. According to our results, phase demodulation based on the Fourier technique is less noisy than triangulation based on centroid light-strip estimation. Moreover, Fourier demodulation also provides the amplitude of the analytic signal which is a valuable information for the visualization of surface details.
Politi, Jane; Spadavecchia, Jolanda; Fiorentino, Gabriella; Antonucci, Immacolata; De Stefano, Luca
2016-10-01
Water sources pollution by arsenic ions is a serious environmental problem all around the world. Arsenate reductase enzyme (TtArsC) from Thermus thermophilus extremophile bacterium, naturally binds arsenic ions, As(V) and As (III), in aqueous solutions. In this research, TtArsC enzyme adsorption onto hybrid polyethylene glycol-stabilized gold nanoparticles (AuNPs) was studied at different pH values as an innovative nanobiosystem for metal concentration monitoring. Characterizations were performed by UV/Vis and circular dichroism spectroscopies, TEM images and in terms of surface charge changes. The molecular interaction between arsenic ions and the TtArsC-AuNPs nanobiosystem was also monitored at all pH values considered by UV/Vis spectroscopy. Tests performed revealed high sensitivities and limits of detection equal to 10 ± 3 M -12 and 7.7 ± 0.3 M -12 for As(III) and As(V), respectively. © 2016 The Author(s).
HAL/S-360 compiler test activity report
Helmers, C. T.
1974-01-01
The levels of testing employed in verifying the HAL/S-360 compiler were as follows: (1) typical applications program case testing; (2) functional testing of the compiler system and its generated code; and (3) machine oriented testing of compiler implementation on operational computers. Details of the initial test plan and subsequent adaptation are reported, along with complete test results for each phase which examined the production of object codes for every possible source statement.
Directory of Open Access Journals (Sweden)
Barbara Nicolaus
2016-12-01
Full Text Available Extremophiles are organisms able to thrive in extreme environmental conditions and some of them show the ability to survive high doses of heavy metals thanks to defensive mechanisms provided by primary and secondary metabolic products, i.e., extremolytes, lipids, and extremozymes. This is why there is a growing scientific and industrial interest in the use of thermophilic bacteria in a host of tasks, from the environmental detoxification of heavy metal to industrial activities, such as bio-machining and bio-metallurgy. In this work Thermus thermophilus was challenged against increasing Pb2+ concentrations spanning from 0 to 300 ppm in order to ascertain the sensitiveness of this bacteria to the Pb environmental pollution and to give an insight on its heavy metal resistance mechanisms. Analysis of growth parameters, enzyme activities, protein profiles, and lipid membrane modifications were carried out. In addition, genotyping analysis of bacteria grown in the presence of Pb2+, using random amplified polymorphic DNA-PCR and DNA melting evaluation, were also performed. A better knowledge of the response of thermophilic bacteria to the different pollutants, as heavy metals, is necessary for optimizing their use in remediation or decontamination processes.
Crystal structure of a thermostable Old Yellow Enzyme from Thermus scotoductus SA-01
International Nuclear Information System (INIS)
Opperman, Diederik J.; Sewell, Bryan T.; Litthauer, Derek; Isupov, Mikhail N.; Littlechild, Jennifer A.; Heerden, Esta van
2010-01-01
Recent characterization of the chromate reductase (CrS) from the thermophile Thermus scotoductus SA-01 revealed this enzyme to be related to the Old Yellow Enzyme (OYE) family. Here, we report the structure of a thermostable OYE homolog in its holoform at 2.2 A as well as its complex with p-hydroxybenzaldehyde (pHBA). The enzyme crystallized as octamers with the monomers showing a classical TIM barrel fold which upon dimerization yields the biologically active form of the protein. A sulfate ion is bound above the si-side of the non-covalently bound FMN cofactor in the oxidized solved structure but is displaced upon pHBA binding. The active-site architecture is highly conserved as with other members of this enzyme family. The pHBA in the CrS complex is positioned by hydrogen bonding to the two conserved catalytic-site histidines. The most prominent structural difference between CrS and other OYE homologs is the size of the 'capping domain'. Thermostabilization of the enzyme is achieved in part through increased proline content within loops and turns as well as increased intersubunit interactions through hydrogen bonding and complex salt bridge networks. CrS is able to reduce the C=C bonds of α,β-unsaturated carbonyl compounds with a preference towards cyclic substrates however no activity was observed towards β-substituted substrates. Mutational studies have confirmed the role of Tyr177 as the proposed proton donor although reduction could still occur at a reduced rate when this residue was mutated to phenylalanine.
Doctors' perceptions of why 360-degree feedback does (not) work: a qualitative study.
Overeem, Karlijn; Wollersheim, Hub; Driessen, Erik; Lombarts, Kiki; van de Ven, Geertje; Grol, Richard; Arah, Onyebuchi
2009-09-01
Delivery of 360-degree feedback is widely used in revalidation programmes. However, little has been done to systematically identify the variables that influence whether or not performance improvement is actually achieved after such assessments. This study aims to explore which factors represent incentives, or disincentives, for consultants to implement suggestions for improvement from 360-degree feedback. In 2007, 109 consultants in the Netherlands were assessed using 360-degree feedback and portfolio learning. We carried out a qualitative study using semi-structured interviews with 23 of these consultants, purposively sampled based on gender, hospital, work experience, specialty and views expressed in a previous questionnaire. A grounded theory approach was used to analyse the transcribed tape-recordings. We identified four groups of factors that can influence consultants' practice improvement after 360-degree feedback: (i) contextual factors related to workload, lack of openness and social support, lack of commitment from hospital management, free-market principles and public distrust; (ii) factors related to feedback; (iii) characteristics of the assessment system, such as facilitators and a portfolio to encourage reflection, concrete improvement goals and annual follow-up interviews, and (iv) individual factors, such as self-efficacy and motivation. It appears that 360-degree feedback can be a positive force for practice improvement provided certain conditions are met, such as that skilled facilitators are available to encourage reflection, concrete goals are set and follow-up interviews are carried out. This study underscores the fact that hospitals and consultant groups should be aware of the existing lack of openness and absence of constructive feedback. Consultants indicated that sharing personal reflections with colleagues could improve the quality of collegial relationships and heighten the chance of real performance improvement.
40 CFR 98.360 - Definition of the source category.
2010-07-01
... this rule. (b) A manure management system (MMS) is a system that stabilizes and/or stores livestock... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Manure Management § 98.360 Definition of the source category. (a) This source category consists of livestock facilities with manure management systems that emit 25...
Directory of Open Access Journals (Sweden)
Minwoo Lee
Full Text Available One of the primary transcriptional regulators of fatty acid homeostasis in many prokaryotes is the protein FadR. To better understand its biological function in the extreme thermophile Thermus thermophilus HB8, we sought to first determine its preferred DNA-binding sequences in vitro using the combinatorial selection method Restriction Endonuclease Protection, Selection, and Amplification (REPSA and then use this information to bioinformatically identify potential regulated genes. REPSA determined a consensus FadR-binding sequence 5´-TTRNACYNRGTNYAA-3´, which was further characterized using quantitative electrophoretic mobility shift assays. With this information, a search of the T. thermophilus HB8 genome found multiple operons potentially regulated by FadR. Several of these were identified as encoding proteins involved in fatty acid biosynthesis and degradation; however, others were novel and not previously identified as targets of FadR. The role of FadR in regulating these genes was validated by physical and functional methods, as well as comparative genomic approaches to further characterize regulons in related organisms. Taken together, our study demonstrates that a systematic approach involving REPSA, biophysical characterization of protein-DNA binding, and bioinformatics can be used to postulate biological roles for potential transcriptional regulators.
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Evaluation of the effectiveness of the 360-credit National ...
African Journals Online (AJOL)
We investigated the effectiveness of the 360-credit National Professional Diploma (NPDE) as a programme that is aimed at the upgrading of currently serving unqualified and under-qualified educators, with a view to improving the quality of teaching and learning in schools and Further Education and Training colleges.
Narrow-band 1, 2, 3, 4, 8, 16 and 24 cycles/360o angular frequency filters
Directory of Open Access Journals (Sweden)
Simas M.L.B.
2002-01-01
Full Text Available We measured human frequency response functions for seven angular frequency filters whose test frequencies were centered at 1, 2, 3, 4, 8, 16 or 24 cycles/360º using a supra-threshold summation method. The seven functions of 17 experimental conditions each were measured nine times for five observers. For the arbitrarily selected filter phases, the maximum summation effect occurred at test frequency for filters at 1, 2, 3, 4 and 8 cycles/360º. For both 16 and 24 cycles/360º test frequencies, maximum summation occurred at the lower harmonics. These results allow us to conclude that there are narrow-band angular frequency filters operating somehow in the human visual system either through summation or inhibition of specific frequency ranges. Furthermore, as a general result, it appears that addition of higher angular frequencies to lower ones disturbs low angular frequency perception (i.e., 1, 2, 3 and 4 cycles/360º, whereas addition of lower harmonics to higher ones seems to improve detection of high angular frequency harmonics (i.e., 8, 16 and 24 cycles/360º. Finally, we discuss the possible involvement of coupled radial and angular frequency filters in face perception using an example where narrow-band low angular frequency filters could have a major role.
Tornow, Walter W.; London, Manuel
Ways in which organizations can enhance their use of "360-degree feedback" are presented. The book begins with a review of the process itself, emphasizing that 360-degree feedback should be a core element of self-development. The book is divided into three parts. Part 1 describes how to maximize the value of the process for individual…
Magnetic field control of 90°, 180°, and 360° domain wall resistance
Majidi, Roya
2012-10-01
In the present work, we have compared the resistance of the 90°, 180°, and 360° domain walls in the presence of external magnetic field. The calculations are based on the Boltzmann transport equation within the relaxation time approximation. One-dimensional Néel-type domain walls between two domains whose magnetization differs by angle of 90°, 180°, and 360° are considered. The results indicate that the resistance of the 360° DW is more considerable than that of the 90° and 180° DWs. It is also found that the domain wall resistance can be controlled by applying transverse magnetic field. Increasing the strength of the external magnetic field enhances the domain wall resistance. In providing spintronic devices based on magnetic nanomaterials, considering and controlling the effect of domain wall on resistivity are essential.
37 CFR 360.12 - Form and content of claims.
2010-07-01
... SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Satellite Claims § 360.12 Form and content of claims. (a) Forms. (1) Each claim to compulsory license royalty fees... owner entitled to claim the royalty fees. (ii) A general statement of the nature of the copyright owner...
37 CFR 360.3 - Form and content of claims.
2010-07-01
... SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Cable Claims § 360.3 Form and content of claims. (a) Forms. (1) Each claim to cable compulsory license royalty fees... copyright owner entitled to claim the royalty fees. (ii) A general statement of the nature of the copyright...
2010-07-01
... calculations of royalty or fees under this subpart? 206.360 Section 206.360 Mineral Resources MINERALS... Resources § 206.360 What records must I keep to support my calculations of royalty or fees under this subpart? If you determine royalties or direct use fees for your geothermal resource under this subpart...
Intra prediction using face continuity in 360-degree video coding
Hanhart, Philippe; He, Yuwen; Ye, Yan
2017-09-01
This paper presents a new reference sample derivation method for intra prediction in 360-degree video coding. Unlike the conventional reference sample derivation method for 2D video coding, which uses the samples located directly above and on the left of the current block, the proposed method considers the spherical nature of 360-degree video when deriving reference samples located outside the current face to which the block belongs, and derives reference samples that are geometric neighbors on the sphere. The proposed reference sample derivation method was implemented in the Joint Exploration Model 3.0 (JEM-3.0) for the cubemap projection format. Simulation results for the all intra configuration show that, when compared with the conventional reference sample derivation method, the proposed method gives, on average, luma BD-rate reduction of 0.3% in terms of the weighted spherical PSNR (WS-PSNR) and spherical PSNR (SPSNR) metrics.
Developing Your 360-Degree Leadership Potential.
Verma, Nupur; Mohammed, Tan-Lucien; Bhargava, Puneet
2017-09-01
Radiologists serve in leadership roles throughout their career, making leadership education an integral part of their development. A maxim of leadership style is summarized by 360-Degree Leadership, which highlights the ability of a leader to lead from any position within the organization while relying on core characteristics to build confidence from within their team. The qualities of leadership discussed can be learned and applied by radiologists at any level. These traits can form a foundation for the leader when faced with unfavorable events, which themselves allow the leader an opportunity to build trust. Copyright © 2017 American College of Radiology. Published by Elsevier Inc. All rights reserved.
360-degree suture trabeculotomy ab interno to treat open-angle glaucoma: 2-year outcomes
Sato, Tomoki; Kawaji, Takahiro; Hirata, Akira; Mizoguchi, Takanori
2018-01-01
Purpose The purpose of this study was to evaluate the efficacy of 360-degree suture trabeculotomy (360S-LOT) ab interno for treating open-angle glaucoma (OAG). Risk factors of surgical failure were examined. Patients and methods 360S-LOT ab interno alone was performed for patients with uncontrolled OAG, and combined 360S-LOT ab interno/phacoemulsification was performed for patients with controlled OAG with a visually significant cataract between March 2014 and September 2015 at a single center. The patients were prospectively followed for 2 years. The main outcome measures included 2-year intraocular pressure (IOP), number of anti-glaucoma medications used, postoperative complications, and predictive factors of surgical failure. Kaplan–Meier analysis was performed, with surgical success (with or without medication use) defined as postoperative IOP ≤15 mmHg and IOP reduction ≥20% (criterion A) or IOP ≤12 mmHg and IOP reduction ≥30% (criterion B). Predictive factors were evaluated using Cox proportional hazard ratios. Results A total of 64 eyes of 64 patients were included, and 50 (78%) eyes of 64 eyes underwent a phacoemulsification combination procedure. Surgery significantly reduced IOP from 18.4 ± 2.9 mmHg before surgery to 13.4 ± 3.0 mmHg after surgery (P interno procedure is a favorable option for treating eyes with mild or moderate OAG. PMID:29844656
360° tunable microwave phase shifter based on silicon-on-insulator dual-microring resonator
DEFF Research Database (Denmark)
Pu, Minhao; Xue, Weiqi; Liu, Liu
2010-01-01
We demonstrate tunable microwave phase shifters based on electrically tunable silicon-on-insulator dual-microring resonators. A quasi-linear phase shift of 360° with ~2dB radio frequency power variation at a microwave frequency of 40GHz is obtained......We demonstrate tunable microwave phase shifters based on electrically tunable silicon-on-insulator dual-microring resonators. A quasi-linear phase shift of 360° with ~2dB radio frequency power variation at a microwave frequency of 40GHz is obtained...
ALGORITMOS PARA CONSTRUÇÃO DE PANORAMA DE IMAGENS 360 E VISUALIZAÇÃO
Directory of Open Access Journals (Sweden)
Alan Kazuo Hiraga
2013-07-01
Full Text Available This paper presents a methodology for the construction of mosaic images to form 360 panorama and an application for viewing. We used the SIFT and RANSAC algorithms commonly found in the literature for matching images. The algorithms for projection, adjustment of images and Blend for smoothing the joints were implemented in this paper using the OpenCV Computer Vision library. The methodology of this research techniques were applied to reduce the distortions caused in the joints of successive images, as well as increase the quality of the final panorama and get better performance. The viewer application developed in C# shows the 360 image resulting from images stitching into a cylinder with the point of view inside. The results of the experiments performed using the proposed technique has proved satisfactory, the mosaic formed by the joining of multiple pictures suffers little distortion, however, these distortions do not interfere with the final formation of the panorama 360, which provides good visual quality.
2010-07-01
... other hanging materials that are made of non-combustible or flame-resistant fabric; (f) Use only... resistant; (g) Cooperate with GSA to develop and maintain fire prevention programs that provide the maximum... accident and fire prevention responsibilities of occupant agencies? 102-74.360 Section 102-74.360 Public...
7 CFR 360.400 - Preemption of State and local laws.
2010-01-01
... local laws. (a) Under section 436 of the Plant Protection Act (7 U.S.C. 7756), a State or political... of the Plant Protection Act, the regulations in this part preempt all State and local laws and... 360.400 Agriculture Regulations of the Department of Agriculture (Continued) ANIMAL AND PLANT HEALTH...
Antecedents and Consequences of Reactions to Developmental 360[degrees] Feedback
Atwater, Leanne E.; Brett, Joan F.
2005-01-01
This study investigated the factors that influence leaders' reactions to 360[degrees] feedback and the relationship of feedback reactions to subsequent development activities and changes in leader behavior. For leaders with low ratings, those who agreed with others about their ratings were less motivated than those who received low ratings and…
Spherical rotation orientation indication for HEVC and JEM coding of 360 degree video
Boyce, Jill; Xu, Qian
2017-09-01
Omnidirectional (or "360 degree") video, representing a panoramic view of a spherical 360° ×180° scene, can be encoded using conventional video compression standards, once it has been projection mapped to a 2D rectangular format. Equirectangular projection format is currently used for mapping 360 degree video to a rectangular representation for coding using HEVC/JEM. However, video in the top and bottom regions of the image, corresponding to the "north pole" and "south pole" of the spherical representation, is significantly warped. We propose to perform spherical rotation of the input video prior to HEVC/JEM encoding in order to improve the coding efficiency, and to signal parameters in a supplemental enhancement information (SEI) message that describe the inverse rotation process recommended to be applied following HEVC/JEM decoding, prior to display. Experiment results show that up to 17.8% bitrate gain (using the WS-PSNR end-to-end metric) can be achieved for the Chairlift sequence using HM16.15 and 11.9% gain using JEM6.0, and an average gain of 2.9% for HM16.15 and 2.2% for JEM6.0.
2010-10-01
... design documents prepared by the Self-Governance Tribe? 137.360 Section 137.360 Public Health PUBLIC... HUMAN SERVICES TRIBAL SELF-GOVERNANCE Construction Roles of the Secretary in Establishing and... documents prepared by the Self-Governance Tribe? The Secretary shall have at least one opportunity to...
Jäsen 360° -datan vaikutukset Ylöjärven seurakunnan työn kehittämisprosessissa
Korppoo-Seppänen, Riikka
2017-01-01
Tämän opinnäytetyön tarkoituksena oli selvittää, onko Ylöjärven seurakunnan työn kehittämisprosessissa hyödynnetty Jäsen 360° -dataa ja miten se on vaikuttanut työn tekemiseen ja koko seurakunnan toiminnan suunnitteluun ja ohjaukseen. Tarkoituksena oli myös selvittää minkälaisissa tilanteissa ja miten kehittämisprosessi on muuttanut henkilöstön toimintatapoja sekä onko Jäsen 360° -datan avulla muutettu toiminnan suuntaamista. Tutkimuksen avulla selvitettiin Jäsen 360° -datan käytön rajoitteit...
Autodesk Roadway Design for Infraworks 360 essentials
Chappell, Eric
2015-01-01
Quickly master InfraWorks Roadway Design with hands-on tutorials Autodesk Roadway Design for InfraWorks 360 Essentials, 2nd Edition allows you to begin designing immediately as you learn the ins and outs of the roadway-specific InfraWorks module. Detailed explanations coupled with hands-on exercises help you get up to speed and quickly and become productive with the module's core features and functions. Compelling screenshots illustrate step-by-step tutorials, and the companion website provides downloadable starting and ending files so you can jump in at any point and compare your work to the
Plaque removal efficacy of Colgate 360 toothbrush: A clinical study
Directory of Open Access Journals (Sweden)
Nageshwar Iyer
2016-01-01
Full Text Available Aim: The aim of this clinical study was to confirm the plaque removal efficacy of the Colgate 360 Whole Mouth Clean Toothbrush. Study Design: This was a single-center, monadic, case-controlled study with the 7 days duration. Materials and Methods: A total of eighty participants (56 male and 24 female aged between 18 and 45 years with a minimum of 20 permanent teeth (excluding the third molars without any prosthetic crowns and an initial plaque score of minimum 1.5 as determined by Modified Quigley-Hein Plaque Index (1970 participated in the study. There were two dropouts during the study duration, one male and one female. The participants were instructed to brush for 1 min, after which plaque index was recorded again. They were then instructed to brush their teeth twice a day for 1 min with the assigned toothbrush (Colgate 360 Whole Mouth Clean Toothbrush and a commercially available fluoride toothpaste for the next 7 days. On the 7 th day, all the participants were recalled for follow-up and plaque examination. The plaque index scores (pre- and post-brushing were recorded, tabulated, and analyzed statistically. Results: The mean plaque indices reduced after brushing both on day 1 and day 7. There was also a reduction in mean plaque indices from day 1 to day 7. All these reductions were statistically significant (P < 0.001. The reduction in plaque scores was independent of the gender of the participants however female participants showed lower scores as compared to male participants (P < 0.001. Conclusion: The present study demonstrated a significant reduction in plaque scores with the use of Colgate 360 Whole Mouth Clean Soft Toothbrush throughout the study period. Continued use resulted in a further significant reduction in plaque scores irrespective of the gender of participants.
Person detection and tracking with a 360° lidar system
Hammer, Marcus; Hebel, Marcus; Arens, Michael
2017-10-01
Today it is easily possible to generate dense point clouds of the sensor environment using 360° LiDAR (Light Detection and Ranging) sensors which are available since a number of years. The interpretation of these data is much more challenging. For the automated data evaluation the detection and classification of objects is a fundamental task. Especially in urban scenarios moving objects like persons or vehicles are of particular interest, for instance in automatic collision avoidance, for mobile sensor platforms or surveillance tasks. In literature there are several approaches for automated person detection in point clouds. While most techniques show acceptable results in object detection, the computation time is often crucial. The runtime can be problematic, especially due to the amount of data in the panoramic 360° point clouds. On the other hand, for most applications an object detection and classification in real time is needed. The paper presents a proposal for a fast, real-time capable algorithm for person detection, classification and tracking in panoramic point clouds.
360°-View of Quantum Theory and Ab Initio Simulation at Extreme Conditions: 2014 Sanibel Symposium
International Nuclear Information System (INIS)
Cheng, Hai-Ping
2016-01-01
The Sanibel Symposium 2014 was held February 16-21, 2014, at the King and Prince, St. Simons Island, GA. It was successful in bringing condensed-matter physicists and quantum chemists together productively to drive the emergence of those specialties. The Symposium had a significant role in preparing a whole generation of quantum theorists. The 54th Sanibel meeting looked to the future in two ways. We had 360°-View sessions to honor the exceptional contributions of Rodney Bartlett (70), Bill Butler (70), Yngve Öhrn (80), Fritz Schaefer (70), and Malcolm Stocks (70). The work of these five has greatly impacted several generations of quantum chemists and condensed matter physicists. The ''360°'' is the sum of their ages. More significantly, it symbolizes a panoramic view of critical developments and accomplishments in theoretical and computational chemistry and physics oriented toward the future. Thus, two of the eight 360°-View sessions focused specifically on younger scientists. The 360°-View program was the major component of the 2014 Sanibel meeting. Another four sessions included a sub-symposium on ab initio Simulations at Extreme Conditions, with focus on getting past the barriers of present-day Born-Oppenheimer molecular dynamics by advances in finite-temperature density functional theory, orbital-free DFT, and new all-numerical approaches.
The 360 Degree Fulldome Production "Clockwork Ocean"
Baschek, B.; Heinsohn, R.; Opitz, D.; Fischer, T.; Baschek, T.
2016-02-01
The investigation of submesoscale eddies and fronts is one of the leading oceanographic topics at the Ocean Sciences Meeting 2016. In order to observe these small and short-lived phenomena, planes equipped with high-resolution cameras and fast vessels were deployed during the Submesoscale Experiments (SubEx) leading to some of the first high-resolution observations of these eddies. In a future experiment, a zeppelin will be used the first time in marine sciences. The relevance of submesoscale processes for the oceans and the work of the eddy hunters is described in the fascinating 9-minute long 360 degree fulldome production Clockwork Ocean. The fully animated movie is introduced in this presentation taking the observer from the bioluminescence in the deep ocean to a view of our blue planet from space. The immersive media is used to combine fascination for a yet unknown environment with scientific education of a broad audience. Detailed background information is available at the parallax website www.clockwork-ocean.com. The Film is also available for Virtual Reality glasses and smartphones to reach a broader distribution. A unique Mobile Dome with an area of 70 m² and seats for 40 people is used for science education at events, festivals, for politicians and school classes. The spectators are also invited to participate in the experiments by presenting 360 degree footage of the measurements. The premiere of Clockwork Ocean was in July 2015 in Hamburg, Germany and will be worldwide available in English and German as of fall 2015. Clockwork Ocean is a film of the Helmholtz-Zentrum Geesthacht produced by Daniel Opitz and Ralph Heinsohn.
29 CFR 1952.360 - Description of the plan as initially approved.
2010-07-01
.... It adopts the definition of occupational safety and health issues expressed in § 1909.2(c)(1) of this... issues raised during the review process, including proposals to be submitted to the New Mexico... Section 1952.360 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH...
Expert System for Competences Evaluation 360° Feedback Using Fuzzy Logic
Directory of Open Access Journals (Sweden)
Alberto Alfonso Aguilar Lasserre
2014-01-01
Full Text Available Performance evaluation (PE is a process that estimates the employee overall performance during a given period, and it is a common function carried out inside modern companies. PE is important because it is an instrument that encourages employees, organizational areas, and the whole company to have an appropriate behavior and continuous improvement. In addition, PE is useful in decision making about personnel allocation, productivity bonuses, incentives, promotions, disciplinary measures, and dismissals. There are many performance evaluation methods; however, none is universal and common to all companies. This paper proposes an expert performance evaluation system based on a fuzzy logic model, with competences 360° feedback oriented to human behavior. This model uses linguistic labels and adjustable numerical values to represent ambiguous concepts, such as imprecision and subjectivity. The model was validated in the administrative department of a real Mexican manufacturing company, where final results and conclusions show the fuzzy logic method advantages in comparison with traditional 360° performance evaluation methodologies.
Directory of Open Access Journals (Sweden)
Maciej Płatkowski
2016-01-01
Full Text Available The aim of study was to determine the influence of NaCl and glyphosate-based herbicide Avans Premium 360 SL on acid and alkaline phosphomonoesterase activities in sandy loam. The experiment was carried out in laboratory conditions on sandy loam with Corg content 10.90 g/kg. Soil was divided into half kilogram samples and adjusted to 60% of maximum water holding capacity. In the experiment dependent variables were: I – dosages of Avans Premium 360 SL (0, a recommended field dosage – FD, a tenfold higher dosage – 10 FD and hundredfold higher dosage – 100 FD, II – amount of NaCl (0, 3% and 6%, III – day of experiment (1, 7, 14, 28 and 56. On days of experiment the activity of alkaline and acid phosphomonoesterase activity was assayed spectrophotometrically. The obtained result showed that the application of Avans Premium 360 SL decreased in acid and alkaline phosphomonoesterase activity in clay soil. Significant interaction effect between the dosage of Avans Premium 360 SL, NaCl amount and day of experiment was reported in the experiment. The inhibitory effect of Avans Premium 360 SL was the highest in soil with NaCl at the amount of 6%.
360⁰ -View of Quantum Theory and Ab Initio Simulation at Extreme Conditions: 2014 Sanibel Symposium
Energy Technology Data Exchange (ETDEWEB)
Cheng, Hai-Ping [Univ. of Florida, Gainesville, FL (United States)
2016-09-02
The Sanibel Symposium 2014 was held February 16-21, 2014, at the King and Prince, St. Simons Island, GA. It was successful in bringing condensed-matter physicists and quantum chemists together productively to drive the emergence of those specialties. The Symposium had a significant role in preparing a whole generation of quantum theorists. The 54th Sanibel meeting looked to the future in two ways. We had 360⁰-View sessions to honor the exceptional contributions of Rodney Bartlett (70), Bill Butler (70), Yngve Öhrn (80), Fritz Schaefer (70), and Malcolm Stocks (70). The work of these five has greatly impacted several generations of quantum chemists and condensed matter physicists. The “360⁰” is the sum of their ages. More significantly, it symbolizes a panoramic view of critical developments and accomplishments in theoretical and computational chemistry and physics oriented toward the future. Thus, two of the eight 360⁰-View sessions focused specifically on younger scientists. The 360⁰-View program was the major component of the 2014 Sanibel meeting. Another four sessions included a sub-symposium on ab initio Simulations at Extreme Conditions, with focus on getting past the barriers of present-day Born-Oppenheimer molecular dynamics by advances in finite-temperature density functional theory, orbital-free DFT, and new all-numerical approaches.
360-degree interactive video application for Cultural Heritage Education
Argyriou, L.; Economou, D.; Bouki, V.
2017-01-01
There is a growing interest nowadays of using immersive technologies to promote Cultural Heritage (CH), engage and educate visitors, tourists and citizens. Such examples refer mainly to the use of Virtual Reality (VR) technology or focus on the enhancement of the real world by superimposing digital artefacts, so called Augmented Reality (AR) applications. A new medium that has been introduced lately as an innovative form of experiencing immersion is the 360-degree video, imposing further rese...
PROFIL-360 high resolution steam generator tube profilometry system
International Nuclear Information System (INIS)
Glass, S.W.
1985-01-01
A high-resolution profilometry system, PROFIL 360, has been developed to assess the condition of steam generator tubes and rapidly produce the data to evaluate the potential for developing in-service leaks. The probe has an electromechanical sensor in a rotating head. This technique has been demonstrated in the field, saving tubes that would have been plugged with the go-gauge criterion and indicating plugging other high-risk candidates that might otherwise not have been removed from service
Profil-360 high resolution steam generator tube profilometry system
International Nuclear Information System (INIS)
Glass, S.W.
1985-01-01
A high-resolution profilometry system, PROFIL 360, has been developed to assess the condition of steam generator tubes and rapidly produce the data to evaluate the potential for developing in-service leaks. The probe has an electromechanical sensor in a rotating head. This technique has been demonstrated in the field, saving tubes that would have been plugged with the go-gauge criterion and indicating plugging other high-risk candidates that might otherwise not have been removed from service
12 CFR 360.2 - Federal Home Loan banks as secured creditors.
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Federal Home Loan banks as secured creditors... OF GENERAL POLICY RESOLUTION AND RECEIVERSHIP RULES § 360.2 Federal Home Loan banks as secured... regulations, the receiver of a borrower from a Federal Home Loan Bank shall recognize the priority of any...
Perceptions of Women and Men Leaders Following 360-Degree Feedback Evaluations
Pfaff, Lawrence A.; Boatwright, Karyn J.; Potthoff, Andrea L.; Finan, Caitlin; Ulrey, Leigh Ann; Huber, Daniel M.
2013-01-01
In this study, researchers used a customized 360-degree method to examine the frequency with which 1,546 men and 721 women leaders perceived themselves and were perceived by colleagues as using 10 relational and 10 task-oriented leadership behaviors, as addressed in the Management-Leadership Practices Inventory (MLPI). As hypothesized, men and…
Creep oceli L360NB za normálních teplot
Czech Academy of Sciences Publication Activity Database
Gajdoš, Lubomír; Šperl, Martin; Náprstek, Jiří; Pavelková, M.
2016-01-01
Roč. 96, 9/10 (2016), s. 202-211 ISSN 0032-1761 R&D Projects: GA TA ČR(CZ) TE02000162 Institutional support: RVO:68378297 Keywords : L360NB steel * creep deformation * normal temperatures Subject RIV: JL - Materials Fatigue, Friction Mechanics
Directory of Open Access Journals (Sweden)
Yejing Wang
Full Text Available The effects of urea and guanidine hydrochloride (GdnHCl on the activity, conformation and unfolding process of protein tyrosine phosphatase (PTPase, a thermostable low molecular weight protein from Thermus thermophilus HB27, have been studied. Enzymatic activity assays showed both urea and GdnHCl resulted in the inactivation of PTPase in a concentration and time-dependent manner. Inactivation kinetics analysis suggested that the inactivation of PTPase induced by urea and GdnHCl were both monophasic and reversible processes, and the effects of urea and GdnHCl on PTPase were similar to that of mixed-type reversible inhibitors. Far-ultraviolet (UV circular dichroism (CD, Tryptophan and 1-anilinonaphthalene -8-sulfonic acid (ANS fluorescence spectral analyses indicated the existence of a partially active and an inactive molten globule-like intermediate during the unfolding processes induced by urea and GdnHCl, respectively. Based on the sequence alignment and the homolog Tt1001 protein structure, we discussed the possible conformational transitions of PTPase induced by urea and GdnHCl and compared the conformations of these unfolding intermediates with the transient states in bovine PTPase and its complex structures in detail. Our results may be able to provide some valuable clues to reveal the relationship between the structure and enzymatic activity, and the unfolding pathway and mechanism of PTPase.
International Nuclear Information System (INIS)
Clemons, William M. Jr.; Brodersen, Ditlev E.; McCutcheonn, John P.; May, Joanna L.C.; Carter, Andrew P.; Morgan-Warren, Robert J.; Wimberly, Brian T.; Ramakrishnan, Venki
2001-01-01
We describe the crystallization and structure determination of the 30 S ribosomal subunit from Thermus thermophilus. Previous reports of crystals that diffracted to 10 (angstrom) resolution were used as a starting point to improve the quality of the diffraction. Eventually, ideas such as the addition of substrates or factors to eliminate conformational heterogeneity proved less important than attention to detail in yielding crystals that diffracted beyond 3 (angstrom) resolution. Despite improvements in technology and methodology in the last decade, the structure determination of the 30 S subunit presented some very challenging technical problems because of the size of the asymmetric unit, crystal variability and sensitivity to radiation damage. Some steps that were useful for determination of the atomic structure were: the use of anomalous scattering from the LIII edges of osmium and lutetium to obtain the necessary phasing signal; the use of tunable, third-generation synchrotron sources to obtain data of reasonable quality at high resolution; collection of derivative data precisely about a mirror plane to preserve small anomalous differences between Bijvoet mates despite extensive radiation damage and multi-crystal scaling; the pre-screening of crystals to ensure quality, isomorphism and the efficient use of scarce third-generation synchrotron time; pre-incubation of crystals in cobalt hexaammine to ensure isomorphism with other derivatives; and finally, the placement of proteins whose structures had been previously solved in isolation, in conjunction with biochemical data on protein-RNA interactions, to map out the architecture of the 30 S subunit prior to the construction of a detailed atomic-resolution model.
Role of disulphide bonds in a thermophilic serine protease aqualysin I from Thermus aquaticus YT-1.
Sakaguchi, Masayoshi; Takezawa, Makoto; Nakazawa, Rie; Nozawa, Kazutaka; Kusakawa, Taro; Nagasawa, Takeshi; Sugahara, Yasusato; Kawakita, Masao
2008-05-01
A thermophilic serine protease, Aqualysin I, from Thermus aquaticus YT-1 has two disulphide bonds, which are also found in a psychrophilic serine protease from Vibrio sp. PA-44 and a proteinase K-like enzyme from Serratia sp. at corresponding positions. To understand the significance of these disulphide bonds in aqualysin I, we prepared mutants C99S, C194S and C99S/C194S (WSS), in which Cys69-Cys99, Cys163-Cys194 and both of these disulphide bonds, respectively, were disrupted by replacing Cys residues with Ser residues. All mutants were expressed stably in Escherichia coli. The C99S mutant was 68% as active as the wild-type enzyme at 40 degrees C in terms of k(cat) value, while C194S and WSS were only 6 and 3%, respectively, as active, indicating that disulphide bond Cys163-Cys194 is critically important for maintaining proper catalytic site conformation. Mutants C194S and WSS were less thermostable than wild-type enzyme, with a half-life at 90 degrees C of 10 min as compared to 45 min of the latter and with transition temperatures on differential scanning calorimetry of 86.7 degrees C and 86.9 degrees C, respectively. Mutant C99S was almost as stable as the wild-type aqualysin I. These results indicate that the disulphide bond Cys163-Cys194 is more important for catalytic activity and conformational stability of aqualysin I than Cys67-Cys99.
Yamasaki, Takashi; Nakazaki, Yosuke; Yoshida, Masasuke; Watanabe, Yo-hei
2011-07-01
ClpB, a member of the expanded superfamily of ATPases associated with diverse cellular activities (AAA+), forms a ring-shaped hexamer and cooperates with the DnaK chaperone system to reactivate aggregated proteins in an ATP-dependent manner. The ClpB protomer consists of an N-terminal domain, an AAA+ module (AAA-1), a middle domain, and a second AAA+ module (AAA-2). Each AAA+ module contains highly conserved WalkerA and WalkerB motifs, and two arginines (AAA-1) or one arginine (AAA-2). Here, we investigated the roles of these arginines (Arg322, Arg323, and Arg747) of ClpB from Thermus thermophilus in the ATPase cycle and chaperone function by alanine substitution. These mutations did not affect nucleotide binding, but did inhibit the hydrolysis of the bound ATP and slow the threading of the denatured protein through the central pore of the T. thermophilus ClpB ring, which severely impaired the chaperone functions. Previously, it was demonstrated that ATP binding to the AAA-1 module induced motion of the middle domain and stabilized the ClpB hexamer. However, the arginine mutations of the AAA-1 module destabilized the ClpB hexamer, even though ATP-induced motion of the middle domain was not affected. These results indicated that the three arginines are crucial for ATP hydrolysis and chaperone activity, but not for ATP binding. In addition, the two arginines in AAA-1 and the ATP-induced motion of the middle domain independently contribute to the stabilization of the hexamer. © 2011 The Authors Journal compilation © 2011 FEBS.
Jia, Dong-Xu; Zhou, Lin; Zheng, Yu-Guo
2017-04-01
Glucose isomerase (GI) is used in vitro to convert d-glucose to d-fructose, which is capable of commercial producing high fructose corn syrup (HFCS). To manufacture HFCS at elevated temperature and reduce the cost of enriching syrups, novel refractory GIs from Thermoanaerobacterium xylanolyticum (TxGI), Thermus oshimai (ToGI), Geobacillus thermocatenulatus (GtGI) and Thermoanaerobacter siderophilus (TsGI) were screened via genome mining approach. The enzymatic characteristics research showed that ToGI had higher catalytic efficiency and superior thermostability toward d-glucose among the screened GIs. Its optimum temperature reached 95°C and could retain more than 80% of initial activity in the presence of 20mM Mn 2+ at 85°C for 48h. The K m and k cat /K m values for ToGI were 81.46mM and 21.77min -1 mM -1 , respectively. Furthermore, the maximum conversion yield of 400g/L d-glucose to d-fructose at 85°C was 52.16%. Considering its excellent high thermostability and ameliorable application performance, ToGI might be promising for realization of future industrial production of HFCS at elevated temperature. Copyright © 2017 Elsevier Inc. All rights reserved.
Capar, Ismail Davut; Gok, Tuba; Orhan, Ezgi
2015-12-01
The purpose of the present study was to investigate the amount of root canal filling material after root canal filling removal with 360° rotary instrumentation or reciprocating motion with the same file sequence. Root canals of the 36 mandibular premolars were shaped with ProTaper Universal instruments up to size F2 and filled with corresponding single gutta-percha cone and sealer. The teeth were assigned to two retreatment groups (n = 18): group 1 360° rotational motion and group 2 reciprocating motion of ATR Tecnika motors (1310° clockwise and 578° counterclockwise). Retreatment procedure was performed with ProTaper Universal retreatment files with a sequence of D1-3 and ProTaper Universal F3 instruments. Total time required to remove filling material were recorded. Remaining filling material was examined under stereomicroscope at ×8 magnification. The data were analysed statistically using the Mann-Whitney U test, and testing was performed at 95 % confidence level (p 0.05) in terms of remaining filling material. The total time required for retreatment was shorter in 360° rotational motion group compared to reciprocating motion group (p instruments with reciprocating motion of ATR motor and conventional rotary motion have similar efficacy in root canal filling removal.
Energy Technology Data Exchange (ETDEWEB)
Majidi, Roya, E-mail: royamajidi@gmail.com [Department of Physics, Shahid Rajaee Teacher Training University, Lavizan, 16788-15811 Tehran (Iran, Islamic Republic of)
2012-10-01
In the present work, we have compared the resistance of the 90 Degree-Sign , 180 Degree-Sign , and 360 Degree-Sign domain walls in the presence of external magnetic field. The calculations are based on the Boltzmann transport equation within the relaxation time approximation. One-dimensional Neel-type domain walls between two domains whose magnetization differs by angle of 90 Degree-Sign , 180 Degree-Sign , and 360 Degree-Sign are considered. The results indicate that the resistance of the 360 Degree-Sign DW is more considerable than that of the 90 Degree-Sign and 180 Degree-Sign DWs. It is also found that the domain wall resistance can be controlled by applying transverse magnetic field. Increasing the strength of the external magnetic field enhances the domain wall resistance. In providing spintronic devices based on magnetic nanomaterials, considering and controlling the effect of domain wall on resistivity are essential.
360° virtual reality video for the acquisition of knot tying skills: A randomised controlled trial.
