Davidson, John F.; Fox, Richard; Harris, Dawn D.; Lyons-Abbott, Sally; Loeb, Lawrence A.
2003-01-01
Insertion of the T3 DNA polymerase thioredoxin binding domain (TBD) into the distantly related thermostable Taq DNA polymerase at an analogous position in the thumb domain, converts the Taq DNA polymerase from a low processive to a highly processive enzyme. Processivity is dependent on the presence of thioredoxin. The enhancement in processivity is 20–50-fold when compared with the wild-type Taq DNA polymerase or to the recombinant polymerase in the absence of thioredoxin. The recombinant Taq...
Directory of Open Access Journals (Sweden)
Marcin Olszewski
Full Text Available DNA polymerases are present in all organisms and are important enzymes that synthesise DNA molecules. They are used in various fields of science, predominantly as essential components for in vitro DNA syntheses, known as PCR. Modern diagnostics, molecular biology and genetic engineering need DNA polymerases which demonstrate improved performance. This study was aimed at obtaining a new NeqSSB-TaqS fusion DNA polymerase from the Taq DNA Stoffel domain and a single-stranded DNA binding-like protein of Nanoarchaeum equitans in order to significantly improve the properties of DNA polymerase. The DNA coding sequence of Taq Stoffel DNA polymerase and the nonspecific DNA-binding protein of Nanoarchaeum equitans (NeqSSB-like protein were fused. A novel recombinant gene was obtained which was cloned into the pET-30 Ek/LIC vector and introduced into E. coli for expression. The recombinant enzyme was purified and its enzymatic properties including DNA polymerase activity, PCR amplification rate, thermostability, processivity and resistance to inhibitors, were tested. The yield of the target protein reached approximately 18 mg/l after 24 h of the IPTG induction. The specific activity of the polymerase was 2200 U/mg. The recombinant NeqSSB-TaqS exhibited a much higher extension rate (1000 bp template in 20 s, processivity (19 nt, thermostability (half-life 35 min at 95°C and higher tolerance to PCR inhibitors (0.3-1.25% of whole blood, 0.84-13.5 μg of lactoferrin and 4.7-150 ng of heparin than Taq Stoffel DNA polymerase. Furthermore, our studies show that NeqSSB-TaqS DNA polymerase has a high level of flexibility in relation to Mg2+ ions (from 1 to 5 mM and KCl or (NH42SO4 salts (more than 60 mM and 40 mM, respectively. Using NeqSSB-TaqS DNA polymerase instead of the Taq DNA polymerase could be a better choice in many PCR applications.
PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.
Cline, J; Braman, J C; Hogrefe, H H
1996-09-15
The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at pH 8.5-9.1. Under these conditions, the error rate of exo- Pfu was approximately 40-fold higher (5 x 10(-5)) than the error rate of Pfu. As the reaction pH was raised from pH 8 to 9, the error rate of Pfu decreased approximately 2-fold, while the error rate of exo- Pfu increased approximately 9-fold. An increase in error rate with pH has also been noted for the exonuclease-deficient DNA polymerases Taq and exo- Klenow, suggesting that the parameters which influence replication error rates may be similar in pol l- and alpha-like polymerases. Finally, the fidelity of 'long PCR' DNA polymerase mixtures was examined. The error rates of a Taq/Pfu DNA polymerase mixture and a Klentaq/Pfu DNA polymerase mixture were found to be less than the error rate of Taq DNA polymerase, but approximately 3-4-fold higher than the error rate of Pfu DNA polymerase.
Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I
2012-03-13
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.
Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.
2012-01-01
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201
Directory of Open Access Journals (Sweden)
Rudolph Spangler
Full Text Available BACKGROUND: PCR in principle can detect a single target molecule in a reaction mixture. Contaminating bacterial DNA in reagents creates a practical limit on the use of PCR to detect dilute bacterial DNA in environmental or public health samples. The most pernicious source of contamination is microbial DNA in DNA polymerase preparations. Importantly, all commercial Taq polymerase preparations inevitably contain contaminating microbial DNA. Removal of DNA from an enzyme preparation is problematical. METHODOLOGY/PRINCIPAL FINDINGS: This report demonstrates that the background of contaminating DNA detected by quantitative PCR with broad host range primers can be decreased greater than 10-fold through the simple expedient of Taq enzyme dilution, without altering detection of target microbes in samples. The general method is: For any thermostable polymerase used for high-sensitivity detection, do a dilution series of the polymerase crossed with a dilution series of DNA or bacteria that work well with the test primers. For further work use the concentration of polymerase that gave the least signal in its negative control (H(2O while also not changing the threshold cycle for dilutions of spiked DNA or bacteria compared to higher concentrations of Taq polymerase. CONCLUSIONS/SIGNIFICANCE: It is clear from the studies shown in this report that a straightforward procedure of optimizing the Taq polymerase concentration achieved "treatment-free" attenuation of interference by contaminating bacterial DNA in Taq polymerase preparations. This procedure should facilitate detection and quantification with broad host range primers of a small number of bona fide bacteria (as few as one in a sample.
Data of self-made Taq DNA polymerase prepared for screening purposes
Directory of Open Access Journals (Sweden)
E.V. Konovalova
2017-04-01
Full Text Available DNA analysis is a key procedure in genetic engineering. Nowadays the analysis is often done by PCR with Taq DNA polymerase. Although the last enzyme price is quite low, demand for numerous analyses results in much money expenditure which are not affordable for many laboratories. In a meanwhile, many screening tasks do not require the highly purified enzyme. Taking into account the enzyme unique properties it makes possible to marginally simplify its production without resorting to costly or lengthy techniques such as column chromatography and/or dialysis. Here the data of routine usage of Taq DNA polymerase prepared according to the protocol developed in our laboratory is presented. The protocol takes only several hours to realize and does not need qualified personnel or expensive equipment. Yet it gives the enzyme preparation suitable for most screening purposes. The isolated Taq DNA polymerase stock can be stored as ammonium sulfate suspension in a refrigerator for prolonged period, not less than 6 months. The working enzyme solution is prepared from the stock suspension on demand, not more than once in a month and can be stored also in a refrigerator.
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Directory of Open Access Journals (Sweden)
Tom eKillelea
2014-05-01
Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.
PCR fidelity of pfu DNA polymerase and other thermostable DNA polymerases.
Cline, J; Braman, J C; Hogrefe, H H
1996-01-01
The replication fidelities of Pfu, Taq, Vent, Deep Vent and UlTma DNA polymerases were compared using a PCR-based forward mutation assay. Average error rates (mutation frequency/bp/duplication) increased as follows: Pfu (1.3 x 10(-6)) < Deep Vent (2.7 x 10(-6)) < Vent (2.8 x 10(-6)) < Taq (8.0 x 10(-6)) < < exo- Pfu and UlTma (approximately 5 x 10(-5)). Buffer optimization experiments indicated that Pfu fidelity was highest in the presence of 2-3 mM MgSO4 and 100-300 microM each dNTP and at p...
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme commonly used for DNA amplification in PCR. However, little has been done to characterize the motions of other structural domains of Taq Pol or any other DNA polymerase during catalysis. Here, we used stopped-flow Förster resonance energy transfer (FRET) to investigate the conformational dynamics of all five structural domains of the full-length Taq Pol relative to the DNA substrate during nucleotide binding and incorporation. Our study provides evidence for a rapid conformational change step induced by dNTP binding and a subsequent global conformational transition involving all domains of Taq Pol during catalysis. Additionally, our study shows that the rate of the global transition was greatly increased with the truncated form of Taq Pol lacking the N-terminal domain. Finally, we utilized a mutant of Taq Pol containing a de novo disulfide bond to demonstrate that limiting protein conformational flexibility greatly reduced the polymerization activity of Taq Pol. PMID:24931550
Conformational Dynamics of Thermus aquaticus DNA Polymerase I during Catalysis
Xu, Cuiling; Maxwell, Brian A.; Suo, Zucai
2014-01-01
Despite the fact that DNA polymerases have been investigated for many years and are commonly used as tools in a number of molecular biology assays, many details of the kinetic mechanism they use to catalyze DNA synthesis remain unclear. Structural and kinetic studies have characterized a rapid, pre-catalytic open-to-close conformational change of the Finger domain during nucleotide binding for many DNA polymerases including Thermus aquaticus DNA polymerase I (Taq Pol), a thermostable enzyme c...
Crystallization and preliminary X-ray characterization of two thermostable DNA nucleases
International Nuclear Information System (INIS)
Kuettner, E. Bartholomeus; Pfeifer, Sven; Keim, Antje; Greiner-Stöffele, Thomas; Sträter, Norbert
2006-01-01
Two thermostable DNA nucleases from archaea were crystallized in different space groups; the crystals were suitable for X-ray analysis. Temperature-tolerant organisms are an important source to enhance the stability of enzymes used in biotechnological processes. The DNA-cleaving enzyme exonuclease III from Escherichia coli is used in several applications in gene technology. A thermostable variant could expand the applicability of the enzyme in these methods. Two homologous nucleases from Archaeoglobus fulgidus (ExoAf) and Methanothermobacter thermoautrophicus (ExoMt) were studied for this purpose. Both enzymes were crystallized in different space groups using (poly)ethylene glycols, 2,4-methyl pentandiol, dioxane, ethanol or 2-propanol as precipitants. The addition of a 10-mer DNA oligonucleotide was important to obtain monoclinic crystals of ExoAf and ExoMt that diffracted to resolutions better than 2 Å using synchrotron radiation. The crystal structures of the homologous proteins can serve as templates for genetic engineering of the E. coli exonuclease III and will aid in understanding the different catalytic properties of the enzymes
[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].
Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng
2013-10-18
To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.
Wadowsky, Robert M; Laus, Stella; Green, Michael; Webber, Steven A; Rowe, David
2003-11-01
Epstein-Barr virus (EBV) DNA load values were measured in samples of whole blood (n = 60) and plasma (n = 59) by TaqMan PCR and in samples of peripheral blood lymphocytes (PBLs) (n = 60) by competitive PCR (cPCR). The samples were obtained from 44 transplant recipients. The whole-blood and PBL loads correlated highly (r(2) > 0.900), whereas the plasma and PBL loads correlated poorly (r(2) = 0.512). Testing of whole blood by TaqMan PCR is an acceptable alternative to testing of PBLs by cPCR for quantifying EBV DNA load.
Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.
Pegels, N; González, I; Fernández, S; García, T; Martín, R
2012-01-01
A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.
Directory of Open Access Journals (Sweden)
Ribal María
2008-06-01
Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.
The ectoparasitic stubby root nematode Paratrichodorus allius transmits Tobacco rattle virus, which causes corky ringspot disease resulting in significant economic losses in the potato industry. This study developed a diagnostic method for direct quantification of P. allius from soil DNA using a Taq...
Arezi, Bahram; McKinney, Nancy; Hansen, Connie; Cayouette, Michelle; Fox, Jeffrey; Chen, Keith; Lapira, Jennifer; Hamilton, Sarah; Hogrefe, Holly
2014-01-01
Faster-cycling PCR formulations, protocols, and instruments have been developed to address the need for increased throughput and shorter turn-around times for PCR-based assays. Although run times can be cut by up to 50%, shorter cycle times have been correlated with lower detection sensitivity and increased variability. To address these concerns, we applied Compartmentalized Self Replication (CSR) to evolve faster-cycling mutants of Taq DNA polymerase. After five rounds of selection using progressively shorter PCR extension times, individual mutations identified in the fastest-cycling clones were randomly combined using ligation-based multi-site mutagenesis. The best-performing combinatorial mutants exhibit 35- to 90-fold higher affinity (lower Kd ) for primed template and a moderate (2-fold) increase in extension rate compared to wild-type Taq. Further characterization revealed that CSR-selected mutations provide increased resistance to inhibitors, and most notably, enable direct amplification from up to 65% whole blood. We discuss the contribution of individual mutations to fast-cycling and blood-resistant phenotypes.
Directory of Open Access Journals (Sweden)
Bayoh Nabie M
2007-02-01
Full Text Available Abstract Background Identification of Anopheles gambiae s.s. and Anopheles arabiensis from field-collected Anopheles gambiae s.l. is often necessary in basic and applied research, and in operational control programmes. The currently accepted method involves use of standard polymerase chain reaction amplification of ribosomal DNA (rDNA from the 3' 28S to 5' intergenic spacer region of the genome, and visual confirmation of amplicons of predicted size on agarose gels, after electrophoresis. This report describes development and evaluation of an automated, quantitative PCR method based upon TaqMan™ single nucleotide polymorphism (SNP genotyping. Methods Standard PCR, and TaqMan SNP genotyping with newly designed primers and fluorophore-labeled probes hybridizing to sequences of complementary rDNA specific for either An. gambiae s.s. or An. arabiensis, were conducted in three experiments involving field-collected An. gambiae s.l. from western Kenya, and defined laboratory strains. DNA extraction was from a single leg, sonicated for five minutes in buffer in wells of 96-well PCR plates. Results TaqMan SNP genotyping showed a reaction success rate, sensitivity, and species specificity comparable to that of standard PCR. In an extensive field study, only 29 of 3,041 (0.95% were determined to be hybrids by TaqMan (i.e., having rDNA sequences from both species, however, all but one were An. arabiensis by standard PCR, suggesting an acceptably low (ca. 1% error rate for TaqMan genotyping in mistakenly identifying species hybrids. Conclusion TaqMan SNP genotyping proved to be a sensitive and rapid method for identification of An. gambiae s.l. and An. arabiensis, with a high success rate, specific results, and congruence with the standard PCR method.
Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub
2016-01-01
This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.
Real-time TaqMan polymerase chain reaction to quantify the effects ...
African Journals Online (AJOL)
TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...
Czech Academy of Sciences Publication Activity Database
Utekal, Pavol; Kocanda, Lukáš; Matoušek, P.; Wagner, P.; Bugajev, Viktor; Dráber, Petr
2015-01-01
Roč. 416, January (2015), s. 178-182 ISSN 0022-1759 R&D Projects: GA ČR(CZ) GBP302/12/G101; GA MPO FR-TI3/067; GA ČR(CZ) GA14-09807S; GA ČR(CZ) GA14-00703S Institutional support: RVO:68378050 Keywords : 1,2-Propanediol * real-time PCR * SYBR Green I * Taq DNA polymerase * trehalose * Unseparated blood Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.858, year: 2015
KlenTaq polymerase replicates unnatural base pairs by inducing a Watson-Crick geometry.
Betz, Karin; Malyshev, Denis A; Lavergne, Thomas; Welte, Wolfram; Diederichs, Kay; Dwyer, Tammy J; Ordoukhanian, Phillip; Romesberg, Floyd E; Marx, Andreas
2012-07-01
Many candidate unnatural DNA base pairs have been developed, but some of the best-replicated pairs adopt intercalated structures in free DNA that are difficult to reconcile with known mechanisms of polymerase recognition. Here we present crystal structures of KlenTaq DNA polymerase at different stages of replication for one such pair, dNaM-d5SICS, and show that efficient replication results from the polymerase itself, inducing the required natural-like structure.
Salpini, Romina; Piermatteo, Lorenzo; Gill, Upkar; Battisti, Arianna; Stazi, Francesca; Guenci, Tania; Giannella, Sara; Serafini, Valentina; Kennedy, Patrick T F; Perno, Carlo Federico; Svicher, Valentina; Ciotti, Marco
2017-08-01
Intrahepatic total HBV DNA (it-HBV DNA) level might reflect the size of virus reservoir and correlate with the histological status of the liver. To quantitate it-HBV DNA in a series of 70 liver biopsies obtained from hepatitis B chronic patients, a modified version of the COBAS ® Ampliprep/COBAS ® TaqMan HBV test v2.0 was used for this purpose. The linearity and reproducibility of the modified protocol was tested by quantifying serial dilutions of a full-length HBV containing plasmid and it-HBV DNA from a reference patient. A good linear trend between the expected values and those generated by the assay was observed at different concentrations of both plasmid and reference patient (R 2 = 0.994 and 0.962, respectively). Differences between the values obtained in two independent runs were ≤0.3 log IU for the plasmid and ≤0.6 log IU/mg for the reference patient, showing a high inter-run reproducibility. In the 70 liver biopsies, it-HBV DNA level ranged from 1.4 to 5.4 log IU/mg, with a good linearity and reproducibility between the values obtained in two runs [R 2 = 0.981; median (IQR) difference of it-HBV DNA 0.05 (0.02-0.09) IU/mg]. The modified COBAS ® Ampliprep/COBAS ® TaqMan HBV test v2.0 allows an accurate quantitation of it-HBV DNA. Its determination may have prognostic value and may be a useful tool for the new therapeutic strategies aimed at eradicating the HBV infection.
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
Thermostating highly confined fluids.
Bernardi, Stefano; Todd, B D; Searles, Debra J
2010-06-28
In this work we show how different use of thermostating devices and modeling of walls influence the mechanical and dynamical properties of confined nanofluids. We consider a two dimensional fluid undergoing Couette flow using nonequilibrium molecular dynamics simulations. Because the system is highly inhomogeneous, the density shows strong fluctuations across the channel. We compare the dynamics produced by applying a thermostating device directly to the fluid with that obtained when the wall is thermostated, considering also the effects of using rigid walls. This comparison involves an analysis of the chaoticity of the fluid and evaluation of mechanical properties across the channel. We look at two thermostating devices with either rigid or vibrating atomic walls and compare them with a system only thermostated by conduction through vibrating atomic walls. Sensitive changes are observed in the xy component of the pressure tensor, streaming velocity, and density across the pore and the Lyapunov localization of the fluid. We also find that the fluid slip can be significantly reduced by rigid walls. Our results suggest caution in interpreting the results of systems in which fluid atoms are thermostated and/or wall atoms are constrained to be rigid, such as, for example, water inside carbon nanotubes.
Nagy, Alexander; Černíková, Lenka; Vitásková, Eliška; Křivda, Vlastimil; Dán, Ádám; Dirbáková, Zuzana; Jiřincová, Helena; Procházka, Bohumír; Sedlák, Kamil; Havlíčková, Martina
2016-01-01
In the present work, we optimised and evaluated a qPCR system integrating 6-FAM (6-carboxyfluorescein)-labelled TaqMan probes and melting analysis using the SYTO 82 (S82) DNA binding dye in a single reaction. We investigated the influence of the S82 on various TaqMan and melting analysis parameters and defined its optimal concentration. In the next step, the method was evaluated in 36 different TaqMan assays with a total of 729 paired reactions using various DNA and RNA templates, including field specimens. In addition, the melting profiles of interest were correlated with the electrophoretic patterns. We proved that the S82 is fully compatible with the FAM-TaqMan system. Further, the advantages of this approach in routine diagnostic TaqMan qPCR were illustrated with practical examples. These included solving problems with flat or other atypical amplification curves or even false negativity as a result of probe binding failure. Our data clearly show that the integration of the TaqMan qPCR and melting analysis into a single assay provides an additional control option as well as the opportunity to perform more complex analyses, get more data from the reactions, and obtain analysis results with higher confidence. PMID:27031831
Muller, Laura K.; Lorch, Jeffrey M.; Lindner, Daniel L.; O'Connor, Michael; Gargas, Andrea; Blehert, David S.
2013-01-01
The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The test is highly sensitive, consistently detecting as little as 3.3 fg of genomic DNA from G. destructans. The real-time PCR test specifically amplified genomic DNA from G. destructans but did not amplify target sequence from 54 closely related fungal isolates (including 43 Geomyces spp. isolates) associated with bats. The test was further qualified by analyzing DNA extracted from 91 bat wing skin samples, and PCR results matched histopathology findings. These data indicate the real-time TaqMan PCR method described herein is a sensitive, specific, and rapid test to detect DNA from G. destructans and provides a valuable tool for WNS diagnostics and research.
Katano, Yuta; Li, Tongyang; Baba, Misato; Nakamura, Miyo; Ito, Masaaki; Kojima, Kenji; Takita, Teisuke; Yasukawa, Kiyoshi
2017-12-01
We attempted to increase the thermostability of Moloney murine leukemia virus (MMLV) reverse transcriptase (RT). The eight-site saturation mutagenesis libraries corresponding to Ala70-Arg469 in the whole MMLV RT (Thr24-Leu671), in each of which 1 out of 50 amino acid residues was replaced with other amino acid residue, were constructed. Seven-hundred and sixty eight MMLV RT clones were expressed using a cell-free protein expression system, and their thermostabilities were assessed by the temperature of thermal treatment at which they retained cDNA synthesis activity. One clone D200C was selected as the most thermostable variant. The highest temperature of thermal treatment at which D200C exhibited cDNA synthesis activity was 57ºC, which was higher than for WT (53ºC). Our results suggest that a combination of site saturation mutagenesis library and cell-free protein expression system might be useful for generation of thermostable MMLV RT in a short period of time for expression and selection.
Taq I RFLP in the human cellular retinol-binding protein (CRBP) gene
Energy Technology Data Exchange (ETDEWEB)
Pellegrino, A [Istituto di Ricovero e Cura a Carattere Scientifico SANATRIX, Vena (Italy); Garofalo, S; Cocozza, S; Monticelli, A; Varrone, S [CNR Universita degli Studi di Napoli (Italy); Faraonio, R; Colantuoni, V [Universita degli Studi di Napoli (Italy)
1988-08-11
The probe was a Pst I - Bam HI fragment of cDNA, about 600 bp long, encoding for the human CRBP gene. The clone was isolated by screening a human liver cDNA library in the expression vector pEX with antibodies against rat CRBP. Taq I digestion of genomic DNA and hybridization with the CRBP probe detects a two allele polymorphism with allelic fragments of 3.0 kb and 2.7 kb. There are two invariant bands at 2.4 and 2.2 kb. Human CRBP gene has been mapped on the long arm of chromosome 3 using somatic cell hybrids. Co-dominant segregation was observed in two caucasian families (10 individuals).
Bellin, Robert M.; Bruno, Mary K.; Farrow, Melissa A.
2010-01-01
We have developed a 9-week undergraduate laboratory series focused on the purification and characterization of "Thermus aquaticus" DNA polymerase (Taq). Our aim was to provide undergraduate biochemistry students with a full-semester continuing project simulating a research-like experience, while having each week's procedure focus on a single…
Investigations of Flare Gas Emissions in Taq Taq Oil Field on the Surrounding Land
Directory of Open Access Journals (Sweden)
Jafar A. Ali
2014-11-01
Full Text Available Environmental pollution caused by oil takes many different forms; one of the most damaging sources is simply the combustion of oil products, such as a well flare burn-off. This paper presents the results of a survey of the agriculture lands around the Taq Taq Oil Production Company. The aim of the survey was to determine the potential contamination caused by the gas emissions from the well flares. Taq Taq field is located in the Kurdistan Region of Iraq, 60 km north of the giant Kirkuk oil field, 85 km south-east of Erbil and 120 km north-west of Suleimani. Samples of soil were collected from several locations around the site and analyzed to determine the content of Polycyclic Aromatic Hydrocarbons PAH present. A gas chromatography linked to a mass spectrometry (GCMS machine was used for these measurements. The PAH contamination at each location of soil was determined and the 16-PAHs, as listed in the US Environmental Protection Agency (EPA documentation were investigated. The average content of total PAH in all samples of the agricultural soil was 0.654 mg·kg-1 with the concentrations ranging from 0.310 to 0.869 mg·kg-1. It was found that the PAH concentrations decreased with increasing distance from the TTOPCO oil field, indicating that pollution was evident, the area close to the field being more affected by the gas pollution.
International Nuclear Information System (INIS)
Ruan Changgeng; Gu Jianmin; Wang Xiaodong; Chu Xiaohong; Pan Junliang; Wu Qingyu
1992-08-01
Glanzmann's thrombasthenia is a bleeding disorder caused by qualitative and/or quantitative defects of platelet membrane glycoprotein (GP) Ii b /III a complex. The disease is inherited in an autosomal recessive manner. The use of cDNA probes to study restriction fragment length polymorphisms (RFLPs) in GPIII a gene is reported. A Taq I polymorphism was identified and this RFLP consisted of variant bands of 6.5 kb/4.0 and 2.5 kb with a frequency of 0.46/0.54 in Chinese population. The Taq I polymorphism was further localized by polymerase chain reaction (PCR) method to exon VIII of the GPIII a gene. In two Glanzmann's thrombasthenia families, the Taq I RFLP studied with both Southern blotting and PCR methods identified defective GPIII a gene inherited by patients, and determined the genotype of asymptomatic subjects. Analysis of this Taq I polymorphism by PCR method should be potentially useful in future for the carrier detection and prenatal diagnosis in Glanzmann's thrombasthenia families
Directory of Open Access Journals (Sweden)
Olivier Martínez
Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.
Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming
2013-07-01
Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
Lek, Fang-Ying; Ong, Hing-Huat; Say, Yee-How
2018-01-01
This study investigated the association of DRD2 Taq1A, Taq1B and Taq1D gene polymorphisms with eating behavior, the preference/intake frequency/craving of high-fat foods and obesity in 394 Malaysian adults (161 males, 233 females; 308 Chinese, 86 Indians; 67 obese, 327 non-obese). Eating behaviors namely Cognitive Restraint, Uncontrolled Eating and Emotional Eating scores were assessed by the Three Factor Eating Questionnaire-R18. The preference/intake frequency/craving of 26 common high-fat Malaysian foods was assessed using a 7-point hedonic scale. Anthropometric measurements were taken and Taq1 gene polymorphisms were genotyped by PCR-Restriction Fragment Length Polymorphism using DNA extracted from mouthwash samples. The overall minor allele frequencies of Taq1A, Taq1B and Taq1D according to ethnicities (Chinese/Indian) were 0.37/0.29, 0.39/0.28, 0.06/0.30, respectively; genotype and allele distributions of Taq1B and Taq1D were significantly different between ethnicities. Eating behaviorscores were not significantly different between gender and ethnicities. Those with A1 or B1 allele had lower Cognitive Restraint score and higher Uncontrolled Eating score, while those with A1/A1 or B1/B1 genotype had higher fast food preference. D1 allele was associated with increased starchy food craving and mamak (Malaysian Indian-Muslim) food preference, but not eating behavior scores. All three gene variants were not associated with obesity and adiposity. Taken together, we posit that three DRD2 Taq1 gene polymorphisms influence the eating behavior and preference/intake frequency/craving of certain high-fat foods in Malaysian adults, but their role in obesity and adiposity is still inconclusive and needs further investigation.
Ueno, Tomohiro; Niimi, Hideki; Yoneda, Noriko; Yoneda, Satoshi; Mori, Masashi; Tabata, Homare; Minami, Hiroshi; Saito, Shigeru; Kitajima, Isao
2015-01-01
Intra-amniotic infection has long been recognized as the leading cause of preterm delivery. Microbial culture is the gold standard for the detection of intra-amniotic infection, but several days are required, and many bacterial species in the amniotic fluid are difficult to cultivate. We developed a novel nested-PCR-based assay for detecting Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples within three hours of sample collection. To detect prokaryotes, eukaryote-made thermostable DNA polymerase, which is free from bacterial DNA contamination, is used in combination with bacterial universal primers. In contrast, to detect eukaryotes, conventional bacterially-made thermostable DNA polymerase is used in combination with fungal universal primers. To assess the validity of the PCR assay, we compared the PCR and conventional culture results using 300 amniotic fluid samples. Based on the detection level (positive and negative), 93.3% (280/300) of Mycoplasma, 94.3% (283/300) of Ureaplasma, 89.3% (268/300) of other bacteria and 99.7% (299/300) of fungi matched the culture results. Meanwhile, concerning the detection of bacteria other than Mycoplasma and Ureaplasma, 228 samples were negative according to the PCR method, 98.2% (224/228) of which were also negative based on the culture method. Employing the devised primer sets, mixed amniotic fluid infections of Mycoplasma, Ureaplasma and/or other bacteria could be clearly distinguished. In addition, we also attempted to compare the relative abundance in 28 amniotic fluid samples with mixed infection, and judged dominance by comparing the Ct values of quantitative real-time PCR. We developed a novel PCR assay for the rapid detection of Mycoplasma, Ureaplasma, other bacteria and fungi in amniotic fluid samples. This assay can also be applied to accurately diagnose the absence of bacteria in samples. We believe that this assay will positively contribute to the treatment of intra-amniotic infection and
COMPARISON OF SIX COMMERCIALLY-AVAILABLE DNA POLYMERASES FOR DIRECT PCR
Directory of Open Access Journals (Sweden)
Masashi Miura
2013-12-01
Full Text Available SUMMARY The use of a “direct PCR” DNA polymerase enables PCR amplification without any prior DNA purification from blood samples due to the enzyme's resistance to inhibitors present in blood components. Such DNA polymerases are now commercially available. We compared the PCR performance of six direct PCR-type DNA polymerases (KOD FX, Mighty Amp, Hemo KlenTaq, Phusion Blood II, KAPA Blood, and BIOTAQ in dried blood eluted from a filter paper with TE buffer. GoTaq Flexi was used as a standard DNA polymerase. PCR performance was evaluated by a nested PCR technique for detecting Plasmodium falciparum genomic DNA in the presence of the blood components. Although all six DNA polymerases showed resistance to blood components compared to the standard Taq polymerase, the KOD FX and BIOTAQ DNA polymerases were resistant to inhibitory blood components at concentrations of 40%, and their PCR performance was superior to that of other DNA polymerases. When the reaction mixture contained a mild detergent, only KOD FX DNA polymerase retained the original amount of amplified product. These results indicate that KOD FX DNA polymerase is the most resistant to inhibitory blood components and/or detergents. Thus, KOD FX DNA polymerase could be useful in serological studies to simultaneously detect antibodies and DNA in eluents for antibodies. KOD FX DNA polymerase is thus not limited to use in detecting malaria parasites, but could also be employed to detect other blood-borne pathogens.
The impact of making vaccines thermostable in Niger's vaccine supply chain.
Lee, Bruce Y; Cakouros, Brigid E; Assi, Tina-Marie; Connor, Diana L; Welling, Joel; Kone, Souleymane; Djibo, Ali; Wateska, Angela R; Pierre, Lionel; Brown, Shawn T
2012-08-17
Determine the effects on the vaccine cold chain of making different types of World Health Organization (WHO) Expanded Program on Immunizations (EPI) vaccines thermostable. Utilizing a detailed computational, discrete-event simulation model of the Niger vaccine supply chain, we simulated the impact of making different combinations of the six current EPI vaccines thermostable. Making any EPI vaccine thermostable relieved existing supply chain bottlenecks (especially at the lowest levels), increased vaccine availability of all EPI vaccines, and decreased cold storage and transport capacity utilization. By far, the most substantial impact came from making the pentavalent vaccine thermostable, increasing its own vaccine availability from 87% to 97% and the vaccine availabilities of all other remaining non-thermostable EPI vaccines to over 93%. By contrast, making each of the other vaccines thermostable had considerably less effect on the remaining vaccines, failing to increase the vaccine availabilities of other vaccines to more than 89%. Making tetanus toxoid vaccine along with the pentavalent thermostable further increased the vaccine availability of all EPI vaccines by at least 1-2%. Our study shows the potential benefits of making any of Niger's EPI vaccines thermostable and therefore supports further development of thermostable vaccines. Eliminating the need for refrigerators and freezers should not necessarily be the only benefit and goal of vaccine thermostability. Rather, making even a single vaccine (or some subset of the vaccines) thermostable could free up significant cold storage space for other vaccines, and thereby help alleviate supply chain bottlenecks that occur throughout the world. Copyright © 2012 Elsevier Ltd. All rights reserved.
RFLP for TaqI at the human tyrosinase locus
Energy Technology Data Exchange (ETDEWEB)
Spritz, R; Strunk, K; Oetting, W; King, R
1988-10-25
A 1.4-kb EcoRI-PstI fragment from the mouse tyrosinase cDNA plasmid pTyrs-33 containing virtually the complete coding sequences. TaqI identifies a two-allele polymorphism with fragments of either 2.8 kb or 2.4 kb that contain most of the tyrosinase coding region. Three weak (1.4 kb, 0.9 kb, and 0.6 kb) and two very weak (5.0 and 3.2 kb) constant bands are also seen. The human tyrosinase gene has been regionally mapped to 11q14->21, and a wealy cross-hybridizing tyrosinase-related sequence mapped to 11p11.2->cen. Co-dominant segregation has been shown in two families. The RFLP was observed under normal hybridization and wash conditions.
A TaqI RFLP identified at the retinoblastoma locus on chromosome 13
Energy Technology Data Exchange (ETDEWEB)
Shiang, R; Murray, J C [Univ. of Iowa, Iowa City (USA); Wiggs, J; Dryja, T [Massachusetts Eye and Ear Infirmary, Boston (USA)
1988-09-26
Probe D95HS0.5 is a 0.6 kb fragment subcloned into Bluescribe a pUC19 derivative from a bacterio phage library isolated by a cDNA probe of the retinoblastoma gene. The fragment is released with the enzymes HindIII and SaII. TaqI identifies a 2 allele polymorphism with a band at 2.1 kb and 1.8 kb with a frequency of 0.97 and 0.03 respectively. There are no constant bands. The probe was assigned to chromosome 13 using a linkage analysis with retinoblastoma. Co-dominant inheritance was shown in 3 CEPH pedigrees.
Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...
Zhang, X.; Liu, H.; Liu, P.; Peeters, B.P.H.; Zhao, C.; Kong, X.
2013-01-01
A reverse genetics system for thermostable Newcastle disease virus (NDV) is not currently available. In this study, we developed a reverse genetics system for the avirulent and thermostable NDV4-C strain. Successful recovery of NDV4-C was achieved by using either T7 RNA polymerase or cellular RNA
Thermostable enzymes as biocatalysts in the biofuel industry.
Yeoman, Carl J; Han, Yejun; Dodd, Dylan; Schroeder, Charles M; Mackie, Roderick I; Cann, Isaac K O
2010-01-01
Lignocellulose is the most abundant carbohydrate source in nature and represents an ideal renewable energy source. Thermostable enzymes that hydrolyze lignocellulose to its component sugars have significant advantages for improving the conversion rate of biomass over their mesophilic counterparts. We review here the recent literature on the development and use of thermostable enzymes for the depolymerization of lignocellulosic feedstocks for biofuel production. Furthermore, we discuss the protein structure, mechanisms of thermostability, and specific strategies that can be used to improve the thermal stability of lignocellulosic biocatalysts. Copyright 2010 Elsevier Inc. All rights reserved.
The Impact of Making Vaccines Thermostable in Niger’s Vaccine Supply Chain
Lee, Bruce Y.; Cakouros, Brigid E.; Assi, Tina-Marie; Connor, Diana L.; Welling, Joel; Kone, Souleymane; Djibo, Ali; Wateska, Angela R.; Pierre, Lionel; Brown, Shawn T.
2012-01-01
Objective Determine the effects on the vaccine cold chain of making different types of World Health Organization (WHO) Expanded Program on Immunizations (EPI) vaccines thermostable. Methods Utilizing a detailed computational, discrete-event simulation model of the Niger vaccine supply chain, we simulated the impact of making different combinations of the six current EPI vaccines thermostable. Findings Making any EPI vaccine thermostable relieved existing supply chain bottlenecks (especially at the lowest levels), increased vaccine availability of all EPI vaccines, and decreased cold storage and transport capacity utilization. By far, the most substantial impact came from making the pentavalent vaccine thermostable, increasing its own vaccine availability from 87% to 97% and the vaccine availabilities of all other remaining non-thermostable EPI vaccines to over 93%. By contrast, making each of the other vaccines thermostable had considerably less effect on the remaining vaccines, failing to increase the vaccine availabilities of other vaccines to more than 89%. Making tetanus toxoid vaccine along with the pentavalent thermostable further increased the vaccine availability of all EPI vaccines by at least 1–2%. Conclusion Our study shows the potential benefits of making any of Niger’s EPI vaccines thermostable and therefore supports further development of thermostable vaccines. Eliminating the need for refrigerators and freezers should not necessarily be the only benefit and goal of vaccine thermostability. Rather, making even a single vaccine (or some subset of the vaccines) thermostable could free up significant cold storage space for other vaccines, and thereby help alleviate supply chain bottlenecks that occur throughout the world. PMID:22789507
Directory of Open Access Journals (Sweden)
Jesús Salvador Velarde Félix
2009-02-01
Full Text Available OBJETIVO: Determinar la relación del polimorfismo TaqI del gen del receptor de la vitamina D (RVD con la lepra lepromatosa (LL en individuos originarios de Sinaloa, México. MATERIAL Y MÉTODOS: Se amplificó un fragmento de 740 pb del gen RVD en muestras de ADN de 71 pacientes con LL y 144 controles en el Hospital General de Culiacán durante el periodo 2004-2007. El polimorfismo se identificó mediante la endonucleasa TaqI. RESULTADOS: Se observó un aumento de relevancia estadística del genotipo TT en pacientes con LL en comparación con los controles (p= 0.040; RM= 1.82. CONCLUSIÓN: Se demuestra un nexo entre el genotipo TT y la susceptibilidad a la LL.OBJETIVE: To establish the association of the vitamin D receptor gene TaqI polymorphism with lepromatous leprosy (LL in individuals from Sinaloa, Mexico. MATERIAL AND METHODS: A 740 bp fragment was amplified from the VDR gene in DNA samples of 71 patients with LL and 144 controls in the Hospital General de Culiacán during 2004-2007. Polymorphism was identified through TaqI endonuclease. RESULTS: A significant increase in the genotype TT of the VDR gene was observed in patients when compared to controls (p = 0.040; OR = 1.82. CONCLUSIONS: Our data support the association between the TT genotype and susceptibility to LL in this Mexican population.
DNA polymorphism of HLA class II genes in systemic lupus erythematosus
DEFF Research Database (Denmark)
Cowland, J B; Andersen, V; Halberg, P
1994-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3......- and DRw6-associated 7.00 kb DRB TaqI DNA fragment was found in SLE patients compared to normal controls (83.3% vs 35.5%; RR = 9.1, p 1*0501-associated 4.56 kb DQA TaqI fragment and the DRB3*01/03-associated 9.79 kb TaqI fragment were also found to be significantly...... increased in SLE patients (70.8% vs 29.7%; RR = 5.8, p 1%; RR = 4.3, p
Kho, S L; Chua, K H; George, E; Tan, J A M A
2013-07-15
Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes
2017-02-07
Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.
Directory of Open Access Journals (Sweden)
Leila Mehdizadeh Fanid
2016-05-01
Full Text Available Background Attention deficit hyperactivity disorder (ADHD is a multi-factorial disorder that has defined by hyperactivity, impulsivity and attention deficits. Various neurotransmitters such as dopamine can play a role in its pathophysiology. The aim of this study was to examine the association of two common single nucleotide polymorphisms in DRD2 gene, Taq I A (T/C and Taq I B (G/A, with ADHA risk among Iranian-Azeri population. Materials and Methods A study of case–control association was performed with 89 samples with attention deficit hyperactivity disorder and 96 healthy subjects. Peripheral blood samples were used for Genomic DNA extraction by salting-out method. SNP genotyping was carried out by PCR-RFLP technique. The collected data were analyzed through javastant online statistics software, using Chi-square, with a significance level of 0.05. Results There was not a significant difference in the allele and genotype frequencies between ADHD and Taq1B polymorphism in cases and controls (P>0.05. In the Taq IA of DRD2 gene, TT homozygous dominants and CC homozygous recessives were more frequent in case group than in control group but significant difference was not observed (P>0.05. Also, T/C heterozygotes were more frequent among the control group than the case group, and difference was significant (P
Functional analysis of thermostable proteins involved in carbohydrate metabolism
Akerboom, A.P.
2007-01-01
Thermostable proteins can resist temperature stress whilst keeping their integrity and functionality. In many cases, thermostable proteins originate from hyperthermophilic microorganisms that thrive in extreme environments. These systems are generally located close to geothermal (volcanic) activity,
Directory of Open Access Journals (Sweden)
Yachun Su
2013-01-01
Full Text Available Sporisorium scitamineum is a fungal smut pathogen epidemic in sugarcane producing areas. Early detection and proper identification of the smut are an essential requirement in its management practice. In this study, we developed a TaqMan real-time PCR assay using specific primers (bEQ-F/bEQ-R and a TaqMan probe (bEQ-P which were designed based on the bE (b East mating type gene (Genbank Accession no. U61290.1. This method was more sensitive (a detection limit of 10 ag pbE DNA and 0.8 ng sugarcane genomic DNA than that of conventional PCR (10 fg and 100 ng, resp.. Reliability was demonstrated through the positive detection of samples collected from artificially inoculated sugarcane plantlets (FN40. This assay was capable of detecting the smut pathogen at the initial stage (12 h of infection and suitable for inspection of sugarcane pathogen-free seed cane and seedlings. Furthermore, quantification of pathogen was verified in pathogen-challenged buds in different sugarcane genotypes, which suggested its feasibility for evaluation of smut resistance in different sugarcane genotypes. Taken together, this novel assay can be used as a diagnostic tool for sensitive, accurate, fast, and quantitative detection of the smut pathogen especially for asymptomatic seed cane or plants and evaluation of smut resistance of sugarcane genotypes.
Carbonell, Pablo; Turpin, María C; Torres-Moreno, Daniel; Molina-Martínez, Irene; García-Solano, José; Perez-Guillermo, Miguel; Conesa-Zamora, Pablo
2011-09-01
The V600E mutation in the BRAF oncogene is associated with colorectal carcinomas, with mismatch-repair deficiency and, recently, with nonresponse to epidermal growth factor receptor inhibitor therapy. The use of reliable techniques for its detection is important. The aim of our study was to compare the performance characteristics in V600E detection of denaturing high-performance liquid chromatography (dHPLC) and high-resolution melting (HRM) with TaqMan allelic discrimination as well as direct-sequencing methods in a series of 195 colorectal paraffin-embedded specimens up to the age of 15 years. The effectiveness for obtaining results on mutation status was best using TaqMan (96.9%), followed by dHPLC (93.3%), HRM (88.7%), and sequencing (88.2%). In general, TaqMan was best for analyzing older tissues, whereas sequencing was the least efficient. Heterozygotic V600E was detected in 11.6%, 9.9%, 11.6%, and 9.9% of tissues using TaqMan, dHPLC, HRM, and sequencing, respectively. Result concordances between dHPLC and TaqMan or sequencing were excellent (κ = 0.9411 and κ = 0.8988, respectively); for HRM, the concordances were good (κ = 0.7973 and κ = 0.7488, respectively). By using DNA dilutions from tumor tissue, a minimum of 10% of V600E harboring cancer content was required for the analysis by dHPLC and HRM. dHPLC could detect four non-V600E mutations, whereas HRM detected one. Our results indicate that dHPLC and HRM are techniques that can be reliably used for the detection of the BRAFV600E mutation in archival paraffin-embedded tissues. Copyright © 2011 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
A TaqMan real-time PCR assay for detection of Meloidogyne hapla in root galls and in soil
DEFF Research Database (Denmark)
Sapkota, Rumakanta; Skantar, Andrea M.; Nicolaisen, Mogens
2016-01-01
. haplaand showed no significant amplification of DNA from non-target nematodes. The assay was able to detect M. haplain a background of plant and soil DNA. A dilution series of M. haplaeggs in soil showed a high correlation ( R 2 = 0 . 95 , P ...Early detection and quantification of Meloidogyne haplain soil is essential for effective disease management. The purpose of this study was to develop a real-time PCR assay for detection of M. haplain soil. Primers and a TaqMan probe were designed for M. hapladetection. The assay detected M......-knot development in carrots by testing soils before planting. The assay could be useful for management decisions in carrot cultivation....
Vallefuoco, L; Sorrentino, R; Spalletti Cernia, D; Colucci, G; Portella, G
2012-12-01
The cobas p 630, a fully automated pre-analytical instrument for primary tube handling recently introduced to complete the Cobas(®) TaqMan systems portfolio, was evaluated in conjunction with: the COBAS(®) AmpliPrep/COBAS(®) TaqMan HBV Test, v2.0, COBAS(®) AmpliPrep/COBAS(®) TaqMan HCV Test, v1.0 and COBAS(®) AmpliPrep/COBAS(®) TaqMan HIV Test, v2.0. The instrument performance in transferring samples from primary to secondary tubes, its impact in improving COBAS(®) AmpliPrep/COBAS(®) TaqMan workflow and hands-on reduction and the risk of possible cross-contamination were assessed. Samples from 42 HBsAg positive, 42 HCV and 42 HIV antibody (Ab) positive patients as well as 21 healthy blood donors were processed with or without automated primary tubes. HIV, HCV and HBsAg positive samples showed a correlation index of 0.999, 0.987 and of 0.994, respectively. To assess for cross-contamination, high titer HBV DNA positive samples, HCV RNA and HIV RNA positive samples were distributed in the cobas p 630 in alternate tube positions, adjacent to negative control samples within the same rack. None of the healthy donor samples showed any reactivity. Based on these results, the cobas p 630 can improve workflow and sample tracing in laboratories performing molecular tests, and reduce turnaround time, errors, and risks. Copyright © 2012 Elsevier B.V. All rights reserved.
Engineering of DNA polymerase I from Thermus thermophilus using compartmentalized self-replication.
Aye, Seaim Lwin; Fujiwara, Kei; Ueki, Asuka; Doi, Nobuhide
2018-05-05
Although compartmentalized self-replication (CSR) and compartmentalized partnered replication (CPR) are powerful tools for directed evolution of proteins and gene circuits, limitations remain in the emulsion PCR process with the wild-type Taq DNA polymerase used so far, including long run times, low amounts of product, and false negative results due to inhibitors. In this study, we developed a high-efficiency mutant of DNA polymerase I from Thermus thermophilus HB27 (Tth pol) suited for CSR and CPR. We modified the wild-type Tth pol by (i) deletion of the N-terminal 5' to 3' exonuclease domain, (ii) fusion with the DNA-binding protein Sso7d, (iii) introduction of four known effective point mutations from other DNA polymerase mutants, and (iv) codon optimization to reduce the GC content. Consequently, we obtained a mutant that provides higher product yields than the conventional Taq pol without decreased fidelity. Next, we performed four rounds of CSR selection with a randomly mutated library of this modified Tth pol and obtained mutants that provide higher product yields in fewer cycles of emulsion PCR than the parent Tth pol as well as the conventional Taq pol. Copyright © 2018 Elsevier Inc. All rights reserved.
Engineering Thermostable Microbial Xylanases Toward its Industrial Applications.
Kumar, Vishal; Dangi, Arun Kumar; Shukla, Pratyoosh
2018-03-01
Xylanases are one of the important hydrolytic enzymes which hydrolyze the β-1, 4 xylosidic linkage of the backbone of the xylan polymeric chain which consists of xylose subunits. Xylanases are mainly found in plant cell walls and are produced by several kinds of microorganisms such as fungi, bacteria, yeast, and some protozoans. The fungi are considered as most potent xylanase producers than that of yeast and bacteria. There is a broad series of industrial applications for the thermostable xylanase as an industrial enzyme. Thermostable xylanases have been used in a number of industries such as paper and pulp industry, biofuel industry, food and feed industry, textile industry, etc. The present review explores xylanase-substrate interactions using gene-editing tools toward the comprehension in improvement in industrial stability of xylanases. The various protein-engineering and metabolic-engineering methods have also been explored to improve operational stability of xylanase. Thermostable xylanases have also been used for improvement in animal feed nutritional value. Furthermore, they have been used directly in bakery and breweries, including a major use in paper and pulp industry as a biobleaching agent. This present review envisages some of such applications of thermostable xylanases for their bioengineering.
Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert
2013-01-01
The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...
A Laboratory-Developed TaqMan Array Card for Simultaneous Detection of 19 Enteropathogens
Liu, Jie; Gratz, Jean; Amour, Caroline; Kibiki, Gibson; Becker, Stephen; Janaki, Lalitha; Verweij, Jaco J.; Taniuchi, Mami; Sobuz, Shihab U.; Haque, Rashidul; Haverstick, Doris M.