Yoganathan, S; Finch, D A; Parkin, E; Pollard, J
2018-04-10
360° virtual reality (VR) video is an exciting and evolving field. Current technology promotes a totally immersive, 3-dimensional (3D), 360° experience anywhere in the world using simply a smart phone and virtual reality headset. The potential for its application in the field of surgical education is enormous. The aim of this study was to determine knot tying skills taught with a 360-degree VR video compared to conventional 2D video teaching. This trial was a prospective, randomised controlled study. 40 foundation year doctors (first year postgraduate) were randomised to either the 360-degree VR video (n = 20) or 2D video teaching (n = 20). Participants were given 15 min to watch their allocated video. Ability to tie a single handed reef knot was then assessed against a marking criteria developed for the Royal College of Surgeons, England, (RCSeng) Basic Surgical Skills (BSS) course, by a blinded assessor competent in knot tying. Each candidate then underwent further teaching using Peyton's four step model. Knot tying technique was then re-assessed. Knot tying scores were significantly better in the VR video teaching arm when compared with conventional (median knot score 5.0 vs 4.0 p = 0.04). When used in combination with face to face skills teaching this difference persisted (median knot score 9.5 vs 9.0 p = 0.01). More people in the VR arm constructed a complete reef knot than in the 2D arm following face to face teaching (17/20 vs 12/20). No difference between the groups existed in the time taken to construct a reef knot following video and teaching (median time 31.0s vs 30.5s p = 0.89). This study shows there is significant merit in the application of 360-degree VR video technology in surgical training, both as an independent teaching aid and when used as an adjunct to traditional face to face teaching. Copyright © 2018 IJS Publishing Group Ltd. Published by Elsevier Ltd. All rights reserved.
Stegen, Ludo; Kitshoff, Adriaan M; Van Goethem, Bart; Vandekerckhove, Peter; de Rooster, Hilde
2015-01-01
Laryngeal paralysis is a condition in which failure of arytaenoid abduction results in a reduced rima glottidis cross-sectional area. The most commonly performed surgical techniques rely on unilateral abduction of the arytaenoid, requiring a lateral or ventral surgical approach to the larynx. The aim of the study was to investigate a novel minimally invasive intralaryngeal thyroarytaenoid lateralisation technique, using the Fast-Fix 360 meniscal repair system. Larynges were harvested from large breed canine cadavers. With the aid of Kirschner wires placed between the centre of the vocal process and the centre of an imaginary line between the cranial thyroid fissure and the cricothyroid articulation, the mean insertion angle was calculated. The Fast-Fix 360 delivery needle inserted intralaryngeally (n=10), according to a simplified insertion angle (70°), resulted in thyroid penetration (>2.5 mm from margin) in all patients. The Fast-Fix was applied unilaterally at 70° with the first toggle fired on the lateral aspect of the thyroid cartilage and inside the laryngeal cavity on retraction. The suture was tightened. Preprocedural (61.06±9.21 mm2) and postprocedural (138.37±26.12 mm2) rima glottidis cross-sectional area was significantly different (P<0.0001). The mean percentage increase in rima glottidis cross-sectional area was 125.96 per cent (±16.54 per cent). Intralaryngeal thyroarytaenoid laterlisation using the Fast-Fix 360 meniscal repair system ex vivo increased the rima glottidis cross-sectional area significantly.
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Directory of Open Access Journals (Sweden)
Tina Y Liu
Full Text Available CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus Type III-A Csm complex (TthCsm with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A
2017-01-01
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
International Nuclear Information System (INIS)
LEBARON, G.J.
2001-01-01
360 o photo technology is being used to document conditions, especially hazardous conditions, at US. Department of Energy (DOE) facilities that are being closed. Traditional efforts to document the condition of rooms and cells, especially those difficult to enter due to the hazards present, using engineering drawings, documents, ''traditional flat'' photographs or videos, don't provide perspective. These miss items or quickly pan across areas of interest with little opportunity to study details. Therefore, it becomes necessary to make multiple entries into these hazardous areas resulting in work activities taking longer and increasing exposure and the risk of accidents. High-resolution digital cameras, in conjunction with software techniques, make possible 360 o photos that allow a person to look all around, up and down, and zoom in or out. The software provides the opportunity to attach other information to a 360 o photo such as sound files providing audio information; flat photos providing additional detail or information about what is behind a panel or around a comer; and text information which can be used to show radiological conditions or identify other hazards present but not readily visible. The software also allows other 360 o photos to be attached to create a virtual tour where the user can move from area to area or room to room. The user is able to stop, study and zoom in on areas of interest. A virtual tour of a building or room can be used for facility documentation, work planning and orientation, and training. Documentation is developed during facility closure so people involved in follow-on activities can gain a perspective of the area, focus on points of interest and discuss what they would do or how they would respond to and manage conditions. Decontamination and Decommissioning (D and D) planners and workers can make use of the tour to plan work and decide ahead of time, while looking at the areas of interest, what and how tasks will be performed
Creep crack growth in a reactor pressure vessel steel at 360 deg C
Energy Technology Data Exchange (ETDEWEB)
Wu, Rui; Seitisleam, F; Sandstroem, R [Swedish Institute for Metals Research, Stockholm (Sweden)
1999-12-31
Plain creep (PC) and creep crack growth (CCG) tests at 360 deg C and post metallography were carried out on a low alloy reactor pressure vessel steel (ASTM A508 class 2) with different microstructures. Lives for the CCG tests were shorter than those for the PC tests and this is more pronounced for simulated heat affected zone microstructure than for the parent metal at longer lives. For the CCG tests, after initiation, the cracks grew constantly and intergranularly before they accelerated to approach rupture. The creep crack growth rate is well described by C*. The relations between reference stress, failure time and steady crack growth rate are presented for the CCG tests. It is demonstrated that the failure stress due to CCG is considerably lower than the yield stress at 360 deg C. Consequently, the CCG will control the static strength of a reactor vessel. (orig.) 17 refs.
Creep crack growth in a reactor pressure vessel steel at 360 deg C
Energy Technology Data Exchange (ETDEWEB)
Rui Wu; Seitisleam, F.; Sandstroem, R. [Swedish Institute for Metals Research, Stockholm (Sweden)
1998-12-31
Plain creep (PC) and creep crack growth (CCG) tests at 360 deg C and post metallography were carried out on a low alloy reactor pressure vessel steel (ASTM A508 class 2) with different microstructures. Lives for the CCG tests were shorter than those for the PC tests and this is more pronounced for simulated heat affected zone microstructure than for the parent metal at longer lives. For the CCG tests, after initiation, the cracks grew constantly and intergranularly before they accelerated to approach rupture. The creep crack growth rate is well described by C*. The relations between reference stress, failure time and steady crack growth rate are presented for the CCG tests. It is demonstrated that the failure stress due to CCG is considerably lower than the yield stress at 360 deg C. Consequently, the CCG will control the static strength of a reactor vessel. (orig.) 17 refs.
360-Degree Rhetorical Analysis of Job Hunting: A Four-Part, Multimodal Project
Ding, Huiling; Ding, Xin
2013-01-01
This article proposes the use of a four-component multimodal employment project that offers students a 360-degree understanding of the rhetorical situations surrounding job searches. More specifically, we argue for the use of the four deliverables of written resumes and cover letters, mock oral onsite interview, video resume analysis, and peer…
Acoustic results of the Boeing model 360 whirl tower test
Watts, Michael E.; Jordan, David
1990-09-01
An evaluation is presented for whirl tower test results of the Model 360 helicopter's advanced, high-performance four-bladed composite rotor system intended to facilitate over-200-knot flight. During these performance measurements, acoustic data were acquired by seven microphones. A comparison of whirl-tower tests with theory indicate that theoretical prediction accuracies vary with both microphone position and the inclusion of ground reflection. Prediction errors varied from 0 to 40 percent of the measured signal-to-peak amplitude.
Letter of the Synod of Paris (360/1 to eastern bishops
Directory of Open Access Journals (Sweden)
Zakharov Georgii
2013-08-01
Full Text Available The Russian translation from Latin of the letter of the synod of Paris (360/1 to Eastern bishops which is included in Fragmenta historica of Hilarius of Poitiers is published for the first time. The text contains some important evidences on participation of Gallic bishops in the Arian controversy and also attests the high degree of consolidation of the local Churches in Gaul.
ORF Alignment: NC_005835 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available [Thermus thermophilus HB8] pdb|1FP9|A Chain A, Structure ... Of Amylomaltase From Thermus Thermophilus Hb8 In Space... ... Amylomaltase From Thermus Thermophilus Hb8 In Space ... Group P21212 ... Length = 500 ... Query
ORF Alignment: NC_006461 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available [Thermus thermophilus HB8] pdb|1FP9|A Chain A, Structure ... Of Amylomaltase From Thermus Thermophilus Hb8 In Space... ... Amylomaltase From Thermus Thermophilus Hb8 In Space ... Group P21212 ... Length = 500 ... Query
Politseis ja piirivalves võib kaduda kuni 360 töökohta / Urmas Seaver
Seaver, Urmas, 1973-
2009-01-01
Seoses eelarvekärpe ja 1. jaanuarist tööle hakkava politsei-, piiirvalve- ja kodakondsus- ja migratsioniametit liitva uue ühendasutuse loomisega võib kaduda politseis ja piirivalves 350-360 töökohta
Lithakong, Koetlisi Eugene
2014-01-01
Most companies are competing in the diverse global markets, and competitive advantage through human capital is becoming very important. Employee development for high productivity and the use of effective tools to measure their performance are therefore paramount. One such tool is the 360-degree performance appraisal system. The study on the effectiveness of the 360-degree performance appraisal was conducted on a selected steel organisation. The primary objective of the research...
Exploring the World using Street View 360 Images
Bailey, J.
2016-12-01
The phrase "A Picture is Worth a Thousand Words" is an idiom of unknown 20th century origin. There is some belief that the modern use of the phrase stems from an article in a 1921 issue of a popular trade journal, that used "One Look is Worth A Thousand Words" to promote the use of images in advertisements on the sides of streetcars. There is a certain irony to this as nearly a century later the camera technologies on "Street View cars" are collecting images that look everywhere at once. However, while it can be to fun drive along the World's streets, it was the development of Street View imaging systems that could be mounted on other modes of transport or capture platforms (Street View Special Collects) that opened the door for these 360 images to become a tool for exploration and storytelling. Using Special Collect imagery captured in "off-road" and extreme locations, scientists are now using Street View images to assess changes to species habitats, show the impact of natural disasters and even perform "armchair" geology. A powerful example is the imagery captured before and after the 2011 earthquake and tsunami that devastated Japan. However, it is use of the immersive nature of 360 images that truly allows them to create wonder and awe, especially when combined with Virtual Reality (VR) viewers. Combined with the Street View App or Google Expeditions, VR provides insight into what it is like to swim with sealions in the Galapagos or climb El Capitan in Yosemite National Park. While these image could never replace experiencing these locations in real-life, they can inspire the viewer to explore and learn more about the many wonders of our planet. https://www.google.com/streetview/https://www.google.com/expeditions/
International Nuclear Information System (INIS)
Okai, Masahiko; Yamamura, Akihiro; Hayakawa, Kou; Tsutsui, Shiho; Miyazono, Ken-ichi; Lee, Woo-Cheol; Nagata, Koji; Inoue, Yumiko; Tanokura, Masaru
2017-01-01
Carboxypeptidase cleaves the C-terminal amino acid residue from proteins and peptides. Here, we report the functional and structural characterizations of carboxypeptidase belonging to the M32 family from the thermophilic bacterium Thermus thermophilus HB8 (TthCP). TthCP exhibits a relatively broad specificity for both hydrophilic (neutral and basic) and hydrophobic (aliphatic and aromatic) residues at the C-terminus and shows optimal activity in the temperature range of 75–80 °C and in the pH range of 6.8–7.2. Enzyme activity was significantly enhanced by cobalt or cadmium and was moderately inhibited by Tris at 25 °C. We also determined the crystal structure of TthCP at 2.6 Å resolution. Two dimer types of TthCP are present in the crystal. One type consists of two subunits in different states, open and closed, with a C α RMSD value of 2.2 Å; the other type consists of two subunits in the same open state. This structure enables us to compare the open and closed states of an M32 carboxypeptidase. The TthCP subunit can be divided into two domains, L and S, which are separated by a substrate-binding groove. The L and S domains in the open state are almost identical to those in the closed state, with C α RMSD values of 0.84 and 0.53 Å, respectively, suggesting that the transition between the open and closed states proceeds with a large hinge-bending motion. The superimposition between the closed states of TthCP and BsuCP, another M32 family member, revealed that most putative substrate-binding residues in the grooves are oriented in the same direction. - Highlights: • The enzyme activity of TthCP was inhibited moderately by Tris molecule. • We solved the crystal structure of TthCP at 2.6 Å resolution. • The crystal structure of TthCP revealed both the open and closed conformations.
International Nuclear Information System (INIS)
Taschner, Christian A.; Thines, Laurent; Lejeune, Jean-Paul; El-Mahdy, Mohamed; Rachdi, Henda; Gauvrit, Jean-Yves; Pruvo, Jean-Pierre; Leclerc, Xavier
2009-01-01
The purpose of this study was to determine whether coil embolisation with a new complex-shaped Guglielmi Detachable Coil (GDC 360 ; Boston Scientific Neurovascular, Fremont, CA, USA) has any effect on the stability of aneurysm occlusion. Fifty-one consecutive patients with intracranial aneurysms treated with GDC 360 were included. Angiographic results and adverse neurological events during the follow-up period were recorded. For 38 patients treated with GDC 360 with available follow-up data, a corresponding patient treated with GDC 3D was identified from our database. Matches were sought for rupture status, location, aneurysmal size, and neck size. The angiographic outcome of these matched controls at 6 months was compared to aneurysms treated with GDC 360 . Initial angiographic controls for 38 patients treated with GDC 360 showed complete occlusion in 32 aneurysms, and a neck remnant in six. At 6-month follow-up, complete occlusion was found in 29, a neck remnant in eight, and a residual aneurysm in one. One patient treated with GDC 360 needed retreatment for a major recanalisation. In 38 matched patients treated with GDC 3D, initial angiographic controls found complete aneurysmal occlusion in 30 aneurysms and a residual neck in 8. At 6-month follow-up, 24 aneurysms were completely occluded, ten showed a neck remnant, and residual aneurysms were seen in four. Four patients, treated with GDC 3D, were retreated for major aneurysm recanalisations. Our data suggests that endovascular coil embolisation with GDC 360 might improve long-term stability of coiled aneurysms when compared to GDC 3D. (orig.)
Learning by Viewing - Nobel Labs 360
Mather, John C.
2013-01-01
First of all, my thanks to the Nobel Lindau Foundation for their inspiration and leadership in sharing the excitement of scientific discovery with the public and with future scientists! I have had the pleasure of participating twice in the Lindau meetings, and recently worked with the Nobel Labs 360 project to show how we are building the world's greatest telescope yet, the James Webb Space Telescope (JWST). For the future, I see the greatest challenges for all the sciences in continued public outreach and inspiration. Outreach, so the public knows why we are doing what we are doing, and what difference it makes for them today and in the long-term future. Who knows what our destiny may be? It could be glorious, or not, depending on how we all behave. Inspiration, so that the most creative and inquisitive minds can pursue the scientific and engineering discoveries that are at the heart of so much of human prosperity, health, and progress. And, of course, national and local security depend on those discoveries too; scientists have been working with "the government" throughout recorded history. For the Lindau Nobel experiment, we have a truly abundant supply of knowledge and excitement, through the interactions of young scientists with the Nobelists, and through the lectures and the video recordings we can now share with the whole world across the Internet. But the challenge is always to draw attention! With 7 billion inhabitants on Earth, trying to earn a living and have some fun, there are plenty of competing opportunities and demands on us all. So what will draw attention to our efforts at Lindau? These days, word of mouth has become word of (computer) mouse, and ideas propagate as viruses ( or memes) across the Internet according to the interests of the participants. So our challenge is to find and match those interests, so that the efforts of our scientists, photographers, moviemakers, and writers are rewarded by our public. The world changes every day, so there
Experimental demonstration of 360 tunable RF phase shift using slow and fast light effects
DEFF Research Database (Denmark)
Xue, Weiqi; Sales, Salvador; Capmany, Jose
2009-01-01
A microwave photonic phase shifter realizing 360º phase shift over a RF bandwidth of more than 10 GHz is demonstrated using optical filtering assisted slow and fast light effects in a cascaded structure of semiconductor optical amplifiers....
U mosta slúžiti. Mezinárodní vědecká konference k 800. výročí založení Řádu kazatelů – dominikánů
Czech Academy of Sciences Publication Activity Database
Vytlačil, Lukáš
2016-01-01
Roč. 53, 2/3 (2016), s. 302-304 ISSN 0018-7003. [U mosta slúžiti. Mezinárodní vědecká konference k 800. výročí založení Řádu kazatelů – dominikánů. Praha, 29.09.2016-30.09.2016] Institutional support: RVO:68378076 Keywords : dominicans * conferences * medieval music * graduals * medieval music theory * Hieronymus de Moravia Subject RIV: AL - Art, Architecture, Cultural Heritage
2010-04-01
... 25 Indians 2 2010-04-01 2010-04-01 false Is the trust evaluation standard or process different when the trust asset is held in trust for an individual Indian or Indian allottee? 1000.360 Section 1000.360 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMEN...
Baek, Jin-Sook; Kim, Hye-Young; Abbott, Thomas P; Moon, Tae-Wha; Lee, Soo-Bok; Park, Cheon-Seok; Park, Kwan-Hwa
2003-03-01
Simmondsin was modified with acarviosine-glucose using the transglycosylation activity of Thermus maltogenic amylase to synthesize a novel compound with both antiobesity and hypoglycemic activity. The LC/MS and 13C NMR analyses confirmed that the structure of the major transglycosylation product was acarviosine-simmondsin (Acv-simmondsin), in which acarviosine was attached to the glucose moiety of simmondsin by an alpha-(1,6)-glycosidic linkage. It was found that Acv-simmondsin was a potent competitive inhibitor of alpha-glucosidase with the Ki value of 0.69 microM and a mixed type inhibitor of alpha-amylase with the Ki and KI of 20.78 microM and 26.31 microM, respectively. The administration of Acv-simmondsin (0.1 g/100 g diet/day) to mice for 5 days significantly reduced food intake by 35%, compared to 25% with simmondsin in control obese mice. Acv-simmondsin (50 mg/kg BW) suppressed the postprandial blood glucose response to sucrose (1 g/kg BW) by 74%, compared to 71% with acarbose, in normal rats.
Kulikov, Alexei N; Maltsev, Dmitrii S; Boiko, Ernest V
2016-01-01
Purpose . To compare three 360°-laser retinopexy (LRP) approaches (using navigated pattern laser system, single-spot slit-lamp (SL) laser delivery, and single-spot indirect ophthalmoscope (IO) laser delivery) in regard to procedure duration, procedural pain score, technical difficulties, and the ability to achieve surgical goals. Material and Methods . Eighty-six rhegmatogenous retinal detachment patients (86 eyes) were included in this prospective randomized study. The mean procedural time, procedural pain score (using 4-point Verbal Rating Scale), number of laser burns, and achievement of the surgical goals were compared between three groups (pattern LRP (Navilas® laser system), 36 patients; SL-LRP, 28 patients; and IO-LRP, 22 patients). Results . In the pattern LRP group, the amount of time needed for LRP and pain level were statistically significantly lower, whereas the number of applied laser burns was higher compared to those in the SL-LRP group and in the IO-LRP group. In the pattern LRP, SL-LRP, and IO-LRP groups, surgical goals were fully achieved in 28 (77.8%), 17 (60.7%), and 13 patients (59.1%), respectively ( p > 0.05). Conclusion . The navigated pattern approach allows improving the treatment time and pain in postoperative 360° LRP. Moreover, 360° pattern LRP is at least as effective in achieving the surgical goal as the conventional (slit-lamp or indirect ophthalmoscope) approaches with a single-spot laser.
Scleral depressed vitreous shaving, 360 laser, and perfluoropropane (C 3 F 8 for retinal detachment
Directory of Open Access Journals (Sweden)
Vivek Chaturvedi
2014-01-01
Full Text Available Purpose : To review the characteristics and outcomes of patients who underwent pars plana vitrectomy (PPV with scleral depressed vitreous shaving, 360 degree peripheral endolaser, and 14% C3F8 gas for rhegmatogenous retinal detachment (RRD. Materials and Methods : A retrospective review of a consecutive series of patients who underwent primary repair of RRD by PPV with scleral depressed vitreous shaving, 360 degree peripheral endolaser, and 14% perfluoropropane (C 3 F 8 was conducted. Patients with less than 3 months follow-up, previous retinal surgery, and higher than grade B proliferative vitreoretinopathy were excluded. Results : Ninety-one eyes were included in the study. The mean age was 60.1 years. The mean follow-up was 13.7 months. The macula was detached in 63% (58/91 of the eyes. The reattachment rate after one surgical procedure was 95% (86/91 while overall reattachment rate was 100%. There was no statistically significant difference between reattachment rates of superior, nasal/temporal, or inferior RRDs. The mean final best corrected visual acuity (BCVA was 20/40. Of all the patients, 66% of patients with macula-off RRDs had a final BCVA of 20/40 or better. Conclusions: PPV with scleral depressed vitreous shaving, 360 degree peripheral endolaser, and 14% C 3 F 8 leads to successful anatomical reattachment with visual improvement in patients with primary RRD.
360度绩效考评在政府财政绩效管理中的应用%The Application of 360-degree Feedback in the Government Finance Performance
Institute of Scientific and Technical Information of China (English)
邓洁
2012-01-01
基于目前我国财政绩效管理中存在着资金管理效益低下、绩效考评主体单一、监督机制缺失等问题,分析将360度绩效考评方法引入财政绩效管理中的优势,具体表现为:信息充足、可信度高、有利于提高政府行政能力和增强大众监督。从主体确定、权重设计、实施步骤三个方面探讨360度财政绩效考评框架,提出在应用中应创造和谐氛围、加强主体培训、充分利用网络引入媒体监督等对策建议。%There are some problems in the government finance performance,such as inefficient fund management,unitary evaluation subject,and lack of supervision mechanism.In view of these problems,the paper analyzes the advantages of 360-degree feedback being introduced into the government finance performance.Its advantages are: adequate in information,high in credibility,and beneficial for government executive ability improvement and public supervision enhancement.The paper discusses the basic performance appraisal framework from the aspects of subject deciding,weight design and implementation steps,and then offers some proposals for the application,such proposals as creating a harmonious atmosphere,strengthening subject training,and introducing media supervision by making full use of Internet.
Togawa, Yoichiro; Nunoshiba, Tatsuo; Hiratsu, Keiichiro
2018-02-01
Markerless gene-disruption technology is particularly useful for effective genetic analyses of Thermus thermophilus (T. thermophilus), which have a limited number of selectable markers. In an attempt to develop a novel system for the markerless disruption of genes in T. thermophilus, we applied a Cre/lox system to construct a triple gene disruptant. To achieve this, we constructed two genetic tools, a loxP-htk-loxP cassette and cre-expressing plasmid, pSH-Cre, for gene disruption and removal of the selectable marker by Cre-mediated recombination. We found that the Cre/lox system was compatible with the proliferation of the T. thermophilus HB27 strain at the lowest growth temperature (50 °C), and thus succeeded in establishing a triple gene disruptant, the (∆TTC1454::loxP, ∆TTC1535KpnI::loxP, ∆TTC1576::loxP) strain, without leaving behind a selectable marker. During the process of the sequential disruption of multiple genes, we observed the undesired deletion and inversion of the chromosomal region between multiple loxP sites that were induced by Cre-mediated recombination. Therefore, we examined the effects of a lox66-htk-lox71 cassette by exploiting the mutant lox sites, lox66 and lox71, instead of native loxP sites. We successfully constructed a (∆TTC1535::lox72, ∆TTC1537::lox72) double gene disruptant without inducing the undesired deletion of the 0.7-kbp region between the two directly oriented lox72 sites created by the Cre-mediated recombination of the lox66-htk-lox71 cassette. This is the first demonstration of a Cre/lox system being applicable to extreme thermophiles in a genetic manipulation. Our results indicate that this system is a powerful tool for multiple markerless gene disruption in T. thermophilus.
Pennacchio, Angela; Pucci, Biagio; Secundo, Francesco; La Cara, Francesco; Rossi, Mosè; Raia, Carlo A
2008-07-01
The gene encoding a novel alcohol dehydrogenase (ADH) that belongs to the short-chain dehydrogenase/reductase (SDR) superfamily was identified in the extremely thermophilic, halotolerant gram-negative eubacterium Thermus thermophilus HB27. The T. thermophilus ADH gene (adh(Tt)) was heterologously overexpressed in Escherichia coli, and the protein (ADH(Tt)) was purified to homogeneity and characterized. ADH(Tt) is a tetrameric enzyme consisting of identical 26,961-Da subunits composed of 256 amino acids. The enzyme has remarkable thermophilicity and thermal stability, displaying activity at temperatures up to approximately 73 degrees C and a 30-min half-inactivation temperature of approximately 90 degrees C, as well as good tolerance to common organic solvents. ADH(Tt) has a strict requirement for NAD(H) as the coenzyme, a preference for reduction of aromatic ketones and alpha-keto esters, and poor activity on aromatic alcohols and aldehydes. This thermophilic enzyme catalyzes the following reactions with Prelog specificity: the reduction of acetophenone, 2,2,2-trifluoroacetophenone, alpha-tetralone, and alpha-methyl and alpha-ethyl benzoylformates to (S)-(-)-1-phenylethanol (>99% enantiomeric excess [ee]), (R)-alpha-(trifluoromethyl)benzyl alcohol (93% ee), (S)-alpha-tetralol (>99% ee), methyl (R)-(-)-mandelate (92% ee), and ethyl (R)-(-)-mandelate (95% ee), respectively, by way of an efficient in situ NADH-recycling system involving 2-propanol and a second thermophilic ADH. This study further supports the critical role of the D37 residue in discriminating NAD(H) from NADP(H) in members of the SDR superfamily.
Energy Technology Data Exchange (ETDEWEB)
Abramchik, Yu. A. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation); Muravieva, T. I.; Sinitsyna, E. V.; Esipov, R. S., E-mail: esipov@mx.ibch.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography of Federal Scientific Research Centre “Crystallography and Photonics” (Russian Federation)
2017-01-15
Phosphoribosylpyrophosphate synthetases (PRPP synthetases) are among the key enzymes essential for vital functions of organisms and are involved in the biosynthesis of purine and pyrimidine nucleotides, coenzymes, and the amino acids histidine and tryptophan. These enzymes are used in biotechnology for the combined chemoenzymatic synthesis of natural nucleotide analogs. Recombinant phosphoribosylpyrophosphate synthetase I from the thermophilic strain HB27 of the bacterium Thermus thermophilus (T. th HB27) has high thermal stability and shows maximum activity at 75°Ð¡, due to which this enzyme holds promise for biotechnological applications. In order to grow crystals and study them by X-ray crystallography, an enzyme sample, which was produced using a highly efficient producer strain, was purified by affinity and gel-filtration chromatography. The screening of crystallization conditions was performed by the vapor-diffusion technique. The crystals of the enzyme suitable for X-ray diffraction were grown by the counter-diffusion method through a gel layer. These crystals were used to collect the X-ray diffraction data set at the SPring-8 synchrotron radiation facility (Japan) to 3-Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unitcell parameters: a = 107.7 Å, b = 112.6 Å, c = 110.2 Å, α = γ = 90°, β = 116.6°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the enzyme at 3.0-Å resolution.
Energy Technology Data Exchange (ETDEWEB)
Kumar, S.M. [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India); Pampa, K.J. [Department of Studies in Microbiology, University of Mysore, Mysore 570 006 (India); Manjula, M. [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India); Abdoh, M.M.M. [Department of Physics, Faculty of Science, An-Najah National University, Nablus, West Bank, Palestine (Country Unknown); Kunishima, Naoki [Advanced Protein Crystallography Research Group, RIKEN SPring-8 Center, Harima Institute, Hyogo 679-5148 (Japan); Lokanath, N.K., E-mail: lokanath@physics.uni-mysore.ac.in [Department of Studies in Physics, University of Mysore, Mysore 570 006 (India)
2014-06-20
Highlights: • We determined the structure of isocitrate dehydrogenase with citrate and cofactor. • The structure reveals a unique novel terminal domain involved in dimerization. • Clasp domain shows significant difference, and catalytic residues are conserved. • Oligomerization of the enzyme is quantized with subunit-subunit interactions. • Novel domain of this enzyme is classified as subfamily of the type IV. - Abstract: NADP{sup +} dependent isocitrate dehydrogenase (IDH) is an enzyme catalyzing oxidative decarboxylation of isocitrate into oxalosuccinate (intermediate) and finally the product α-ketoglutarate. The crystal structure of Thermus thermophilus isocitrate dehydrogenase (TtIDH) ternary complex with citrate and cofactor NADP{sup +} was determined using X-ray diffraction method to a resolution of 1.80 Å. The overall fold of this protein was resolved into large domain, small domain and a clasp domain. The monomeric structure reveals a novel terminal domain involved in dimerization, very unique and novel domain when compared to other IDH’s. And, small domain and clasp domain showing significant differences when compared to other IDH’s of the same sub-family. The structure of TtIDH reveals the absence of helix at the clasp domain, which is mainly involved in oligomerization in other IDH’s. Also, helices/beta sheets are absent in the small domain, when compared to other IDH’s of the same sub family. The overall TtIDH structure exhibits closed conformation with catalytic triad residues, Tyr144-Asp248-Lys191 are conserved. Oligomerization of the protein is quantized using interface area and subunit–subunit interactions between protomers. Overall, the TtIDH structure with novel terminal domain may be categorized as a first structure of subfamily of type IV.
Thomsen, J. S.; Morukov, B. V.; Vico, L.; Saparin, P. I.; Gowin, W.
The loss of bone during immobilization is well-known and investigated, whereas the structural changes human cancellous bone undergoes during disuse is less well examined. The aim of the study was to examine the influence of hypokinesia on the static histomorphometric measures of the iliac crest using a 360-day-long bed rest experiment, simulating exposure to microgravity. Eight healthy males underwent 360 days of 5° head-down tilt bed rest. Three subjects were treated with the bisphosphonate Xidifon (900 mg/day) combined with a treadmill and ergonometer exercise regimen (1--2 hours/day) for the entire study period. Five subjects underwent 120 days of bed rest without countermeasures followed by 240 days of bed rest with the treadmill and ergonometer exercise regimen. Transiliac bone biopsies were obtained either at day 0 and 360 or at day 0, 120, and 360 at alternating sides of the ileum. The biopsies were embedded in methylmethacrylate, cut in 7-μm-thick sections, stained with Goldner trichrome, and static histomorphometry was performed. 120 days of bed rest without countermeasures resulted in decreased trabecular bone volume (-6.3%, p = 0.046) and trabecular number (-10.2%, p = 0.080) and increased trabecular separation (14.7%, p = 0.020), whereas 240 days of subsequent bed rest with exercise treatment prevented further significant deterioration of the histomorphometric measures. 360 days of bed rest with bisphosphonate and exercise treatment did not induce any significant changes in any of the histomorphometric measures. The study showed that 120 days of antiorthostatic bed rest without countermeasures induced significant deterioration of iliac crest trabecular bone histomorphometric properties. There are indications that the immobilization induced changes involve a loss of trabeculae rather than a general thinning of the trabeculae. On average, the countermeasures consisting of either bisphosphonate and exercise or exercise alone were able to either prevent
NCBI nr-aa BLAST: CBRC-TBEL-01-0397 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TBEL-01-0397 ref|YP_005572.1| competence factor comEC [Thermus thermophilus HB...27] gb|AAG34707.1|AF319938_2 competence factor ComEC [Thermus thermophilus] gb|AAS81945.1| competence factor comEC [Thermus thermophilus HB27] YP_005572.1 0.10 31% ...
Directory of Open Access Journals (Sweden)
Adem BALTACI
2014-03-01
Full Text Available ÖzetGünümüzün en popüler değerlendirme sistemi olarak kabul edilen 360 derece değerlendirme sistemi gücünü, farklı kaynaklardan elde edilecek olan sonuçların daha objektif ve kapsayıcı olacağı görüşünden almaktadır. Ancak burada hangi değerlendiricinin daha geçerli ve güvenilir bilgi sağladığı halen belirsizliğini koruyan bir konudur. Bu belirsizliğe rağmen 360 derece değerlendirme sistemi çalışana kendini ve diğerlerini değerlendirme şansı tanıyor olması nedeniyle sistemden duyulan tatmini arttırmaktadır. Bu bağlamda yapılan bu çalışmada, değerlendirme sisteminden duyulan tatmin ve değerlendiriciler arası güvenilirlik özelinde 360 derece değerlendirme sistemi ele alınmıştır. Bu amaçla bu sistemi uygulayan bir işletmenin çalışanlarının değerlendirme sonuçları incelenmiş ve ayrıca çalışanlara sistemden duydukları tatmini ölçen bir anket uygulanmıştır. Analizler sonucunda demografik değişkenlerin performans puanları üzerinde olmasa da farklı kaynaklardan gelen değerlendirmeler üzerinde etkili olabildiği görülmüştür. Ayrıca üstlerin çalışanların gerçek performans puanlarına en yakın değerlendirmeleri yaptığı incelemeler sonucunda ortaya çıkmıştır. Bunun yanı sıra sisteme karşı duyulan tatmin ile çalışanların performansları arasında kuvvetli bir ilişki tespit edilmiştir.AbstractThe 360-degree appraisal system, viewed as today’s most popular appraisal system, gets its strength from the view that results from different sources would be much more objective and inclusive. Yet, the question of exactly which rating source provides relatively more valid and reliable information remains to be answered. This uncertainty notwithstanding, the 360-degree performance appraisal system leads to higher satisfaction with the system as it allows employees to assess both themselves and others. Against this background, this study addresses the
Cormack, Carrie L; Jensen, Elizabeth; Durham, Catherine O; Smith, Gigi; Dumas, Bonnie
2018-05-01
The 360 Degree Evaluation Model is one means to provide a comprehensive view of clinical competency and readiness for progression in an online nursing program. This pilot project aimed to evaluate the effectiveness of implementing a 360 Degree Evaluation of clinical competency of graduate advanced practice nursing students. The 360 Degree Evaluation, adapted from corporate industry, encompasses assessment of student knowledge, skills, behaviors and attitudes and validates student's progression from novice to competent. Cohort of advanced practice nursing students in four progressive clinical semesters. Graduate advanced practice nursing students (N = 54). Descriptive statistics and Jonckheere's Trend Test were used to evaluate OSCE's scores from graded rubric, standardized patient survey scores, student reflection and preceptor evaluation. We identified all students passed the four OSCEs during a first attempt or second attempt. Scaffolding OSCE's over time allowed faculty to identify cohort weakness and create subsequent learning opportunities. Standardized patients' evaluation of the students' performance in the domains of knowledge, skills and attitudes, showed high scores of 96% in all OSCEs. Students' self-reflection comments were a mix of strengths and weaknesses in their self-evaluation, demonstrating themes as students progressed. Preceptor evaluation scores revealed the largest increase in knowledge and learning skills (NONPF domain 1), from an aggregate average of 90% in the first clinical course, to an average of 95%. The 360 Degree Evaluation Model provided a comprehensive evaluation of the student and critical information for the faculty ensuring individual student and cohort data and ability to analyze cohort themes. Copyright © 2018 Elsevier Ltd. All rights reserved.
Rapid nickel diffusion in cold-worked type 316 austenitic steel at 360-500 C
Energy Technology Data Exchange (ETDEWEB)
Arioka, Koji [Institute of Nuclear Safety Systems, Inc., Mihama (Japan); Iijima, Yoshiaki [Tohoku Univ., Sendai (Japan). Dept. of Materials Science; Miyamoto, Tomoki [Kobe Material Testing Laboratory Co. Ltd., Harima (Japan)
2017-10-15
The diffusion coefficient of nickel in cold-worked Type 316 austenitic steel was determined by the diffusion couple method in the temperature range between 360 and 500 C. A diffusion couple was prepared by electroless nickel plating on the surface of a 20 % cold-worked Type 316 austenitic steel specimen. The growth in width of the interdiffusion zone was proportional to the square root of diffusion time until 14 055 h. The diffusion coefficient of nickel (D{sub Ni}) in cold-worked Type 316 austenitic steel was determined by extrapolating the concentration-dependent interdiffusion coefficient to 11 at.% of nickel. The value of D{sub Ni} at 360 C was about 5 000 times higher than the lattice diffusion coefficient of nickel in Type 316 austenitic steel. The determined activation energy 117 kJ mol{sup -1} was 46.6 % of the activation energy 251 kJ mol{sup -1} for the lattice diffusion of nickel in Type 316 austenitic steel.
Defects in SiO2 crystals after neutron irradiations at 20 K and 360 K
International Nuclear Information System (INIS)
Nakagawa, M.; Okada, M.; Kawabata, Y.; Atobe, K.; Itoh, H.; Nakanishi, S.
1994-01-01
The synthetic silicon dioxide (SiO 2 ), cut parallel (x-plate) or perpendicular (z-plate) to c-axis, are irradiated by reactor neutrons at 360 K (2.8x10 18 n/cm 2 ) or at 20 K (8.0x10 16 n/cm 2 ). After neutron irradiation at 360 K, the main absorption peak can be observed at 212 nm (5.84 eV) for z-plate and 217 nm (5.71 eV) for x-plate. After irradiation at 20 K a new band at 250 nm (4.96 eV) can be observed in addition to the band at about 220 nm. The 250 nm band having FWHM similar 0.44 eV disappears at 300-340 K. Thermoluminescences are also observed between 80 to 400 K; which show some difference between x-plate and z-plate. ((orig.))
360 Degrees Project: Final Report of 1972-73. National Career Education Television Project.
Wisconsin Univ., Madison. Univ. Extension.
Project 360 Degrees was a mass-media, multi-State, one-year effort in adult career education initiated by WHA-TV, the public television station of the University of Wisconsin-Extension, and funded by the U.S. Office of Education. The overall goal of the project was to provide, through a coordinated media system, information and motivation that…
Use of 360-degree assessment of residents in internal medicine in a Danish setting
DEFF Research Database (Denmark)
Allerup, Peter
2007-01-01
objectives to be assessed. We considered 22 of these suitable for assessment by 360-degrees assessment. METHODS: Medical departments of six hospitals contributed 42 interns to the study. Each resident was assessed by ten persons of whom one was a secretary, four were nurses and five senior doctors...
Fernandez-Luque, Luis; Singh, Meghna; Ofli, Ferda; Mejova, Yelena A; Weber, Ingmar; Aupetit, Michael; Jreige, Sahar Karim; Elmagarmid, Ahmed; Srivastava, Jaideep; Ahmedna, Mohamed
2017-04-13
The explosion of consumer electronics and social media are facilitating the rise of the Quantified Self (QS) movement where millions of users are tracking various aspects of their daily life using social media, mobile technology, and wearable devices. Data from mobile phones, wearables and social media can facilitate a better understanding of the health behaviors of individuals. At the same time, there is an unprecedented increase in childhood obesity rates worldwide. This is a cause for grave concern due to its potential long-term health consequences (e.g., diabetes or cardiovascular diseases). Childhood obesity is highly prevalent in Qatar and the Gulf Region. In this study we examine the feasibility of capturing quantified-self data from social media, wearables and mobiles within a weight lost camp for overweight children in Qatar. Over 50 children (9-12 years old) and parents used a wide range of technologies, including wearable sensors (actigraphy), mobile and social media (WhatsApp and Instagram) to collect data related to physical activity and food, that was then integrated with physiological data to gain insights about their health habits. In this paper, we report about the acquired data and visualization techniques following the 360° Quantified Self (360QS) methodology (Haddadi et al., ICHI 587-92, 2015). 360QS allows for capturing insights on the behavioral patterns of children and serves as a mechanism to reinforce education of their mothers via social media. We also identified human factors, such as gender and cultural acceptability aspects that can affect the implementation of this technology beyond a feasibility study. Furthermore, technical challenges regarding the visualization and integration of heterogeneous and sparse data sets are described in the paper. We proved the feasibility of using 360QS in childhood obesity through this pilot study. However, in order to fully implement the 360QS technology careful planning and integration in the health
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2012-11-01
Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.
Sinitsyna, E. V.; Timofeev, V. I.; Tuzova, E. S.; Kostromina, M. A.; Murav'eva, T. I.; Esipov, R. S.; Kuranova, I. P.
2017-07-01
Adenine phosphoribosyltransferase (APRT) belongs to the type I phosphoribosyltransferase family and catalyzes the formation of adenosine monophosphate via transfer of the 5-phosphoribosyl group from phosphoribosyl pyrophosphate to the nitrogen atom N9 of the adenine base. Proteins of this family are involved in a salvage pathway of nucleotide synthesis, thus providing purine base utilization and maintaining the optimal level of purine bases in the body. Adenine phosphoribosyltransferase from the extremely thermophilic Thermus thermophilus strain HB27 was produced using a highly efficient E. coli producer strain and was then purified by affinity and gel-filtration chromatography. This enzyme was successfully employed as a catalyst for the cascade biosynthesis of biologically important nucleotides. The screening of crystallization conditions for recombinant APRT from T. thermophilus HB27 was performed in order to determine the enzyme structure by X-ray diffraction. The crystallization conditions, which were found by the vapor-diffusion technique, were then optimized to apply the counter-diffusion technique. The crystals of the enzyme were grown by the capillary counter-diffusion method. The crystals belong to sp. gr. P1211 and have the following unitcell parameters: a = 69.86 Å, b = 82.16 Å, c = 91.39 Å, α = γ = 90°, β = 102.58°. The X-ray diffraction data set suitable for the determination of the APRT structure at 2.6 Å resolution was collected from the crystals at the SPring-8 synchrotron facility (Japan).
Directory of Open Access Journals (Sweden)
Benedikt eLeis
2015-04-01
Full Text Available Functional metagenomic screening strategies, which are independent of known sequence information, can lead to the identification of truly novel genes and enzymes. Since E. coli has been used exhaustively for this purpose as a host, it is important to establish alternative expression hosts and to use them for functional metagenomic screening for new enzymes. In this study we show that Thermus thermophilus HB27 is an excellent screening host and can be used as an alternative provider of truly novel biocatalysts. In a previous study we constructed the mutant strain BL03 that was no longer able to grow on defined minimal medium supplemented with tributyrin as the sole carbon source and could be used as a host to screen for metagenomic DNA fragments that could complement growth on tributyrin. Several thousand single fosmid clones from thermophilic metagenomic libraries from heated compost and hot spring water samples were subjected to a comparative screening for esterase activity in both T. thermophilus strain BL03 and E. coli EPI300. We scored a greater number of active clones in the thermophilic bacterium than in the mesophilic E. coli. From all clones functionally screened in E. coli, only two thermostable α/β-fold hydrolase enzymes with high amino acid sequence similarity to already characterized enzymes were identifiable. In contrast, five further fosmids were found that conferred lipolytic activities in T. thermophilus. Four open reading frames (ORFs were found which did not share significant similarity to known esterase enzymes. Two of the genes were expressed in both hosts and the novel thermophilic esterases, which based on their primary structures could not be assigned to known esterase or lipase families, were purified and preliminarily characterized. Our work underscores the benefit of using additional screening hosts other than E. coli for the identification of novel biocatalysts with industrial relevance.
Zhu, Lizhe
2016-02-24
Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Agos but rigid for eukaryotic Agos. © 2016 American Chemical Society.
Zhu, Lizhe; Jiang, Hanlun; Sheong, Fu Kit; Cui, Xuefeng; Gao, Xin; Wang, Yanli; Huang, Xuhui
2016-03-17
Argonaute proteins (Ago) are core components of the RNA Induced Silencing Complex (RISC) that load and utilize small guide nucleic acids to silence mRNAs or cleave foreign DNAs. Despite the essential role of Ago in gene regulation and defense against virus, the molecular mechanism of guide-strand loading into Ago remains unclear. We explore such a mechanism in the bacterium Thermus thermophilus Ago (TtAgo), via a computational approach combining molecular dynamics, bias-exchange metadynamics, and protein-DNA docking. We show that apo TtAgo adopts multiple closed states that are unable to accommodate guide-DNA. Conformations able to accommodate the guide are beyond the reach of thermal fluctuations from the closed states. These results suggest an induced-fit dominant mechanism for guide-strand loading in TtAgo, drastically different from the two-step mechanism for human Ago 2 (hAgo2) identified in our previous study. Such a difference between TtAgo and hAgo2 is found to mainly originate from the distinct rigidity of their L1-PAZ hinge. Further comparison among known Ago structures from various species indicates that the L1-PAZ hinge may be flexible in general for prokaryotic Ago's but rigid for eukaryotic Ago's.
International Nuclear Information System (INIS)
Gao, Catherine; Leyton, Jeffrey V.; Schimmer, Aaron D.; Minden, Mark; Reilly, Raymond M.
2016-01-01
Chimeric IgG_1 monoclonal antibody CSL360 recognizes the CD123"+/CD131"− phenotype expressed by leukemic stem cells (LSC). Auger electron-emitting "1"1"1In-DTPA-NLS-CSL360 radioimmunoconjugates incorporating nuclear translocation sequence (NLS) peptides bound specifically to Raji cells transfected with CD123 and exhibited a K_D of 11 nmols/L in a competition receptor-binding assay using CD123-transfected CHO cells. "1"1"1In-DTPA-NLS-CSL360 was bound, internalized and transported to the nucleus of human AML-5 myeloid leukemia cells. The clonogenic survival of AML-5 cells was reduced by "1"1"1In-DTPA-NLS-CSL360 up to 3.7-fold. Isotype control "1"1"1In-DTPA-chIgG_1 was 2-fold less cytotoxic, and unlabeled CSL360, DTPA-NLS-CSL360 or free "1"1"1In acetate did not decrease cell survival. These results are promising for further evaluation of "1"1"1In-DTPA-NLS-CSL360 for Auger electron radioimmunotherapy of AML targeting the critical LSC subpopulation. - Highlights: • "1"1"1In-DTPA-NLS-CSL360 the CD123"+/CD131"− phenotype of leukemic stem cells (LSC). • "1"1"1In-DTPA-NLS-CSL360 was bound, internalized and imported into the nucleus of AML-5 leukemia cells. • "1"1"1In-DTPA-NLS-CSL360 reduced the clonogenic survival of AML-5 leukemia cells by 4-fold.
Directory of Open Access Journals (Sweden)
Selin Metin CAMGÖZ
2006-01-01
Full Text Available In this study, “360 Degree Performance Appraisal” which is one of the most current and controversial issues of human resource practices is extensively examined and supported with an empirical research. The study contains 2 parts. After explaining the necessity and the general utilities of the classical performance appraisal system, the first theoretical part shifts to the emergence of 360 degree performance appraisal, discusses its distinctive benefits over the classical appraisal system and focuses its attention to the raters (superiors, subordinates, peers, self involving in the 360 degree performance appraisal.The second empirical part illustrates the development of 360 degree performance appraisal system as well as its application and sample feedback reports for feedback purposes in order to appraise the managerial skills of supervisors working in Health Care Centre of a public university.
Periodismo Ambiental: un análisis a los medios digitales venezolanos Noticias 24 y Reporte 360
Directory of Open Access Journals (Sweden)
Herly Alejandra Quiñónez Gómez
2012-03-01
Full Text Available Para analizar la información ambiental en medios digitales, se hizo un estudio descriptivo y de análisis de contenido, donde se examinaron Reporte 360 y Noticias 24, con las categorías de Krisppendorff (1990 para el análisis de contenido; Aceves (2003 información ambiental y Cely (2004 para el medio digital. Se elaboró una clasificación de géneros periodísticos (tradicionales y ciberperiodísticos, se analizó el hipertexto, actualización, procedencia de la información, fuentes, temas, comentarios y explicación de términos. Como resultados destacan: la procedencia de la información de ambos medios es mayoritariamente de Agencias de Noticias internacionales y nacional, domina la fuente gobierno, escaso uso del lenguaje multimedia, Reporte 360 muestra un lento ritmo de actualización frente a Noticias 24 y ésta hace mayor uso de video. El género periodístico más empleado es la noticia, con la misma estructura del medio impreso. En ambos medios la agenda temática es: Contaminación, Desastres Naturales, Desechos y Lluvias. Los comentarios en Noticias 24 fueron muy críticos para los temas de contaminación y desechos y, los usuarios de Reporte 360, las reenviaron a las redes sociales. Se concluye que los medios digitales estudiados basan su contenido en las agencias de noticias.
Performance comparison of AV1, HEVC, and JVET video codecs on 360 (spherical) video
Topiwala, Pankaj; Dai, Wei; Krishnan, Madhu; Abbas, Adeel; Doshi, Sandeep; Newman, David
2017-09-01
This paper compares the coding efficiency performance on 360 videos, of three software codecs: (a) AV1 video codec from the Alliance for Open Media (AOM); (b) the HEVC Reference Software HM; and (c) the JVET JEM Reference SW. Note that 360 video is especially challenging content, in that one codes full res globally, but typically looks locally (in a viewport), which magnifies errors. These are tested in two different projection formats ERP and RSP, to check consistency. Performance is tabulated for 1-pass encoding on two fronts: (1) objective performance based on end-to-end (E2E) metrics such as SPSNR-NN, and WS-PSNR, currently developed in the JVET committee; and (2) informal subjective assessment of static viewports. Constant quality encoding is performed with all the three codecs for an unbiased comparison of the core coding tools. Our general conclusion is that under constant quality coding, AV1 underperforms HEVC, which underperforms JVET. We also test with rate control, where AV1 currently underperforms the open source X265 HEVC codec. Objective and visual evidence is provided.
National Research Council Canada - National Science Library
Morrison, Devin
2002-01-01
360-degree feedback is a personal development and appraisal tool designed to quantify the competencies and skills of fellow employees by tapping the collective experience of their superiors, subordinates, and peers...
The usefulness of 360 degree feedback in developing a personal work style
Chicu Nicoleta; Nedelcu Alexandra Catalina
2017-01-01
The present study focuses on a new approach in the process of developing personal work styles, based on the usefulness of 360 degree feedback, taking into consideration the following dimensions: work-life balance, gender-age, self-development and the behavior a person has, following the process of self-development and defining work style. Using different approaches, the study attempts to identify if there are some differences between the evaluations received from the family and the ones from ...
Intermittency patterns in pp collisions at 360 GeV/c
International Nuclear Information System (INIS)
Singh, J.B.; Kohli, J.M.
1991-01-01
The intermittency effect has been observed in pp collisions at 360 GeV/c and the strength decreases with the increase in multiplicity. The low multiplicity events in pp data (n ch ≤ 8), anti pp collisions (n ch ≤ 15) at Collider energy and elementary interaction (e + e - , μp) samples have almost the same strength. Most likely, few sources seem to contribute at lower multiplications. The intermittency effect is less in pp data compared to e + e - data, however it is fairly strong as compared to nucleus data. The presently used hadronization models DPM, LUND and FRITIOF do not reproduce the results fully. (orig.)
Detection Thresholds for Rotation and Translation Gains in 360° Video-Based Telepresence Systems.
Zhang, Jingxin; Langbehn, Eike; Krupke, Dennis; Katzakis, Nicholas; Steinicke, Frank
2018-04-01
Telepresence systems have the potential to overcome limits and distance constraints of the real-world by enabling people to remotely visit and interact with each other. However, current telepresence systems usually lack natural ways of supporting interaction and exploration of remote environments (REs). In particular, single webcams for capturing the RE provide only a limited illusion of spatial presence, and movement control of mobile platforms in today's telepresence systems are often restricted to simple interaction devices. One of the main challenges of telepresence systems is to allow users to explore a RE in an immersive, intuitive and natural way, e.g., by real walking in the user's local environment (LE), and thus controlling motions of the robot platform in the RE. However, the LE in which the user's motions are tracked usually provides a much smaller interaction space than the RE. In this context, redirected walking (RDW) is a very suitable approach to solve this problem. However, so far there is no previous work, which explored if and how RDW can be used in video-based 360° telepresence systems. In this article, we conducted two psychophysical experiments in which we have quantified how much humans can be unknowingly redirected on virtual paths in the RE, which are different from the physical paths that they actually walk in the LE. Experiment 1 introduces a discrimination task between local and remote translations, and in Experiment 2 we analyzed the discrimination between local and remote rotations. In Experiment 1 participants performed straightforward translations in the LE that were mapped to straightforward translations in the RE shown as 360° videos, which were manipulated by different gains. Then, participants had to estimate if the remotely perceived translation was faster or slower than the actual physically performed translation. Similarly, in Experiment 2 participants performed rotations in the LE that were mapped to the virtual rotations
Verbauwhede, Annelien E; Lambrecht, Marlies A; Fierens, Ellen; Hermans, Senne; Shegay, Oksana; Brijs, Kristof; Delcour, Jan A
2018-10-30
The thermo-active serine peptidase aqualysin 1 (Aq1) of Thermus aquaticus was applied in bread making to study the relative contribution of thermoset gluten to bread crumb texture. Aq1 is active between 30 °C and 90 °C with an optimum activity temperature of around 65 °C. It is inhibited by wheat endogenous serine peptidase inhibitors during dough mixing and fermentation and starts hydrolyzing gluten proteins during baking above 80 °C when the enzyme is no longer inhibited and most of the starch is gelatinized and contributes to structure formation. Aq1 activity reduced the molecular weight of gluten proteins and significantly increased their extractability in sodium dodecyl sulfate containing medium. While it had no impact on the specific bread volume and only limited impact on hardness, cohesiveness, springiness, resilience and chewiness, it impacted bread crumb coherence. We conclude that starch has a greater impact on crumb texture than thermoset gluten. Copyright © 2018 Elsevier Ltd. All rights reserved.
Tsai, Patricia
2013-01-01
The 360 deal has been an attractive option for music labels in the United States to gain traction in the faltering music industry, but potential legal obstacles may hinder the incentive to enter into the deals both for the label and for the artist. Labels entering into 360 deals may find themselves liable for violating the Seven-Year Statute or ...
Charm hadron properties in 360 GeV/c π-p-interactions
International Nuclear Information System (INIS)
Aguilar-Benitez, M.; Colino, N.; Ladron de Guevara, P.; Willmott, C.; Allison, W.W.M.; Colwill, S.; Lyons, L.; Wright, P.; Bailly, J.L.; Baland, J.F.; Grard, F.; Kesteman, J.; Pilette, P.; Banerjee, S.; Ganguli, S.; Malhotra, P.K.; Shankar, K.; Subramanian, A.; Bartl, W.; Epp, B.; Hrubec, J.; Pernicka, M.; Rohringer, H.; Begalli, M.; Otter, G.; Ransone, G.; Schulte, R.; Struczinski, W.; Belliere, P.; Defoix, C.; Dolbeau, J.; Laloum, M.; Bettini, A.; Checchia, P.; Cresti, M.; De-Angelis, A.; Gasparini, U.; Mazzucato, M.; Pinori, C.; Ventura, L.; Zotto, P.L.; Zumerle, G.; Billy, L. de; Briand, H.; Dumarchez, J.; Nguyen, H.K.; Touboul, M.C.; Bizarri, R.; Capua, E. di; Falciano, S.; Gentile, S.; Marel, G.; Marzano, F.; Piredda, G.; Zanello, L.; Borreani, G.; Garbellini, L.; Marchetto, F.; Rinaudo, G.; Brun, R.; Fernandez, C.; Goshaw, A.; Gurtu, A.; Hernandez, J.J.; Herve, A.; Iori, M.; Leutz, H.; Montanet, L.; Neuhofer, G.; Nowak, H.; Poppleton, A.; Powell, B.; Reucroft, S.; Richardson, J.; Schouten, M.; Bugg, W.M.; Handler, T.; Hart, E.L.; Caso, C.; Contri, R.; Fontanelli, F.; Monge, R.; Squarcia, S.; Trevisan, U.; Castelli, E.; Poropat, P.; Sessa, M.; Troncon, C.; Chliapnikov, P.; Fisyak, Yu.; Kistenev, E.; Kniazev, V.; Stopchenko, V.; Uvarov, V.; Vlasov, E.; Yarba, V.; Crennel, D.; Fisher, C.; Hughes, P.; MacDermott, M.; Dimarco, R.; Plano, R.; Stamer, P.; Fry, J.R.; Houlden, M.A.; Mason, P.; Patel, G.D.; Roberts, K.; Hamatsu, R.; Iga, Y.; Kita, I.; Kitamura, S.; Oshima, N.; Tsurugai, T.; Yamagata, T.; Haupt, L.; Hellman, S.; Holmgren, S.O.; Johanson, E.; Nilsson, S.; Sellden, B.; Huss, D.; Jegham, E.; Michalon, A.; Michalon-Mentzer, M.E.; Voltolini, C.; Lemonne, J.; Vilain, P.; Vonck, B.; Wickens, J.
1986-01-01
A study of the properties of charm particles produced in 360 GeV/c π - p interactions is reported. The experiment was performed using the high resolution hydrogen bubble chamber LEBC in association with the European Hybrid Spectrometer at the CERN SPS. Details of the exposure and operation of the spectrometer are given and the methods used to extract the charm data are presented. The essential physics results on the decay properties (lifetime, branching ratios) as well as on the hadroproduction properties (cross sections for D, anti D, F, Λsub(c), Dsup(*), correlations between charm particles) are given. (orig.)
Directory of Open Access Journals (Sweden)
Jessica H Brehm
Full Text Available We previously demonstrated in vitro that zidovudine (AZT selects for A371V in the connection domain and Q509L in ribonuclease H (RNase H domain of HIV-1 reverse transcriptase (RT which, together with the thymidine analog mutations D67N, K70R and T215F, confer greater than 100-fold AZT resistance. The goal of the current study was to determine whether AZT monotherapy in HIV-1 infected patients also selects the A371V, Q509L or other mutations in the C-terminal domains of HIV-1 RT.Full-length RT sequences in plasma obtained pre- and post-therapy were compared in 23 participants who received AZT monotherapy from the AIDS Clinical Trials Group study 175. Five of the 23 participants reached a primary study endpoint. Mutations significantly associated with AZT monotherapy included K70R (p = 0.003 and T215Y (p = 0.013 in the polymerase domain of HIV-1 RT, and A360V (p = 0.041 in the connection domain of HIV-1 RT. HIV-1 drug susceptibility assays demonstrated that A360V, either alone or in combination with thymidine analog mutations, decreased AZT susceptibility in recombinant viruses containing participant-derived full-length RT sequences or site-directed mutant RT. Biochemical studies revealed that A360V enhances the AZT-monophosphate excision activity of purified RT by significantly decreasing the frequency of secondary RNase H cleavage events that reduce the RNA/DNA duplex length and promote template/primer dissociation.The A360V mutation in the connection domain of RT was selected in HIV-infected individuals that received AZT monotherapy and contributed to AZT resistance.
International Nuclear Information System (INIS)
Richardson, R.M.
1979-12-01
A suite of programs for analysing neutron scattering data from time-of-flight spectrometers has been implemented on the Rutherford Laboratory IBM 360/195 computer system. The programs are intended for near inelastic and quasielastic data and operate by convoluting the measured instrumental resolution function with a model scattering function before fitting to the measured sample scattering law. (author)
Extreme embrittlement of austenitic stainless steel irradiated to 75-81 dpa at 335-360{degrees}C
Energy Technology Data Exchange (ETDEWEB)
Porollo, S.I.; Vorobjev, A.N.; Konobeev, Yu.V. [Institute of Physics and Power Engineering, Obninsk (Russian Federation)] [and others
1997-04-01
It is generally accepted that void swelling of austenitic steels ceases below some temperature in the range 340-360{degrees}C, and exhibits relatively low swelling rates up to {approximately}400{degrees}C. This perception may not be correct at all irradiation conditions, however, since it was largely developed from data obtained at relatively high displacement rates in fast reactors whose inlet temperatures were in the range 360-370{degrees}C. There is an expectation, however, that the swelling regime can shift to lower temperatures at low displacement rates via the well-known {open_quotes}temperature shift{close_quotes} phenomenon. It is also known that the swelling rates at the lower end of the swelling regime increase continuously at a sluggish rate, never approaching the terminal 1%/dpa level within the duration of previous experiments. This paper presents the results of an experiment conducted in the BN-350 fast reactor in Kazakhstan that involved the irradiation of argon-pressurized thin-walled tubes (0-200 MPa hoop stress) constructed from Fe-16Cr-15Ni-3Mo-Nb stabilized steel in contact with the sodium coolant, which enters the reactor at {approx}270{degrees}C. Tubes in the annealed condition reached 75 dpa at 335{degrees}C, and another set in the 20% cold-worked condition reached 81 dpa at 360{degrees}C. Upon disassembly all tubes, except those in the stress-free condition, were found to have failed in an extremely brittle fashion. The stress-free tubes exhibited diameter changes that imply swelling levels ranging from 9 to 16%. It is expected that stress-enhancement of swelling induced even larger swelling levels in the stressed tubes.
Extreme embrittlement of austenitic stainless steel irradiated to 75-81 dpa at 335-360 degrees C
International Nuclear Information System (INIS)
Porollo, S.I.; Vorobjev, A.N.; Konobeev, Yu.V.
1997-01-01
It is generally accepted that void swelling of austenitic steels ceases below some temperature in the range 340-360 degrees C, and exhibits relatively low swelling rates up to ∼400 degrees C. This perception may not be correct at all irradiation conditions, however, since it was largely developed from data obtained at relatively high displacement rates in fast reactors whose inlet temperatures were in the range 360-370 degrees C. There is an expectation, however, that the swelling regime can shift to lower temperatures at low displacement rates via the well-known open-quotes temperature shiftclose quotes phenomenon. It is also known that the swelling rates at the lower end of the swelling regime increase continuously at a sluggish rate, never approaching the terminal 1%/dpa level within the duration of previous experiments. This paper presents the results of an experiment conducted in the BN-350 fast reactor in Kazakhstan that involved the irradiation of argon-pressurized thin-walled tubes (0-200 MPa hoop stress) constructed from Fe-16Cr-15Ni-3Mo-Nb stabilized steel in contact with the sodium coolant, which enters the reactor at ∼270 degrees C. Tubes in the annealed condition reached 75 dpa at 335 degrees C, and another set in the 20% cold-worked condition reached 81 dpa at 360 degrees C. Upon disassembly all tubes, except those in the stress-free condition, were found to have failed in an extremely brittle fashion. The stress-free tubes exhibited diameter changes that imply swelling levels ranging from 9 to 16%. It is expected that stress-enhancement of swelling induced even larger swelling levels in the stressed tubes
Directory of Open Access Journals (Sweden)
Theresa Tiefenbrunn
Full Text Available The fundamental chemistry underpinning aerobic life on Earth involves reduction of dioxygen to water with concomitant proton translocation. This process is catalyzed by members of the heme-copper oxidase (HCO superfamily. Despite the availability of crystal structures for all types of HCO, the mode of action for this enzyme is not understood at the atomic level, namely how vectorial H(+ and e(- transport are coupled. Toward addressing this problem, we report wild type and A120F mutant structures of the ba(3-type cytochrome c oxidase from Thermus thermophilus at 1.8 Å resolution. The enzyme has been crystallized from the lipidic cubic phase, which mimics the biological membrane environment. The structures reveal 20 ordered lipid molecules that occupy binding sites on the protein surface or mediate crystal packing interfaces. The interior of the protein encloses 53 water molecules, including 3 trapped in the designated K-path of proton transfer and 8 in a cluster seen also in A-type enzymes that likely functions in egress of product water and proton translocation. The hydrophobic O(2-uptake channel, connecting the active site to the lipid bilayer, contains a single water molecule nearest the Cu(B atom but otherwise exhibits no residual electron density. The active site contains strong electron density for a pair of bonded atoms bridging the heme Fe(a3 and Cu(B atoms that is best modeled as peroxide. The structure of ba(3-oxidase reveals new information about the positioning of the enzyme within the membrane and the nature of its interactions with lipid molecules. The atomic resolution details provide insight into the mechanisms of electron transfer, oxygen diffusion into the active site, reduction of oxygen to water, and pumping of protons across the membrane. The development of a robust system for production of ba(3-oxidase crystals diffracting to high resolution, together with an established expression system for generating mutants, opens the
Consensus Control Design for 360 MN Extrusion Machine Producing Process
Directory of Open Access Journals (Sweden)
Chao Wang
2014-01-01
Full Text Available This paper mainly addresses the issue of 360 MN extrusion machine and focuses on the stabilization control of main table attitude. We will first introduce the problem and then model the extrusion machine. As the machine is a multi-input multioutput (MIMO and strong coupling system, it is challenging to apply existing control theory to design a controller to stabilize the main table attitude. Motivated by recent research in the field of multiagent systems, we design a consensus control protocol for our system and derive our convergence conditions based directly on Routh stability criterion. The advantages of the design are also demonstrated by numerical simulation.
DEFF Research Database (Denmark)
Xue, Weiqi; Sales, Salvador; Capmany, Jose
2010-01-01
In this work we demonstrate for the first time, to the best of our knowledge, a continuously tunable 360° microwave phase shifter spanning a microwave bandwidth of several tens of GHz (up to 40 GHz) by slow light effects. The proposed device exploits the phenomenon of coherent population oscillat...... of the suggested technique, dictated by the underlying physics, are also analyzed....
International Nuclear Information System (INIS)
Blamey, C.
1977-01-01
In order to assess the problems which might arise from monitoring a comprehensive test ban treaty by seismological methods, an experimental monitoring operation is being conducted. This work has involved the establishment of a database on the Rutherford Laboratory 360/195 system computer. The database can be accessed in the UK over the public telephone network and in the USA via ARPANET. (author)
Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji
2009-04-01
The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.
Schep, Daniel G.; Rubinstein, John L.
2016-01-01
Rotary ATPases couple ATP synthesis or hydrolysis to proton translocation across a membrane. However, understanding proton translocation has been hampered by a lack of structural information for the membrane-embedded a subunit. The V/A-ATPase from the eubacterium Thermus thermophilus is similar in structure to the eukaryotic V-ATPase but has a simpler subunit composition and functions in vivo to synthesize ATP rather than pump protons. We determined the T. thermophilus V/A-ATPase structure by cryo-EM at 6.4 Å resolution. Evolutionary covariance analysis allowed tracing of the a subunit sequence within the map, providing a complete model of the rotary ATPase. Comparing the membrane-embedded regions of the T. thermophilus V/A-ATPase and eukaryotic V-ATPase from Saccharomyces cerevisiae allowed identification of the α-helices that belong to the a subunit and revealed the existence of previously unknown subunits in the eukaryotic enzyme. Subsequent evolutionary covariance analysis enabled construction of a model of the a subunit in the S. cerevisae V-ATPase that explains numerous biochemical studies of that enzyme. Comparing the two a subunit structures determined here with a structure of the distantly related a subunit from the bovine F-type ATP synthase revealed a conserved pattern of residues, suggesting a common mechanism for proton transport in all rotary ATPases. PMID:26951669
International Nuclear Information System (INIS)
Snow, Bruce A.; Maciuska, Frank
2001-01-01
Error-free operation is the ultimate objective of any safety culture. Ginna Training and Operations has embarked on an approach directed at further developing coaching skills, attitudes, and values. To accomplish this, a 360-deg assessment process designed to enhance coaching skills, attitudes, and values has been implemented. The process includes measuring participants based on a set of values and an individual self-development plan based on the feedback from the 360-deg assessment. The skills and experience of the people who make up that culture are irreplaceable. As nuclear organizations mature and generations retire, knowledge and skills must be transferred to the incoming generations without a loss in performance. The application of a 360- deg assessment process can shift the culture to include coaching in a strong command and control environment. It is a process of change management strengthened by experience while meeting the challenge to improve human performance by changing workplace attitudes. At Ginna, training programs and new processes were initiated to pursue the ultimate objective: error-free operation. The overall objective of the programs is to create a common knowledge base and the skill required to consistently incorporate ownership of 'coach and collaborate' responsibility into a strong existing 'command and control' culture. This involves the role of coach; the role of communications; and concept integration, which includes communications, coaching, and team dimensional training (TDT). The overall objective of the processes, TDT and shifting to a coaching culture through the application of a 360-deg assessment process, is to provide guidance for applying the skills learned in the programs. As depicted in Fig. 1, the TDT (a process that identifies 'strengths and challenges') can be greatly improved by applying good communications and coaching practices. As the training programs were implemented, the participants were observed and coached in
Design and Implementation of a Novel Portable 360° Stereo Camera System with Low-Cost Action Cameras
Holdener, D.; Nebiker, S.; Blaser, S.
2017-11-01
The demand for capturing indoor spaces is rising with the digitalization trend in the construction industry. An efficient solution for measuring challenging indoor environments is mobile mapping. Image-based systems with 360° panoramic coverage allow a rapid data acquisition and can be processed to georeferenced 3D images hosted in cloud-based 3D geoinformation services. For the multiview stereo camera system presented in this paper, a 360° coverage is achieved with a layout consisting of five horizontal stereo image pairs in a circular arrangement. The design is implemented as a low-cost solution based on a 3D printed camera rig and action cameras with fisheye lenses. The fisheye stereo system is successfully calibrated with accuracies sufficient for the applied measurement task. A comparison of 3D distances with reference data delivers maximal deviations of 3 cm on typical distances in indoor space of 2-8 m. Also the automatic computation of coloured point clouds from the stereo pairs is demonstrated.
International Nuclear Information System (INIS)
Leger, D.; Tordera, V.; Spik, G.; Dorland, L.; Haverkamp, J.; Vliegenthart, J.F.G.
1978-01-01
The glycopeptide fraction of rabbit serotransferrin (STF) has been investigated applying an original method for the determination of glycan primary structure combining monosaccharide determination, permethylation and 360 MHz 1 H NMR. It is concluded that the highly purified rabbit transferrin contains only 1 glycan chain/molecule. A heterogeneity of the glycan moiety in the sialic acid residues was observed on isolation by paper electrophoresis of a disialylglycopeptide G-1 and a monosialylglycopeptide 2. The primary structure of glycopeptide G-1 deduced on the basis of the data of carbohydrate composition, permethylation analysis and 360 MHz 1 H NMR spectroscopy is identical to the primary structure of human serotransferrin glycan and the glycopeptide G-2 was shown by 1 H NMR spectroscopy, to be a mixture of two isomeric monosialylglycopeptides. (Auth.)
Wee, S. Y.; Edgcomb, V. P.; Burgaud, G.; Klein, F.; Schubotz, F.; Yvon-Lewis, S. A.; Sylvan, J. B.
2017-12-01
International Ocean Discovery Program (IODP) Expedition 360 represents the first leg of a multi-phase drilling program, SloMo, aimed at investigating the nature of the lower crust and Moho at slow spreading ridges. The goal of Expedition 360 was to recover a representative transect of the lower oceanic crust formed at Atlantis Bank, an oceanic core complex on the SW Indian Ridge. Recovered cores were primarily gabbro and olivine gabbro, which may potentially host serpentinization reactions and associated microbial life. Our goal was to sample this subseafloor environment and determine quantity, diversity and metabolic capabilities of any resident microbial life. Hole U1473A was drilled during Expedition 360 down to 790 m below seafloor and samples for detection of microbial communities and microbial biosignatures were collected throughout. We present here quantification of microbial biomass via fluorescence microscopy, preliminary analysis of nutrient addition experiments, data from sequencing of microbial 16S rRNA genes, analysis of microbial lipids, and data from Raman spectra of subsurface isolates. We initiated and sampled 12 nutrient addition experiments from 71-745 mbsf by adding sampled rocks to artificial seawater with no additions, added ammonium, added ammonium plus phosphate, and added organic acids. In nearly all of the experiment bottles, methane was detected when samples were collected at six months and again after one year of incubation. Phosphate in the incubations was drawn down, indicating active microbial metabolism, and archaeal lipids from in situ samples indicate the presence of methanogens, corroborating the likelihood of methanogens as the source of detected methane in the nutrient addition incubations. Altogether, the interdisciplinary approach used here provides a peek into life in the subseafloor upper ocean crust.
IMPROVING SPHERICAL PHOTOGRAMMETRY USING 360° OMNI-CAMERAS: USE CASES AND NEW APPLICATIONS
Directory of Open Access Journals (Sweden)
G. Fangi
2018-05-01
Full Text Available During the last few years, there has been a growing exploitation of consumer-grade cameras allowing one to capture 360° images. Each device has different features and the choice should be entrusted on the use and the expected final output. The interest on such technology within the research community is related to its use versatility, enabling the user to capture the world with an omnidirectional view with just one shot. The potential is huge and the literature presents many use cases in several research domains, spanning from retail to construction, from tourism to immersive virtual reality solutions. However, the domain that could the most benefit is Cultural Heritage (CH, since these sensors are particularly suitable for documenting a real scene with architectural detail. Following the previous researches conducted by Fangi, which introduced its own methodology called Spherical Photogrammetry (SP, the aim of this paper is to present some tests conducted with the omni-camera Panono 360° which reach a final resolution comparable with a traditional camera and to validate, after almost ten years from the first experiment, its reliability for architectural surveying purposes. Tests have been conducted choosing as study cases Santa Maria della Piazza and San Francesco alle scale Churches in Ancona, Italy, since they were previously surveyed and documented with SP methodology. In this way, it has been possible to validate the accuracy of the new survey, performed by means an omni-camera, compared with the previous one for both outdoor and indoor scenario. The core idea behind this work is to validate if this new sensor can replace the standard image collection phase, speeding up the process, assuring at the same time the final accuracy of the survey. The experiment conducted demonstrate that, w.r.t. the SP methodology developed so far, the main advantage in using 360° omni-directional cameras lies on increasing the rapidity of acquisition and
Surerus, K K; Oertling, W A; Fan, C; Gurbiel, R J; Einarsdóttir, O; Antholine, W E; Dyer, R B; Hoffman, B M; Woodruff, W H; Fee, J A
1992-01-01
Cytochrome ba3 from Thermus thermophilus reacts slowly with excess HCN at pH 7.4 to create a form of the enzyme in which CuA, cytochrome b, and CuB remain oxidized, while cytochrome a3 is reduced by one electron, presumably with the formation of cyanogen. We have examined this form of the enzyme by UV-visible, resonance Raman, EPR, and electron nuclear double resonance spectroscopies in conjunction with permutations of 13C- and 15N-labeled cyanide. The results support a model in which one CN- binds through the carbon atom to ferrous a3, supporting a low-spin (S = 0) configuration on the Fe; bridging by this cyanide to the CuB is weak or absent. Four 14N atoms, presumably donated by histidine residues of the protein, provide a strong equatorial ligand field about CuB; a second CN- is coordinated through the carbon atom to CuB in an axial position. PMID:1314380
NCBI nr-aa BLAST: CBRC-TBEL-01-0397 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TBEL-01-0397 ref|YP_145234.1| competence protein ComEC [Thermus thermophilus HB8] dbj|BAD71791.1| compe...tence protein ComEC [Thermus thermophilus HB8] YP_145234.1 0.020 31% ...
Directory of Open Access Journals (Sweden)
Saurav Mallik
Full Text Available Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU. Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend.
International Nuclear Information System (INIS)
Pioszak, Augen A.; Murayama, Kazutaka; Nakagawa, Noriko; Ebihara, Akio; Kuramitsu, Seiki; Shirouzu, Mikako; Yokoyama, Shigeyuki
2005-01-01
Three structures of a putative RNA 5-methyluridine methyltransferase from T. thermophilus, including its complex with S-adenosyl-l-homocysteine, are presented. The structures reveal the mode of cofactor binding, architecture of the putative active site, and the presence of a deep cleft adjacent to the active site that may bind RNA. The Thermus thermophilus hypothetical protein TTHA1280 belongs to a family of predicted S-adenosyl-l-methionine (AdoMet) dependent RNA methyltransferases (MTases) present in many bacterial and archaeal species. Inspection of amino-acid sequence motifs common to class I Rossmann-fold-like MTases suggested a specific role as an RNA 5-methyluridine MTase. Selenomethionine (SeMet) labelled and native versions of the protein were expressed, purified and crystallized. Two crystal forms of the SeMet-labelled apoprotein were obtained: SeMet-ApoI and SeMet-ApoII. Cocrystallization of the native protein with S-adenosyl-l-homocysteine (AdoHcy) yielded a third crystal form, Native-AdoHcy. The SeMet-ApoI structure was solved by the multiple anomalous dispersion method and refined at 2.55 Å resolution. The SeMet-ApoII and Native-AdoHcy structures were solved by molecular replacement and refined at 1.80 and 2.60 Å, respectively. TTHA1280 formed a homodimer in the crystals and in solution. Each subunit folds into a three-domain structure composed of a small N-terminal PUA domain, a central α/β-domain and a C-terminal Rossmann-fold-like MTase domain. The three domains form an overall clamp-like shape, with the putative active site facing a deep cleft. The architecture of the active site is consistent with specific recognition of uridine and catalysis of methyl transfer to the 5-carbon position. The cleft is suitable in size and charge distribution for binding single-stranded RNA.
The usefulness of 360 degree feedback in developing a personal work style
Directory of Open Access Journals (Sweden)
Chicu Nicoleta
2017-07-01
Full Text Available The present study focuses on a new approach in the process of developing personal work styles, based on the usefulness of 360 degree feedback, taking into consideration the following dimensions: work-life balance, gender-age, self-development and the behavior a person has, following the process of self-development and defining work style. Using different approaches, the study attempts to identify if there are some differences between the evaluations received from the family and the ones from the work environment. All these factors aim at improving personal, but also organizational performances. Based on the current body of the literature, a discussion is made and conclusions are presented.
41 CFR 102-38.360 - What must an executive agency do to implement the eFAS program?
2010-07-01
... PROPERTY 38-SALE OF PERSONAL PROPERTY Implementation of the Federal Asset Sales Program § 102-38.360 What must an executive agency do to implement the eFAS program? (a) An executive agency must review the effectiveness of all sales solutions, and compare them to the effectiveness (e.g., cost, level of service, and...
Energy Technology Data Exchange (ETDEWEB)
Leger, D; Tordera, V; Spik, G [Lille-1 Univ., 59 - Villeneuve-d' Ascq (France); Dorland, L; Haverkamp, J; Vliegenthart, J F.G. [Rijksuniversiteit Utrecht (Netherlands)
1978-09-15
The glycopeptide fraction of rabbit serotransferrin (STF) has been investigated applying an original method for the determination of glycan primary structure combining monosaccharide determination, permethylation and 360 MHz /sup 1/H NMR. It is concluded that the highly purified rabbit transferrin contains only 1 glycan chain/molecule. A heterogeneity of the glycan moiety in the sialic acid residues was observed on isolation by paper electrophoresis of a disialylglycopeptide G-1 and a monosialylglycopeptide 2. The primary structure of glycopeptide G-1 deduced on the basis of the data of carbohydrate composition, permethylation analysis and 360 MHz /sup 1/H NMR spectroscopy is identical to the primary structure of human serotransferrin glycan and the glycopeptide G-2 was shown by /sup 1/H NMR spectroscopy, to be a mixture of two isomeric monosialylglycopeptides.
Directory of Open Access Journals (Sweden)
Torres Leticia L
2012-08-01
Full Text Available Abstract Background Penicillin acylases (PACs are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Results Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1. The optimum pH was aprox. 4 and the optimum
Torres, Leticia L; Ferreras, Eloy R; Cantero, Angel; Hidalgo, Aurelio; Berenguer, José
2012-08-09
Penicillin acylases (PACs) are enzymes of industrial relevance in the manufacture of β-lactam antibiotics. Development of a PAC with a longer half-life under the reaction conditions used is essential for the improvement of the operational stability of the process. A gene encoding a homologue to Escherichia coli PAC was found in the genome of the thermophilic bacterium Thermus thermophilus (Tth) HB27. Because of the nature of this PAC and its complex maturation that is crucial to reach its functional heterodimeric final conformation, the overexpression of this enzyme in a heterologous mesophilic host was a challenge. Here we describe the purification and characterization of the PAC protein from Tth HB27 overexpressed in Escherichia coli. Fusions to a superfolder green fluorescent protein and differential membrane solubilization assays indicated that the native enzyme remains attached through its amino-terminal end to the outer side of the cytoplasmic membrane of Tth cells. In order to overexpress this PAC in E. coli cells, a variant of the protein devoid of its membrane anchoring segment was constructed. The effect of the co-expression of chaperones and calcium supplementation of the culture medium was investigated. The total production of PAC was enhanced by the presence of DnaK/J and GrpE and even more by trigger factor and GroEL/ES. In addition, 10 mM calcium markedly improved both PAC specific and volumetric activities. Recombinant PAC was affinity-purified and proper maturation of the protein was confirmed by SDS-PAGE and MALDI-TOF analysis of the subunits. The recombinant protein was tested for activity towards several penicillins, cephalosporins and homoserine lactones. Hydrophobic acyl-chain penicillins were preferred over the rest of the substrates. Penicillin K (octanoyl penicillin) was the best substrate, with the highest specificity constant value (16.12 mM-1.seg-1). The optimum pH was aprox. 4 and the optimum temperature was 75 °C. The half-life of
COLLAGE 360: A Model of Person-Centered Care To Promote Health Among Older Adults.
Howard, Elizabeth P; Schreiber, Robert; Morris, John N; Russotto, Aline; Flashner-Fineman, Susan
2016-01-01
Health care leaders and providers have introduced the assumption the typical elder, even in the presence of complex, chronic disease and prevailing illness, is capable of assuming greater personal responsibility for their health care, with a shift from provider-centered to a person-centered model of care. For older adults who often and repeatedly face challenges managing and maintaining their health status, guidance and support is needed. In this study, COLLAGE 360 , a comprehensive assessment system and wellness coaching program that focuses on prevention and wellness, care coordination and self-management of health care was implemented in one continuing care retirement community. Following completion of two assessment tools via directed conversation with a wellness coach, older adults developed an individualized vitality plan that outlined life goals, supporting goals and action plans for goal achievement. Results from this program suggest engagement in the assessment and wellness coaching process via the COLLAGE 360 program translated into sample older adults sensing that they live in a more supportive environment when compared with elders not receiving any wellness coaching. In addition, the older adults had positive effects in the areas of mood, loneliness, social interaction, health status, and life satisfaction. Strategies to improve health and well being need an extended focus beyond the older adult's medical conditions and consider psychological, spiritual and social needs with personal preferences being paramount. These issues are foundational to a person-centered, health promotion approach needed among this population.