2013-01-01
The TaqMan Array Card (TAC) system is a 384-well singleplex real-time PCR format that has been used to detect multiple infection targets. Here we developed an enteric TaqMan Array Card to detect 19 enteropathogens, including viruses (adenovirus, astrovirus, norovirus GII, rotavirus, and sapovirus), bacteria (Campylobacter jejuni/C. coli, Clostridium difficile, Salmonella, Vibrio cholerae, diarrheagenic Escherichia coli strains including enteroaggregative E. coli [EAEC], enterotoxigenic E. coli [ETEC], enteropathogenic E. coli [EPEC], and Shiga-toxigenic E. coli [STEC]), Shigella/enteroinvasive E. coli (EIEC), protozoa (Cryptosporidium, Giardia lamblia, and Entamoeba histolytica), and helminths (Ascaris lumbricoides and Trichuris trichiura), as well as two extrinsic controls to monitor extraction and amplification efficiency (the bacteriophage MS2 and phocine herpesvirus). Primers and probes were newly designed or adapted from published sources and spotted onto microfluidic cards. Fecal samples were spiked with extrinsic controls, and DNA and RNA were extracted using the QiaAmp Stool DNA minikit and the QuickGene RNA Tissue kit, respectively, and then mixed with Ag-Path-ID One Step real-time reverse transcription-PCR (RT-PCR) reagents and loaded into cards. PCR efficiencies were between 90% and 105%, with linearities of 0.988 to 1. The limit of detection of the assays in the TAC was within a 10-fold difference from the cognate assays performed on plates. Precision testing demonstrated a coefficient of variation of below 5% within a run and 14% between runs. Accuracy was evaluated for 109 selected clinical specimens and revealed an average sensitivity and specificity of 85% and 77%, respectively, compared with conventional methods (including microscopy, culture, and immunoassay) and 98% and 96%, respectively, compared with our laboratory-developed PCR-Luminex assays. This TAC allows fast, accurate, and quantitative detection of a broad spectrum of enteropathogens and
Prediction of Protein Thermostability by an Efficient Neural Network Approach
Directory of Open Access Journals (Sweden)
Jalal Rezaeenour
2016-10-01
Full Text Available Introduction: Manipulation of protein stability is important for understanding the principles that govern protein thermostability, both in basic research and industrial applications. Various data mining techniques exist for prediction of thermostable proteins. Furthermore, ANN methods have attracted significant attention for prediction of thermostability, because they constitute an appropriate approach to mapping the non-linear input-output relationships and massive parallel computing. Method: An Extreme Learning Machine (ELM was applied to estimate thermal behavior of 1289 proteins. In the proposed algorithm, the parameters of ELM were optimized using a Genetic Algorithm (GA, which tuned a set of input variables, hidden layer biases, and input weights, to and enhance the prediction performance. The method was executed on a set of amino acids, yielding a total of 613 protein features. A number of feature selection algorithms were used to build subsets of the features. A total of 1289 protein samples and 613 protein features were calculated from UniProt database to understand features contributing to the enzymes’ thermostability and find out the main features that influence this valuable characteristic. Results:At the primary structure level, Gln, Glu and polar were the features that mostly contributed to protein thermostability. At the secondary structure level, Helix_S, Coil, and charged_Coil were the most important features affecting protein thermostability. These results suggest that the thermostability of proteins is mainly associated with primary structural features of the protein. According to the results, the influence of primary structure on the thermostabilty of a protein was more important than that of the secondary structure. It is shown that prediction accuracy of ELM (mean square error can improve dramatically using GA with error rates RMSE=0.004 and MAPE=0.1003. Conclusion: The proposed approach for forecasting problem
Thermostable Carbonic Anhydrases in Biotechnological Applications
Directory of Open Access Journals (Sweden)
Anna Di Fiore
2015-07-01
Full Text Available Carbonic anhydrases are ubiquitous metallo-enzymes which catalyze the reversible hydration of carbon dioxide in bicarbonate ions and protons. Recent years have seen an increasing interest in the utilization of these enzymes in CO2 capture and storage processes. However, since this use is greatly limited by the harsh conditions required in these processes, the employment of thermostable enzymes, both those isolated by thermophilic organisms and those obtained by protein engineering techniques, represents an interesting possibility. In this review we will provide an extensive description of the thermostable carbonic anhydrases so far reported and the main processes in which these enzymes have found an application.
Thermostable cellulases, and mutants thereof, capable of hydrolyzing cellulose in ionic liquid
Sapra, Rajat; Datta, Supratim; Chen, Zhiwei; Holmes, Bradley M.; Simmons, Blake A.; Blanch, Harvey W.
2016-04-26
The present invention provides for a composition comprising an ionic liquid and a thermostable cellulose, and a method of hydrolyzing a cellulose, comprising: (a) providing a composition comprising a solution comprising an ionic liquid and a cellulose, and (b) introducing a thermostable cellulase to the solution, such that the cellulose is hydrolyzed by the cellulase. The present invention also provides for a Thermatoga maritima thermostable cellulase mutant with increased cellulase activity.
Yadav, Reena; Paria, Anutosh; Mankame, Smruti; Makesh, M; Chaudhari, Aparna; Rajendran, K V
2015-12-01
Hepatopancreatic parvovirus (HPV) infects Penaeus monodon and causes mortality in the larval stages. Further, it has been implicated in the growth retardation in cultured P. monodon. Though different geographical isolates of HPV show large sequence variations, a sensitive PCR assay specific to Indian isolate has not yet been reported. Here, we developed a sensitive SYBR Green-based and TaqMan real-time PCR for the detection and quantification of the virus. A 441-bp PCR amplicon was cloned in pTZ57 R/T vector and the plasmid copy number was estimated. A 10-fold serial dilution of the plasmid DNA from 1 × 10(9) copies to 1 copy was prepared and used as the standard. The primers were tested initially using the standard on a conventional PCR format to determine the linearity of detection. The standards were further tested on real-time PCR format using SYBR Green and TaqMan chemistry and standard curves were generated based on the Ct values from three well replicates for each dilution. The assays were found to be sensitive, specific and reproducible with a wide dynamic range (1 × 10(9) to 10 copies) with coefficient of regression (R(2)) > 0.99, calculated average slope -3.196 for SYBR Green assay whereas, for TaqMan assay it was >0.99 and -3.367, respectively. The intra- and inter-assay variance of the Ct values ranged from 0.26% to 0.94% and 0.12% to 0.81%, respectively, for SYBR Green assay, and the inter-assay variance of the Ct values for TaqMan assay ranged from 0.07% to 1.93%. The specificity of the assays was proved by testing other DNA viruses of shrimp such as WSSV, IHHNV and MBV. Standardized assays were further tested to detect and quantify HPV in the post-larvae of P. monodon. The result was further compared with conventional PCR to test the reproducibility of the test. The assay was also used to screen Litopeneaus vannamei, Macrobrachium rosenbergii and Scylla serrata for HPV. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Anuradha Balan
2012-01-01
Full Text Available Thermostable lipase from Geobacillus thermodenitrificans IBRL-nra was purified and characterized. The production of thermostable lipase from Geobacillus thermodenitrificans IBRL-nra was carried out in a shake-flask system at 65°C in cultivation medium containing; glucose 1.0% (w/v; yeast extract 1.25% (w/v; NaCl 0.45% (w/v olive oil 0.1% (v/v with agitation of 200 rpm for 24 hours. The extracted extracellular crude thermostable lipase was purified to homogeneity by using ultrafiltration, Heparin-affinity chromatography, and Sephadex G-100 gel-filtration chromatography by 34 times with a final yield of 9%. The molecular weight of the purified enzyme was estimated to be 30 kDa after SDS-PAGE analysis. The optimal temperature for thermostable lipase was 65°C and it retained its initial activity for 3 hours. Thermostable lipase activity was highest at pH 7.0 and stable for 16 hours at this pH at 65°C. Thermostable lipase showed elevated activity when pretreated with BaCl2, CaCl2, and KCl with 112%, 108%, and 106%, respectively. Lipase hydrolyzed tripalmitin (C16 and olive oil with optimal activity (100% compared to other substrates.
A Taq 1 polymorphism for the human platelet glycoprotein IIIa gene (GP3A)
Energy Technology Data Exchange (ETDEWEB)
Burk, C; Ingram, C; Weiner, M; Rappaport, E F; Schwartz, E; Poncz, M [Univ. of Pennsylvania School of Medicine, Philadelphia (USA)
1988-07-25
A cDNA clone containing a 4.0 kb GPIIIa insert was isolated from a human erythroleukemia (HEL) cell cDNA library. A 2.3 kb Eco RI fragment, representing the 5{prime} portion of this insert, was used as a probe for these Southern blot experiments. Taq I (T/CGA) identifies invariant bands of 5.0, 3.5, 1.3, 1.1, and 0.8 kb and a simple polymorphism with a band(s) at 8.0 kb or 4.8 and 3.2 kb. The frequency of the gene was studied in 17 persons (11 Caucasians, 3 Asians, and 3 blacks). The GPIIIa gene has been localized to the region 17q21{r arrow}22 by somatic cell hybrid and in situ hybridization studies. Mendelian inheritance was demonstrated in one family. The father is homozygous for the 8.0 kb band, and the mother is heterozygous for the 8.0/4.8 and 3.2 kb bands.
Thermostability of biological systems: fundamentals, challenges, and quantification.
He, Xiaoming
2011-01-01
This review examines the fundamentals and challenges in engineering/understanding the thermostability of biological systems over a wide temperature range (from the cryogenic to hyperthermic regimen). Applications of the bio-thermostability engineering to either destroy unwanted or stabilize useful biologicals for the treatment of diseases in modern medicine are first introduced. Studies on the biological responses to cryogenic and hyperthermic temperatures for the various applications are reviewed to understand the mechanism of thermal (both cryo and hyperthermic) injury and its quantification at the molecular, cellular and tissue/organ levels. Methods for quantifying the thermophysical processes of the various applications are then summarized accounting for the effect of blood perfusion, metabolism, water transport across cell plasma membrane, and phase transition (both equilibrium and non-equilibrium such as ice formation and glass transition) of water. The review concludes with a summary of the status quo and future perspectives in engineering the thermostability of biological systems.
Genomic DNA extraction from sapwood of Pinus roxburghii for ...
African Journals Online (AJOL)
Ashish
2013-02-22
Feb 22, 2013 ... A method for extraction of genomic DNA from sapwood tissues of mature tall trees of Pinus roxburghii, .... DNA as a template. PCR was performed on a thermal cycler. (Biorad, Mycycler) incorporating 10 ng genomic DNA to a 25 µl reaction mix containing 1X Taq buffer, 3 mM MgCl2, 0.2 mM each of dNTPs ...
Taranta, Andrzej; Tien Sy, Bui; Zacher, Behrend Johan; Rogalska-Taranta, Magdalena; Manns, Michael Peter; Bock, Claus Thomas; Wursthorn, Karsten
2014-08-01
Hepatitis B virus (HBV) replicates via reverse transcription converting its partially double stranded genome into the covalently closed circular DNA (cccDNA). The long-lasting cccDNA serves as a replication intermediate in the nuclei of hepatocytes. It is an excellent, though evasive, parameter for monitoring the course of liver disease and treatment efficiency. To develop and test a new approach for HBV DNA quantification in serum and small-size liver samples. The p3io plasmid contains an HBV fragment and human β-actin gene (hACTB) as a standard. Respective TaqMan probes were labeled with different fluorescent dyes. A triplex real-time PCR for simultaneous quantification of total HBV DNA, cccDNA and hACTB could be established. Three-in-one method allows simultaneous analysis of 3 targets with a lower limit of quantification of 48 copies per 20 μl PCR reaction and a wide range of linearity (R(2)>0.99, pDNA samples from HBV infected patients. Total HBV DNA and cccDNA could be quantified in 32 and 22 of 33 FFPE preserved liver specimens, respectively. Total HBV DNA concentrations quantified by the 3io method remained comparable with Cobas TaqMan HBV Test v2.0. The three-in-one protocol allows the single step quantification of viral DNA in samples from different sources. Therefore lower sample input, faster data acquisition, a lowered error and significantly lower costs are the advantages of the method. Copyright © 2014 Elsevier B.V. All rights reserved.
Taq I polymorphism in the 5' region of the von Willebrand Factor (vWF) gene
Energy Technology Data Exchange (ETDEWEB)
Lavergne, J M; Bahnak, B R; Assouline, Z; Pietu, G; Kerbiriou-Nabias, D; Meulien, P; Pavirani, A; Meyer, D
1988-03-25
pvWFIPC8 is a 2.28 Kb partial cDNA clone for human von Willebrand factor (vWF) isolated from a human lung cDNA library and inserted into the EcoRI site of pUC9. The sequence includes the last 1330 nucleotides that encode for vWF propeptide and 950 nucleotides that encode for mature vWF. Taq I (TCGA) identifies plural invariant bands and two variant bands with alleles at 2.3 (Al) and 1.0 (A2). The frequency was determined in 33 unrelated European and North American caucasians. The extreme 3' region of pvWFIPC8 corresponds to the 5' boundary of an area that could possibly hybridize with similar sequences on human chromosome 22. The 5' 1.74 Kb portion of pvWFIPC8 generated by Bam HI digestion that corresponds to sequences only on chromosome 12 also demonstrates the polymorphism. Co-dominant segregation was demonstrated in 6 families of 48 individuals.
Tubeleviciute, Agne; Skirgaila, Remigijus
2010-08-01
The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.
Development of a Rickettsia bellii-Specific TaqMan Assay Targeting the Citrate Synthase Gene.
Hecht, Joy A; Allerdice, Michelle E J; Krawczak, Felipe S; Labruna, Marcelo B; Paddock, Christopher D; Karpathy, Sandor E
2016-11-01
Rickettsia bellii is a rickettsial species of unknown pathogenicity that infects argasid and ixodid ticks throughout the Americas. Many molecular assays used to detect spotted fever group (SFG) Rickettsia species do not detect R. bellii, so that infection with this bacterium may be concealed in tick populations when assays are used that screen specifically for SFG rickettsiae. We describe the development and validation of a R. bellii-specific, quantitative, real-time PCR TaqMan assay that targets a segment of the citrate synthase (gltA) gene. The specificity of this assay was validated against a panel of DNA samples that included 26 species of Rickettsia, Orientia, Ehrlichia, Anaplasma, and Bartonella, five samples of tick and human DNA, and DNA from 20 isolates of R. bellii, including 11 from North America and nine from South America. A R. bellii control plasmid was constructed, and serial dilutions of the plasmid were used to determine the limit of detection of the assay to be one copy per 4 µl of template DNA. This assay can be used to better determine the role of R. bellii in the epidemiology of tick-borne rickettsioses in the Western Hemisphere. Published by Oxford University Press on behalf of Entomological Society of America 2016. This work is written by US Government employees and is in the public domain in the US.
Purification and Characterization of Thermostable Cellulase from ...
African Journals Online (AJOL)
Available online at http://www.tjpr.org ... Methods: Molecular community structure of the newly selected thermophilic bacterial ... Keywords: Thermostable cellulase, Sugarcane bagasse, Purification, Characterization, Hot spring ... Currently, one.
Thermostability in rubredoxin and its relationship to mechanical rigidity
Rader, A. J.
2010-03-01
The source of increased stability in proteins from organisms that thrive in extreme thermal environments is not well understood. Previous experimental and theoretical studies have suggested many different features possibly responsible for such thermostability. Many of these thermostabilizing mechanisms can be accounted for in terms of structural rigidity. Thus a plausible hypothesis accounting for this remarkable stability in thermophilic enzymes states that these enzymes have enhanced conformational rigidity at temperatures below their native, functioning temperature. Experimental evidence exists to both support and contradict this supposition. We computationally investigate the relationship between thermostability and rigidity using rubredoxin as a case study. The mechanical rigidity is calculated using atomic models of homologous rubredoxin structures from the hyperthermophile Pyrococcus furiosus and mesophile Clostridium pasteurianum using the FIRST software. A global increase in structural rigidity (equivalently a decrease in flexibility) corresponds to an increase in thermostability. Locally, rigidity differences (between mesophilic and thermophilic structures) agree with differences in protection factors.
Thermostability in rubredoxin and its relationship to mechanical rigidity
International Nuclear Information System (INIS)
Rader, A J
2010-01-01
The source of increased stability in proteins from organisms that thrive in extreme thermal environments is not well understood. Previous experimental and theoretical studies have suggested many different features possibly responsible for such thermostability. Many of these thermostabilizing mechanisms can be accounted for in terms of structural rigidity. Thus a plausible hypothesis accounting for this remarkable stability in thermophilic enzymes states that these enzymes have enhanced conformational rigidity at temperatures below their native, functioning temperature. Experimental evidence exists to both support and contradict this supposition. We computationally investigate the relationship between thermostability and rigidity using rubredoxin as a case study. The mechanical rigidity is calculated using atomic models of homologous rubredoxin structures from the hyperthermophile Pyrococcus furiosus and mesophile Clostridium pasteurianum using the FIRST software. A global increase in structural rigidity (equivalently a decrease in flexibility) corresponds to an increase in thermostability. Locally, rigidity differences (between mesophilic and thermophilic structures) agree with differences in protection factors
Thermostable endoglucanases in the liquefaction of hydrothermally pretreated wheat straw
Directory of Open Access Journals (Sweden)
Siika-aho Matti
2011-01-01
Full Text Available Abstract Background Thermostable enzymes have several benefits in lignocellulose processing. In particular, they potentially allow the use of increased substrate concentrations (because the substrate viscosity decreases as the temperature increases, resulting in improved product yields and reduced capital and processing costs. A short pre-hydrolysis step at an elevated temperature using thermostable enzymes aimed at rapid liquefaction of the feedstock is seen as an attractive way to overcome the technical problems (such as poor mixing and mass transfer properties connected with high initial solid loadings in the lignocellulose to ethanol process. Results The capability of novel thermostable enzymes to reduce the viscosity of high-solid biomass suspensions using a real-time viscometric measurement method was investigated. Heterologously expressed enzymes from various thermophilic organisms were compared for their ability to liquefy the lignocellulosic substrate, hydrothermally pretreated wheat straw. Once the best enzymes were identified, the optimal temperatures for these enzymes to decrease substrate viscosity were compared. The combined hydrolytic properties of the thermostable preparations were tested in hydrolysis experiments. The studied mixtures were primarily designed to have good liquefaction potential, and therefore contained an enhanced proportion of the key liquefying enzyme, EGII/Cel5A. Conclusions Endoglucanases were shown to have a superior ability to rapidly reduce the viscosity of the 15% (w/w; dry matter hydrothermally pretreated wheat straw. Based on temperature profiling studies, Thermoascus aurantiacus EGII/Cel5A was the most promising enzyme for biomass liquefaction. Even though they were not optimized for saccharification, many of the thermostable enzyme mixtures had superior hydrolytic properties compared with the commercial reference enzymes at 55°C.
Thermophilic growth and enzymatic thermostability are polyphyletic traits within Chaetomiaceae.
van den Brink, Joost; Facun, Kryss; de Vries, Michel; Stielow, J Benjamin
2015-12-01
Thermophilic fungi have the potential to produce industrial-relevant thermostable enzymes, in particular for the degradation of plant biomass. Sordariales is one of the few fungal orders containing several thermophilic taxa, of which many have been associated with the production of thermostable enzymes. The evolutionary affiliation of Sordariales fungi, especially between thermophiles and non-thermophilic relatives, is however poorly understood. Phylogenetic analysis within the current study was based on sequence data, derived from a traditional Sanger and highly multiplexed targeted next generation sequencing approach of 45 isolates. The inferred phylogeny and detailed growth analysis rendered the trait 'thermophily' as polyphyletic within Chaetomiaceae (Sordariales, Sordariomycetes), and characteristic to: Myceliophthora spp., Thielavia terrestris, Chaetomium thermophilum, and Mycothermus thermophilus. Compared to mesophiles, the isolates within thermophilic taxa produced enzyme mixtures with the highest thermostability of known cellulase activities. Temperature profiles of the enzyme activities correlated strongly with the optimal growth temperatures of the isolates but not with their phylogenetic relationships. This strong correlation between growth and enzyme characteristics indicated that detailed analysis of growth does give predictive information on enzyme physiology. The variation in growth and enzyme characteristics reveals these fungi as an excellent platform to better understand fungal thermophily and enzyme thermostability. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Influence of high temperature and ethanol on thermostable lignocellulolytic enzymes
DEFF Research Database (Denmark)
Skovgaard, Pernille Anastasia; Jørgensen, Henning
2013-01-01
the influence of temperature and ethanol on enzyme activity and stability in the distillation step, where most enzymes are inactivated due to high temperatures. Two enzyme mixtures, a mesophilic and a thermostable mixture, were exposed to typical process conditions [temperatures from 55 to 65 °C and up to 5...... % ethanol (w/v)] followed by specific enzyme activity analyses and SDS-PAGE. The thermostable and mesophilic mixture remained active at up to 65 and 55 °C, respectively. When the enzyme mixtures reached their maximum temperature limit, ethanol had a remarkable influence on enzyme activity, e.g., the more...... ethanol, the faster the inactivation. The reason could be the hydrophobic interaction of ethanol on the tertiary structure of the enzyme protein. The thermostable mixture was more tolerant to temperature and ethanol and could therefore be a potential candidate for recycling after distillation....
Restriction enzyme cleavage of ultraviolet-damaged Simian virus 40 and pBR322 DNA
International Nuclear Information System (INIS)
Cleaver, J.E.
1983-01-01
Cleavage of specific DNA sequences by the restriction enzymes EcoRI, HindIII and TaqI was prevented when the DNA was irradiated with ultraviolet light. Most of the effects were attributed to cyclobutane pyrimidine dimers in the recognition sequences; the effectiveness of irradiation was directly proportional to the number of potential dimer sites in the DNA. Combining EcoRI with dimer-specific endonuclease digestion revealed that pyrimidine dimers blocked cleavage within one base-pair on the strand opposite to the dimer but did not block cleavage three to four base-pairs away on the same strand. These are the probable limits for the range of influence of pyrimidine dimers along the DNA, at least for this enzyme. The effect of irradiation on cleavage by TaqI seemed far greater than expected for the cyclobutane dimer yield, possibly because of effects from photoproducts flanking the tetranucleotide recognition sequence and the effect of non-cyclobutane (6-4)pyrimidine photoproducts involving adjacent T and C bases. (author)
Optimization of medium composition for thermostable protease ...
African Journals Online (AJOL)
SERVER
2008-04-17
Apr 17, 2008 ... Optimization of the fermentation medium for maximization of thermostable neutral protease production by Bacillus sp. ..... Each contour curve represented an infinite number of combinations of two ..... Production in sea-water of.
Exogenous cellulases of thermophilic micromycetes. Pt. 2. Thermostability of enzyme preparations
Energy Technology Data Exchange (ETDEWEB)
Kvesitadze, G; Gogilashvili, L; Svanidze, R; Buachidze, T; Chirgadze, L; Nizharadze, D
1986-01-01
The ability of a large number of higher fungi to form extracellular cellulases is investigated. Some representatives of these fungi grow at 40-50/sup 0/C, and form extracellular cellulases exceeding cellulases of mesophilic fungi in thermostability. It is shown that cellulases of higher thermophilic fungi differ by their thermostability. The temperature optimum of cellulase action of higher fungi occurs within 60-62/sup 0/C.
Evaluation of thermostable enzymes for bioethanol processing
DEFF Research Database (Denmark)
Skovgaard, Pernille Anastasia
of fermentable sugars (glucose) as cellulose is tightly linked to hemicellulose and lignin. Lignocellulose is disrupted during pretreatment, but to degrade cellulose to single sugars, lignocellulolytic enzymes such as cellulases and hemicellulases are needed. Lignocellulolytic enzymes are costly...... for the ioethanol production, but the expenses can be reduced by using thermostable enzymes, which are known for their increased stability and inhibitor olerance. However, the advantage of using thermostable enzymes has not been studied thoroughly and more knowledge is needed for development of bioethanol processes....... Enzymes are added to the bioethanol process after pretreatment. For an efficient sugar and ethanol yield, the solids content of biomass is normally increased, which results in highly viscous slurries that are difficult to mix. Therefore, the first enzymatic challenge is to ensure rapid reduction...
Saha, Ratul; Donofrio, Robert S; Bagley, Susan T
2010-08-01
A TaqMan quantitative real-time polymerase chain reaction (qPCR) assay was developed for the detection and enumeration of three Pseudomonas species belonging to the mendocina sublineage (P. oleovorans, P. pseudoalcaligenes, and P. oleovorans subsp. lubricantis) found in contaminated metalworking fluids (MWFs). These microbes are the primary colonizers and serve as indicator organisms of biodegradation of used MWFs. Molecular techniques such as qPCR are preferred for the detection of these microbes since they grow poorly on typical growth media such as R2A agar and Pseudomonas isolation agar (PIA). Traditional culturing techniques not only underestimate the actual distribution of these bacteria but are also time-consuming. The primer-probe pair developed from gyrase B (gyrB) sequences of the targeted bacteria was highly sensitive and specific for the three species. qPCR was performed with both whole cell and genomic DNA to confirm the specificity and sensitivity of the assay. The sensitivity of the assay was 10(1) colony forming units (CFU)/ml for whole cell and 13.7 fg with genomic DNA. The primer-probe pair was successful in determining concentrations from used MWF samples, indicating levels between 2.9 x 10(3) and 3.9 x 10(6) CFU/ml. In contrast, the total count of Pseudomonas sp. recovered on PIA was in the range of <1.0 x 10(1) to 1.4 x 10(5) CFU/ml for the same samples. Based on these results from the qPCR assay, the designed TaqMan primer-probe pair can be efficiently used for rapid (within 2 h) determination of the distribution of these species of Pseudomonas in contaminated MWFs.
Sevcenco, Ana-Maria
2015-03-13
Oxo-anion binding properties of the thermostable enzyme ferritin from Pyrococcus furiosus were characterized with radiography. Radioisotopes 32P and 76As present as oxoanions were used to measure the extent and the rate of their absorption by the ferritin. Thermostable ferritin proved to be an excellent system for rapid phosphate and arsenate removal from aqueous solutions down to residual concentrations at the picomolar level. These very low concentrations make thermostable ferritin a potential tool to considerably mitigate industrial biofouling by phosphate limitation or to remove arsenate from drinking water.
Thermostable crude endoglucanase produced by Aspergillus ...
African Journals Online (AJOL)
Cellulases are used in many industries worldwide and there is an ever increasing need to isolate, produce or develop thermostable cellulases. Manipulation of fermentation techniques in order to obtain desirable product(s) can be one line of action. In this study Aspergillus fumigatus was grown on chopped wheat straw in a ...
Comparison of the thermostability of cellulases from various thermophilic fungi
Energy Technology Data Exchange (ETDEWEB)
Wojtczak, G; Breuil, C; Yamada, J; Saddler, J N
1987-10-01
The cellulase activities of six thermophilic fungi were compared. Although the thermophilic fungi grew at relatively high temperatures (> 45/sup 0/C) the optimum temperatures for assaying the various cellulase activities were only slightly higher than the optimum temperatures for the mesophilic fungi, Trichoderma harzianum. Over prolonged incubation (> 24 h) the thermophilic strains demonstrated a higher hydrolytic potential as a result of the greater thermostability of the cellulase components. Although the extracellular cellulase activities had similar pH and temperature optima, in some cases the thermostability of the extracellular components were considerably lower.
EIJSINK, VGH; VRIEND, G; VANDERVINNE, B; HAZES, B; VANDENBURG, B; VENEMA, G
1992-01-01
Variants of the thermolabile neutral protease (Npr) of B. subtilis (Npr-sub) and the thermostable neutral protease of B. stearothermophilus (Npr-ste) were produced by means of site-directed mutagenesis and the effects of the mutations on thermostability were determined. Mutations were designed to
Thermostability in endoglucanases is fold-specific
2011-01-01
Background Endoglucanases are usually considered to be synergistically involved in the initial stages of cellulose breakdown-an essential step in the bioprocessing of lignocellulosic plant materials into bioethanol. Despite their economic importance, we currently lack a basic understanding of how some endoglucanases can sustain their ability to function at elevated temperatures required for bioprocessing, while others cannot. In this study, we present a detailed comparative analysis of both thermophilic and mesophilic endoglucanases in order to gain insights into origins of thermostability. We analyzed the sequences and structures for sets of endoglucanase proteins drawn from the Carbohydrate-Active enZymes (CAZy) database. Results Our results demonstrate that thermophilic endoglucanases and their mesophilic counterparts differ significantly in their amino acid compositions. Strikingly, these compositional differences are specific to protein folds and enzyme families, and lead to differences in intramolecular interactions in a fold-dependent fashion. Conclusions Here, we provide fold-specific guidelines to control thermostability in endoglucanases that will aid in making production of biofuels from plant biomass more efficient. PMID:21291533
Thermostability in endoglucanases is fold-specific
Directory of Open Access Journals (Sweden)
Wolt Jeffrey D
2011-02-01
Full Text Available Abstract Background Endoglucanases are usually considered to be synergistically involved in the initial stages of cellulose breakdown-an essential step in the bioprocessing of lignocellulosic plant materials into bioethanol. Despite their economic importance, we currently lack a basic understanding of how some endoglucanases can sustain their ability to function at elevated temperatures required for bioprocessing, while others cannot. In this study, we present a detailed comparative analysis of both thermophilic and mesophilic endoglucanases in order to gain insights into origins of thermostability. We analyzed the sequences and structures for sets of endoglucanase proteins drawn from the Carbohydrate-Active enZymes (CAZy database. Results Our results demonstrate that thermophilic endoglucanases and their mesophilic counterparts differ significantly in their amino acid compositions. Strikingly, these compositional differences are specific to protein folds and enzyme families, and lead to differences in intramolecular interactions in a fold-dependent fashion. Conclusions Here, we provide fold-specific guidelines to control thermostability in endoglucanases that will aid in making production of biofuels from plant biomass more efficient.
Association between vitamin D receptor gene polymorphism (TaqI)
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...
Association between vitamin D receptor gene polymorphism (TaqI ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 94; Issue 3. Association between vitamin D receptor gene polymorphism (TaqI) and obesity in Chinese population. Hui-Ru Fan Li-Qun Lin Hao Ma Ying Li Chang-Hao Sun. Research Note Volume 94 Issue 3 September 2015 pp 473-478 ...
Institute of Scientific and Technical Information of China (English)
周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛
2011-01-01
The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.
Liu, Yang; Cathcart, Andrea L; Delaney, William E; Kitrinos, Kathryn M
2017-11-01
The COBAS TaqMan assay has a lower limit of quantification (LLOQ) of 169 HBV copies/mL and a lower limit of detection (LLOD) of 58 copies/mL. HBV DNA below the TaqMan LLOQ is classified as target not detected (TND) (HBV DNA to 8 copies/mL. HBV DNA levels in plasma from patients with or without HBsAg seroconversion were assessed by ddPCR. For patients who did not achieve HBsAg seroconversion, the majority of TD samples (33/58, 57%) were HBV DNA positive by ddPCR while (10/37, 27%) of TND samples were positive. In contrast, for patients who achieved HBsAg seroconversion, HBV DNA was rarely detected by ddPCR after HBsAg seroconversion (1/28, 3.6%). ddPCR is a sensitive method to evaluate low-level viral replication in plasma samples. Frequent detection of HBV DNA by ddPCR among patients who did not achieve HBsAg seroconversion suggests new agents may be needed to suppress low levels of replicating HBV. Copyright © 2017. Published by Elsevier B.V.
A nuclear DNA-based species determination and DNA quantification assay for common poultry species.
Ng, J; Satkoski, J; Premasuthan, A; Kanthaswamy, S
2014-12-01
DNA testing for food authentication and quality control requires sensitive species-specific quantification of nuclear DNA from complex and unknown biological sources. We have developed a multiplex assay based on TaqMan® real-time quantitative PCR (qPCR) for species-specific detection and quantification of chicken (Gallus gallus), duck (Anas platyrhynchos), and turkey (Meleagris gallopavo) nuclear DNA. The multiplex assay is able to accurately detect very low quantities of species-specific DNA from single or multispecies sample mixtures; its minimum effective quantification range is 5 to 50 pg of starting DNA material. In addition to its use in food fraudulence cases, we have validated the assay using simulated forensic sample conditions to demonstrate its utility in forensic investigations. Despite treatment with potent inhibitors such as hematin and humic acid, and degradation of template DNA by DNase, the assay was still able to robustly detect and quantify DNA from each of the three poultry species in mixed samples. The efficient species determination and accurate DNA quantification will help reduce fraudulent food labeling and facilitate downstream DNA analysis for genetic identification and traceability.
Purification and Characterization of Thermostable Cellulase from ...
African Journals Online (AJOL)
The thermostable CMCase was purified with ion-exchange and gel filtration chromatography. Results: ... Conclusion: Due to its high temperature stability, the purified XM70-CMCase may be useful for industrial application such as biofuel, animal feed industry, paper industry and clarification of fruit juices. Keywords: ...
Directory of Open Access Journals (Sweden)
Jeni Vuong
Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.
Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.
André, P; Kim, A; Khrapko, K; Thilly, W G
1997-08-01
The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.
Karp, Christopher L; Lans, Deborah; Esparza, José; Edson, Eleanore B; Owen, Katey E; Wilson, Christopher B; Heaton, Penny M; Levine, Orin S; Rao, Raja
2015-07-09
The need to keep vaccines cold in the face of high ambient temperatures and unreliable access to electricity is a challenge that limits vaccine coverage in low and middle-income countries (LMICs). Greater vaccine thermostability is generally touted as the obvious solution. Despite conventional wisdom, comprehensive analysis of the value proposition for increasing vaccine thermostability has been lacking. Further, while significant investments have been made in increasing vaccine thermostability in recent years, no vaccine products have been commercialized as a result. We analyzed the value proposition for increasing vaccine thermostability, grounding the analysis in specific vaccine use cases (e.g., use in routine immunization [RI] programs, or in campaigns) and in the broader context of cold chain technology and country level supply chain system design. The results were often surprising. For example, cold chain costs actually represent a relatively small fraction of total vaccine delivery system costs. Further, there are critical, vaccine use case-specific temporal thresholds that need to be overcome for significant benefits to be reaped from increasing vaccine thermostability. We present a number of recommendations deriving from this analysis that suggest a rational path toward unlocking the value (maximizing coverage, minimizing total system costs) of increased vaccine thermostability, including: (1) the full range of thermostability of existing vaccines should be defined and included in their labels; (2) for new vaccines, thermostability goals should be addressed up-front at the level of the target product profile; (3) improving cold chain infrastructure and supply chain system design is likely to have the largest impact on total system costs and coverage in the short term-and will influence the degree of thermostability required in the future; (4) in the long term, there remains value in monitoring the emergence of disruptive technologies that could remove the
Directory of Open Access Journals (Sweden)
Lei Jia
Full Text Available Thermostability issue of protein point mutations is a common occurrence in protein engineering. An application which predicts the thermostability of mutants can be helpful for guiding decision making process in protein design via mutagenesis. An in silico point mutation scanning method is frequently used to find "hot spots" in proteins for focused mutagenesis. ProTherm (http://gibk26.bio.kyutech.ac.jp/jouhou/Protherm/protherm.html is a public database that consists of thousands of protein mutants' experimentally measured thermostability. Two data sets based on two differently measured thermostability properties of protein single point mutations, namely the unfolding free energy change (ddG and melting temperature change (dTm were obtained from this database. Folding free energy change calculation from Rosetta, structural information of the point mutations as well as amino acid physical properties were obtained for building thermostability prediction models with informatics modeling tools. Five supervised machine learning methods (support vector machine, random forests, artificial neural network, naïve Bayes classifier, K nearest neighbor and partial least squares regression are used for building the prediction models. Binary and ternary classifications as well as regression models were built and evaluated. Data set redundancy and balancing, the reverse mutations technique, feature selection, and comparison to other published methods were discussed. Rosetta calculated folding free energy change ranked as the most influential features in all prediction models. Other descriptors also made significant contributions to increasing the accuracy of the prediction models.
Production of thermostable and organic solvent-tolerant alkaline ...
African Journals Online (AJOL)
An alkaliphilic bacterium producing organic solvent-tolerant and thermostable alkaline protease was isolated from poultry litter site and identified as Bacillus coagulans PSB-07. Protease production under different submerged fermentation conditions were investigated with the aim of optimizing yield of enzyme. B. coagulans ...
Structural characterization of the thermostable Bradyrhizobium japonicumD-sorbitol dehydrogenase.
Fredslund, Folmer; Otten, Harm; Gemperlein, Sabrina; Poulsen, Jens Christian N; Carius, Yvonne; Kohring, Gert Wieland; Lo Leggio, Leila
2016-11-01
Bradyrhizobium japonicum sorbitol dehydrogenase is NADH-dependent and is active at elevated temperatures. The best substrate is D-glucitol (a synonym for D-sorbitol), although L-glucitol is also accepted, giving it particular potential in industrial applications. Crystallization led to a hexagonal crystal form, with crystals diffracting to 2.9 Å resolution. In attempts to phase the data, a molecular-replacement solution based upon PDB entry 4nbu (33% identical in sequence to the target) was found. The solution contained one molecule in the asymmetric unit, but a tetramer similar to that found in other short-chain dehydrogenases, including the search model, could be reconstructed by applying crystallographic symmetry operations. The active site contains electron density consistent with D-glucitol and phosphate, but there was not clear evidence for the binding of NADH. In a search for the features that determine the thermostability of the enzyme, the T m for the orthologue from Rhodobacter sphaeroides, for which the structure was already known, was also determined, and this enzyme proved to be considerably less thermostable. A continuous β-sheet is formed between two monomers in the tetramer of the B. japonicum enzyme, a feature not generally shared by short-chain dehydrogenases, and which may contribute to thermostability, as may an increased Pro/Gly ratio.
Tang, Zizhong; Jin, Weiqiong; Sun, Rong; Liao, Yan; Zhen, Tianrun; Chen, Hui; Wu, Qi; Gou, Lin; Li, Chenlei
2018-01-01
We previously constructed three recombinant phyA mutant strains (PP-NP m -8, PP-NP ep -6A and I44E/T252R-PhyA), showing improved catalytic efficiency or thermostability of Aspergillus niger N25 phytase, by error-prone PCR or site-directed mutagenesis. In this study, directed evolution and site-directed mutagenesis were further applied to improve the modified phytase properties. After one-round error-prone PCR for phytase gene of PP-NP ep -6A, a single transformant, T195L/Q368E/F376Y, was obtained with the significant improvements in catalytic efficiency and thermostability. The phytase gene of T195L/Q368E/F376Y, combined with the previous mutant phytase genes of PP-NP ep -6A, PP-NP m -8 and I44E/T252R-PhyA, was then sequentially modified by DNA shuffling. Three genetically engineered strains with desirable properties were then obtained, namedQ172R, Q172R/K432R andQ368E/K432R. Among them, Q172R/K432R showed the highest thermostability with the longest half-life and the greatest remaining phytase activity after heat treatment, while Q368E/K432R showed the highest catalytic activity. Five substitutions (Q172R, T195L, Q368E, F376Y, K432R) identified from random mutagenesis were added sequentially to the phytase gene of PP-NP ep -6A to investigate how the mutant sites influence the properties of phytase. Characterization and structural analysis demonstrated that these mutations could produce cumulative or synergistic improvements in thermostability or catalytic efficiency of phytase. Copyright © 2017 Elsevier Inc. All rights reserved.
[Effect of BSA on random amplified polymorphic DNA (RAPD) in plants].
Bian, Cai-Miao; Li, Jun-Min; Jin, Ze-Xin; Ge, Ming-Ju
2002-05-01
Using Metasequoia glyptostroboides and Heptacodium miconioides DNA as templates,the effect of bovine serum albumin (BSA) on RAPD in plants was studied. The results showed that suitable concentrations of BSA used in Metasequoia glyptostroboides and Heptacodium miconioides RAPD were different, which were 0.6 microg/microl and 1 microg/microl, respectively. The inhibition of acetylated BSA on the amplification of plant RAPD could be relieved by BSA. BSA could reduce the dosage of Taq DNA polymerase.
A novel non-thermostable deuterolysin from Aspergillus oryzae.
Maeda, Hiroshi; Katase, Toru; Sakai, Daisuke; Takeuchi, Michio; Kusumoto, Ken-Ichi; Amano, Hitoshi; Ishida, Hiroki; Abe, Keietsu; Yamagata, Youhei
2016-09-01
Three putative deuterolysin (EC 3.4.24.29) genes (deuA, deuB, and deuC) were found in the Aspergillus oryzae genome database ( http://www.bio.nite.go.jp/dogan/project/view/AO ). One of these genes, deuA, was corresponding to NpII gene, previously reported. DeuA and DeuB were overexpressed by recombinant A. oryzae and were purified. The degradation profiles against protein substrates of both enzymes were similar, but DeuB showed wider substrate specificity against peptidyl MCA-substrates compared with DeuA. Enzymatic profiles of DeuB except for thermostability also resembled those of DeuA. DeuB was inactivated by heat treatment above 80° C, different from thermostable DeuA. Transcription analysis in wild type A. oryzae showed only deuB was expressed in liquid culture, and the addition of the proteinous substrate upregulated the transcription. Furthermore, the NaNO3 addition seems to eliminate the effect of proteinous substrate for the transcription of deuB.
CYP2D7 sequence variation interferes with TaqMan CYP2D6*15 and *35 genotyping
Directory of Open Access Journals (Sweden)
Amanda K Riffel
2016-01-01
Full Text Available TaqMan™ genotyping assays are widely used to genotype CYP2D6, which encodes a major drug metabolizing enzyme. Assay design for CYP2D6 can be challenging owing to the presence of two pseudogenes, CYP2D7 and CYP2D8, structural and copy number variation and numerous single nucleotide polymorphisms (SNPs some of which reflect the wild-type sequence of the CYP2D7 pseudogene. The aim of this study was to identify the mechanism causing false positive CYP2D6*15 calls and remediate those by redesigning and validating alternative TaqMan genotype assays. Among 13,866 DNA samples genotyped by the CompanionDx® lab on the OpenArray platform, 70 samples were identified as heterozygotes for 137Tins, the key SNP of CYP2D6*15. However, only 15 samples were confirmed when tested with the Luminex xTAG CYP2D6 Kit and sequencing of CYP2D6-specific long range (XL-PCR products. Genotype and gene resequencing of CYP2D6 and CYP2D7-specific XL-PCR products revealed a CC>GT dinucleotide SNP in exon 1 of CYP2D7 that reverts the sequence to CYP2D6 and allows a TaqMan assay PCR primer to bind. Because CYP2D7 also carries a Tins, a false-positive mutation signal is generated. This CYP2D7 SNP was also responsible for generating false-positive signals for rs769258 (CYP2D6*35 which is also located in exon 1. Although alternative CYP2D6*15 and *35 assays resolved the issue, we discovered a novel CYP2D6*15 subvariant in one sample that carries additional SNPs preventing detection with the alternate assay. The frequency of CYP2D6*15 was 0.1% in this ethnically diverse U.S. population sample. In addition, we also discovered linkage between the CYP2D7 CC>GT dinucleotide SNP and the 77G>A (rs28371696 SNP of CYP2D6*43. The frequency of this tentatively functional allele was 0.2%. Taken together, these findings emphasize that regardless of how careful genotyping assays are designed and evaluated before being commercially marketed, rare or unknown SNPs underneath primer and/or probe
Structure of a thermostable serralysin from Serratia sp. FS14 at 1.1 Å resolution.
Wu, Dongxia; Ran, Tinting; Wang, Weiwu; Xu, Dongqing
2016-01-01
Serralysin is a well studied metalloprotease, and typical serralysins are not thermostable. The serralysin isolated from Serratia sp. FS14 was found to be thermostable, and in order to reveal the mechanism responsible for its thermostability, the crystal structure of serralysin from Serratia sp. FS14 was solved to a crystallographic R factor of 0.1619 at 1.10 Å resolution. Similar to its homologues, it mainly consists of two domains: an N-terminal catalytic domain and a `parallel β-roll' C-terminal domain. Comparative studies show that the shape of the catalytic active-site cavity is more open owing to the 189-198 loop, with a short 310-helix protruding further from the molecular surface, and that the β-sheets comprising the `parallel β-roll' are longer than those in its homologues. The formation of hydrogen bonds from one of the nonconserved residues (Asn200) to Lys27 may contribute to the thermostability.
Highly thermostable fluorescent proteins
Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM
2011-03-22
Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to 99.degree. C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to 80.degree. C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.
Thermostable Alginate degrading enzymes and their methods of use
Hreggvidsson, Gudmundur Oli; Jonsson, Oskar W.J.; Bjornsdottir, Bryndis; Fridjonsson, Hedinn O; Altenbuchner, Josef; Watzlawick, Hildegard; Dobruchowska, Justyna; Kamerling, Johannis
2015-01-01
The present invention relates to the identification, production and use of thermostable alginate lyase enzymes that can be used to partially degrade alginate to yield oligosaccharides or to give complete degradation of alginate to yield (unsaturated) mono-uronates.
Directory of Open Access Journals (Sweden)
Aditya eBhalla
2015-06-01
Full Text Available AbstractEfficient enzymatic hydrolysis of lignocellulose to fermentable sugars requires a complete repertoire of biomass deconstruction enzymes. Hemicellulases play an important role in hydrolyzing hemicellulose component of lignocellulose to xylo-oligosaccharides and xylose. Thermostable xylanases have been a focus of attention as industrially important enzymes due to their long shelf life at high temperatures. Geobacillus sp. strain WSUCF1 produced thermostable xylanase activity (crude xylanase cocktail when grown on xylan or various inexpensive untreated and pretreated lignocellulosic biomasses such as prairie cord grass and corn stover. The optimum pH and temperature for the crude xylanase cocktail were 6.5 and 70ºC, respectively. The WSUCF1 crude xylanase was found to be highly thermostable with half-lives of 18 and 12 days at 60 and 70ºC, respectively. At 70ºC, rates of xylan hydrolysis were also found to be better with the WSUCF1 secretome than those with commercial enzymes, i.e., for WSUCF1 crude xylanase, CellicHTec2, and AccelleraseXY, the percent xylan conversions were 68.9, 49.4, and 28.92, respectively. To the best of our knowledge, WSUCF1 crude xylanase cocktail is among the most thermostable xylanases produced by thermophilic Geobacillus spp. and other thermophilic microbes (optimum growth temperature ≤70ºC. High thermostability, activity over wide range of temperatures, and better xylan hydrolysis than commercial enzymes make WSUCF1 crude xylanase suitable for thermophilic lignocellulose bioconversion processes.
Thermostable Subunit Vaccines for Pulmonary Delivery: How Close Are We?
DEFF Research Database (Denmark)
Foged, Camilla
2016-01-01
, such as influenza, tuberculosis, and Ebola, for which no good universal vaccines exist. At least two pharmaceutical improvements are expected to help filling this gap: i) The development of thermostable vaccine dosage forms, and ii) the full exploitation of the adjuvant technology for subunit vaccines to potentiate...... strong immune responses. This review highlights the status and recent advances in formulation and pulmonary delivery of thermostable human subunit vaccines. Such vaccines are very appealing from compliance, distribution and immunological point of view: Being non-invasive, inhalable vaccines are self...... immunity. Here, I review state of the art and perspectives in formulation design and processing methods for powder-based subunit vaccines intended for pulmonary administration, and present dry powder inhaler technologies suitable for translating these vaccines into clinical trials....
DEFF Research Database (Denmark)
Zweig, Maria; Schork, Sabine; Koerdt, Andrea
2014-01-01
plays an important role in biofilm formation. Many clinical isolates contain a gonococcal genetic island that encodes a type IV secretion system (T4SS). The T4SS of N. gonorrhoeae strain MS11 secretes ssDNA directly into the medium. Biofilm formation, studied in continuous flow‐chamber systems...... was developed in which thermostable fluorescently labelled ssDNA‐ and ss/dsDNA‐binding proteins were used to visualize ssDNA and total DNA in biofilms and planktonic cultures. Remarkably, mainly dsDNA was detected in biofilms of the ssDNA secreting strain. We conclude that the secreted ssDNA facilitates initial...
Approaches for improving thermostability characteristics in cellulases.
Anbar, Michael; Bayer, Edward A
2012-01-01
Many efforts have been invested to reduce the cost of biofuel production to substitute renewable sources of energy for fossil-based fuels. At the forefront of these efforts are the initiatives to convert plant-derived cellulosic material to biofuels. Although significant improvements have been achieved recently in cellulase engineering in both efficiency and cost reduction, complete degradation of lignocellulosic material still requires very long periods of time and high enzyme loads. Thermostable cellulases offer many advantages in the bioconversion process, which include increase in specific activity, higher levels of stability, inhibition of microbial growth, increase in mass transfer rate due to lower fluid viscosity, and greater flexibility in the bioprocess. Besides rational design methods, which require deep understanding of protein structure-function relationship, two of the major methods for improvement in specific cellulase properties are directed evolution and knowledge-based library design based on multiple sequence alignments. In this chapter, we provide protocols for constructing and screening of improved thermostable cellulases. Modifications of these protocols may also be used for screening for other improved properties of cellulases such as pH tolerance, high salt, and more. Copyright © 2012 Elsevier Inc. All rights reserved.
The GH10 endo-xylanase from Thermoascus aurantiacus CBMAI 756 (XynA) is industrially attractive due to its considerable thermostability and high specific activity. Considering the possibility of a further improvement in thermostability, eleven mutants were created in the present study via site-direc...
Understanding the Elementary Steps in DNA Tile-Based Self-Assembly.
Jiang, Shuoxing; Hong, Fan; Hu, Huiyu; Yan, Hao; Liu, Yan
2017-09-26
Although many models have been developed to guide the design and implementation of DNA tile-based self-assembly systems with increasing complexity, the fundamental assumptions of the models have not been thoroughly tested. To expand the quantitative understanding of DNA tile-based self-assembly and to test the fundamental assumptions of self-assembly models, we investigated DNA tile attachment to preformed "multi-tile" arrays in real time and obtained the thermodynamic and kinetic parameters of single tile attachment in various sticky end association scenarios. With more sticky ends, tile attachment becomes more thermostable with an approximately linear decrease in the free energy change (more negative). The total binding free energy of sticky ends is partially compromised by a sequence-independent energy penalty when tile attachment forms a constrained configuration: "loop". The minimal loop is a 2 × 2 tetramer (Loop4). The energy penalty of loops of 4, 6, and 8 tiles was analyzed with the independent loop model assuming no interloop tension, which is generalizable to arbitrary tile configurations. More sticky ends also contribute to a faster on-rate under isothermal conditions when nucleation is the rate-limiting step. Incorrect sticky end contributes to neither the thermostability nor the kinetics. The thermodynamic and kinetic parameters of DNA tile attachment elucidated here will contribute to the future improvement and optimization of tile assembly modeling, precise control of experimental conditions, and structural design for error-free self-assembly.
Kurek, Itzhak; Chang, Thom Kai; Bertain, Sean M; Madrigal, Alfredo; Liu, Lu; Lassner, Michael W; Zhu, Genhai
2007-10-01
Plant photosynthesis declines when the temperature exceeds its optimum range. Recent evidence indicates that the reduction in photosynthesis is linked to ribulose-1,5-bis-phosphate carboxylase/oxygenase (Rubisco) deactivation due to the inhibition of Rubisco activase (RCA) under moderately elevated temperatures. To test the hypothesis that thermostable RCA can improve photosynthesis under elevated temperatures, we used gene shuffling technology to generate several Arabidopsis thaliana RCA1 (short isoform) variants exhibiting improved thermostability. Wild-type RCA1 and selected thermostable RCA1 variants were introduced into an Arabidopsis RCA deletion (Deltarca) line. In a long-term growth test at either constant 26 degrees C or daily 4-h 30 degrees C exposure, the transgenic lines with the thermostable RCA1 variants exhibited higher photosynthetic rates, improved development patterns, higher biomass, and increased seed yields compared with the lines expressing wild-type RCA1 and a slight improvement compared with untransformed Arabidopsis plants. These results provide clear evidence that RCA is a major limiting factor in plant photosynthesis under moderately elevated temperatures and a potential target for genetic manipulation to improve crop plants productivity under heat stress conditions.
Expression of Acidothermus cellulolyticus thermostable cellulases in tobacco and rice plants
Directory of Open Access Journals (Sweden)
Xiran Jiang
2017-01-01
Full Text Available The production of cellulases in plants is an economical method for the conversion of lignocellulosic biomass into fuels. Herein we report the expressions of two thermostable Acidothermus cellulolyticus cellulases, endo-1,4-β-D-glucanase (E1 and exoglucanase (Gux1, in tobacco and rice. To evaluate the expression of these recombinant cellulases, we expressed the full-length E1, the catalytic domains of E1 (E1cd and Gux1 (Gux1cd, as well as an E1–Gux1cd fusion enzyme in various subcellular compartments. In the case of tobacco, transgenic plants that expressed apoplast-localized E1 showed the highest level of activity, about three times higher than those that expressed the cytosolic E1. In the case of rice, the level of cellulase-specific activity in the transgenic plants ranged from 11 to 20 nmol 4-methylumbelliferone min−1 mg−1 total soluble protein. The recombinant cellulases exhibited good thermostability below 70 °C. Furthermore, transgenic rice leaves that were stored at room temperature for a month lost about 20% of the initial cellulase activity. Taken together, the results suggested that heterologous expression of thermostable cellulases in plants may be a viable option for biomass conversion.
Hanapi, Wan Nurhidayah Wan; Iuan-Sheau, Chin; Mahadi, Nor Muhammad; Murad, Abdul Munir Abdul; Bakar, Farah Diba Abu
2015-09-01
Cutinase is an important biocatalyst for various industrial applications. This enzyme which has dual functionality comparable to esterases and lipases, is efficient in the hydrolysis of soluble esters and emulsified triacylglycerols. Naturally-occurring enzymes usually have disadvantages when applied in non-natural catalysis due to Glomerella cingulata cutinase enzyme thermostability. It is postulated that by increasing the rigidity at certain amino acid positions showing high mobility based on the three-dimensional structure of G. cingulata cutinase, the improvement in thermostability will be achieved. The amino acid N82 of G. cingulata cutinase was selected based on its high B-factor value determined via the B-FITTER program. Megaprimer PCR was employed to introduce mutations at the chosen site by randomization using NNK degenerate primers. About 300 transformants were selected for screening of positive cutinase variants. The N82_V14 cutinase variant was observed to be more thermostable at an almost 2-fold increase when exposed at 50°C for 1 hr as compared to the wild-type enzyme. This study may provide valuable information regarding thermal stability of cutinases denaturation at high temperatures.
Real-time PCR assays for hepatitis B virus DNA quantification may require two different targets.
Liu, Chao; Chang, Le; Jia, Tingting; Guo, Fei; Zhang, Lu; Ji, Huimin; Zhao, Junpeng; Wang, Lunan
2017-05-12
Quantification Hepatitis B virus (HBV) DNA plays a critical role in the management of chronic HBV infections. However, HBV is a DNA virus with high levels of genetic variation, and drug-resistant mutations have emerged with the use of antiviral drugs. If a mutation caused a sequence mismatched in the primer or probe of a commercial DNA quantification kit, this would lead to an underestimation of the viral load of the sample. The aim of this study was to determine whether commercial kits, which use only one pair of primers and a single probe, accurately quantify the HBV DNA levels and to develop an improved duplex real-time PCR assay. We developed a new duplex real-time PCR assay that used two pairs of primers and two probes based on the conserved S and C regions of the HBV genome. We performed HBV DNA quantitative detection of HBV samples and compared the results of our duplex real-time PCR assays with the COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. The target region of the discordant sample was amplified, sequenced, and validated using plasmid. The results of the duplex real-time PCR were in good accordance with the commercial COBAS TaqMan HBV Test version 2 and Daan real-time PCR assays. We showed that two samples from Chinese HBV infections underestimated viral loads when quantified by the Roche kit because of a mismatch between the viral sequence and the reverse primer of the Roche kit. The HBV DNA levels of six samples were undervalued by duplex real-time PCR assays of the C region because of mutations in the primer of C region. We developed a new duplex real-time PCR assay, and the results of this assay were similar to the results of commercial kits. The HBV DNA level could be undervalued when using the COBAS TaqMan HBV Test version 2 for Chinese HBV infections owing to a mismatch with the primer/probe. A duplex real-time PCR assay based on the S and C regions could solve this problem to some extent.
Molecular Dynamics Approach in Designing Thermostable Aspergillus niger Xylanase
Malau, N. D.; Sianturi, M.
2017-03-01
Molecular dynamics methods we have applied as a tool in designing thermostable Aspergillus niger Xylanase, by examining Root Mean Square Deviation (RMSD) and The Stability of the Secondary Structure of enzymes structure at its optimum temperature and compare with its high temperature behavior. As RMSD represents structural fluctuation at a particular temperature, a better understanding of this factor will suggest approaches to bioengineer these enzymes to enhance their thermostability. In this work molecular dynamic simulations of Aspergillus niger xylanase (ANX) have been carried at 400K (optimum catalytic temperature) for 2.5 ns and 500K (ANX reported inactive temperature) for 2.5 ns. Analysis have shown that the Root Mean Square Deviation (RMSD) significant increase at higher temperatures compared at optimum temperature and some of the secondary structures of ANX that have been damaged at high temperature. Structural analysis revealed that the fluctuations of the α-helix and β-sheet regions are larger at higher temperatures compared to the fluctuations at optimum temperature.
Development of a thermostable microneedle patch for influenza vaccination
Mistilis, Matthew; Bommarius, Andreas S; Prausnitz, Mark R.
2017-01-01
The goal of this study is to develop thermostable microneedle patch formulations for influenza vaccine that can be partially or completely removed from the cold chain. During vaccine drying associated with microneedle patch manufacturing, ammonium acetate and HEPES buffer salts stabilized influenza vaccine, surfactants had little effect during drying, drying temperature had weak effects on vaccine stability, and drying on polydimethylsiloxane led to increased stability compared to drying on stainless steel. A number of excipients, mostly polysaccharides and some amino acids, further stabilized the influenza vaccine during drying. Over longer time scales of storage, combinations of stabilizers preserved the most vaccine activity. Finally, dissolving microneedle patches formulated with arginine and calcium heptagluconate had no significant activity loss for all three strains of seasonal influenza vaccine during storage at room temperature for six months. We conclude that appropriately formulated microneedle patches can exhibit remarkable thermostability that could enable storage and distribution of influenza vaccine outside the cold chain. PMID:25448542
Schalasta, Gunnar; Börner, Anna; Speicher, Andrea; Enders, Martin
2018-03-28
Proper management of patients with chronic hepatitis B virus (HBV) infection requires monitoring of plasma or serum HBV DNA levels using a highly sensitive nucleic acid amplification test. Because commercially available assays differ in performance, we compared herein the performance of the Hologic Aptima HBV Quant assay (Aptima) to that of the Roche Cobas TaqMan HBV test for use with the high pure system (HPS/CTM). Assay performance was assessed using HBV reference panels as well as plasma and serum samples from chronically HBV-infected patients. Method correlation, analytical sensitivity, precision/reproducibility, linearity, bias and influence of genotype were evaluated. Data analysis was performed using linear regression, Deming correlation analysis and Bland-Altman analysis. Agreement between the assays for the two reference panels was good, with a difference in assay values vs. target 0.98). The two assays had similar bias and precision across the different genotypes tested at low viral loads (25-1000 IU/mL). Aptima has a performance comparable with that of HPS/CTM, making it suitable for use for HBV infection monitoring. Aptima runs on a fully automated platform (the Panther system) and therefore offers a significantly improved workflow compared with HPS/CTM.
Rodriguez, R.J.
1993-01-01
During the development of a procedure for the isolation of total genomic DNA from filamentous fungi (Rodriguez, R. J., and Yoder, 0. C., Exp. Mycol. 15, 232-242, 1991) a cell fraction was isolated which inhibited the digestion of DNA by restriction enzymes. After elimination of DNA, RNA, proteins, and lipids, the active compound was purified by gel filtration to yield a single fraction capable of complete inhibition of restriction enzyme activity. The inhibitor did not absorb uv light above 220 nm, and was resistant to alkali and acid at 25°C and to temperatures as high as 100°C. More extensive analyses demonstrated that the inhibitor was also capable of inhibiting T4 DNA ligase and TaqI DNA polymerase, but not DNase or RNase. Chemical analyses indicated that the inhibitor was devoid of carbohydrates, proteins, lipids, and nucleic acids but rich in phosphorus. A combination of nuclear magnetic resonance, metachromatic shift of toluidine blue, and gel filtration indicated that the inhibitor was a polyphosphate (polyP) containing approximately 60 phosphate molecules. The mechanism of inhibition appeared to involve complexing of polyP to the enzymatic proteins. All species of Colletotrichum analyzed produced polyP equivalent in chain length and concentration. A modification to the original DNA extraction procedure is described which eliminates polyP and reduces the time necessary to obtain DNA of sufficient purity for restriction enzyme digestion and TaqI polymerase amplification.
Ridge, Justin P; Dodd, Peter R
2009-10-01
Real-time RT-PCR normalized to GAPDH was used to assay N-methyl-D-aspartate (NMDA) receptor NR1, NR2A and NR2B subunit mRNA in human autopsy cortex tissue from chronic alcoholics with and without comorbid cirrhosis of the liver and matched controls. Subunit expression was influenced by the subject's genotype. The TaqIA polymorphism selectively modulated NMDA receptor mean transcript expression in cirrhotic-alcoholic superior frontal cortex, in diametrically opposite ways in male and female subjects. Genetic make-up may differentially influence vulnerability to brain damage by altering the excitation: inhibition balance, particularly in alcoholics with comorbid cirrhosis of the liver. The TaqIA polymorphism occurs within the poorly characterised ankyrin-repeat containing kinase 1 (ANKK1) gene. Using PCR, ANKK1 mRNA transcript was detected in inferior temporal, occipital, superior frontal and primary motor cortex of control human brain. ANKK1 expression may mediate the influence of the TaqIA polymorphism on phenotype.
Sheng, Jun; Ji, Xiaofeng; Zheng, Yuan; Wang, Zhipeng; Sun, Mi
2016-10-01
To determine the effects of artificial disulfide bridges on the thermostability and catalytic efficiency of chitosanase EAG1. Five artificial disulfide bridges were designed based on the structural information derived from the three-dimensional (3-D) model of chitosanase EAG1. Two beneficial mutants (G113C/D116C, A207C-L286C) were located in the flexible surface loop region, whereas the similar substitutions introduced in α-helices regions had a negligible effect. Mut5, the most active mutant, had a longer half-life at 50 °C (from 10.5 to 69.3 min) and a 200 % higher catalytic efficiency (K cat/K m) than that of the original EAG1. The contribution of disulfide bridges to enzyme thermostability is mainly dependent on its location within the polypeptide chain. Strategical placement of a disulfide bridge in flexible regions provides a rigid support and creation of a protected microenvironment, which is effective in improving enzyme's thermostability and catalytic efficiency.
Directory of Open Access Journals (Sweden)
Paulo B. Chaves
2006-01-01
Full Text Available The muriqui (Brachyteles is one of the most endangered primates in the world, however little is known about the viability of the remaining populations. We evaluated the technique of extracting DNA from wild muriqui feces for PCR applications. In order to determine the effect of the DNA in subsequent amplifications, we analyzed five different extracts. The importance of the recommended BSA and the HotStarTaq DNA polymerase was tested. The minimal conditions to successfully amplify highly degraded fecal DNA were determined, showing that the recommended reagents are not required. We envision that this method may be useful in further conservation management studies.
Kurek, Itzhak; Chang, Thom Kai; Bertain, Sean M.; Madrigal, Alfredo; Liu, Lu; Lassner, Michael W.; Zhu, Genhai
2007-01-01
Plant photosynthesis declines when the temperature exceeds its optimum range. Recent evidence indicates that the reduction in photosynthesis is linked to ribulose-1,5-bis-phosphate carboxylase/oxygenase (Rubisco) deactivation due to the inhibition of Rubisco activase (RCA) under moderately elevated temperatures. To test the hypothesis that thermostable RCA can improve photosynthesis under elevated temperatures, we used gene shuffling technology to generate several Arabidopsis thaliana RCA1 (short isoform) variants exhibiting improved thermostability. Wild-type RCA1 and selected thermostable RCA1 variants were introduced into an Arabidopsis RCA deletion (Δrca) line. In a long-term growth test at either constant 26°C or daily 4-h 30°C exposure, the transgenic lines with the thermostable RCA1 variants exhibited higher photosynthetic rates, improved development patterns, higher biomass, and increased seed yields compared with the lines expressing wild-type RCA1 and a slight improvement compared with untransformed Arabidopsis plants. These results provide clear evidence that RCA is a major limiting factor in plant photosynthesis under moderately elevated temperatures and a potential target for genetic manipulation to improve crop plants productivity under heat stress conditions. PMID:17933901
[Microcalorimetric study of the effect of mitoxantrone on chromatin DNA in vivo].
Monaselidze, D R; Kalandadze, Ia L; Khachidze, D G; Topuridze, I
1994-01-01
The influence of antitumor drugs--mitocsantron on the chromatine of tumor cells spleen tissue of BALB/c-mice has been established. Two-stage denaturation process of chromatine in normal cells has been shown. The first stage--thermolabel domain can be described by the following transition parameters: Td1 = 72, delta Td1 = 6.2 degrees C, Qd1 = 36.5 J/g DNA; the second one-thermostable domain by Td2 = 83, delta Td2 = 9.0 degrees C kappa Qd2 = 58 J/g DNA.
Directory of Open Access Journals (Sweden)
Widya Paramita Lokapirnasari
2017-04-01
Full Text Available This study aimed to identified cellulolytic inoculant code WPL 214 isolated from bovine rumen fluid waste of Ongole Cross Breed of Surabaya Slaughter house. A single colony of isolates celulolytic grown on 5 mL of liquid media Luria Bertani (LB consist of 1 % NaCl , 1% tripton , 0.5 % yeast extract, containing1 % carboxymethyl cellulose (CMC at temperature 37°C, using a shaker of incubator during 16-18 hours. That isolate determined by 16S DNA gen analysis using High Fidelity Platinum Taq DNA Polymerase with primer forward PB36 5’-AGR GTT TGA TCM TGG CTC AG-3’ and primer reverse PB38 5’-GMT ACCTTG TTA CGA CTT-3’ for PCR. Nucleotide sequence of 16S DNA fragment was determined through the sequencing method. The result was then compared with GenBank database to recognize the type of the sample bacteria. DNA isolation and 16S DNA coding genes amplification were carried out using Kit High Fidelity Platinum Taq DNA Polymerase. Afterward, BLAST was applied to identify the phylogenetic tree. The bacteria was capable of indicating the existence of clear zone in a media CMC by congo red staining. The existence of the clear zone associated with the activity of microbes to degrade cellulose. The conclusión of this research based on the results was the sequencing nucleotides genome 16S DNA showed that cellulolytic inoculant was identified as Enterobacter cloacae WPL 214. ABSTRAK Penelitian ini bertujuan untuk mengidentifikasi lebih lanjut isolat selulolitik kode WPL 214 yang telah diisolasi dari cairan rumen sapi peranakan ongole dari limbah Rumah Potong Hewan Surabaya. Koloni tunggal dari isolat selulolitik ditumbuhkan pada 5 mL media cair Luria Bertani (LB dengan komposisisi 1% NaCl, 1% tripton, 0,5% yeast ekstrak, yang mengandung 1% substrat carboxymethyl cellulose (CMC pada suhu 37°C, dengan pengocokan menggunakan shaker incubator selama ±16-18 jam. Penelitian ini terdiri dari dua tahap, tahap pertama dilakukan isolasi DNA, tahap kedua
A comparative molecular dynamics study on thermostability of human and chicken prion proteins
International Nuclear Information System (INIS)
Ji, Hong-Fang; Zhang, Hong-Yu
2007-01-01
To compare the thermostabilities of human and chicken normal cellular prion proteins (HuPrP C and CkPrP C ), molecular dynamics (MD) simulations were performed for both proteins at an ensemble level (10 parallel simulations at 400 K and 5 parallel simulations at 300 K as a control). It is found that the thermostability of HuPrP C is comparable with that of CkPrP C , which implicates that the non-occurrence of prion diseases in non-mammals cannot be completely attributed to the thermodynamic properties of non-mammalian PrP C
Thermostable cellulase from a thermomonospora gene
Wilson, D.B.; Walker, L.P.; Zhang, S.
1997-10-14
The invention relates to a gene isolated from Thermomonospora fusca, wherein the gene encodes a thermostable cellulase. Disclosed is the nucleotide sequence of the T. fusca gene; and nucleic acid molecules comprising the gene, or a fragment of the gene, that can be used to recombinantly express the cellulase or a catalytically active polypeptide thereof, respectively. The isolated and purified recombinant cellulase or catalytically active polypeptide may be used to hydrolyze substrate either by itself; or in combination with other cellulases, with the resultant combination having unexpected hydrolytic activity. 3 figs.
Bagheri, Fahimeh; Ebadifar, Asghar; Khorram Khorshid, Hamid Reza; Kamali, Koorosh
2017-10-16
The aim of this study is to evaluate the association of TGFA TaqI polymorphism with nonsyndromic cleft lip and/or palate (NSCLP) in an Iranian population. In this case-control study, 113 children with NSCLP and 209 controls were included. Genotyping of the TaqI polymorphism was performed by polymerase chain reaction and restriction fragment length polymorphism methods. A p-value of control group (p = 0.422) were in Hardy-Weinberg equilibrium. There was no statistically significant difference in the genotype distribution (p = 0.059) and allele frequency (p = 0.065) of the TGFA TaqI polymorphism in the NSCLP and control groups. TGFA TaqI polymorphism was not associated with the risk of NSCLP in Iranian children. Birth Defects Research 109:1386-1389, 2017.© 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
FireProt: web server for automated design of thermostable proteins
Musil, Milos; Stourac, Jan; Brezovsky, Jan; Prokop, Zbynek; Zendulka, Jaroslav; Martinek, Tomas
2017-01-01
Abstract There is a continuous interest in increasing proteins stability to enhance their usability in numerous biomedical and biotechnological applications. A number of in silico tools for the prediction of the effect of mutations on protein stability have been developed recently. However, only single-point mutations with a small effect on protein stability are typically predicted with the existing tools and have to be followed by laborious protein expression, purification, and characterization. Here, we present FireProt, a web server for the automated design of multiple-point thermostable mutant proteins that combines structural and evolutionary information in its calculation core. FireProt utilizes sixteen tools and three protein engineering strategies for making reliable protein designs. The server is complemented with interactive, easy-to-use interface that allows users to directly analyze and optionally modify designed thermostable mutants. FireProt is freely available at http://loschmidt.chemi.muni.cz/fireprot. PMID:28449074
Clinical trial participant characteristics and saliva and DNA metrics
Directory of Open Access Journals (Sweden)
Richards Julie
2009-10-01
Full Text Available Abstract Background Clinical trial and epidemiological studies need high quality biospecimens from a representative sample of participants to investigate genetic influences on treatment response and disease. Obtaining blood biospecimens presents logistical and financial challenges. As a result, saliva biospecimen collection is becoming more frequent because of the ease of collection and lower cost. This article describes an assessment of saliva biospecimen samples collected through the mail, trial participant demographic and behavioral characteristics, and their association with saliva and DNA quantity and quality. Methods Saliva biospecimens were collected using the Oragene® DNA Self-Collection Kits from participants in a National Cancer Institute funded smoking cessation trial. Saliva biospecimens from 565 individuals were visually inspected for clarity prior to and after DNA extraction. DNA samples were then quantified by UV absorbance, PicoGreen®, and qPCR. Genotyping was performed on 11 SNPs using TaqMan® SNP assays and two VNTR assays. Univariate, correlation, and analysis of variance analyses were conducted to observe the relationship between saliva sample and participant characteristics. Results The biospecimen kit return rate was 58.5% among those invited to participate (n = 967 and 47.1% among all possible COMPASS participants (n = 1202. Significant gender differences were observed with males providing larger saliva volume (4.7 vs. 4.5 ml, p = 0.019, samples that were more likely to be judged as cloudy (39.5% vs. 24.9%, p 0.21, P Conclusion Findings from this study show that demographic and behavioral characteristics of smoking cessation trial participants have significant associations with saliva and DNA metrics, but not with the performance of TaqMan® SNP or VNTR genotyping assays. Trial registration COMPASS; registered as NCT00301145 at clinicaltrials.gov.
Enzymatic Amplification of DNA/RNA Hybrid Molecular Beacon Signaling in Nucleic Acid Detection
Jacroux, Thomas; Rieck, Daniel C.; Cui, Rong; Ouyang, Yexin; Dong, Wen-Ji
2012-01-01
A rapid assay operable under isothermal or non-isothermal conditions is described wherein the sensitivity of a typical molecular beacon (MB) system is improved by utilizing thermostable RNase H to enzymatically cleave an MB comprised of a DNA stem and RNA loop (R/D-MB). Upon hybridization of the R/D-MB to target DNA, there was a modest increase in fluorescence intensity (~5.7x above background) due to an opening of the probe and concomitant reduction in the Förster resonance energy transfer e...
Interim Report on Multiple Sequence Alignments and TaqMan Signature Mapping to Phylogenetic Trees
Energy Technology Data Exchange (ETDEWEB)
Gardner, S; Jaing, C
2012-03-27
The goal of this project is to develop forensic genotyping assays for select agent viruses, addressing a significant capability gap for the viral bioforensics and law enforcement community. We used a multipronged approach combining bioinformatics analysis, PCR-enriched samples, microarrays and TaqMan assays to develop high resolution and cost effective genotyping methods for strain level forensic discrimination of viruses. We have leveraged substantial experience and efficiency gained through year 1 on software development, SNP discovery, TaqMan signature design and phylogenetic signature mapping to scale up the development of forensics signatures in year 2. In this report, we have summarized the Taqman signature development for South American hemorrhagic fever viruses, tick-borne encephalitis viruses and henipaviruses, Old World Arenaviruses, filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus and Japanese encephalitis virus.
'THERMOST' for analysing thermo-structural behaviour of LWR fuel rods under PCI conditions
International Nuclear Information System (INIS)
Nuno, H.; Ogawa, S.; Kobayashi, H.
1983-01-01
As a method for evaluating fuel rod performance under power ramping or load following operations, the combined FROST/ THERMOST system has been developed and brought into practical use. FROST was presented at the IAEA Blackpool Meeting in 1978, and THERMOST is the subject of this paper. The major purpose of THERMOST is to analyse very detailed thermal and structural fuel behaviour in a rather localised part of the fuel rod whereas FROST deals with whole rod general performance. The code handles two-dimensional thermal and structural analyses simultaneously by using a finite element method, in axial section or in lateral section. It consists of a fundamental FEM system of generalised constitution, and a surrounding subroutine system which characterises fuel behaviour, such as temperature distribution, thermal expansion, elastoplasticity, creep, cracking, swelling, growth, etc. Thermal analysis is handled by heat conduction and heat transfer element (six kinds), and structural analysis by axisymmetric ring and lateral plane element (six kinds). Boundary problems such as contact, friction and cracking are treated by gap and crack elements. A sample calculation of PCI performance on a PWR fuel rod under ramping conditions is presented with some in-pile test data. (author)
Shivhare, Devendra; Mueller-Cajar, Oliver
2017-07-01
To maintain metabolic flux through the Calvin-Benson-Bassham cycle in higher plants, dead-end inhibited complexes of Rubisco must constantly be engaged and remodeled by the molecular chaperone Rubisco activase (Rca). In C3 plants, the thermolability of Rca is responsible for the deactivation of Rubisco and reduction of photosynthesis at moderately elevated temperatures. We reasoned that crassulacean acid metabolism (CAM) plants must possess thermostable Rca to support Calvin-Benson-Bassham cycle flux during the day when stomata are closed. A comparative biochemical characterization of rice ( Oryza sativa ) and Agave tequilana Rca isoforms demonstrated that the CAM Rca isoforms are approximately10°C more thermostable than the C3 isoforms. Agave Rca also possessed a much higher in vitro biochemical activity, even at low assay temperatures. Mixtures of rice and agave Rca form functional hetero-oligomers in vitro, but only the rice isoforms denature at nonpermissive temperatures. The high thermostability and activity of agave Rca mapped to the N-terminal 244 residues. A Glu-217-Gln amino acid substitution was found to confer high Rca activity to rice Rca Further mutational analysis suggested that Glu-217 restricts the flexibility of the α4-β4 surface loop that interacts with Rubisco via Lys-216. CAM plants thus promise to be a source of highly functional, thermostable Rca candidates for thermal fortification of crop photosynthesis. Careful characterization of their properties will likely reveal further protein-protein interaction motifs to enrich our mechanistic model of Rca function. © 2017 American Society of Plant Biologists. All Rights Reserved.
Potential and utilization of thermophiles and thermostable enzymes in biorefining
Directory of Open Access Journals (Sweden)
Karlsson Eva
2007-03-01
Full Text Available Abstract In today's world, there is an increasing trend towards the use of renewable, cheap and readily available biomass in the production of a wide variety of fine and bulk chemicals in different biorefineries. Biorefineries utilize the activities of microbial cells and their enzymes to convert biomass into target products. Many of these processes require enzymes which are operationally stable at high temperature thus allowing e.g. easy mixing, better substrate solubility, high mass transfer rate, and lowered risk of contamination. Thermophiles have often been proposed as sources of industrially relevant thermostable enzymes. Here we discuss existing and potential applications of thermophiles and thermostable enzymes with focus on conversion of carbohydrate containing raw materials. Their importance in biorefineries is explained using examples of lignocellulose and starch conversions to desired products. Strategies that enhance thermostablity of enzymes both in vivo and in vitro are also assessed. Moreover, this review deals with efforts made on developing vectors for expressing recombinant enzymes in thermophilic hosts.
Effects of DNA mass on multiple displacement whole genome amplification and genotyping performance
Directory of Open Access Journals (Sweden)
Haque Kashif A
2005-09-01
Full Text Available Abstract Background Whole genome amplification (WGA promises to eliminate practical molecular genetic analysis limitations associated with genomic DNA (gDNA quantity. We evaluated the performance of multiple displacement amplification (MDA WGA using gDNA extracted from lymphoblastoid cell lines (N = 27 with a range of starting gDNA input of 1–200 ng into the WGA reaction. Yield and composition analysis of whole genome amplified DNA (wgaDNA was performed using three DNA quantification methods (OD, PicoGreen® and RT-PCR. Two panels of N = 15 STR (using the AmpFlSTR® Identifiler® panel and N = 49 SNP (TaqMan® genotyping assays were performed on each gDNA and wgaDNA sample in duplicate. gDNA and wgaDNA masses of 1, 4 and 20 ng were used in the SNP assays to evaluate the effects of DNA mass on SNP genotyping assay performance. A total of N = 6,880 STR and N = 56,448 SNP genotype attempts provided adequate power to detect differences in STR and SNP genotyping performance between gDNA and wgaDNA, and among wgaDNA produced from a range of gDNA templates inputs. Results The proportion of double-stranded wgaDNA and human-specific PCR amplifiable wgaDNA increased with increased gDNA input into the WGA reaction. Increased amounts of gDNA input into the WGA reaction improved wgaDNA genotyping performance. Genotype completion or genotype concordance rates of wgaDNA produced from all gDNA input levels were observed to be reduced compared to gDNA, although the reduction was not always statistically significant. Reduced wgaDNA genotyping performance was primarily due to the increased variance of allelic amplification, resulting in loss of heterozygosity or increased undetermined genotypes. MDA WGA produces wgaDNA from no template control samples; such samples exhibited substantial false-positive genotyping rates. Conclusion The amount of gDNA input into the MDA WGA reaction is a critical determinant of genotyping performance of wgaDNA. At least 10 ng of
Directory of Open Access Journals (Sweden)
Meng eWang
2015-05-01
Full Text Available In biofuel production from lignocellulose, low thermostability and product inhibition strongly restrict the enzyme activities and production process. Application of multiple thermostable glycoside hydrolases, forming an enzyme cocktail, can result in a synergistic action and therefore improve production efficiency and reduce operational costs. Therefore, increasing enzyme thermostabilities and compatibility are important for the biofuel industry. In this study, we reported the screening, cloning and biochemical characterization of four novel thermostable lignocellulose hydrolases from a metagenomic library of a long-term dry thermophilic methanogenic digester community, which were highly compatible with optimal conditions and specific activities. The optimal temperatures of the four enzymes, β-xylosidase, xylanase, β-glucosidase, and cellulase ranged from 60°C to 75°C, and over 80% residual activities were observed after 2 h incubation at 50°C. Mixtures of these hydrolases retained high residual synergistic activities after incubation with cellulose, xylan, and steam-exploded corncob at 50°C for 72 h. In addition, about 55% dry weight of steam-exploded corncob was hydrolyzed to glucose and xylose by the synergistic action of the four enzymes at 50°C for 48 h. This work suggested that since different enzymes from a same ecosystem could be more compatible, screening enzymes from a long-term enriching community could be a favorable strategy.
The potential of TaqMan Array Cards for detection of multiple biological agents by real-time PCR.
Directory of Open Access Journals (Sweden)
Phillip A Rachwal
Full Text Available The TaqMan Array Card architecture, normally used for gene expression studies, was evaluated for its potential to detect multiple bacterial agents by real-time PCR. Ten PCR assays targeting five biological agents (Bacillus anthracis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, and Yersinia pestis were incorporated onto Array Cards. A comparison of PCR performance of each PCR in Array Card and singleplex format was conducted using DNA extracted from pure bacterial cultures. When 100 fg of agent DNA was added to Array Card channels the following levels of agent detection (where at least one agent PCR replicate returned a positive result were observed: Y. pestis 100%, B. mallei & F. tularensis 93%; B. anthracis 71%; B. pseudomallei 43%. For B. mallei & pseudomallei detection the BPM2 PCR, which detects both species, outperformed PCR assays specific to each organism indicating identification of the respective species would not be reproducible at the 100 fg level. Near 100% levels of detection were observed when 100 fg of DNA was added to each PCR in singleplex format with singleplex PCRs also returning sporadic positives at the 10 fg per PCR level. Before evaluating the use of Array Cards for the testing of environmental and clinical sample types, with potential levels of background DNA and PCR inhibitors, users would therefore have to accept a 10-fold reduction in sensitivity of PCR assays on the Array Card format, in order to benefit for the capacity to test multiple samples for multiple agents. A two PCR per agent strategy would allow the testing of 7 samples for the presence of 11 biological agents or 3 samples for 23 biological agents per card (with negative control channels.
Dopamine genes (DRD2/ANKK1-TaqA1 and DRD4-7R and executive function: their interaction with obesity.
Directory of Open Access Journals (Sweden)
Mar Ariza
Full Text Available Obesity is a multifactorial disease caused by the interaction between genotype and environment, and it is considered to be a type of addictive alteration. The A1 allele of the DRD2/ANKK1-TaqIA gene has been associated with addictive disorders, with obesity and with the performance in executive functions. The 7 repeat allele of the DRD4 gene has likewise been associated with the performance in executive functions, as well as with addictive behaviors and impulsivity. Participants were included in the obesity group (N = 42 if their body mass index (BMI was equal to or above 30, and in the lean group (N = 42 if their BMI was below 25. The DRD2/ANKK1-TaqIA and DRD4 VNTR polymorphisms were obtained. All subjects underwent neuropsychological assessment. Eating behavior traits were evaluated. The 'DRD2/ANKK1-TaqIA A1-allele status' had a significant effect on almost all the executive variables, but no significant 'DRD4 7R-allele status' effects were observed for any of the executive variables analyzed. There was a significant 'group' x 'DRD2/ANKK1-TaqIA A1-allele status' interaction effect on LN and 'group' x 'DRD4 7R-allele status' interaction effect on TMT B-A score. Being obese and a carrier of the A1 allele of DRD2/ANKK1-TaqIA or the 7R allele of DRD4 VNTR polymorphisms could confer a weakness as regards the performance of executive functions.
Directory of Open Access Journals (Sweden)
Chengtuo Niu
Full Text Available 1,3-1,4-β-glucanase is an important biocatalyst in brewing industry and animal feed industry, while its low thermostability often reduces its application performance. In this study, the thermostability of a mesophilic β-glucanase from Bacillus terquilensis was enhanced by rational design and engineering of disulfide bonds in the protein structure. Protein spatial configuration was analyzed to pre-exclude the residues pairs which negatively conflicted with the protein structure and ensure the contact of catalytic center. The changes in protein overall and local flexibility among the wild-type enzyme and the designated mutants were predicted to select the potential disulfide bonds for enhancement of thermostability. Two residue pairs (N31C-T187C and P102C-N125C were chosen as engineering targets and both of them were proved to significantly enhance the protein thermostability. After combinational mutagenesis, the double mutant N31C-T187C/P102C-N125C showed a 48.3% increase in half-life value at 60°C and a 4.1°C rise in melting temperature (Tm compared to wild-type enzyme. The catalytic property of N31C-T187C/P102C-N125C mutant was similar to that of wild-type enzyme. Interestingly, the optimal pH of double mutant was shifted from pH6.5 to pH6.0, which could also increase its industrial application. By comparison with mutants with single-Cys substitutions, the introduction of disulfide bonds and the induced new hydrogen bonds were proved to result in both local and overall rigidification and should be responsible for the improved thermostability. Therefore, the introduction of disulfide bonds for thermostability improvement could be rationally and highly-effectively designed by combination with spatial configuration analysis and molecular dynamics simulation.
Energy Technology Data Exchange (ETDEWEB)
Shuying, Li; Ying, Nie; Huan, Du; Xuanming, Tang [Institute of Agro-products Processing Science and Technology, Chinese Academy of Agricultural Sciences, Beijing (China); Zhonglin, Zhao [College of Sciences, Henan Agricultural University, Zhengzhou (China); Xin, Ma [Agricultural Information Institute, Chinese Academic of Agricultural Sciences, Beijing (China); Yan, Li [School of Food and Biological Engineering, Zhengzhou University of Light Industry, Zhengzhou (China)
2013-06-15
In this study, Bacillus natto was irradiated by {sup 60}Co γ-ray, and activity was determined by Casein plate method in order to get high activity and thermostability strains. 60 strains with high activity were obtained through irradiation by 800 Gy {sup 60}Co γ-ray. In this dose, the positive mutation rate was 45%. Then 60 strains was treated by different tempreture and 11 strains showed thermostability at 65℃. (authors)
International Nuclear Information System (INIS)
Li Shuying; Nie Ying; Du Huan; Tang Xuanming; Zhao Zhonglin; Ma Xin; Li Yan
2013-01-01
In this study, Bacillus natto was irradiated by "6"0Co γ-ray, and activity was determined by Casein plate method in order to get high activity and thermostability strains. 60 strains with high activity were obtained through irradiation by 800 Gy "6"0Co γ-ray. In this dose, the positive mutation rate was 45%. Then 60 strains was treated by different tempreture and 11 strains showed thermostability at 65℃. (authors)
Usefulness of in-house PCR methods for hepatitis B virus DNA detection.
Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo
2015-10-01
The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.
RFLP for Duchenne muscular dystrophy cDNA clone 44-1
Energy Technology Data Exchange (ETDEWEB)
Laing, N G; Siddique, T; Bartlett, R J; Yamaoka, L H; Chen, J C; Walker, A P; Hung, W Y; Roses, A D [Duke Univ. Medical Center, Durham, NC (USA)
1988-07-25
Clone 44-1 is one of six cDNA clones which comprise the cDNA for the Duchenne muscular dystrophy gene. It is a 0.9kb fragment in the EcoR1 site of Bluescript. Taq1 (TlCGA) identifies two alleles with bands at 6.8 and 5.7kb, as well as four constant bands at 4.8, 3.9, 3.5 and 2.5kb. Its frequency was studied in 62 unrelated individuals. Mendelian inheritance was demonstrated in one three generation and three two generation informative families, 26 individuals. There were no problems on RFLP analysis under normal stringency conditions.
Perugino, Giuseppe; Miggiano, Riccardo; Serpe, Mario; Vettone, Antonella; Valenti, Anna; Lahiri, Samarpita; Rossi, Franca; Rossi, Mosè; Rizzi, Menico; Ciaramella, Maria
2015-10-15
Alkylated DNA-protein alkyltransferases repair alkylated DNA bases, which are among the most common DNA lesions, and are evolutionary conserved, from prokaryotes to higher eukaryotes. The human ortholog, hAGT, is involved in resistance to alkylating chemotherapy drugs. We report here on the alkylated DNA-protein alkyltransferase, SsOGT, from an archaeal species living at high temperature, a condition that enhances the harmful effect of DNA alkylation. The exceptionally high stability of SsOGT gave us the unique opportunity to perform structural and biochemical analysis of a protein of this class in its post-reaction form. This analysis, along with those performed on SsOGT in its ligand-free and DNA-bound forms, provides insights in the structure-function relationships of the protein before, during and after DNA repair, suggesting a molecular basis for DNA recognition, catalytic activity and protein post-reaction fate, and giving hints on the mechanism of alkylation-induced inactivation of this class of proteins. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Shu-xia Guo
2016-09-01
Full Text Available Background: Previous studies have evaluated the associations between the cholesteryl ester transfer protein (CETP TaqIB polymorphism (rs708272, the risk of developing composite ischemic cardiovascular disease (CVD and the concentration of high-density lipoprotein cholesterol (HDL-C, but results remain controversial. The objective of this study was to investigate whether a relationship exists between these factors. Methods: We conducted a meta-analysis of available studies to clarify the associations of the CETP TaqIB polymorphism with HDL-C concentration and the composite ischemic CVD risk in both Asians and Caucasians. All statistical analyses were done with Stata 12.0. Results: Through utilization of the Cochrane Library, Embase, PubMed, Web of Science, Springer, China Science and Technology Journal Database, China National Knowledge Infrastructure, Google Scholar, and Baidu Library, a total of 45 studies from 44 papers with 20,866 cases and 21,298 controls were combined showing a significant association between the CETP TaqIB variant and composite ischemic CVD risk. Carriers of allele TaqIB-B1 were found to have a higher risk of composite ischemic CVD than non-carriers: OR = 1.15, 95% CI = 1.09–1.21, p < 0.001. Meanwhile, 28 studies with 23,959 subjects were included in the association between the CETP TaqIB polymorphism and the concentration of HDL-C. Results suggested that carriers of the B1B1 genotype had lower concentrations of HDL-C than those of the B2B2 genotype: SMD = 0.50, 95% CI = 0.36–0.65, p < 0.001. Conclusions: The synthesis of available evidence demonstrates that the CETP TaqIB polymorphism protects against composite ischemic CVD risk and is associated with a higher HDL-C concentration in both Asians and Caucasians.
DEFF Research Database (Denmark)
Zhen, Zhuo; Liu, Jingwen; Rensing, Christopher Günther T
2017-01-01
and diversity analysis. In this study, two clone libraries were constructed with two different DNA polymerases, Q5 high-fidelity DNA polymerase and exTaq polymerase, to compare the differences in their capability to accurately reflect the cyanobacterial community structure and diversity in a subtropical deep......-fidelity DNA polymerase. It is noteworthy that so far Q5 high-fidelity DNA polymerase was the first time to be employed in the genetic analysis of cyanobacterial community. And it is for the first time that the cyanobacterial community structure in Dongzhen reservoir was analyzed using molecular methods...
Carneiro, Greice Amaral; Matić, Slavica; Ortu, Giuseppe; Garibaldi, Angelo; Spadaro, Davide; Gullino, Maria Lodovica
2017-07-01
Bakanae disease, which is caused by the seedborne pathogen Fusarium fujikuroi, is found throughout the world on rice. A TaqMan real-time PCR has been developed on the TEF 1-α gene to detect F. fujikuroi in different rice tissues. Three primer/probe sets were tested. The selected set produced an amplicon of 84 bp and was specific for F. fujikuroi with respect to eight Fusarium species of rice and six other rice common pathogens. The assay was validated for specificity, selectivity, sensitivity, repeatability, and reproducibility. The detection limit was set at 27.5 fg of DNA, which is approximately equivalent to one haploid genome of F. fujikuroi. The developed TaqMan real-time assay was able to efficiently detect and quantify F. fujikuroi from rice culms, leaves, roots, and seeds. At 1 week post-germination (wpg), the pathogen was more diffused in the green tissues, while at 3 wpg it was uniformly spread also in the roots. The highest concentration of F. fujikuroi was measured in the M6 cultivar, which showed around 1,450 fungal cells/g. The assay was sufficiently sensitive to detect a few genomic equivalents in the rice seeds, corresponding to 9.89 F. fujikuroi cells/g. The assay permitted bakanae disease to be detected in asymptomatic tissues at the early rice development stages.
Energy Technology Data Exchange (ETDEWEB)
Gonchar, A. E-mail: letyuk@mail.ru; Andreev, V.; Letyuk, L.; Shishkanov, A.; Maiorov, V
2003-01-01
The work considers ways of increasing of thermostability of ferrites of the basic systems NiO-ZnO-Fe{sub 2}O{sub 3} and MgO-ZnO-Fe{sub 2}O{sub 3} and relative materials for telecommunication. Sufficient results in increasing of the thermostability were achieved by doping Cu ions and controlling rejection of Fe{sub 2}O{sub 3} content from equimolar composition. These results allow to increase the Curie temperature to 130-140 deg. C for Ni-Zn ferrites with initial permeability 2000.
Chen, Ana; Li, Yamei; Nie, Jianqi; McNeil, Brian; Jeffrey, Laura; Yang, Yankun; Bai, Zhonghu
2015-10-01
Thermostability has been considered as a requirement in the starch processing industry to maintain high catalytic activity of pullulanase under high temperatures. Four data driven rational design methods (B-FITTER, proline theory, PoPMuSiC-2.1, and sequence consensus approach) were adopted to identify the key residue potential links with thermostability, and 39 residues of Bacillus acidopullulyticus pullulanase were chosen as mutagenesis targets. Single mutagenesis followed by combined mutagenesis resulted in the best mutant E518I-S662R-Q706P, which exhibited an 11-fold half-life improvement at 60 °C and a 9.5 °C increase in Tm. The optimum temperature of the mutant increased from 60 to 65 °C. Fluorescence spectroscopy results demonstrated that the tertiary structure of the mutant enzyme was more compact than that of the wild-type (WT) enzyme. Structural change analysis revealed that the increase in thermostability was most probably caused by a combination of lower stability free-energy and higher hydrophobicity of E518I, more hydrogen bonds of S662R, and higher rigidity of Q706P compared with the WT. The findings demonstrated the effectiveness of combined data-driven rational design approaches in engineering an industrial enzyme to improve thermostability. Copyright © 2015 Elsevier Inc. All rights reserved.
Reddy, Chinreddy Subramanyam; Achary, V Mohan Murali; Manna, Mrinalini; Singh, Jitender; Kaul, Tanushri; Reddy, Malireddy K
2015-03-01
The thermostable phytase gene was isolated from Bacillus subtilis ARRMK33 (BsPhyARRMK33). The gene has an ORF of 1152 bp and that encodes a protein of 383 amino acids. Sequence analysis showed high homology with Bacillus sp. phytase proteins, but no similarity was found with other phytases. SDS-PAGE analysis exhibited a predicted molecular mass of 42 kDa. Homology modeling of BsPhyARRMK33 protein based on Bacillus amyloliquefaciens crystal structure disclosed its β-propeller structure. BsPhyARRMK33 recombinant plasmid in pET-28a(+) was expressed in Rosetta gami B DE3 cells and the maximum phytase activity 15.3 U mg(-1) obtained. The enzyme exhibits high thermostability at various temperatures and broad pH ranges. The recombinant protein retained 74% of its original activity after incubation at 95 °C for 10 min. In the presence of Ca(2+), the recombinant phytase activity was maximal where as it was inhibited by EDTA. The optimal pH and temperature for the recombinant phytase activity is achieved at 7.0 and 55 °C, respectively. Thermostable nature and wide range of pH are promising features of recombinant BsPhyARRMK33 protein that may be employed as an efficient alternative to commercially known phytases and thereby alleviate environmental eutrophication.