International Nuclear Information System (INIS)
Bergstrom, Dane; Leyton, Jeffrey V.; Zereshkian, Arman; Chan, Conrad; Cai, Zhongli; Reilly, Raymond M.
2016-01-01
Introduction: 111 In-DTPA-NLS-CSL360 radioimmunoconjugates (RIC) recognize the overexpression of the interleukin-3 receptor α-subchain (CD123) relative to the β-subchain (CD131) on leukemia stem cells (LSC). Our aim was to study Auger electron radioimmunotherapy (RIT) of acute myeloid leukemia (AML) with 111 In-DTPA-NLS-CSL360 in non-obese diabetic severe combined immunodeficiency (NOD/SCID) mice or NOD-Rag1 null IL2rγ null (NRG) mice engrafted with CD123 + human AML-5 cells. Methods: The toxicity of three doses of 111 In-DTPA-NLS-CSL360 (3.3–4.8 MBq; 11–15 μg each) injected i.v. every two weeks was studied in non-engrafted NOD/SCID or NRG mice pre-treated with 200 cGy of γ-radiation required for AML engraftment. Engraftment efficiency of (1–5) × 10 6 cells AML-5 cells inoculated i.v. into NOD/SCID or NRG mice was assessed by flow cytometric analysis for human CD45 + (hCD45 + ) cells in the bone marrow (BM) and spleen. AML-5 engrafted mice were treated with two or three doses (3.7 MBq; 10 μg each) every two weeks of 111 In-DTPA-NLS-CSL360, non-specific 111 In-DTPA-NLS-hIgG, unlabeled CSL360 (10 μg) or normal saline. The percentage of hCD45 + cells in the BM and spleen were measured at one week after completion of treatment. Results: 111 In-DTPA-NLS-CSL360 in combination with 200 cGy of γ-radiation caused an initial transient decrease in body weight in NOD/SCID but not in NRG mice. There were no hematological, liver or kidney toxicities. The spleen exhibited 13-fold lower engraftment efficiency than the BM in NOD/SCID mice inoculated with 1 × 10 6 cells but both organs were highly (>85%) engrafted in NRG mice. Unexpectedly, 111 In-DTPA-NLS-CSL360 or non-specific 111 In-DTPA-NLS-hIgG caused a paradoxical 1.5-fold increase (P < 0.0001) in the proportion of hCD45 + cells in the BM of NOD/SCID mice compared to normal saline treated mice. 111 In-DTPA-NLS-CSL360 reduced hCD45 + cells in the spleen by 3.0-fold compared to 111 In-DTPA-NLS-hIgG (P = 0
Stupar-Rutenfrans, Snežana; Ketelaars, Loes E H; van Gisbergen, Marnix S
2017-10-01
With this article, we aim to increase our understanding of how mobile virtual reality exposure therapy (VRET) can help reduce speaking anxiety. Using the results of a longitudinal study, we examined the effect of a new VRET strategy (Public Speech Trainer, PST), that incorporates 360° live recorded VR environments, on the reduction of public speaking anxiety. The PST was developed as a 360° smartphone application for a VR head-mounted device that participants could use at home. Realistic anxiety experiences were created by means of live 360° video recordings of a lecture hall containing three training sessions based on graded exposure framework; empty classroom (a) and with a small (b) and large audience (c). Thirty-five students participated in all sessions using PST. Anxiety levels were measured before and after each session over a period of 4 weeks. As expected, speaking anxiety significantly decreased after the completion of all PST sessions, and the decrement was the strongest in participants with initially high speaking anxiety baseline levels. Results also revealed that participants with moderate and high speaking anxiety baseline level differ in the anxiety state pattern over time. Conclusively and in line with habituation theory, the results supported the notion that VRET is more effective when aimed at reducing high-state anxiety levels. Further implications for future research and improvement of current VRET strategies are discussed.
DEFF Research Database (Denmark)
Fonseca, Diana; Kraus, Martin
2016-01-01
The present study is designed to test how immersion, presence, and narrative content (with a focus on emotional immersion) can affect one's pro-environmental attitude and behavior with specific interest in 360° videos and meat consumption as a non pro-environmental behavior. This research describes...... a between-group design experiment that compares two systems with different levels of immersion and two types of narratives, one with and one without emotional content. In the immersive video (IV) condition (high immersion), 21 participants used a Head-Mounted Display (HMD) to watch an emotional 360° video...... about meat consumption and its effects on the environment; another 21 participants experienced the tablet condition (low immersion) where they viewed the same video but with a 10.1 inch tablet; 22 participants in the control condition viewed a non emotional video about submarines with an HMD...
Sancho, Juan; Lloret, Juan; Gasulla, Ivana; Sales, Salvador; Capmany, José
2011-08-29
A fully tunable microwave photonic phase shifter involving a single semiconductor optical amplifier (SOA) is proposed and demonstrated. 360° microwave phase shift has been achieved by tuning the carrier wavelength and the optical input power injected in an SOA while properly profiting from the dispersion feature of a conveniently designed notch filter. It is shown that the optical filter can be advantageously employed to switch between positive and negative microwave phase shifts. Numerical calculations corroborate the experimental results showing an excellent agreement.
Higuera-Trujillo, Juan Luis; López-Tarruella Maldonado, Juan; Llinares Millán, Carmen
2017-11-01
Psychological research into human factors frequently uses simulations to study the relationship between human behaviour and the environment. Their validity depends on their similarity with the physical environments. This paper aims to validate three environmental-simulation display formats: photographs, 360° panoramas, and virtual reality. To do this we compared the psychological and physiological responses evoked by simulated environments set-ups to those from a physical environment setup; we also assessed the users' sense of presence. Analysis show that 360° panoramas offer the closest to reality results according to the participants' psychological responses, and virtual reality according to the physiological responses. Correlations between the feeling of presence and physiological and other psychological responses were also observed. These results may be of interest to researchers using environmental-simulation technologies currently available in order to replicate the experience of physical environments. Copyright © 2017 Elsevier Ltd. All rights reserved.
Yamasaki, Takashi; Oohata, Yukiko; Nakamura, Toshiki; Watanabe, Yo-hei
2015-04-10
The ClpB/Hsp104 chaperone solubilizes and reactivates protein aggregates in cooperation with DnaK/Hsp70 and its cofactors. The ClpB/Hsp104 protomer has two AAA+ modules, AAA-1 and AAA-2, and forms a homohexamer. In the hexamer, these modules form a two-tiered ring in which each tier consists of homotypic AAA+ modules. By ATP binding and its hydrolysis at these AAA+ modules, ClpB/Hsp104 exerts the mechanical power required for protein disaggregation. Although ATPase cycle of this chaperone has been studied by several groups, an integrated understanding of this cycle has not been obtained because of the complexity of the mechanism and differences between species. To improve our understanding of the ATPase cycle, we prepared many ordered heterohexamers of ClpB from Thermus thermophilus, in which two subunits having different mutations were cross-linked to each other and arranged alternately and measured their nucleotide binding, ATP hydrolysis, and disaggregation abilities. The results indicated that the ATPase cycle of ClpB proceeded as follows: (i) the 12 AAA+ modules randomly bound ATP, (ii) the binding of four or more ATP to one AAA+ ring was sensed by a conserved Arg residue and converted another AAA+ ring into the ATPase-active form, and (iii) ATP hydrolysis occurred cooperatively in each ring. We also found that cooperative ATP hydrolysis in at least one ring was needed for the disaggregation activity of ClpB. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Digital Repository Service at National Institute of Oceanography (India)
Biju, A.; Honey, U.K.; Kusum, K.K.; Jagadeesan, L.
di ffe re nt se as o n s St at io n n o . La tit ud e (°N ) Lo ng itu de (°E ) IM S (20 04 ) SW M (20 05 ) N EM (20 06 ) S. gr a ci lis Te m pe ra tu re Sa lin ity S. gr a ci lis Te m pe ra tu re Sa lin ity S. gr a ci lis Te m pe ra tu re Sa lin ity... 04 ) SW M (20 05 ) N EM (20 06 ) S. gr a ci lis Te m pe ra tu re Sa lin ity S. gr a ci lis Te m pe ra tu re Sa lin ity S. gr a ci lis Te m pe ra tu re Sa lin ity de ns ity (°C ) de ns ity (°C ) de ns ity (°C ) 27 15 72 – 29 .7 35 .0 – 30 .7 35 .9...
NCBI nr-aa BLAST: CBRC-MLUC-01-1078 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-MLUC-01-1078 ref|ZP_03497741.1| DNA internalization-related competence protein... ComEC/Rec2 [Thermus aquaticus Y51MC23] gb|EED09156.1| DNA internalization-related competence protein ComEC/Rec2 [Thermus aquaticus Y51MC23] ZP_03497741.1 0.005 32% ...
IODP Expedition 360: Analyzing the Media Coverage of a High Profile Research Project
Kavanagh, L.; Martinez, A. O.; Burgio, M.; Zhang, J.; Expedition 360 Scientists, I.
2016-12-01
During Expedition 360 of the International Ocean Discovery Program (IODP), the JOIDES Resolution drilled 789 meters of lower crustal gabbro in the Southwest Indian Ocean. This hole began a multi-expedition project with the goal of one day drilling across the crust-mantle boundary for the first time. This simplified narrative of the research objectives struck a chord with media and the project received worldwide coverage in the form of over 50 stories with a total audience in the millions. This expedition is presented as a case study in science communication. A four-member education and outreach team onboard the ship acted as the point of contact for interested reporters. Major outlets that ran stories include the Australian Broadcasting Corporation, British Broadcasting Corporation, Boston Globe, Daily Express, Fox News, Nature, Smithsonian, and Chinese based Xinhua News Agency who sailed a reporter on the ship for the duration of the expedition. The majority of stories published provided accurate and favourable coverage of the project; however, a few contained critical errors and cast the expedition in a less positive light. Public reaction varied greatly depending on the article. Positive themes include interest in the scientific outcomes and encouragement of human exploration. Negative themes include the project being an inefficient use of money and a perceived risk of the drilling triggering an earthquake or volcano. Through a review of published articles and online comments, the successes and challenges faced by Expedition 360 are identified. Despite minimal preparation for media relations, the team successfully maintained a public profile while working in one of the most remote locations on Earth. Interviews were facilitated and videos, articles, and podcasts were produced onboard the ship. A simple, catchy narrative resulted in a large volume of coverage; however, this simplicity also formed the root of a number of misconceptions and issues of public concern.
Lanz, Julie J; Gregory, Paul J; Menendez, Mariano E; Harmon, Larry
2018-01-17
Physician performance is a complex construct that is broadly defined by technical and nontechnical components. The primary aim of this study was to identify which Big Five personality traits (openness, conscientiousness, extraversion, agreeableness, and emotional stability) in surgeons were related to patient satisfaction and teamwork performance in a surgical setting. A secondary aim of this study was to examine the specific perceptions of physician behavior related to patient satisfaction and teamwork performance. Orthopedic surgeons received anonymous multisource 360° feedback from managers, colleagues, nurses, technicians, and trainees. Personality traits were categorized with a modified Delphi Consensus technique using the Big Five framework. Patient satisfaction was measured using retrospective Clinician & Group-Consumer Assessment of Healthcare Providers and System (CG-CAHPS) data. Teamwork performance was measured using the Quality PULSE 360 Teamwork Index. Research was performed at a large academic medical center in the northeastern United States. Participants in this study included a sample of 24 orthopedic surgeons. Backward stepwise regressions were used to determine which model with the most variance used the fewest explanatory variables. Personality traits acted as predictor variables in the regression models and patient satisfaction and teamwork performance were utilized as outcome variables. The higher the physicians' emotional stability, the higher patients' overall satisfaction (β = 0.41, p = 0.04) and willingness to recommend them to other patients (β = 0.45, p = 0.03). Furthermore, high emotional stability was related to effective surgical teams as rated by team members (β = -0.75, p = 0.00) such that the more emotionally stable physicians were, the higher their teamwork rating by colleagues. Both physicians-in-training and in-practice physicians may benefit from engaging in empathic and constructive behaviors with patients and team members
Energy Technology Data Exchange (ETDEWEB)
Boreli, F M [Institute of Nuclear Sciences Boris Kidric, Vinca, Beograd (Yugoslavia)
1958-07-01
Reaction Li{sup 7}(p,n)Be{sup 7} was used as a neutron source to determine the strength functions on a number of intermediate and heavy nuclei at average neutron energies from 60 - 360 keV. The strength functions were obtained by measuring the deviation from exponential attenuation of neutrons passing through the sample. Values obtained at lower energies showed dependence on the atomic weight predicted by the optical model and were in agreement with previous measurements. For the elements in the region A=90 the fast increase of strength function obtained by assuming only S-wave interactions suggests that P-wave interactions are taking place.
HAL/S-FC and HAL/S-360 compiler system program description
1976-01-01
The compiler is a large multi-phase design and can be broken into four phases: Phase 1 inputs the source language and does a syntactic and semantic analysis generating the source listing, a file of instructions in an internal format (HALMAT) and a collection of tables to be used in subsequent phases. Phase 1.5 massages the code produced by Phase 1, performing machine independent optimization. Phase 2 inputs the HALMAT produced by Phase 1 and outputs machine language object modules in a form suitable for the OS-360 or FCOS linkage editor. Phase 3 produces the SDF tables. The four phases described are written in XPL, a language specifically designed for compiler implementation. In addition to the compiler, there is a large library containing all the routines that can be explicitly called by the source language programmer plus a large collection of routines for implementing various facilities of the language.
Luna-Oliva, Laura; Ortiz-Gutiérrez, Rosa María; Cano-de la Cuerda, Roberto; Piédrola, Rosa Martínez; Alguacil-Diego, Isabel M; Sánchez-Camarero, Carlos; Martínez Culebras, María Del Carmen
2013-01-01
Limited evidence is available about the effectiveness of virtual reality using low cost commercial consoles for children with developmental delay. The aim of this preliminary study is to evaluate the usefulness of a videogame system based on non-immersive virtual reality technology (Xbox 360 KinectTM) to support conventional rehabilitation treatment of children with cerebral palsy. Secondarily, to objectify changes in psychomotor status of children with cerebral palsy after receiving rehabilitation treatment in addition with this last generation game console. 11 children with cerebral palsy were included the study. A baseline, a post-treatment and a follow-up assessment were performed related to motor and the process skills, balance, gait speed, running and jumping and fine and manual finger dexterity. All the participants completed 8 weeks of videogame treatment, added to their conventional physiotherapy treatment, with Xbox 360 Kinect™ (Microsoft) game console. The Friedman test showed significant differences among the three assessments for each variable: GMFM (p = 0.001), AMPS motor (p = 0.001), AMPS process (p = 0.010), PRT (p = 0.005) and 10 MW (p = 0.029). Wilcoxon test showed significant statistically differences pre and post-treatment, in all the values. Similarly, results revealed significant differences between basal and follow-up assessment. There were not statistical differences between post-treatment and follow-up evaluation, indicating a long-term maintenance of the improvements achieved after treatment. Low cost video games based on motion capture are potential tools in the rehabilitation context in children with CP. Our Kinect Xbox 360 protocol has showed improvements in balance and ADL in CP participants in a school environment, but further studies are need to validate the potential benefits of these video game systems as a supplement for rehabilitation of children with CP.
A 360-degree floating 3D display based on light field regeneration.
Xia, Xinxing; Liu, Xu; Li, Haifeng; Zheng, Zhenrong; Wang, Han; Peng, Yifan; Shen, Weidong
2013-05-06
Using light field reconstruction technique, we can display a floating 3D scene in the air, which is 360-degree surrounding viewable with correct occlusion effect. A high-frame-rate color projector and flat light field scanning screen are used in the system to create the light field of real 3D scene in the air above the spinning screen. The principle and display performance of this approach are investigated in this paper. The image synthesis method for all the surrounding viewpoints is analyzed, and the 3D spatial resolution and angular resolution of the common display zone are employed to evaluate display performance. The prototype is achieved and the real 3D color animation image has been presented vividly. The experimental results verified the representability of this method.
Inclusive production of strange particles in 360 GeV/c PP interactions
International Nuclear Information System (INIS)
Rodrigo Anoro, T.
1985-01-01
Results on cross sections, longitudinal and transverse momentum distributions for ksub(s)sup(o), Λ and anti Λ production in 360 GeV/c PP interactions are presented as obtained from EHS equipped with the Rapid Cycling Bubble Chamber (RCBC). The Λ and anti Λ polarization are measured. The cross sections for the diffractive components are given using the recoil spectrum. The data are discussed with respect to charm production. The study on inclusive production of strange meson and baryon resonances is presented. Results on cross sections for K**(892), K* - (892), Σ + (1385) and Σ - (1285). Longitudinal and transverse momentum distributions for K*(892) and Σ(1385) are presented as well as for their induced Ksup(o's) and Λsup('s). An estimation is given on the K*(1430) and Σ* - (1915) productions. (author)
IN10 data processing on the Rutherford Laboratory IBM 360
International Nuclear Information System (INIS)
Howells, W.S.; Anderson, I.S.
1978-09-01
This report described modifications made to some of the IN10 spectrometer data analysis programs in use at the Institut Laue-Langevin, Grenoble in order that they may be used on the IBM 360 system at the Rutherford Laboratory. Fuller descriptions of the programs are contained in the original manual (Users' Guide to Processing IN10 Data by W S Howells, ILL Internal Report (1977). Programs discussed are: a) FAST. A program for fitting Lorentzians to raw data. This is a modification of the ILL programs FAST and HAST. b) SUPER. A convolution program for fitting quasielastic peaks to corrected data. This program is based on the ILL program SUPER. c) SAND. A convolution program for fitting an elastic and a Quasielastic peak to data. This is similar to the ILL version of SAND. d) SWIFT. A program similar to SUPER but faster. It is based on the ILL program CONTTY. Before using these programs users must consult the NBRU in order to obtain an account number and a user identifier. (U.K.)
Taniguchi, Hironori; Sungwallek, Sathidaphorn; Chotchuang, Phatcharin; Okano, Kenji; Honda, Kohsuke
2017-09-01
NAD (NAD + ) is a cofactor related to many cellular processes. This cofactor is known to be unstable, especially at high temperatures, where it chemically decomposes to nicotinamide and ADP-ribose. Bacteria, yeast, and higher organisms possess the salvage pathway for reconstructing NAD + from these decomposition products; however, the importance of the salvage pathway for survival is not well elucidated, except for in pathogens lacking the NAD + de novo synthesis pathway. Herein, we report the importance of the NAD + salvage pathway in the thermophilic bacterium Thermus thermophilus HB8 at high temperatures. We identified the gene encoding nicotinamidase (TTHA0328), which catalyzes the first reaction of the NAD + salvage pathway. This recombinant enzyme has a high catalytic activity against nicotinamide ( K m of 17 μM, k cat of 50 s -1 , k cat / K m of 3.0 × 10 3 s -1 · mM -1 ). Deletion of this gene abolished nicotinamide deamination activity in crude extracts of T. thermophilus and disrupted the NAD + salvage pathway in T. thermophilus Disruption of the salvage pathway led to the severe growth retardation at a higher temperature (80°C), owing to the drastic decrease in the intracellular concentrations of NAD + and NADH. IMPORTANCE NAD + and other nicotinamide cofactors are essential for cell metabolism. These molecules are unstable and decompose, even under the physiological conditions in most organisms. Thermophiles can survive at high temperatures where NAD + decomposition is, in general, more rapid. This study emphasizes that NAD + instability and its homeostasis can be one of the important factors for thermophile survival in extreme temperatures. Copyright © 2017 American Society for Microbiology.
Burde, Howard A; Scarfo, Richard
2015-01-01
Presented by HIMSS, the Venture+ Forum program and pitch competition provides a 360-degree view on health technology investing and today's top innovative companies. It features exciting 3-minute pitch presentations from emerging and growth-stage companies, investor panels and a networking reception. Recent Venture+ Forum winners include TowerView Health, Prima-Temp, ActuaiMeds and M3 Clinician. As an industry catalyst for health IT innovation and business-building resource for growing companies and emerging technology solutions, HIMSS has co-developed with A VIA, a new initiative that addresses how emerging technologies, health system business model changes and investment will transform the delivery of care. HX360 engages senior healthcare leaders, innovation teams, investors and entrepreneurs around the vision of transforming healthcare delivery by leveraging technology, process and structure.
Extreme embrittlement of austenitic stainless steel irradiated to 75--81 dpa at 335--360 C
International Nuclear Information System (INIS)
Porollo, S.I.; Vorobjev, A.N.; Konobeev, Yu.V.; Garner, F.A.
1998-01-01
This paper presents the results of an experiment conducted in the BN-350 fast reactor in Kazakhstan that involved the irradiation of argon-pressurized thin-walled tubes (0--2000 MPa hoop stress) constructed from Fe-16Cr-15Ni-3Mo-Nb stabilized steel in contact with the sodium coolant, which enters the reactor at ∼270 C. Tubes in the annealed condition reached 75 dpa at 335 C, and another set in the 20% cold-worked condition reached 81 dpa at 360 C. Upon disassembly all tubes, except those in the stress-free condition, were found to have failed in an extremely brittle fashion. The stress-free tubes exhibited diameter changes that imply swelling levels ranging from 9 to 16%. It is expected that stress-enhancement of swelling induced even larger swelling levels in the stressed tubes. The embrittlement is explained in terms of the sensitivity of the swelling regime to displacement rate and the large, unprecedented levels of swelling reached at 335--360 C at these high neutron fluences. The failure mechanism appears to be identical to that observed at similar swelling levels in other austenitic steels irradiated in US fast reactors at 400--425 C, whereby stress-concentration between voids and nickel segregation at void surfaces predisposes the steel to an epsilon martensite transformation followed by formation of alpha martensite at crack tips. The very slow strain rate inherent in such creep tests and the relatively high helium levels may also contribute to the failure
Experimental investigations concerning the three particle reaction 19B(d,3α) at 360 keV
International Nuclear Information System (INIS)
Nocken, U.
1976-01-01
In this paper a complete energy angular correlation measurement of the three-particle reaction 10 B(d,3α) with an incident energy of Esub(d) = 360 keV is reported. By the measurement of coincidence events in two detectors complanar to the incident beam under 24 different angles, the 'Dalitz-plane' is covered in a wide region. An exact theory of three-particle reactions with compound nuclei in the final state does not exist, therefore three wellknown model theories are used for comparison. (orig./WL) [de
Xue, Weiqi; Sales, Salvador; Capmany, José; Mørk, Jesper
2010-03-15
In this work we demonstrate for the first time, to the best of our knowledge, a continuously tunable 360 degrees microwave phase shifter spanning a microwave bandwidth of several tens of GHz (up to 40 GHz). The proposed device exploits the phenomenon of coherent population oscillations, enhanced by optical filtering, in combination with a regeneration stage realized by four-wave mixing effects. This combination provides scalability: three hybrid stages are demonstrated but the technology allows an all-integrated device. The microwave operation frequency limitations of the suggested technique, dictated by the underlying physics, are also analyzed.
The Development and Demonstration of a 360m/10 kA HTS DC Power Cable
Xiao, Liye
With the quick development of renewable energy, it is expected that the electric power from renewable energy would be the dominant one for the future power grid. Due to the specialty of the renewable energy, the HVDC power transmission would be very useful for the transmission of electric power from renewable energy. DC power cable made of High Tc Superconductor (HTS) would be a possible alternative for the construction of HVDC power transmission system. In this chapter, we report the development and demonstration of a 360 m/10 kA HTS DC power cable and the test results.
Directory of Open Access Journals (Sweden)
Minna Pitkänen
Full Text Available Repetition suppression (RS is evident as a weakened response to repeated stimuli after the initial response. RS has been demonstrated in motor-evoked potentials (MEPs induced with transcranial magnetic stimulation (TMS. Here, we investigated the effect of inter-train interval (ITI on the induction of RS of MEPs with the attempt to optimize the investigative protocols. Trains of TMS pulses, targeted to the primary motor cortex by neuronavigation, were applied at a stimulation intensity of 120% of the resting motor threshold. The stimulus trains included either four or twenty pulses with an inter-stimulus interval (ISI of 1 s. The ITI was here defined as the interval between the last pulse in a train and the first pulse in the next train; the ITIs used here were 1, 3, 4, 6, 7, 12, and 17 s. RS was observed with all ITIs except with the ITI of 1 s, in which the ITI was equal to ISI. RS was more pronounced with longer ITIs. Shorter ITIs may not allow sufficient time for a return to baseline. RS may reflect a startle-like response to the first pulse of a train followed by habituation. Longer ITIs may allow more recovery time and in turn demonstrate greater RS. Our results indicate that RS can be studied with confidence at relatively short ITIs of 6 s and above.
Gregory, Paul J; Robbins, Benjamin; Schwaitzberg, Steven D; Harmon, Larry
2017-09-01
The current research evaluated the potential utility of a 360-degree survey feedback program for measuring leadership quality in potential committee leaders of a professional medical association (PMA). Emotional intelligence as measured by the extent to which self-other agreement existed in the 360-degree survey ratings was explored as a key predictor of leadership quality in the potential leaders. A non-experimental correlational survey design was implemented to assess the variation in leadership quality scores across the sample of potential leaders. A total of 63 of 86 (76%) of those invited to participate did so. All potential leaders received feedback from PMA Leadership, PMA Colleagues, and PMA Staff and were asked to complete self-ratings regarding their behavior. Analyses of variance revealed a consistent pattern of results as Under-Estimators and Accurate Estimators-Favorable were rated significantly higher than Over-Estimators in several leadership behaviors. Emotional intelligence as conceptualized in this study was positively related to overall performance ratings of potential leaders. The ever-increasing roles and potential responsibilities for PMAs suggest that these organizations should consider multisource performance reviews as these potential future PMA executives rise through their organizations to assume leadership positions with profound potential impact on healthcare. The current findings support the notion that potential leaders who demonstrated a humble pattern or an accurate pattern of self-rating scored significantly higher in their leadership, teamwork, and interpersonal/communication skills than those with an aggrandizing self-rating.
International Nuclear Information System (INIS)
Krasznovszky, S.; Wagner, I.
1987-06-01
A distribution function is proposed for multiplicity in accordance with the stochastic number evolution. This function gives a universal description of inelastic and nondiffractive multiplicity distributions in pp collisions at 250, 360 and 800 GeV/c. The negative binomial distribution fails in the description of inelastic data. (author)
THERMUS—A thermal model package for ROOT
Wheaton, S.; Cleymans, J.; Hauer, M.
2009-01-01
THERMUS is a package of C++ classes and functions allowing statistical-thermal model analyses of particle production in relativistic heavy-ion collisions to be performed within the ROOT framework of analysis. Calculations are possible within three statistical ensembles; a grand-canonical treatment of the conserved charges B, S and Q, a fully canonical treatment of the conserved charges, and a mixed-canonical ensemble combining a canonical treatment of strangeness with a grand-canonical treatment of baryon number and electric charge. THERMUS allows for the assignment of decay chains and detector efficiencies specific to each particle yield, which enables sensible fitting of model parameters to experimental data. Program summaryProgram title: THERMUS, version 2.1 Catalogue identifier: AEBW_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEBW_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 17 152 No. of bytes in distributed program, including test data, etc.: 93 581 Distribution format: tar.gz Programming language: C++ Computer: PC, Pentium 4, 1 GB RAM (not hardware dependent) Operating system: Linux: FEDORA, RedHat, etc. Classification: 17.7 External routines: Numerical Recipes in C [1], ROOT [2] Nature of problem: Statistical-thermal model analyses of heavy-ion collision data require the calculation of both primordial particle densities and contributions from resonance decay. A set of thermal parameters (the number depending on the particular model imposed) and a set of thermalized particles, with their decays specified, is required as input to these models. The output is then a complete set of primordial thermal quantities for each particle, together with the contributions to the final particle yields from resonance decay. In many applications of
Mock, B A; Holiday, D L; Cerretti, D P; Darnell, S C; O'Brien, A D; Potter, M
1994-01-01
The interval of mouse chromosome 1 extending from Idh-1 to Pep-3 harbors the natural resistance gene Ity/Lsh/Bcg; it controls the outcome of infection with Salmonella typhimurium, Leishmania donovani, and several Mycobacterium species. This region also contains a DNA repair gene, Rep-1, which determines the rapidity with which double-strand breaks in chromatin are repaired. BALB/cAnPt and DBA/2N mice differ in their phenotypic expression of these genes. To generate appropriate strains of mice for the study of these genes, a series of 10 C.D2 congenic strains recombinant across a 28-centimorgan interval of mouse chromosome 1 extending from Idh-1 to Pep-3 were derived from crosses of the C.D2-Idh-1 Pep-3 congenic strain back to BALB/cAn. Analyses of these recombinant strains will allow the correlation of biological-immunological phenotypes with defined genetic regions.
Time interval between successive trading in foreign currency market: from microscopic to macroscopic
Sato, Aki-Hiro
2004-12-01
Recently, it has been shown that inter-transaction interval (ITI) distribution of foreign currency rates has a fat tail. In order to understand the statistical property of the ITI dealer model with N interactive agents is proposed. From numerical simulations it is confirmed that the ITI distribution of the dealer model has a power law tail. The random multiplicative process (RMP) can be approximately derived from the ITI of the dealer model. Consequently, we conclude that the power law tail of the ITI distribution of the dealer model is a result of the RMP.
Peroxiredoxins: A Model for a Self-Assembling Nanoscale System
2014-08-24
Introduction 24 Chapter Three describes the identification of a potential peroxiredoxin enzyme in the genome of the thermophilic bacterium Thermus...Discussion (TaqPrx) 80 3.9 Summary of results Comparison of the sequences of thermophilic peroxiredoxins showed that the enzyme reported by Logan and...well as that of the other two variants. A second enzyme was also examined, a thermophilic peroxiredoxin from the bacterium Thermus aquaticus. This
Agha, Riaz; Agha, Maliha
2011-01-01
Much has been achieved in the scientific and surgical fields over the last 360 years. Some institutions have contributed disproportionately to these advances. The medical schools and hospitals of Guy's (est. 1721), King's (est. 1840) and St. Thomas' (est. 1173) seem to provide a focus and a catalyst for much innovation and creativity dating back to 1608. This review sets to provide an overview of the major contributors to surgical advances at these institutions over the last 360 years and what factors affected unique to these institutions contributed to the climate of discovery. It is based on a lecture given to the Osler Club of London (est. 1928) at the Royal College of Physicians in London on 4 November 2010. It is the author's premise that the people and the discoveries they made within these institutions within three square miles of London changed the practice and understanding of science and healthcare as we know it today. Copyright © 2011 Surgical Associates Ltd. Published by Elsevier Ltd. All rights reserved.
Complete 360° circumferential SSOCT gonioscopy of the iridocorneal angle
McNabb, Ryan P.; Kuo, Anthony N.; Izatt, Joseph A.
2014-02-01
The ocular iridocorneal angle is generally an optically inaccessible area when viewed directly through the cornea due to the high angle of incidence required and the large index of refraction difference between air and cornea (nair = 1.000 and ncornea = 1.376) resulting in total internal reflection. Gonioscopy allows for viewing of the angle by removing the aircornea interface through the use of a special contact lens on the eye. Gonioscopy is used clinically to visualize the angle directly but only en face. Optical coherence tomography (OCT) has been used to image the angle and deeper structures via an external approach. Typically, this imaging technique is performed by utilizing a conventional anterior segment OCT scanning system. However, instead of imaging the apex of the cornea, either the scanner or the subject is tilted such that the corneoscleral limbus is orthogonal to the optical axis of the scanner requiring multiple volumes to obtain complete circumferential coverage of the ocular angle. We developed a novel gonioscopic OCT (GOCT) system that images the entire ocular angle within a single volume via an "internal" approach through the use of a custom radially symmetric gonioscopic contact lens. We present, to our knowledge, the first complete 360° circumferential volumes of the iridocorneal angle from a direct, internal approach.
Eva, Megan M; Yuki, Kyoko E; Dauphinee, Shauna M; Schwartzentruber, Jeremy A; Pyzik, Michal; Paquet, Marilène; Lathrop, Mark; Majewski, Jacek; Vidal, Silvia M; Malo, Danielle
2014-01-01
Salmonella enterica is a ubiquitous Gram-negative intracellular bacterium that continues to pose a global challenge to human health. The etiology of Salmonella pathogenesis is complex and controlled by pathogen, environmental, and host genetic factors. In fact, patients immunodeficient in genes in the IL-12, IL-23/IFN-γ pathway are predisposed to invasive nontyphoidal Salmonella infection. Using a forward genomics approach by N-ethyl-N-nitrosourea (ENU) germline mutagenesis in mice, we identified the Ity14 (Immunity to Typhimurium locus 14) pedigree exhibiting increased susceptibility following in vivo Salmonella challenge. A DNA-binding domain mutation (p.G418_E445) in Stat4 (Signal Transducer and Activator of Transcription Factor 4) was the causative mutation. STAT4 signals downstream of IL-12 to mediate transcriptional regulation of inflammatory immune responses. In mutant Ity14 mice, the increased splenic and hepatic bacterial load resulted from an intrinsic defect in innate cell function, IFN-γ-mediated immunity, and disorganized granuloma formation. We further show that NK and NKT cells play an important role in mediating control of Salmonella in Stat4(Ity14/Ity14) mice. Stat4(Ity14/Ity14) mice had increased expression of genes involved in cell-cell interactions and communication, as well as increased CD11b expression on a subset of splenic myeloid dendritic cells, resulting in compromised recruitment of inflammatory cells to the spleen during Salmonella infection. Stat4(Ity14/Ity14) presented upregulated compensatory mechanisms, although inefficient and ultimately Stat4(Ity14/Ity14) mice develop fatal bacteremia. The following study further elucidates the pathophysiological impact of STAT4 during Salmonella infection.
Directory of Open Access Journals (Sweden)
Anne eBobin-Bègue
2014-12-01
Full Text Available This study examined the young children’s abilities to switch from rhythm production, with short 15 Inter-Taps Intervals (ITI, to temporal interval production, with long ITI (> 1 s, in a sensorimotor synchronization task. Children aged 3 and 5 years old were given 6 sessions of synchronization. In a control group, they had to synchronize their ITI to an Inter-Stimulus Interval (ISI of 4 s. In the experimental group, they must progressively increase their ITI for one session to the next (from 0.4-s to 4.0-s ISI. Our results showed that the 5-year-olds produced longer ITI that the 3-year-olds in synchronization. However, the value of ITI in the 5-year-olds never exceeded 1.5 s, with more variable ITI in the control than in the experimental group. In addition, at 5 years, boys had more difficulties than girls in changing their tapping rhythm. These results suggest a temporal window in sensorimotor synchronization, beyond which the rhythm is lost and the synchronization becomes difficult.
Mangione-Smith, Rita; Zhou, Chuan; Corwin, Michael J; Taylor, James A; Rice, Fiona; Stout, James W
To determine the effectiveness of the Spirometry 360 distance learning quality improvement (QI) program for enhancing the processes and outcomes of care for children with asthma. Cluster randomized controlled trial involving 25 matched pairs of pediatric primary care practices. Practices were recruited from 2 practice-based research networks: the Slone Center Office-based Research Network at Boston University, Boston, Mass, and the Puget Sound Pediatric Research Network, Seattle, Wash. Study participants included providers from one of the 50 enrolled pediatric practices and 626 of their patients with asthma. Process measures assessed included spirometry test quality and appropriate prescription of asthma controller medications. Outcome measures included asthma-specific health-related quality of life, and outpatient, emergency department, and inpatient utilization for asthma. At baseline, 25.4% of spirometry tests performed in control practices and 50.4% of tests performed in intervention practices were of high quality. During the 6-month postintervention period, 28.7% of spirometry tests performed in control practices and 49.9% of tests performed in intervention practices were of high quality. The adjusted difference-of-differences analysis revealed no intervention effect on spirometry test quality. Adjusted differences-of-differences analysis also revealed no intervention effect on appropriate use of controller medications or any of the parent- or patient-reported outcomes examined. In this study, the Spirometry 360 distance learning QI program was ineffective in improving spirometry test quality or parent- or patient-reported outcomes. QI programs like the one assessed here may need to focus on practices with lower baseline performance levels or may need to be tailored for those with higher baseline performance. Copyright © 2017 Academic Pediatric Association. Published by Elsevier Inc. All rights reserved.
AMDLIBF, IBM 360 Subroutine Library, Eigenvalues, Eigenvectors, Matrix Inversion
International Nuclear Information System (INIS)
Wang, Jesse Y.
1980-01-01
Description of problem or function: AMDLIBF is a subset of the IBM 360 Subroutine Library at the Applied Mathematics Division at Argonne. This subset includes library category F: Identification/Description: F152S F SYMINV: Invert sym. matrices, solve lin. systems; F154S A DOTP: Double plus precision accum. inner prod.; F156S F RAYCOR: Rayleigh corrections for eigenvalues; F161S F XTRADP: A fast extended precision inner product; F162S A XTRADP: Inner product of two DP real vectors; F202S F1 EIGEN: Eigen-system for real symmetric matrix; F203S F: Driver for F202S; F248S F RITZIT: Largest eigenvalue and vec. real sym. matrix; F261S F EIGINV: Inverse eigenvalue problem; F313S F CQZHES: Reduce cmplx matrices to upper Hess and tri; F314S F CQZVAL: Reduce complex matrix to upper Hess. form; F315S F CQZVEC: Eigenvectors of cmplx upper triang. syst.; F316S F CGG: Driver for complex general Eigen-problem; F402S F MATINV: Matrix inversion and sol. of linear eqns.; F403S F: Driver for F402S; F452S F CHOLLU,CHOLEQ: Sym. decomp. of pos. def. band matrices; F453S F MATINC: Inversion of complex matrices; F454S F CROUT: Solution of simultaneous linear equations; F455S F CROUTC: Sol. of simultaneous complex linear eqns.; F456S F1 DIAG: Integer preserving Gaussian elimination
Thermostabilization of desulfurization enzymes from Rhodococcos sp. IGTS8. Final technical report
Energy Technology Data Exchange (ETDEWEB)
John J. Kilbane II
2000-12-15
The objective of this project was to develop thermophilic cultures capable of expressing the desulfurization (dsz) operon of Rhodococcus sp. IGTS8. The approaches taken in this project included the development of plasmid and integrative expression vectors that function well in Thermus thermophilus, the cloning of Rhodococcus dsz genes in Thermus expression vectors, and the isolation of bacterial cultures that express the dsz operon at thermophilic temperatures. This project has resulted in the development of plasmid and integrative expression vectors for use in T. thermophilus. The dsz genes have been expressed at moderately thermophilic temperatures (52 C) in Mycobacterium phlei and at temperatures as high as 72 C in T. thermophilus. The tools and methods developed in this project will be generally useful for the expression of heterologous genes in Thermus. Key developments in the project have been the isolation of a Mycobacterium phlei culture capable of expressing the desulfurization operon at 52 C, development of plasmid and integrative expression vectors for Thermus thermophilus, and the development of a host-vector system based on the malate dehydrogenase gene that allows plasmids to be stably maintained in T. thermophilus and provides a convenient reporter gene for the accurate quantification of gene expression. Publications have been prepared regarding each of these topics; these preprints are included.
Directory of Open Access Journals (Sweden)
Paolo Di Pietro Martinelli
2016-12-01
Full Text Available Fort360 project is a cultural initiative that receives the main directives of edutainment processes, trying to provide an answer to the necessity of a capillary system of information and awareness about the dismissing cultural heritage. The proposed study – carried out in the Fort Bravetta, Rome – presents a video where the educational aspect, related to the historical and architectural site contents, is strictly connected with the playful and emotional quality, resulted from a VR interaction with a panoramic video. This first case study focuses on the use of low-cost digital instrumentation and tries to improve the value of culture from the bottom, proposing an alternative way of cultural heritage enjoyment, based on participation and on interdisciplinarity of the proposed contents.
The creep and intergranular cracking behavior of Ni-Cr-Fe-C alloys in 360 degree C water
International Nuclear Information System (INIS)
Angeliu, T.M.; Paraventi, D.J.; Was, G.S.