Lee, Yeongjoon; Kwak, Chulhee; Jeong, Ki-Woong; Durai, Prasannavenkatesh; Ryu, Kyoung-Seok; Kim, Eun-Hee; Cheong, Chaejoon; Ahn, Hee-Chul; Kim, Hak Jun; Kim, Yangmee
2018-05-18
Cold-shock proteins (Csps) are expressed at lower-than-optimum temperatures, and they function as RNA chaperones; however, no structural studies on psychrophilic Csps have been reported. Here, we aimed to investigate the structure and dynamics of the Csp of psychrophile Colwellia psychrerythraea 34H, ( Cp-Csp). Although Cp-Csp shares sequence homology, common folding patterns, and motifs, including a five β-stranded barrel, with its thermophilic counterparts, its thermostability (37 °C) was markedly lower than those of other Csps. Cp-Csp binds heptathymidine with an affinity of 10 -7 M, thereby increasing its thermostability to 50 °C. Nuclear magnetic resonance spectroscopic analysis of the Cp-Csp structure and backbone dynamics revealed a flexible structure with only one salt bridge and 10 residues in the hydrophobic cavity. Notably, Cp-Csp contains Tyr51 instead of the conserved Phe in the hydrophobic core, and its phenolic hydroxyl group projects toward the surface. The Y51F mutation increased the stability of hydrophobic packing and may have allowed for the formation of a K3-E21 salt bridge, thereby increasing its thermostability to 43 °C. Cp-Csp exhibited conformational exchanges in its ribonucleoprotein motifs 1 and 2 (754 and 642 s -1 ), and heptathymidine binding markedly decreased these motions. Cp-Csp lacks salt bridges and has longer flexible loops and a less compact hydrophobic cavity resulting from Tyr51 compared to mesophilic and thermophilic Csps. These might explain the low thermostability of Cp-Csp. The conformational flexibility of Cp-Csp facilitates its accommodation of nucleic acids at low temperatures in polar oceans and its function as an RNA chaperone for cold adaptation.
Otti, Gerald; Bouvaine, Sophie; Kimata, Bernadetha; Mkamillo, Geoffrey; Kumar, Lava; Tomlins, Keith; Maruthi, M.N.
2016-01-01
Aims: To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa.\\ud \\ud Methods and Results: The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause t...
Yang, Hung-Wei; Ye, Ling; Guo, Xin Dong; Yang, Chinglai; Compans, Richard W; Prausnitz, Mark R
2017-01-01
Ebola DNA vaccine is incorporated into PLGA-PLL/γPGA nanoparticles and administered to skin using a microneedle (MN) patch. The nanoparticle delivery system increases vaccine thermostability and immunogenicity compared to free vaccine. Vaccination by MN patch produces stronger immune responses than intramuscular administration. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Linguistic grammar learning and DRD2-TAQ-IA polymorphism.
Wong, Patrick C M; Ettlinger, Marc; Zheng, Jing
2013-01-01
As research into the neurobiology of language has focused primarily on the systems level, fewer studies have examined the link between molecular genetics and normal variations in language functions. Because the ability to learn a language varies in adults and our genetic codes also vary, research linking the two provides a unique window into the molecular neurobiology of language. We consider a candidate association between the dopamine receptor D2 gene (DRD2) and linguistic grammar learning. DRD2-TAQ-IA polymorphism (rs1800497) is associated with dopamine receptor D2 distribution and dopamine impact in the human striatum, such that A1 allele carriers show reduction in D2 receptor binding relative to carriers who are homozygous for the A2 allele. The individual differences in grammatical rule learning that are particularly prevalent in adulthood are also associated with striatal function and its role in domain-general procedural memory. Therefore, we reasoned that procedurally-based grammar learning could be associated with DRD2-TAQ-IA polymorphism. Here, English-speaking adults learned artificial concatenative and analogical grammars, which have been respectively associated with procedural and declarative memory. Language learning capabilities were tested while learners' neural hemodynamic responses were simultaneously measured by fMRI. Behavioral learning and brain activation data were subsequently compared with the learners' DRD2 (rs1800497) genotype. Learners who were homozygous for the A2 allele were better at concatenative (but not analogical) grammar learning and had higher striatal responses relative to those who have at least one A1 allele. These results provide preliminary evidence for the neurogenetic basis of normal variations in linguistic grammar learning and its link to domain-general functions.
Directory of Open Access Journals (Sweden)
Dawn N Birdsell
Full Text Available Francisella tularensis, the etiologic agent of tularemia and a Class A Select Agent, is divided into three subspecies and multiple subpopulations that differ in virulence and geographic distribution. Given these differences, there is a need to rapidly and accurately determine if a strain is F. tularensis and, if it is, assign it to subspecies and subpopulation. We designed TaqMan real-time PCR genotyping assays using eleven single nucleotide polymorphisms (SNPs that were potentially specific to closely related groups within the genus Francisella, including numerous subpopulations within F. tularensis species. We performed extensive validation studies to test the specificity of these SNPs to particular populations by screening the assays across a set of 565 genetically and geographically diverse F. tularensis isolates and an additional 21 genetic near-neighbor (outgroup isolates. All eleven assays correctly determined the genetic groups of all 565 F. tularensis isolates. One assay differentiates F. tularensis, F. novicida, and F. hispaniensis from the more genetically distant F. philomiragia and Francisella-like endosymbionts. Another assay differentiates F. tularensis isolates from near neighbors. The remaining nine assays classify F. tularensis-confirmed isolates into F. tularensis subspecies and subpopulations. The genotyping accuracy of these nine assays diminished when tested on outgroup isolates (i.e. non F. tularensis, therefore a hierarchical approach of assay usage is recommended wherein the F. tularensis-specific assay is used before the nine downstream assays. Among F. tularensis isolates, all eleven assays were highly sensitive, consistently amplifying very low concentrations of DNA. Altogether, these eleven TaqMan real-time PCR assays represent a highly accurate, rapid, and sensitive means of identifying the species, subspecies, and subpopulation of any F. tularensis isolate if used in a step-wise hierarchical scheme. These assays
Thermostability promotes the cooperative function of split adenylate kinases.
Nguyen, Peter Q; Liu, Shirley; Thompson, Jeremy C; Silberg, Jonathan J
2008-05-01
Proteins can often be cleaved to create inactive polypeptides that associate into functional complexes through non-covalent interactions, but little is known about what influences the cooperative function of the ensuing protein fragments. Here, we examine whether protein thermostability affects protein fragment complementation by characterizing the function of split adenylate kinases from the mesophile Bacillus subtilis (AKBs) and the hyperthermophile Thermotoga neapolitana (AKTn). Complementation studies revealed that the split AKTn supported the growth of Escherichia coli with a temperature-sensitive AK, but not the fragmented AKBs. However, weak complementation occurred when the AKBs fragments were fused to polypeptides that strongly associate, and this was enhanced by a Q16L mutation that thermostabilizes the full-length protein. To examine how the split AK homologs differ in structure and function, their catalytic activity, zinc content, and circular dichroism spectra were characterized. The reconstituted AKTn had higher levels of zinc, greater secondary structure, and >10(3)-fold more activity than the AKBs pair, albeit 17-fold less active than full-length AKTn. These findings provide evidence that the design of protein fragments that cooperatively function can be improved by choosing proteins with the greatest thermostability for bisection, and they suggest that this arises because hyperthermophilic protein fragments exhibit greater residual structure compared to their mesophilic counterparts.
Shivhare, Devendra
2017-01-01
To maintain metabolic flux through the Calvin-Benson-Bassham cycle in higher plants, dead-end inhibited complexes of Rubisco must constantly be engaged and remodeled by the molecular chaperone Rubisco activase (Rca). In C3 plants, the thermolability of Rca is responsible for the deactivation of Rubisco and reduction of photosynthesis at moderately elevated temperatures. We reasoned that crassulacean acid metabolism (CAM) plants must possess thermostable Rca to support Calvin-Benson-Bassham cycle flux during the day when stomata are closed. A comparative biochemical characterization of rice (Oryza sativa) and Agave tequilana Rca isoforms demonstrated that the CAM Rca isoforms are approximately10°C more thermostable than the C3 isoforms. Agave Rca also possessed a much higher in vitro biochemical activity, even at low assay temperatures. Mixtures of rice and agave Rca form functional hetero-oligomers in vitro, but only the rice isoforms denature at nonpermissive temperatures. The high thermostability and activity of agave Rca mapped to the N-terminal 244 residues. A Glu-217-Gln amino acid substitution was found to confer high Rca activity to rice Rca. Further mutational analysis suggested that Glu-217 restricts the flexibility of the α4-β4 surface loop that interacts with Rubisco via Lys-216. CAM plants thus promise to be a source of highly functional, thermostable Rca candidates for thermal fortification of crop photosynthesis. Careful characterization of their properties will likely reveal further protein-protein interaction motifs to enrich our mechanistic model of Rca function. PMID:28546437
Directory of Open Access Journals (Sweden)
Takao Ito
Full Text Available Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.
Directory of Open Access Journals (Sweden)
Eleni Gomes
2007-02-01
Full Text Available REVIEW: Living organisms encountered in hostile environments that are characterized by extreme temperatures rely on novel molecular mechanisms to enhance the thermal stability of their proteins, nucleic acids, lipids and cell membranes. Proteins isolated from thermophilic organisms usually exhibit higher intrinsic thermal stabilities than their counterparts isolated from mesophilic organisms. Although the molecular basis of protein thermostability is only partially understood, structural studies have suggested that the factors that may contribute to enhance protein thermostability mainly include hydrophobic packing, enhanced secondary structure propensity, helix dipole stabilization, absence of residues sensitive to oxidation or deamination, and increased electrostatic interactions. Thermostable enzymes such as amylases, xylanases and pectinases isolated from thermophilic organisms are potentially of interest in the optimization of industrial processes due to their enhanced stability. In the present review, an attempt is made to delineate the structural factors that increase enzyme thermostability and to document the research results in the production of these enzymes.
Useful halophilic, thermostable and ionic liquids tolerant cellulases
Zhang, Tao; Datta, Supratim; Simmons, Blake A.; Rubin, Edward M.
2016-06-28
The present invention provides for an isolated or recombinant polypeptide comprising an amino acid sequence having at least 70% identity with the amino acid sequence of a Halorhabdus utahensis cellulase, such as Hu-CBH1, wherein said amino acid sequence has a halophilic thermostable and/or thermophilic cellobiohydrolase (CBH) activity. In some embodiments, the polypeptide has a CBH activity that is resistant to up to about 20% of ionic liquids. The present invention also provides for compositions comprising and methods using the isolated or recombinant polypeptide.
Directory of Open Access Journals (Sweden)
Nur Syazwani Mohtar
2016-12-01
Full Text Available The glycogen branching enzyme (EC 2.4.1.18, which catalyses the formation of α-1,6-glycosidic branch points in glycogen structure, is often used to enhance the nutritional value and quality of food and beverages. In order to be applicable in industries, enzymes that are stable and active at high temperature are much desired. Using genome mining, the nucleotide sequence of the branching enzyme gene (glgB was extracted from the Geobacillus mahadia Geo-05 genome sequence provided by the Malaysia Genome Institute. The size of the gene is 2013 bp, and the theoretical molecular weight of the protein is 78.43 kDa. The gene sequence was then used to predict the thermostability, function and the three dimensional structure of the enzyme. The gene was cloned and overexpressed in E. coli to verify the predicted result experimentally. The purified enzyme was used to study the effect of temperature and pH on enzyme activity and stability, and the inhibitory effect by metal ion on enzyme activity. This thermostable glycogen branching enzyme was found to be most active at 55 °C, and the half-life at 60 °C and 70 °C was 24 h and 5 h, respectively. From this research, a thermostable glycogen branching enzyme was successfully isolated from Geobacillus mahadia Geo-05 by genome mining together with molecular biology technique.
Directory of Open Access Journals (Sweden)
Fabrizio Pucci
Full Text Available The ability to rationally modify targeted physical and biological features of a protein of interest holds promise in numerous academic and industrial applications and paves the way towards de novo protein design. In particular, bioprocesses that utilize the remarkable properties of enzymes would often benefit from mutants that remain active at temperatures that are either higher or lower than the physiological temperature, while maintaining the biological activity. Many in silico methods have been developed in recent years for predicting the thermodynamic stability of mutant proteins, but very few have focused on thermostability. To bridge this gap, we developed an algorithm for predicting the best descriptor of thermostability, namely the melting temperature Tm, from the protein's sequence and structure. Our method is applicable when the Tm of proteins homologous to the target protein are known. It is based on the design of several temperature-dependent statistical potentials, derived from datasets consisting of either mesostable or thermostable proteins. Linear combinations of these potentials have been shown to yield an estimation of the protein folding free energies at low and high temperatures, and the difference of these energies, a prediction of the melting temperature. This particular construction, that distinguishes between the interactions that contribute more than others to the stability at high temperatures and those that are more stabilizing at low T, gives better performances compared to the standard approach based on T-independent potentials which predict the thermal resistance from the thermodynamic stability. Our method has been tested on 45 proteins of known Tm that belong to 11 homologous families. The standard deviation between experimental and predicted Tm's is equal to 13.6°C in cross validation, and decreases to 8.3°C if the 6 worst predicted proteins are excluded. Possible extensions of our approach are discussed.
Energy Technology Data Exchange (ETDEWEB)
Byun, Jung-Sue [Department of Biology, Yonsei University, Seoul 120-749 (Korea, Republic of); Protein Network Research Center, Yonsei University, Seoul 120-749 (Korea, Republic of); Rhee, Jin-Kyu [Department of Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Kim, Dong-Uk [Department of Biology, Yonsei University, Seoul 120-749 (Korea, Republic of); Oh, Jong-Won [Department of Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Cho, Hyun-Soo, E-mail: hscho8@yonsei.ac.kr [Department of Biology, Yonsei University, Seoul 120-749 (Korea, Republic of); Protein Network Research Center, Yonsei University, Seoul 120-749 (Korea, Republic of)
2006-02-01
Recombinant EstE1 protein with a histidine tag at the C-terminus was overexpressed in Escherichia coli strain BL21(DE3) and then purified by affinity chromatography. The protein was then crystallized at 290 K by the hanging-drop vapour-diffusion method. EstE1, a new thermostable esterase, was isolated by functional screening of a metagenomic DNA library from thermal environment samples. This enzyme showed activity towards short-chain acyl derivatives of length C4–C6 at a temperature of 303–363 K and displayed a high thermostability above 353 K. EstE1 has 64 and 57% amino-acid sequence similarity to est{sub pc}-encoded carboxylesterase from Pyrobaculum calidifontis and AFEST from Archaeoglobus fulgidus, respectively. The recombinant protein with a histidine tag at the C-terminus was overexpressed in Escherichia coli strain BL21(DE3) and then purified by affinity chromatography. The protein was crystallized at 290 K by the hanging-drop vapour-diffusion method. X-ray diffraction data were collected to 2.3 Å resolution from an EstE1 crystal; the crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 73.71, c = 234.23 Å. Assuming the presence of four molecules in the asymmetric unit, the Matthews coefficient V{sub M} is calculated to be 2.2 Å{sup 3} Da{sup −1} and the solvent content is 44.1%.
Association study between the Taq1A (rs1800497 polymorphism and schizophrenia in a Brazilian sample
Directory of Open Access Journals (Sweden)
Quirino Cordeiro
2014-08-01
Full Text Available Schizophrenia is a severe psychotic disorder with recurrent relapse and functional impairment. It results from a poorly understood gene-environment interaction. The Taq1A polymorphism (located in the gene cluster NTAD is a likely candidate for schizophrenia. Its rs1800497 polymorphism was shown to be associated with DRD2 gene expression. Therefore the present work aims to investigate a possible association between schizophrenia and such polymorphism. The compared distribution of the alleles and genotypes of the studied polymorphism was investigated in a Brazilian sample of 235 patients and 834 controls. Genotypic frequencies were in Hardy-Weinberg equilibrium. There was a trend of allelic association between the Taq1A polymorphism (rs1800497 with schizophrenia in the studied sample. However no statistically differences were found between cases and controls when analyzed by gender or schizophrenia subtypes.
First isolation of a novel thermostable antifungal peptide secreted by Aspergillus clavatus.
Skouri-Gargouri, Houda; Gargouri, Ali
2008-11-01
A novel antifungal peptide produced by an indigenous fungal strain (VR) of Aspergillus clavatus was purified. The antifungal peptide was enriched in the supernatant after heat treatment at 70 degrees C. The thermostable character was exploited in the first purification step, as purified peptide was obtained after ultrafiltration and reverse phase-HPLC on C18 column application. The purified peptide named "AcAFP" for A. clavatus antifungal peptide, has molecular mass of 5773Da determined by MALDI-ToF spectrometry. The N-terminal sequence showed a notable identity to the limited family of antifungal peptides produced by ascomycetes fungi. The AcAFP activity remains intact even after heat treatment at 100 degrees C for 1h confirming its thermostability. It exhibits a strong inhibitory activity against mycelial growth of several serious human and plant pathogenic fungi: Fusariuym oxysporum, Fusarium solani, Aspergillus niger, Botrytis cinerea, Alternaria solani, whereas AcAFP did not affect yeast and bacterial growth.
Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario
2010-06-01
Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.
Mohammad, Balsam T; Al Daghistani, Hala I; Jaouani, Atef; Abdel-Latif, Saleh; Kennes, Christian
2017-01-01
The aim of this study was the isolation and characterization of thermophilic bacteria from hot springs in Jordan. Ten isolates were characterized by morphological, microscopic, biochemical, molecular, and physiological characteristics. Sequencing of the 16S rDNA of the isolates followed by BLAST search revealed that nine strains could be identified as Bacillus licheniformis and one isolate as Thermomonas hydrothermalis . This is the first report on the isolation of Thermomonas species from Jordanian hot springs. The isolates showed an ability to produce some thermostable enzymes such as amylase, protease, cellulose, gelatins, and lecithin. Moreover, the UPGMA dendrogram of the enzymatic characteristics of the ten isolates was constructed; results indicated a high phenotypic diversity, which encourages future studies to explore further industrial and environmental applications.
Directory of Open Access Journals (Sweden)
Balsam T. Mohammad
2017-01-01
Full Text Available The aim of this study was the isolation and characterization of thermophilic bacteria from hot springs in Jordan. Ten isolates were characterized by morphological, microscopic, biochemical, molecular, and physiological characteristics. Sequencing of the 16S rDNA of the isolates followed by BLAST search revealed that nine strains could be identified as Bacillus licheniformis and one isolate as Thermomonas hydrothermalis. This is the first report on the isolation of Thermomonas species from Jordanian hot springs. The isolates showed an ability to produce some thermostable enzymes such as amylase, protease, cellulose, gelatins, and lecithin. Moreover, the UPGMA dendrogram of the enzymatic characteristics of the ten isolates was constructed; results indicated a high phenotypic diversity, which encourages future studies to explore further industrial and environmental applications.
Linguistic grammar learning and DRD2-TAQ-IA polymorphism.
Directory of Open Access Journals (Sweden)
Patrick C M Wong
Full Text Available As research into the neurobiology of language has focused primarily on the systems level, fewer studies have examined the link between molecular genetics and normal variations in language functions. Because the ability to learn a language varies in adults and our genetic codes also vary, research linking the two provides a unique window into the molecular neurobiology of language. We consider a candidate association between the dopamine receptor D2 gene (DRD2 and linguistic grammar learning. DRD2-TAQ-IA polymorphism (rs1800497 is associated with dopamine receptor D2 distribution and dopamine impact in the human striatum, such that A1 allele carriers show reduction in D2 receptor binding relative to carriers who are homozygous for the A2 allele. The individual differences in grammatical rule learning that are particularly prevalent in adulthood are also associated with striatal function and its role in domain-general procedural memory. Therefore, we reasoned that procedurally-based grammar learning could be associated with DRD2-TAQ-IA polymorphism. Here, English-speaking adults learned artificial concatenative and analogical grammars, which have been respectively associated with procedural and declarative memory. Language learning capabilities were tested while learners' neural hemodynamic responses were simultaneously measured by fMRI. Behavioral learning and brain activation data were subsequently compared with the learners' DRD2 (rs1800497 genotype. Learners who were homozygous for the A2 allele were better at concatenative (but not analogical grammar learning and had higher striatal responses relative to those who have at least one A1 allele. These results provide preliminary evidence for the neurogenetic basis of normal variations in linguistic grammar learning and its link to domain-general functions.
Cellobiose 2-epimerase from the thermophile Caldicellulosiruptor saccharolyticus (CsCE) catalyzes the isomerization of lactose into lactulose, a non-digestible disaccharide widely used in food and pharmaceutical industries. Semi-rational approaches were applied to enhance the thermostability of CsCE...
Zhu, Hong; Reynolds, L Bruce; Menassa, Rima
2017-06-19
Alpha amylase hydrolyzes α-bonds of polysaccharides such as starch and produces malto-oligosaccharides. Its starch saccharification applications make it an essential enzyme in the textile, food and brewing industries. Commercially available α-amylase is mostly produced from Bacillus or Aspergillus. A hyper-thermostable and Ca 2++ independent α-amylase from Pyrococcus furiosus (PFA) expressed in E.coli forms insoluble inclusion bodies and thus is not feasible for industrial applications. We expressed PFA in Nicotiana tabacum and found that plant-produced PFA forms functional aggregates with an accumulation level up to 3.4 g/kg FW (fresh weight) in field conditions. The aggregates are functional without requiring refolding and therefore have potential to be applied as homogenized plant tissue without extraction or purification. PFA can also be extracted from plant tissue upon dissolution in a mild reducing buffer containing SDS. Like the enzyme produced in P. furiosus and in E. coli, plant produced PFA preserves hyper-thermophilicity and hyper-thermostability and has a long shelf life when stored in lyophilized leaf tissue. With tobacco's large biomass and high yield, hyper-thermostable α-amylase was produced at a scale of 42 kg per hectare. Tobacco may be a suitable bioreactor for industrial production of active hyperthermostable alpha amylase.
Typisierung von HLA-Klasse-II-Merkmalen mittels des TaqMan-Verfahrens
Tremmel, Matthias
2001-01-01
In Anlehnung an die konventionelle SSP-PCR-Methode wurde ein Low-Resolution-Panel mittels des TaqMan-Prinzips entwickelt und es wurde exemplarisch für DR4 und DR15/16 gezeigt, daß die auf dem 5 Nuklease-Assay beruhende Methode fähig ist, auch einzelne Punktmutationen voneinander zu unterscheiden. Das Grundprinzip dieser Methode basiert ähnlich dem der PCR-SSP auf dem Verfahren der PCR und auf dem Ausnutzen genetischer Unterschiede. So kommt es nur zu einer Amplifizierung wenn beide Primer spe...
S.D. Pas (Suzan); R. Molenkamp (Richard); J. Schinkel (Janke); S. Rebers; C. Copra (Cederick); S. Seven-Deniz; D. Thamke (Diana); R.J. de Knegt (Robert); B.L. Haagmans (Bart); M. Schutten (Martin)
2013-01-01
textabstractTo evaluate the analytical performance and explore the clinical applicability of the new Roche cobas AmpliPrep/cobas TaqMan HCV test, v2.0 (CAP/CTM v2.0), a platform comparison was performed on panels and diagnostic samples with the Roche cobas AmpliPrep/cobas TaqMan HCV test (CAP/CTM
Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.
2004-12-01
The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection
Sevcenco, Ana-Maria; Paravidino, Monica; Vrouwenvelder, Johannes S.; Wolterbeek, Hubert Th.; van Loosdrecht, Mark C.M.; Hagen, Wilfred R.
2015-01-01
Oxo-anion binding properties of the thermostable enzyme ferritin from Pyrococcus furiosus were characterized with radiography. Radioisotopes 32P and 76As present as oxoanions were used to measure the extent and the rate of their absorption
Not so monofunctional-a case of thermostable Thermobifida fusca catalase with peroxidase activity
Lončar, Nikola; Fraaije, Marco W
Thermobifida fusca is a mesothermophilic organism known for its ability to degrade plant biomass and other organics, and it was demonstrated that it represents a rich resource of genes encoding for potent enzymes for biocatalysis. The thermostable catalase from T. fusca has been cloned and
Directory of Open Access Journals (Sweden)
Yuexia Wang
2015-09-01
Full Text Available Real-time polymerase chain reaction (PCR allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at −18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 103 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 100 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach.
Wang, Yuexia; Yang, Ming; Liu, Shuchun; Chen, Wanyi; Suo, Biao
2015-09-01
Real-time polymerase chain reaction (PCR) allows rapid detection of Salmonella in frozen dairy products, but it might cause a false positive detection result because it might amplify DNA from dead target cells as well. In this study, Salmonella-free frozen ice cream was initially inoculated with heat-killed Salmonella Typhimurium cells and stored at -18°C. Bacterial DNA extracted from the sample was amplified using TaqMan probe-based real-time PCR targeting the invA gene. Our results indicated that DNA from the dead cells remained stable in frozen ice cream for at least 20 days, and could produce fluorescence signal for real-time PCR as well. To overcome this limitation, propidium monoazide (PMA) was combined with real-time PCR. PMA treatment can effectively prevent PCR amplification from heat-killed Salmonella cells in frozen ice cream. The PMA real-time PCR assay can selectively detect viable Salmonella at as low as 10 3 CFU/mL. Combining 18 hours of pre-enrichment with the assay allows for the detection of viable Salmonella at 10 0 CFU/mL and avoiding the false-positive result of dead cells. The PMA real-time PCR assay provides an alternative specifically for detection of viable Salmonella in ice cream. However, when the PMA real-time PCR assay was evaluated in ice cream subjected to frozen storage, it obviously underestimated the contamination situation of viable Salmonella, which might lead to a false negative result. According to this result, the use of enrichment prior to PMA real-time PCR analysis remains as the more appropriate approach. Copyright © 2015. Published by Elsevier B.V.
Shin, Kyung-Hwa; Lee, Hyun-Ji; Chang, Chulhun L; Kim, Hyung-Hoi
2018-04-01
Hepatitis B virus (HBV) DNA levels are used to predict the response to therapy, determine therapy initiation, monitor resistance to therapy, and establish treatment success. To verify the performance of the cobas HBV test using the cobas 4800 system for HBV DNA quantification and to compare the HBV DNA quantification ability between the cobas HBV test and COBAS AmpliPrep/COBAS TaqMan HBV version 2.0 (CAP/CTM v2.0). The precision, linearity, and limit of detection of the cobas HBV test were evaluated using the 4th World Health Organization International Standard material and plasma samples. Clinical samples that yielded quantitative results using the CAP/CTM v2.0 and cobas HBV tests were subjected to correlational analysis. Three hundred forty-nine samples were subjected to correlational analysis, among which 114 samples showed results above the lower limit of quantification. Comparable results were obtained ([cobas HBV test] = 1.038 × [CAP/CTM v2.0]-0.173, r = 0.914) in 114 samples, which yielded values above the lower limit of quantification. The results for 86.8% of the samples obtained using the cobas HBV test were within 0.5 log 10 IU/mL of the CAP/CTM v2.0 results. The total precision values against the low and high positive controls were 1.4% (mean level: 2.25 log 10 IU/mL) and 3.2% (mean level: 6.23 log 10 IU/mL), respectively. The cobas HBV test demonstrated linearity (1.15-6.75 log 10 IU/mL, y = 0.95 × 6 + 0.17, r 2 = 0.994). The cobas HBV test showed good correlation with CAP/CTM v2.0, and had good precision and an acceptable limit of detection. The cobas HBV test using the cobas 4800 is a reliable method for quantifying HBV DNA levels in the clinical setting. Copyright © 2018. Published by Elsevier B.V.
Thermostability of bovine submaxillary mucin (BSM) in bulk solution and at a sliding interface
DEFF Research Database (Denmark)
Madsen, Jan Busk; Pakkanen, Kirsi I.; Lee, Seunghwan
2014-01-01
Thermostability of bovine submaxillary mucin (BSM) was studied in terms of its structure, hydrodynamic size, surface adsorption, and lubricating properties in the temperature range of 5-85°C. The overall random coil structure of BSM showed a gradual loosening with increasing temperature as charac......Thermostability of bovine submaxillary mucin (BSM) was studied in terms of its structure, hydrodynamic size, surface adsorption, and lubricating properties in the temperature range of 5-85°C. The overall random coil structure of BSM showed a gradual loosening with increasing temperature...... as characterized by circular dichroism (CD) spectroscopy, but this change was fully reversible upon lowering temperature. Extended heating up to 120min at 80°C did not make any appreciable changes in the structure of BSM when it was cooled to room temperature. The hydrodynamic size of BSM, as studied by dynamic...
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of
Fidelity and Mutational Spectrum of Pfu DNA Polymerase on a Human Mitochondrial DNA Sequence
André, Paulo; Kim, Andrea; Khrapko, Konstantin; Thilly, William G.
1997-01-01
The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10−6 must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or “PCR noise”. Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 × 10−7, and five of its more frequent mutations (hot spots) consisted of three transversions (GC → TA, AT → TA, and AT → CG), one transition (AT → GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be
Li, Lijun; Liao, Hui; Yang, Yan; Gong, Jianye; Liu, Jianan; Jiang, Zedong; Zhu, Yanbing; Xiao, Anfeng; Ni, Hui
2018-06-01
To improve the thermostability of α-L-rhamnosidase (r-Rha1), an enzyme previously identified from Aspergillus niger JMU-TS528, multiple arginine (Arg) residues were introduced into the r-Rha1 sequence to replace several lysine (Lys) residues that located on the surface of the folded r-Rha1. Hinted by in silico analysis, five surface Lys residues (K134, K228, K406, K440, K573) were targeted to produce a list of 5 single-residue mutants and 4 multiple-residue mutants using site-directed mutagenesis. Among these mutants, a double Lys to Arg mutant, i.e. K406R/K573R, showed the best thermostability improvement. The half-life of this mutant's enzyme activity increased 3 h at 60 °C, 23 min at 65 °C, and 3.5 min at 70 °C, when compared with the wild type. The simulated protein structure based interaction analysis and molecular dynamics calculation indicate that the thermostability improvement of the mutant K406R-K573R was possibly due to the extra hydrogen bonds, the additional cation-π interactions, and the relatively compact conformation. With the enhanced thermostability, the α-L-rhamnosidase mutant, K406R-K573R, has potentially broadened the r-Rha1 applications in food processing industry. Copyright © 2018 Elsevier B.V. All rights reserved.
WIND, RD; BUITELAAR, RM; EGGINK, G; HUIZING, HJ; DIJKHUIZEN, L
A novel strain of Bacillus stearothermophilus was isolated from samples of a potato-processing industry. Compared to known alpha-amylases from other B. stearothermophilus strains, the isolate was found to produce a highly thermostable alpha-amylase. The half-time of inactivation of this
DEFF Research Database (Denmark)
Gouda, Alaa S.; Amine, Mahasen S.; Pedersen, Erik Bjerregaard
2017-01-01
Two new phosphoramidite building blocks for DNA synthesis were synthesized from 1,5- and 2,6-dihydroxyanthraquinones through alkylation with 3-bromo-1-propanol followed by DMT-protection. The novel synthesized 1,5- and 2,6-disubstituted anthraquinone monomers H15 and H26 are incorporated into a G...... anthraquinone-modified quadruplexes revealed no change of the antiparallel structure when compared with the wild type under potassium buffer conditions. The significantly increased thermostabilities were interpreted by molecular modeling of anthraquinone-modified G-quadruplexes....
Thermostable Cellulases: Why & How?
Energy Technology Data Exchange (ETDEWEB)
Kumar, Manoj [Royal DSM, San Francisco, CA (United States)
2010-03-24
These are a set of slides from the conference. Lignocellulosic biomass is the most abundant, least expensive renewable natural biological resource for the production of biobased products and bioenergy is important for the sustainable development of human civilization in 21st century. For making the fermentable sugars from lignocellulosic biomass, a reduction in cellulase production cost, an improvement in cellulase performance, and an increase in sugar yields are all vital to reduce the processing costs of biorefineries. Improvements in specific cellulase activities for non-complexed cellulase mixtures can be implemented through cellulase engineering based on rational design or directed evolution for each cellulase component enzyme, as well as on the reconstitution of cellulase components. In this paper, we will provide DSM's efforts in cellulase research and developments and focus on limitations. Cellulase improvement strategies based on directed evolution using screening on relevant substrates, screening for higher thermal tolerance based on activity screening approaches such as continuous culture using insoluble cellulosic substrates as a powerful selection tool for enriching beneficial cellulase mutants from the large library. We will illustrate why and how thermostable cellulases are vital for economic delivery of bioproducts from cellulosic biomass using biochemical conversion approach.
Thermostable Cellulases: Why & How?
Energy Technology Data Exchange (ETDEWEB)
Kumar, Manoj [DSM Innovation, Incorporated, San Francisco, CA (United States)
2010-04-19
Lignocellulosic biomass is the most abundant, least expensive renewable natural biological resource for the production of biobased products and bioenergy is important for the sustainable development of human civilization in 21st century. For making the fermentable sugars from lignocellulosic biomass, a reduction in cellulase production cost, an improvement in cellulase performance, and an increase in sugar yields are all vital to reduce the processing costs of biorefineries. Improvements in specific cellulase activities for non-complexed cellulase mixtures can be implemented through cellulase engineering based on rational design or directed evolution for each cellulase component enzyme, as well as on the reconstitution of cellulase components. In this paper, we will provide DSM's efforts in cellulase research and developments and focus on limitations. Cellulase improvement strategies based on directed evolution using screening on relevant substrates, screening for higher thermal tolerance based on activity screening approaches such as continuous culture using insoluble cellulosic substrates as a powerful selection tool for enriching beneficial cellulase mutants from the large library. We will illustrate why and how thermostable cellulases are vital for economic delivery of bioproducts from cellulosic biomass using biochemical conversion approach.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
RFLP for Duchenne muscular dystrophy cDNA clone 30-2
Energy Technology Data Exchange (ETDEWEB)
Walker, A P; Bartlett, R J; Laing, N G; Siddique, T; Yamaoka, L H; Chen, J C; Hung, W Y; Roses, A D [Duke Univ. Medical Center, Durham, NC (USA)
1988-09-26
30-2 is one of 6 cDNA clones which comprise the cDNA for the Duchenne muscular dystrophy gene. It is a 1.15 kb fragment in the EcoRI site of Bluescribe. TaqI (T{down arrow}CGA) identifies two bands with alleles at 3.7 and 3.5 kb, as well as eight constant bands at 9.0, 7.5, 4.6, 3.6, 3.4, 2.5, 1.7 and 1.4 kb. The allele frequency was studied in 47 unrelated DMD males: 3.7 kb allele 0.45; and 3.5 kb allele 0.55. Co-dominant X-linked segregation was demonstrated in two 2-generation families. 1.1% agarose gels required to resolve the bands. The polymorphism is also recognized by PERT 87-15.
A new building block for DNA network formation by self-assembly and polymerase chain reaction.
Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas
2014-01-01
The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.
Ahmad, Israr; Jafar, Tabrez; Mahdi, Farzana; Ameta, Keerti; Arshad, Md; Das, Siddharth Kumar; Waliullah, Shah; Rizvi, Imran; Mahdi, Abbas Ali
2018-06-15
Vitamin D receptor (VDR) gene has an important role as a candidate gene for the regulation of bone mass in osteoporosis. However, its association with bone mineral density (BMD) is controversial and has not been established in different ethnic populations. To enhance the understanding of VDR gene polymorphism in the context of BMD, we investigated the plausible genetic association of TaqI and ApaI polymorphism with BMD in North Indian postmenopausal women with osteoporosis.254 osteoporotic women (Age 55.82 ± 6.91) and 254 postmenopausal non osteoporotic women (Age 54.76 ± 6.26) were included in the study. VDR TaqI and ApaI polymorphism were determined by PCR (polymerase chain reaction) and RFLP (restriction fragment length polymorphism). BMD was assessed by dual energy X-ray absorptiometry (DXA) at the lumbar spine (L 1 -L 4 ), hip, forearm and femoral neck. The average BMD with TT genotype was significantly lower at lumbar spine, hip and forearm. The Frequency of TT genotype and t allele was significantly high in osteoporotic women when compared with controls. The average BMD with Aa genotype was higher in ApaI. Furthermore, comparison of frequency distribution of genotype and allele for VDR ApaI between osteoporotic patients and controls did not show any significant difference. Our findings revealed that TaqI gene TT genotype was associated with low BMD in North Indian osteoporotic women. Moreover, TT genotype and t allele associated significantly with osteoporosis in postmenopausal women. Therefore, VDR TaqI gene is an important determinant of risk factor for osteoporosis. Copyright © 2018 Elsevier B.V. All rights reserved.
Mohammadi, Mohsen; Sepehrizadeh, Zargham; Ebrahim-Habibi, Azadeh; Shahverdi, Ahmad Reza; Faramarzi, Mohammad Ali; Setayesh, Neda
2016-11-01
Lipases as significant biocatalysts had been widely employed to catalyze various chemical reactions such as ester hydrolysis, ester synthesis, and transesterification. Improving the activity and thermostability of enzymes is desirable for industrial applications. The lipase of Serratia marcescens belonging to family I.3 lipase has a very important pharmaceutical application in production of chiral precursors. In the present study, to achieve improved lipase activity and thermostability, using computational predictions of protein, four mutant lipases of SML (MutG2P, MutG59P, Mut H279K and MutL613WA614P) were constructed by site-directed mutagenesis. The recombinant mutant proteins were over-expressed in E. coli and purified by affinity chromatography on the Ni-NTA system. Circular dichroism spectroscopy, differential scanning calorimetry and kinetic parameters (Km and kcat) were determined. Our results have shown that the secondary structure of all lipases was approximately similar to one another. The MutG2P and MutG59P were more stable than wild type by approximately 2.3 and 2.9 in T 1/2 , respectively. The catalytic efficiency (kcat/Km) of MutH279K was enhanced by 2-fold as compared with the wild type (p<0.05). These results indicate that using protein modeling program and creating mutation, can enhance lipase activity and/or thermostability of SML and it also could be used for improving other properties of enzyme to the desired requirements as well as further mutations. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Koh Eunhee
2007-07-01
Full Text Available Abstract Background EstE1 is a hyperthermophilic esterase belonging to the hormone-sensitive lipase family and was originally isolated by functional screening of a metagenomic library constructed from a thermal environmental sample. Dimers and oligomers may have been evolutionally selected in thermophiles because intersubunit interactions can confer thermostability on the proteins. The molecular mechanisms of thermostabilization of this extremely thermostable esterase are not well understood due to the lack of structural information. Results Here we report for the first time the 2.1-Å resolution crystal structure of EstE1. The three-dimensional structure of EstE1 exhibits a classic α/β hydrolase fold with a central parallel-stranded beta sheet surrounded by alpha helices on both sides. The residues Ser154, Asp251, and His281 form the catalytic triad motif commonly found in other α/β hydrolases. EstE1 exists as a dimer that is formed by hydrophobic interactions and salt bridges. Circular dichroism spectroscopy and heat inactivation kinetic analysis of EstE1 mutants, which were generated by structure-based site-directed mutagenesis of amino acid residues participating in EstE1 dimerization, revealed that hydrophobic interactions through Val274 and Phe276 on the β8 strand of each monomer play a major role in the dimerization of EstE1. In contrast, the intermolecular salt bridges contribute less significantly to the dimerization and thermostability of EstE1. Conclusion Our results suggest that intermolecular hydrophobic interactions are essential for the hyperthermostability of EstE1. The molecular mechanism that allows EstE1 to endure high temperature will provide guideline for rational design of a thermostable esterase/lipase using the lipolytic enzymes showing structural similarity to EstE1.
Engineering of pectinolytic enzymes for enhanced thermostability
DEFF Research Database (Denmark)
Larsen, Dorte Møller
Conversion of waste materials into valuable compounds is promising concerning transformation of byproduct streams such as sugar beet and potato pulp. In order to obtain those compounds with reduced energy consumption, carbohydrate active enzymes can be used as catalysts. Sugar beet and potato pulp...... consist of pectin that can be converted into beneficial polymeric and oligomeric carbohydrates requiring enzymes such as pectin lyases, rhamnogalacturonan I (RGI) lyases, polygalacturonases and galactanases. Enzymatic conversion of such pectinaceous biomasses at high temperatures is advantageous...... as it gives rise to lower substrate viscosity, easier mixing, higher substrate solubility and lowers the risk of contamination. The overall objective of this thesis was to discover enzymes for degradation of RGI structures in pectin and further engineer for enhanced thermostability. The hypotheses were...
Monnier, Stéphanie; Cox, David G; Albion, Tim; Canzian, Federico
2005-01-01
Background Single Nucleotide Polymorphism (SNP) genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS) need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS. PMID:16221298
Chemical Morphing of DNA Containing Four Noncanonical Bases.
Eremeeva, Elena; Abramov, Michail; Margamuljana, Lia; Rozenski, Jef; Pezo, Valerie; Marlière, Philippe; Herdewijn, Piet
2016-06-20
The ability of alternative nucleic acids, in which all four nucleobases are substituted, to replicate in vitro and to serve as genetic templates in vivo was evaluated. A nucleotide triphosphate set of 5-chloro-2'-deoxyuridine, 7-deaza-2'-deoxyadenosine, 5-fluoro-2'-deoxycytidine, and 7-deaza-2'deoxyguanosine successfully underwent polymerase chain reaction (PCR) amplification using templates of different lengths (57 or 525mer) and Taq or Vent (exo-) DNA polymerases as catalysts. Furthermore, a fully morphed gene encoding a dihydrofolate reductase was generated by PCR using these fully substituted nucleotides and was shown to transform and confer trimethoprim resistance to E. coli. These results demonstrated that fully modified templates were accurately read by the bacterial replication machinery and provide the first example of a long fully modified DNA molecule being functional in vivo. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
2015-12-23
Molecular Recognition Element For Use in Sensor Applications Report Title The overall goal of the project was to evolve a highly thermostable enzyme ( alcohol ...SECURITY CLASSIFICATION OF: The overall goal of the project was to evolve a highly thermostable enzyme ( alcohol dehydrogenase D (AdhD) from Pyrococcus...furiosus) to bind an explosive molecule, RDX. The enzyme naturally catalyzes the nicotinamide cofactor-dependent oxidation or reduction of alcohols
Jiang, Wei; Wang, Ya-Li; Fang, Bai-Shan
2018-05-09
As phenylalanine dehydrogenase (PheDH) plays an important role in the synthesis of chiral drug intermediates and detection of phenylketonuria, it is significant to obtain a PheDH with specific and high activity. Here, a PheDH gene, pdh, encoding a novel BhPheDH with 61.0% similarity to the known PheDH from Microbacterium sp., was obtained. The BhPheDH showed optimal activity at 60 °C and pH 7.0, and it showed better stability in hot environment (40-70 °C) than the PheDH from Nocardia sp. And its activity and thermostability could be significantly increased by sodium salt. After incubation for 2 h in 3 M NaCl at 60 °C, the residual activity of the BhPheDH was found to be 1.8-fold higher than that of the control group (without NaCl). The BhPheDH could tolerate high concentration of ammonium chloride and its activity could be also enhanced by the high concentration of ammonium salts. These characteristics indicate that the BhPheDH possesses better thermostability, ammonium chloride tolerance, halophilic mechanism, and high salt activation. The mechanism of thermostability and high salt tolerance of the BhPheDH was analyzed by molecular dynamics simulation. These results provide useful information about the enzyme with high-temperature activity, thermostability, halophilic mechanism, tolerance to high concentration of ammonium chloride, higher salt activation and enantio-selectivity, and the application of molecular dynamics simulation in analyzing the mechanism of these distinctive characteristics.
Ligand binding and thermostability of different allosteric states of the insulin zinc-hexamer
DEFF Research Database (Denmark)
Huus, Kasper; Havelund, Svend; Olsen, Helle B
2006-01-01
The influence of ligand binding and conformation state on the thermostability of hexameric zinc-insulin was studied by differential scanning calorimetry (DSC). The insulin hexamer exists in equilibrium between the forms T6, T3R3, and R6. Phenolic ligands induce and stabilize the T3R3- and R6-stat...
Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi
2018-03-01
One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Understanding thermostability and pH dependent properties of proteins
DEFF Research Database (Denmark)
Galberg, Pernille
The work performed in this thesis is part of a larger project (“Computational design of stable enzymes”) involving several research teams, which aimed to improve PROPKA (http://propka.ki.ku.dk) and to provide the scientific community with a computational protocol and associated PROPKA program......, which could be used for predicting mutations with expectation of increased thermostability at a certain pH value or a shifted pH activity optimum. The ability of a Bacillus circulans xylanase (BCX) mutant (N35D/A115E) to induce a decrease in pH activity optimum was evaluated by a pH dependent xylanase...
Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.
Singh, Prashant; Mustapha, Azlin
2013-09-02
Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Directory of Open Access Journals (Sweden)
Albion Tim
2005-10-01
Full Text Available Abstract Background Single Nucleotide Polymorphism (SNP genotyping is a major activity in biomedical research. The Taqman technology is one of the most commonly used approaches. It produces large amounts of data that are difficult to process by hand. Laboratories not equipped with a Laboratory Information Management System (LIMS need tools to organize the data flow. Results We propose a package of Visual Basic programs focused on sample management and on the parsing of input and output TaqMan files. The code is written in Visual Basic, embedded in the Microsoft Office package, and it allows anyone to have access to those tools, without any programming skills and with basic computer requirements. Conclusion We have created useful tools focused on management of TaqMan genotyping data, a critical issue in genotyping laboratories whithout a more sophisticated and expensive system, such as a LIMS.
Directory of Open Access Journals (Sweden)
Hua-Ying Fu
2016-01-01
Full Text Available Ratoon stunting disease (RSD of sugarcane, one of the most important diseases seriously affecting the productivity of sugarcane crops, was caused by the bacterial agent Leifsonia xyli subsp. xyli (Lxx. A TaqMan probe-based real-time quantitative polymerase chain reaction (qPCR assay was established in this study for the quantification of Lxx detection in sugarcane stalk juice. A pair of PCR primers (Pat1-QF/Pat1-QR and a fluorogenic probe (Pat1-QP targeting the Part1 gene of Lxx were used for the qPCR assay. The assay had a detection limit of 100 copies of plasmid DNA and 100 fg of Lxx genomic DNA, which was 100-fold more sensitive than the conventional PCR. Fifty (28.7% of 174 stalk juice samples from two field trials were tested to be positive by qPCR assay, whereas, by conventional PCR, only 12.1% (21/174 were tested to be positive with a published primer pair CxxITSf#5/CxxITSr#5 and 15.5% (27/174 were tested to be positive with a newly designed primer pair Pat1-F2/Pat1-R2. The new qPCR assay can be used as an alternative to current diagnostic methods for Lxx, especially when dealing with certificating a large number of healthy cane seedlings and determining disease incidence accurately in commercial fields.