1995-01-01
Mechanical testing of controlled-purity Ni-xCr-9Fe-yC alloys at 360 C revealed an environmental enhancement in IG cracking and time-dependent deformation in high purity and primary water over that exhibited in argon. Dimples on the IG facets indicate a creep void nucleation and growth failure mode. IG cracking was primarily located at the interior of the specimen and not necessarily linked to direct contact with the environment. Controlled potential CERT experiments showed increases in IG cracking as the applied potential decreased, suggesting that hydrogen is detrimental to the mechanical properties. It is proposed that the environment, through the presence of hydrogen, enhances IG cracking by enhancing the matrix dislocation mobility. This is based on observations that dislocation-controlled creep controls the IG cracking of controlled-purity Ni-xCr-9Fe-yC in argon at 360 C and grain boundary cavitation and sliding results that show the environmental enhancement of the creep rate is primarily due to an increase in matrix plastic deformation. However, controlled potential CLT experiments did not exhibit a change in the creep rate as the applied potential decreased. While this does not clearly support hydrogen assisted creep, the material may already be saturated with hydrogen at these applied potentials and thus no effect was realized. Chromium and carbon decrease the IG cracking in high purity and primary water by increasing the creep resistance. The surface film does not play a significant role in the creep or IG cracking behavior under the conditions investigated
VANDEWIELE, J; LANGEVINJOLIOT, H; GUILLOT, J; ROSIER, LH; WILLIS, A; MORLET, M; DUHAMELCHRETIEN, G; GERLIC, E; TOMASIGUSTAFSSON, E; BLASI, N; MICHELETTI, S; VANDERWERF, SY
Cross sections and vector and tensor analyzing powers for the main levels in Pb-207 have been measured via the Pb-208(d over arrow pointing right, t)Pb-207 reaction at 200 and 360 MeV incident energies. A(y) and A(yy) spin observables allow a clear identification of the valence levels, especially at
AMDLIBGZ, IBM 360 Subroutine Library for Data Processing, Graphics, Sorting
International Nuclear Information System (INIS)
Wang, Jesse Y.
1980-01-01
Description of problem or function: AMDLIBGZ is a subset of the IBM 360 Subroutine Library at the Applied Mathematics Division at Argonne National Laboratory. This subset includes library categories G-Z: Identification/Description: G552S F RANF: Random number generator; J952S F YOLYPLOT: CalComp plots; J955S P GRAF: Prints a graph of points on line printer; K250S A1: Core to core conversion; K251S A HEXINP: Hexadecimal input for PL/I programs; K252S A HEXOUT: Hexadecimal output conv. PL/I programs; M101S F SORT: Algebraic sort; M150S F CSORT: Algebraic sort; M151S P2 ANLKWIC: KWIC sort; M250S A SMALLIST: Squeezes assembler listing to 8 x 11; N251S A ABEND: Calls ABEND dump; Q052S A CLOCK: Time; Q053S A COPYAGO: Copy load module from tape to disk; Q054S A DATE: Current date in form MM/DD/YY; Q055S A TIME: Time (24 hour clock) in EBCDIC HH.MM.SS; Z013S F: Variable metric minimization; Z057S A LOCF: Locate machine addresses of variables; Z071S A ALLOC: Allocate LCS for FORTRAN programs; Z074S A ANLMNP: Exponent and mantissa manipulative functs.
Directory of Open Access Journals (Sweden)
Pramod Kumar
2018-01-01
Conclusion: To accomplish, this preliminary study brought the information on the ApoA4 polymorphism in the Asian Indians residing in Delhi and adjacent areas. The minor alleles of the Ser347 and His360 showed significant association with lipid risk factors like high levels of OXLDL, TC, and low HDL levels. However neither of these polymorphisms showed an association with CAD.
International Nuclear Information System (INIS)
Chonez, Nicole
1968-12-01
This report contains the assembly list, the flow chart and some comments about each of the IBM 360 assembler language programmes used for preparing one of the subject indexes contained in the bibliographical bulletin entitled: 'Index de la Litterature nucleaire francaise'; this bulletin has been produced by the French C.E.A. since 1968. Only the processing phases from the magnetic tape file of the bibliographical references, assumed correct, to the printing out of the permuted index obtained with the French titles of the documents on the tape are considered here. This permuted index has the peculiarity of automatically regrouping synonyms and certain grammatical variations of the words. (author) [fr
Directory of Open Access Journals (Sweden)
Rasekh HR
2011-11-01
Full Text Available Hamid Reza Rasekh1, Ali Imani1, Mehran Karimi2, Mina Golestani11Shahid Beheshti University of Medical Sciences, Department of Pharmaceutical Management and Pharmacoeconomics, School of Pharmacy, Tehran, 2University of Shiraz Medical Sciences, Hematology Research Center, Shiraz, IranBackground: In developing countries, the treatment of hemophilia patients with inhibitors is presently the most challenging and serious issue in hemophilia management, direct costs of clotting factor concentrates accounting for >98% of the highest economic burden absorbed for the health care of patients in this setting. In the setting of chronic diseases, cost-utility analysis, which takes into account the beneficial effects of a given treatment/health care intervention in terms of health-related quality of life, is likely to be the most appropriate approach.Objective: The aim of this study was to assess the incremental cost-effectiveness ratios of immune tolerance induction (ITI therapy with plasma-derived factor VIII concentrates versus on-demand treatment with recombinant-activated FVIIa (rFVIIa in hemophilia A with high titer inhibitors from an Iranian Ministry of Health perspective.Methods: This study was based on the study of Knight et al, which evaluated the cost-effectiveness ratios of different treatments for hemophilia A with high-responding inhibitors. To adapt Knight et al's results to the Iranian context, a few clinical parameters were varied, and cost data were replaced with the corresponding Iranian estimates of resource use. The time horizon of the analysis was 10 years. One-way sensitivity analyses were performed, varying the cost of the clotting factor, the drug dose, and the administration frequency, to test the robustness of the analysis.Results: Comparison of the incremental cost-effectiveness ratios between the three ITI protocols and the on-demand regimen with rFVIIa shows that all three ITI protocols dominate the on-demand regimen with r
Huamán Alva, Ancelmo
2017-01-01
La presente investigación tiene como objetivo determinar la incidencia de la comunicación 360° como estrategia para reducir el índice de morosidad en los pagos académicos de los alumnos de la Universidad Alas Peruanas – Filial Cajamarca, 2016. Para ello se identificaron dos variables, la primera estuvo referida a la comunicación 360º con cinco dimensiones: comunicación organizacional, fidelización, relaciones públicas, imagen corporativa y publicidad, la segunda variable fue sobre la morosida...
Directory of Open Access Journals (Sweden)
Huiping Liu
Full Text Available Laccases have been used for the decolorization and detoxification of synthetic dyes due to their ability to oxidize a wide variety of dyes with water as the sole byproduct. A putative laccase gene (LacTT from Thermus thermophilus SG0.5JP17-16 was screened using the genome mining approach, and it was highly expressed in Pichia pastoris, yielding a high laccase activity of 6130 U/L in a 10-L fermentor. The LacTT open reading frame encoded a protein of 466 amino acid residues with four putative Cu-binding regions. The optimal pH of the recombinant LacTT was 4.5, 6.0, 7.5 and 8.0 with 2,2'-azino-bis(3-ethylbenzothazoline-6-sulfonic acid (ABTS, syringaldazine (SGZ, guaiacol, and 2,6-dimethoxyphenol (2,6-DMP as the substrate, respectively. The optimal temperature of LacTT was 90°C with guaiacol as the substrate. LacTT was highly stable at pH 4.0-11.0 and thermostable at 40°C-90°C, confirming that it is a pH-stable and thermostable laccase. Furthermore, LacTT also exhibited high tolerance to halides such as NaCl, NaBr and NaF, and decolorized 100%, 94%, 94% and 73% of Congo Red, Reactive Black B and Reactive Black WNN, and Remazol Brilliant Blue R, respectively. Interestingly, addition of high concentration of NaCl increased the RBBR decolorization efficiency of LacTT. These results suggest that LacTT is a good candidate for industrial applications such as dyestuff processing and degradation of dyes in textile wastewaters.
Zhang, Shaojun; Xu, Xiping
2015-10-01
The 360-degree and all round looking camera, as its characteristics of suitable for automatic analysis and judgment on the ambient environment of the carrier by image recognition algorithm, is usually applied to opto-electronic radar of robots and smart cars. In order to ensure the stability and consistency of image processing results of mass production, it is necessary to make sure the centers of image planes of different cameras are coincident, which requires to calibrate the position of the image plane's center. The traditional mechanical calibration method and electronic adjusting mode of inputting the offsets manually, both exist the problem of relying on human eyes, inefficiency and large range of error distribution. In this paper, an approach of auto- calibration of the image plane of this camera is presented. The imaging of the 360-degree and all round looking camera is a ring-shaped image consisting of two concentric circles, the center of the image is a smaller circle and the outside is a bigger circle. The realization of the technology is just to exploit the above characteristics. Recognizing the two circles through HOUGH TRANSFORM algorithm and calculating the center position, we can get the accurate center of image, that the deviation of the central location of the optic axis and image sensor. The program will set up the image sensor chip through I2C bus automatically, we can adjusting the center of the image plane automatically and accurately. The technique has been applied to practice, promotes productivity and guarantees the consistent quality of products.
Directory of Open Access Journals (Sweden)
Derya KARA
2010-01-01
Full Text Available This study sets out to reveal the effect of 360 degree feedback performance evaluation process on the achievement of middle-level managers. To serve this purpose, 5-star establishments, in total 182, with tourism certification and operating in 5 major provinces (Antalya, İstanbul, Muğla, Ankara, İzmir made up the application field of the study. The study aims to determine to what extent the 360 degree feedback performance evaluation process differentiate compared to traditional performance evaluation processes within the context of job achievement. The results of the study suggest that 7 dimensions (leadership, task performance, adaptation to change, communication, human relations, creating output, employee training and development were found to be more effective in the job performances of the middle-level managers.
Good to great: using 360-degree feedback to improve physician emotional intelligence.
Hammerly, Milton E; Harmon, Larry; Schwaitzberg, Steven D
2014-01-01
The past decade has seen intense interest and dramatic change in how hospitals and physician organizations review physician behaviors. The characteristics of successful physicians extend past their technical and cognitive skills. Two of the six core clinical competencies (professionalism and interpersonal/communication skills) endorsed by the Accreditation Council for Graduate Medical Education, the American Board of Medical Specialties, and The Joint Commission require physicians to succeed in measures associated with emotional intelligence (EI). Using 360-degree anonymous feedback surveys to screen for improvement opportunities in these two core competencies enables organizations to selectively offer education to further develop physician EI. Incorporating routine use of these tools and interventions into ongoing professional practice evaluation and focused professional practice evaluation processes may be a cost-effective strategy for preventing disruptive behaviors and increasing the likelihood of success when transitioning to an employed practice model. On the basis of a literature review, we determined that physician EI plays a key role in leadership; teamwork; and clinical, financial, and organizational outcomes. This finding has significant implications for healthcare executives seeking to enhance physician alignment and transition to a team-based delivery model.
Formica, S; Roach, T I; Blackwell, J M
1994-05-01
The murine resistance gene Lsh/Ity/Bcg regulates activation of macrophages for tumour necrosis factor-alpha (TNF-alpha)-dependent production of nitric oxide mediating antimicrobial activity against Leishmania, Salmonella and Mycobacterium. As Lsh is differentially expressed in macrophages from different tissue sites, experiments were performed to determine whether interaction with extracellular matrix (ECM) proteins would influence the macrophage TNF-alpha response. Plating of bone marrow-derived macrophages onto purified fibrinogen or fibronectin-rich L929 cell-derived matrices, but not onto mannan, was itself sufficient to stimulate TNF-alpha release, with significantly higher levels released from congenic B10.L-Lshr compared to C57BL/10ScSn (Lshs) macrophages. Only macrophages plated onto fibrinogen also released measurable levels of nitrites, again higher in Lshr compared to Lshs macrophages. Addition of interferon-gamma (IFN-gamma), but not bacterial lipopolysaccharide or mycobacterial lipoarabinomannan, as a second signal enhanced the TNF-alpha and nitrite responses of macrophages plated onto fibrinogen, particularly in the Lshr macrophages. Interaction with fibrinogen and fibronectin also primed macrophages for an enhanced TNF-alpha response to leishmanial parasites, but this was only translated into enhanced nitrite responses in the presence of IFN-gamma. In these experiments, Lshr macrophages remained superior in their TNF-alpha responses throughout, but to a degree which reflected the magnitude of the difference observed on ECM alone. Hence, the specificity for the enhanced TNF-alpha responses of Lshr macrophages lay in their interaction with fibrinogen and fibronectin ECM, while a differential nitrite response was only observed with fibrinogen and/or IFN-gamma. The results are discussed in relation to the possible function of the recently cloned candidate gene Nramp, which has structural identity to eukaryote transporters and an N-terminal cytoplasmic
Using Mobile Apps to Entice General Education Students into Technology Fields
Liu, Michelle; Murphy, Diane
2013-01-01
It is of national importance to increase the number of college students pursuing degrees in information systems/information technology (IT/IS) subjects. The primary focus at many institutions is renovating or enhancing existing IT/IS programs and the target audience is the students who have selected to major in IT/IS subjects. This paper looks at…
Impact parameter analysis of proton-proton elastic and inelastic interactions at 360 GeV/c
International Nuclear Information System (INIS)
Banerjee, S.; Ragavan, R.; Bailly, J
1987-01-01
Data obtained with the European Hybrid Spectrometer on the proton-proton elastic scattering at 360 GeV/c are presented. The differential cross sections of elastic and inelastic pp-interactions are studied as a function of the impact parameter. The results are compared to those obtained at other energies. They are interpreted in the framework of a simple geometrical Monte-Carlo model of inelastic collisions considering protons as composite particles having a definite effective radius with valence quarks inside. The shape of the inelastic overlap function is well reproduced for both pp- and π + p-interactions. The effective radii of the proton and pion as well as of the valence quarks are estimated for inelastic interactions. The model calculations indicate an increase of the effective radii both of protons and valence quarks and an increase of the proton opacity with increasing energy
High efficiency AlGaInN-based light emitting diode in the 360-380 nm wavelength range
Energy Technology Data Exchange (ETDEWEB)
Sato, Hisao; Wang, Hong-Xing; Sato, Daisuke; Takaki, Ryohei; Wada, Naoki; Tanahashi, Tetsuya; Yamashita, Kenji; Kawano, Shunsuke; Mizobuchi, Takashi; Dempo, Akihiko; Morioka, Kenji; Kimura, Masahiro; Nohda, Suguru [Nitride Semiconductors Co., Ltd., 115-7 Itayajima, Akinokami, Seto-cho, Naruto, Tokushima 771-0360 (Japan); Sugahara, Tomoya [Satellite Venture Business Laboratory, The University of Tokushima (Japan); Sakai, Shiro [Department of Electrical and Electronic Engineering, The University of Tokushima, 2-1 Minami-josanjima, Tokushima 770-8506 (Japan)
2003-11-01
High performance LEDs emitting in the wavelength range 360-380 nm, are fabricated on sapphire substrates by one-time metalorganic chemical vapor deposition (MOCVD) without using epitaxial lateral overgrowth (ELO) or similar techniques. By improving layer structures and growth conditions, the output power of the LEDs was much improved. The light output power of the LEDs at an injection current of 20 mA is 3.2 mW, 2.5 mW and 1 mW at wavelengths of 378 nm, 373 nm and 363 nm, which correspond to an external quantum efficiency of 4.8%, 3.8% and 1.4%, respectively. (copyright 2003 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Oliveira, Fernando C; Ferreira, Carlos E R; Haas, Cristina S; Oliveira, Leonardo G; Mondadori, Rafael G; Schneider, Augusto; Rovani, Monique T; Gonçalves, Paulo B D; Vieira, Arnaldo D; Gasperin, Bernardo G; Lucia, Thomaz
2017-03-01
Intratesticular injection (ITI) of sodium chloride (NaCl) is efficient for chemical castration of young calves, but its effects on calves welfare are unknown. Two experiments were conducted to evaluate the effects of ITI of 20% NaCl on stress and inflammatory markers in calves less than 20 days old and to assess the efficiency of ITI of 30% NaCl in 5 months old calves. In Experiment 1, control calves were only restrained and compared to calves submitted to castration through surgery (SC) and ITI with 20% NaCl (n = 9/group). No differences were observed for the eye corner temperature measured by thermography from 60 s before to 60 s after the procedures (P > 0.05). In the SC group, acute serum cortisol levels increased at 30 and 60 min after the procedure, but increased levels in the ITI group occurred only at 30 min (P 0.05). Scrotal temperature was higher at D1 in the SC group than for the other groups, but lowest at D4 compared to the control (both P castration through ITI of 20% NaCl in young calves was followed by slight stress and inflammatory responses compared to surgical castration. However, ITI of 30% NaCl was ineffective for chemical castration of 5 months old calves. Copyright © 2016 Elsevier Inc. All rights reserved.
Li, Ziru; Zhang, Xusheng
2008-12-01
Infrared thermal imaging (ITI) is the potential imaging technique for the health care field of traditional Chinese medicine (TCM). Successful application demands obeying the characteristics and regularity of the ITI of human body and designing rigorous trials. First, the influence of time must be taken into account as the ITI of human body varies with time markedly. Second, relative magnitude is preferred to be the index of the image features. Third, scatter diagrams and the method of least square could present important information for evaluating the health care effect. A double-blind placebo-controlled randomized trial was undertaken to study the influences of Shengsheng capsule, one of the TCM health food with immunity adjustment function, on the ITI of human body. The results showed that the effect of Shengsheng capsule to people with weak constitution or in the period of being weak could be reflected objectively by ITI. The relative efficacy rate was 81.3% for the trial group and 30.0% for the control group, there was significant difference between the two groups (P=0.003). So the sensitivity and objectivity of ITI are of great importance to the health care field of TCM.
1977-08-01
The AUDIT documentation provides the maintenance programmer personnel with the information to effectively maintain and use the AUDIT software. The ...SESCOMPSPEC’s) and produces reports detailing the deviations from those standards. The AUDIT software also examines a program unit to detect and report...changes in word length on the output of computer programs. This report contains the listings of the AUDIT software for the IBM 360. (Author)
EVALUATION OF 360 ° TO GET TO KNOW THE PERFORMANCE OF THE STUDENTS OF THE CyBENP
Directory of Open Access Journals (Sweden)
Ofelia Arzate-Ortiz
2014-07-01
Full Text Available The skills assessment in institutions of higher education today is a challenge, assess skills from a viewpoint that leads to the improvement and student growth and not just issuing a rating, is the challenge. The methodology of evaluation of 360 allowed for the case of the present investigation to determine the performance of students CyBENP regarding generic skills acquired in the course of a semester to use the educational coaching as a tool for achieving the same, the results allow us to objectively knowing the skills developed by students with a look at the performance review as an opportunity to express themselves and improve, while allowing generate an action plan to enhance the performance of students.
Desenvolvimento corporal e testicular em machos de codornas de corte e de postura de 25 a 360 dias
Directory of Open Access Journals (Sweden)
Tatiana C. Santos
2012-11-01
Full Text Available Codornas do tipo carne e tipo ovos foram analisadas para determinar o desenvolvimento reprodutivo, a puberdade e o início da senilidade. Para tal, 288 codornas (144 codornas de corte e 144 de postura foram acompanhadas desde a eclosão até os 360 dias de idade. As aves foram distribuídas por idade em 18 grupos, sendo 8 codornas/grupo/tipo de codorna. Após 35 dias as codornas foram mantidas em condições de fotoperíodo de dias longos (17luz: 7escuro. O peso vivo e os valores morfométricos e histológicos testiculares foram determinados em cada período. Os dados obtidos foram analisados para determinar a curva de crescimento e o comportamento dos parâmetros analisados. O modelo que mais se adequou aos dados foi o modelo não linear de Gompertz (Y=A exp [-B e (-kt]. O peso vivo e as características testiculares macro e microscópicas apresentaram comportamento alométrico entre si, sendo que, aproximadamente aos 60 dias os machos apresentaram-se sexualmente desenvolvidos, e estabilizaram o peso corporal por volta dos 100 dias. O testículo direito é mais cranial que o esquerdo e diferem em relação a comprimento e largura, porém não foi observada diferenças (P>0,05 para peso testicular. As codornas de corte apresentaram peso corporal e peso testicular maiores que as codornas de postura, porém as codornas de postura apresentaram peso relativo testicular maior. Durante todo o período analisado os machos puderam ser considerados sexualmente aptos. Os reprodutores apresentaram características sexuais ativas até os 360 dias de idade, representadas pelo tamanho testicular e pela atividade celular nos túbulos seminíferos.
Turchi, Janita; Devan, Bryan; Yin, Pingbo; Sigrist, Emmalynn; Mishkin, Mortimer
2010-07-01
The monkey's ability to learn a set of visual discriminations presented concurrently just once a day on successive days (24-h ITI task) is based on habit formation, which is known to rely on a visuo-striatal circuit and to be independent of visuo-rhinal circuits that support one-trial memory. Consistent with this dissociation, we recently reported that performance on the 24-h ITI task is impaired by a striatal-function blocking agent, the dopaminergic antagonist haloperidol, and not by a rhinal-function blocking agent, the muscarinic cholinergic antagonist scopolamine. In the present study, monkeys were trained on a short-ITI form of concurrent visual discrimination learning, one in which a set of stimulus pairs is repeated not only across daily sessions but also several times within each session (in this case, at about 4-min ITIs). Asymptotic discrimination learning rates in the non-drug condition were reduced by half, from approximately 11 trials/pair on the 24-h ITI task to approximately 5 trials/pair on the 4-min ITI task, and this faster learning was impaired by systemic injections of either haloperidol or scopolamine. The results suggest that in the version of concurrent discrimination learning used here, the short ITIs within a session recruit both visuo-rhinal and visuo-striatal circuits, and that the final performance level is driven by both cognitive memory and habit formation working in concert.
Directory of Open Access Journals (Sweden)
Rayevsky A. V.
2016-02-01
Full Text Available Aim. To investigate the structural bases for the amino acid selectivity of the Thermus thermophilus leucyl-tRNA synthetase (LeuRSTT aminoacylation site and to disclose the binding pattern of pre-transfer editing substrates. Methods. Eight amino acids proposed as semi-cognate substrates for aminoacylation and eight aminoacyl-adenylates (formed from AMP and eight amino acids were prepared in zwitterions form. The protein structure with a co-crystallized substrate in the aminoacylation site [PDBID: 1OBH] was taken from RCSB. Docking settings and evaluation of substrate efficiency were followed by twofold docking function analysis for each conformation with Gold CCDC. The molecular dynamics simulation was performed using Gromacs. The procedures of relaxation and binding study were separated in two different subsequent simulations for 50ns and 5ns. Results. The evaluation of substrate efficiency for 8 amino acids by twofold docking function analysis, based on score values,has shown that the ligands of LeuRSTT can be positioned in the following order: Leu>Nva>Hcy>Nle>Met>Cys>Ile >Val. MD simulation has revealed lower electrostatic interactions of isoleucine with the active site of the enzyme compared with those for norvaline and leucine. In the case of aminoacyl-adenylates no significant differences were found based on score values for both GoldScore and Asp functions. Molecular dynamics of leucyl-, isoleucyl- and norvalyl-adenylates showed that the most stable and conformationally favorable is leucine, then follow norvaline and isoleucine. It has been also found that the TYR43 of the active site covers carboxyl group of leucine and norvaline like a shield and deflected towards isoleucine, allowing water molecules to come closer. Conclusions. In this study we revealed some structural basis for screening unfavorable substrates by shape, size and flexibility of a radical. The results obtained for different amino acids by molecular docking and MD studies
Between-Trial Forgetting Due to Interference and Time in Motor Adaptation.
Directory of Open Access Journals (Sweden)
Sungshin Kim
Full Text Available Learning a motor task with temporally spaced presentations or with other tasks intermixed between presentations reduces performance during training, but can enhance retention post training. These two effects are known as the spacing and contextual interference effect, respectively. Here, we aimed at testing a unifying hypothesis of the spacing and contextual interference effects in visuomotor adaptation, according to which forgetting between trials due to either spaced presentations or interference by another task will promote between-trial forgetting, which will depress performance during acquisition, but will promote retention. We first performed an experiment with three visuomotor adaptation conditions: a short inter-trial-interval (ITI condition (SHORT-ITI; a long ITI condition (LONG-ITI; and an alternating condition with two alternated opposite tasks (ALT, with the same single-task ITI as in LONG-ITI. In the SHORT-ITI condition, there was fastest increase in performance during training and largest immediate forgetting in the retention tests. In contrast, in the ALT condition, there was slowest increase in performance during training and little immediate forgetting in the retention tests. Compared to these two conditions, in the LONG-ITI, we found intermediate increase in performance during training and intermediate immediate forgetting. To account for these results, we fitted to the data six possible adaptation models with one or two time scales, and with interference in the fast, or in the slow, or in both time scales. Model comparison confirmed that two time scales and some degree of interferences in either time scale are needed to account for our experimental results. In summary, our results suggest that retention following adaptation is modulated by the degree of between-trial forgetting, which is due to time-based decay in single adaptation task and interferences in multiple adaptation tasks.
Perancangan dan Pembuatan Alat Scanner 3D Menggunakan Sensor Kinect Xbox 360
Directory of Open Access Journals (Sweden)
Arif Armansyah
2018-04-01
Full Text Available Abstrak Scanner 3D adalah teknologi yang digunakan untuk memindai objek nyata untuk mendapatkan bentuk, ukuran dan fitur lainnya agar menghasilkan gambar yang sangat akurat. Dalam perancangan alat scanner 3D sebelumnya, yaitu scanner 3D menggunakan sensor ultrasonik, infra merah, dan line laser. Maka dapat disimpulkan terdapat beberapa kekurangan yaitu masih terbatasnya objek yang di scan serta hasil scan yang belum akurat karena hanya menghasilkan garis-garis yang membentuk objek. Pada penelitian ini, penulis membuat scanner 3D dengan hasil akurasi yang tinggi. Scanner 3D yang dibuat adalah menggunakan sensor Kinect xbox 360. Cara kerja dari kinect yaitu dengan menggabungkan antara beberapa kamera, Color Cimos (VNA38209015 kamera ini berfungsi membantu dalam pengenalan objek dan fitur deteksi lainnya, serta kamera IR CMOS (VCA379C7130, dan IR Projector (OG12 yaitu sebagai depth sensor atau sensor kedalaman yang merupakan sebuah proyektor infrared dan sebuah sensor monochrome CMOS yang bekerja secara bersama-sama untuk melihat ruangan atau area dalam bentuk 3D tanpa memperdulikan kondisi cahaya. Untuk mengolah serta menampilkan hasil dari objek yang sudah di scan menggunakan aplikasi KScan3D. Kemudian untuk koneksi antara PC dengan media penggerak menggunakan Bluetooth HC-06. Setelah dilakukan pengujian didapatkan model gambar 3D dengan dengan hasil akurasi yang cukup tinggi. Kata Kunci: Bluetooth HC-06, Infra Merah, Line Laser, Kinect, KScan3D, Scanner 3D, Ultrasonik Abstract Scanner 3D is the technology used to scan real objects to get the form, size and other features in order to produce pictures that are very accurate. In the design of the appliance scanner 3D previously, namely scanner 3D using the ultrasonic sensor, infrared and laser line. It can be concluded there are some disadvantages that is still limited objects in the scan and the scans are not accurate because only produces lines that formed the object. In this research, author
International Nuclear Information System (INIS)
Augustides, Jean
1973-01-01
As computing time did not allow working in real time, and as different methods had been proposed to reduce the computing time (the Cooley-Tuckey method, the use of specific FFT processors), this thesis proposes an intermediate solution, between the entirely programmed solution and the entirely cabled solution. After some generalities on micro-programming (definition, history, benefits and drawbacks, perspectives), the author reports the micro-programming of the Mitra 15 micro-machine: description of the machine, memory, command memory and associated circuits, interruptions and suspensions, descriptions of micro-statements, execution of a micro-statement. Programs and subroutines developed for the modelling of Mitra 15 micro-machine on IBM 360/91 are presented. Then, the author reports the micro-programming of the fast Fourier transform: theory, program description, and test
International Nuclear Information System (INIS)
Tsurugai, T.
1987-01-01
Feynman x distributions and transverse momentum p T distributions for the inclusive reactions pp → h ± , π 0 , K-s 0 Λ 0 , anti Λ 0 , K* ± , Σ* ± + anything at 360 GeV/c are analyzed in terms of the quark-diquark fragmentation models. Comparison of the model predictions with inclusive data reveals that the model with diquarks can quantitatively describe all data. In particular for the baryon production such as pp → Λ 0 + anything, the model without diquarks shows serious discrepancies with the data. Using the quark-diquark fragmentation model, we have found that the primordial transverse momentum T > ≅ 0.6 GeV/c can well reproduce p T 2 distributions and the Feynman x-p T correlations. (author)
Borgbjerg, Jens; Bøgsted, Martin; Lindholt, Jes S; Behr-Rasmussen, Carsten; Hørlyck, Arne; Frøkjær, Jens B
2018-02-01
Controversy exists regarding optimal caliper placement in ultrasound assessment of maximum abdominal aortic diameter. This study aimed primarily to determine reproducibility of caliper placement in relation to the aortic wall with the three principal methods: leading to leading edge (LTL), inner to inner edge (ITI), and outer to outer edge (OTO). The secondary aim was to assess the mean difference between the OTO, ITI, and LTL diameters and estimate the impact of using either of these methods on abdominal aortic aneurysm (AAA) prevalence in a screening program. Radiologists (n=18) assessed the maximum antero-posterior abdominal aortic diameter by completing repeated caliper placements with the OTO, LTL, and ITI methods on 50 still abdominal aortic images obtained from an AAA screening program. Inter-observer reproducibility was calculated as the limit of agreement with the mean (LoA), which represents expected deviation of a single observer from the mean of all observers. Intra-observer reproducibility was assessed averaging the LoA for each observer with their repeated measurements. Based on data from an AAA screening trial and the estimated mean differences between the three principal methods, AAA prevalence was estimated using each of the methods. The inter-observer LoA of the OTO, ITI, and LTL was 2.6, 1.9, and 1.9 mm, whereas the intra-observer LoA was 2.0, 1.6, and 1.5 mm, respectively. Mean differences of 5.0 mm were found between OTO and ITI measurements, 2.6 mm between OTO and LTL measurements, and 2.4 mm between LTL and ITI measurements. The prevalence of AAA almost doubled using OTO instead of ITI, while the difference between ITI and LTL was minor (3.3% vs. 4.0% AAA). The study shows superior reproducibility of LTL and ITI compared with the OTO method of caliper placement in ultrasound determination of maximum abdominal aortic diameter, and the choice of caliper placement method significantly affects the prevalence of AAAs in screening programs
Cady, Roger; Saper, Joel; Dexter, Kent; Manley, Heather R
2015-01-01
To determine if repetitive sphenopalatine ganglion (SPG) blocks with 0.5% bupivacaine delivered through the Tx360(®) are superior in reducing pain associated with chronic migraine (CM) compared with saline. The SPG is a small concentrated structure of neuronal tissue that resides within the pterygopalatine fossa (PPF) in close proximity to the sphenopalatine foramen and is innervated by the maxillary division of the trigeminal nerve. From an anatomical and physiological perspective, SPG blockade may be an effective acute and preventative treatment for CM. This was a double-blind, parallel-arm, placebo-controlled, randomized pilot study using a novel intervention for acute treatment in CM. Up to 41 subjects could be enrolled at 2 headache specialty clinics in the US. Eligible subjects were between 18 and 80 years of age and had a history of CM defined by the second edition of the International Classification of Headache Disorders appendix definition. They were allowed a stable dose of migraine preventive medications that was maintained throughout the study. Following a 28-day baseline period, subjects were randomized by computer-generated lists of 2:1 to receive 0.5% bupivacaine or saline, respectively. The primary end-point was to compare numeric rating scale scores at pretreatment baseline vs 15 minutes, 30 minutes, and 24 hours postprocedure for all 12 treatments. SPG blockade was accomplished with the Tx360(®) , which allows a small flexible soft plastic tube that is advanced below the middle turbinate just past the pterygopalatine fossa into the intranasal space. A 0.3 cc of anesthetic or saline was injected into the mucosa covering the SPG. The procedure is performed similarly in each nostril. The active phase of the study consisted of a series of 12 SPG blocks with 0.3 cc of 0.5% bupivacaine or saline provided 2 times per week for 6 weeks. Subjects were re-evaluated at 1 and 6 months postfinal procedure. The final dataset included 38 subjects, 26 in the
Cady, Roger; Saper, Joel; Dexter, Kent; Manley, Heather R
2015-01-01
Objective To determine if repetitive sphenopalatine ganglion (SPG) blocks with 0.5% bupivacaine delivered through the Tx360® are superior in reducing pain associated with chronic migraine (CM) compared with saline. Background The SPG is a small concentrated structure of neuronal tissue that resides within the pterygopalatine fossa (PPF) in close proximity to the sphenopalatine foramen and is innervated by the maxillary division of the trigeminal nerve. From an anatomical and physiological perspective, SPG blockade may be an effective acute and preventative treatment for CM. Method This was a double-blind, parallel-arm, placebo-controlled, randomized pilot study using a novel intervention for acute treatment in CM. Up to 41 subjects could be enrolled at 2 headache specialty clinics in the US. Eligible subjects were between 18 and 80 years of age and had a history of CM defined by the second edition of the International Classification of Headache Disorders appendix definition. They were allowed a stable dose of migraine preventive medications that was maintained throughout the study. Following a 28-day baseline period, subjects were randomized by computer-generated lists of 2:1 to receive 0.5% bupivacaine or saline, respectively. The primary end-point was to compare numeric rating scale scores at pretreatment baseline vs 15 minutes, 30 minutes, and 24 hours postprocedure for all 12 treatments. SPG blockade was accomplished with the Tx360®, which allows a small flexible soft plastic tube that is advanced below the middle turbinate just past the pterygopalatine fossa into the intranasal space. A 0.3 cc of anesthetic or saline was injected into the mucosa covering the SPG. The procedure is performed similarly in each nostril. The active phase of the study consisted of a series of 12 SPG blocks with 0.3 cc of 0.5% bupivacaine or saline provided 2 times per week for 6 weeks. Subjects were re-evaluated at 1 and 6 months postfinal procedure. Results The final dataset
Preliminary study on the time-related changes of the infrared thermal images of the human body
Li, Ziru; Zhang, Xusheng; Lin, Gang; Chen, Zhigang
2009-08-01
It is of great importance to study the manifestations and the influencing factors of the time-related changes of infrared thermal images (ITI) of human body since the variable body surface temperature distribution seriously affected the application of ITI in medicine. In this paper, manifestations of time-related changes of the ITI of human body from three double-blind randomized trials and their correlation with meteorological factors (e.g. temperature, pressure, humidity, cold front passage and tropical cyclone landing) were studied. The trials were placebo or drug controlled studying the influences of Chinese medicine health food (including Shengsheng capsule with immunity adjustment function, Shengan capsule with sleep improvement function and Shengyi capsule with the function of helping to decrease serum lipid) on the ITI of human body. In the first thirty-six days of the trials images were scanned every six days and image data in the seven observation time spots (including the 0, 6, 12, 18, 24, 30, 36 day of the trial) were used for the time-related study. For every subject the scanned time was fixed in the day within two hours. The ITI features which could reflect the functions of the health foods were studied. The indexes of the features were relative magnitude (temperature difference between the viewing area and the reference area). Results showed that the variation tendencies of the trial group and control group were basically the same in placebo controlled trials and some of the long-term effects of Chinese medicine health food could be reflected significantly in certain time spots in the first thirty-six days. Time-related changes of the ITI of human body were closely related with meteorological factors but there were other influencing factors still need to be studied. As the ITI of human body could reflect the influences of Chinese medicine health foods and are closely related with meteorology, there are bright prospects for the application of ITI in
Light-driven molecular machine at ITIES
DEFF Research Database (Denmark)
Kornyshev, A.A.; Kuimova, M.; Kuznetsov, A.M.
2007-01-01
We suggest a principle of operation of a new molecular device that transforms the energy of light into repetitive mechanical motions. Such a device can also serve as a model system for the study of the effect of electric field on intramolecular electron transfer. We discuss the design of suitable...
Light-driven molecular machine at ITIES
International Nuclear Information System (INIS)
Kornyshev, Alexei A; Kuimova, Marina; Kuznetsov, Alexander M; Ulstrup, Jens; Urbakh, Michael
2007-01-01
We suggest a principle of operation of a new molecular device that transforms the energy of light into repetitive mechanical motions. Such a device can also serve as a model system for the study of the effect of electric field on intramolecular electron transfer. We discuss the design of suitable molecular systems and the methods that may monitor the 'performance' of such a machine
Marketingové využitie Instagramu
Poláková, Lucia
2015-01-01
This bachelor thesis deals with the use of Instagram for marketing purposes. The theoretical part includes basic information about Internet, on-line marketing and social media, but it is mainly focused on Instagram, its principles, on the companies which are using this media and also on successful campaigns on Instagram. The practical part deals with activities of company Birell on Instagram and evaluates their marketing campaign led on this social media.
Medium-spin levels and a 360 ns Isup(π)=19-/2 isomer in the N=80 nucleus 137La
International Nuclear Information System (INIS)
Kortelahti, M.; Pakkanen, A.; Piiparinen, M.; Komppa, T.; Komu, R.
1981-03-01
The level structure of 137 La has been studied using the 138 Ba(p,2n) reaction and methods of in-beam γ-ray and conversion-electron spectroscopy. The 137 La level scheme has been established with 21 new levels with spins up to (19/2) - . A 360 ns (19/2) - isomer at 1870 keV has been identified and a (πgsub(7/2)(νhsub(11/2)sup(-1)dsub(3/2)sup(-1)sub(7 - ))sub(19/2) - configuration is suggested for it. The level ordering of the πhsub(11/2)x2 + multiplet has been discussed on the basis of the triaxial rotor-plus-particle model which suggests a slightly oblate triaxial shape to the 137 La nucleus. (author)
Limestone: some observations on luminescence in the region of 360 nm
International Nuclear Information System (INIS)
Galloway, R.B.
2003-01-01
An empirical study of luminescence around 360 nm from limestone is presented. Thermoluminescence glow curves from natural limestone show broad peaks at 440 deg. C, 350 deg. C, 530 deg. C and 286 deg. C in order of decreasing amplitude in contrast to the usual observation, for luminescence around 535 nm, of a sharp peak at 286 deg. C with a broader less intense peak at 350 deg. C. Recuperation occurs around 350 deg. C and 525 deg. C, which has a time dependence consistent with quantum tunnelling. Dependent on the history of heating and light exposure of the sample, sharp peaks at about 325 deg. C and 425 deg. C can be observed. Laboratory irradiated limestone shows a peak at 140 deg. C. The stimulation of luminescence by light of 470 nm with preheating at 145 deg. C for 300 s, shows an increasing signal for successive cycles of measurement associated with the heating, light exposure having little influence. Beta irradiation of a sample, with the same measurement conditions, gives a signal which increases in proportion to radiation dose but which does not survive storage for 17 h. Time resolved luminescence spectra, with no preheating, show a luminescence lifetime between stimulation and emission of less than a few μs for natural limestone, and an exponential increase in signal with increase in temperature (over the rang 20-167 deg. C) during stimulation. A signal proportional to laboratory applied beta dose is measurable at room temperature, with lifetime between stimulation and emission of this signal of 35 μs, but it does not survive heating to 100 deg. C
360° deterministic magnetization rotation in a three-ellipse magnetoelectric heterostructure
Kundu, Auni A.; Chavez, Andres C.; Keller, Scott M.; Carman, Gregory P.; Lynch, Christopher S.
2018-03-01
A magnetic dipole-coupled magnetoelectric heterostructure comprised of three closely spaced ellipse shapes was designed and shown to be capable of achieving deterministic in-plane magnetization rotation. The design approach used a combination of conventional micromagnetic simulations to obtain preliminary configurations followed by simulations using a fully strain-coupled, time domain micromagnetic code for a detailed assessment of performance. The conventional micromagnetic code has short run times and was used to refine the ellipse shape and orientation, but it does not accurately capture the effects of the strain gradients present in the piezoelectric and magnetostrictive layers that contribute to magnetization reorientation. The fully coupled code was used to assess the effects of strain and magnetic field gradients on precessional switching in the side ellipses and on the resulting dipole-field driven magnetization reorientation in the center ellipse. The work led to a geometry with a CoFeB ellipse (125 nm × 95 nm × 4 nm) positioned between two smaller CoFeB ellipses (75 nm × 50 nm × 4 nm) on a 500 nm PZT-5H film substrate clamped at its bottom surface. The smaller ellipses were oriented at 45° and positioned at 70° and 250° about the central ellipse due to the film deposition on a thick substrate. A 7.3 V pulse applied to the PZT for 0.22 ns produced 180° switching of the magnetization in the outer ellipses that then drove switching in the center ellipse through dipole-dipole coupling. Full 360° deterministic rotation was achieved with a second pulse. The temporal response of the resulting design is discussed.
Appenzeller, Silke; Balling, Rudi; Barisic, Nina; Baulac, Stéphanie; Caglayan, Hande; Craiu, Dana; De Jonghe, Peter; Depienne, Christel; Dimova, Petia; Djémié, Tania; Gormley, Padhraig; Guerrini, Renzo; Helbig, Ingo; Hjalgrim, Helle; Hoffman-Zacharska, Dorota; Jähn, Johanna A.; Klein, Karl Martin; Koeleman, Bobby; Komarek, Vladimir; Krause, Roland; Kuhlenbäumer, Gregor; Leguern, Eric; Lehesjoki, Anna-Elina; Lemke, Johannes R.; Lerche, Holger; Linnankivi, Tarja; Marini, Carla; May, Patrick; Møller, Rikke S.; Muhle, Hiltrud; Pal, Deb; Palotie, Aarno; Pendziwiat, Manuela; Robbiano, Angela; Roelens, Filip; Rosenow, Felix; Selmer, Kaja; Serratosa, Jose M.; Sisodiya, Sanjay M.; Stephani, Ulrich; Sterbova, Katalin; Striano, Pasquale; Suls, Arvid; Talvik, Tiina; von Spiczak, Sarah; Weber, Yvonne G.; Weckhuysen, Sarah; Zara, Federico; Abou-Khalil, Bassel; Alldredge, Brian K.; Andermann, Eva; Andermann, Frederick; Amrom, Dina; Bautista, Jocelyn F.; Berkovic, Samuel F.; Bluvstein, Judith; Boro, Alex; Cascino, Gregory; Consalvo, Damian; Crumrine, Patricia; Devinsky, Orrin; Dlugos, Dennis; Epstein, Michael P.; Fiol, Miguel; Fountain, Nathan B.; French, Jacqueline; Friedman, Daniel; Geller, Eric B.; Glauser, Tracy; Glynn, Simon; Haas, Kevin; Haut, Sheryl R.; Hayward, Jean; Helmers, Sandra L.; Joshi, Sucheta; Kanner, Andres; Kirsch, Heidi E.; Knowlton, Robert C.; Kossoff, Eric H.; Kuperman, Rachel; Kuzniecky, Ruben; Lowenstein, Daniel H.; McGuire, Shannon M.; Motika, Paul V.; Novotny, Edward J.; Ottman, Ruth; Paolicchi, Juliann M.; Parent, Jack; Park, Kristen; Poduri, Annapurna; Sadleir, Lynette G.; Scheffer, Ingrid E.; Shellhaas, Renée A; Sherr, Elliott; Shih, Jerry J.; Singh, Rani; Sirven, Joseph; Smith, Michael C.; Sullivan, Joe; Thio, Liu Lin; Venkat, Anu; Vining, Eileen P. G.; Von Allmen, Gretchen K.; Weisenberg, Judith L.; Widdess-Walsh, Peter; Winawer, Melodie R.; Allen, Andrew S.; Berkovic, Samuel F.; Cossette, Patrick; Delanty, Norman; Dlugos, Dennis; Eichler, Evan E.; Epstein, Michael P.; Glauser, Tracy; Goldstein, David B.; Han, Yujun; Heinzen, Erin L.; Johnson, Michael R.; Kuzniecky, Ruben; Lowenstein, Daniel H.; Marson, Anthony G.; Mefford, Heather C.; Nieh, Sahar Esmaeeli; O'Brien, Terence J.; Ottman, Ruth; Petrou, Stephen; Petrovski, Slavé; Poduri, Annapurna; Ruzzo, Elizabeth K.; Scheffer, Ingrid E.; Sherr, Elliott
2017-01-01
(The American Journal of Human Genetics 95, 360–370; October 2, 2014) In the list of consortium members for the Epilepsy Phenome/Genome Project, member Dina Amrom's name was misspelled as Amron. The authors regret the error.
Directory of Open Access Journals (Sweden)
Suhrad G Banugaria
Full Text Available OBJECTIVE: Although enzyme replacement therapy (ERT is a highly effective therapy, CRIM-negative (CN infantile Pompe disease (IPD patients typically mount a strong immune response which abrogates the efficacy of ERT, resulting in clinical decline and death. This study was designed to demonstrate that immune tolerance induction (ITI prevents or diminishes the development of antibody titers, resulting in a better clinical outcome compared to CN IPD patients treated with ERT monotherapy. METHODS: We evaluated the safety, efficacy and feasibility of a clinical algorithm designed to accurately identify CN IPD patients and minimize delays between CRIM status determination and initiation of an ITI regimen (combination of rituximab, methotrexate and IVIG concurrent with ERT. Clinical and laboratory data including measures of efficacy analysis for response to ERT were analyzed and compared to CN IPD patients treated with ERT monotherapy. RESULTS: Seven CN IPD patients were identified and started on the ITI regimen concurrent with ERT. Median time from diagnosis of CN status to commencement of ERT and ITI was 0.5 months (range: 0.1-1.6 months. At baseline, all patients had significant cardiomyopathy and all but one required respiratory support. The ITI regimen was safely tolerated in all seven cases. Four patients never seroconverted and remained antibody-free. One patient died from respiratory failure. Two patients required another course of the ITI regimen. In addition to their clinical improvement, the antibody titers observed in these patients were much lower than those seen in ERT monotherapy treated CN patients. CONCLUSIONS: The ITI regimen appears safe and efficacious and holds promise in altering the natural history of CN IPD by increasing ERT efficacy. An algorithm such as this substantiates the benefits of accelerated diagnosis and management of CN IPD patients, thus, further supporting the importance of early identification and treatment
Indian Academy of Sciences (India)
The special theory of relativity is one of the cornerstones of physics. When we ... ity of the principle of relativity, many great physicists and mathematicians ... ity, according to which the laws of physical phenomena should ... The difference be-.
International Nuclear Information System (INIS)
Aziz, T.; Banerjee, S.; Ganguli, S.N.; Malhotra, P.K.; Raghavan, R.; Bailly, J.L.; Herquet, P.; Bruyant, F.; Caso, C.; Hrubec, J.; Marin, J.C.; Montanet, L.; Chiba, Y.; Epp, B.; Girtler, P.; Fontanelli, F.; Squarcia, S.; Trevisan, U.; Gemesy, T.; Pinter, G.; Matsumoto, S.; Mittra, I.S.; Singh, J.B.; Takahashi, K.; Tikhonova, L.A.
1985-01-01
A study of Λ production has been made in the target fragmentation region from pp interactions at 360 GeV/c. The triple Regge analysis of the double differential distribution d 2 N/d(M 2 /s)dt led to an estimate of the kaon trajectory intercept as approx.=-0.6. Comparison of the double and single inclusive distributions supports the idea of Pomeron factorization. The charged multiplicities and moments from virtual 'K + 'p interactions have been studied as a function of M, the c.m. energy of the virtual 'K + 'p system. The results agree reasonably well with the on shell K + p data. (orig.)
Directory of Open Access Journals (Sweden)
J. F. Pankow
2008-05-01
Full Text Available The SIMPOL.1 group contribution method is developed for predicting the liquid vapor pressure poL (atm and enthalpy of vaporization Δ Hvap (kJ mol-1 of organic compounds as functions of temperature (<i>T>. For each compound i, the method assumes log10poL,i (T=∑kνk,ibk(T where νk,i is the number of groups of type k, and bk (<i>T> is the contribution to log10poL,i (<i>T> by each group of type k. A zeroeth group is included that uses b0 (<i>T> with ν0,i=1 for all i. A total of 30 structural groups are considered: molecular carbon, alkyl hydroxyl, aromatic hydroxyl, alkyl ether, alkyl ring ether, aromatic ether, aldehyde, ketone, carboxylic acid, ester, nitrate, nitro, alkyl amine (primary, secondary, and tertiary, aromatic amine, amide (primary, secondary, and tertiary, peroxide, hydroperoxide, peroxy acid, C=C, carbonylperoxynitrate, nitro-phenol, nitro-ester, aromatic rings, non-aromatic rings, C=C–C=O in a non-aromatic ring, and carbon on the acid-side of an amide. The <i>T> dependence in each of the bk (<i>T> is assumed to follow b(T=B1/T+B2+B3T+B4ln <i>T>. Values of the B coefficients are fit using an initial basis set of 272 compounds for which experimentally based functions po L,i=fi (<i>T> are available. The range of vapor pressure considered spans fourteen orders of magnitude. The ability of the initially fitted B coefficients to predict poL values is examined using a test set of 184 compounds and a <i>T> range that is as wide as 273
Study of charm meson production in Tip and pp interactions at 360 Gev/c
International Nuclear Information System (INIS)
Etienne, F.
1984-02-01
The available energy at accelerators of SPS Type, implies the development of new experimental technics and firet of all their optimization by simulation program. A set of programs has been written to evaluate and improve the performances of the spectrometer EHS (European Hybrid Spectrometer) at C.E.R.N. In 1979, the main components of the spectrometer are ready to be used in an experiment allowing the direct observation of charm decays. Charm D meson production in 360 GeV π - p and pp interactions has been studied using the high resolution Hydrogen bubble chamber LEBC and EHS. The production cross sections are computed. The date show evidence for leading quark effect in the Feynman x distribution in the π - p sample. The rapidity gap between members of reconstructed charm pairs is small compared to the available rapidity range in the π - p sample although no strong correlation is observed between DantiD pairs in the pp sample. Finally the data are compared to other experimental results and checked to the predictions of the models of charm hadro-production in a kinematical region very different from the one of leptons pairs production at high Psub(t) where perturbative QCD applies [fr
A review of the microbiology of the Rehai geothermal field in Tengchong, Yunnan Province, China
Directory of Open Access Journals (Sweden)
Brian P. Hedlund
2012-05-01
Full Text Available The Rehai Geothermal Field, located in Tengchong County, in central-western Yunnan Province, is the largest and most intensively studied geothermal field in China. A wide physicochemical diversity of springs (ambient to ∼97 °C; pH from ≤1.8 to ≥9.3 provides a multitude of niches for extremophilic microorganisms. A variety of studies have focused on the cultivation, identification, basic physiology, taxonomy, and biotechnological potential of thermophilic microorganisms from Rehai. Thermophilic bacteria isolated from Rehai belong to the phyla Firmicutes and Deinococcus-Thermus. Firmicutes include neutrophilic or alkaliphilic Anoxybacillus, Bacillus, Caldalkalibacillus, Caldanaerobacter, Laceyella, and Geobacillus, as well as thermoacidophilic Alicyclobacillus and Sulfobacillus. Isolates from the Deinococcus-Thermus phylum include several Meiothermus and Thermus species. Many of these bacteria synthesize thermostable polymer-degrading enzymes that may be useful for biotechnology. The thermoacidophilic archaea Acidianus, Metallosphaera, and Sulfolobus have also been isolated and studied. A few studies have reported the isolation of thermophilic viruses belonging to Siphoviridae (TTSP4 and TTSP10 and Fuselloviridae (STSV1 infecting Thermus spp. and Sulfolobus spp., respectively. More recently, cultivation-independent studies using 16S rRNA gene sequences, shotgun metagenomics, or “functional gene” sequences have revealed a much broader diversity of microorganisms than represented in culture. Studies of the gene and mRNA encoding the large subunit of the ammonia monooxygenase (amoA of ammonia-oxidizing Archaea (AOA and the tetraether lipid crenarchaeol, a potential biomarker for AOA, suggest a wide diversity, but possibly low abundance, of thermophilic AOA in Rehai. Finally, we introduce the Tengchong Partnerships in International Research and Education (PIRE project, an international collaboration between Chinese and U.S. scientists with
Hussein, R; Khalifa, A
2011-01-01
During the last decade, Egypt has experienced a revolution in the field of Information and Communication Technology (ICT) that has had a corresponding impact on the field of healthcare. Since 1993, the Information Technology Institute (ITI) has been leading the development of the Information Technology (IT) professional training and education in Egypt to produce top quality IT professionals who are considered now the backbone of the IT revolution in Egypt. For the past five years, ITI has been adopting the objective of building high caliber health professionals who can effectively serve the ever-growing information society. Academic links have been established with internationally renowned universities, e.g., Oregon Health and Science University (OHSU) in US, University of Leipzig in Germany, in addition those with the Egyptian Fellowship Board in order to enrich ITI Medical Informatics Education and Research. The ITI Biomedical and Health Informatics (BMHI) education and training programs target fresh graduates as well as life-long learners. Therefore, the program's learning objectives are framed within the context of the four specialization tracks: Healthcare Management (HCM), Biomedical Informatics Research (BMIR), Bioinformatics Professional (BIP), and Healthcare Professional (HCP). The ITI BMHI research projects tackle a wide-range of current challenges in this field, such as knowledge management in healthcare, providing tele-consultation services for diagnosis and treatment of infectious diseases for underserved regions in Egypt, and exploring the cultural and educational aspects of Nanoinformatics. Since 2006, ITI has been positively contributing to develop the discipline of BMHI in Egypt in order to support improved healthcare services.
Directory of Open Access Journals (Sweden)
Jovanka V. Popov-Raljić
2009-03-01
Full Text Available In this work sensory characteristics (appearance – color, brilliance, shape and surface; texture – structure, break, firmness and chewiness; aroma – odor and taste of dietary chocolates of different compositions were evaluated, in parallel with color parameter measurements. Color was determined instrumentally on the top and bottom surfaces, using a "MINOLTA" Chroma meter CR 400 thristimulus colorimeter. Sensory evaluation was performed by a group of experienced panelists immediately after the production (0 – 30 days, and then after 90, 180, 270 and 360 days of storage under ambient conditions (t = 18 – 20°C. Results were statistically analyzed by the two-factorial analysis of variance (MANOVA and with the LSD – test. It was concluded that the storage time up to one year had statistically highly significant (p < 0.01 effects on the sensory attributes of chocolate, as well as on instrumentally measured color parameters.
Neto, Olmiro Andrade; Gasperin, Bernardo G; Rovani, Monique T; Ilha, Gustavo F; Nóbrega, Janduí E; Mondadori, Rafael G; Gonçalves, Paulo B D; Antoniazzi, Alfredo Q
2014-10-15
Castration of male calves is necessary for trading to facilitate handling and prevent reproduction. However, some methods of castration are traumatic and lead to economic losses because of infection and myiasis. The objective of the present study was to evaluate the efficiency of intratesticular injection (ITI) of hypertonic sodium chloride (NaCl; 20%) solution in male calf castration during the first weeks of life. Forty male calves were allocated to one of the following experimental groups: negative control-surgically castrated immediately after birth; positive control -intact males; G1-ITI from 1- to 5-day old; G2-ITI from 15- to 20-day old; and G3-ITI from 25- to 30-day old. Intratesticular injection induced coagulative necrosis of Leydig cells and seminiferous tubules leading to extensive fibrosis. Testosterone secretion and testicular development were severely impaired in 12-month-old animals from G1 and G2 groups (P<0.05), in which no testicular structure and sperm cells were observed during breeding soundness evaluation. Rectal and scrotal temperatures were not affected by different procedures. In conclusion, ITI of hypertonic NaCl solution induces sterility and completely suppresses testosterone secretion when performed during the first 20 days of life. Copyright © 2014 Elsevier Inc. All rights reserved.
Xylanases of thermophilic bacteria from Icelandic hot springs
Energy Technology Data Exchange (ETDEWEB)
Pertulla, M; Raettoe, M; Viikari, L [VTT, Biotechnical Lab., Espoo (Finland); Kondradsdottir, M [Dept. of Biotechnology, Technological Inst. of Iceland, Reykjavik (Iceland); Kristjansson, J K [Dept. of Biotechnology, Technological Inst. of Iceland, Reykjavik (Iceland) Inst. of Biotechnology, Iceland Univ., Reykjavik (Iceland)
1993-02-01
Thermophilic, aerobic bacteria isolated from Icelandic hot springs were screened for xylanase activity. Of 97 strains tested, 14 were found to be xylanase positive. Xylanase activities up to 12 nkat/ml were produced by these strains in shake flasks on xylan medium. The xylanases of the two strains producing the highest activities (ITI 36 and ITI 283) were similar with respect to temperature and pH optima (80deg C and pH 8.0). Xylanase production of strain ITI 36 was found to be induced by xylan and xylose. Xylanase activity of 24 nkat/ml was obtained with this strain in a laboratory-scale-fermentor cultivation on xylose medium. [beta]-Xylosidase activity was also detected in the culture filtrate. The thermal half-life of ITI 36 xylanase was 24 h at 70deg C. The highest production of sugars from hydrolysis of beech xylan was obtained at 70deg C, although xylan depolymerization was detected even up to 90deg C. (orig.).
Directory of Open Access Journals (Sweden)
Moore Ernest E
2009-02-01
Full Text Available Abstract Background Pyogenic spondylodiscitis represents a potentially life-threatening condition. Due to the low incidence, evidence-based surgical recommendations in the literature are equivocal, and the treatment modalities remain controversial. Case presentation A 59 year-old patient presented with a history of thoracic spondylodiscitis resistant to antibiotic treatment for 6 weeks, progressive severe back pain, and a new onset of bilateral lower extremity weakness. Clinically, the patient showed a deteriorating spastic paraparesis of her lower extremities. An emergent MRI revealed a kyphotic wedge compression fracture at T7/T8 with significant spinal cord compression, paravertebral and epidural abscess, and signs of myelopathy. The patient underwent surgical debridement with stabilization of the anterior column from T6–T9 using an expandable titanium cage, autologous bone graft, and an anterolateral locking plate. The patient recovered well under adjunctive antibiotic treatment. She presented again to the emergency department 6 months later, secondary to a repeat fall, with acute paraplegia of the lower extremities and radiographic evidence of failure of fixation of the anterior T-spine. She underwent antero-posterior revision fixation with hardware removal, correction of kyphotic malunion, evacuation of a recurrent epidural abscess, decompression of the spinal canal, and 360° fusion from T2–T11. Despite the successful salvage procedure, the patient deteriorated in the postoperative phase, when she developed multiple complications including pneumonia, acute respiratory distress syndrome, bacterial meningitis, abdominal compartment syndrome, followed by septic shock with multiple organ failure and a lethal outcome within two weeks after revision surgery. Conclusion This catastrophic example of a lethal outcome secondary to failure of anterior column fixation for pyogenic thoracic spondylodiscitis underlines the notion that surgical
A Logic Architecture for 360 ADAS-Alerts for Hazards Detection Based in Driver Actions
Directory of Open Access Journals (Sweden)
Izquierdo-Reyes Javier
2017-01-01
Full Text Available In this work is presented a novel approach for passive safety in vehicles by Advanced Driver Assistance Systems (ADAS alert emission in 360° around driver to notify about hazards nearby the vehicle depending on the actions taken by driver per the context. This proposal would create a more robust system compared to current passive ADAS systems since the feedback to driver is in the same direction that hazard is detected (Punctual Sound Source Alert, compared with most assistance systems that emits sounds from the monitor or from the dashboard provoking distractions when emits alerts unnecessarily. The increase of security by this method will allow the driver to be aware of their surroundings even in a very quiet cabin or in a noisy environment. Also, it would detect the steering wheel angle, speed of movement and the activation of turning lights among other alerts, which would allow us to define a critical action during driving; apart from using sensors and cameras aimed at the driver to detect patterns of movement during these critical actions and have a prediction of a possible turn or manoeuvre when driving, refer to Figure 1. It will be necessary a reconfiguration of the alert in frequency, time of action depending upon the level of risk to prevent an accident or to reduce the consequences in an imminent accident.
Position on mouse chromosome 1 of a gene that controls resistance to Salmonella typhimurium.
Taylor, B A; O'Brien, A D
1982-06-01
Ity is a gene which regulates the magnitude of Salmonella typhimurium growth in murine tissues and, hence, the innate salmonella resistance of mice. The results of a five-point backcross clearly showed that the correct gene order on chromosome 1 is fz-Idh-1-Ity-ln-Pep-3.
Intensive strength and balance training with the Kinect console (Xbox 360) in a patient with CMT1A.
Pagliano, Emanuela; Foscan, Maria; Marchi, Alessia; Corlatti, Alice; Aprile, Giorgia; Riva, Daria
2017-08-01
Effective drugs for type 1A Charcot-Marie-Tooth (CMT1A) disease are not available. Various forms of moderate exercise are beneficial, but few data are available on the effectiveness of exercise in CMT1A children. To investigate the feasibility and effectiveness of exercises to improve ankle strength and limb function in a child with CMT1A. Outpatient clinic. Nine-year-old boy with CMT1A. The rehabilitation program consisted of ankle exercises and Kinect videogame-directed physical activities (using an Xbox 360 console/movement sensor) that aimed to improve balance and limb strength. The program was given 3 times a week for 5 weeks. The child was assessed at baseline, after 5 weeks, and 3 and 6 months after. By the end of follow-up, child balance and endurance had improved, but ankle strength did not. The encouraging results for balance and endurance justify further studies on videogame-directed activities in CMT1A children/adolescents.
Tumors of the salivary gland in Mexicans. A retrospective study of 360 cases.
Mejía-Velázquez, C-P; Durán-Padilla, M-A; Gómez-Apo, E; Quezada-Rivera, D; Gaitán-Cepeda, L-A
2012-03-01
To establish distribution frequency and demographic characteristics of salivary gland tumours (SGT) in order to identify possible risk profiles. The present report constitutes an eight year retrospective study (January 2000-August 2007). The archives of the Clinical and Experimental Pathology Laboratory (Graduate and Research Division, Dental School, National Autonomous University of Mexico) as well as archives of the Surgical Pathology Service (General Hospital, Mexico City) were subject to revision in order to select all cases where SGT tumour diagnoses were emitted. Age and gender of patients as well as SGT topography were obtained from medical records. Selected cases were classified according to location of the lesion, histological lineage and biological behaviour. 360 cases of SGT were included, 227 (67%) cases were benign tumours, while 83 cases (23%) were malignant tumours. SGT were most frequent in women with ages ranging from their 3rd to 5th decades of life. 275 tumours were located in major salivary glands, 78.9% of them were identified in the parotid gland. The most frequent location of tumours arising from minor salivary glands (33 cases, 38%) was found in the palatine glands. Tumours of epithelial lineage were the predominant histological type. The most frequent benign tumours were pleomorphic adenomas (86.1%) and papillary cystadenoma lymphomatosum (7.3%). The most frequent malignant tumours were adenoid cystic carcinomas (25%) and mucoepidermoid carcinomas (23.6%). Salivary gland tumours in Mexican population appear principally in major salivary glands of women in their 3rd to 5th decade of life.
HIV intertest interval among MSM in King County, Washington.
Katz, David A; Dombrowski, Julia C; Swanson, Fred; Buskin, Susan E; Golden, Matthew R; Stekler, Joanne D
2013-02-01
The authors examined temporal trends and correlates of HIV testing frequency among men who have sex with men (MSM) in King County, Washington. The authors evaluated data from MSM testing for HIV at the Public Health-Seattle & King County (PHSKC) STD Clinic and Gay City Health Project (GCHP) and testing history data from MSM in PHSKC HIV surveillance. The intertest interval (ITI) was defined as the number of days between the last negative HIV test and the current testing visit or first positive test. Correlates of the log(10)-transformed ITI were determined using generalised estimating equations linear regression. Between 2003 and 2010, the median ITI among MSM seeking HIV testing at the STD Clinic and GCHP were 215 (IQR: 124-409) and 257 (IQR: 148-503) days, respectively. In multivariate analyses, younger age, having only male partners and reporting ≥10 male sex partners in the last year were associated with shorter ITIs at both testing sites (pGCHP attendees, having a regular healthcare provider, seeking a test as part of a regular schedule and inhaled nitrite use in the last year were also associated with shorter ITIs (pGCHP (median 359 vs 255 days, p=0.02). Although MSM in King County appear to be testing at frequent intervals, further efforts are needed to reduce the time that HIV-infected persons are unaware of their status.
Bakar, Ab Rahim; Mohamed, Shamsiah; Hamzah, Ramlah
2013-01-01
This study was performed to identify the employability skills of technical students from the Industrial Training Institutes (ITI) and Indigenous People's Trust Council (MARA) Skills Training Institutes (IKM) in Malaysia. The study sample consisted of 850 final year trainees of IKM and ITI. The sample was chosen by a random sampling procedure from…
Epidemiology of Maternal Mortality in Malawi
African Journals Online (AJOL)
live births. Causes and determinants of maternal mortal- ity. Global causes of maternal mortality. Across the globe the causes of maternal deaths are strik- ..... at home”. Findings from Thyolo, Mangochi and Chik- wawa were similar". Perceived qua/ity of care. Like anywhere in the world, the perceived quality of care in ...
ORF Alignment: NC_005835 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available ine pdb|1FJG|S Chain S, Structure ... Of The Thermus Thermophilus 30s Ribosomal Subunit In ... Complex With The Antibioti...cs Streptomycin, ... Spectinomycin, And Paromomycin ... Length = 84 ... Q
ORF Alignment: NC_006461 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available ine pdb|1FJG|S Chain S, Structure ... Of The Thermus Thermophilus 30s Ribosomal Subunit In ... Complex With The Antibioti...cs Streptomycin, ... Spectinomycin, And Paromomycin ... Length = 84 ... Q
Investigation of IT/IS Outsourcing in Singapore
Mui, Angela Koh Ser
2003-01-01
The concept of outsourcing information technology (IT) or systems (IS) has been around since mid 1960s. Today, outsourcing has become a potentially viable business solution that many IT managers are looking into in order to remain competitive in the current dynamic business and technological environment. In Singapore, the recent IT outsourcing by DBS Bank has raised the awareness and sparked off the interest to conduct this study. The purpose of this thesis is therefore to investigate this la...
Využitie youtuberov v marketingu
Kladivíková, Zuzana
2017-01-01
This bachelor thesis aims at acquainting with one of the most significant marketing phenomena in recent: marketing campaings cooperating with youtubers. Also describes when and for what types of products it is appropriate to use this type of campaigns. First part of thesis points to the uniqueness of the video comparing to other formats and highlites its benefits over other media, using the human perception concept and marketign succes as a point of view. YouTube is examined as a most importa...
Emolo, Antonio; Zollo, Aldo; Picozzi, Matteo; Martino, Claudio; Elia, Luca; Verderame, Gerardo; De Risi, Maria Teresa; Ricci, Paolo; Lombardi, Anna; Bindi, Dino; Parolai, Stefano; Boxberger, Tobias; Miranda, Nicola
2014-05-01
One of the main objective of the WP7 (Strategic Applications and Capacity Building) in the framework of the REAKT-Strategies and tools for Real Time Earthquake RisK ReducTion FP7 European project, is to evaluate the effectiveness of EEW and real-time risk assessment procedures in reducing seismic risk to various industrial partners and end-users. In the context of the REAKT project, the AMRA-RISSCLab group is engaged in a feasibility study on the application of earthquake early-warning procedures in two high schools located in the Irpinia region (South Italy), an area that in the 1980 was struck by a magnitude 6.9 earthquake. In this work we report on the activities carried out during the last 24 Months at the school ITIS 'E. Majorana', located in Somma Vesuviana, a village in the neighbourhood of Naples. In order to perform a continuous seismic monitoring of the site, which includes a rather complex structure building, 5 accelerometric stations have been installed in different part of the school. In particular, a 24-bit ADC (Sigma/Delta) Agecodagis-Kefren data-logger has been installed with a Guralp CMG-5TC accelerometer with a 0.25g full-scale in the school courtyard, while 4 SOSEWIN sensors have been also installed at different locations within the building. Commercial ADSL lines provide transmission of real-time data to the EEW centre. Data streams are now acquired in real-time in the PRESToPlus (regional and on-site, threshold-based early-warning) software platform [1]. The recent December 29, 2013 M 5.1 Monti del Matese Earthquake, gave us the unique opportunity to use real strong motion data to test the performance of threshold-based early warning method at the school. The on-site method [2] aims to define alert levels at the monitored site. In particular, at each station the characteristic P-waves period (τc) and the peak displacement (Pd) are measured on the initial P-wave signal. They are compared with threshold values, previously established through an
Theresia, L.; Lahuddin, A. H.; Bangun, R.
2017-12-01
Balanced Scorecard (BSC) is a powerful tool in decision making process. Nevertheless, it is not rare that the BSC does not give satisfactory results because the indicators chosen do not reflect the needs of the organization. Therefore, indicator establishment is very crucial in the utilization of BSC. This research aims to determine the indicators BSC for a university and the research is a case study in Institut Teknologi Indonesia (ITI). In this study, BSC structure and indicators, comparison made by 4 previous researchers was used as the initial guide to determine the structure and indicators of ITI. And then, questionnaires were distributed to selected respondents and a focus group discussion (FGD) was conducted in order to produce indicators of BSC based on the mental model of the ITI. It is found 15 indicators based on the mental model of ITI. Furthermore, the relationships between the indicators are seen as dynamic relationships, and by using system dynamics, some feedback loops that are considered critical to organizational success can be identified and isolated.
Interaction of acridine-calix[4]arene with DNA at the electrified liquid liquid interface
International Nuclear Information System (INIS)
Kivlehan, Francine; Lefoix, Myriam; Moynihan, Humphrey A.; Thompson, Damien; Ogurtsov, Vladimir I.; Herzog, Gregoire; Arrigan, Damien W.M.
2010-01-01
The behaviour of an acridine-functionalised calix[4]arene at the interface between two immiscible electrolyte solutions (ITIES) is reported. Molecular modelling showed that the acridine-calix[4]arene has regions of significant net positive charge spread throughout the protonated acridine moieties, consistent with it being able to function as an anion ionophore. The presence of this compound in the organic phase facilitated the transfer of aqueous phase electrolyte ions. Upon addition of double stranded DNA to the aqueous phase, the transfer of electrolyte anions was diminished, due to DNA binding to the acridine moiety at the ITIES. The behaviour provides a basis for DNA hybridization detection using electrochemistry at the ITIES.
Evidence for e+e− →γχc1,2 at center-of-mass energies from 4.009 to 4.360 GeV
International Nuclear Information System (INIS)
Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.
2015-01-01
Using data samples collected at center-of-mass energies of √s=4.009, 4.230, 4.260, and 4.360 GeV with the BESIII detector operating at the BEPCII collider, we perform a search for the process e + e − → γχ cJ (J=0, 1, 2) and find evidence for e + e − → γχ c1 and e + e − → γχ c2 with statistical significances of 3.0σ and 3.4σ, respectively. The Born cross sections σ B (e + e − → γχ cJ ), as well as their upper limits at the 90% confidence level (C.L.) are determined at each center-of-mass energy
Directory of Open Access Journals (Sweden)
Younos Vakil Alroaia
2012-08-01
Full Text Available Performance measurement plays an essential role on accelerating the efficiency of any organization. There are literally different methods for measuring the relative performance of a particular unit and many of them are involved considering various criteria. In this paper, we propose 360° feedback system for performance measurement of all employees who work for municipality of the city of Tabas located in east part of Iran. The proposed model of this paper also uses hierarchical method to cluster different attributes based on various characteristics and implements analytical hierarchy process to find the relative importance of all items. The survey uses five personal characteristics including cognitive, technical, personal and human skills and for each major item, the proposed model considers various sub-criteria. The results indicate that technical and cognitive skills are the most important personal characteristics followed by human and personal characteristics. The results of this survey show that responsibility and quality of work are the most important employee characteristics.
Directory of Open Access Journals (Sweden)
Yao Wang
2017-05-01
Full Text Available The increased track density in bit patterned media recording (BPMR causes increased inter-track interference (ITI, which degrades the bit error rate (BER performance. In order to mitigate the effect of the ITI, signals from multiple tracks can be equalized by a 2D equalizer with 1D target. Usually, the 2D fixed equalizer coefficients are obtained by using a pseudo-random bit sequence (PRBS for training. In this study, a 2D variable equalizer is proposed, where various sets of 2D equalizer coefficients are predetermined and stored for different ITI patterns besides the usual PRBS training. For data detection, as the ITI patterns are unknown in the first global iteration, the main and adjacent tracks are equalized with the conventional 2D fixed equalizer, detected with Bahl-Cocke-Jelinek-Raviv (BCJR detector and decoded with low-density parity-check (LDPC decoder. Then using the estimated bit information from main and adjacent tracks, the ITI pattern for each island of the main track can be estimated and the corresponding 2D variable equalizers are used to better equalize the bits on the main track. This process is executed iteratively by feeding back the main track information. Simulation results indicate that for both single-track and two-track detection, the proposed 2D variable equalizer can achieve better BER and frame error rate (FER compared to that with the 2D fixed equalizer.
DEFF Research Database (Denmark)
Fitzpatrick, Ciaràn M; Maric, Vojislav S; Bate, Simon T
2018-01-01
test day per week for three weeks) as previous experience had shown that 4 training days would be sufficient to induce consistent premature response levels in male C57BL/6J mice. Once a steady state was achieved, the effects of dextroamphetamine (AMPH) and (±)-2,5-dimethoxy-4-iodoamphetamine (DOI) were...... then assessed using a Latin-square design to determine whether pharmacological-induced impulsive actions depended on ITI length. Mice habituated to the variable ITI schedule after only 3days and showed consistently lower premature response levels until the end of the study. AMPH (pDOI (p....05) increased the percentage of premature responses at 15s ITI trials, while only DOI (pDOI increased omission rates (p
Temperature Dependence of the Stability of Ion Pair Interactions ...
Indian Academy of Sciences (India)
The occurrence of bridging water molecules between the ions ensures that the ions are not ... The structural features that render this thermostability ..... dehydrogenase single site mutant T198I from Thermus thermophilus with PDB ID 1BDM.
Cady, Roger K; Saper, Joel; Dexter, Kent; Cady, Ryan J; Manley, Heather R
2015-04-01
This study aims to determine if repetitive sphenopalatine ganglion (SPG) blockades with 0.5% bupivacaine delivered with the Tx360 device results in long-term improvement in chronic migraine (CM). The SPG is a small concentrated structure of neuronal tissue that resides within the pterygopalatine fossa in close proximity to the sphenopalatine foramen and is innervated by the maxillary division of the trigeminal nerve. In a previous article, these authors reported repetitive SPG blockades with 0.5% bupivacaine delivered by the Tx360 device, which was an effective and well-tolerated intervention to incrementally decrease baseline headache intensity of subjects with CM. This was a double-blind, parallel-arm, placebo-controlled, randomized pilot study using a novel intervention for acute treatment in CM. A total of 41 subjects were enrolled at two headache specialty clinics in the USA. Eligible subjects were between 18 and 80 years of age and had a history of CM defined by International Classification of Headache Disorders-II definition. Subjects were allowed a stable dose of migraine preventive medications that was maintained throughout the study. Following a 28-day baseline period, subjects were randomized by computer-generated lists 2:1 to receive 0.3 cc of 0.5% bupivacaine or saline, respectively, delivered with the Tx360 twice a week for 6 weeks. Secondary end-points reported in this manuscript include post-treatment measures including number of headache days and quality of life measures. The final data set included 38 subjects: 26 in the bupivacaine group and 12 in the saline group. Our primary end-point for the study, difference in numeric pain rating scale scores, was met and reported in a previous article. The supplemental secondary end-points reported in this manuscript did not reach statistical significance. When looking collectively at these end-points, trends were noticed and worthy of reporting. Subjects receiving bupivacaine reported a decrease in the
Surgery for Infective Endocarditis: Outcomes and Predictors of Mortality in 360 Consecutive Patients
Farag, Mina; Borst, Tobias; Sabashnikov, Anton; Zeriouh, Mohamed; Schmack, Bastian; Arif, Rawa; Beller, Carsten J.; Popov, Aron-Frederik; Kallenbach, Klaus; Ruhparwar, Arjang; Dohmen, Pascal M.; Szabó, Gábor; Karck, Matthias; Weymann, Alexander
2017-01-01
Background A retrospective analysis was conducted of the early and long-term outcomes after surgery for infective endocarditis (IE). Material/Methods We included 360 patients with IE operated upon between 1993 and 2012. The primary endpoint was overall cumulative postoperative survival at 30 days. Secondary endpoints were early postoperative outcomes and complication rates. Factors associated with 30-day mortality were analyzed. Results Mean age was 58.7±14.7 years and 26.9% (n=97) were female. The mean follow-up was 4.41±4.53 years. Postoperative survival was 81.7% at 30 days, 69.4% at 1 year, 63.3% at 5 years, and 63.3% at 10 years. Non-survivors were significantly older (p=0.014), with higher NYHA Class (p=0.002), had higher rates of preoperative diabetes mellitus (p=0.005), renal failure (p=0.001), and hepatic disease (p=0.002). Furthermore, non-survivors had higher baseline alanine aminotransferase (ALT, p=0.048), aspartate transaminase (AST, p=0.027), bilirubin (p=0.013), white cell count (WCC, p=0.034), and CRP (p=0.049). Factors associated with 30-day mortality were longer duration of surgery, CPB, and aortic cross-clamping times (p<0.001, p<0.001, and p=0.003, respectively), as well as higher RBC, FFP, and platelet transfusion requirements (p<0.001, p=0.005, and p<0.001, respectively). Multivariate logistic regression analysis revealed liver cirrhosis (OR 4.583, 95-CI: 1.096–19.170, p=0.037) and longer CPB time (OR 1.025, 95-CI 1.008–1.042, p=0.004) as independent predictors of 30-day mortality. Conclusions Surgical treatment of IE shows satisfactory early, midterm, and long-term results. Multivariate logistic regression analysis revealed cirrhosis and longer CPB time as independent predictors of 30-day mortality. PMID:28740070
James, Richard J E; O'Malley, Claire; Tunney, Richard J
2016-01-01
Manipulating different behavioral characteristics of gambling games can potentially affect the extent to which individuals persevere at gambling, and their transition to problematic behaviors. This has potential impact for mobile gambling technologies and responsible gambling interventions. Two laboratory models pertinent to this are the partial reinforcement extinction effect (PREE) and the trial spacing effect. Both of these might speed up or delay the acquisition and extinction of conditioned behavior. We report an experiment that manipulated the rate of reinforcement and inter trial interval (ITI) on a simulated slot machine where participants were given the choice between gambling and skipping on each trial, before perseverative gambling was measured in extinction, followed by measurements of the illusion of control, depression and impulsivity. We hypothesized that longer ITI's in conjunction with the low rates of reinforcement observed in gambling would lead to greater perseverance. We further hypothesized, given that timing is known to be important in displaying illusory control and potentially in persevering in gambling, that prior exposure to longer intervals might affect illusions of control. An interaction between ITI and rate of reinforcement was observed, as low reinforced gamblers with a long ITI gambled for longer. Respondents also displayed extinction and a PREE. Gamblers exposed to a higher rate of reinforcement gambled for longer in acquisition. Impulsivity was associated with extended perseverance in extinction, and more depressed gamblers in the high reinforcement short ITI group persevered for longer. Performance in the contingency judgment failed to support the second hypothesis: the only significant contrast observed was that participants became better calibrated as the task progressed.
Directory of Open Access Journals (Sweden)
C. Albergel
2008-12-01
Full Text Available A long term data acquisition effort of profile soil moisture is under way in southwestern France at 13 automated weather stations. This ground network was developed in order to validate remote sensing and model soil moisture estimates. In this paper, both those in situ observations and a synthetic data set covering continental France are used to test a simple method to retrieve root zone soil moisture from a time series of surface soil moisture information. A recursive exponential filter equation using a time constant, <i>T>, is used to compute a soil water index. The Nash and Sutcliff coefficient is used as a criterion to optimise the <i>T> parameter for each ground station and for each model pixel of the synthetic data set. In general, the soil water indices derived from the surface soil moisture observations and simulations agree well with the reference root-zone soil moisture. Overall, the results show the potential of the exponential filter equation and of its recursive formulation to derive a soil water index from surface soil moisture estimates. This paper further investigates the correlation of the time scale parameter <i>T> with soil properties and climate conditions. While no significant relationship could be determined between <i>T> and the main soil properties (clay and sand fractions, bulk density and organic matter content, the modelled spatial variability and the observed inter-annual variability of <i>T> suggest that a weak climate effect may exist.
CarD uses a minor groove wedge mechanism to stabilize the RNA polymerase open promoter complex.
Bae, Brian; Chen, James; Davis, Elizabeth; Leon, Katherine; Darst, Seth A; Campbell, Elizabeth A
2015-09-08
A key point to regulate gene expression is at transcription initiation, and activators play a major role. CarD, an essential activator in Mycobacterium tuberculosis, is found in many bacteria, including Thermus species, but absent in Escherichia coli. To delineate the molecular mechanism of CarD, we determined crystal structures of Thermus transcription initiation complexes containing CarD. The structures show CarD interacts with the unique DNA topology presented by the upstream double-stranded/single-stranded DNA junction of the transcription bubble. We confirm that our structures correspond to functional activation complexes, and extend our understanding of the role of a conserved CarD Trp residue that serves as a minor groove wedge, preventing collapse of the transcription bubble to stabilize the transcription initiation complex. Unlike E. coli RNAP, many bacterial RNAPs form unstable promoter complexes, explaining the need for CarD.