Directory of Open Access Journals (Sweden)
Al-Eisa AA
2016-08-01
Full Text Available Amal A Al-Eisa, Mohammad Z Haider Department of Pediatrics, Faculty of Medicine, Kuwait University, Safat, Kuwait Background: Vitamin D activity is controlled by vitamin D receptors (VDRs, which are affected by different genetic polymorphisms, including TaqI and Apal restriction fragment length polymorphisms (RFLPs, which have been reported to be associated with several diseases. The aim of this study was to determine the frequency and the association of VDR gene polymorphisms with idiopathic nephrotic syndrome (INS and steroid responsiveness in Kuwaiti children. Subjects and methods: Genotypes of the VDR TaqI gene polymorphism and the Apal gene polymorphism were analyzed using polymerase chain reaction-RFLP in 78 INS patients and 56 matched controls. Results: A total of 78 INS (62 steroid sensitive [SS] and 16 steroid resistant [SR] patients with a mean age of 6.5±3.1 years were studied. Male:female ratio was 2:1. The TT genotype of VDR–TaqI polymorphism was detected in 41% of the INS patients compared to 42% of the controls (P=0.816. The heterozygous TC genotype was detected in 33% of INS patients compared to 46% of the controls (P=0.462. The CC genotype was detected in 25.6% of INS patients and 21% of the controls (P=0.719. The C-allele frequency, in its homozygous and heterozygous forms, was 71% in INS patients compared to 63% in the controls (P=0.342. Similarly, no significant difference was detected in terms of VDR–Apal polymorphism in INS patients compared to the controls for all the three genotypes (P=0.76, P=0.207, and P=0.364, respectively, for GG, GT, and TT genotypes. The T-allele frequency, in its homozygous and heterozygous forms, was 89% in INS patients compared to 93% in the controls (P=0.076. No significant difference was found in any of the allele frequencies between SS and SR subgroups when compared with each other or when compared to the controls. Conclusion: Our data do not support the use of VDR–TaqI or
Directory of Open Access Journals (Sweden)
Salleh Abu
2009-04-01
Full Text Available Abstract Background Many researchers have reported on the optimization of protease production; nevertheless, only a few have reported on the optimization of the production of organic solvent-tolerant proteases. Ironically, none has reported on thermostable organic solvent-tolerant protease to date. The aim of this study was to isolate the thermostable organic solvent-tolerant protease and identify the culture conditions which support its production. The bacteria of genus Bacillus are active producers of extra-cellular proteases, and the thermostability of enzyme production by Bacillus species has been well-studied by a number of researchers. In the present study, the Bacillus subtilis strain Rand was isolated from the contaminated soil found in Port Dickson, Malaysia. Results A thermostable organic solvent-tolerant protease producer had been identified as Bacillus subtilis strain Rand, based on the 16S rRNA analysis conducted, as well as the morphological characteristics and biochemical properties. The production of the thermostable organic solvent-tolerant protease was optimized by varying various physical culture conditions. Inoculation with 5.0% (v/v of (AB600 = 0.5 inoculum size, in a culture medium (pH 7.0 and incubated for 24 h at 37°C with 200 rpm shaking, was the best culture condition which resulted in the maximum growth and production of protease (444.7 U/ml; 4042.4 U/mg. The Rand protease was not only stable in the presence of organic solvents, but it also exhibited a higher activity than in the absence of organic solvent, except for pyridine which inhibited the protease activity. The enzyme retained 100, 99 and 80% of its initial activity, after the heat treatment for 30 min at 50, 55, and 60°C, respectively. Conclusion Strain Rand has been found to be able to secrete extra-cellular thermostable organic solvent-tolerant protease into the culture medium. The protease exhibited a remarkable stability towards temperature and organic
CSIR Research Space (South Africa)
Van Heerden, A
2016-11-01
Full Text Available International Military Testing Association (IMTA) Conference, New Delhi, India, 7-11 November 2016 The formulation of a peer evaluation measure for special forces: operational forces operator traits and attitude questionnaire (SFO-TAQ) Van Heerden A...
Nakamura, Hitomi; Oda-Ueda, Naoko; Ueda, Tadashi; Ohkuri, Takatoshi
2018-01-01
We constructed a system for expressing the Fab of the therapeutic human monoclonal antibody adalimumab at a yield of 20 mg/L in the methylotrophic yeast Pichia pastoris. To examine the contribution of interchain disulfide bonds to conformational stability, we prepared adalimumab Fab from which the interchain disulfide bond at the C-terminal region at both the CH 1 and CL domains was deleted by substitution of Cys with Ala (Fab ΔSS ). DSC measurements showed that the Tm values of Fab ΔSS were approximately 5 °C lower than those of wild-type Fab, suggesting that the interchain disulfide bond contributes to conformational thermostability. Using computer simulations, we designed a novel interchain disulfide bond outside the C-terminal region to increase the stability of Fab ΔSS . The resulting Fab (mutSS Fab ΔSS ) had the mutations H:V177C and L:Q160C in Fab ΔSS , confirming the formation of the disulfide bond between CH 1 and CL. The thermostability of mutSS Fab ΔSS was approximately 5 °C higher than that of Fab ΔSS . Therefore, the introduction of the designed interchain disulfide bond enhanced the thermostability of Fab ΔSS and mitigated the destabilization caused by partial reduction of the interchain disulfide bond at the C-terminal region, which occurs in site-specific modification such as PEGylation. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Fahri Akbas
2015-02-01
Full Text Available A novel thermostable lipase from Shewanella putrefaciens was identified, expressed in Escherichia coli, characterized and used in biodiesel production. Enzyme characterization was carried out by enzyme assay, SDS-PAGE and other biochemical reactions. The recombinant lipase was found to have a molecular mass of 29 kDa and exhibited lipase activity when Tween 80 was used as the substrate. The purified enzyme showed maximum activity at pH 5.0 and at 80°C. The recombinant lipase was used for the transesterification of canola oil and waste oil. The enzyme retains 50% of its activity at 90°C for 30 minutes. It is also able to retain 20% of its activity even at 100 °C for 20 minutes. These properties of the obtained new recombinant thermostable lipase make it promising as a biocatalyst for industrial processes.
Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A
2014-01-01
The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.
Saboo, Sugandha; Tumban, Ebenezer; Peabody, Julianne; Wafula, Denis; Peabody, David S.; Chackerian, Bryce; Muttil, Pavan
2016-01-01
Existing vaccines against human papillomavirus (HPV) require continuous cold-chain storage. Previously, we developed a bacteriophage virus-like particle (VLP) based vaccine for Human Papillomavirus (HPV) infection, which elicits broadly neutralizing antibodies against diverse HPV types. Here, we formulated these VLPs into a thermostable dry powder using a multi-component excipient system and by optimizing the spray drying parameters using a half-factorial design approach. Dry powder VLPs were stable after spray drying and after long-term storage at elevated temperatures. Immunization of mice with a single dose of reconstituted dry powder VLPs that were stored at 37°C for more than a year elicited high anti-L2 IgG antibody titers. Spray dried thermostable, broadly protective L2 bacteriophage VLPs vaccine could be accessible to remote regions of the world (where ~84% of cervical cancer patients reside) by eliminating the cold-chain requirement during transportation and storage. PMID:27019231
International Nuclear Information System (INIS)
Roy, Sumana; Choudhury, Debi; Chakrabarti, Chandana; Biswas, Sampa; Dattagupta, J. K.
2011-01-01
The crystallization of the precursor of a thermostable variant of papain and the collection of diffraction data to 2.6 Å resolution are reported. The crystallization of a recombinant thermostable variant of pro-papain has been carried out. The mutant pro-enzyme was expressed in Escherichia coli as inclusion bodies, refolded, purified and crystallized. The crystals belonged to space group P2 1 , with unit-cell parameters a = 42.9, b = 74.8, c = 116.5 Å, β = 93.0°, and diffracted to 2.6 Å resolution using synchrotron radiation. Assuming the presence of two molecules in the asymmetric unit, the calculated Matthews coefficient is 2.28 Å 3 Da −1 , corresponding to a solvent content of 46%. Initial attempts to solve the structure using molecular-replacement techniques were successful
Munk, Aisha J L; Wielpuetz, Catrin; Osinsky, Roman; Müller, Erik M; Grant, Phillip; Hennig, Jürgen
2016-01-01
Early and late event-related potential (ERP) responses, representing early subconscious and late motivational processes, were recorded for positive emotional words related to 'wanting' and 'liking', in dependence of the dopamine-related Taq1A genotype (ANKK1/DRD2). Research suggests that 'wanting' as opposed to 'liking' is related to dopaminergic processes. Therefore, it was hypothesized that risk allele carriers of the Taq1A polymorphism exhibit late ERP changes in reaction to words representing incentive motivation, i.e. 'wanting' (word categories 'lust' and 'anticipation'), but not to words representing 'liking' ('closeness'). Seventy-two male participants performed an emotional-word Stroop task during EEG recording and were genotyped according to the Taq1A polymorphism of ANKK1/DRD2. Positive emotional words related to anticipation and lust revealed blunted responses in the late positive potential (LPP) in carriers of the A1 allele, an effect absent in response to 'liking'-related words. These differences were not evident in the earlier posterior negativity (EPN). As no differences in dependence of the Taq1A genotype were observed in reaction to 'wanting'- and 'liking'-related words in the EPN, but merely in the LPP, it can be assumed that incentive-motivational stimuli only modify motivation-related ERP responses in carriers of the A1 allele of the Taq1A polymorphism, indicating the role of dopamine in late ERP components. © 2016 S. Karger AG, Basel.
Murray, V
1999-01-01
This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.
Cytoplasmic expression of a thermostable invertase from Thermotoga maritima in Lactococcus lactis.
Pek, Han Bin; Lim, Pei Yu; Liu, Chengcheng; Lee, Dong-Yup; Bi, Xuezhi; Wong, Fong Tian; Ow, Dave Siak-Wei
2017-05-01
To evaluate the secretory and cytoplasmic expression of a thermostable Thermogata maritima invertase in Lactococcus lactis. The thermostable invertase from T. maritima was cloned with and without the USP45 secretory peptide into the pNZ8148 vector for nisin-inducible expression in L. lactis. The introduction of an USP45 secretion peptide at the N-terminal of the enzyme led to a loss of protein solubility. Computational homology modeling and hydrophobicity studies indicated that the USP45 peptide exposes a stretch of hydrophobic amino acids on the protein surface resulting in lower solubility. Removal of the USP45 secretion peptide allowed a soluble and functional invertase to be expressed intracellularly in L. lactis. Immobilized metal affinity chromatography purification of the cell lysate with nickel-NTA gave a single protein band on SDS-PAGE, while E. coli-expressed invertase consistently co-purified with an additional band. The yields of the purified invertase from E. coli and L. lactis were 14.1 and 6.3 mg/l respectively. Invertase can be expressed in L. lactis and purified in a functional form. L. lactis is a suitable host for the production of food-grade invertase for use in the food and biotechnology industries.
Thermostating extended Lagrangian Born-Oppenheimer molecular dynamics.
Martínez, Enrique; Cawkwell, Marc J; Voter, Arthur F; Niklasson, Anders M N
2015-04-21
Extended Lagrangian Born-Oppenheimer molecular dynamics is developed and analyzed for applications in canonical (NVT) simulations. Three different approaches are considered: the Nosé and Andersen thermostats and Langevin dynamics. We have tested the temperature distribution under different conditions of self-consistent field (SCF) convergence and time step and compared the results to analytical predictions. We find that the simulations based on the extended Lagrangian Born-Oppenheimer framework provide accurate canonical distributions even under approximate SCF convergence, often requiring only a single diagonalization per time step, whereas regular Born-Oppenheimer formulations exhibit unphysical fluctuations unless a sufficiently high degree of convergence is reached at each time step. The thermostated extended Lagrangian framework thus offers an accurate approach to sample processes in the canonical ensemble at a fraction of the computational cost of regular Born-Oppenheimer molecular dynamics simulations.
Directory of Open Access Journals (Sweden)
Specht Günther
2010-03-01
Full Text Available Abstract Background Mitochondrial DNA (mtDNA is widely being used for population genetics, forensic DNA fingerprinting and clinical disease association studies. The recent past has uncovered severe problems with mtDNA genotyping, not only due to the genotyping method itself, but mainly to the post-lab transcription, storage and report of mtDNA genotypes. Description eCOMPAGT, a system to store, administer and connect phenotype data to all kinds of genotype data is now enhanced by the possibility of storing mtDNA profiles and allowing their validation, linking to phenotypes and export as numerous formats. mtDNA profiles can be imported from different sequence evaluation programs, compared between evaluations and their haplogroup affiliations stored. Furthermore, eCOMPAGT has been improved in its sophisticated transparency (support of MySQL and Oracle, security aspects (by using database technology and the option to import, manage and store genotypes derived from various genotyping methods (SNPlex, TaqMan, and STRs. It is a software solution designed for project management, laboratory work and the evaluation process all-in-one. Conclusions The extended mtDNA version of eCOMPAGT was designed to enable error-free post-laboratory data handling of human mtDNA profiles. This software is suited for small to medium-sized human genetic, forensic and clinical genetic laboratories. The direct support of MySQL and the improved database security options render eCOMPAGT a powerful tool to build an automated workflow architecture for several genotyping methods. eCOMPAGT is freely available at http://dbis-informatik.uibk.ac.at/ecompagt.
Weissensteiner, Hansi; Schönherr, Sebastian; Specht, Günther; Kronenberg, Florian; Brandstätter, Anita
2010-03-09
Mitochondrial DNA (mtDNA) is widely being used for population genetics, forensic DNA fingerprinting and clinical disease association studies. The recent past has uncovered severe problems with mtDNA genotyping, not only due to the genotyping method itself, but mainly to the post-lab transcription, storage and report of mtDNA genotypes. eCOMPAGT, a system to store, administer and connect phenotype data to all kinds of genotype data is now enhanced by the possibility of storing mtDNA profiles and allowing their validation, linking to phenotypes and export as numerous formats. mtDNA profiles can be imported from different sequence evaluation programs, compared between evaluations and their haplogroup affiliations stored. Furthermore, eCOMPAGT has been improved in its sophisticated transparency (support of MySQL and Oracle), security aspects (by using database technology) and the option to import, manage and store genotypes derived from various genotyping methods (SNPlex, TaqMan, and STRs). It is a software solution designed for project management, laboratory work and the evaluation process all-in-one. The extended mtDNA version of eCOMPAGT was designed to enable error-free post-laboratory data handling of human mtDNA profiles. This software is suited for small to medium-sized human genetic, forensic and clinical genetic laboratories. The direct support of MySQL and the improved database security options render eCOMPAGT a powerful tool to build an automated workflow architecture for several genotyping methods. eCOMPAGT is freely available at http://dbis-informatik.uibk.ac.at/ecompagt.
Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P
2001-07-01
Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.
Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.
Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik
2010-04-01
To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Sandeep Kaur Saggu
Full Text Available Proteases are one of the largest groups of hydrolytic enzymes constituting about 60% of total worldwide sales of industrial enzymes due to their wide applications in detergent, leather, textile, food and pharmaceutical industry. Microbial proteases have been preferred over animal and plant proteases because of their fundamental features and ease in production. Bacillus infantis SKS1, an alkaline protease producing bacteria has been isolated from garden soil of north India and identified using morphological, biochemical and molecular methods. 16S rDNA sequence amplified using universal primers has 99% sequence identity with corresponding gene sequence of Bacillus infantis strain FM 34 and Bacillus sp. Beige. The bacterial culture and its 16S rDNA gene sequence have been deposited to Microbial Culture Collection (Pune, India with accession number MCC 3035 and GenBank with accession number KR092197 respectively. The partially purified extract of Bacillus infantis SKS1 was thermostable and active in presence of Mg2+, acetyl acetone and laundry detergents implicating its application in industry. Production of these enzymes using this strain was maximized by optimization of various parameters including temperature, pH, media components and other growth conditions. Our results show that fructose and dextrose serve as the best carbon sources for production of these enzymes, highlighting the use of this strain for enzyme production utilizing relatively inexpensive substrates like beet molasses and corn steep liquor. Additionally, this strain showed maximum production of enzymes at 40°C similar to bacterial species used for commercial production of alkaline proteases. Characterization of alkaline proteases from this strain of Bacillus infantis and optimization of parameters for its production would help in understanding its industrial application and large-scale production.
DEFF Research Database (Denmark)
Fachmann, Mette Sofie Rousing; Josefsen, Mathilde Hasseldam; Hoorfar, Jeffrey
2015-01-01
bacterial cells in two validated real-time PCR assays for Campylobacter and Salmonella. The five best performing (based on: limit of detection (LOD), maximum fluorescence, shape of amplification curves, and amplification efficiency) were subsequently applied to meat and fecal samples. The VeriQuest q......PCR master mix performed best for both meat and fecal samples (LODs of 102 and 104 CFU ml-1 in the purest and crudest DNA extractions, respectively) compared with Tth (LOD=102 -103 and 105 -106 CFU ml-1 ). AmpliTaqGold and HotMasterTaq both performed well (LOD=102 -104 CFU ml-1 ) with meat samples and poorly...... (LOD=103 -106 CFU ml-1 /not detected) with fecal samples. CONCLUSIONS: Applying the VeriQuest qPCR master mix in the two tested real-time PCR assays could allow for simpler sample preparation and thus a reduction in cost. SIGNIFICANCE AND IMPACT OF STUDY: This work exemplifies a cost-effective strategy...
Impact of two different commercial DNA extraction methods on BK virus viral load
Directory of Open Access Journals (Sweden)
Massimiliano Bergallo
2016-03-01
Full Text Available Background and aim: BK virus, a member of human polyomavirus family, is a worldwide distributed virus characterized by a seroprevalence rate of 70-90% in adult population. Monitoring of viral replication is made by evaluation of BK DNA by quantitative polymerase chain reaction. Many different methods can be applied for extraction of nucleic acid from several specimens. The aim of this study was to assess the impact of two different DNA extraction procedure on BK viral load. Materials and methods: DNA extraction procedure including the Nuclisens easyMAG platform (bioMerieux, Marcy l’Etoile, France and manual QIAGEN extraction (QIAGEN Hilden, Germany. BK DNA quantification was performed by Real Time TaqMan PCR using a commercial kit. Result and discussion: The samples capacity, cost and time spent were compared for both systems. In conclusion our results demonstrate that automated nucleic acid extraction method using Nuclisense easyMAG was superior to manual protocol (QIAGEN Blood Mini kit, for the extraction of BK virus from serum and urine specimens.
Xie, Ning; Ruprich-Robert, Gwenaël; Silar, Philippe; Chapeland-Leclerc, Florence
2015-03-01
Plant biomass degradation by fungi is a critical step for production of biofuels, and laccases are common ligninolytic enzymes envisioned for ligninolysis. Bilirubin oxidases (BODs)-like are related to laccases, but their roles during lignocellulose degradation have not yet been fully investigated. The two BODs of the ascomycete fungus Podospora anserina were characterized by targeted gene deletions. Enzymatic assay revealed that the bod1(Δ) and bod2(Δ) mutants lost partly a thermostable laccase activity. A triple mutant inactivated for bod1, bod2 and mco, a previously investigated multicopper oxidase gene distantly related to laccases, had no thermostable laccase activity. The pattern of fruiting body production in the bod1(Δ) bod2(Δ) double mutant was changed. The bod1(Δ) and bod2(Δ) mutants were reduced in their ability to grow on ligneous and cellulosic materials. Furthermore, bod1(Δ) and bod2(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and triple mutants were more affected than single mutants, evidencing redundancy of function among BODs and mco. Overall, the data show that bod1, bod2 and mco code for non-canonical thermostable laccases that participate in the degradation of lignocellulose. Thanks to their thermal stability, these enzymes may be more promising candidate for biotechnological application than canonical laccases. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Liu, Yi; Cui, Wenjing; Liu, Zhongmei; Cui, Youtian; Xia, Yuanyuan; Kobayashi, Michihiko; Zhou, Zhemin
2014-09-01
Self-assembling amphipathic peptides (SAPs) are the peptides that can spontaneously assemble into ordered nanostructures. It has been reported that the attachment of SAPs to the N- or C-terminus of an enzyme can benefit the thermo-stability of the enzyme. Here, we discovered that the thermo-stability and product tolerance of nitrile hydratase (NHase) were enhanced by fusing with two of the SAPs (EAK16 and ELK16). When the ELK16 was fused to the N-terminus of β-subunit, the resultant NHase (SAP-NHase-2) became an active inclusion body; EAK16 fused NHase in the N-terminus of β-subunit (SAP-NHase-1) and ELK16 fused NHase in the C-terminus of β-subunit (SAP-NHase-10) did not affect NHase solubility. Compared with the deactivation of the wild-type NHase after 30 min incubation at 50°C, SAP-NHase-1, SAP-NHase-2 and SAP-NHase-10 retained 45%, 30% and 50% activity; after treatment in the buffer containing 10% acrylamide, the wild-type retained 30% activity, while SAP-NHase-1, SAP-NHase-2 and SAP-NHase-10 retained 52%, 42% and 55% activity. These SAP-NHases with enhanced thermo-stability and product tolerance would be helpful for further industrial applications of the NHase. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Two Family B DNA Polymerases From Aeropyrum pernix, Based on Revised Translational Frames
Directory of Open Access Journals (Sweden)
Katsuya Daimon
2018-04-01
Full Text Available Living organisms are divided into three domains, Bacteria, Eukarya, and Archaea. Comparative studies in the three domains have provided useful information to understand the evolution of the DNA replication machinery. DNA polymerase is the central enzyme of DNA replication. The presence of multiple family B DNA polymerases is unique in Crenarchaeota, as compared with other archaeal phyla, which have a single enzyme each for family B (PolB and family D (PolD. We analyzed PolB1 and PolB3 in the hyperthermophilic crenarchaeon, Aeropyrum pernix, and found that they are larger proteins than those predicted from the coding regions in our previous study and from public database annotations. The recombinant larger PolBs exhibited the same DNA polymerase activities as previously reported. However, the larger PolB3 showed remarkably higher thermostability, which made this enzyme applicable to PCR. In addition, the high tolerance to salt and heparin suggests that PolB3 will be useful for amplification from the samples with contaminants, and therefore it has a great potential for diagnostic use in the medical and environmental field.
Protein features as determinants of wild-type glycoside hydrolase thermostability
DEFF Research Database (Denmark)
Geertz-Hansen, Henrik Marcus; Kiemer, Lars; Nielsen, Morten
2017-01-01
-silico methods guiding the discovery process would be of high value. To develop such an in-silico method and provide the data foundation of it, we determined the melting temperatures of 602 fungal glycoside hydrolases from the families GH5, 6, 7, 10, 11, 43 and AA9 (formerly GH61). We, then used sequence...... and homology modeled structure information of these enzymes to develop the ThermoP melting temperature prediction method. Futhermore, in the context of thermostability, we determined the relative importance of 160 molecular features, such as amino acid frequencies and spatial interactions, and exemplified...
EIJSINK, VGH; VRIEND, G; VANDERZEE, [No Value; VANDENBURG, B; VENEMA, G
1992-01-01
In an attempt to increase the thermostability of the neutral proteinase of Bacillus stearothermophilus the buried Ala-170 was replaced by serine. Molecular-dynamics simulations showed that Ser-170 stabilizes the enzyme by formation of an internal hydrogen bond. In addition, the hydroxy group of
Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.
We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene
DEFF Research Database (Denmark)
Søndergaard, Mette Sofie Rousing; Löfström, Charlotta; Al-Habib, Zahra Fares Sayer
DNA extractions and intermediate or bad with the crude extractions, while TaKaRa ExTaq HS only performed well with the purest extractions of fecal samples and intermediate with semi-automated magnetic beads based extracted fecal samples. In conclusion, our data shows that exchanging the DNA polymerase......Diagnostic analyses of foodborne pathogens are increasingly based on molecular methods such as PCR, which can improve the sensitivity and reduce the analysis time. The core of PCR is the enzyme performing the reaction: the DNA polymerase. Changing the polymerase can influence the sensitivity...... commercially available polymerases and four master mixes in two validated PCR assays, for Campylobacter and Salmonella, respectively, to develop more sensitive, robust and cost effective assays. The polymerases were screened on purified DNA and the five best performing, for each PCR assay, were then applied...
Directory of Open Access Journals (Sweden)
Boris Pastorino
Full Text Available As a partner of the European Virus Archive (EVA FP7 project, our laboratory maintains a large collection of freeze-dried viruses. The distribution of these viruses to academic researchers, public health organizations and industry is one major aim of the EVA consortium. It is known that lyophilization requires appropriate stabilizers to prevent inactivation of the virus. However, few studies have investigated the influence of different stabilizers and lyophilization protocols on the thermostability of different viruses. In order to identify optimal lyophilization conditions that will deliver maximum retention of viral infectivity titre, different stabilizer formulations containing trehalose, sorbitol, sucrose or foetal bovine serum were evaluated for their efficacy in stabilizing a representative panel of freeze dried viruses at different storage temperatures (-20°C, +4°C and +20°C for one week, the two latter mimicking suboptimal shipping conditions. The Tissue Culture Infectious Dose 50% (TCID50 assay was used to compare the titres of infectious virus. The results obtained using four relevant and model viruses (enveloped/non enveloped RNA/DNA viruses still serve to improve the freeze drying conditions needed for the development and the distribution of a large virus collection.
Zhang, Zhen; Wang, Bao-Jie; Guan, Hong-Yu; Pang, Hao; Xuan, Jin-Feng
2009-11-01
Reducing amplicon sizes has become a major strategy for analyzing degraded DNA typical of forensic samples. However, amplicon sizes in current mini-short tandem repeat-polymerase chain reaction (PCR) and mini-sequencing assays are still not suitable for analysis of severely degraded DNA. In this study, we present a multiplex typing method that couples ligase detection reaction with PCR that can be used to identify single nucleotide polymorphisms and small-scale insertion/deletions in a sample of severely fragmented DNA. This method adopts thermostable ligation for allele discrimination and subsequent PCR for signal enhancement. In this study, four polymorphic loci were used to assess the ability of this technique to discriminate alleles in an artificially degraded sample of DNA with fragment sizes <100 bp. Our results showed clear allelic discrimination of single or multiple loci, suggesting that this method might aid in the analysis of extremely degraded samples in which allelic drop out of larger fragments is observed.
International Nuclear Information System (INIS)
Bhuiya, Mohammad Wadud; Suryadi, Jimmy; Zhou, Zholi; Brown, Bernard Andrew II
2013-01-01
The crystal structure of A. pernix L7Ae is reported, providing insight into the extreme thermostability of this protein. Archaeal ribosomal protein L7Ae is a multifunctional RNA-binding protein that directs post-transcriptional modification of archaeal RNAs. The L7Ae protein from Aeropyrum pernix (Ap L7Ae), a member of the Crenarchaea, was found to have an extremely high melting temperature (>383 K). The crystal structure of Ap L7Ae has been determined to a resolution of 1.56 Å. The structure of Ap L7Ae was compared with the structures of two homologs: hyperthermophilic Methanocaldococcus jannaschii L7Ae and the mesophilic counterpart mammalian 15.5 kD protein. The primary stabilizing feature in the Ap L7Ae protein appears to be the large number of ion pairs and extensive ion-pair network that connects secondary-structural elements. To our knowledge, Ap L7Ae is among the most thermostable single-domain monomeric proteins presently observed
Hesampour, Ardeshir; Siadat, Seyed Ehsan Ranaei; Malboobi, Mohammad Ali; Mohandesi, Nooshin; Arab, Seyed Shahriar; Ghahremanpour, Mohammad Mehdi
2015-03-01
Phytase efficiently catalyzes the hydrolysis of phytate to phosphate; it can be utilized as an animal supplement to provide animals their nutrient requirements for phosphate and to mitigate environmental pollution caused by unutilized feed phosphate. Owing to animal feed being commonly pelleted at 70 to 90 °C, phytase with a sufficiently high thermal stability is desirable. Based on the crystal structure of PhyA and bioinformatics analysis at variant heat treatments, 12 single and multiple mutants were introduced by site-directed mutagenesis in order to improve phytase thermostability. Mutated constructs were expressed in Pichia pastoris. The manipulated phytases were purified; their biochemical and kinetic investigation revealed that while the thermostability of six mutants was improved, P9 (T314S Q315R V62N) and P12 (S205N S206A T151A T314S Q315R) showed the highest heat stability (P phytase to be used as an animal feed supplement.
Directory of Open Access Journals (Sweden)
Hongde An
2015-11-01
Conclusions: This is the first identified thermo activated and thermostable laccase in brown rot fungi. This investigation will contribute to understanding the roles played by laccases in brown rot fungi.
Engineering of a DNA Polymerase for Direct m6 A Sequencing.
Aschenbrenner, Joos; Werner, Stephan; Marchand, Virginie; Adam, Martina; Motorin, Yuri; Helm, Mark; Marx, Andreas
2018-01-08
Methods for the detection of RNA modifications are of fundamental importance for advancing epitranscriptomics. N 6 -methyladenosine (m 6 A) is the most abundant RNA modification in mammalian mRNA and is involved in the regulation of gene expression. Current detection techniques are laborious and rely on antibody-based enrichment of m 6 A-containing RNA prior to sequencing, since m 6 A modifications are generally "erased" during reverse transcription (RT). To overcome the drawbacks associated with indirect detection, we aimed to generate novel DNA polymerase variants for direct m 6 A sequencing. Therefore, we developed a screen to evolve an RT-active KlenTaq DNA polymerase variant that sets a mark for N 6 -methylation. We identified a mutant that exhibits increased misincorporation opposite m 6 A compared to unmodified A. Application of the generated DNA polymerase in next-generation sequencing allowed the identification of m 6 A sites directly from the sequencing data of untreated RNA samples. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.
Directory of Open Access Journals (Sweden)
Valentina di Rienzo
Full Text Available In tomato, resistance to Tomato spotted wilt virus (TSWV is conferred by the dominant gene, designated Sw-5. Virulent Sw-5 resistance breaking (SRB mutants of TSWV have been reported on Sw-5 tomato cultivars. Two different PCR-based allelic discrimination techniques, namely Custom TaqMan™ SNP Genotyping and high-resolution melting (HRM assays, were developed and compared for their ability to distinguish between avirulent (Sw-5 non-infecting, SNI and SRB biotypes. TaqMan assays proved to be more sensitive (threshold of detection in a range of 50-70 TSWV RNA copies and more reliable than HRM, assigning 25 TSWV isolates to their correct genotype with an accuracy of 100%. Moreover, the TaqMan SNP assays were further improved developing a rapid and simple protocol that included crude leaf extraction for RNA template preparations. On the other hand, HRM assays showed higher levels of sensitivity than TaqMan when used to co-detect both biotypes in different artificial mixtures. These diagnostic assays contributed to gain preliminary information on the epidemiology of TSWV isolates in open field conditions. In fact, the presented data suggest that SRB isolates are present as stable populations established year round, persisting on both winter (globe artichoke and summer (tomato crops, in the same cultivated areas of Southern Italy.
Directory of Open Access Journals (Sweden)
Zhiguo Chen
2013-01-01
Full Text Available Bacillus amyloliquefaciens ribonuclease Barnase (RNase Ba is a 12 kD (kilodalton small extracellular ribonuclease. It has broad application prospects in agriculture, clinical medicine, pharmaceutical, and so forth. In this work, the thermal stability of Barnase has been studied using molecular dynamics simulation at different temperatures. The present study focuses on the contribution of noncovalent intramolecular interaction to protein stability and how they affect the thermal stability of the enzyme. Profiles of root mean square deviation and root mean square fluctuation identify thermostable and thermosensitive regions of Barnase. Analyses of trajectories in terms of secondary structure content, intramolecular hydrogen bonds and salt bridge interactions indicate distinct differences in different temperature simulations. In the simulations, Four three-member salt bridge networks (Asp8-Arg110-Asp12, Arg83-Asp75-Arg87, Lys66-Asp93-Arg69, and Asp54-Lys27-Glu73 have been identified as critical salt bridges for thermostability which are maintained stably at higher temperature enhancing stability of three hydrophobic cores. The study may help enlighten our knowledge of protein structural properties, noncovalent interactions which can stabilize secondary peptide structures or promote folding, and also help understand their actions better. Such an understanding is required for designing efficient enzymes with characteristics for particular applications at desired working temperatures.
Farnoosh, Gholamreza; Khajeh, Khosro; Latifi, Ali Mohammad; Aghamollaei, Hossein
2016-12-01
The organophosphorus hydrolase (OPH) has been used to degrade organophosphorus chemicals, as one of the most frequently used decontamination methods. Under chemical and thermal denaturing conditions, the enzyme has been shown to unfold. To utilize this enzyme in various applications, the thermal stability is of importance. The engineering of de novo disulphide bridges has been explored as a means to increase the thermal stability of enzymes in the rational method of protein engineering. In this study, Disulphide by Design software, homology modelling and molecular dynamics simulations were used to select appropriate amino acid pairs for the introduction of disulphide bridge to improve protein thermostability. The thermostability of the wild-type and three selected mutant enzymes were evaluated by half-life, delta G inactivation (ΔGi) and structural studies (fluorescence and far-UV CD analysis). Data analysis showed that half-life of A204C/T234C and T128C/E153C mutants were increased up to 4 and 24 min, respectively; however, for the G74C/A78C mutant, the half-life was decreased up to 9 min. For the T128C/E124C mutant, both thermal stability and Catalytic efficiency (kcat) were also increased. The half-life and ΔGi results were correlated to the obtained information from structural studies by circular dichroism (CD) spectrometry and extrinsic fluorescence experiments; as rigidity increased in A204C/T2234C and T128C/E153C mutants, half-life and ΔGi also increased. For G74C/A78C mutant, these parameters decreased due to its higher flexibility. The results were submitted a strong evidence for the possibility to improve the thermostability of OPH enzyme by introducing a disulphide bridge after bioinformatics design, even though this design would not be always successful.
Qu, X S; Wanner, L A; Christ, B J
2011-03-01
To develop a multiplex real-time PCR assay using TaqMan probes for the simultaneous detection and discrimination of potato powdery scab and common scab, two potato tuber diseases with similar symptoms, and the causal pathogens Spongospora subterranea and plant pathogenic Streptomyces spp. Real-time PCR primers and a probe for S. subterranea were designed based on the DNA sequence of the ribosomal RNA ITS2 region. Primers and a probe for pathogenic Streptomyces were designed based on the DNA sequence of the txtAB genes. The two sets of primer pairs and probes were used in a single real-time PCR assay. The multiplex real-time PCR assay was confirmed to be specific for S. subterranea and pathogenic Streptomyces. The assay detected DNA quantities of 100 fg for each of the two pathogens and linear responses and high correlation coefficients between the amount of DNA and C(t) values for each pathogen were achieved. The presence of two sets of primer pairs and probes and of plant extracts did not alter the sensitivity and efficiency of multiplex PCR amplification. Using the PCR assay, we could discriminate between powdery scab and common scab tubers with similar symptoms. Common scab and powdery scab were detected in some tubers with no visible symptoms. Mixed infections of common scab and powdery scab on single tubers were also revealed. This multiplex real-time PCR assay is a rapid, cost efficient, specific and sensitive tool for the simultaneous detection and discrimination of the two pathogens on infected potato tubers when visual symptoms are inconclusive or not present. Accurate and quick identification and discrimination of the cause of scab diseases on potatoes will provide critical information to potato growers and researchers for disease management. This is important because management strategies for common and powdery scab diseases are very different. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
UV light induced DNA damages and the radiation protection effects of Lingzi mushroom extract
International Nuclear Information System (INIS)
Vo Thi Thuong Lan; Dinh Ba Tuan; Ta Bich Thuan; Tran Bang Diep; Tran Minh Quynh
2016-01-01
UV light has strongly influenced on the growth of E. coli as well as caused DNA damages. Configurations of both genomic DNA and pUC 19 plasmids extracted from E. coli were significantly changed by the exposure to UV light of 254 nm and DLT, an extract of Ganoderma lucidum Lingzi mushroom. The results also revealed the radio-protective effects of DLT to UV radiation. By adding 2% DLT to its culturing suspension, the growth of E. coli was significantly decreased, whereas a low DLT amount of about 0.5% slightly improved its growth, indicated that the DLT extract can be used as a promising protective substance against UV radiation. At the molecular level, the radio-protective effects of DLT were observed for both UV treated DNA and protein. Thus, DLT can protect DNA in vivo, but not in vitro. This effect was also observed for Taq polymerase, suggested that the radioprotection effect of DLT may due to it accelerated the degradation of radicals or species that produced in the suspensions during UV exposure. (author)
Directory of Open Access Journals (Sweden)
Ma Mingxiao
Full Text Available Sacbrood virus (SBV is a picorna-like virus that affects honey bees (Apis mellifera and results in the death of the larvae. Several procedures are available to detect Chinese SBV (CSBV in clinical samples, but not to estimate the level of CSBV infection. The aim of this study was develop an assay for rapid detection and quantification of this virus. Primers and probes were designed that were specific for CSBV structural protein genes. A TaqMan minor groove binder (MGB probe-based, fluorescence real-time quantitative PCR was established. The specificity, sensitivity and stability of the assay were assessed; specificity was high and there were no cross-reactivity with healthy larvae or other bee viruses. The assay was applied to detect CSBV in 37 clinical samples and its efficiency was compared with clinical diagnosis, electron microscopy observation, and conventional RT-PCR. The TaqMan MGB-based probe fluorescence real-time quantitative PCR for CSBV was more sensitive than other methods tested. This assay was a reliable, fast, and sensitive method that was used successfully to detect CSBV in clinical samples. The technology can provide a useful tool for rapid detection of CSBV. This study has established a useful protocol for CSBV testing, epidemiological investigation, and development of animal models.
Molecular Detection of Leptospiral DNA in Environmental Water on St. Kitts
Directory of Open Access Journals (Sweden)
Julienne Rawlins
2014-08-01
Full Text Available Leptospirosis is an important waterborne zoonotic disease caused by pathogenic Leptospira. The pathogen is maintained in a population due to chronic colonization and shedding from renal tubules of domestic and wild animals. Humans and other animals become infected when they come in contact with urine from infected animals, either directly or through urine-contaminated surface water. In this study, we screened environmental water on the island of St. Kitts by using a TaqMan based real time quantitative polymerase chain reaction (qPCR targeting a pathogen specific leptospiral gene, lipl32. Our results indicate that around one-fifth of tested water sources have detectable leptospiral DNA.
Gazali, F. M.; Suwastika, I. N.
2018-03-01
α-Amylase is one of the most important enzyme in biotechnology field, especially in industrial application. Thermostability of α-Amylase produced by thermophilic bacteria improves industrial process of starch degradation in starch industry. The present study were concerned to the characterization of α-Amylase activity from indigenous thermophilic bacteria isolated from Bora hot spring, Central Sulawesi. There were 18 isolates which had successfully isolated from 90°C sediment samples of Bora hot spring and 13 of them showed amylolytic activity. The α-Amylase activity was measured qualitatively at starch agar and quantitatively based on DNS (3,5-Dinitrosalicylic acid) methods, using maltose as standard solution. Two isolates (out of 13 amylolytic bacteria), BR 002 and BR 015 showed amylolytic index of 0.8 mm and 0.5 mm respectively, after being incubated at 55°C in the 0.002% Starch Agar Medium. The α-Amylase activity was further characterized quantitatively which includes the optimum condition of pH and temperature of α-Amylase crude enzyme from each isolate. To our knowledge, this is the first report on isolation and characterization of a thermostable α-Amylase from thermophilic bacteria isolated from Central Sulawesi particularly from Bora hot spring.
International Nuclear Information System (INIS)
Palaniswami, K.S.; Thangavelu, A.; Velmurugan, R.
2005-01-01
Two Indian PPRV isolates were subjected to thermal hardening procedures to increase the proportion of temperature-resistant virions. Initial infectivity loss was compensated by titre increases on subsequent cell passages at 37 deg C. The immunogenicity of 'thermostable' viruses was assessed by virulent PPRV challenge and for safety by host animal inoculation and antibodies assessment. Vaccine viruses were not found using PCR on ocular and nasal swabs, although virus nucleic acid and antigens were demonstrated in spleen and lymph nodes by FAT and PCR. One vaccine strain (MIB187(T)) giving 100% protection (tested on only a few animals) was freeze dried and the minimum protective dose calculated. Changes in the virus genome after thermo-adaptation were examined using RT-PCR to amplify portions of the F gene, and three base changes were observed in the thermostable PPR strain (compared with the F gene sequence of the Nigerian PPRV strain). At room temperature, the titre and potency of the thermo-adapted vaccine remained constant up to one month at the10 5.5 TCID 50 level, and was 10 4.5 TCID 50 /100 μl after two months. Field trials with over 40 000 doses of the thermostable vaccine under various environmental conditions have given serum neutralization titres exceeding 2 3 and are assumed protective. (author)
Design and Testing of a Thermostable Platform for Multimerization of Single Domain Antibodies
2012-08-01
H.J. Properties , production, and applications of camelid single domain antibody fragments. Appl. Microbiol. Biot. 2007, 77, 13‒22. 2. Goldman...Conway, J.; Sherwood, L.J.; Fech, M.; Vo, B.; Liu, J.L.; Hayhurst, A. Thermostable llama single domain antibodies for detection of Botulinum A...antiparallel coiled-coil inserted. J. Mol. Bio. 2001, 306, 25‒35. 9. Liu, J.L.; Anderson, G.P.; Goldman, E.R. Isolation of anti- toxin single domain
Typing DNA profiles from previously enhanced fingerprints using direct PCR.
Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Linacre, Adrian
2017-07-01
Fingermarks are a source of human identification both through the ridge patterns and DNA profiling. Typing nuclear STR DNA markers from previously enhanced fingermarks provides an alternative method of utilising the limited fingermark deposit that can be left behind during a criminal act. Dusting with fingerprint powders is a standard method used in classical fingermark enhancement and can affect DNA data. The ability to generate informative DNA profiles from powdered fingerprints using direct PCR swabs was investigated. Direct PCR was used as the opportunity to generate usable DNA profiles after performing any of the standard DNA extraction processes is minimal. Omitting the extraction step will, for many samples, be the key to success if there is limited sample DNA. DNA profiles were generated by direct PCR from 160 fingermarks after treatment with one of the following dactyloscopic fingerprint powders: white hadonite; silver aluminium; HiFi Volcano silk black; or black magnetic fingerprint powder. This was achieved by a combination of an optimised double-swabbing technique and swab media, omission of the extraction step to minimise loss of critical low-template DNA, and additional AmpliTaq Gold ® DNA polymerase to boost the PCR. Ninety eight out of 160 samples (61%) were considered 'up-loadable' to the Australian National Criminal Investigation DNA Database (NCIDD). The method described required a minimum of working steps, equipment and reagents, and was completed within 4h. Direct PCR allows the generation of DNA profiles from enhanced prints without the need to increase PCR cycle numbers beyond manufacturer's recommendations. Particular emphasis was placed on preventing contamination by applying strict protocols and avoiding the use of previously used fingerprint brushes. Based on this extensive survey, the data provided indicate minimal effects of any of these four powders on the chance of obtaining DNA profiles from enhanced fingermarks. Copyright © 2017
Patterson, D.P.; Schwarz, B.; El-Boubbou, K.; Oost, van der J.; Prevelige, P.E.; Douglas, T.
2012-01-01
Self-assembling biological systems hold great potential for the synthetic construction of new active soft nanomaterials. Here we demonstrate the hierarchical bottom-up assembly of bacteriophage P22 virus-like particles (VLPs) that encapsulate the thermostable CelB glycosidase creating catalytically
Holt, Allison; Wootton, Sharon Chao; Mulero, Julio J; Brzoska, Pius M; Langit, Emanuel; Green, Robert L
2016-03-01
The quantification of human genomic DNA is a necessary first step in the DNA casework sample analysis workflow. DNA quantification determines optimal sample input amounts for subsequent STR (short tandem repeat) genotyping procedures, as well as being a useful screening tool to identify samples most likely to provide probative genotypic evidence. To better mesh with the capabilities of newest-generation STR analysis assays, the Quantifiler(®) HP and Quantifiler(®) Trio DNA Quantification Kits were designed for greater detection sensitivity and more robust performance with samples that contain PCR inhibitors or degraded DNA. The new DNA quantification kits use multiplex TaqMan(®) assay-based fluorescent probe technology to simultaneously quantify up to three human genomic targets, allowing samples to be assessed for total human DNA, male contributor (i.e., Y-chromosome) DNA, as well as a determination of DNA degradation state. The Quantifiler HP and Trio Kits use multiple-copy loci to allow for significantly improved sensitivity compared to earlier-generation kits that employ single-copy target loci. The kits' improved performance provides better predictive ability for results with downstream, newest-generation STR assays, and their shortened time-to-result allows more efficient integration into the forensic casework analysis workflow. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Lenka Maršálková
2014-07-01
Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.
Directory of Open Access Journals (Sweden)
Manar Fayiz Atoum
2017-01-01
Conclusions: An inverse association was found between 25(OHD serum level and breast cancer risk. Statistical difference was also found between different VDR TaqI genotypes and circulating levels of 25(OHD among Jordanian females with breast cancer.
International Nuclear Information System (INIS)
Inoue, Ippei; Yasueda, Hisashi; Yamauchi, Hirofumi; Okamoto, Naofumi; Toyoda, Kenichi; Horita, Masahiro; Ishikawa, Yasuaki; Uraoka, Yukiharu; Yamashita, Ichiro
2015-01-01
We produced a thermostable TiO_2-(anatase)-coated multi-walled-carbon-nanotube (MWNT) nanocomposite for use in dye-sensitized solar cells (DSSCs) using biological supuramolecules as catalysts. We synthesized two different sizes of iron oxide nanoparticles (NPs) and arrayed the NPs on a silicon substrate utilizing two kinds of genetically modified cage-shaped proteins with silicon-binding peptide aptamers on their outer surfaces. Chemical vapor deposition (CVD) with the vapor–liquid-solid phase (VLS) method was applied to the substrate, and thermostable MWNTs with a diameter of 6 ± 1 nm were produced. Using a genetically modified cage-shaped protein with carbon-nanomaterials binding and Ti-mineralizing peptides as a catalyst, we were able to mineralize a titanium compound around the surface of the MWNT. The products were sintered, and thin TiO_2-layer-coated MWNTs nanocomoposites were successfully produced. Addition of a 0.2 wt% TiO_2-coated MWNT nanocomposite to a DSSC photoelectrode improved current density by 11% and decreased electric resistance by 20% compared to MWNT-free reference DSSCs. These results indicate that a nanoscale TiO_2-layer-coated thermostable MWNT structure produced by our mutant proteins works as a superior electron transfer highway within TiO_2 photoelectrodes. (paper)
Blaya, Josefa; Lacasa, Carmen; Lacasa, Alfredo; Martínez, Victoriano; Santísima-Trinidad, Ana B; Pascual, Jose A; Ros, Margarita
2015-04-01
The soil-borne pathogens Phytophthora nicotianae and P. capsici are the causal agents of root and stem rot of many plant species. Although P. capsici was considered the causal agent in one of the main pepper production areas of Spain to date, evidence of the presence of P. nicotianae was found. We aimed to survey the presence of P. nicotianae and study the variability in its populations in this area in order to improve the management of Tristeza disease. A new specific primer and a TaqMan probe were designed based on the internal transcribed spacer regions of ribosomal DNA to detect and quantify P. nicotianae. Both morphological and molecular analysis showed its presence and confirmed it to be the causal agent of the Phytophthora disease symptoms in the studied area. The genetic characterization among P. nicotianae populations showed a low variability of genetic diversity among the isolates. Only isolates of the A2 mating type were detected. Not only is a specific and early detection of P. nicotianae essential but also the study of genetic variability among isolates for the appropriate management of the disease, above all, in producing areas with favorable conditions for the advance of the disease. © 2014 Society of Chemical Industry.
GFA Taq I polymorphism and cleft lip with or without cleft palate (CL/P) risk
Dong, Lijia; Ma, Lian
2015-01-01
The transforming growth factor alpha (TGFA) Taq I polymorphism has been indicated to be correlated with cleft lip with or without cleft palate (CL/P) susceptibility, but study results are still debatable. Thus, a meta-analysis was conducted. We conducted a comprehensive search of Embase, Ovid, Web of Science, the Cochrane database, PubMed, the Chinese Biomedical Literature Database (CBM-disc, 1979-2014), the database of National Knowledge Infrastructure (CNKI, 1979-2014) and the full paper database of Chinese Science and Technology of Chongqing (VIP, 1989-2014) to identify suitable studies. There were 18 studies suitable for this meta-analysis, involving a total of 3135 cases and 3575 controls. Significantly increased CL/P risk was observed (OR = 1.49; 95% CI 1.17-1.89; P = 0.001). In subgroup analyses stratified by ethnicity, there was evidence in the Caucasian population for an association between this polymorphism and CL/P risk (OR = 1.52; 95% CI 1.14-2.02; P = 0.004). However, no significant association was found between this his polymorphism and CL/P risk in African and Hispanic populations. According to a specific CL/P type, increased clip lip and palate risk and clip palate risk were found (OR = 1.38; 95% CI 1.10-1.73; P = 0.005; OR = 1.29; 95% CI 1.01-1.66; P = 0.042). In conclusion, the present meta-analysis found that the TGFA Taq I polymorphism may be associated with CL/P susceptibility. PMID:26064247
U'Ren, Jana M.; Van Ert, Matthew N.; Schupp, James M.; Easterday, W. Ryan; Simonson, Tatum S.; Okinaka, Richard T.; Pearson, Talima; Keim, Paul
2005-01-01
A TaqMan allelic-discrimination assay designed around a synonymous single-nucleotide polymorphism was used to genotype Burkholderia pseudomallei and Burkholderia mallei isolates. The assay rapidly identifies and discriminates between these two highly pathogenic bacteria and does not cross-react with genetic near neighbors, such as Burkholderia thailandensis and Burkholderia cepacia.