Cook, David A; Castillo, Richmond M; Gas, Becca; Artino, Anthony R
2017-10-01
Measurement of motivation and cognitive load has potential value in health professions education. Our objective was to evaluate the validity of scores from Dweck's Implicit Theories of Intelligence Scale (ITIS), Elliot's Achievement Goal Questionnaire-Revised (AGQ-R) and Leppink's cognitive load index (CLI). This was a validity study evaluating internal structure using reliability and factor analysis, and relationships with other variables using the multitrait-multimethod matrix. Two hundred and thirty-two secondary school students participated in a medical simulation-based training activity at an academic medical center. Pre-activity ITIS (implicit theory [mindset] domains: incremental, entity) and AGQ-R (achievement goal domains: mastery-approach, mastery-avoidance, performance-approach, performance-avoidance), post-activity CLI (cognitive load domains: intrinsic, extrinsic, germane) and task persistence (self-directed repetitions on a laparoscopic surgery task) were measured. Internal consistency reliability (Cronbach's alpha) was > 0.70 for all domain scores except AGQ-R performance-avoidance (alpha 0.68) and CLI extrinsic load (alpha 0.64). Confirmatory factor analysis of ITIS and CLI scores demonstrated acceptable model fit. Confirmatory factor analysis of AGQ-R scores demonstrated borderline fit, and exploratory factor analysis suggested a three-domain model for achievement goals (mastery-approach, performance and avoidance). Correlations among scores from conceptually-related domains generally aligned with expectations, as follows: ITIS incremental and entity, r = -0.52; AGQ-R mastery-avoidance and performance-avoidance, r = 0.71; mastery-approach and performance-approach, r = 0.55; performance-approach and performance-avoidance, r = 0.43; mastery-approach and mastery-avoidance, r = 0.36; CLI germane and extrinsic, r = -0.35; ITIS incremental and AGQ-R mastery-approach, r = 0.34; ITIS incremental and CLI germane, r = 0.44; AGQ-R mastery
Characterization of Thermostable Cellulases Produced by Bacillus and Geobacillus Strains
Bacterial community composition of thermophilic (60 deg C) mixed cellulose-enrichment cultures was examined by constructing a 16S rDNA clone library which demonstrated major lineages affiliated to Actinobacteria, Bacteroidetes, Chloroflexi, Deinococcus-Thermus, Firmicutes, and Proteobacteria. A tot...
Diet-dependent depletion of queuosine in tRNAs in Caenorhabditis ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
1972). Apart from the known exceptions of yeast, Thermus .... Hypomodification can also be induced by .... Panels C and D show UV absorbance of the Q and manQ peaks, respectively. ... E. coli B105(Q–), a mutant strain lacking Q modification.
International Nuclear Information System (INIS)
Gauchet, J.P.
1995-01-01
This study predicts life duration of shot-peening effect and finally to allow the plant operator to prepare routine stopping, considering the following four steps have been: the shot-peening parameters must been carefully chosen and implementation must be reliable and perfectly reproducible; the residual stresses and cold working state checked by X-ray diffraction; the EDF feedback on different steam-water system components working at around-300 0 C and repaired by shot-peening, like feed heater water boxes, water tanks and vessels, steam pipes; a program, carried out on a feedwater tank repaired by welding and hot-peening and working at 360 0 C, on the correlation between expected and effective results. (author). 7 refs., 3 figs., 1 tab
Engerer, Cosima; Berberat, Pascal O; Dinkel, Andreas; Rudolph, Baerbel; Sattel, Heribert; Wuensch, Alexander
2016-10-18
Feedback is considered a key didactic element in medical education, especially for teaching of communication skills. This study investigates the impact of a best evidence-based practice feedback concept within the context of communication skills training (CST). We evaluate this concept for acceptance and changes in students self-ratings of communication competence. Our CST integrating feedback process comprises a short theoretical introduction presenting standards for good communication and a constructive 360° feedback from three perspectives: feedback from peers, from standardized patients (SPs), and from a trainer. Feed-forward process was facilitated for documenting suggestions for improvements based on observable behaviors to maximize learning benefits. Our CST was applied to four groups of eight or nine students. We assessed the data on students' acceptance using a 6-point scale ranging from very good (1) to poor (6), applied a forced choice question to rank didactic items, and assessed changes in student' self-ratings of their communication competence on a 10-cm visual analogue scale (VAS). Thirty-four medical undergraduates (82 % female, 18 % male) in their first clinical year, with an average age of 21.4 years (SD = 1.0), participated in the new training. The concept achieved high acceptance from good to very good: overall impression (M = 1.56), sufficient interaction for discussion (M = 1.15), and constructive learning atmosphere (M = 1.18). Specific elements, such as practical training with SPs (M = 1.18) and feedback by SPs (M = 1.12), showed highest acceptance. The forced choice ranking placed all feedback elements at the top of the list (feedback (FB) by SPs, rank 2; FB by trainer, rank 3; FB by colleagues, rank 4), whereas theoretical elements were at the bottom (theoretical introduction, rank 7; memory card, rank 9). Overall, student self-ratings of communication competence significantly improved in nine of the ten
Maekawa, Toshihiko; Tobimatsu, Shozo; Ogata, Katsuya; Onitsuka, Toshiaki; Kanba, Shigenobu
2009-09-01
The aim of this study was to test the hypothesis that visual mismatch negativity (vMMN) is based on memory trace formation. Special care was taken to distinguish between memory mismatch and rareness effect. Subjects were seated in front of a monitor and asked to listen to a story. The standard sequence block consisted of nine consecutive 24-vane windmill patterns with an 800-ms inter-stimulus interval. The deviant sequence block consisted of one 24-vane pattern with eight six-vane patterns. Inter-train intervals (ITIs) varied among 1, 6, and 12s in the changing ITI experiment, while the deviant stimulus occupied the eighth position in the sequence. In the changing order experiment, the position of the deviant stimulus was varied among the second, fourth and eighth position with a 12-s constant ITI. vMMN was ascertained from the difference in responses to standard and deviant stimulus. vMMN appeared in the occipital region 150-300 ms after stimulus onset. It was significantly modulated by the ITI, and more than four preceding stimuli were needed to reinstate the implicit memory trace. These results suggest that memory-based change detection underlies vMMN. Therefore, vMMN is useful to study visual sensory memory function.
Okano, Masahiro; Shinya, Masahiro; Kudo, Kazutoshi
2017-03-09
In solo synchronization-continuation (SC) tasks, intertap intervals (ITI) are known to drift from the initial tempo. It has been demonstrated that people in paired and group contexts modulate their action timing unconsciously in various situations such as choice reaction tasks, rhythmic body sway, and hand clapping in concerts, which suggests the possibility that ITI drift is also affected by paired context. We conducted solo and paired SC tapping experiments with three tempos (75, 120, and 200 bpm) and examined whether tempo-keeping performance changed according to tempo and/or the number of players. Results indicated that those tapping in the paired conditions were faster, relative to those observed in the solo conditions, for all tempos. For the faster participants, the degree of ITI drift in the solo conditions was strongly correlated with that in the paired conditions. Regression analyses suggested that both faster and slower participants adapted their tap timing to that of their partners. A possible explanation for these results is that the participants reset the phase of their internal clocks according to the faster beat between their own tap and the partners' tap. Our results indicated that paired context could bias the direction of ITI drift toward decreasing.
International Nuclear Information System (INIS)
Sadeghi-Goughari, M; Mojra, A; Sadeghi, S
2016-01-01
Intraoperative Thermal Imaging (ITI) is a new minimally invasive diagnosis technique that can potentially locate margins of brain tumor in order to achieve maximum tumor resection with least morbidity. This study introduces a new approach to ITI based on artificial tactile sensing (ATS) technology in conjunction with artificial neural networks (ANN) and feasibility and applicability of this method in diagnosis and localization of brain tumors is investigated. In order to analyze validity and reliability of the proposed method, two simulations were performed. (i) An in vitro experimental setup was designed and fabricated using a resistance heater embedded in agar tissue phantom in order to simulate heat generation by a tumor in the brain tissue; and (ii) A case report patient with parafalcine meningioma was presented to simulate ITI in the neurosurgical procedure. In the case report, both brain and tumor geometries were constructed from MRI data and tumor temperature and depth of location were estimated. For experimental tests, a novel assisted surgery robot was developed to palpate the tissue phantom surface to measure temperature variations and ANN was trained to estimate the simulated tumor’s power and depth. Results affirm that ITI based ATS is a non-invasive method which can be useful to detect, localize and characterize brain tumors. (paper)
Progress toward inducing immunologic tolerance to factor VIII
Scott, David W.; Pratt, Kathleen P.; Miao, Carol H.
2013-01-01
A major problem in treating hemophilia A patients with therapeutic factor VIII (FVIII) is that 20% to 30% of these patients produce neutralizing anti-FVIII antibodies. These antibodies block (inhibit) the procoagulant function of FVIII and thus are termed “inhibitors.” The currently accepted clinical method to attempt to eliminate inhibitors is immune tolerance induction (ITI) via a protocol requiring intensive FVIII treatment until inhibitor titers drop. Although often successful, ITI is ext...
PÖFF köitis suhetega / Maris Balbat
Balbat, Maris, 1936-
2003-01-01
PÖFFi sümpaatsemaid filme - vene mängufilmid "Memmeke" ("Babusja") ja "Isa ja poeg" ("Otets i sõn"), saksa "Keppivad kalad" ("Fickende Fische"), briti "Kordumatu kuusteist" ("Sweet Sixteen"). Lisatud auhinnatute nimekiri
Toxic cannabis psychosis IS a valid entIty
African Journals Online (AJOL)
1990-10-20
Oct 20, 1990 ... Psychotic features included: formal thought disorder; hallucinations; delusions; ..... Major depressive episode. Manic episode ... Anxiety disorder. Temporal ... admission to hospital were in fact suffering from a mixed dagga and ...
Bürklein, S; Benten, S; Schäfer, E
2014-05-01
To assess in a laboratory setting the amount of apically extruded debris associated with different single-file nickel-titanium instrumentation systems compared to one multiple-file rotary system. Eighty human mandibular central incisors were randomly assigned to four groups (n = 20 teeth per group). The root canals were instrumented according to the manufacturers' instructions using the reciprocating single-file system Reciproc, the single-file rotary systems F360 and OneShape and the multiple-file rotary Mtwo instruments. The apically extruded debris was collected and dried in pre-weighed glass vials. The amount of debris was assessed with a micro balance and statistically analysed using anova and post hoc Student-Newman-Keuls test. The time required to prepare the canals with the different instruments was also recorded. Reciproc produced significantly more debris compared to all other systems (P file rotary systems and the multiple-file rotary system (P > 0.05). Instrumentation with the three single-file systems was significantly faster than with Mtwo (P systems caused apical debris extrusion. Rotary instrumentation was associated with less debris extrusion compared to reciprocal instrumentation. © 2013 International Endodontic Journal. Published by John Wiley & Sons Ltd.
Simulations of Wind Field Effect on Two-Stream Waves in the Equatorial Electrojet
Directory of Open Access Journals (Sweden)
Chi-Lon Fern
2009-01-01
Full Text Available The wind field effect on the phase veloc i ties of 3- to 10-me ter Farley-Buneman two-stream waves in the equato rial E region ion o sphere at al titudes in the range of 95 - 110 km is stud ied by nu mer i cal simu la tion. The behav ior of this two-stream wave in the uni form wind field Un in a plane per pen dic u lar to the Earth’s mag netic field is simu lated with a two-di men sional two-fluid code in which elec tron in er tia is ne glected while ion in er tia is re tained. It is con firmed that, the thresh old con di tion for the ap pear ance of two-stream waves is VD C U th » + s + n (1 / cos Y0 q ; and the phase ve loc ity of the two-stream wave at the thresh old con di tion is Vp » Cs + Un cos q, where q is the ele va tion an gle of the wave prop a ga tion in a limited range and Y0 = ninnen / WiWe. The first formula in di cates that the wind field paral lel (anti-par al lel to the elec tron drift ve loc ity will raise (lower the thresh old drift ve loc ity by the amount of the wind speed. This means that par al lel wind is a sta ble fac tor, while anti-paral lel wind is an un sta ble fac tor of two-stream waves. This may ex plain why high speed (larger than acous tic speed two-stream waves were rarely ob served, since larger thresh old drift veloc ity de mands larger po larization elec tric field. The result of the simu la tions at the sat u ra tion stage show that when VD was only slightly larger than VD th , the hor i zon tal phase ve loc ity of the two-stream wave would grad u ally down-shift to the thresh old phase ve loc ity Cs + Un. The physical implications of which are discussed
International Nuclear Information System (INIS)
Couvant, T.; Vaillant, F.; Boursier, JM.; Delafosse, D.
2004-01-01
Austenitic stainless steels (ASS) are widespread in primary and auxiliary circuits of PWR. Moreover, some components suffer stress corrosion cracking (SCC) under neutron irradiation. This degradation could be the result of the increase of hardness or the modification of chemical composition at the grain boundary by irradiation. In order to avoid complex and costly corrosion facilities, the effects of irradiation on the material are commonly simulated by applying a cold work on non-irradiated material prior to stress corrosion cracking tests. Slow strain rate tests were conducted on an austenitic stainless steel (SS) AISI 304L in PWR environment (360 deg. C). Particular attention was directed towards pre-straining effects on crack growth rate (CGR) and crack growth path (CGP). Results have demonstrated that the susceptibility of 304L to SCC in high-temperature hydrogenated water was enhanced by pre-straining. It seemed that IGSCC was enhanced by complex strain paths. (authors)
Energy Technology Data Exchange (ETDEWEB)
Skinner, L. B. [X-Ray Science Division, Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Mineral Physics Institute, Stony Brook University, Stony Brook, New York, New York 11794-2100 (United States); Galib, M.; Fulton, J. L., E-mail: John.Fulton@pnnl.gov, E-mail: benmore@anl.gov; Mundy, C. J.; Schenter, G. K. [Physical and Computational Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99354 (United States); Parise, J. B. [Mineral Physics Institute, Stony Brook University, Stony Brook, New York, New York 11794-2100 (United States); Department of Geosciences, Stony Brook University, Stony Brook, New York, New York 11794-2100 (United States); Photon Sciences Division, Brookhaven National Laboratory, Upton, New York 11973 (United States); Pham, V.-T. [Synchrotron SOLEIL, L’Orme des Merisiers, Saint-Aubin, BP48, 91192 Gif-sur-Yvette (France); Center for Quantum Electronics, Institute of Physics, Vietnam Academy of Science and Technology, P.O. Box 429, Boho, Hanoi 10000 (Viet Nam); Benmore, C. J., E-mail: John.Fulton@pnnl.gov, E-mail: benmore@anl.gov [X-Ray Science Division, Advanced Photon Source, Argonne National Laboratory, Argonne, Illinois 60439 (United States)
2016-04-07
X-ray diffraction measurements of liquid water are reported at pressures up to 360 MPa corresponding to a density of 0.0373 molecules per Å{sup 3}. The measurements were conducted at a spatial resolution corresponding to Q{sub max} = 16 Å{sup −1}. The method of data analysis and measurement in this study follows the earlier benchmark results reported for water under ambient conditions having a density of 0.0333 molecules per Å{sup 3} and Q{sub max} = 20 Å{sup −1} [J. Chem. Phys. 138, 074506 (2013)] and at 70 °C having a density of 0.0327 molecules per Å{sup 3} and Q{sub max} = 20 Å{sup −1} [J. Chem. Phys. 141, 214507 (2014)]. The structure of water is very different at these three different T and P state points and thus they provide the basis for evaluating the fidelity of molecular simulation. Measurements show that at 360 MPa, the 4 waters residing in the region between 2.3 and 3 Å are nearly unchanged: the peak position, shape, and coordination number are nearly identical to their values under ambient conditions. However, in the region above 3 Å, large structural changes occur with the collapse of the well-defined 2nd shell and shifting of higher shells to shorter distances. The measured structure is compared to simulated structure using intermolecular potentials described by both first-principles methods (revPBE-D3) and classical potentials (TIP4P/2005, MB-pol, and mW). The DFT-based, revPBE-D3, method and the many-body empirical potential model, MB-pol, provide the best overall representation of the ambient, high-temperature, and high-pressure data. The revPBE-D3, MB-pol, and the TIP4P/2005 models capture the densification mechanism, whereby the non-bonded 5th nearest neighbor molecule, which partially encroaches the 1st shell at ambient pressure, is pushed further into the local tetrahedral arrangement at higher pressures by the more distant molecules filling the void space in the network between the 1st and 2nd shells.
New Organizational Forms and IT
Schwarzer, Bettina;Zerbe, Stefan;Krcmar, Helmut
2014-01-01
The availability of powerful IT/IS is percieved as a driving force as well as a necessary prerequisite for new organizational solutions. However, even though the close interre-latedness of organizational structure and IT/IS has been widely recognized for a long time, a thorough understanding of their linkage is still missing. The research project NOF (New Organizational Forms) aims at closing the gap between the organizational and IS discipline in order to further the understanding and provid...
International Nuclear Information System (INIS)
Jordan, G.B.; Reed, J.H.; Wyler, L.D.
1997-03-01
This report describes the process and results from an effort to develop metrics for program accomplishments for the FY 1997 budget submission of the U.S. Department of Energy Environmental Management International Technology Integration Program (EM-ITI). The four-step process included interviews with key EM-ITI staff, the development of a strawman program logic chart, and all day facilitated workshop with EM-ITI staff during which preliminary performance plans and measures were developed and refined, and a series of follow-on discussions and activities including a cross-organizational project data base. The effort helped EM-ITI to crystallize and develop a unified vision of their future which they can effectively communicate to their own management and their internal and external customers. The effort sets the stage for responding to the Government Performance and Results Act. The metrics developed may be applicable to other international technology integration programs. Metrics were chosen in areas of eight general performance goals for 1997-1998: (1) number of forums provided for the exchange of information, (2) formal agreements signed, (3) new partners identified, (4) customers reached and satisfied, (5, 6) dollars leveraged by EM technology focus area and from foreign research, (7) number of foreign technologies identified for potential use in remediation of DOE sites, and (8) projects advanced through the pipeline
Mühlmeier, G; Maier, S; Maier, M; Maier, H
2015-10-01
High-dose corticosteroids are currently recommended for idiopathic sudden sensorineural hearing loss (ISSNHL) treatment. Intratympanic injections (ITI) are of growing importance, especially in cases of therapy resistance. The selection of patients for this procedure in SSNHL has not been adequately examined so far. A total of 77 patients with ISSNHL after ineffective systemic pretreatment underwent intratympanic administration of dexamethasone and hyaluronic acid. Improvement after treatment was determined by pure tone audiometry for both ears before and of the treated ear after ITI. In this study 34 female and 43 male patients with mean age of 57 years showed a pre-ITI hearing loss of 35 dB in the lower frequencies and 69 dB in the higher frequencies. The mean hearing gain was 10 dB and the response rate was 62%. Absolute hearing gain revealed significant improvements at 500 Hz, 1 kHz and 2 kHz. Under inclusion of contralateral thresholds there were hardly any differences up to 4 kHz. In a detailed analysis of responders moderate improvements could be observed even in higher frequencies. Overall, no relevant adverse events occurred. Treatment of ISSNHL resistant to systemic regimens by ITI of steroids provides an option that offers additional prospects of auditory improvement for affected patients. The presented results indicate that these modalities are also valid for patients with pancochlear ISSNHL.
Strategic IS Planning Practices: A Case of Medium Manufacturing Company in Malaysia
Directory of Open Access Journals (Sweden)
Raja Mohd. Ali Raja Haslinda
2017-01-01
Full Text Available Deployment of Information Technology/Information Systems (IT/IS has been recognized as one of the potential means to supply information for timely business decision making. Despite growing importance of IT/IS in business, Small Medium Enterprises (SMEs embrace constant challenges to deploy IS effectively, and thus, hardly to optimize the IT/IS strategic values. In such situation, IS planning is getting paramount to promote more effective IT/IS management of the firms. This study reports IS planning practices of a manufacturing-based SME. The face to face interview has been carried out to explore IS planning activities in a chosen firm. The qualitative analysis suggests that the selected company did undergo the four phases of strategic IS planning process namely, planning, analysing, selection, and implementation. The owner act as the champion of the strategic IS planning process. Further, the owner and the employees plays an important role as a decision maker. Specifically, the owner decides mainly on acquiring a new technology related to the firm’s core business process whereas the users responsible on the selection of relevant application (s to be used in their respective departments. Apart from that, the owner also plays a role as a researcher for the new technology acquired whilst the users provide an input on the applications to be acquired.
Modeling Mathematical Programs with Equilibrium Constraints in Pyomo
Energy Technology Data Exchange (ETDEWEB)
Hart, William E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Siirola, John Daniel [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2015-07-01
We describe new capabilities for modeling MPEC problems within the Pyomo modeling software. These capabilities include new modeling components that represent complementar- ity conditions, modeling transformations for re-expressing models with complementarity con- ditions in other forms, and meta-solvers that apply transformations and numeric optimization solvers to optimize MPEC problems. We illustrate the breadth of Pyomo's modeling capabil- ities for MPEC problems, and we describe how Pyomo's meta-solvers can perform local and global optimization of MPEC problems.
Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.
2010-01-01
We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…
Sorption and desorption of indaziflam degradates in several agricultural soils
Directory of Open Access Journals (Sweden)
Diego Gonçalves Alonso
2016-04-01
Full Text Available ABSTRACT Processes regulating pesticide fate in the environment are influenced by the physicochemical properties of pesticides and soils. Sorption and desorption are important processes as they regulate the movement of pesticides in soil. Although sorption-desorption is widely studied for herbicides, studies involving their metabolites in soil are scarce. Sorption and desorption of indaziflam metabolites (indaziflam-triazinediamine (FDAT, indaziflam-triazine-indanone (ITI and indaziflam-carboxilic acid (ICA were investigated in six Brazilian (BRA soils and three United States (USA soils with different physicochemical properties. The Freundlich equation described sorption of the metabolites for all soils (R2 > 0.98; 1/n ~ 1. Sorption order (Kf was ITI > ICA > FDAT. Mean values of Kf,oc were 453, 289, and 81 (BRA and 444, 48, and 48 (USA for metabolites ITI, ICA, and FDAT respectively. Desorption was hysteretic for all metabolites in all soils. These results suggest that these metabolites fall in the classification range of mobile to moderately mobile in soils.
Msetfi, Rachel M; Murphy, Robin A; Simpson, Jane
2007-03-01
In three experiments we tested how the spacing of trials during acquisition of zero, positive, and negative response-outcome contingencies differentially affected depressed and nondepressed students' judgements. Experiment 1 found that nondepressed participants' judgements of zero contingencies increased with longer intertrial intervals (ITIs) but not simply longer procedure durations. Depressed groups' judgements were not sensitive to either manipulation, producing an effect known as depressive realism only with long ITIs. Experiments 2 and 3 tested predictions of Cheng's (1997) Power PC theory and the Rescorla-Wagner (1972) model, that the increase in context exposure experienced during the ITI might influence judgements most with negative contingencies and least with positive contingencies. Results suggested that depressed people were less sensitive to differences in contingency and contextual exposure. We propose that a context-processing difference between depressed and nondepressed people removes any objective notion of "realism" that was originally employed to explain the depressive realism effect (Alloy & Abramson, 1979).
Energy Technology Data Exchange (ETDEWEB)
de Saussure, G.; Olsen, D. K.; Perez, R. B.
1978-05-01
The FORTRAN-IV code SIOB was developed to least-square fit the shape of neutron transmission curves. Any number of measurements on a common energy scale for different sample thicknesses can be simultaneously fitted. The computed transmission curves can be broadened with either a Gaussian or a rectangular resolution function or both, with the resolution width a function of energy. The total cross section is expressed as a sum of single-level or multilevel Breit--Wigner terms and Doppler broadened by using the fast interpolation routine QUICKW. The number of data points, resonance levels, and variables which can be handled simultaneously is only limited by the overall dimensions of two arrays in the program and by the stability of the matrix inversion. In a test problem seven transmissions each with 3750 data points were simultaneously fitted with 74 resonances and 110 variable parameters. The problem took 47 min of CPU time on an IBM-360/91, for 3 iterations. 3 figures, 2 tables.
International Nuclear Information System (INIS)
Jewell, P.R.; Hollis, J.M.; Lovas, F.J.; Snyder, L.E.
1989-01-01
A continuous spectral line survey of the Orion A position from 330.5 to 360.1 GHz was carried out. This survey covers nearly the entire 870 micron atmospheric window accessible from ground-based observations. Approximately 160 distinct spectral features composed of about 180 lines were detected, 29 of which could not be readily identified. In addition, Orion A from 200.7 to 202.3 GHz and from 203.7 to 205.3 GHz and 42 distinct new spectral lines were detected, including four that are unidentified at present. These data sets are the first thorough survey results in these spectral regions. The new interstellar lines in the survey bands are tabulated and displayed graphically. Moreover, the data are being made available to the Astronomical Data Center at the Goddard Space Flight Center for distribution by request to the astronomical community. 14 refs
Študija primera: Volkswagnova afera Diesel-gate
Hočevar, Gregor
2016-01-01
Namen diplomskega dela je osredotočiti se na primer »Diesel-gate«, škandal z goljufanjem emisijskih testov, ki je izbruhnil lansko leto in v katerega je bil vpleten Volkswagen. Naš glavni cilj diplomskega dela je analizirati razloge za nastali škandal in preučiti posledice, ki jih Volkswagnovo ravnanje prinaša. Poleg same študije primera smo v diplomskem delu pozornost namenili tudi gospodarski kriminaliteti kot področju, kamor bi lahko uvrstili Volkswagnovo ravnanje, ter goljufijo oz. potroš...
Aleksius II KGB-tööd tõestab ametlik kogumik / Jaanus Piirsalu
Piirsalu, Jaanus, 1973-
2005-01-01
Ajaloolase Indrek Jürjo koostatud kogumikus "Aruanded Riikliku Julgeoleku Komitee 2. ja 4. osakonna tööst 1958. aastal" selgub, et Aleksius II tegi KGB-le kaastööd. 2003. aastal anti Aleksius II-le Maarjamaa Risti I klassi teenetemärk, siis väitis tollane välisminister Kristiina Ojuland, et Eesti riigi käsutuses ei ole tõendeid, mis kinnitaksid Aleksius II sidemeid KGB-ga. Vt. samas: Agent Drozdov täitis KGB ülesandeid meelsasti. Lisa: Karjäär
Silva, Patrícia
2014-01-01
O presente projecto pretende determinar em que medida é que uma ferramenta digital pode influenciar a decisão do local a visitar, com o intuito de promover o turismo e assim aumentar as receitas daí provenientes. O mundo digital está em constante actualização e desenvolvimento, e o acompanhamento dos sectores que influenciam o desenvolvimento humano (factores sociais, culturais, económicos, entre outros) têm que estar em constante crescimento para que haja uma evolução homogénea e contínua. O...
... discuss the formation and future of the SDGs: http://bit.ly/2zKSGjl 10h We were thrilled to ... strong relationships between Americans and their international counterparts.” http://bit.ly/2hwpE2o #IEW2017 Nov 13 "If you ...
DEFF Research Database (Denmark)
Wong, Mei Mei Jaslyn Elizabeth; Midtgaard, Søren Roi; Gysel, Kira
2015-01-01
of multiple LysM domains in substrate binding has so far lacked support from high-resolution structures of ligand-bound complexes. Here, a structural study of the Thermus thermophilus NlpC/P60 endopeptidase containing two LysM domains is presented. The crystal structure and small-angle X-ray scattering...
Abu-Akkada, S S; Oda, S S
2016-01-01
This study was conducted to evaluate the efficacy of oral administration of fenbendazole (20 mg/kg body weight) prior to and after experimental infection of immunosuppressed rabbits with Encephalitozoon cuniculi . A total of thirty rabbits were divided into five groups: NN (non-immunosuppressed; non-infected), IN (immunosuppressed; non-infected), IPI (immunosuppressed; protected-infected), ITI (immunosuppressed; treated-infected), and II (immunosuppressed; infected) groups. Fenbendazole was administered as a prophylactic for seven successive days before infection with E. cuniculi and as a treatment for four weeks initiated on the 28th day post-challenge (PC). Experimental rabbits were infected with intraperitoneal injection of 2 × 10 5 E. cuniculi spores. Parameters evaluated were body weight, detection of spores in urine, serum antibody assay, hematological, biochemical and histopathological changes. The IPI and ITI groups showed a significant better final bwt than the II group. Spores were detected in urine of all infected rabbits from the 28th day PC until the end of the study. The IPI group showed the least values of antibodies (IgG) compared to the ITI and II groups. Concerning histopathological changes, the intensity of the lesions was marked particularly in the II rabbits and to a lesser extent in the ITI rabbits. Noticeable improvement was found in the IPI rabbits. It could be concluded that fenbendazole was effective to some extent in protection of rabbits against E. cuniculi infection, while when administered as a therapeutic no significant effects were observed.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Pristop k projektu po agilni metodologiji Scrum z upoštevanjem konceptov vitkosti
Uranjek, Nina
2016-01-01
Namen diplomskega dela je preučiti, kako hkrati vpeljati v projektno vodenje tako agilno metodologijo Scrum kot tudi vitko razmišljanje. Študija domače in tuje literature ter praktičen preizkus kažejo, da je najbolje v vsakdanji Scrum proces vključiti prakse za detekcijo in odstranjevanje potrate tako pri samem planiranju kot tudi razvoju produkta in s tem stremljenje h konstantnemu učenju in izboljšavam ter posledično k večji efektivnosti. Zaradi dobro zastavljenih okvirjev je Scrum d...
Študija uporabnosti računalniških simulacij in animacija oblačil za potrebe manjših podjetij
Slakonja, Andreja
2016-01-01
Namen diplomskega dela je bil preučiti uporabnost računalniške simulacije in animacije oblačila za potrebe manjšega podjetja, izdelati kroj, simulacijo in animacijo oblačila na virtualnem parametričnem modelu v programu Marvelous Designer 3 ter zašiti realni model oblačila in ju primerjati. Nadalje je bil namen izdelati spletno stran za modno oblikovalko Barbaro F. V uvodnem delu je opisano modno oblikovanje in konstrukcija oblačil ter predstavitev oblikovalke Barbare F. V nadaljevanju so opi...
Admir Mulahusić; Nedim Tuno
2011-01-01
U ovom radu predstavljeni su različiti načini identifikovanja promjena kod daljinskih istraživanja. Različiti autori su predstavljali različite metode otkrivanja promjena na površini zemlje. Otkrivanje promjena je, između ostalog, veoma važno zbog praćenja promjena, kao i procjene promjena i međusobnih odnosa prirodnih i vještačkih objekata. Sve to vodi ka boljem razumijevanju potencijalnih uzroka promjena. : In this paper, the different ways to identify changes in remote sensing are given. V...
Directory of Open Access Journals (Sweden)
Ina Blau
2016-12-01
Full Text Available Creative computing is one of the rapidly growing educational trends around the world. Previous studies have shown that creative computing can empower disadvantaged children and youth. At-risk youth tend to hold a negative view of self and perceive their abilities as inferior compared to “normative” pupils. The Implicit Theories of Intelligence approach (ITI; Dweck, 1999, 2008 suggests a way of changing beliefs regarding one’s abilities. This paper reports findings from an experiment that explores the impact of a short intervention among at-risk youth and “normative” high-school students on (1 changing ITI from being perceived as fixed (entity view of intelligence to more flexible (incremental view of intelligence and (2 the quality of digital self-representations programmed though a creative computing app. The participants were 117 Israeli youth aged 14-17, half of whom were at-risk youth. The participants were randomly assigned to the experimental and control conditions. The experimental group watched a video of a lecture regarding brain plasticity that emphasized flexibility and the potential of human intelligence to be cultivated. The control group watched a neutral lecture about brain-functioning and creativity. Following the intervention, all of the participants watched screencasts of basic training for the Scratch programming app, designed artifacts that digitally represented themselves five years later and reported their ITI. The results showed more incremental ITI in the experimental group compared to the control group and among normative students compared to at-risk youth. In contrast to the research hypothesis, the Scratch projects of the at-risk youth, especially in the experimental condition, were rated by neutral judges as being more creative, more aesthetically designed, and more clearly conveying their message. The results suggest that creative computing combined with the ITI intervention is a way of developing
Pape, L; de Zwaan, M; Tegtbur, U; Feldhaus, F; Wolff, J K; Schiffer, L; Lerch, C; Hellrung, N; Kliem, V; Lonnemann, G; Nolting, H D; Schiffer, M
2017-08-23
Follow-up care after kidney transplantation is performed in transplant centers as well as in local nephrologist's practices in Germany. However, organized integrated care of these different sectors of the German health care system is missing. This organizational deficit as well as non-adherence of kidney recipients and longterm cardiovascular complications are major reasons for an impaired patient and graft survival. The KTx360° study is supported by a grant from the Federal Joint Committee of the Federal Republic of Germany. The study will include 448 (39 children) incident patients of all ages with KTx after study start in May 2017 and 963 (83 children) prevalent patients with KTx between 2010 and 2016. The collaboration between transplant centers and nephrologists in private local practices will be supported by internet-based case-files and scheduled virtual visits (patient consultation via video conferencing). At specified points of the care process patients will receive cardiovascular and adherence assessments and respective interventions. Care will be coordinated by an additional case management. The goals of the study will be evaluated by an independent institute using claims data from the statutory health insurances and data collected from patients and their caregivers during study participation. To model longitudinal changes after transplantation and differences in changes and levels of immunosuppresive therapy after transplantation between study participants and historical data as well as data from control patients who do not participate in KTx360°, adjusted regression analyses, such as mixed models with repeated measures, will be used. Relevant confounders will be controlled in all analyses. The study aims to prolong patient and graft survival, to reduce avoidable hospitalizations, co-morbidities and health care costs, and to enhance quality of life of patients after kidney transplantation. ISRCTN29416382 (retrospectively registered on 05.05.2017).
Functional consequences of T-stem mutations in E. coli tRNA Thr UGU in vitro and in vivo
DEFF Research Database (Denmark)
Saks, Margaret E; Sanderson, Lee E; Choi, Daniel S
2011-01-01
The binding affinities between Escherichia coli EF-Tu and 34 single and double base-pair changes in the T stem of E. coli tRNAThrUGU were compared with similar data obtained previously for several aa-tRNAs binding to Thermus thermophilus EF-Tu. With a single exception, the two proteins bound to m...
Breast-feeding communIty practIces In a Black
African Journals Online (AJOL)
1983-01-01
Jan 1, 1983 ... Women were selected and interviewed by one of us (N.C.K.) in a similar .... Mortality and morbidity rates for partly bottle-fed infants more closely approxi- ... lactation amenorrhoea, it can exen a profound effect on fertility rates.7.
E-Profiil täitis unikaalse lepingu / Erki Freiberg
Freiberg, Erki
2005-01-01
Maailma suurima naftapuurimisseadmete tootja National Oilwell Varco Inc naftamahutite tellimus Eesti ettevõttele E-Profiil suurendas firma käivet tunduvalt ning eelmise aasta kahjum võib pöörduda kasumiks. Diagramm: Eelmise aasta kahjum võib pöörduda kasumiks. Vt. samas: Dvigateli aktsiate müük on toonud uue salapärase omaniku; Dvigatelist on saanud valdusfirma. Diagramm: Salapärasel Dvigateli aktsiate ostjal 14,8% osalus
Visual habit formation in monkeys with neurotoxic lesions of the ventrocaudal neostriatum
Fernandez-Ruiz, Juan; Wang, Jin; Aigner, Thomas G.; Mishkin, Mortimer
2001-01-01
Visual habit formation in monkeys, assessed by concurrent visual discrimination learning with 24-h intertrial intervals (ITI), was found earlier to be impaired by removal of the inferior temporal visual area (TE) but not by removal of either the medial temporal lobe or inferior prefrontal convexity, two of TE's major projection targets. To assess the role in this form of learning of another pair of structures to which TE projects, namely the rostral portion of the tail of the caudate nucleus and the overlying ventrocaudal putamen, we injected a neurotoxin into this neostriatal region of several monkeys and tested them on the 24-h ITI task as well as on a test of visual recognition memory. Compared with unoperated monkeys, the experimental animals were unaffected on the recognition test but showed an impairment on the 24-h ITI task that was highly correlated with the extent of their neostriatal damage. The findings suggest that TE and its projection areas in the ventrocaudal neostriatum form part of a circuit that selectively mediates visual habit formation. PMID:11274442
Changes in Pilot Behavior with Predictive System Status Information
Trujillo, Anna C.
1998-01-01
Research has shown a strong pilot preference for predictive information of aircraft system status in the flight deck. However, changes in pilot behavior associated with using this predictive information have not been ascertained. The study described here quantified these changes using three types of predictive information (none, whether a parameter was changing abnormally, and the time for a parameter to reach an alert range) and three initial time intervals until a parameter alert range was reached (ITIs) (1 minute, 5 minutes, and 15 minutes). With predictive information, subjects accomplished most of their tasks before an alert occurred. Subjects organized the time they did their tasks by locus-of-control with no predictive information and for the 1-minute ITI, and by aviatenavigate-communicate for the time for a parameter to reach an alert range and the 15-minute conditions. Overall, predictive information and the longer ITIs moved subjects to performing tasks before the alert actually occurred and had them more mission oriented as indicated by their tasks grouping of aviate-navigate-communicate.
Goldstein, Michael J; Kim, Eugene; Widmann, Warren D; Hardy, Mark A
2004-01-01
New York State Code 405 and societal/political pressure have led the RRC and ACGME to mandate strict limitations on resident work hours. In an attempt to meet these limitations, we have switched from the previous Q3 call schedule to a specialized night float (NF) system, the continuity-care system (CCS). The purpose of this CCS is to maximize resident duty time spent on direct patient care, operative experience, and outpatient clinics, while reducing duty hours spent on performing routine tasks and call coverage. The implementation of the CCS is the fundamental step in the restructuring of our residency program. In addition to a change in the call system, we added physician assistants to aid in performing some service tasks. We performed a 360 degrees evaluation of this work in progress. In May 2002, the standard Q3 call system was abolished on the general surgery services at the New York Presbyterian Hospital, Columbia campus. Two dedicated teams were created to provide day and night coverage, a day continuity-care team (DCT) and a night continuity-care team (NCT). The DCTs, consisting of PGY1-5 residents, provide daily in-house coverage from 6 AM to 5 PM with no regular weekday night-call responsibilities. The DCT residents provide Friday night, Saturday, and daytime Sunday call coverage 3 to 4 days per month. The NCT, consisting of 5 PGY1-5 residents, provides nightly continuous care, 5 PM to 6 AM, Sunday through Thursday, with no other weekend call responsibilities. This system creates a schedule with less than 80 duty hours per week, on average, with one 24-hour period off a week, one complete weekend off per month, and no more than 24 hours of consecutive duty time. After 1 year of use, the system was evaluated by a 360 degrees method in which residents, residents' spouses, nurses, and faculty were surveyed using a Likert-type scale. Statistical significance was calculated using the Student t-test. Patient satisfaction was measured both by internal review of
Gov'tal FY 1987 draft budget for N-energy set at 360 billion yen, up 0.8 %
International Nuclear Information System (INIS)
Anon.
1987-01-01
The governmental draft budget for nuclear energy was approved on December 30. The total provided is 360,222 million yen, an increase of 0.8 % over the previous year. This is made up of general account, 183,308 million yen (1.4 % down) and special account for power resources development (related only to nuclear power) 175,914 million yen (up 3.2 %). The amount from the general account is reduced for the first time in three years. This decrease is due mainly to completion of the energy break-even plasma testing device for nuclear fusion research. The special account primarily represents the tax for promoting power source development, a kind of special purpose tax from the electric power companies, based on generated electricity, and from this, subsidies are paid to local municipalities for promotion of siting for power sources and for the cost of survey and research on the development of oil alternative power sources. The special account for power resources development consists of the power sources siting account, 68,114 million yen (up 4.5 %) and the power sources diversification account, 108,800 million yen (up 2.4 %). Nuclear energy budgets sought by the Science and Technology Agency, the Ministry of International Trade and Industry, and other government agencies are shown in Table. STA and MITI have both requested slightly less than in the preceding year from the general accout, but both asked for higher amounts from the special account than in the preceding year. The high rise in the amount sougt by other agencies is attributed to the increase in the cost of eradication of melon flies. (Nogami, K.)
Directory of Open Access Journals (Sweden)
Guillermo Martín Quiña
2014-01-01
Full Text Available La música independiente ha tendido a ser indagada casi exclusivamente en su dimensión discográfica, pese a la creciente articulación de negocios editoriales y de espectáculos en vivo mediante los llamados contratos 360º y al crecimiento constante de la actividad musical en vivo. El presente trabajo explora, desde una perspectiva sociológica que recupera los aportes de la economía política, las transformaciones concretas que en este nuevo contexto tienen lugar sobre la producción musical independiente en vivo en la ciudad de Buenos Aires. Siendo ésta poco reconocida como una industria, nuestro objetivo es comprender el vínculo entre la producción musical independiente y el proceso de acumulación de capital así como despertar la atención sobre la dinámica de funcionamiento de la música en vivo.
Assessment of complications due to intratympanic injections
Directory of Open Access Journals (Sweden)
Yu-Chuan Liu
2016-03-01
Full Text Available Objective: The purpose of the study is to report and to analyze the complications following intratympanic injections (ITI of steroids. The occurrence rate of complications at different ITI sites, four quadrants of eardrum, was also compared. Methods: A retrospective clinical review in a medical center. Each patient received ITI twice in a week for 2â3 consecutive weeks as a salvage therapy for sudden sensorineural hearing loss. Post-injection complications, especially transient dizziness and vertigo, were recorded. Patients with acute or chronic vertigo episodes in 1 month were excluded. Results: A total of 59 patients with sudden sensorineural hearing loss and a total of 278 times of ITI were performed in 1 year. The post-injection complications included pain, tongue numbness, transient dizziness, vertigo, tinnitus, and a small persistent perforation. There was no significant difference in the occurrence of these complications between the injections sites on the 4 quadrants of the tympanic membrane. However, there was statistical significance in the post-injection vertiginous episode after IT injections to posterior-inferior quadrant (Q3 and posterior-superior quadrant (Q4 compared to anterior-superior quadrant (Q1 and anterior-inferior quadrant (Q2 (PÂ =Â 0.0113. Conclusion: IT injection is recommended to be applied to the Q2 since the Q1 and Q4 injections are more likely to induce the adverse effect of tongue numbness, while the Q3 and Q4 areas are more likely to induce post-injection vertigo. Keywords: Intratympanic injection, Sudden deafness, Complications, Vertigo
Composite-Nanoparticles Thermal History Sensors
2014-05-01
blue-shifts with temperature. 0 20000 40000 60000 570 590 610 630 650 670 PL In te ns ity (a .c ) Wavelength (nm) RT 200°C 300°C 350...time. 0 20000 40000 60000 570 590 610 630 650 670 PL In te ns ity (a .c ) Wavelength (nm) 0s 2s 8s 16s 32s 64s 128s 0 5 10 15 20 25 0...measured on a WiTEC Raman microscope. 14/84 Figure 3-4. PL spectra of QDs heated at different temperatures for 1 s. Each spectrum was recorded at
Jacquesson, Timothée; Mertens, Patrick; Berhouma, Moncef; Jouanneau, Emmanuel; Simon, Emile
2017-01-01
Skull base architecture is tough to understand because of its 3D complex shape and its numerous foramen, reliefs or joints. It is especially true for the sphenoid bone whom central location hinged with most of skull base components is unique. Recently, technological progress has led to develop new pedagogical tools. This way, we bought a new real-time three-dimensional insight of the sphenoid bone that could be useful for the teacher, the student and the surgeon. High-definition photography was taken all around an isolated dry skull base bone prepared with Beauchêne's technique. Pictures were then computed to provide an overview with rotation and magnification on demand. From anterior, posterior, lateral or oblique views and from in out looks, anatomical landmarks and subtleties were described step by step. Thus, the sella turcica, the optic canal, the superior orbital fissure, the sphenoid sinus, the vidian canal, pterygoid plates and all foramen were clearly placed relative to the others at each face of the sphenoid bone. In addition to be the first report of the 360 Photography tool, perspectives are promising as the development of a real-time interactive tridimensional space featuring the sphenoid bone. It allows to turn around the sphenoid bone and to better understand its own special shape, numerous foramen, neurovascular contents and anatomical relationships. This new technological tool may further apply for surgical planning and mostly for strengthening a basic anatomical knowledge firstly introduced.
AMDLIBAE, IBM 360 Subroutine Library, Special Function, Polynomials, Differential Equation
International Nuclear Information System (INIS)
Wang, Jesse Y.
1980-01-01
Description of problem or function: AMDLIBAE is a subset of the IBM 360 Subroutine Library at the Applied Mathematics Division at Argonne National Laboratory. This subset includes library categories A-E: Identification/Description: A152S A MPA: Mult. prec. floating point arith. package; B156S A ARSIN: Arcsine, arccosine; B158S A DSIN/DCOS: DP sine, cosine; B159S A DTAN/DCOT: DP tangent, cotangent; B252S A SINH/COSH: Hyperbolic sine, cosine; B353S A ALOG: SP logarithm; B354S A DEXP: DP exponential; B355S A DLOG: DP logarithm; B456S A DCUBRT: DP cube root; B457S A ARGPOWER: X Y ; B458S A ARGFDXPD: DP X Y ; C150S F DQD: Q. D. algorithm applied to a power series; C151S F DCONF1: Eval. cont. fract. Q. D. of power series; C250S F CUBIC: Roots of cubic polynomial equation; C251S F QUARTIC: Roots of quartic polynomial equation; C252S F RSSR: All roots of poly eqs. with real coef.; C253S F POLDRV: Driver for C254S; C254S F CPOLY: Roots arb. poly. Jenkins-Traub algorithm; C353S F1 CLEBSH: Ang. mom. coef. - Clebsch, Racah, Wigner; C365S A ALGAMA: Logarithm of the gamma function; C366S A DGAMMA/DLGAMA: DP gamma and log(gamma) functions; C368S F EONE: Exponential integral E1; C370S F BESJY: Bessel functions J and Y; C371S F BESIK: Bessel functions I and K; C372S F CHIPRB: Chi-square integral; C380S F DRZETA: Long precision zeta, zeta-1 functions; C382S F DCGAM: Long precision complex gamma; C383S A DERF/DERFC: DP error function; C384S F BFJ1: Bessel function J1; C385S F COULMB: Regular Coulomb wave functions; C386S F1 DSGMAL: Coulomb phase shift; C387S F BFJYR: Bessel functions J0,J1,Y0,Y1; C388S F IRCOUL: LP irregular Coulomb wave functions; C389S F GAMIN: Incomplete gamma function; C390S F LQ: Assoc. Legendre functions of 2. kind; C392S A DAERF: Inverse error function; C393S F CDEONE: Modified complex exponential integral; D153S F DROMB: Two-dimensional Romberg quadrature; D153S P DROMBP: Two-dimensional Romberg quadrature; D158S F ANC4: Adap. quad. using 4. order Newton
Honda, Kohsuke; Maya, Shohei; Omasa, Takeshi; Hirota, Ryuichi; Kuroda, Akio; Ohtake, Hisao
2010-08-02
Six thermophilic enzymes from Thermus thermophilus were used to construct an 'artificial bio-synthetic pathway' for the production of 2-deoxyribose 5-phosphate from fructose. By a simple operation using six recombinant Escherichia coli strains producing the thermophilic enzymes, respectively, fructose was converted to 2-deoxyribose 5-phosphate with a molar yield of 55%. Copyright 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
D. F. Hurst
2011-12-01
Full Text Available We compare coincident, in situ, balloon-borne measurements of temperature (<i>T> and pressure (P by two radiosondes (Vaisala RS92, Intermet iMet-1-RSB and similar measurements of relative humidity (RH by RS92 sondes and frost point hygrometers. Data from a total of 28 balloon flights with at least one pair of radiosondes are analyzed in 1-km altitude bins to quantify measurement differences between the sonde sensors and how they vary with altitude. Each comparison (<i>T>, P, RH exposes several profiles of anomalously large measurement differences. Measurement difference statistics, calculated with and without the anomalous profiles, are compared to uncertainties quoted by the radiosonde manufacturers. Excluding seven anomalous profiles, <i>T> differences between 19 pairs of RS92 and iMet sondes exceed their measurement uncertainty limits (2 σ 31% of the time and reveal a statistically significant, altitude-independent bias of 0.5 ± 0.2 °C. Similarly, RS92-iMet P differences in 22 non-anomalous profiles exceed their uncertainty limits 23% of the time, with a disproportionate 83% of the excessive P differences at altitudes >16 km. The RS92-iMet pressure differences increase smoothly from −0.6 hPa near the surface to 0.8 hPa above 25 km. Temperature and P differences between all 14 pairs of RS92 sondes exceed manufacturer-quoted, reproducibility limits (σ 28% and 11% of the time, respectively. About 95% of the excessive <i>T> differences are eliminated when 5 anomalous RS92-RS92 profiles are excluded. Only 5% of RH measurement differences between 14 pairs of RS92 sondes exceed the manufacturer's measurement reproducibility limit (σ. RH measurements by RS92 sondes are also compared to RH values calculated from frost point hygrometer measurements and coincident <i>T> measurements by the radiosondes. The influences of RS92-iMet Tand P differences on RH values and water vapor mixing
Directory of Open Access Journals (Sweden)
Richard J. E. eJames
2016-02-01
Full Text Available Manipulating different behavioral characteristics of gambling games can potentially affect the extent to which individuals persevere at gambling, and their transition to problematic behaviors. This has potential impact for mobile gambling technologies and responsible gambling interventions. Two laboratory models pertinent to this are the partial reinforcement extinction effect and the trial spacing effect. Both of these might speed up or delay the acquisition and extinction of conditioned behaviour. We report an experiment that manipulated the rate of reinforcement and inter trial interval (ITI on a simulated slot machine where participants were given the choice between gambling and skipping on each trial, before perseverative gambling was measured in extinction, followed by measurements of the illusion of control, depression and impulsivity. We hypothesized that longer ITI’s in conjunction with the low rates of reinforcement observed in gambling would lead to greater perseverance. We further hypothesized, given that timing is known to be important in displaying illusory control and potentially in persevering in gambling, that prior exposure to longer intervals might affect illusions of control. An interaction between ITI and rate of reinforcement was observed, as low reinforced gamblers with a long ITI gambled for longer. Respondents also displayed extinction and a partial reinforcement extinction effect. Gamblers exposed to a higher rate of reinforcement gambled for longer in acquisition. Impulsivity was associated with extended perseverance in extinction, and more depressed gamblers in the high reinforcement short ITI group persevered for longer. Performance in the contingency judgement failed to support the second hypothesis: the only significant contrast observed was that participants became better calibrated as the task progressed.
What Determines the Response: Test or Reference?
Chukova, S. V.; Ahumada, A. J., Jr.; Null, Cynthia (Technical Monitor)
1998-01-01
The stability of sensory memory has been studied by presenting a reference stimulus, a delay, and a test stimulus. As has been pointed out by Lages and Treisman (1998 Vision Research 38 557-572), the usual measure of performance depends only on the effect of test variations on the responses. The Weber fraction characterizing performance is more properly called the test stimulus Weber fraction. We measure the relative contribution of the test and reference to the response by the ratio of the test Weber fraction to the reference Weber fraction. The stimuli were two dark lines on a bright background. Seven reference separations, varying from 9.5 to 16.7 arc min, were intermixed in each run. Interstimulus intervals (ISI) of 50, 200 and 2000 msec and intertrial intervals (ITI) of 500 and 2500 msec were investigated. When the ISI was short (50 or 200 msec), for both ITIs, responses were determined equally by the test and reference. For the long ISI (2000 msec), the reference stimulus contributed less. However, only for the 500 msec ITI (and not for all observers) was the contribution of the reference stimulus negligible, as Treisman's criterion setting theory might suggest.
A multi-national study of reading and tracing skills in novice programmers
DEFF Research Database (Denmark)
Lindholm Nielsen, Morten; Lister, Raymond; Adams, Elisabeth Shaw
2004-01-01
A study by a ITiCSE 2001 working group ("the McCracken Group") established that many students do not know how to program at the conclusion of their introductory courses. A popular explanation for this incapacity is that the students lack the ability to problem-solve. That is, they lack the ability...... tasks, such as tracing (or "desk checking") through code. This ITiCSE 2004 working group studied the alternative explanation, by testing students from seven countries, in two ways. First, students were tested on their ability to predict the outcome of executing a short piece of code. Second, students...... of skills that are a prerequisite for problem-solving....
Educators’ Implicit Theories of Intelligence and Beliefs about the Identification of Gifted Students
Directory of Open Access Journals (Sweden)
María Caridad García-Cepero
2009-06-01
Full Text Available This research study analyzed the structure of educators’ implicit theoriesof intelligence (ITI and explored the relationship between ITI and beliefsabout the identification of gifted students. This study included a sampleof 372 educators. School Teachers and professors from colleges of educationfavor practical, analytical, and creative attributes in their prototypesof an intelligence person. However, participants were fairly neutral aboutwhether interpersonal and intrapersonal attributes characterized intelligentpeople. Educators that rated creativity as an important attribute ofintelligence tend to favor multiple methods to identify gifted students. Incontrast, educators who supported the use of IQ test as the primary basisof gifted identification tended to agree that analytical abilities were part ofthe structure of intelligence.
Optimization and Sensitivity Analysis for a Launch Trajectory
2014-12-01
burnout . At a higher first stage burnout velocity, less thrust input is...3050 3100 z (k m ) time (sec) 0 20 40 60 80 -5 0 5 V el oc ity (k m /s ) vx vy vz |v| 0 20 40 60 80 -1 0 1 2 U ni t T hr us t V ec to r time...0.5 1 V el oc ity vx vy vz 0 10 20 30 40 50 60 70 -15 -10 -5 0 5 x 10-4 Th ru st V ec to r time (sec) cx cy cz 22 running DIDO.
Usmerjanje urbanega razvoja na mestni ravni
Directory of Open Access Journals (Sweden)
Mojca Šašek Divjak
1999-01-01
Full Text Available Kot je poudarjeno v predstavljenem načrtu Kopenhagna, mestni načrt ne more rešiti vseh planskih problemov mesta. Predstavljal naj bi predvideni red, ki pa se pogosto sproti podira glede na nepredvidena dogajanja v prostoru. Probleme je velikokrat treba reševati šele, ko se pokažejo. Zato mora biti mestni načrt zastavljen dovolj prilagodljivo in fleksibilno, da dovoljuje potrebne spremembe. Vendar mora kljub temu dati mestu trdne glavne usmeritve in s tem omogočiti, da meščani lahko izkoristijo priložnosti, ki jih nudi nova doba in uveljavljajo nove kvalitete bivanja.
Nobuhara, Hirofumi; Okamoto, Yoshihiro; Yamashita, Masato; Nakamura, Yasuaki; Osawa, Hisashi; Muraoka, Hiroaki
2014-05-01
In this paper, we investigate the influence of the writing and reading intertrack interferences (ITIs) in terms of bit aspect ratio (BAR) in shingled magnetic recording by computer simulation using a read/write model which consists of a writing process based on Stoner-Wohlfarth switching asteroid by a one-side shielded isosceles triangular write head and a reading process by an around shielded read head for a discrete Voronoi medium model. The results show that BAR should be 3 to reduce the influence of writing and reading ITIs, media noise, and additive white Gaussian noise in an assumed areal density of 4.61Tbpsi.
A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.
Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I
2016-01-01
We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.
1998-01-01
The main advantages of sandwiches as structural components are now well known and well-established. Due to the progress in polymer science and engineering and advances in manufacturing processes, sandwich structures can blend various functional and structural properties and therefore lead to highly innovating systems. The current difficulty to overcome is to provide designers with proper methodologies and tools that could enable them to design improved sandwich structures. Such dedicated design tools should be efficient, reliable, flexible and user-friendly. They should be based on advanced knowledge of sandwich behaviour at global and local scales. Such approach relies on our capability to test, identify, control and model structure performances. The impressive variety of core and face materials and the rapid developments in forming processes give new opportunities to design components which have more complex shapes and higher integrated functional and structural properties. Interest in sandwiches is perma...
African Journals Online (AJOL)
Cambridge, USA: Harvard University. Press, 2014 ... This book provides an excellent systematic account of global health law by: ... The book is then divided into four parts. ... demand substantial public attention and action; and social, economic.
Indian Academy of Sciences (India)
tribpo
netic indices follow different paths for the ascending and descending phases of the solar cycle while for radiative indices, the separation between the paths are well within the error limits. Key words. Sun: oscillations, activity. 1. Introduction. Ever since the discovery of global modes in the Sun, it has been expected that solar.
Elrod, David; Christensen, Eric; Brown, Andrew
2011-01-01
The temporal frequency content of the dynamic pressure predicted by a 360 degree computational fluid dynamics (CFD) analysis of a turbine flow field provides indicators of forcing function excitation frequencies (e.g., multiples of blade pass frequency) for turbine components. For the Pratt and Whitney Rocketdyne J-2X engine turbopumps, Campbell diagrams generated using these forcing function frequencies and the results of NASTRAN modal analyses show a number of components with modes in the engine operating range. As a consequence, forced response and static analyses are required for the prediction of combined stress, high cycle fatigue safety factors (HCFSF). Cyclically symmetric structural models have been used to analyze turbine vane and blade rows, not only in modal analyses, but also in forced response and static analyses. Due to the tortuous flow pattern in the turbine, dynamic pressure loading is not cyclically symmetric. Furthermore, CFD analyses predict dynamic pressure waves caused by adjacent and non-adjacent blade/vane rows upstream and downstream of the row analyzed. A MATLAB script has been written to calculate displacements due to the complex cyclically asymmetric dynamic pressure components predicted by CFD analysis, for all grids in a blade/vane row, at a chosen turbopump running speed. The MATLAB displacements are then read into NASTRAN, and dynamic stresses are calculated, including an adjustment for possible mistuning. In a cyclically symmetric NASTRAN static analysis, static stresses due to centrifugal, thermal, and pressure loading at the mode running speed are calculated. MATLAB is used to generate the HCFSF at each grid in the blade/vane row. When compared to an approach assuming cyclic symmetry in the dynamic flow field, the current approach provides better assurance that the worst case safety factor has been identified. An extended example for a J-2X turbopump component is provided.
Navy And Marine Corps IT/IS Acquisition: A Way Forward
2017-12-01
Chief Financial Officer . (2016, February). Defense budget overview. United States Department of Defense fiscal year 2017 budget request. Washington...UNDER THE SERVICE LEVEL CHIEF INFORMATION OFFICERS ..................47 C. RECOMMENDATION TWO: PROVIDE BUDGETARY AND TASKING AUTHORITY TO SERVICE...LEVEL CHIEF INFORMATION OFFICERS .................................................................48 D. RECOMMENDATION THREE: PROVIDE FUNDING
Využitie revenue managementu v oblasti Food and Beverage
Džambová, Adela
2013-01-01
The aim of this thesis is to introduce theoretical basis and practical review of actual revenue management usage in hospitality, espacially in the Food&Beverage Department. First chapter brings out the concept of revenue management from the view of its origin, development and integration into other industries. The second and third chapter describes different tools and approaches between the Rooms and Food&Beverage Department. The purpose of the last chapter is to compare revenue management us...
Disease as a theoretical concept: the case of "HPV-itis".
Broadbent, Alex
2014-12-01
If there is any value in the idea that disease is something other than the mere absence of health then that value must lie in the way that diseases are classified. This paper offers further development of a view advanced previously, the Contrastive Model of Disease: it develops the account to handle asymptomatic disease (previously excluded); and in doing so it relates the model to a broadly biostatistical view of health (where before the model was neutral in the naturalism debate). The developments are prompted by considering cancers featuring viruses as prominent causes, since these appear to amount to cases where the prescriptions of the Contrastive Model could be followed, but aren't. The resulting Irrelevance Objection claims that the Contrastive Model is irrelevant to medical science and practice. The paper seeks to rebut the Irrelevance Objection. Copyright © 2014 Elsevier Ltd. All rights reserved.
Marketingové využitie sociálnych sietí
Letková, Natália
2017-01-01
The objective of the bachelor thesis is to evaluate which social network is a more effective online marketing tool for WELD ZVAR s. r. o., a small local welding company. The theoretical part of thesis offers a detailed description of current online marketing landscape, social networks Instagram and Facebook and the role of paid advertising. The applied part of the thesis analyses the effect of fan page actions and its paid advertisements on the growth of fans in comparison with fan pages of c...
Tomie, Arthur; Festa, Eugene D; Sparta, Dennis R; Pohorecky, Larissa A
2003-05-01
Two experiments were designed to evaluate whether brief access to a saccharin-ethanol solution would function as an effective unconditioned stimulus (US) in Pavlovian-autoshaping procedures. In these experiments, the insertion of a lever conditioned stimulus (CS) was followed by the brief presentation of a sipper tube containing saccharin-ethanol US solution. Experience with this Pavlovian-autoshaping procedure engendered lever CS-directed autoshaping conditioned responses (CRs) in all rats. In Experiment 1, the concentration of ethanol [0%, 2%, 4%, 6%, or 8% (vol./vol.)] in 0.1% saccharin was systematically increased within subjects across autoshaping sessions to evaluate the relation between a rat's drinking and lever pressing. In Experiment 2, the mean intertrial interval (ITI) duration (60, 90, 120 s) was systematically increased within subjects across autoshaping sessions to evaluate the effect of ITI duration on drinking and lever pressing. A pseudoconditioning control group received lever CS randomly with respect to the saccharin-ethanol US solution. In Experiment 1, lever-press autoshaping CRs developed in all rats, and the tendency of a rat to drink an ethanol concentration was predictive of the performance of lever-press autoshaping CRs. In Experiment 2, longer ITIs induced more lever CS-directed responding, and CS-US paired procedures yielded more lever CS-directed responding than that observed in CS-US random procedures. Saccharin-ethanol is an effective US in Pavlovian-autoshaping procedures, inducing more CS-directed responding than in pseudoconditioning controls receiving CS-US random procedures. More lever CS-directed responding was observed when there was more drinking of the saccharin-ethanol US solution (Experiment 1); when the CS and US were paired, rather than random (Experiment 2); and with longer mean ITI durations (Experiment 2). This pattern of results is consistent with the hypothesis that lever CS-directed responding reflects performance
Satellite retrieval of the liquid water fraction in tropical clouds between −20 and −38 °C
Directory of Open Access Journals (Sweden)
D. L. Mitchell
2012-07-01
Full Text Available This study describes a satellite remote sensing method for directly retrieving the liquid water fraction in mixed phase clouds, and appears unique in this respect. The method uses MODIS split-window channels for retrieving the liquid fraction from cold clouds where the liquid water fraction is less than 50% of the total condensate. This makes use of the observation that clouds only containing ice exhibit effective 12-to-11 μm absorption optical thickness ratios (βeff that are quasi-constant with retrieved cloud temperature <i>T>. This observation was made possible by using two CO2 channels to retrieve <i>T> and then using the 12 and 11 μm channels to retrieve emissivities and βeff. Thus for <i>T> < −40 °C, βeff is constant, but for <i>T> > −40 °C, βeff slowly increases due to the presence of liquid water, revealing mean liquid fractions of ~ 10% around −22 °C from tropical clouds identified as cirrus by the cloud mask. However, the uncertainties for these retrievals are large, and extensive in situ measurements are needed to refine and validate these retrievals. Such liquid levels are shown to reduce the cloud effective diameter De such that cloud optical thickness will increase by more than 50% for a given water path, relative to De corresponding to pure ice clouds. Such retrieval information is needed for validation of the cloud microphysics in climate models. Since low levels of liquid water can dominate cloud optical properties, tropical clouds between −25 and −20 °C may be susceptible to the first aerosol indirect effect.
Poslanje Crkve u pluralizmu - »preobražavajuće prihvaćanje«
RAGUŽ, Ivica
2003-01-01
Članak namjerava predočiti osnovni teološki pristup pluralizmu i pluralističkome društvu. U prvome će se dijelu pružiti osnovna obilježja pluralizma i pluralističke misli u novovjekovlju. Pri tomu će doći do izražaja da je pluralizam postao osnovni pojam kojim teologija tumači današnju situaciju društva i čovjeka. U drugome dijelu autor će prikazati promijenjeno stanje odnosa između Crkve i društva u pluralizmu. Navest će se ujedno osobine te nove situacije za Crkvu i kršćane. U trećemu odlom...
University of New Mexico Undergraduate Breast Cancer Training Program: Pathway to Research Careers
National Research Council Canada - National Science Library
Griffith, Jeffrey
2004-01-01
We have established a three-phase training program to motivate talented undergraduate students, especially students from under-represented Southwestern minorIties, to pursue careers in breast cancer research...
A Metagenomic Analysis of Microbial Contamination in Aviation Fuels
2009-03-01
classification by the RDP Classifier, sequences similar to members of the Acidobacteria, Actinobacteria , Bacteroidetes, Chloroflexi, Cyanobacteria... Actinobacteria 85 63 4 152 Bacteroidetes 5 0 0 5 Chloroflexi 7 0 0 7 Cyanobacteria 56 0 0 56 Deinococcus-Thermus 2 0 0 2 Firmicutes 83 99 2 184...Members of the Proteobacteria, Firmicutes and Actinobacteria were represented in all three fuel types; in Jet A and Biodiesel they were the only
Lifescience Database Archive (English)
Full Text Available ity*ptrkcyrnnqnry*w *lhvlsiing*ilsqcnnsirynssnr*qrfsih*wsvlc*ikwsyti*qh*c*srfrin ...rnnqnry*w *lhvlsiing*ilsqcnnsirynssnr*qrfsih*wsvlc*ikwsyti*qh*c*srfrin t*ywsicldrke**wy*rir*tiitrcfsfivltkwn
Lifescience Database Archive (English)
Full Text Available nherited disorder characterized by multiorgan dysfunction. AS shares several features with the common metabolic syndrome, namely obes...ity, hyperinsulinemia, and hypertriglyceridemia. A wide range of clinical variabili
Plants of the fynbos biome harbour host species-specific bacterial communities.
Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel
2016-08-01
The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Microbiological investigations on the water of a thermal bath at Budapest.
Szuróczki, Sára; Kéki, Zsuzsa; Káli, Szandra; Lippai, Anett; Márialigeti, Károly; Tóth, Erika
2016-06-01
Thermal baths are unique aquatic environments combining a wide variety of natural and anthropogenic ecological factors, which also appear in their microbiological state. There is limited information on the microbiology of thermal baths in their complexity, tracking community shifts from the thermal wells to the pools. In the present study, the natural microbial community of well and pool waters in Gellért bath was studied in detail by cultivation-based techniques. To isolate bacteria, 10% R2A and minimal synthetic media (with "bath water") with agar-agar and gellan gum were used after prolonged incubation time; moreover, polyurethane blocks covered with media were also applied. Strains were identified by sequencing their 16S rRNA gene after grouping them by amplified rDNA restriction analysis. From each sample, the dominance of Alphaproteobacteria was characteristic though their diversity differed among samples. Members of Actinobacteria, Firmicutes, Beta- and Gamma-proteobacteria, Deinococcus-Thermus, and Bacteroidetes were also identified. Representatives of Deinococcus-Thermus phylum appeared only in the pool water. The largest groups in the pool water belonged to the Tistrella and Chelatococcus genera. The most dominant member in the well water was a new taxon, its similarity to Hartmannibacter diazotrophicus as closest relative was 93.93%.
Viveiros, Miguel; Leandro, Clara; Rodrigues, Liliana; Almeida, Josefina; Bettencourt, Rosário; Couto, Isabel; Carrilho, Lurdes; Diogo, José; Fonseca, Ana; Lito, Luís; Lopes, João; Pacheco, Teresa; Pessanha, Mariana; Quirim, Judite; Sancho, Luísa; Salfinger, Max; Amaral, Leonard
2005-01-01
The INNO-LiPA Rif.TB assay for the identification of Mycobacterium tuberculosis complex strains and the detection of rifampin (RIF) resistance has been evaluated with 360 smear-positive respiratory specimens from an area of high incidence of multidrug-resistant tuberculosis (MDR-TB). The sensitivity when compared to conventional identification/culture methods was 82.2%, and the specificity was 66.7%; the sensitivity and specificity were 100.0% and 96.9%, respectively, for the detection of RIF resistance. This assay has the potential to provide rapid information that is essential for the effective management of MDR-TB. PMID:16145166
Carter : Iisraelil on 150 või enam tuumapommi / Kaivo Kopli
Kopli, Kaivo
2008-01-01
USA endine president Jimmy Carter väitis, et Iisraelil on 150 tuumapommi või rohkemgi. Eri hinnangutest Iisraeli tuumapommide arvu kohta, n.-ö. tunnustatud tuumariigid maailmas. Lisa: Tuumakatsetus 1979. aastal?
Conservative therapy versus intra-gastric balloon in treatment of ...
African Journals Online (AJOL)
Haidy N. Ashem
2013-02-13
Feb 13, 2013 ... treatment with other therapeutic means, Exercise is an activity requiring physical exertion ..... ity (hypertension, diabetes, hyperlipidemia), and reduction of mortality [35]. .... factors with endurance training. Metabolism 2002 ...
Genetic dissection of seed vigour traits in maize (Zea mays L.) under ...
Indian Academy of Sciences (India)
YONG SHI
ity, reflects potential seed germination, seedling growth, seed ... Keywords. recombinant inbred line population; seed vigour; quantitative trait locus analysis; cold tolerance. ..... nent youth fund of Henan province, Corn Industry Technology Sys-.
Ellis, Jonathan S; Strutwolf, Jörg; Arrigan, Damien W M
2012-02-21
Adsorption onto the walls of micropores was explored by computational simulations involving cyclic voltammetry of ion transfer across an interface between aqueous and organic phases located at the micropore. Micro-interfaces between two immiscible electrolyte solutions (micro-ITIES) have been of particular research interest in recent years and show promise for biosensor and biomedical applications. The simulation model combines diffusion to and within the micropore, Butler-Volmer kinetics for ion transfer at the liquid-liquid interface, and Langmuir-style adsorption on the pore wall. Effects due to pore radius, adsorption and desorption rates, surface adsorption site density, and scan rates were examined. It was found that the magnitude of the reverse peak current decreased due to adsorption of the transferring ion on the pore wall; this decrease was more marked as the scan rate was increased. There was also a shift in the half-wave potential to lower values following adsorption, consistent with a wall adsorption process which provides a further driving force to transfer ions across the ITIES. Of particular interest was the disappearance of the reverse peak from the cyclic voltammogram at higher scan rates, compared to the increase in the reverse peak size in the absence of wall adsorption. This occurred for scan rates of 50 mV s(-1) and above and may be useful in biosensor applications using micropore-based ITIES.
Strutwolf, Jörg; Arrigan, Damien W M
2010-10-01
Micropore membranes have been used to form arrays of microinterfaces between immiscible electrolyte solutions (µITIES) as a basis for the sensing of non-redox-active ions. Implementation of stripping voltammetry as a sensing method at these arrays of µITIES was applied recently to detect drugs and biomolecules at low concentrations. The present study uses computational simulation to investigate the optimum conditions for stripping voltammetric sensing at the µITIES array. In this scenario, the diffusion of ions in both the aqueous and the organic phases contributes to the sensing response. The influence of the preconcentration time, the micropore aspect ratio, the location of the microinterface within the pore, the ratio of the diffusion coefficients of the analyte ion in the organic and aqueous phases, and the pore wall angle were investigated. The simulations reveal that the accessibility of the microinterfaces during the preconcentration period should not be hampered by a recessed interface and that diffusional transport in the phase where the analyte ions are preconcentrated should be minimized. This will ensure that the ions are accumulated within the micropores close to the interface and thus be readily available for back transfer during the stripping process. On the basis of the results, an optimal combination of the examined parameters is proposed, which together improve the stripping voltammetric signal and provide an improvement in the detection limit.
Bumblebees exhibit the memory spacing effect
Toda, Nicholas R. T.; Song, Jeremy; Nieh, James C.
2009-10-01
Associative learning is key to how bees recognize and return to rewarding floral resources. It thus plays a major role in pollinator floral constancy and plant gene flow. Honeybees are the primary model for pollinator associative learning, but bumblebees play an important ecological role in a wider range of habitats, and their associative learning abilities are less well understood. We assayed learning with the proboscis extension reflex (PER), using a novel method for restraining bees (capsules) designed to improve bumblebee learning. We present the first results demonstrating that bumblebees exhibit the memory spacing effect. They improve their associative learning of odor and nectar reward by exhibiting increased memory acquisition, a component of long-term memory formation, when the time interval between rewarding trials is increased. Bombus impatiens forager memory acquisition (average discrimination index values) improved by 129% and 65% at inter-trial intervals (ITI) of 5 and 3 min, respectively, as compared to an ITI of 1 min. Memory acquisition rate also increased with increasing ITI. Encapsulation significantly increases olfactory memory acquisition. Ten times more foragers exhibited at least one PER response during training in capsules as compared to traditional PER harnesses. Thus, a novel conditioning assay, encapsulation, enabled us to improve bumblebee-learning acquisition and demonstrate that spaced learning results in better memory consolidation. Such spaced learning likely plays a role in forming long-term memories of rewarding floral resources.
Information Systems’ Portfolio: Contributions of Enterprise and Process Architecture
Directory of Open Access Journals (Sweden)
Silvia Fernandes
2017-09-01
Full Text Available We are witnessing a need for a quick and intelligent reaction from organizations to the level and speed of change in business processes.New information technologies and systems (IT/IS are challenging business models and products. One of the great shakes comes from the online and/or mobile apps and platforms.These are having a tremendous impact in launching innovative and competitive services through the combination of digital and physical features. This leads to actively rethink enterprise information systems’ portfolio, its management and suitability. One relevant way for enterprises to manage their IT/IS in order to cope with those challenges is enterprise and process architecture. A decision-making culture based on processes helps to understand and define the different elements that shape an organization and how those elements inter-relate inside and outside it. IT/IS portfolio management requires an increasing need of modeling data and process flows for better discerning and acting at its selection and alignment with business goals. The new generation of enterprise architecture (NGEA helps to design intelligent processes that answer quickly and creatively to new and challenging trends. This has to be open, agile and context-aware to allow well-designed services that match users’ expectations. This study includes two real cases/problems to solve quickly in companies and solutions are presented in line with this architectural approach.
African Journals Online (AJOL)
ination of high quality research generated in the Western Indian Ocean ..... ities such as hotels, restaurants, transport, export, edu- ..... pliance to regulations will require internal expertise ... Fisheries Service to approve the management plans.
Li, Ziru; Zhang, Xusheng
2009-08-01
To explore the assessing technique which could objectively reflect the characteristics of Chinese medicine in the prevention of cardiovascular and cerebrovascular diseases, four balance features of infrared thermal images (ITI) corresponding to the up and down, left and right, proximal and distal balance of blood circulation of human body were studied. First, the ITI features of the middle-aged and elderly people with lipid abnormality history were compared with those of the healthy youth. It was found that the balance state of the youth was significantly better than that of the middle-aged and elderly, Pfood with the function of helping to decrease serum lipid, on the balance features. The subjects were middle-aged and elderly people with lipid abnormality history. Shengyi capsule was taken by the trial group while Xuezhikang capsule (with lovastatin as the main effective component) by the control group for 108 days. The balance features of ITI showed that Shengyi was significantly better than Xuezhikang in improving the whole body balance of blood circulation (including the up and down, left and right, proximal and distal balance). The relative efficacy rate was 81.0% for the trial group and 33.3% for the control group, there was significant difference between the two groups (P=0.002). Shengyi could effectively decrease the low density lipoprotein cholesterol (LDL-C) but the effect of Xuezhikang in decreasing total cholesterol (TC) and LDL-C was better than Shengyi. Though the lipid-lowering effect of Shengyi was not as good as Xuezhikang, ITI reflected the obvious advantage of Shengyi in improving the whole body balance of blood circulation which indicated that helping to decrease serum lipid is only part of the health function of Shengyi. The physiology and pathology basis of the influences of Shengyi on the four balance features and its relationship with the clinical outcome deserves further study. So the prospect of infrared thermal imaging is indicated as
Railway bribery investigation falls through / Joel Alas
Alas, Joel
2007-01-01
Eesti Kaitsepolitsei ei alustanud Reformierakonna võimaliku altkäemaksu nõudmise uurimist. Raudteeärimees Edward Burkhardt väitis, et Reformierakond küsis miljon eurot altkäemaksu raudtee erastamise ajal
2018-04-29T18:09:00Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
SOCPS), Peer PressureAssessment Scale (PPAS) and the Parental Influence ... Itis recommended that counsellors should collect, analyze and interpret relevant data about the adolescents, and their capabilities with a view to helping them ...
Subject Index S¯adhan¯a Vol. 37, 2012
Indian Academy of Sciences (India)
Size effect on strength and lifetime probabil- ity distributions of ... dimensional discrete element model. 261 ... behaviour of alloyed gray cast iron. 569. Brick ... Plastic collapse load of corroded steel plates. 341 .... Minimum flow problem.
Haber Process for Ammonia Synthesis
Indian Academy of Sciences (India)
and production methods for large-scale production of ammonia. The collaborative ... temperature also causes the equilibrium position to move to the right .... From the equilibrium data measured it was obvious ... ity, performance and lifetime.
The South African guidelines on Enuresis—2017
African Journals Online (AJOL)
Ahmed Adam
2018-02-28
Feb 28, 2018 ... of antidiuretic hormone (ADH)/arginine-vasopressin release during sleep, .... in therapy resistant older children with attention deficit hyperactiv- ity who are .... The South African Smartphone market growth is amongst the high-.
Challenges in the Quest for Clean Energies
Indian Academy of Sciences (India)
article/fulltext/reso/018/12/1110-1126. Keywords. Hydroelectric ity; bio-energy; geothermal; renewable energy. Author Affiliations. Sheela K Ramasesha1. Divecha Centre for Climate Change, Indian Institute of Science, Bangalore 560 012, India.
Lessons Learned with the Innovation Triangle Initiative
National Research Council Canada - National Science Library
Freire, Marco; Guglielmi, Marco; Lascar, Stephane
2005-01-01
... seed for significant innovation. ITI is based on the concept that a close collaboration between three different entities -- the inventor, the developer, and the customer -- is an important factor for the rapid and successful...
Synthesis, spectroscopic characterization and catalytic oxidation ...
Indian Academy of Sciences (India)
were characterized by infrared, electronic, electron paramagnetic resonance ... The catalytic oxidation property of ruthenium(III) complexes were also ... cies at room temperature. ..... aldehyde part of Schiff base ligands, catalytic activ- ity of new ...
2011-08-12
...-2251. Mail: U.S. Department of Transportation, Docket Operations, M-30, West Building Ground Floor... FURTHER INFORMATION CONTACT: Norm Perenson, Aerospace Engineer, New York Aircraft Certification Office... 1, 1997. FAA's Determination We are proposing this AD because we evaluated all the relevant...
1974-06-01
itwmi iti i•nvi ist nnuii-tiTiui’miisi’tKYciii’Oiii mimxmi iti-nTiioi i/t»i isi •to« x-ttc aractm" •« PIM o*t* rm u.n." 00 It* N-I.ll WIIMI...1, IOIIIOJ , DCIIIOI , nrr•t~~•, nc•••· tC•••• a . .., •••. u••••· m•n•. OTt •••· ,.,,,, ,,.,,, ··"’’’ .. ’ catiWI.OCI IOIII,ft,.ttt...ii-mioii m.tn.m (II .KMOUI triM)Ui-j> ii*,(i>i.tii «11 J-MIISl C Ott UP TIOATAl a« Kriui-urij-n - rrciiTi t*-«l»l.I<f(>0> T«riiTi-Tiriiii
International Nuclear Information System (INIS)
Zasowski, G.; Beaton, R. L.; Hamm, K. K.; Majewski, S. R.; Patterson, R. J.; Babler, B.; Churchwell, E.; Meade, M.; Whitney, B. A.; Benjamin, R. A.; Watson, C.
2013-01-01
Open stellar clusters are extremely valuable probes of Galactic structure, star formation, kinematics, and chemical abundance patterns. Near-infrared (NIR) data have enabled the detection of hundreds of clusters hidden from optical surveys, and mid-infrared (MIR) data are poised to offer an even clearer view into the most heavily obscured parts of the Milky Way. We use new MIR images from the Spitzer GLIMPSE-360, Cyg-X, and SMOG surveys to visually identify a large number of open cluster candidates in the outer disk of the Milky Way (65° < l < 265°). Using NIR color-magnitude diagrams, stellar isochrones, and stellar reddening estimates, we derive cluster parameters (metallicity, distance, reddening) for those objects without previous identification and/or parameters in the literature. In total, we present coordinates and sizes of 20 previously unknown open cluster candidates; for 7 of these we also present metallicity, distance, and reddening values. In addition, we provide the first estimates of these values for nine clusters that had been previously cataloged. We compare our cluster sizes and other derived parameters to those in the open cluster catalog of Dias et al. and find strong similarities except for a higher mean reddening for our objects, which signifies our increased detection sensitivity in regions of high extinction. The results of this cluster search and analysis demonstrate the ability of MIR imaging and photometry to augment significantly the current census of open clusters in the Galaxy
Influence of land-use patterns on benthic diatom communities and ...
African Journals Online (AJOL)
2010-03-01
Mar 1, 2010 ... for management of Brazilian and other tropical lotic systems. The objective of this ... ity, floods and inundations, which affect diatom development, especially ...... Sociedade Brasileira de Ficologia, CETESB, São Paulo. 34-55.
Indian Academy of Sciences (India)
Classroom” is equally a forum for raising broader issues and sharing personal experiences and viewpoints on matters related to teaching and learning science. A Note on Sum-Product Numbers. Keywords. Sum-product number, divisibil- ity.