Kim, Jung Hyun; Yun, Eun Ju; Seo, Nari; Yu, Sora; Kim, Dong Hyun; Cho, Kyung Mun; An, Hyun Joo; Kim, Jae-Han; Choi, In-Geol; Kim, Kyoung Heon
2017-02-01
The main carbohydrate of red macroalgae is agarose, a heterogeneous polysaccharide composed of D-galactose and 3,6-anhydro-L-galactose. When saccharifying agarose by enzymes, the unique physical properties of agarose, namely the sol-gel transition and the near-insolubility of agarose in water, limit the accessibility of agarose to the enzymes. Due to the lower accessibility of agarose to enzymes in the gel state than to the sol state, it is important to prevent the sol-gel transition by performing the enzymatic liquefaction of agarose at a temperature higher than the sol-gel transition temperature of agarose. In this study, a thermostable endo-type β-agarase, Aga16B, originating from Saccharophagus degradans 2-40 T , was characterized and introduced in the liquefaction process. Aga16B was thermostable up to 50 °C and depolymerized agarose mainly into neoagarooligosaccharides with degrees of polymerization 4 and 6. Aga16B was applied to enzymatic liquefaction of agarose at 45 °C, which was above the sol-gel transition temperature of 1 % (w/v) agarose (∼35 °C) when cooling agarose. This is the first systematic demonstration of enzymatic liquefaction of agarose, enabled by determining the sol-gel temperature of agarose under specific conditions and by characterizing the thermostability of an endo-type β-agarase.
The ''THERMOST'' for analysing thermo-structural behaviour of LWR fuel rod under PCI conditions
International Nuclear Information System (INIS)
Nuno, H.; Ogawa, S.; Kobayashi, H.
1983-01-01
As one of the methods for evaluating the fuel rod performances under power ramping or load following operations, the combined ''FROST'' and ''THERMOST'' system has been developed and being brought into practical use. The former had already been presented at Blackpool Meeting in 1978, and the latter is going to be presented in this paper. The major purpose of the THERMOST is to analyse very detailed thermal and structural fuel behaviours in a rather localized part of fuel rod whereas the FROST deals with whole-rod-wide general performances. The code handles 2-dimensional thermal and structural analyses simultaneously by using finite element method, in axial section wide or in lateral section wide. It consists of a fundamental FEM system of generalized constitution and its surrounding subroutine system which characterizes fuel behaviours such as temperature distribution, thermal expansion, elastoplasticity, creep, cracking, swelling, growth, etc. Thermal analysis is handled by heat conduction and heat transfer elements (6 kinds) and structural analysis by axisymmetric ring and lateral plane elements (6 kinds). Boundary problems such as contact, friction and cracking are treated by gap and crack elements. A sample calculation of PCI performance on a PWR fuel rod under ramping condition is presented with some inpile test data. (author)
A TaqI RFLP in the locus D9S29 on human chromosome 9
Energy Technology Data Exchange (ETDEWEB)
Weitnauer, L.; Antonelli, A.; Pandolfo, M. (Istituto Neurologico, Milan (Italy))
1989-12-25
Phage LAMP92 was isolated from the Los Alamos chromosome 9 library and its 3.8 Kbp insert was subcloned into the Eco RI site of pUC19. Taq I identifies a three allele RFLP (B1: 7.6 kb + 3 kb, B2: 14 kb + 3 kb, B3: 17 kb). A two allele Pvu II RFLP detected by the same probe was described previously. It was localized on 9q22-q31 by in situ hybridization and linkage analysis. Co-dominant segregation was shown in 14 informative families.
Directory of Open Access Journals (Sweden)
Elliot Bradshaw
2017-09-01
Full Text Available Small mitochondrial genomes can behave as selfish elements by displacing wild-type genomes regardless of their detriment to the host organism. In the budding yeast Saccharomyces cerevisiae, small hypersuppressive mtDNA transiently coexist with wild-type in a state of heteroplasmy, wherein the replicative advantage of the small mtDNA outcompetes wild-type and produces offspring without respiratory capacity in >95% of colonies. The cytosolic enzyme ribonucleotide reductase (RNR catalyzes the rate-limiting step in dNTP synthesis and its inhibition has been correlated with increased petite colony formation, reflecting loss of respiratory function. Here, we used heteroplasmic diploids containing wild-type (rho+ and suppressive (rho− or hypersuppressive (HS rho− mitochondrial genomes to explore the effects of RNR activity on mtDNA heteroplasmy in offspring. We found that the proportion of rho+ offspring was significantly increased by RNR overexpression or deletion of its inhibitor, SML1, while reducing RNR activity via SML1 overexpression produced the opposite effects. In addition, using Ex Taq and KOD Dash polymerases, we observed a replicative advantage for small over large template DNA in vitro, but only at low dNTP concentrations. These results suggest that dNTP insufficiency contributes to the replicative advantage of small mtDNA over wild-type and cytosolic dNTP synthesis by RNR is an important regulator of heteroplasmy involving small mtDNA molecules in yeast.
Zheng, Wenjun; Wang, Qingsong; Bi, Qun
2016-04-01
Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.
Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong
2018-02-01
Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.
Yang, Zhongsi; Xu, Lei; Liu, Li; Feng, Qiuxia; Zhang, Longmu; Ma, Weijuan; Saldanha, John; Wang, Mingmin; Zhao, Lin
2013-10-01
The Roche cobas TaqScreen MPX test was used to evaluate the rate of hepatitis B surface antigen (HBsAg)-negative donations that were hepatitis B virus (HBV) DNA reactive from June 2010 to January 2011 in Qingdao, China. HBsAg-negative samples from 65,800 voluntary blood donors were tested with the cobas TaqScreen MPX test in pools of 6 on the Roche cobas s 201 blood screening platform. Samples positive for HBV DNA and negative for HBsAg were quantitated with the Roche COBAS AmpliPrep/COBAS TaqMan HBV test. In addition, serologic tests for HBsAg, hepatitis B surface antibody, anti-hepatitis B core antigen (anti-HBc), anti-hepatitis B e antigen (anti-HBe), and hepatitis B e antigen (HBe) were done using the Roche electrochemiluminescence immunoassay. A total of 80 nucleic acid amplification technology (NAT) test-reactive pools were identified and 59 pools (74%) resolved to a reactive sample. All samples were HBV DNA reactive and the viral load in each sample was quantitated. The viral loads of the samples ranged from less than 20 to 34,600 IU/mL; 13 samples (22%) had viral loads of more than 20 IU/mL, 27 samples (45.8%) had viral loads of less than 20 IU/mL, and 19 samples (32.2%) had undetectable viral loads. Of the 59 NAT-reactive samples, 40 (67.8%) were anti-HBc positive. Fifteen of the 59 samples could not be confirmed as NAT reactive either by an alternative NAT test or by serology. The HBV NAT yield in blood donors in Qingdao is 0.06% (38/65,800). This study confirmed the value of NAT for interdicting HBV-positive donations and preventing transfusion-transmitted HBV infections. © 2013 American Association of Blood Banks.
Directory of Open Access Journals (Sweden)
Alessandra Colombini
Full Text Available Three adjacent single nucleotide polymorphisms of the vitamin D receptor gene (VDR BsmI (rs1544410, ApaI (rs7975232, and TaqI (rs731236 are commonly studied in several pathologies. We aimed to evaluate the distribution of VDR BsmI, ApaI, and TaqI allele, genotype, and haplotype frequencies in an Italian cohort of 266 patients with lumbar spine disorders assessed by Magnetic Resonance Imaging and 252 asymptomatic controls. The exposure to putative risk factors was evaluated by a questionnaire. Polymorphisms were detected by PCR-RFLP and TaqMan® SNP Genotyping Assay. The results were statistically adjusted for the identified conventional risk factors. The three SNPs were in linkage disequilibrium. For all cases BbAaTT was a 3-fold risk factor OR = 3.38, whereas bbAATT (OR = 0.22, and bbaaTT (OR = 0.47 genotypes were found to be protective. Specifically, for patients affected by disc herniation only (n = 88 and all lumbar pathologies excluding stenosis and/or spondylolistesis (n = 215 B allele, Bb, Aa, and BbAaTT genotypes were risky, whereas b allele, bb, aa, and bbaaTT genotypes were protective. In patients affected by osteochondrosis with or without disc hernation (n = 50, T allele, Aa, and bbAaTT genotypes were risky, whereas t allele, AA, tt genotypes were protective. In patients affected by stenosis and/or spondylolistesis (n = 51 no significant associations were found. This is the first study showing an association of the three genetic VDR variants BsmI, ApaI, and TaqI and lumbar spine pathologies. Our study contributes to delineate genetic risk factors for specific subgroups of patients with lumbar spine pathologies highlighting the importance of haplotype analysis, and of detailed clinical evaluation of the patients for identification of genetic biomarkers.
Kashiwagi, Sayo; Kuraoka, Isao; Fujiwara, Yoshie; Hitomi, Kenichi; Cheng, Quen J.; Fuss, Jill O.; Shin, David S.; Masutani, Chikahide; Tainer, John A.; Hanaoka, Fumio; Iwai, Shigenori
2010-01-01
Human DNA polymerase η (HsPolη) plays an important role in translesion synthesis (TLS), which allows for replication past DNA damage such as UV-induced cis-syn cyclobutane pyrimidine dimers (CPDs). Here, we characterized ApPolη from the thermophilic worm Alvinella pompejana, which inhabits deep-sea hydrothermal vent chimneys. ApPolη shares sequence homology with HsPolη and contains domains for binding ubiquitin and proliferating cell nuclear antigen. Sun-induced UV does not penetrate Alvinella's environment; however, this novel DNA polymerase catalyzed efficient and accurate TLS past CPD, as well as 7,8-dihydro-8-oxoguanine and isomers of thymine glycol induced by reactive oxygen species. In addition, we found that ApPolη is more thermostable than HsPolη, as expected from its habitat temperature. Moreover, the activity of this enzyme was retained in the presence of a higher concentration of organic solvents. Therefore, ApPolη provides a robust, human-like Polη that is more active after exposure to high temperatures and organic solvents. PMID:20936172
Guan, Wei; Shao, Jonathan; Singh, Raghuwinder; Davis, Robert E; Zhao, Tingchang; Huang, Qi
2013-02-15
A TaqMan-based real-time PCR assay was developed for specific detection of strains of X. fastidiosa causing oleander leaf scorch. The assay uses primers WG-OLS-F1 and WG-OLS-R1 and the fluorescent probe WG-OLS-P1, designed based on unique sequences found only in the genome of oleander strain Ann1. The assay is specific, allowing detection of only oleander-infecting strains, not other strains of X. fastidiosa nor other plant-associated bacteria tested. The assay is also sensitive, with a detection limit of 10.4fg DNA of X. fastidiosa per reaction in vitro and in planta. The assay can also be applied to detect low numbers of X. fastidiosa in insect samples, or further developed into a multiplex real-time PCR assay to simultaneously detect and distinguish diverse strains of X. fastidiosa that may occupy the same hosts or insect vectors. Specific and sensitive detection and quantification of oleander strains of X. fastidiosa should be useful for disease diagnosis, epidemiological studies, management of oleander leaf scorch disease, and resistance screening for oleander shrubs. Published by Elsevier B.V.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Tao; Datta, Supratim; Simmons, Blake A.; Rubin, Edward M.
2018-01-09
The present invention provides for an isolated or recombinant polypeptide comprising an amino acid sequence having at least 70% identity with the amino acid sequence of a Halorhabdus utahensis cellulase, such as Hu-CBH1, wherein said amino acid sequence has a halophilic thermostable and/or thermophilic cellobiohydrolase (CBH) activity. In some embodiments, the polypeptide has a CBH activity that is resistant to up to about 20% of ionic liquids. The present invention also provides for compositions comprising and methods using the isolated or recombinant polypeptide.
Directory of Open Access Journals (Sweden)
Fan Xinjiong
2012-03-01
Full Text Available Abstract Background Pyrethroid pesticides are broad-spectrum pest control agents in agricultural production. Both agricultural and residential usage is continuing to grow, leading to the development of insecticide resistance in the pest and toxic effects on a number of nontarget organisms. Thus, it is necessary to hunt suitable enzymes including hydrolases for degrading pesticide residues, which is an efficient "green" solution to biodegrade polluting chemicals. Although many pyrethroid esterases have consistently been purified and characterized from various resources including metagenomes and organisms, the thermostable pyrethroid esterases have not been reported up to the present. Results In this study, we identified a novel pyrethroid-hydrolyzing enzyme Sys410 belonging to familyV esterases/lipases with activity-based functional screening from Turban Basin metagenomic library. Sys410 contained 280 amino acids with a predicted molecular mass (Mr of 30.8 kDa and was overexpressed in Escherichia coli BL21 (DE3 in soluble form. The optimum pH and temperature of the recombinant Sys410 were 6.5 and 55°C, respectively. The enzyme was stable in the pH range of 4.5-8.5 and at temperatures below 50°C. The activity of Sys410 decreased a little when stored at 4°C for 10 weeks, and the residual activity reached 94.1%. Even after incubation at 25°C for 10 weeks, it kept 68.3% of its activity. The recombinant Sys410 could hydrolyze a wide range of ρ-nitrophenyl esters, but its best substrate is ρ-nitrophenyl acetate with the highest activity (772.9 U/mg. The enzyme efficiently degraded cyhalothrin, cypermethrin, sumicidin, and deltamethrin under assay conditions of 37°C for 15 min, with exceeding 95% hydrolysis rate. Conclusion This is the first report to construct metagenomic libraries from Turban Basin to obtain the thermostable pyrethroid-hydrolyzing enzyme. The recombinant Sys410 with broad substrate specificities and high activity was the most
Czajkowski, R.L.; Wolf, van der J.M.
2012-01-01
A Serratia plymuthica-specific TaqMan® assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to various
In TFIIH, XPD helicase is exclusively devoted to DNA repair.
Directory of Open Access Journals (Sweden)
Jochen Kuper
2014-09-01
Full Text Available The eukaryotic XPD helicase is an essential subunit of TFIIH involved in both transcription and nucleotide excision repair (NER. Mutations in human XPD are associated with several inherited diseases such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. We performed a comparative analysis of XPD from Homo sapiens and Chaetomium thermophilum (a closely related thermostable fungal orthologue to decipher the different molecular prerequisites necessary for either transcription or DNA repair. In vitro and in vivo assays demonstrate that mutations in the 4Fe4S cluster domain of XPD abrogate the NER function of TFIIH and do not affect its transcriptional activity. We show that the p44-dependent activation of XPD is promoted by the stimulation of its ATPase activity. Furthermore, we clearly demonstrate that XPD requires DNA binding, ATPase, and helicase activity to function in NER. In contrast, these enzymatic properties are dispensable for transcription initiation. XPD helicase is thus exclusively devoted to NER and merely acts as a structural scaffold to maintain TFIIH integrity during transcription.
Zhu, B C; Lo, J Y; Li, Y T; Li, S C; Jaynes, J M; Gildemeister, O S; Laine, R A; Ou, C Y
1992-07-01
A chitobiase gene from Vibrio parahemolyticus was cloned into plasmid pUC18 in Escherichia coli strain DH5 alpha. The plasmid construct, pC120, contained a 6.4 kb Vibrio DNA insert. The recombinant gene expressed chitobiase [EC 3.2.1.30] activity similar to that found in the native Vibrio. The enzyme was purified by ion exchange, hydroxylapatite and gel permeation chromatographies, and exhibited an apparent molecular weight of 80 kDa on SDS-polyacrylamide gel electrophoresis. Chitobiose and 6 more substrates, including beta-N-acetyl galactosamine glycosides, were hydrolyzed by the recombinant chitobiase, indicating its putative classification as an hexosaminidase [EC 3.2.1.52]. The enzyme was resistant to denaturation by 2 M NaCl, thermostable at 45 degrees C and active over a very unusual (for glycosyl hydrolases) pH range, from 4 to 10. The purified cloned chitobiase gave 4 closely focussed bands on an isoelectric focusing gel, at pH 4 to 6.5. The N-terminal 43 amino acid sequence shows no homology with other proteins in commercial databanks or in the literature, and from its N-terminal sequence, appears to be a novel protein, unrelated in sequence to chitobiases from other Vibrios reported and unrelated to hexosaminidases from other organisms.
Directory of Open Access Journals (Sweden)
Chi-Ho Chan
Full Text Available Most thermophilic proteins tend to have more salt bridges, and achieve higher thermostability by up-shifting and broadening their protein stability curves. While the stabilizing effect of salt-bridge has been extensively studied, experimental data on how salt-bridge influences protein stability curves are scarce. Here, we used double mutant cycles to determine the temperature-dependency of the pair-wise interaction energy and the contribution of salt-bridges to ΔC(p in a thermophilic ribosomal protein L30e. Our results showed that the pair-wise interaction energies for the salt-bridges E6/R92 and E62/K46 were stabilizing and insensitive to temperature changes from 298 to 348 K. On the other hand, the pair-wise interaction energies between the control long-range ion-pair of E90/R92 were negligible. The ΔC(p of all single and double mutants were determined by Gibbs-Helmholtz and Kirchhoff analyses. We showed that the two stabilizing salt-bridges contributed to a reduction of ΔC(p by 0.8-1.0 kJ mol⁻¹ K⁻¹. Taken together, our results suggest that the extra salt-bridges found in thermophilic proteins enhance the thermostability of proteins by reducing ΔC(p, leading to the up-shifting and broadening of the protein stability curves.
Wu, Tzu-Hui; Chen, Chun-Chi; Cheng, Ya-Shan; Ko, Tzu-Ping; Lin, Cheng-Yen; Lai, Hui-Lin; Huang, Ting-Yung; Liu, Je-Ruei; Guo, Rey-Ting
2014-04-10
Escherichia coli phytase (EcAppA) which hydrolyzes phytate has been widely applied in the feed industry, but the need to improve the enzyme activity and thermostability remains. Here, we conduct rational design with two strategies to enhance the EcAppA performance. First, residues near the substrate binding pocket of EcAppA were modified according to the consensus sequence of two highly active Citrobacter phytases. One out of the eleven mutants, V89T, exhibited 17.5% increase in catalytic activity, which might be a result of stabilized protein folding. Second, the EcAppA glycosylation pattern was modified in accordance with the Citrobacter phytases. An N-glycosylation motif near the substrate binding site was disrupted to remove spatial hindrance for phytate entry and product departure. The de-glycosylated mutants showed 9.6% increase in specific activity. On the other hand, the EcAppA mutants that adopt N-glycosylation motifs from CbAppA showed improved thermostability that three mutants carrying single N-glycosylation motif exhibited 5.6-9.5% residual activity after treatment at 80°C (1.8% for wild type). Furthermore, the mutant carrying all three glycosylation motifs exhibited 27% residual activity. In conclusion, a successful rational design was performed to obtain several useful EcAppA mutants with better properties for further applications. Copyright © 2014 Elsevier B.V. All rights reserved.
Boukhris, Ines; Farhat-Khemakhem, Ameny; Blibech, Monia; Bouchaala, Kameleddine; Chouayekh, Hichem
2015-09-01
The extracellular phytase produced by the Bacillus amyloliquefaciens US573 strain, isolated from geothermal soil located in Southern Tunisia was purified and characterized. This calcium-dependent and bile-stable enzyme (PHY US573) was optimally active at pH 7.5 and 70 °C. It showed a good stability at pH ranging from 4 to 10, and especially, an exceptional thermostability as it recovered 50 and 62% of activity after heating for 10 min at 100 and 90 °C, respectively. In addition, PHY US573 was found to be extremely salt-tolerant since it preserved 80 and 95% of activity in the presence of 20 g/l of NaCl and LiCl, respectively. The gene corresponding to PHY US573 was cloned. It encodes a 383 amino acids polypeptide exhibiting 99% identity with the highly thermostable phytases from Bacillus sp. MD2 and B. amyloliquefaciens DS11 (3 and 5 residues difference, respectively), suggesting the existence of common molecular determinants responsible for their remarkable heat stability. Overall, our findings illustrated that in addition to its high potential for application in feed industry, the salt tolerance of the PHY US573 phytase, may represent an exciting new avenue for improvement of phosphorus-use efficiency of salt-tolerant plants in soils with high salt and phytate content. Copyright © 2015 Elsevier B.V. All rights reserved.
Qin, Yidan; Yao, Jun; Wu, Douglas C.; Nottingham, Ryan M.; Mohr, Sabine; Hunicke-Smith, Scott; Lambowitz, Alan M.
2016-01-01
Next-generation RNA-sequencing (RNA-seq) has revolutionized transcriptome profiling, gene expression analysis, and RNA-based diagnostics. Here, we developed a new RNA-seq method that exploits thermostable group II intron reverse transcriptases (TGIRTs) and used it to profile human plasma RNAs. TGIRTs have higher thermostability, processivity, and fidelity than conventional reverse transcriptases, plus a novel template-switching activity that can efficiently attach RNA-seq adapters to target RNA sequences without RNA ligation. The new TGIRT-seq method enabled construction of RNA-seq libraries from RNA in RNA in 1-mL plasma samples from a healthy individual revealed RNA fragments mapping to a diverse population of protein-coding gene and long ncRNAs, which are enriched in intron and antisense sequences, as well as nearly all known classes of small ncRNAs, some of which have never before been seen in plasma. Surprisingly, many of the small ncRNA species were present as full-length transcripts, suggesting that they are protected from plasma RNases in ribonucleoprotein (RNP) complexes and/or exosomes. This TGIRT-seq method is readily adaptable for profiling of whole-cell, exosomal, and miRNAs, and for related procedures, such as HITS-CLIP and ribosome profiling. PMID:26554030
DEFF Research Database (Denmark)
Pedersen, Mads; Lauritzen, Henrik Klitgaard; Frisvad, Jens Christian
2007-01-01
Twenty Aspergillus strains were evaluated for production of extracellular cellulolytic and xylanolytic activities. Aspergillus brasiliensis, A. niger and A. japonicus produced the highest xylanase activities with the A. brasiliensis and A. niger strains producing thermostable beta......-xylosidases. The beta-xylosidase activities of the A. brasiliensis and A. niger strains had similar temperature and pH optima at 75 degrees C and pH 5 and retained 62% and 99%, respectively, of these activities over 1 h at 60 degrees C. At 75 degrees C, these values were 38 and 44%, respectively. Whereas A. niger...
Miura, Itaru; Takeuchi, Satoshi; Katsumi, Akihiko; Mori, Azuma; Kanno, Keiko; Yang, Qiaohui; Mashiko, Hirobumi; Numata, Yoshihiko; Niwa, Shin-Ichi
2012-02-01
The Taq1A polymorphism in the dopamine D2 receptor (DRD2) gene could be related to the response to antipsychotics. We examined the effects of the Taq1A polymorphism on the plasma monoamine metabolites during the treatment of schizophrenia with aripiprazole, a DRD2 partial agonist. Thirty Japanese patients with schizophrenia were treated with aripiprazole for 6 weeks. We measured plasma levels of homovanillic acid (pHVA) and 3-methoxy-4hydroxyphenylglycol (pMHPG) before and after treatment. The Taq1A polymorphism was genotyped with polymerase chain reaction. Aripiprazole improved the acute symptoms of schizophrenia and decreased pHVA in responders (P = 0.023) but not in nonresponders (P = 0.28). Although A1 allele carriers showed a tendency to respond to aripiprazole (61.5%) compared to A1 allele noncarriers (29.4%) (P = 0.078), there was not statistically significant difference in the response between the 2 genotype groups. There were significant effect for response (P = 0.013) and genotype × response interaction (P = 0.043) on the change of pHVA. The changes of pHVA differ between responders and nonresponders in A1 allele carriers but not in A1 allele noncarriers. There were no genotype or response effects or genotype × response interaction on the changes of the plasma levels of 3-methoxy-4hydroxyphenylglycol. Our preliminary results suggest that Taq1A polymorphism may be partly associated with changes in pHVA during acute schizophrenia.
Fan, Jing; Yang, Haowen; Liu, Ming; Wu, Dan; Jiang, Hongrong; Zeng, Xin; Elingarami, Sauli; Ll, Zhiyang; Li, Song; Liu, Hongna; He, Nongyue
2015-02-01
In this research, a novel method for relative fluorescent quantification of DNA based on Fe3O4@SiO2@Au gold-coated magnetic nanocomposites (GMNPs) and multiplex ligation- dependent probe amplification (MLPA) has been developed. With the help of self-assembly, seed-mediated growth and chemical reduction method, core-shell Fe3O4@SiO2@Au GMNPs were synthesized. Through modified streptavidin on the GMNPs surface, we obtained a bead chip which can capture the biotinylated probes. Then we designed MLPA probes which were tagged with biotin or Cy3 and target DNA on the basis of human APP gene sequence. The products from the thermostable DNA ligase induced ligation reactions and PCR amplifications were incubated with SA-GMNPs. After washing, magnetic separation, spotting, the fluorescent scanning results showed our method can be used for the relative quantitative analysis of the target DNA in the concentration range of 03004~0.5 µM.
Yamashita, Mami
2017-05-08
The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.
Yamashita, Mami; Xu, Jian; Morokuma, Daisuke; Hirata, Kazuma; Hino, Masato; Mon, Hiroaki; Takahashi, Masateru; Hamdan, Samir; Sakashita, Kosuke; Iiyama, Kazuhiro; Banno, Yutaka; Kusakabe, Takahiro; Lee, Jae Man
2017-01-01
The KOD DNA polymerase from Thermococcus kodakarensis (Tkod-Pol) has been preferred for PCR due to its rapid elongation rate, extreme thermostability and outstanding fidelity. Here in this study, we utilized silkworm-baculovirus expression vector system (silkworm-BEVS) to express the recombinant Tkod-Pol (rKOD) with N-terminal (rKOD-N) or C-terminal (rKOD-C) tandem fusion tags. By using BEVS, we produced functional rKODs with satisfactory yields, about 1.1 mg/larva for rKOD-N and 0.25 mg/larva for rKOD-C, respectively. Interestingly, we found that rKOD-C shows higher thermostability at 95 °C than that of rKOD-N, while that rKOD-N is significantly unstable after exposing to long period of heat-shock. We also assessed the polymerase activity as well as the fidelity of purified rKODs under various conditions. Compared with commercially available rKOD, which is expressed in E. coli expression system, rKOD-C exhibited almost the same PCR performance as the commercial rKOD did, while rKOD-N did lower performance. Taken together, our results suggested that silkworm-BEVS can be used to express and purify efficient rKOD in a commercial way.
Improved lignocellulose conversion to biofuels with thermophilic bacteria and thermostable enzymes.
Bhalla, Aditya; Bansal, Namita; Kumar, Sudhir; Bischoff, Kenneth M; Sani, Rajesh K
2013-01-01
Second-generation feedstock, especially nonfood lignocellulosic biomass is a potential source for biofuel production. Cost-intensive physical, chemical, biological pretreatment operations and slow enzymatic hydrolysis make the overall process of lignocellulosic conversion into biofuels less economical than available fossil fuels. Lignocellulose conversions carried out at ≤ 50 °C have several limitations. Therefore, this review focuses on the importance of thermophilic bacteria and thermostable enzymes to overcome the limitations of existing lignocellulosic biomass conversion processes. The influence of high temperatures on various existing lignocellulose conversion processes and those that are under development, including separate hydrolysis and fermentation, simultaneous saccharification and fermentation, and extremophilic consolidated bioprocess are also discussed. Copyright © 2012 Elsevier Ltd. All rights reserved.
Czajkowski, R.L.; Van der Wolf, J.M.
2012-01-01
A Serratia plymuthica-specific TaqManA (R) assay was designed based on the consensus nucleotide sequence from the 3'- end of the luxS gene present in all S. plymuthica strains tested. The specificity of the assay was demonstrated by testing 21 Serratia spp. strains and 30 isolates belonging to
Directory of Open Access Journals (Sweden)
Alejandro G Schijman
-95%, accuracy of 86.8-89.5% and kappa index of 0.7-0.8 compared to consensus PCR reports of the 16 good performing tests and 63-69%, 100%, 71.4-76.2% and 0.4-0.5, respectively compared to serodiagnosis. Method LbD2 used solvent extraction followed by Sybr-Green based Real time PCR targeted to Sat-DNA; method LbD3 used solvent DNA extraction followed by conventional PCR targeted to Sat-DNA. The third method (LbF1 used glass fiber column based DNA extraction followed by TaqMan Real Time PCR targeted to Sat-DNA (cruzi 1/cruzi 2 and cruzi 3 TaqMan probe and the fourth method (LbQ used solvent DNA extraction followed by conventional hot-start PCR targeted to kDNA (primer pairs 121/122. These four methods were further evaluated at the coordinating laboratory in a subset of human blood samples, confirming the performance obtained by the participating laboratories. CONCLUSION/SIGNIFICANCE: This study represents a first crucial step towards international validation of PCR procedures for detection of T. cruzi in human blood samples.
Detection and Quantification of Methyl tert-Butyl Ether-Degrading Strain PM1 by Real-Time TaqMan PCR
Hristova, Krassimira R.; Lutenegger, Christian M.; Scow, Kate M.
2001-01-01
The fuel oxygenate methyl tert-butyl ether (MTBE), a widely distributed groundwater contaminant, shows potential for treatment by in situ bioremediation. The bacterial strain PM1 rapidly mineralizes and grows on MTBE in laboratory cultures and can degrade the contaminant when inoculated into groundwater or soil microcosms. We applied the TaqMan quantitative PCR method to detect and quantify strain PM1 in laboratory and field samples. Specific primers and probes were designed for the 16S ribos...
Highly Efficient Thermostable DSM Cellulases: Why & How?
Energy Technology Data Exchange (ETDEWEB)
Kumar, Manoj [DSM Innovation, Inc., San Francisco, CA (United States)
2011-04-26
These are the slides from this presentation. Lignocellulosic biomass is the most abundant, least expensive renewable natural biological resource for the production of biobased products and bioenergy is important for the sustainable development of human civilization in 21st century. For making the fermentable sugars from lignocellulosic biomass, a reduction in cellulase production cost, an improvement in cellulase performance, and an increase in sugar yields are all vital to reduce the processing costs of biorefineries. Improvements in specific cellulase activities for non-complexed cellulase mixtures can be implemented through cellulase engineering based on rational design or directed evolution for each cellulase component enzyme, as well as on the reconstitution of cellulase components. In this paper, we will provide DSM's efforts in cellulase research and developments and focus on limitations. Cellulase improvement strategies based on directed evolution using screening on relevant substrates, screening for higher thermal tolerance based on activity screening approaches such as continuous culture using insoluble cellulosic substrates as a powerful selection tool for enriching beneficial cellulase mutants from the large library. We will illustrate why and how thermostable cellulases are vital for economic delivery of bioproducts from cellulosic biomass using biochemical conversion approach.
Anwar, R; Booth, A; Churchill, A J; Markham, A F
1996-01-01
The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096
Maritz, Jean; Preiser, Wolfgang; van Zyl, Gert U
2012-02-01
As antibody testing cannot confirm HIV-1 infection in children less than 18 months of age, diagnosis in these children depends on nucleic acid testing. The COBAS(®) AmpliPrep/COBAS(®) TaqMan(®) (CAP/CTM, Roche(®) Molecular Systems, Inc., Branchburg, NJ) HIV-1 Qualitative test is a total nucleic acid real-time PCR assay utilising whole EDTA blood or dried blood spots (DBS), which recently replaced the Roche(®) AMPLICOR(®) DNA test v1.5 (Amplicor) as the diagnostic HIV PCR assay in many South African laboratories. For the Amplicor assay, stringent diagnostic criteria were previously formulated for the local population, and a comparison reported the CAP/CTM's sensitivity at 99.7% and specificity at 100% for both sample types compared to these Amplicor criteria. To validate the assay prior to introduction in our laboratory and to define stringent diagnostic cut-off criteria. Whole EDTA blood samples from patients younger than 18 months sent for routine HIV-1 diagnosis were tested by Amplicor, and positive results were confirmed from DBS. CAP/CTM assays were subsequently performed from DBS. The CAP/CTM had a sensitivity of 98.8% and a specificity of 97.1%, but a positive predictive value (PPV) of only 78.7% compared to the Amplicor assay. Samples positive by CAP/CTM but negative by Amplicor displayed poor amplification curves compared to concordant positive samples. Upon re-testing those with sufficient material available by CAP/CTM, all showed negative results. The decreased PPV may either be due to false positive CAP/CTM results, or increased sensitivity compared to the Amplicor assay. Criteria were formulated for defining presumed false-positive results. Copyright © 2011 Elsevier B.V. All rights reserved.
Mashhadiabbas, Fatemeh; Neamatzadeh, Hossein; Nasiri, Rezvan; Foroughi, Elnaz; Farahnak, Soudabeh; Piroozmand, Parisa; Mazaheri, Mahta; Zare-Shehneh, Masoud
2018-01-01
There has been increasing interest in the study of the association between Vitamin D receptor (VDR) gene polymorphisms and risk of chronic periodontitis. However, the results remain inconclusive. To better understand the roles of VDR polymorphisms (BsmI, TaqI, FokI, and ApaI) in chronic periodontitis susceptibility, we conducted this systematic review and meta-analysis. The PubMed, Google Scholar, and Web of Science database were systemically searched to determine all the eligible studies about VDR polymorphisms and risk of chronic periodontitis up to April 2017. Odds ratio (OR) and 95% confidence interval (CI) were used to evaluate the associations between VDR polymorphisms and chronic periodontitis risk. All the statistical analyses were performed by Comprehensive Meta-Analysis. All P values were two-tailed with a significant level at 0.05. Finally, a total of 38 case-control studies in 19 publications were identified which met our inclusion criteria. There are ten studies with 866 chronic periodontitis cases and 786 controls for BsmI, 16 studies with 1570 chronic periodontitis cases and 1676 controls for TaqI, five studies with 374 chronic periodontitis cases and 382 controls for FokI, and seven studies with 632 chronic periodontitis cases and 604 controls for ApaI. Overall, no significant association was observed between VDR gene BsmI, TaqI, FokI, and ApaI polymorphisms and risk of chronic periodontitis in any genetic model. Subgroup analysis stratified by ethnicity suggested a significant association between BsmI polymorphism and chronic periodontitis risk in the Caucasian subgroup under allele model (A vs. G: OR = 1.747, 95% CI = 1.099-2.778, P = 0.018). Further, no significant associations were observed when stratified by Hardy-Weinberg equilibrium status for BsmI, TaqI, and ApaI. Our results suggest that BsmI, TaqI, FokI, and ApaI polymorphisms in the VDR gene might not be associated with risk of chronic periodontitis in overall population.
Consistent mutational paths predict eukaryotic thermostability
Directory of Open Access Journals (Sweden)
van Noort Vera
2013-01-01
Full Text Available Abstract Background Proteomes of thermophilic prokaryotes have been instrumental in structural biology and successfully exploited in biotechnology, however many proteins required for eukaryotic cell function are absent from bacteria or archaea. With Chaetomium thermophilum, Thielavia terrestris and Thielavia heterothallica three genome sequences of thermophilic eukaryotes have been published. Results Studying the genomes and proteomes of these thermophilic fungi, we found common strategies of thermal adaptation across the different kingdoms of Life, including amino acid biases and a reduced genome size. A phylogenetics-guided comparison of thermophilic proteomes with those of other, mesophilic Sordariomycetes revealed consistent amino acid substitutions associated to thermophily that were also present in an independent lineage of thermophilic fungi. The most consistent pattern is the substitution of lysine by arginine, which we could find in almost all lineages but has not been extensively used in protein stability engineering. By exploiting mutational paths towards the thermophiles, we could predict particular amino acid residues in individual proteins that contribute to thermostability and validated some of them experimentally. By determining the three-dimensional structure of an exemplar protein from C. thermophilum (Arx1, we could also characterise the molecular consequences of some of these mutations. Conclusions The comparative analysis of these three genomes not only enhances our understanding of the evolution of thermophily, but also provides new ways to engineer protein stability.
International Nuclear Information System (INIS)
Varshney, Nishant Kumar; Suresh Kumar, R.; Ignatova, Zoya; Prabhune, Asmita; Pundle, Archana; Dodson, Eleanor; Suresh, C. G.
2012-01-01
A thermostable penicillin G acylase from A. faecalis has been crystallized in two space groups: C222 1 and P4 1 2 1 2. X-ray diffraction data were collected to 3.3 and 3.5 Å resolution, respectively. The enzyme penicillin G acylase (EC 3.5.1.11) catalyzes amide-bond cleavage in benzylpenicillin (penicillin G) to yield 6-aminopenicillanic acid, an intermediate chemical used in the production of semisynthetic penicillins. A thermostable penicillin G acylase from Alcaligenes faecalis (AfPGA) has been crystallized using the hanging-drop vapour-diffusion method in two different space groups: C222 1 , with unit-cell parameters a = 72.9, b = 86.0, c = 260.2 Å, and P4 1 2 1 2, with unit-cell parameters a = b = 85.6, c = 298.8 Å. Data were collected at 293 K and the structure was determined using the molecular-replacement method. Like other penicillin acylases, AfPGA belongs to the N-terminal nucleophilic hydrolase superfamily, has undergone post-translational processing and has a serine as the N-terminal residue of the β-chain. A disulfide bridge has been identified in the structure that was not found in the other two known penicillin G acylase structures. The presence of the disulfide bridge is perceived to be one factor that confers higher stability to this enzyme
Wu, Xi; Zhang, Chong; Orita, Izumi; Imanaka, Tadayuki
2013-01-01
A novel thermostable alcohol dehydrogenase (ADH) showing activity toward aromatic secondary alcohols was identified from the hyperthermophilic archaeon Thermococcus kodakarensis KOD1 (TkADH). The gene, tk0845, which encodes an aldo-keto reductase, was heterologously expressed in Escherichia coli. The enzyme was found to be a monomer with a molecular mass of 31 kDa. It was highly thermostable with an optimal temperature of 90°C and a half-life of 4.5 h at 95°C. The apparent Km values for the cofactors NAD(P)+ and NADPH were similar within a range of 66 to 127 μM. TkADH preferred secondary alcohols and accepted various ketones and aldehydes as substrates. Interestingly, the enzyme could oxidize 1-phenylethanol and its derivatives having substituents at the meta and para positions with high enantioselectivity, yielding the corresponding (R)-alcohols with optical purities of greater than 99.8% enantiomeric excess (ee). TkADH could also reduce 2,2,2-trifluoroacetophenone to (R)-2,2,2-trifluoro-1-phenylethanol with high enantioselectivity (>99.6% ee). Furthermore, the enzyme showed high resistance to organic solvents and was particularly highly active in the presence of H2O–20% 2-propanol and H2O–50% n-hexane or n-octane. This ADH is expected to be a useful tool for the production of aromatic chiral alcohols. PMID:23354700
Directory of Open Access Journals (Sweden)
Yolanda Bautista
2017-12-01
Full Text Available A polyester composite was prepared through the polymerization of an unsaturated ester resin with styrene and an open-cage oligomeric silsesquioxane with methacrylate groups. The effect of the open-cage oligomeric silsesquioxane on the thermal stability of the thermostable polyester was studied using both thermogravimetric analysis and differential thermal analysis. The results showed that the methacryl oligomeric silsesquioxane improved the thermal stability of the polyester. The decomposition mechanism of the polyester/oligomer silsesquioxane composite was proposed by Fourier transform infrared spectroscopy (FTIR analysis of the volatiles.
Directory of Open Access Journals (Sweden)
Dial Stacey L
2008-07-01
Full Text Available Abstract Background The MicroArray Quality Control (MAQC project evaluated the inter- and intra-platform reproducibility of seven microarray platforms and three quantitative gene expression assays in profiling the expression of two commercially available Reference RNA samples (Nat Biotechnol 24:1115-22, 2006. The tested microarrays were the platforms from Affymetrix, Agilent Technologies, Applied Biosystems, GE Healthcare, Illumina, Eppendorf and the National Cancer Institute, and quantitative gene expression assays included TaqMan® Gene Expression PCR Assay, Standardized (Sta RT-PCR™ and QuantiGene®. The data showed great consistency in gene expression measurements across different microarray platforms, different technologies and test sites. However, SYBR® Green real-time PCR, another common technique utilized by half of all real-time PCR users for gene expression measurement, was not addressed in the MAQC study. In the present study, we compared the performance of SYBR Green PCR with TaqMan PCR, microarrays and other quantitative technologies using the same two Reference RNA samples as the MAQC project. We assessed SYBR Green real-time PCR using commercially available RT2 Profiler™ PCR Arrays from SuperArray, containing primer pairs that have been experimentally validated to ensure gene-specificity and high amplification efficiency. Results The SYBR Green PCR Arrays exhibit good reproducibility among different users, PCR instruments and test sites. In addition, the SYBR Green PCR Arrays have the highest concordance with TaqMan PCR, and a high level of concordance with other quantitative methods and microarrays that were evaluated in this study in terms of fold-change correlation and overlap of lists of differentially expressed genes. Conclusion These data demonstrate that SYBR Green real-time PCR delivers highly comparable results in gene expression measurement with TaqMan PCR and other high-density microarrays.
Vitamin-D receptor (VDR) gene polymorphisms (Taq-I & Apa-I) in Syrian healthy population.
Haddad, Shaden
2014-12-01
The vitamin D endocrine system regulates bone metabolism and calcium homeostasis as well as cellular proliferation and differentiation. Vitamin D receptor (VDR) mediates Vit-D activity, thus VDR gene polymorphisms may correlate with different diseases. This study aimed to determine the distribution of VDR gene (Taq-I and Apa-I) polymorphisms using a RFLP in unrelated normal healthy individuals of Syrian population. Allelic frequencies were 65% vs 35% and 66% vs 34% for T vs t and A vs a alleles, respectively. Genotype distribution was 36%, 58% and 6% for TT, Tt and tt and 42%, 47% and 10% for AA, Aa and aa, respectively. These results demonstrate that the frequency and distribution of the VDR polymorphisms in Syrian population are different from other populations worldwide.
Narayanan, Sai Shyam; Sokkar, Pandian; Ramachandran, Murugesan; Nampoothiri, Kesavan Madhavan
2011-07-01
Peptide deformylase (PDF) catalyses the removal of the N-formyl group from the nascent polypeptide during protein maturation. The PDF of Mycobacterium tuberculosis H37Rv (MtbPDF), overexpressed and purified from Escherichia coli, was characterized as an iron-containing enzyme with stability towards H(2) O(2) and moderate thermostability. Substitution of two conserved residues (G49 and L107) from MtbPDF with the corresponding residues found in human PDF affected its deformylase activity. Among characterized PDFs, glycine (G151) in motif III instead of conserved aspartate is characteristic of M. tuberculosis. Although the G151D mutation in MtbPDF increased its deformylase activity and thermostability, it also affected enzyme stability towards H(2) O(2) . Molecular dynamics and docking results confirmed improved substrate binding and catalysis for the G151D mutant and the study provides another possible molecular basis for the stability of MtbPDF against oxidizing agents. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Sang, Fuming; Yang, Yang; Yuan, Lin; Ren, Jicun; Zhang, Zhizhou
2015-09-01
Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour preincubation at 50 °C before real time PCR. Moreover, the results obtained by QD-based HS PCR were comparable to a commercial Taq antibody DNA polymerase. However, no obvious HS effect of QDs was found in real time PCR using Taq DNA polymerase. The findings of this study demonstrated that a cost-effective high-throughput real time PCR based on QD triggered HS PCR could be established with high consistency, sensitivity and accuracy.Hot start (HS) PCR is an excellent alternative for high-throughput real time PCR due to its ability to prevent nonspecific amplification at low temperature. Development of a cost-effective and simple HS PCR technique to guarantee high-throughput PCR specificity and consistency still remains a great challenge. In this study, we systematically investigated the HS characteristics of QDs triggered in real time PCR with EvaGreen and SYBR Green I dyes by the analysis of amplification curves, standard curves and melting curves. Two different kinds of DNA polymerases, Pfu and Taq, were employed. Here we showed that high specificity and efficiency of real time PCR were obtained in a plasmid DNA and an error-prone two-round PCR assay using QD-based HS PCR, even after an hour
Jiang, Huang; Zhang, Shaowei; Gao, Haofeng; Hu, Nan
2016-01-22
In recent years, cold-active esterases have received increased attention due to their attractive properties for some industrial applications such as high catalytic activity at low temperatures. An esterase-encoding gene (estS, 909 bp) from Serratia sp. was identified, cloned and expressed in Escherichia coli DE3 (BL21). The estS encoded a protein (EstS) of 302 amino acids with a predicted molecular weight of 32.5 kDa. It showed the highest activity at 10 °C and pH 8.5. EstS was cold active and retained ~92 % of its original activity at 0 °C. Thermal inactivation analysis showed that the T1/2 value of EstS was 50 min at 50 °C (residual activity 41.23 %) after 1 h incubation. EstS is also quite stable in high salt conditions and displayed better catalytic activity in the presence of 4 M NaCl. To improve the thermo-stability of EstS, variants of estS gene were created by error-prone PCR. A mutant 1-D5 (A43V, R116W, D147N) that showed higher thermo-stability than its wild type predecessor was selected. 1-D5 showed enhanced T1/2 of 70 min at 50 °C and retained 63.29 % of activity after incubation at 50 °C for 60 min, which were about 22 % higher than the wild type (WT). CD spectrum showed that the secondary structure of WT and 1-D5 are more or less similar, but an increase in β-sheets was recorded, which enhanced the thermostability of mutant protein. EstS was a novel cold-active and salt-tolerant esterase and half-life of mutant 1-D5 was enhanced by 1.4 times compared with WT. The features of EstS are interesting and can be exploited for commercial applications. The results have also provided useful information about the structure and function of Est protein.
Directory of Open Access Journals (Sweden)
Jong Eun Park
2017-11-01
Full Text Available Objective: To evaluate the performance of the Cobas TaqMan MTB assay (Cobas assay with respect to its clinical application. Methods: This was a retrospective analysis of 1154 results from 1034 patients for whom mycobacterial cultures and the Cobas assay were performed simultaneously. Based on the patient medical records, two categories of clinical application were defined: (1 the diagnosis of patients with a high probability of pulmonary tuberculosis according to clinical and radiological features (n = 128, and (2 the exclusion of tuberculosis in clinically indeterminate patients (n = 1026. Standard culture was used as the reference method. Results: The sensitivity of the Cobas assay for the detection of Mycobacterium tuberculosis was 70.4% (95% confidence interval (CI 49.7â85.5% for category 1, but only 25.0% (95% CI 4.5â64.4% for category 2. The specificity was â¥95.0% for both categories. The positive predictive value was 79.2% (95% CI 57.3â92.1% for category 1 and 33.3% (95% CI 6.0â75.9% for category 2, while the negative predictive value was 92.3% (95% CI 85.0â96.4% for category 1 and 99.4% (95% CI 98.7â99.8% for category 2. Conclusions: The results of this study indicate that Cobas assay results must be interpreted carefully according to the clinical purpose of the assay. Keywords: Mycobacterium tuberculosis, Pulmonary tuberculosis, Cobas TaqMan MTB assay, Korea
Evaluations on power ramp data of PWR fuels by FROST and THERMOST codes
International Nuclear Information System (INIS)
Murai, K.; Ogawa, S.; Nuno, H.; Kondo, Y.
1987-01-01
An evaluation is presented of power ramp data of Mitsubishi's PWR fuel rods tested in R-2, Studsvik, which was analysed by FROST and THERMOST codes. The analyses give good predictions for measured diameter changes and on-power rod elongations. The work indicates that FROST is capable of analysing both radial and axial pellet-cladding mechanism interaction (PCMI) appropriately, and that predicted states of PCMI (i.e. stress and strain which cannot be measured directly) are considered to be reliable. The ramp data used in the present analyses were obtained in two joint programmes with five Japanese PWR utilities (KEPCO, KYEPCO, SEPCO, HEPCO, and JAPCO). (UK)
Directory of Open Access Journals (Sweden)
Jiivittha Veno
2017-11-01
Full Text Available In the industrial processes, lipases are expected to operate at temperatures above 45 °C and could retain activity in organic solvents. Hence, a C-terminal truncated lipase from Staphylococcus epidermis AT2 (rT-M386 was engineered by directed evolution. A mutant with glycine-to-cysteine substitution (G210C demonstrated a remarkable improvement of thermostability, whereby the mutation enhanced the activity five-fold when compared to the rT-M386 at 50 °C. The rT-M386 and G210C lipases were purified concurrently using GST-affinity chromatography. The biochemical and biophysical properties of both enzymes were investigated. The G210C lipase showed a higher optimum temperature (45 °C and displayed a more prolonged half-life in the range of 40–60 °C as compared to rT-M386. Both lipases exhibited optimal activity and stability at pH 8. The G210C showed the highest stability in the presence of polar organic solvents at 50 °C compared to the rT-M386. Denatured protein analysis presented a significant change in the molecular ellipticity value above 60 °C, which verified the experimental result on the temperature and thermostability profile of G210C.
Cheng, Kun; Zhang, Fei; Sun, Fangfang; Chen, Hongge; Percival Zhang, Y-H
2015-08-20
Biobattery, a kind of enzymatic fuel cells, can convert organic compounds (e.g., glucose, starch) to electricity in a closed system without moving parts. Inspired by natural starch metabolism catalyzed by starch phosphorylase, isoamylase is essential to debranch alpha-1,6-glycosidic bonds of starch, yielding linear amylodextrin - the best fuel for sugar-powered biobattery. However, there is no thermostable isoamylase stable enough for simultaneous starch gelatinization and enzymatic hydrolysis, different from the case of thermostable alpha-amylase. A putative isoamylase gene was mined from megagenomic database. The open reading frame ST0928 from a hyperthermophilic archaeron Sulfolobus tokodaii was cloned and expressed in E. coli. The recombinant protein was easily purified by heat precipitation at 80 (o)C for 30 min. This enzyme was characterized and required Mg(2+) as an activator. This enzyme was the most stable isoamylase reported with a half lifetime of 200 min at 90 (o)C in the presence of 0.5 mM MgCl2, suitable for simultaneous starch gelatinization and isoamylase hydrolysis. The cuvett-based air-breathing biobattery powered by isoamylase-treated starch exhibited nearly doubled power outputs than that powered by the same concentration starch solution, suggesting more glucose 1-phosphate generated.
Shivange, Amol V; Roccatano, Danilo; Schwaneberg, Ulrich
2016-01-01
Bacterial phytases have attracted industrial interest as animal feed supplement due to their high activity and sufficient thermostability (required for feed pelleting). We devised an approach named KeySIDE, an iterative Key-residues interrogation of the wild type with Substitutions Identified in Directed Evolution for improving Yersinia mollaretii phytase (Ymphytase) thermostability by combining key beneficial substitutions and elucidating their individual roles. Directed evolution yielded in a discovery of nine positions in Ymphytase and combined iteratively to identify key positions. The "best" combination (M6: T77K, Q154H, G187S, and K289Q) resulted in significantly improved thermal resistance; the residual activity improved from 35 % (wild type) to 89 % (M6) at 58 °C and 20-min incubation. Melting temperature increased by 3 °C in M6 without a loss of specific activity. Molecular dynamics simulation studies revealed reduced flexibility in the loops located next to helices (B, F, and K) which possess substitutions (Helix-B: T77K, Helix-F: G187S, and Helix-K: K289E/Q). Reduced flexibility in the loops might be caused by strengthened hydrogen bonding network (e.g., G187S and K289E/K289Q) and a salt bridge (T77K). Our results demonstrate a promising approach to design phytases in food research, and we hope that the KeySIDE might become an attractive approach for understanding of structure-function relationships of enzymes.
International Nuclear Information System (INIS)
Aggarwal, Mayank; Boone, Christopher D.; Kondeti, Bhargav; Tu, Chingkuang; Silverman, David N.; McKenna, Robert
2013-01-01
Here, a case study of the effects of cryoprotectants on the kinetics of carbonic anhydrase II (CA II) and its inhibition by the clinically used inhibitor acetazolamide (AZM) is presented. Protein X-ray crystallography has seen a progressive shift from data collection at cool/room temperature (277–298 K) to data collection at cryotemperature (100 K) because of its ease of crystal preparation and the lessening of the detrimental effects of radiation-induced crystal damage, with 20–25%(v/v) glycerol (GOL) being the preferred choice of cryoprotectant. Here, a case study of the effects of cryoprotectants on the kinetics of carbonic anhydrase II (CA II) and its inhibition by the clinically used inhibitor acetazolamide (AZM) is presented. Comparative studies of crystal structure, kinetics, inhibition and thermostability were performed on CA II and its complex with AZM in the presence of either GOL or sucrose. These results suggest that even though the cryoprotectant GOL was previously shown to be directly bound in the active site and to interact with AZM, it affects neither the thermostability of CA II nor the binding of AZM in the crystal structure or in solution. However, addition of GOL does affect the kinetics of CA II, presumably as it displaces the water proton-transfer network in the active site
Energy Technology Data Exchange (ETDEWEB)
Aggarwal, Mayank; Boone, Christopher D.; Kondeti, Bhargav; Tu, Chingkuang; Silverman, David N.; McKenna, Robert, E-mail: rmckenna@ufl.edu [University of Florida, 1600 SW Archer Road, PO Box 100245, Gainesville, FL 32610 (United States)
2013-05-01
Here, a case study of the effects of cryoprotectants on the kinetics of carbonic anhydrase II (CA II) and its inhibition by the clinically used inhibitor acetazolamide (AZM) is presented. Protein X-ray crystallography has seen a progressive shift from data collection at cool/room temperature (277–298 K) to data collection at cryotemperature (100 K) because of its ease of crystal preparation and the lessening of the detrimental effects of radiation-induced crystal damage, with 20–25%(v/v) glycerol (GOL) being the preferred choice of cryoprotectant. Here, a case study of the effects of cryoprotectants on the kinetics of carbonic anhydrase II (CA II) and its inhibition by the clinically used inhibitor acetazolamide (AZM) is presented. Comparative studies of crystal structure, kinetics, inhibition and thermostability were performed on CA II and its complex with AZM in the presence of either GOL or sucrose. These results suggest that even though the cryoprotectant GOL was previously shown to be directly bound in the active site and to interact with AZM, it affects neither the thermostability of CA II nor the binding of AZM in the crystal structure or in solution. However, addition of GOL does affect the kinetics of CA II, presumably as it displaces the water proton-transfer network in the active site.
KRAS detection in colonic tumors by DNA extraction from FTA paper: the molecular touch-prep.
Petras, Melissa L; Lefferts, Joel A; Ward, Brian P; Suriawinata, Arief A; Tsongalis, Gregory J
2011-12-01
DNA isolated from formalin-fixed paraffin-embedded (FFPE) tissue is usually more degraded and contains more polymerase chain reaction (PCR) inhibitors than DNA isolated from nonfixed tissue. In addition, the tumor size and cellular heterogeneity found in tissue sections can often impact testing for molecular biomarkers. As a potential remedy to this situation, we evaluated the use of Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA for use in a real-time PCR-based KRAS mutation assay. Eleven colon tumor samples were collected by making a cut into the fresh tumor and applying the Whatman FTA paper to the cut surface. Matched FFPE tissue blocks from these tumors were also collected for comparison. KRAS mutation analysis was carried out using the Applied Biosystems 7500 Fast Real-time PCR System using 7 independent custom TaqMan PCR assays. Of the 11 colon tumors sampled, 6 were positive for KRAS mutations in both the Whatman FTA paper preparations and corresponding FFPE samples. Whatman FTA paper cards for collection of colorectal tumor samples before tissue fixation and for isolation of DNA have many advantages including ease of use, intrinsic antimicrobial properties, long storage potential (stability of DNA over time), and a faster turnaround time for results. Extracted DNA should be suitable for most molecular diagnostic assays that use PCR techniques. This novel means of DNA preservation from surgical specimens would benefit from additional study and validation as a dependable and practical technique to preserve specimens for molecular testing.
Energy Technology Data Exchange (ETDEWEB)
Manikandan, K. [Department of Physics, Indian Institute of Science, Bangalore 560 012 (India); Bhardwaj, Amit [International Centre for Genetic Engineering and Biotechnology, New Delhi 110 067 (India); Ghosh, Amit [Institute of Microbial Technology, Sector 39-A, Chandigarh 160 036 (India); Reddy, V. S. [International Centre for Genetic Engineering and Biotechnology, New Delhi 110 067 (India); Ramakumar, S., E-mail: ramak@physics.iisc.ernet.in [Department of Physics, Indian Institute of Science, Bangalore 560 012 (India); Bioinformatics Centre, Indian Institute of Science, Bangalore 560 012 (India)
2005-08-01
A family 10 alkali-thermostable xylanase from Bacillus sp. NG-27 has been crystallized. A diffraction data set has been collected to 2.2 Å resolution. Xylanases (EC 3.2.1.8) catalyze the hydrolysis of β-1,4-glycosidic linkages within xylan, a major hemicellulose component in the biosphere. The extracellular endoxylanase (XylnA) from the alkalophilic Bacillus sp. strain NG-27 belongs to family 10 of the glycoside hydrolases. It is active at 343 K and pH 8.4. Moreover, it has attractive features from the point of view of utilization in the paper pulp, animal feed and baking industries since it is an alkali-thermostable protein. In this study, XylnA was purified from the native host source and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 174.5, b = 54.7, c = 131.5 Å, β = 131.2°, and diffract to better than 2.2 Å resolution.
International Nuclear Information System (INIS)
Manikandan, K.; Bhardwaj, Amit; Ghosh, Amit; Reddy, V. S.; Ramakumar, S.
2005-01-01
A family 10 alkali-thermostable xylanase from Bacillus sp. NG-27 has been crystallized. A diffraction data set has been collected to 2.2 Å resolution. Xylanases (EC 3.2.1.8) catalyze the hydrolysis of β-1,4-glycosidic linkages within xylan, a major hemicellulose component in the biosphere. The extracellular endoxylanase (XylnA) from the alkalophilic Bacillus sp. strain NG-27 belongs to family 10 of the glycoside hydrolases. It is active at 343 K and pH 8.4. Moreover, it has attractive features from the point of view of utilization in the paper pulp, animal feed and baking industries since it is an alkali-thermostable protein. In this study, XylnA was purified from the native host source and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 174.5, b = 54.7, c = 131.5 Å, β = 131.2°, and diffract to better than 2.2 Å resolution
Osmundson, Todd W; Eyre, Catherine A; Hayden, Katherine M; Dhillon, Jaskirn; Garbelotto, Matteo M
2013-01-01
The ubiquity, high diversity and often-cryptic manifestations of fungi and oomycetes frequently necessitate molecular tools for detecting and identifying them in the environment. In applications including DNA barcoding, pathogen detection from plant samples, and genotyping for population genetics and epidemiology, rapid and dependable DNA extraction methods scalable from one to hundreds of samples are desirable. We evaluated several rapid extraction methods (NaOH, Rapid one-step extraction (ROSE), Chelex 100, proteinase K) for their ability to obtain DNA of quantity and quality suitable for the following applications: PCR amplification of the multicopy barcoding locus ITS1/5.8S/ITS2 from various fungal cultures and sporocarps; single-copy microsatellite amplification from cultures of the phytopathogenic oomycete Phytophthora ramorum; probe-based P. ramorum detection from leaves. Several methods were effective for most of the applications, with NaOH extraction favored in terms of success rate, cost, speed and simplicity. Frozen dilutions of ROSE and NaOH extracts maintained PCR viability for over 32 months. DNA from rapid extractions performed poorly compared to CTAB/phenol-chloroform extracts for TaqMan diagnostics from tanoak leaves, suggesting that incomplete removal of PCR inhibitors is an issue for sensitive diagnostic procedures, especially from plants with recalcitrant leaf chemistry. NaOH extracts exhibited lower yield and size than CTAB/phenol-chloroform extracts; however, NaOH extraction facilitated obtaining clean sequence data from sporocarps contaminated by other fungi, perhaps due to dilution resulting from low DNA yield. We conclude that conventional extractions are often unnecessary for routine DNA sequencing or genotyping of fungi and oomycetes, and recommend simpler strategies where source materials and intended applications warrant such use. © 2012 Blackwell Publishing Ltd.
Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M
2012-04-01
To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.
Vecchioni, Simon; Toomey, Emily; Capece, Mark C.; Rothschild, Lynn; Wind, Shalom
2017-01-01
DNA is an ideal template for a biological nanowire-it has a linear structure several atoms thick; it possesses addressable nucleobase geometry that can be precisely defined; and it is massively scalable into branched networks. Until now, the drawback of DNA as a conducting nanowire been, simply put, its low conductance. To address this deficiency, we extensively characterize a chemical variant of canonical DNA that exploits the affinity of natural cytosine bases for silver ions. We successfully construct chains of single silver ions inside double-stranded DNA, confirm the basic dC-Ag+-dC bond geometry and kinetics, and show length-tunability dependent on mismatch distribution, ion availability and enzyme activity. An analysis of the absorbance spectra of natural DNA and silver-binding, poly-cytosine DNA demonstrates the heightened thermostability of the ion chain and its resistance to aqueous stresses such as precipitation, dialysis and forced reduction. These chemically critical traits lend themselves to an increase in electrical conductivity of over an order of magnitude for 11-base silver-paired duplexes over natural strands when assayed by STM break junction. We further construct and implement a genetic pathway in the E. coli bacterium for the biosynthesis of highly ionizable DNA sequences. Toward future circuits, we construct a model of transcription network architectures to determine the most efficient and robust connectivity for cell-based fabrication, and we perform sequence optimization with a genetic algorithm to identify oligonucleotides robust to changes in the base-pairing energy landscape. We propose that this system will serve as a synthetic biological fabrication platform for more complex DNA nanotechnology and nanoelectronics with applications to deep space and low resource environments.
Czech Academy of Sciences Publication Activity Database
Šanderová, Hana; Hůlková, Marta; Maloň, Petr; Kepková, M.; Jonák, Jiří
2004-01-01
Roč. 13, č. 1 (2004), s. 89-99 ISSN 0961-8368 R&D Projects: GA AV ČR IPP1050128; GA ČR GA204/98/0863; GA ČR GA303/02/0689 Institutional research plan: CEZ:AV0Z4055905; CEZ:AV0Z5052915 Keywords : elongation factor EF-Tu, thermostability, chimeric protein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.116, year: 2004
A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification
Directory of Open Access Journals (Sweden)
Luiz Tadeu M Figueiredo
1997-05-01
Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique
International Nuclear Information System (INIS)
Barros, Bráulio Silva; Chojnacki, Jaroslaw; Macêdo Soares, Antonia Alice; Kulesza, Joanna; Lourenço da Luz, Leonis; Júnior, Severino Alves
2015-01-01
The reaction between Zn(NO 3 ) 2 ·6H 2 O or Zn(CH 3 COO) 2 ·2H 2 O and isophthalic acid (1,3-H 2 bdc) in the presence of benzimidazole (Hbzim) in dimethylformamide (DMF)/ethanol (EtOH)/H 2 O solvent mixture at room temperature yielded two structurally different coordination polymers: [Zn 2 (1,3-bdc) 2 (Hbzim) 2 ] (1) and [Zn 2 (1,3-bdc)(bzim) 2 ] (2). (1) is a 2D-layered framework with a molecule of benzimidazole coordinated to the Zn center, whereas (2) is a 3D framework with benzimidazolate species acting as a co-ligand and bridging two Zn(II) ions. Reactions performed at 90 °C led to the formation of coordination polymers structurally similar to (2), independently of the Zn(II) source used. In the absence of benzimidazole, the reaction between ZnAc 2 .2H 2 O and 1,3-H 2 bdc at 90 °C resulted in the formation of (3), a 3D coordination polymer Zn(HCOO) 3 (Me 2 NH 2 + ). It was observed that the thermostability and the photophysical properties of (1) and (2) are strongly dependent on the coordination modes and packing of benzimidazole in the solid state. These materials present photoluminescence in the wide range of the spectrum, from UV to IR. A full understanding of a physical process occurring in these intriguing systems, including complete energy level diagrams with possible transitions were provided. - Graphical abstract: Display Omitted - Highlights: • Structurally different Zn(II)-coordination polymers were prepared. • The formation of frameworks was counter anion and temperature dependent. • Photoluminescence in the wide range of the spectrum, from UV to IR was observed. • Thermostability and luminescence depended on bzim packing in the structure
Directory of Open Access Journals (Sweden)
Bing Zhang
2016-09-01
Full Text Available Babesia spp. are tick-transmitted haemoparasites causing tick fever in cattle. In Australia, economic losses to the cattle industry from tick fever are estimated at AUD$26 Million per annum. If animals recover from these infections, they become immune carriers. Here we describe a novel multiplex TaqMan qPCR targeting cytochrome b genes for the identification of Babesia spp. The assay shows high sensitivity, specificity and reproducibility, and allows quantification of parasite DNA from Babesia bovis and B. bigemina compared to standard PCR assays. A previously published cytochrome b SYBR Green qPCR was also tested in this study, showing slightly higher sensitivity than the Taqman qPCRs but requires melting curve analysis post-PCR to confirm specificity. The SYBR Green assays were further evaluated using both diagnostic submissions and vaccinated cattle (at 7, 9, 11 and 14 days post-inoculation showed that B. bigemina can be detected more frequently than B. bovis. Due to fewer circulating parasites, B. bovis detection in carrier animals requires higher DNA input. Preliminary data for a novel fluorescent PCR genotyping based on the Internal Transcribed Spacer 1 region to detect vaccine and field alleles of B. bovis are described. This assay is capable of detecting vaccine and novel field isolate alleles in a single sample.
Directory of Open Access Journals (Sweden)
Bianca Ramalho Quintaes
2004-03-01
Full Text Available Optimization of the RAPD reaction for characterizing Salmonella enterica serovar Typhi strains was studied in order to ensure the reproducibility and the discriminatory power of this technique. Eight Salmonella serovar Typhi strains isolated from various regions in Brazil were examined for the fragment patterns produced using different concentrations of DNA template, primer, MgCl2 and Taq DNA polymerase. Using two different low stringency thermal cycle profiles, the RAPD fingerprints obtained were compared. A set of sixteen primers was evaluated for their ability to produce a high number of distinct fragments. We found that variations associated to all of the tested parameters modified the fingerprinting patterns. For the strains of Salmonella enterica serovar Typhi used in this experiment, we have defined a set of conditions for RAPD-PCR reaction, which result in a simple, fast and reproducible typing method.A otimização da reação de RAPD para a caracterização de cepas de Salmonella enterica sorovar Typhi foi estudada com o objetivo de assegurar a reprodutibilidade e o poder discriminatório desta técnica. Oito cepas de Salmonella sorovar Typhi isoladas de algumas regiões do Brasil foram usadas para examinar os padrões de fragmentação produzidos quando foram empregadas concentrações diferentes do DNA molde, do iniciador, do MgCl2 e da enzima Taq DNA polimerase. Com a utilização de dois diferentes perfis de ciclos termais de baixa estringência, foram comparados os padrões de bandeamento obtidos. Um conjunto de dezesseis iniciadores foi avaliado quanto à capacidade de produzir elevado número de fragmentos distintos. Observou-se que variações associadas a todos os parâmetros testados modificaram os padrões de bandeamento. Para as amostras de Salmonella enterica sorovar Typhi utilizadas neste experimento, definiu-se um conjunto de condições para a reação de RAPD-PCR que resultou num método de tipagem simples, rápido e
Energy Technology Data Exchange (ETDEWEB)
Chia-Hsiang Chen [Cheng Hsin Rehabilitation and Medical Center, Taipei (Taiwan, Province of China); Shih-Hsiang Chien; Hai-Gwo Hwu [National Taiwan Univ., Taipei (Taiwan, Province of China)
1996-09-20
Association studies between the A1 allele of the dopamine D2 receptor (DRD2) gene TaqI A polymorphism and alcoholism remain controversial. A recent study from Japan demonstrated that the A1 allele is associated with severe alcoholism in the Japanese population. We were interested in knowing if this association also exists in the Atayals of Taiwan, who were found to have a higher prevalence of alcohol-use disorders than the Han Chinese in Taiwan. Genotype and allele frequencies were determined in alcohol-abusing, alcohol-dependent, and nonalcoholic control Atayal natives in Taiwan. A1 allele frequencies in alcohol-dependent, alcohol-abusing, and normal control Atayals were 0.39, 0.42, and 0.39, respectively. No difference in A1 allele frequency was found among these three groups. Our data do not support the hypothesis that the A1 allele of the TaqI A polymorphism of the DRD2 gene increases susceptibility to alcohol-use disorders in the Atayals of Taiwan. 18 refs., 1 tab.
Water Bridging Dynamics of Polymerase Chain Reaction in the Gauge Theory Paradigm of Quantum Fields
Directory of Open Access Journals (Sweden)
L. Montagnier
2017-05-01
Full Text Available We discuss the role of water bridging the DNA-enzyme interaction by resorting to recent results showing that London dispersion forces between delocalized electrons of base pairs of DNA are responsible for the formation of dipole modes that can be recognized by Taq polymerase. We describe the dynamic origin of the high efficiency and precise targeting of Taq activity in PCR. The spatiotemporal distribution of interaction couplings, frequencies, amplitudes, and phase modulations comprise a pattern of fields which constitutes the electromagnetic image of DNA in the surrounding water, which is what the polymerase enzyme actually recognizes in the DNA water environment. The experimental realization of PCR amplification, achieved through replacement of the DNA template by the treatment of pure water with electromagnetic signals recorded from viral and bacterial DNA solutions, is found consistent with the gauge theory paradigm of quantum fields.
Cura, Carolina I.; Duffy, Tomas; Lucero, Raúl H.; Bisio, Margarita; Péneau, Julie; Jimenez-Coello, Matilde; Calabuig, Eva; Gimenez, María J.; Valencia Ayala, Edward; Kjos, Sonia A.; Santalla, José; Mahaney, Susan M.; Cayo, Nelly M.; Nagel, Claudia; Barcán, Laura; Málaga Machaca, Edith S.; Acosta Viana, Karla Y.; Brutus, Laurent; Ocampo, Susana B.; Aznar, Christine; Cuba Cuba, Cesar A.; Gürtler, Ricardo E.; Ramsey, Janine M.; Ribeiro, Isabela; VandeBerg, John L.; Yadon, Zaida E.; Osuna, Antonio; Schijman, Alejandro G.
2015-01-01
Background Trypanosoma cruzi has been classified into six Discrete Typing Units (DTUs), designated as TcI–TcVI. In order to effectively use this standardized nomenclature, a reproducible genotyping strategy is imperative. Several typing schemes have been developed with variable levels of complexity, selectivity and analytical sensitivity. Most of them can be only applied to cultured stocks. In this context, we aimed to develop a multiplex Real-Time PCR method to identify the six T. cruzi DTUs using TaqMan probes (MTq-PCR). Methods/Principal Findings The MTq-PCR has been evaluated in 39 cultured stocks and 307 biological samples from vectors, reservoirs and patients from different geographical regions and transmission cycles in comparison with a multi-locus conventional PCR algorithm. The MTq-PCR was inclusive for laboratory stocks and natural isolates and sensitive for direct typing of different biological samples from vectors, reservoirs and patients with acute, congenital infection or Chagas reactivation. The first round SL-IR MTq-PCR detected 1 fg DNA/reaction tube of TcI, TcII and TcIII and 1 pg DNA/reaction tube of TcIV, TcV and TcVI reference strains. The MTq-PCR was able to characterize DTUs in 83% of triatomine and 96% of reservoir samples that had been typed by conventional PCR methods. Regarding clinical samples, 100% of those derived from acute infected patients, 62.5% from congenitally infected children and 50% from patients with clinical reactivation could be genotyped. Sensitivity for direct typing of blood samples from chronic Chagas disease patients (32.8% from asymptomatic and 22.2% from symptomatic patients) and mixed infections was lower than that of the conventional PCR algorithm. Conclusions/Significance Typing is resolved after a single or a second round of Real-Time PCR, depending on the DTU. This format reduces carryover contamination and is amenable to quantification, automation and kit production. PMID:25993316
Leong, Sze Ying; Oey, Indrawati
2014-03-01
The objective of this research was to study the enzyme kinetics and thermostability of endogenous ascorbic acid oxidase (AAO) in carrot purée (Daucus carota cv. Nantes) after being treated with pulsed electric field (PEF) processing. Various PEF treatments using electric field strength between 0.2 and 1.2kV/cm and pulsed electrical energy between 1 and 520kJ/kg were conducted. The enzyme kinetics and the kinetics of AAO thermal inactivation (55-70°C) were described using Michaelis-Menten model and first order reaction model, respectively. Overall, the estimated Vmax and KM values were situated in the same order of magnitude as the untreated carrot purée after being exposed to pulsed electrical energy between 1 and 400kJ/kg, but slightly changed at pulsed electrical energy above 500kJ/kg. However, AAO presented different thermostability depending on the electric field strength applied. After PEF treatment at the electric field strength between 0.2 and 0.5kV/cm, AAO became thermolabile (i.e. increase in inactivation rate (k value) at reference temperature) but the temperature dependence of k value (Ea value) for AAO inactivation in carrot purée decreased, indicating that the changes in k values were less temperature dependent. It is obvious that PEF treatment affects the temperature stability of endogenous AAO. The changes in enzyme kinetics and thermostability of AAO in carrot purée could be related to the resulting carrot purée composition, alteration in intracellular environment and the effective concentration of AAO released after being subjected to PEF treatment. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Anika Daing
2015-01-01
Full Text Available Background: Increasing evidences support the role of genetic factors in susceptibility to chronic periodontitis. The aim of the present pilot study was to explore the association of two potential single nucleotide polymorphisms (SNPs: Interleukin (IL-1β + 3954 (rs1143634, C > T and vitamin D receptor (VDR TaqI (rs731236, T > C with chronic periodontitis in a North Indian population. Materials and Methods: Twenty-eight chronic periodontitis subjects and 47 periodontally healthy controls were recruited. Individual samples of venous blood were obtained from each subject. Genotyping was done by polymerase chain reaction, followed by restriction fragment length polymorphism (PCR-RFLP. Logistic regression and chi square test were used for genetic association analysis and a P value less than 0.05 taken as statistical significance. Statistical Analysis Used: Chi square test and odds ratio (OR was used. Results: Genotypes and alleles of SNP IL-1β + 3954 did not show a significant association (P > 0.05 with chronic periodontitis. Genotype CC and allele C of VDR TaqI were significantly associated with a higher risk for chronic periodontitis as compared to subjects with TT genotype (CC/TT OR = 4.615; 95% confidence interval [CI]: 1.17 to 18.078 P = 0.028 and allele T (C/T OR = 2.423; 95% CI: 1.179 to 4.980. Conclusion: In North Indian population, genotype CC and allele C of VDR TaqI were associated with risk of chronic periodontitis. No significant correlation was found for IL-1β + 3954 polymorphism and chronic periodontitis.
Directory of Open Access Journals (Sweden)
Xiao-Wei Yu
Full Text Available The key to enzyme function is the maintenance of an appropriate balance between molecular stability and structural flexibility. The lid domain which is very important for "interfacial activation" is the most flexible part in the lipase structure. In this work, rational design was applied to explore the relationship between lid rigidity and lipase activity by introducing a disulfide bond in the hinge region of the lid, in the hope of improving the thermostability of R. chinensis lipase through stabilization of the lid domain without interfering with its catalytic performance. A disulfide bridge between F95C and F214C was introduced into the lipase from R. chinensis in the hinge region of the lid according to the prediction of the "Disulfide by Design" algorithm. The disulfide variant showed substantially improved thermostability with an eleven-fold increase in the t(1/2 value at 60°C and a 7°C increase of T(m compared with the parent enzyme, probably contributed by the stabilization of the geometric structure of the lid region. The additional disulfide bond did not interfere with the catalytic rate (k(cat and the catalytic efficiency towards the short-chain fatty acid substrate, however, the catalytic efficiency of the disulfide variant towards pNPP decreased by 1.5-fold probably due to the block of the hydrophobic substrate channel by the disulfide bond. Furthermore, in the synthesis of fatty acid methyl esters, the maximum conversion rate by RCLCYS reached 95% which was 9% higher than that by RCL. This is the first report on improving the thermostability of the lipase from R. chinensis by introduction of a disulfide bond in the lid hinge region without compromising the catalytic rate.
2013-01-01
Background Lactose intolerance is a common health concern causing gastrointestinal symptoms and avoidance of dairy products by afflicted individuals. Since milk is a primary source of calcium and vitamin D, lactose intolerant individuals often obtain insufficient amounts of these nutrients which may lead to adverse health outcomes. Production of lactose-free milk can provide a solution to this problem, although it requires use of lactase from microbial sources and increases potential for contamination. Use of thermostable lactase enzymes can overcome this issue by functioning under pasteurization conditions. Results A thermostable β-glucosidase gene from Pyrococcus furiosus was cloned in frame with the Saccharomyces cerecisiae a-factor secretory signal and expressed in Pichia pastoris strain X-33. The recombinant enzyme was purified by a one-step method of weak anion exchange chromatography. The optimum temperature and pH for this β-glucosidase activity was 100°C and pH 6.0, respectively. The enzyme activity was not significantly inhibited by Ca2+. We tested the additive amount, hydrolysis time, and the influence of glucose on the enzyme during pasteurization and found that the enzyme possessed a high level of lactose hydrolysis in milk that was not obviously influenced by glucose. Conclusions The thermostablity of this recombinant β-glucosidase, combined with its neutral pH activity and favorable temperature activity optima, suggest that this enzyme is an ideal candidate for the hydrolysis of lactose in milk, and it would be suitable for application in low-lactose milk production during pasteurization. PMID:24053641
International Nuclear Information System (INIS)
Shariff, Fairolniza Mohd; Rahman, Raja Noor Zaliha Raja Abd.; Ali, Mohd Shukuri Mohamad; Chor, Adam Leow Thean; Basri, Mahiran; Salleh, Abu Bakar
2010-01-01
Thermostable recombinant L2 lipase from thermophilic Bacillus sp. L2 has been crystallized by using counter-diffusion method and diffracted to 2.7 Å resolution. The crystal belongs to the primitive orthorhombic space group P2 1 2 1 2 1 with unit-cell parameters a = 87.44, b = 94.90, c = 126.46 Å. Purified thermostable recombinant L2 lipase from Bacillus sp. L2 was crystallized by the counter-diffusion method using 20% PEG 6000, 50 mM MES pH 6.5 and 50 mM NaCl as precipitant. X-ray diffraction data were collected to 2.7 Å resolution using an in-house Bruker X8 PROTEUM single-crystal diffractometer system. The crystal belonged to the primitive orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 87.44, b = 94.90, c = 126.46 Å. The asymmetric unit contained one single molecule of protein, with a Matthews coefficient (V M ) of 2.85 Å 3 Da −1 and a solvent content of 57%
2018-02-16T07:35:40Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
The technique consists essentially of the enzymatic synthesis of millions of copies of a target DNA sequence (Saiki et al., 1985). Using a thermostable DNA polymerase (Saiki et al., 1988), and a succession of cycles that includes denaturation of the template DNA, hybridization of specific DNA primers to the template and ...
DEFF Research Database (Denmark)
Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede
2011-01-01
We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...
in differentiation of selected species of Cucumis grown in Southern ...
African Journals Online (AJOL)
Jane
2011-08-22
Aug 22, 2011 ... series, Operon, USA) primers for amplification products. The PCR reaction was performed with 20 ng template DNA; Taq buffer with 1.5 mM MgCl2; dNTPs (1 mM/µl);. Taq polymerase (2 units); primer (5 pm); spermidine (20 mM) and reaction volume of 20 µl. Amplifications were performed on a. Eppendorf ...
Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay
Zhou, Huijuan; Wu, Baoyan
2008-12-01
The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Directory of Open Access Journals (Sweden)
Tina Y Liu
Full Text Available CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus Type III-A Csm complex (TthCsm with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
RNA and DNA Targeting by a Reconstituted Thermus thermophilus Type III-A CRISPR-Cas System.
Liu, Tina Y; Iavarone, Anthony T; Doudna, Jennifer A
2017-01-01
CRISPR-Cas (clustered regularly interspaced short palindromic repeats-CRISPR-associated) systems are RNA-guided adaptive immunity pathways used by bacteria and archaea to defend against phages and plasmids. Type III-A systems use a multisubunit interference complex called Csm, containing Cas proteins and a CRISPR RNA (crRNA) to target cognate nucleic acids. The Csm complex is intriguing in that it mediates RNA-guided targeting of both RNA and transcriptionally active DNA, but the mechanism is not well understood. Here, we overexpressed the five components of the Thermus thermophilus (T. thermophilus) Type III-A Csm complex (TthCsm) with a defined crRNA sequence, and purified intact TthCsm complexes from E. coli cells. The complexes were thermophilic, targeting complementary ssRNA more efficiently at 65°C than at 37°C. Sequence-independent, endonucleolytic cleavage of single-stranded DNA (ssDNA) by TthCsm was triggered by recognition of a complementary ssRNA, and required a lack of complementarity between the first 8 nucleotides (5' tag) of the crRNA and the 3' flanking region of the ssRNA. Mutation of the histidine-aspartate (HD) nuclease domain of the TthCsm subunit, Cas10/Csm1, abolished DNA cleavage. Activation of DNA cleavage was dependent on RNA binding but not cleavage. This leads to a model in which binding of an ssRNA target to the Csm complex would stimulate cleavage of exposed ssDNA in the cell, such as could occur when the RNA polymerase unwinds double-stranded DNA (dsDNA) during transcription. Our findings establish an amenable, thermostable system for more in-depth investigation of the targeting mechanism using structural biology methods, such as cryo-electron microscopy and x-ray crystallography.
Ramírez, Juan Carlos; Cura, Carolina Inés; da Cruz Moreira, Otacilio; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Marcos da Matta Guedes, Paulo; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Maria da Cunha Galvão, Lúcia; Jácome da Câmara, Antonia Cláudia; Espinoza, Bertha; Alarcón de Noya, Belkisyole; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G
2015-09-01
An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.
Prajapati, Vimalkumar S; Ray, Sanket; Narayan, Jitendra; Joshi, Chaitanya C; Patel, Kamlesh C; Trivedi, Ujjval B; Patel, R M
2017-12-01
Bacillus amyloliquefaciens strain KCP2 was isolated from municipal food waste samples collected in Vallabh Vidyanagar, Gujarat, India. Strain KCP2 is noteworthy due to its ability to produce a thermostable, alkaliphilic α-amylase and a protease. These enzymes have importance in several industrial processes including bread making, brewing, starch processing, pharmacy, and textile industries. Whole genome sequencing of strain KCP2 showed that the estimated genome size was 3.9 Mb, the G + C content was 46%, and it coded for 4113 genes.
Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene
Directory of Open Access Journals (Sweden)
Lewin Astrid
2008-12-01
Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.
Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng
2017-06-01
A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.
Genetic divergence between two clinostomatid fish endoparasites ...
African Journals Online (AJOL)
1998-11-16
. To identify usable oligonucleotide prim- ers, a trial study was conducted using parasite DNA and six different 10-mer primers. For amplification, we used a mix- ture including 0.125 ~I DNA polymerase (Takara Taq), 2.5 ~I.
Chemoenzymatic Synthesis of Oligo(L-cysteine) for Use as a Thermostable Bio-Based Material.
Ma, Yinan; Sato, Ryota; Li, Zhibo; Numata, Keiji
2016-01-01
Oligomerization of thiol-unprotected L-cysteine ethyl ester (Cys-OEt) catalyzed by proteinase K in aqueous solution has been used to synthesize oligo(L-cysteine) (OligoCys) with a well-defined chemical structure and relatively large degree of polymerization (DP) up to 16-17 (average 8.8). By using a high concentration of Cys-OEt, 78.0% free thiol content was achieved. The thermal properties of OligoCys are stable, with no glass transition until 200 °C, and the decomposition temperature could be increased by oxidation. Chemoenzymatically synthesized OligoCys has great potential for use as a thermostable bio-based material with resistance to oxidation. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Roberta V. Branco
2015-01-01
Full Text Available A recombinant thermostable lipase (Pf2001Δ60 from the hyperthermophilic Archaeon Pyrococcus furiosus (PFUL was immobilized by hydrophobic interaction on octyl-agarose (octyl PFUL and by covalent bond on aldehyde activated-agarose in the presence of DTT at pH = 7.0 (one-point covalent attachment (glyoxyl-DTT PFUL and on glyoxyl-agarose at pH 10.2 (multipoint covalent attachment (glyoxyl PFUL. The enzyme’s properties, such as optimal temperature and pH, thermostability, and selectivity, were improved by covalent immobilization. The highest enzyme stability at 70°C for 48 h incubation was achieved for glyoxyl PFUL (around 82% of residual activity, whereas glyoxyl-DTT PFUL maintained around 69% activity, followed by octyl PFUL (27% remaining activity. Immobilization on glyoxyl-agarose improved the optimal temperature to 90°C, while the optimal temperature of octyl PFUL was 70°C. Also, very significant changes in activity with different substrates were found. In general, the covalent bond derivatives were more active than octyl PFUL. The E value also depended substantially on the derivative and the conditions used. It was observed that the reaction of glyoxyl-DTT PFUL using methyl mandelate as a substrate at pH 7 presented the best results for enantioselectivity E=22 and enantiomeric excess (ee (% = 91.
Detection of Leptospiral DNA in the Urine of Donkeys on the Caribbean Island of Saint Kitts
Directory of Open Access Journals (Sweden)
Bernard Grevemeyer
2017-01-01
Full Text Available Leptospirosis is a global zoonosis caused by pathogenic spirochetes classified within the genus Leptospira. Leptospires live in the proximal renal tubules of reservoir or chronic carrier animals, and are shed in the urine. Naïve animals acquire infection either when they come in direct contact with a reservoir or infected animals or by exposure to environmental surface water or soil that is contaminated with their urine. In this study, urine samples from a herd of donkeys on the Caribbean island of St. Kitts were screened using a TaqMan-based real-time quantitative polymerase chain reaction (qPCR targeting a pathogen-specific leptospiral gene, lipl32. Out of 124 clinically normal donkeys, 22 (18% tested positive for leptospiral DNA in their urine. Water samples from two water troughs used by the donkeys were also tested, but were found to be free from leptospiral contamination. Detection of leptospiral DNA in the urine of clinically healthy donkeys may point to a role that these animals play in the maintenance of the bacteria on St. Kitts.
Detection of Leptospiral DNA in the Urine of Donkeys on the Caribbean Island of Saint Kitts
Grevemeyer, Bernard; Vandenplas, Michel; Beigel, Brittney; Cho, Ellen; Willingham, Arve Lee; Verma, Ashutosh
2017-01-01
Leptospirosis is a global zoonosis caused by pathogenic spirochetes classified within the genus Leptospira. Leptospires live in the proximal renal tubules of reservoir or chronic carrier animals, and are shed in the urine. Naïve animals acquire infection either when they come in direct contact with a reservoir or infected animals or by exposure to environmental surface water or soil that is contaminated with their urine. In this study, urine samples from a herd of donkeys on the Caribbean island of St. Kitts were screened using a TaqMan-based real-time quantitative polymerase chain reaction (qPCR) targeting a pathogen-specific leptospiral gene, lipl32. Out of 124 clinically normal donkeys, 22 (18%) tested positive for leptospiral DNA in their urine. Water samples from two water troughs used by the donkeys were also tested, but were found to be free from leptospiral contamination. Detection of leptospiral DNA in the urine of clinically healthy donkeys may point to a role that these animals play in the maintenance of the bacteria on St. Kitts. PMID:29056661
Ryu, Se-Ah; Kim, Chang Sup; Kim, Hye-Jung; Baek, Dae Heoun; Oh, Deok-Kun
2003-01-01
D-Tagatose was continuously produced using thermostable L-arabinose isomerase immobilized in alginate with D-galactose solution in a packed-bed bioreactor. Bead size, L/D (length/diameter) of reactor, dilution rate, total loaded enzyme amount, and substrate concentration were found to be optimal at 0.8 mm, 520/7 mm, 0.375 h(-1), 5.65 units, and 300 g/L, respectively. Under these conditions, the bioreactor produced about 145 g/L tagatose with an average productivity of 54 g tagatose/L x h and an average conversion yield of 48% (w/w). Operational stability of the immobilized enzyme was demonstrated, with a tagatose production half-life of 24 days.
Mitochondrial DNA-based identification of some forensically important blowflies in Thailand.
Preativatanyou, Kanok; Sirisup, Nantana; Payungporn, Sunchai; Poovorawan, Yong; Thavara, Usavadee; Tawatsin, Apiwat; Sungpradit, Sivapong; Siriyasatien, Padet
2010-10-10
Accurate identification of insects collected from death scenes provides not only specific developmental data assisting forensic entomologists to determine the postmortem interval more precisely but also other kinds of forensic evidence. However, morphological identification can be complicated due to the similarity among species, especially in the early larval stages. To simplify and make the species identification more practical and reliable, DNA-based identification is preferentially considered. In this study, we demonstrate the application of partial mitochondrial cytochrome oxidase I (COI) and cytochrome oxidase II (COII) sequences for differentiation of forensically important blowflies in Thailand; Chrysomya megacephala, Chrysomya rufifacies and Lucilia cuprina by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The PCR yields a single 1324bp-sized amplicon in all blowfly specimens, followed by direct DNA sequencing. Taq(α)I and VspI predicted from the sequencing data provide different RFLP profiles among these three species. Sequence analysis reveals no significant intraspecific divergence in blowfly specimens captured from different geographical regions in Thailand. Accordingly, neighbor-joining tree using Kimura's 2-parameter model illustrates reciprocal monophyly between species. Thus, these approaches serve as promising tools for molecular identification of these three common forensically important blowfly species in Thailand. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Kim, Hanah; Hur, Mina; Bae, Eunsin; Lee, Kyung-A; Lee, Woo-In
2018-02-19
Hepatitis B virus (HBV) nucleic acid amplification testing (NAAT) is important for the diagnosis and management of HBV infection. We evaluated the analytical performance of the cobas HBV NAAT (Roche Diagnostics GmbH, Mannheim, Germany) on the cobas 4800 System in comparison with COBAS AmpliPrep/COBAS TaqMan HBV Test (CAP/CTM HBV). Precision was evaluated using three levels of cobas HBV/HCV/HIV-1 Control Kit, and linearity was evaluated across the anticipated measuring range (10.0-1.0×109 IU/mL) at seven levels using clinical samples. Detection capability, including limit of blank (LOB), limit of detection (LOD) and limit of quantitation (LOQ), was verified using the 4th WHO International Standard for HBV DNA for NAT (NIBSC code: 10/266). Correlation between the two systems was compared using 205 clinical samples (102 sera and 103 EDTA plasma). Repeatability and total imprecision (coefficient of variation) ranged from 0.5% to 3.8% and from 0.5% to 3.5%, respectively. Linearity (coefficient of determination, R2) was 0.999. LOB, LOD and LOQ were all acceptable within the observed proportion rate (85%). Correlation was very high between the two systems in both serum and plasma samples (correlation coefficient [r]=0.995). The new cobas HBV real-time PCR assay on the cobas 4800 System showed reliable analytical performances.
Menéndez, Carmen; Martínez, Duniesky; Trujillo, Luis E; Ramírez, Ricardo; Sobrino, Alina; Cutiño-Ávila, Bessy V; Basabe, Liliana; del Monte-Martínez, Alberto; Pérez, Enrique R; Hernández, Lázaro
2014-01-01
Biocatalysts for the industrial production of invert sugar are preferred to stably operate at high sucrose concentrations and pasteurization temperatures. Thermotoga maritima ß-fructosidase (BfrA) is more thermostable and less susceptible to substrate inhibition than the current commercial invertase from Saccharomyces cerevisiae. In this research, the non-saccharolytic host Pichia pastoris was engineered for BfrA production. Fed-batch fermentation of the recombinant yeast for 72 h using cane ...
Jia, Dong-Xu; Zhou, Lin; Zheng, Yu-Guo
2017-04-01
Glucose isomerase (GI) is used in vitro to convert d-glucose to d-fructose, which is capable of commercial producing high fructose corn syrup (HFCS). To manufacture HFCS at elevated temperature and reduce the cost of enriching syrups, novel refractory GIs from Thermoanaerobacterium xylanolyticum (TxGI), Thermus oshimai (ToGI), Geobacillus thermocatenulatus (GtGI) and Thermoanaerobacter siderophilus (TsGI) were screened via genome mining approach. The enzymatic characteristics research showed that ToGI had higher catalytic efficiency and superior thermostability toward d-glucose among the screened GIs. Its optimum temperature reached 95°C and could retain more than 80% of initial activity in the presence of 20mM Mn 2+ at 85°C for 48h. The K m and k cat /K m values for ToGI were 81.46mM and 21.77min -1 mM -1 , respectively. Furthermore, the maximum conversion yield of 400g/L d-glucose to d-fructose at 85°C was 52.16%. Considering its excellent high thermostability and ameliorable application performance, ToGI might be promising for realization of future industrial production of HFCS at elevated temperature. Copyright © 2017 Elsevier Inc. All rights reserved.
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
Quantification of Leishmania infantum DNA in females, eggs and larvae of Rhipicephalus sanguineus
Directory of Open Access Journals (Sweden)
Otranto Domenico
2011-04-01
Full Text Available Background Leishmania infantum is a widespread parasite that affects dogs and humans worldwide. It is transmitted primarily by phlebotomine sand flies, but recently there has been much discussion on the role of the brown dog tick, Rhipicephalus sanguineus, as a potential vector for this protozoan. Recent laboratory and field investigations have contributed to this hypothesis, but a proof of the vector capacity of R. sanguineus has yet to be provided. Following a recent study suggesting that L. infantum passes transovarially from the female tick to her progeny the current study provides new evidence of the transovarial transmission of L. infantum in R. sanguineus. Methods Engorged females of R. sanguineus were collected from the environment in a dog shelter of southern Italy, where canine leishmaniosis is endemic. In the laboratory, 97 females that successfully laid eggs, their eggs and the originated larvae were subjected to DNA extraction and then tested by a TaqMan-based real time PCR targeting a fragment of the kinetoplast DNA (kDNA of L. infantum. Results and conclusions L. infantum kDNA was detected in engorged females, their eggs and originating larvae, with a parasite load ranging from 1.8 × 10-4 to 10.0 × 100. Certainly, the current study provides further evidence on the passage of L. infantum from R. sanguineus females to their offspring. The observation of promastigote forms in larvae is necessary to definitively confirm this hypothesis, which would raise interesting questions about the possible role of ticks in the maintenance of L. infantum infection among dogs in certain areas.
Directory of Open Access Journals (Sweden)
Skorić Marijana
2012-01-01
Full Text Available Random amplified polymorphic DNA (RAPD analysis is a simple and reliable method used to detect DNA polymorphism. Several factors can affect the amplification profiles, thereby causing false bands and non-reproducibility of the assay. In this study, we analyzed the effects of different concentrations of primer, magnesium chloride, template DNA and Taq DNA polymerase to develop and standardize a RAPD protocol for Centaurium species. The optimized PCR reaction mixture included: 50 ng of DNA extracted using a CTbased protocol, 2.5 mM MgCl2, 7.5 pmol primer and 2 U of Taq polymerase in a final volume of 25 μl. Each of the five primers used in experiments (OPB11, OPB15, OPB18, OPF05 and OPH02 generated reproducible and distinguishable fingerprinting patterns of four Centaurium species. The obtained optimized RAPD protocol and the selected primers are useful for our further work in the genetic diversity studies of Centaurium species.
França, Renata Cristina da Penha; Assis, Caio Rodrigo Dias; Santos, Juliana Ferreira; Torquato, Ricardo José Soares; Tanaka, Aparecida Sadae; Hirata, Izaura Yoshico; Assis, Diego Magno; Juliano, Maria Aparecida; Cavalli, Ronaldo Olivera; Carvalho, Luiz Bezerra de; Bezerra, Ranilson Souza
2016-10-15
A thermostable alkaline peptidase was purified from the processing waste of cobia (Rachycentron canadum) using bovine pancreatic trypsin inhibitor (BPTI) immobilized onto Sepharose. The purified enzyme had an apparent molecular mass of 24kDa by both sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and mass spectrometry. Its optimal temperature and pH were 50°C and 8.5, respectively. The enzyme was thermostable until 55°C and its activity was strongly inhibited by the classic trypsin inhibitors N-ρ-tosyl-l-lysine chloromethyl ketone (TLCK) and benzamidine. BPTI column allowed at least 15 assays without loss of efficacy. The purified enzyme was identified as a trypsin and the N-terminal amino acid sequence of this trypsin was IVGGYECTPHSQAHQVSLNSGYHFC, which was highly homologous to trypsin from cold water fish species. Using Nα-benzoyl-dl-arginine ρ-nitroanilide hydrochloride (BApNA) as substrate, the apparent km value of the purified trypsin was 0.38mM, kcat value was 3.14s(-1), and kcat/km was 8.26s(-1)mM(-1). The catalytic proficiency of the purified enzyme was 2.75×10(12)M(-1) showing higher affinity for the substrate at the transition state than other fish trypsin. The activation energy (AE) of the BApNA hydrolysis catalyzed by this enzyme was estimated to be 11.93kcalmol(-1) while the resulting rate enhancement of this reaction was found to be approximately in a range from 10(9) to 10(10)-fold evidencing its efficiency in comparison to other trypsin. This new purification strategy showed to be appropriate to obtain an alkaline peptidase from cobia processing waste with high purification degree. According with N-terminal homology and kinetic parameters, R. canadum trypsin may gathers desirable properties of psychrophilic and thermostable enzymes. Copyright © 2016 Elsevier B.V. All rights reserved.
Thermostable cross-protective subunit vaccine against Brucella species.
Cherwonogrodzky, John W; Barabé, Nicole D; Grigat, Michelle L; Lee, William E; Poirier, Robert T; Jager, Scott J; Berger, Bradley J
2014-12-01
A subunit vaccine candidate was produced from Brucella suis 145 (biovar 4; expressing both the A antigen of Brucella abortus and the M antigen of Brucella melitensis). The preparation consisted mostly of polysaccharide (PS; >90% [wt/wt]; both cell-associated PS and exo-PS were combined) and a small amount of protein (1 to 3%) with no apparent nucleic acids. Vaccinated mice were protected (these had a statistically significant reduction in bacterial colonization compared to that of unvaccinated controls) when challenged with representative strains of three Brucella species most pathogenic for humans, i.e., B. abortus, B. melitensis, and B. suis. As little as 1 ng of the vaccine, without added adjuvant, protected mice against B. suis 145 infection (5 × 10(5) CFU), and a single injection of 1 μg of this subunit vaccine protected mice from B. suis 145 challenge for at least 14 months. A single immunization induced a serum IgG response to Brucella antigens that remained elevated for up to 9 weeks. The use of heat (i.e., boiling-water bath, autoclaving) in the vaccine preparation showed that it was thermostable. This method also ensured safety and security. The vaccine produced was immunogenic and highly protective against multiple strains of Brucella and represents a promising candidate for further evaluation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
DEFF Research Database (Denmark)
Schultz, Anna Charlotte; Vega, Everado; Dalsgaard, Anders
2011-01-01
BackgroundCurrent detection and genotyping methods of genogroup (G) I and II noroviruses (NoVs) consist of a 2-step approach including detection of viral RNA by TaqMan realtime RT-PCR (RT-qPCR) followed by conventional RT-PCR and sequencing of partial regions of ORF1 or ORF2. ObjectiveTo develop ......Man RT-qPCR assays for the sensitive detection and direct genotyping of GI and GII NoVs from clinical and environmental matrices...... novel long-template one-step TaqMan assays (L-RT-qPCR) for the rapid detection and direct genotyping of GI and GII NoVs and to evaluate the sensitivity and specificity of the assays. Study designGI and GII-specific broadly reactive L-RT-qPCR assays were developed by combining existing NoV primers...... and probes targeting the open reading frame (ORF)1–ORF2 junction as well as region C at the 5′–ORF2. The assays were validated using GI and GII RNA transcripts and a coded panel of 75 stool samples containing NoV strains representing 9 GI genotypes and 12 GII genotypes, as well as sapoviruses, astroviruses...
International Nuclear Information System (INIS)
Vite T, J.; Vite T, M.; Guerrero D, J.; Carreno de Leon, M.C.
2000-01-01
We studied the metallic composition from waste water sludge and incinerators ashes of an incinerator located in Toluca, Mexico, the qualitative studies were made using the Activation Analysis technique, and fluorescence X-ray techniques. The quantitative analysis of heavy metals in the wastes were made using Inductively coupled plasma atomic emission spectrometry (Icp-Aes). For leaching the samples, we used four coupled thermostated columns, each one had a p H of 2,5, 7 and 10. The flux of the air was of 1600 cc/min. The temperature was maintain constant in 60 Centigrade using a thermostated system. For this study we used 100 g of wastes mixed with mineral acid or sodium hydroxide to reach p H 2,5,7 and 10. We added a reducing and tensoactive agents and finally DTPA as complex agent. With this method, we obtain a better leaching efficiency using a complex agent. However the high DTPA cost, make this process expansive that is why we recommend to work with another classes of complex agents, that be cheaper to leach metals of different chemistry matrix. (Author)
Raghunath, Pendru
2014-01-01
Vibrio parahaemolyticus is the leading cause of seafood borne bacterial gastroenteritis in the world, often associated with the consumption of raw or undercooked seafood. However, not all strains of V. parahaemolyticus are pathogenic. The thermostable direct hemolysin (TDH) or TDH-related hemolysin (TRH) encoded by tdh and trh genes, respectively, are considered major virulence factors in V. parahaemolyticus. However, about 10% of clinical strains do not contain tdh and/or trh. Environmental isolates of V. parahaemolyticus lacking tdh and/or trh are also highly cytotoxic to human gastrointestinal cells. Even in the absence of these hemolysins, V. parahaemolyticus remains pathogenic indicating other virulence factors exist. This mini review aims at discussing the possible roles of tdh and trh genes in clinical and environmental isolates of V. parahaemolyticus.
Study the Three Extraction Methods for HBV DNA to Use in PCR
Directory of Open Access Journals (Sweden)
N. Sheikh
2004-07-01
Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.
Babady, N Esther; Germer, Jeffrey J; Yao, Joseph D C
2010-03-01
No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding "target not detected" results by CTM.
Myat, Lin; Ryu, Gi-Hyung
2014-01-30
In industry, a jet cooker is used to gelatinize starch by mixing the starch slurry with steam under pressure at 100-175 °C. A higher degree of starch hydrolysis in an extruder is possible with glucoamylase. Unfortunately, it is difficult to carry out liquefaction and saccharification in parallel, because the temperature of gelatinization will be too high and will inactivate glucoamylase. Since the temperature for liquefaction and saccharification is different, it is hard to change the temperature from high (required for liquefaction) to low (required for saccharification). The industrial gelatinization process is usually carried out with 30-35% (w/w) dry solids starch slurry. Conventional jet cookers cannot be used any more at high substrate concentrations owing to higher viscosity. In this study, therefore, corn starch was extruded at different melt temperatures to overcome these limitations and to produce the highest enzyme-accessible starch extrudates. Significant effects on physical properties (water solubility index, water absorption index and color) and chemical properties (reducing sugar and % increase in reducing sugar after saccharification) were achieved by addition of thermostable α-amylase at melt temperatures of 115 and 135 °C. However, there was no significant effect on % increase in reducing sugar of extruded corn starch at 95 °C. The results show the great potential of extrusion with thermostable α-amylase injection at 115 and 135 °C as an effective pretreatment for breaking down starch granules, because of the significant increase (P < 0.05) in % reducing sugar and enzyme-accessible extrudates for saccharification yield. © 2013 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
Jorge Fraga
2005-10-01
Full Text Available Random amplified polymorphic DNA (RAPD technique is a simple and reliable method to detect DNA polymorphism. Several factors can affect the amplification profiles, thereby causing false bands and non-reproducibility of assay. In this study, we analyzed the effect of changing the concentration of primer, magnesium chloride, template DNA and Taq DNA polymerase with the objective of determining their optimum concentration for the standardization of RAPD technique for genetic studies of Cuban Triatominae. Reproducible amplification patterns were obtained using 5 pmoL of primer, 2.5 mM of MgCl2, 25 ng of template DNA and 2 U of Taq DNA polymerase in 25 µL of the reaction. A panel of five random primers was used to evaluate the genetic variability of T. flavida. Three of these (OPA-1, OPA-2 and OPA-4 generated reproducible and distinguishable fingerprinting patterns of Triatominae. Numerical analysis of 52 RAPD amplified bands generated for all five primers was carried out with unweighted pair group method analysis (UPGMA. Jaccard's Similarity Coefficient data were used to construct a dendrogram. Two groups could be distinguished by RAPD data and these groups coincided with geographic origin, i.e. the populations captured in areas from east and west of Guanahacabibes, Pinar del Río. T. flavida present low interpopulation variability that could result in greater susceptibility to pesticides in control programs. The RAPD protocol and the selected primers are useful for molecular characterization of Cuban Triatominae.La técnica de ADN polimórfico amplificado al azar (RAPD es un método simple para detectar el polimorfismo genético del ADN. Diferentes factores afectan los perfiles de amplificación lo que se manifiesta en la presencia de bandas falsas y en la reproducibilidad del ensayo. En nuestro trabajo analizamos los cambios de la concentración de cebador, ADN molde, cloruro de magnesio y de Taq ADN polimerasa con el objetivo de determinar su
Haraguchi, Norihisa; Kaseda, Jun; Nakayama, Yasumune; Nagahama, Kazuhiro; Ogawa, Takahira; Matsuoka, Masayoshi
2018-06-08
Photosystem II complex embedded in thylakoid membrane performs oxygenic photosynthesis where the reaction center D1/D2 heterodimer accommodates all components of the electron transport chain. To express thermostable D1/D2 heterodimer in a cyanobacterium Synechococcus elongatus PCC 7942, we constructed a series of mutant strains whose psbA1 and psbD1 genes encoding, respectively, the most highly expressed D1 and D2 polypeptides were replaced with those of a thermophilic strain, Thermosynechococcus vulcanus. Because the C-terminal 16 amino acid sequences of D1 polypeptides should be processed prior to maturation but diverge from each other, we also constructed the psbA1ΔC-replaced strain expressing a thermostable D1 polypeptide devoid of the C-terminal extension. The psbA1/psbD1-replaced strain showed decreased growth rate and oxygen evolution rate, suggesting inefficient photosystem II. Immunoblot analyses for thermostable D1, D2 polypeptides revealed that the heterologous D1 protein was absent in thylakoid membrane from any mutant strains with psbA1, psbA1ΔC, and psbA1/psbD1-replacements, whereas the heterologous D2 protein was present in thylakoid membrane as well as purified photosystem II complex from the psbA1/psbD1-replaced strain. In the latter strain, the compensatory expression of psbA3 and psbD2 genes was elevated. These data suggest that heterologous D2 polypeptide could be combined with the host D1 polypeptide to form chimeric D1/D2 heterodimer, whereas heterologous D1 polypeptide even without the C-terminal extension was unable to make complex with the host D2 polypeptide. Since the heterologous D1 could not be detected even in the whole cells of psbA1/psbD1-replaced strain, the rapid degradation of unprocessed or unassembled heterologous D1 was implicated. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Jørgensen, F; Hansen, O C; Stougaard, P
2004-06-01
The ability to convert D-galactose into D-tagatose was compared among a number of bacterial L-arabinose isomerases ( araA). One of the most efficient enzymes, from the anaerobic thermophilic bacterium Thermoanaerobacter mathranii, was produced heterologously in Escherichia coli and characterised. Amino acid sequence comparisons indicated that this enzyme is only distantly related to the group of previously known araA sequences in which the sequence similarity is evident. The substrate specificity and the Michaelis-Menten constants of the enzyme determined with L-arabinose, D-galactose and D-fucose also indicated that this enzyme is an unusual, versatile L-arabinose isomerase which is able to isomerise structurally related sugars. The enzyme was immobilised and used for production of D-tagatose at 65 degrees C. Starting from a 30% solution of D-galactose, the yield of D-tagatose was 42% and no sugars other than D-tagatose and D-galactose were detected. Direct conversion of lactose to D-tagatose in a single reactor was demonstrated using a thermostable beta-galactosidase together with the thermostable L-arabinose isomerase. The two enzymes were also successfully combined with a commercially available glucose isomerase for conversion of lactose into a sweetening mixture comprising lactose, glucose, galactose, fructose and tagatose.
Snider, John L; Oosterhuis, Derrick M; Collins, Guy D; Pilon, Cristiane; Fitzsimons, Toby R
2013-03-15
Previous investigations have demonstrated that photosystem II (PSII) thermostability acclimates to prior exposure to heat and drought, but contrasting results have been reported for cotton (Gossypium hirsutum). We hypothesized that PSII thermotolerance in G. hirsutum would acclimate to environmental conditions during the growing season and that there would be differences in PSII thermotolerance between commercially-available U.S. cultivars. To this end, three cotton cultivars were grown under dryland conditions in Tifton Georgia, and two under irrigated conditions in Marianna Arkansas. At Tifton, measurements included PSII thermotolerance (T15, the temperature causing a 15% decline in maximum quantum yield), leaf temperatures, air temperatures, midday (1200 to 1400h) leaf water potentials (ΨMD), leaf-air vapor pressure deficit (VPD), actual quantum yield (ΦPSII) and electron transport rate through PSII (ETR) on three sample dates. At Marianna, T15 was measured on two sample dates. Optimal air and leaf temperatures were observed on all sample dates in Tifton, but PSII thermotolerance increased with water deficit conditions (ΨMD=-3.1MPa), and ETR was either unaffected or increased under water-stress. Additionally, T15 for PHY 499 was ∼5°C higher than for the other cultivars examined (DP 0912 and DP 1050). The Marianna site experienced more extreme high temperature conditions (20-30 days Tmax≥35°C), and showed an increase in T15 with higher average Tmax. When average T15 values for each location and sample date were plotted versus average daily Tmax, strong, positive relationships (r(2) from .954 to .714) were observed between Tmax and T15. For all locations T15 was substantially higher than actual field temperature conditions. We conclude that PSII thermostability in G. hirsutum acclimates to pre-existing environmental conditions; PSII is extremely tolerant to high temperature and water-deficit stress; and differences in PSII thermotolerance exist between
A thermostable serralysin inhibitor from marine bacterium Flavobacterium sp. YS-80-122
Liang, Pengjuan; Li, Shangyong; Wang, Kun; Wang, Fang; Xing, Mengxin; Hao, Jianhua; Sun, Mi
2018-03-01
Serralysin inhibitors have been proposed as potent drugs against many diseases and may help to prevent further development of antibiotic-resistant pathogenic bacteria. In this study, a novel serralysin inhibitor gene, lupI, was cloned from the marine bacterium Flavobacterium sp. YS-80-122 and expressed in Escherichia coli. The deduced serralysin inhibitor, LupI, shows <40% amino acid identity to other reported serralysin inhibitors. Multiple sequence alignment and phylogenetic analysis of LupI with other serralysin inhibitors indicated that LupI was a novel type of serralysin inhibitor. The inhibitory constant for LupI towards its target metalloprotease was 0.64 μmol/L. LupI was thermostable at high temperature, in which 35.6%-90.7% of its inhibitory activity was recovered after treatment at 100°C for 1-60 min followed by incubation at 0°C. This novel inhibitor may represent a candidate drug for the treatment of serralysin-related infections.
A quantitative PCR (TaqMan assay for pathogenic Leptospira spp
Directory of Open Access Journals (Sweden)
Symonds Meegan L
2002-07-01
Full Text Available Abstract Background Leptospirosis is an emerging infectious disease. The differential diagnosis of leptospirosis is difficult due to the varied and often "flu like" symptoms which may result in a missed or delayed diagnosis. There are over 230 known serovars in the genus Leptospira. Confirmatory serological diagnosis of leptospirosis is usually made using the microscopic agglutination test (MAT which relies on the use of live cultures as the source of antigen, often performed using a panel of antigens representative of local serovars. Other techniques, such as the enzyme linked immunosorbent assay (ELISA and slide agglutination test (SAT, can detect different classes of antibody but may be subject to false positive reactions and require confirmation of these results by the MAT. Methods The polymerase chain reaction (PCR has been used to detect a large number of microorganisms, including those of clinical significance. The sensitivity of PCR often precludes the need for isolation and culture, thus making it ideal for the rapid detection of organisms involved in acute infections. We employed real-time (quantitative PCR using TaqMan chemistry to detect leptospires in clinical and environmental samples. Results and Conclusions The PCR assay can be applied to either blood or urine samples and does not rely on the isolation and culture of the organism. Capability exists for automation and high throughput testing in a clinical laboratory. It is specific for Leptospira and may discriminate pathogenic and non-pathogenic species. The limit of detection is as low as two cells.
Michelson, Peter; Watkins, Bradley; Webber, Steven A; Wadowsky, Robert; Michaels, Marian G
2008-06-01
Pediatric L-HLTx recipients are at risk for developing PTLD with the lung being a primary site of disease. We hypothesized that BALF is a better sample than peripheral blood for measuring EBV DNA load in this high-risk population. Archived BALF specimens from pediatric L-HLTx recipients with and without PTLD were assayed for EBV DNA load using a quantitative real time TaqMan PCR assay. These values were compared with values determined in peripheral blood by a competitive PCR assay. Fifty-five BALF specimens from 16 L-HLTx patients were evaluated. Three patients with PTLD had mean BALF EBV DNA load values almost 50-fold higher than subjects without PTLD (4.6 x 10(5) copies/mL vs. 1.0 x 10(4) copies/mL). Patients who were EBV seronegative pretransplantation (i.e., high risk for PTLD) had elevated EBV DNA load values vs. patients who were EBV seropositive pretransplantation, regardless of the diagnosis of PTLD (mean values of 3.2 x 10(5) copies/mL vs. 1.1 x 10(4) copies/mL). Lastly, BALF analysis identified all subjects with PTLD, whereas peripheral blood analysis identified only one of these cases. Therefore, it can be concluded that monitoring EBV DNA load in BALF following L-HLTx facilitates detection of PTLD in high-risk patients and may be superior to peripheral blood assays.
Directory of Open Access Journals (Sweden)
Cox Christopher
2010-11-01
Full Text Available Abstract Objective To evaluate the utility of a single quantitative PCR (qPCR measurement of HSV (HSV-1&2 DNA in cervicovaginal lavage (CVL specimens collected from women with predominantly chronic HSV-2 infection in assessing genital HSV shedding and the clinical course of genital herpes (GH within a cohort with semiannual schedule of follow up and collection of specimens. Methods Two previously described methods used for detection of HSV DNA in mucocutaneous swab samples were adapted for quantification of HSV DNA in CVLs. Single CVL specimens from 509 women were tested. Presence and quantity of CVL HSV DNA were explored in relation to observed cross-sectional and longitudinal clinical data. Results The PCR assay was sensitive and reproducible with a limit of quantification of ~50 copies per milliliter of CVL. Overall, 7% of the samples were positive for HSV-2 DNA with median log10 HSV-2 DNA copy number of 3.9 (IQR: 2.6-5.7. No HSV-1 was detected. Presence and quantity of HSV-2 DNA in CVL directly correlated with the clinical signs and symptoms of presence of active symptomatic disease with frequent recurrences. Conclusion Single qPCR measurement of HSV DNA in CVL fluids of women with chronic HSV-2 infection provided useful information for assessing GH in the setting of infrequent sampling of specimens. Observed positive correlation of the presence and quantity of HSV-2 DNA with the presence of active and more severe course of HSV-2 infection may have clinical significance in the evaluation and management of HSV-2 infected patients.
Listyaningrum, N. P.; Sutrisno, A.; Wardani, A. K.
2018-03-01
Cellulase-producing bacteria was isolated from solid waste of carrageenan and identified as Bacillus licheniformis C55 by 16S rRNA sequencing. The optimum condition for cellulase production was obtained at pH and temperature of 8.0 and 50°C, respectively in a medium containing glucose as carbon source and 1.0% carboxymethyl cellulose (CMC) to stimulate the cellulase production. Most remarkably, the enzyme retained its relative activity over 50% after incubation at 50°C for 90 minutes. Substrate specificity suggested that the enzyme is an endoglucanase. The molecular mass of Bacillus licheniformis C55 crude cellulase was found about 18 kDa by SDS-PAGE analysis. This thermostable enzyme would facilitate development of more efficient and cost-effective forms of the process to convert lignocellulosic biomass into high-value products.
Energy Technology Data Exchange (ETDEWEB)
Cruz-Fuentes, C.; Carmarena, B.; Eroza, V. [and others
1994-09-01
The suggested association of the A1 allele of the D2 dopamine receptor (DRD2) human gene with alcoholism was studied by comparing the DRD2/TaqI genotypes of 36 healthy controls and 38 individuals who met the DSM-III-R diagnostic criteria for alcohol dependence. All subjects were unrelated, with parents and grandparents of Mexican origin. The alcoholics in our sample suffered one of the following conditions: delirium tremens (16.6%), alcohol hallucinosis (56.6%) or uncomplicated alcohol withdrawal (26.4%). Eight-eight percent of the controls carried the A1 allele. The frequency of the DRD2 A1 allele in the Mexican urban sample (pA1 = 0.61) was 2 to 3-fold higher than reported in Caucasian populations from the USA and Europe, but similar to the allele frequencies found in defined Amerindian populations. There were not significant differences in the prevalence or allele frequency between alcoholics (pA1 = 0.64) and controls, regardless if the alcoholics were subtyped accordingly to severity, age of onset or positive family history. Alcoholics had higher scores than controls in the neuroticism (N) and psychoticism (P) subscales on the Eysenck personality test: alcoholics P = 6.2 {+-} 2.9, N = 16.0 {+-} 4.2 vs. controls P = 2.5 {+-} 2.3, N = 5.7 {+-} 5.1; p<0.001 and p<0.001, respectively. However, no relationship between personality traits and genotypes was found. Our results do not support a consistent association between the TaqI A1 RFLP for the DRD2 gene and alcoholism.
Babady, N. Esther; Germer, Jeffrey J.; Yao, Joseph D. C.
2009-01-01
No significantly discordant results were observed between the Abbott RealTime HIV-1 assay and the COBAS AmpliPrep/COBAS TaqMan HIV-1 Test (CTM) among 1,190 unique clinical plasma specimens obtained from laboratories located in 40 states representing all nine U.S. geographic regions and previously yielding “target not detected” results by CTM.
DNA radio-induced tandem lesions: formation, introduction in oligonucleotides and repair
International Nuclear Information System (INIS)
Bourdat, Anne-Gaelle
2000-01-01
Cell killing induced by excited photosensitizers, ionizing radiation or radiomimetic drugs can not be only explained by the formation of single DNA lesions. Thus, multiply damaged sites, are likely to have harmful biological consequences. One example of tandem base damage induced by ".OH radical in X-irradiated aqueous solution of DNA oligomers is N-(2-deoxy-β-D-erythro-pentofuranosyl)-formyl-amine (dβF)/8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo). In order to investigate the biological significance of such a tandem lesion, both 8-oxodGuo and dβF were introduced in synthetic oligonucleotides at vicinal positions using the solid phase phosphoramidite method with the 'Pac phosphoramidite' chemistry. The purity of the synthetic DNA fragments and the integrity of modified nucleosides was confirmed using different complementary techniques: HPLC, PAGE, ESI MS, MALDI-TOF MS and capillary electrophoresis. Using the above synthetic substrates, investigations were carried out in order to determine the substrate specificity and the excision mechanism of three glycosylases involved in the base excision repair pathway: endonuclease III, Fpg and yOggl. Both tandem lesions were substrates for the BER enzymes. However, the tandem lesion are not completely excised by the repair enzymes. The rates of excision as inferred from the determination of the ratios of Vm/Km Michaelis kinetics constants were not found to be significantly affected by the presence of the tandem lesions. MALDI-TOF mass spectrometry was used in order to gain insights into mechanistic aspects of oligonucleotide cleavage by the BER enzymes. During in vitro DNA synthesis by Taq DNA polymerase, Klenow fragment exo- and DNA polymerase β, tandem base damage were found to block the progression of the enzymes. Finally, the level of tandem base damage in the DNA exposed to γ-ray using the liquid chromatography coupled to electro-spray ionization tandem mass spectrometry was determined. Both dβF-8-oxodGuo and 8
Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum
Directory of Open Access Journals (Sweden)
Ma Xiaoying
2017-02-01
Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.
Otti, G; Bouvaine, S; Kimata, B; Mkamillo, G; Kumar, P L; Tomlins, K; Maruthi, M N
2016-05-01
To develop a multiplex TaqMan-based real-time PCR assay (qPCR) for the simultaneous detection and quantification of both RNA and DNA viruses affecting cassava (Manihot esculenta) in eastern Africa. The diagnostic assay was developed for two RNA viruses; Cassava brown streak virus (CBSV) and Uganda cassava brown streak virus (UCBSV) and two predominant DNA viruses; African cassava mosaic virus (ACMV) and East African cassava mosaic virus (EACMV), which cause the economically important cassava brown streak disease (CBSD) and cassava mosaic disease (CMD) respectively. Our method, developed by analysing PCR products of viruses, was highly sensitive to detect target viruses from very low quantities of 4-10 femtograms. Multiplexing did not diminish sensitivity or accuracy compared to uniplex alternatives. The assay reliably detected and quantified four cassava viruses in field samples where CBSV and UCBSV synergy was observed in majority of mixed-infected varieties. We have developed a high-throughput qPCR diagnostic assay capable of specific and sensitive quantification of predominant DNA and RNA viruses of cassava in eastern Africa. The qPCR methods are a great improvement on the existing methods and can be used for monitoring virus spread as well as for accurate evaluation of the cassava varieties for virus resistance. © 2016 The Society for Applied Microbiology.
Petersen, M I; Alvarez, I; Trono, K G; Jaworski, J P
2018-04-11
The detection of bovine leukemia virus (BLV) proviral DNA is an important tool to address whether an animal is infected with BLV. Compared with serological assays, real-time PCR accounts for greater sensitivity and can serve as a confirmatory test for the clarification of inconclusive or discordant serological test results. However, the high cost related to real-time PCR assays has limited their systematic inclusion in BLV surveillance and eradication programs. The aim of the present study was to validate a low-cost quantitative real-time PCR. Interestingly, by using SYBR Green detection dye, we were able to reduce the cost of a single reaction by a factor of 5 compared with most common assays based on the use of fluorogenic probes (i.e., TaqMan technology). This approach allowed a highly sensitive and specific detection and quantification of BLV proviral DNA from purified peripheral blood leukocytes and a milk matrix. Due to its simplicity and low cost, our in-house BLV SYBR quantitative real-time PCR might be used either as a screening or as a confirmatory test in BLV control programs. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Roke, Y.; Harten, P.N. van; Franke, B.; Galesloot, T.E.; Boot, A.M.; Buitelaar, J.K.
2013-01-01
OBJECTIVE: To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders. METHODS:
Roke, Yvette; van Harten, Peter N.; Franke, Barbara; Galesloot, Tessel E.; Boot, Annemieke M.; Buitelaar, Jan K.
Objective To investigate the effect of the Taq1A variant in the Dopamine D2 receptor gene (DRD2) and common functional genetic variants in the cytochrome P450 2D6 gene (CYP2D6) on prolactin levels in risperidone-treated boys with autism spectrum disorders and disruptive behavior disorders.Methods
Extremophiles: developments of their special functions and potential resources.
Fujiwara, Shinsuke
2002-01-01
Extremophilles are valuable resources in biotechnology. Enzymes from extremophiles are expected to fill the gap between biological and chemical processes due to their unusual properties. Especially enzymes from hyperthermophiles that can grow at above 90 degrees C were devoted owing to its extraordinary thermostability and denaturant tolerance. Screening trials of hyperthermophilic microorganisms were performed by a number of microbiologists and various unique strains were isolated from natural environments. One of the most successful uses of thermostable enzymes was DNA polymerase in the polymerase chain reaction (PCR). Thermostable enzymes are used in the chemical, food, pharmaceutical, paper and textile industries. Recombinant forms of thermostable enzymes that have been expressed in Escherichia coli are commonly utilized in industrial applications however their enzymatic characteristics and tertiary structure are different from the native ones produced in the original strains. In vitro heat treatment induces a structural conversion of the recombinant protein to its natural form. High temperature itself plays an important role in determining the specific characteristics and tertiary structure of the enzyme. Recent studies have revealed that hyperthermophiles can grow under numerous conditions not only in geothermal or deep-sea thermal environments. Technological advances have allowed DNA to be isolated from natural environments. Now genes could be isolated from microorganisms that have not been cultured. In this review, innovative approaches to hunt genes from natural environments without pure culturing of microorganisms are also discussed.
International Nuclear Information System (INIS)
Morimyo, M.; Hongo, E.; Higashi, T.; Wu, J.; Matsumoto, I.; Okamoto, M.; Kawano, A.; Tsuji, S.
2003-01-01
Full text: Germ-line mutation is detected in mice but not in humans. To estimate genetic risk of humans, a new approach to extrapolate from animal data to humans or to directly detect radiation-induced mutations in man is expected. We have developed a new method to detect germ-line mutations by directly comparing DNA sequences of parents and children. The nucleotide sequences among mouse strains are almost identical except SNP markers that are detected at 1/1000 frequency. When gamma-irradiated male mice are mated with female mice, heterogeneous nucleotide sequences induced in children DNA are a candidate of mutation, whose assignment can be done by SNP analysis. This system can easily detect all types of mutations such as transition, transversion, frameshift and deletion induced by radiation and can be applied to humans having genetically heterogeneous nucleotide sequences and many SNP markers. C3H male mice of 8 weeks of gestation were irradiated with gamma rays of 3 and 1 Gy and after 3 weeks, they were mated with the same aged C57BL female mice. After 3 weeks breeding, DNA was extracted from parents and children mice. The nucleotide sequences of 150 STS markers containing 300-900 bp and SNPs of parents and children DNA were determined by a direct sequencing; amplification of STS markers by Taq DNA polymerase, purification of PCR products, and DNA sequencing with a dye-terminator method. At each radiation dose, a total amount of 5 Mb DNA sequences were examined to detect radiation-induced mutations. We could find 6 deletions in 3 Gy irradiated mice but not in 1 Gy and control mice. The mutation frequency was about 4.0 x 10 -7 /bp/ Gy or 1.6 x 10 -4 /locus/Gy, and suggested the non-linear increase of mutation rate with dose
DEFF Research Database (Denmark)
da Silva, Ines Isabel Cardoso Rodrigues; Jers, Carsten; Otten, Harm
2014-01-01
Rhamnogalacturonan I lyases (RGI lyases) (EC 4.2.2.-) catalyze cleavage of α-1,4 bonds between rhamnose and galacturonic acid in the backbone of pectins by β-elimination. In the present study, targeted improvement of the thermostability of a PL family 11 RGI lyase from Bacillus licheniformis (DSM......, were obtained due to additive stabilizing effects of single amino acid mutations (E434L, G55V, and G326E) compared to the wild type. The crystal structure of the B. licheniformis wild-type RGI lyase was also determined; the structural analysis corroborated that especially mutation of charged amino...
Directory of Open Access Journals (Sweden)
Estu Nugroho
2009-06-01
Full Text Available The objective of this research is to evaluate the genetic variability of freshwater prawn, Macrobrachium rosenbergii. The genetic variability of freshwater prawn collected from Makassar-Sulawesi, Pangkalanbun-Kalimantan, Jambi-Sumatra, Sukabumi-Java, and GIMacro strain was examined using polymorphism of the mitochondria DNA (mtDNA markers. Twelve composite haplotypes were detected following digestion of CO1 sequences with four endonucleases: Hae III, Rsa I, Mbo I, and Taq I. The average haplotype diversity was 0.217. Significant genetic difference was observed among freshwater prawn populations, especially among Makassar-Sulawesi population and others. Makassar-Sulawesi strain has future prospect for genetic resources in breeding program.
Do, Bien-Cuong; Dang, Thi-Thu; Berrin, Jean-Guy; Haltrich, Dietmar; To, Kim-Anh; Sigoillot, Jean-Claude; Yamabhai, Montarop
2009-11-13
Mannans are key components of lignocellulose present in the hemicellulosic fraction of plant primary cell walls. Mannan endo-1,4-beta-mannosidases (1,4-beta-D-mannanases) catalyze the random hydrolysis of beta-1,4-mannosidic linkages in the main chain of beta-mannans. Biodegradation of beta-mannans by the action of thermostable mannan endo-1,4-beta-mannosidase offers significant technical advantages in biotechnological industrial applications, i.e. delignification of kraft pulps or the pretreatment of lignocellulosic biomass rich in mannan for the production of second generation biofuels, as well as for applications in oil and gas well stimulation, extraction of vegetable oils and coffee beans, and the production of value-added products such as prebiotic manno-oligosaccharides (MOS). A gene encoding mannan endo-1,4-beta-mannosidase or 1,4-beta-D-mannan mannanohydrolase (E.C. 3.2.1.78), commonly termed beta-mannanase, from Aspergillus niger BK01, which belongs to glycosyl hydrolase family 5 (GH5), was cloned and successfully expressed heterologously (up to 243 microg of active recombinant protein per mL) in Pichia pastoris. The enzyme was secreted by P. pastoris and could be collected from the culture supernatant. The purified enzyme appeared glycosylated as a single band on SDS-PAGE with a molecular mass of approximately 53 kDa. The recombinant beta-mannanase is highly thermostable with a half-life time of approximately 56 h at 70 degrees C and pH 4.0. The optimal temperature (10-min assay) and pH value for activity are 80 degrees C and pH 4.5, respectively. The enzyme is not only active towards structurally different mannans but also exhibits low activity towards birchwood xylan. Apparent Km values of the enzyme for konjac glucomannan (low viscosity), locust bean gum galactomannan, carob galactomannan (low viscosity), and 1,4-beta-D-mannan (from carob) are 0.6 mg mL-1, 2.0 mg mL-1, 2.2 mg mL-1 and 1.5 mg mL-1, respectively, while the kcat values for these
Pacheco Coello, Ricardo; Pestana Justo, Jorge; Factos Mendoza, Andrés; Santos Ordoñez, Efrén
2017-12-20
In Ecuador, food products need to be labeled if exceeded 0.9% of transgenic content in whole products. For the detection of genetically modified organisms (GMOs), three DNA extraction methods were tested in 35 food products commercialized in Ecuador. Samples with positive amplification of endogenous genes were screened for the presence of the Cauliflower mosaic virus 35S-promoter (P35S) and the nopaline synthase-terminator (Tnos). TaqMan™ probes were used for determination of transgenic content of the GTS 40-3-2 and MON810 events through quantitative PCR (qPCR). Twenty-six processed food samples were positive for the P35S alone and eight samples for the Tnos and P35S. Absolute qPCR results indicated that eleven samples were positive for GTS 40-3-2 specific event and two for MON810 specific event. A total of nine samples for events GTS 40-3-2 and MON810 exceeded the umbral allowed of transgenic content in the whole food product with the specific events. Different food products may require different DNA extraction protocols for GMO detection through PCR. Among the three methods tested, the DNeasy mericon food kit DNA extraction method obtained higher proportion of amplified endogenous genes through PCR. Finally, event-specific GMOs were detected in food products in Ecuador.
Primate community of the tropical rain forests of Saracá-Taqüera National Forest, Pará, Brazil
Directory of Open Access Journals (Sweden)
LC. Oliveira
Full Text Available Brazil is the richest country in the world in terms of primate species and the Amazonian rain forest is one of the richest biomes containing 15 (ca. 90% of the Neotropical primate genera. Although considered key elements in conservation strategies, there is only anecdotal information on primates for several protected areas within the region. Here we present new data on the community composition of the primates in the Saracá-Taqüera National Forest (429,600 ha, an actively mined, bauxite rich area, in Pará, Brazil. We used information from the literature, technical reports, museum data, and interviews conducted with agents from the Brazilian Institute of the Environment and Natural Renewable Resources (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis - IBAMA and members of the local "Quilombo" community. In addition, from July 2003 to June 2007, we carried out 19 field trips ranging from 10 to15 days each, amounting to a total effort of 1,230 hours and 1,420 km of censuses, resulting in 1,034 records of eight primate species (Saguinus martinsi, Saguinus midas, Saimiri sciureus, Cebus apella, Pithecia pithecia, Chiropotes sagulatus, Ateles paniscus, and Alouatta macconelli. Two other species (Cebus olivaceus and Aotus trivirgatus were recorded only indirectly, through interviews and literature data. In all, Alouatta macconelli was the most frequently recorded species (43% of all records; while Saguinus midas and P. pithecia were the least (ca. 0.4 and 0.6% of all records. Based on our results, we discuss group sizes as well as taxonomic problems concerning the genera Pithecia and Chiropotes, for which we registered individuals displaying phenotypic geographical variation and two different forms, respectively. Despite the deforestation inherent in bauxite mining, the Saracá-Taqüera National Forest still has a remarkable richness of primate species. Our study results place this National Forest amongst the richest
Identification of an Unfolding Intermediate for a DNA Lesion Bypass Polymerase
Sherrer, Shanen M.; Maxwell, Brian A.; Pack, Lindsey R.; Fiala, Kevin A.; Fowler, Jason D.; Zhang, Jun; Suo, Zucai
2012-01-01
Sulfolobus solfataricusDNA Polymerase IV (Dpo4), a prototype Y-family DNA polymerase, has been well characterized biochemically and biophysically at 37 °C or lower temperatures. However, the physiological temperature of the hyperthermophile S. solfataricus is approximately 80 °C. With such a large discrepancy in temperature, the in vivo relevance of these in vitro studies of Dpo4 has been questioned. Here, we employed circular dichroism spectroscopy and fluorescence-based thermal scanning to investigate the secondary structural changes of Dpo4 over a temperature range from 26 to 119 °C. Dpo4 was shown to display a high melting temperature characteristic of hyperthermophiles. Unexpectedly, the Little Finger domain of Dpo4, which is only found in the Y-family DNA polymerases, was shown to be more thermostable than the polymerase core. More interestingly, Dpo4 exhibited a three-state cooperative unfolding profile with an unfolding intermediate. The linker region between the Little Finger and Thumb domains of Dpo4 was found to be a source of structural instability. Through site-directed mutagenesis, the interactions between the residues in the linker region and the Palm domain were identified to play a critical role in the formation of the unfolding intermediate. Notably, the secondary structure of Dpo4 was not altered when the temperature was increased from 26 to 87.5 °C. Thus, in addition to providing structural insights into the thermal stability and an unfolding intermediate of Dpo4, our work also validated the relevance of the in vitro studies of Dpo4 performed at temperatures significantly lower than 80 °C. PMID:22667759
Structurally stabilized organosilane-templated thermostable mesoporous titania.
Amoli, Vipin; Tiwari, Rashmi; Dutta, Arghya; Bhaumik, Asim; Sinha, Anil Kumar
2014-01-13
Structurally thermostable mesoporous anatase TiO2 (m-TiO2) nanoparticles, uniquely decorated with atomically dispersed SiO2, is reported for the first time. The inorganic Si portion of the novel organosilane template, used as a mesopores-directing agent, is found to be incorporated in the pore walls of the titania aggregates, mainly as isolated sites. This is evident by transmission electron microscopy and high-angle annular dark field scanning transmission electron microscopy, combined with electron dispersive X-ray spectroscopy. This type of unique structure provides exceptional stability to this new material against thermal collapse of the mesoporous structure, which is reflected in its high surface area (the highest known for anatase titania), even after high-temperature (550 °C) calcination. Control of crystallite size, pore diameter, and surface area is achieved by varying the molar ratios of the titanium precursor and the template during synthesis. These mesoporous materials retain their porosity and high surface area after template removal and further NaOH/HCl treatment to remove silica. We investigate their performance for dye-sensitized solar cells (DSSCs) with bilayer TiO2 electrodes, which are prepared by applying a coating of m-TiO2 onto a commercial titania (P25) film. The high surface area of the upper mesoporous layer in the P25-m-TiO2 DSSC significantly increases the dye loading ability of the photoanode. The photocurrent and fill factor for the DSSC with the bilayer TiO2 electrode are greatly improved. The large increase in photocurrent current (ca. 56%) in the P25-m-TiO2 DSSC is believed to play a significant role in achieving a remarkable increase in the photovoltaic efficiency (60%) of the device, compared to DSSCs with a monolayer of P25 as the electrode. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liu, Jie; Ochieng, Caroline; Wiersma, Steve; Ströher, Ute; Towner, Jonathan S; Whitmer, Shannon; Nichol, Stuart T; Moore, Christopher C; Kersh, Gilbert J; Kato, Cecilia; Sexton, Christopher; Petersen, Jeannine; Massung, Robert; Hercik, Christine; Crump, John A; Kibiki, Gibson; Maro, Athanasia; Mujaga, Buliga; Gratz, Jean; Jacob, Shevin T; Banura, Patrick; Scheld, W Michael; Juma, Bonventure; Onyango, Clayton O; Montgomery, Joel M; Houpt, Eric; Fields, Barry
2016-01-01
Acute febrile illness (AFI) is associated with substantial morbidity and mortality worldwide, yet an etiologic agent is often not identified. Convalescent-phase serology is impractical, blood culture is slow, and many pathogens are fastidious or impossible to cultivate. We developed a real-time PCR-based TaqMan array card (TAC) that can test six to eight samples within 2.5 h from sample to results and can simultaneously detect 26 AFI-associated organisms, including 15 viruses (chikungunya, Crimean-Congo hemorrhagic fever [CCHF] virus, dengue, Ebola virus, Bundibugyo virus, Sudan virus, hantaviruses [Hantaan and Seoul], hepatitis E, Marburg, Nipah virus, o'nyong-nyong virus, Rift Valley fever virus, West Nile virus, and yellow fever virus), 8 bacteria (Bartonella spp., Brucella spp., Coxiella burnetii, Leptospira spp., Rickettsia spp., Salmonella enterica and Salmonella enterica serovar Typhi, and Yersinia pestis), and 3 protozoa (Leishmania spp., Plasmodium spp., and Trypanosoma brucei). Two extrinsic controls (phocine herpesvirus 1 and bacteriophage MS2) were included to ensure extraction and amplification efficiency. Analytical validation was performed on spiked specimens for linearity, intra-assay precision, interassay precision, limit of detection, and specificity. The performance of the card on clinical specimens was evaluated with 1,050 blood samples by comparison to the individual real-time PCR assays, and the TAC exhibited an overall 88% (278/315; 95% confidence interval [CI], 84% to 92%) sensitivity and a 99% (5,261/5,326, 98% to 99%) specificity. This TaqMan array card can be used in field settings as a rapid screen for outbreak investigation or for the surveillance of pathogens, including Ebola virus. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Directory of Open Access Journals (Sweden)
Naoko Minatani
Full Text Available Using pharmacological unmasking microarray, we identified promoter DNA methylation of cysteine dioxygenase 1 (CDO1 gene in human cancer. In this study, we assessed the clinicopathological significance of CDO1 methylation in primary breast cancer (BC with no prior chemotherapy. The CDO1 DNA methylation was quantified by TaqMan methylation specific PCR (Q-MSP in 7 BC cell lines and 172 primary BC patients with no prior chemotherapy. Promoter DNA of the CDO1 gene was hypermethylated in 6 BC cell lines except SK-BR3, and CDO1 gene expression was all silenced at mRNA level in the 7 BC cell lines. Quantification of CDO1 methylation was developed using Q-MSP, and assessed in primary BC. Among the clinicopathologic factors, CDO1 methylation level was not statistically significantly associated with any prognostic factors. The log-rank plot analysis elucidated that the higher methylation the tumors harbored, the poorer prognosis the patients exhibited. Using the median value of 58.0 as a cut-off one, disease specific survival in BC patients with CDO1 hypermethylation showed significantly poorer prognosis than those with hypomethylation (p = 0.004. Multivariate Cox proportional hazards model identified that CDO1 hypermethylation was prognostic factor as well as Ki-67 and hormone receptor status. The most intriguingly, CDO1 hypermethylation was of robust prognostic relevance in triple negative BC (p = 0.007. Promoter DNA methylation of CDO1 gene was robust prognostic indicator in primary BC patients with no prior chemotherapy. Prognostic relevance of the CDO1 promoter DNA methylation is worthy of being paid attention in triple negative BC cancer.
International Nuclear Information System (INIS)
Matteson, K.J.; Phillips, J.A. III; Miller, W.L.; Chung, B.C.; Orlando, P.J.; Frisch, H.; Ferrandez, A.; Burr, I.M.
1987-01-01
Congenital adrenal hyperplasia (CAH) is a common genetic disorder due to defective 21-hydroxylation of steroid hormones. The human P450XXIA2 gene encodes cytochrome P450c21 [steroid 21-monooxygenase (steroid 21-hydroxylase)], which mediates 21-hydroxylation. The P450XXIA2 gene may be distinguished from the duplicated P450XXIA1 pseudogene by cleavage with the restriction endonuclease Taq I, with the XXIA2 gene characterized by a 3.7-kilobase (kb) fragment and the XXIA1 pseudogene characterized by a 3.2-kb fragment. Restriction endonuclease mapping by several laboratories has suggested that deletion of the P450XXIA2 gene occurs in about 25% of patients with CAH, as their genomic DNA lacks detectable 3.7-kb Taq I fragments. The authors have cloned human P450c21 cDNA and used it to study genomic DNA prepared from 51 persons in 10 families, each of which includes 2 or more persons with CAH. After Taq I digestion, apparent deletions are seen in 7 of the 20 alleles of the probands; using EcoRI, apparent deletions are seen in 9 of the 20 alleles. However, the apparently deleted alleles seen with Taq I do not coincide with those seen with EcoRI. Furthermore, studies with Bgl II, EcoRI, Kpn I, and Xba I yield normal patterns with at least two enzymes in all cases. Since all probands yielded normal patterns with at least two of the five enzymes used, they conclude that the P450XXIA2 gene deletions widely reported in CAH patients probably represent gene conversions, unequal crossovers,or polymorphisms rather than simple gene deletions
Annamalai, Neelamegam; Rajeswari, Mayavan Veeramuthu; Elayaraja, Sivaramasamy; Balasubramanian, Thangavel
2013-04-15
An extracellular thermostable, haloalkaline cellulase by bioconversion of lignocellulosic wastes from Bacillus halodurans CAS 1 was purified to homogeneity with recovery of 12.54% and purity fold 7.96 with the molecular weight of 44 kDa. The optimum temperature, pH and NaCl for enzyme activity was determined as 60°C, 9.0 and 30% and it retained 80% of activity even at 80°C, 12 and 35% respectively. The activity was greatly inhibited by EDTA, indicating that it was a metalloenzyme and significant inhibition by PMSF revealed that serine residue was essential for catalytic activity. The purified cellulase hydrolyzed CMC, cellobiose and xylan, but not avicel, cellulose and PNPG. Furthermore, the cellulase was highly stable in the presence of detergents and organic solvents such as acetone, n-hexane and acetonitrile. Thus, the purified cellulase from B. halodurans utilizing lignocellulosic biomass could be greatly useful to develop industrial processes. Published by Elsevier Ltd.
Directory of Open Access Journals (Sweden)
Shi Gui-Yang
2009-10-01
Full Text Available Abstract Background Some strains of Bacillus licheniformis have been improved by target-directed screening as well as by classical genetic manipulation and used in commercial thermostable α-amylase and alkaline protease production for over 40 years. Further improvements in production of these enzymes are desirable. Results A new strain of B. licheniformis CBBD302 carrying a recombinant plasmid pHY-amyL for Bacillus licheniformis α-amylase (BLA production was constructed. The combination of target-directed screening and genetic recombination led to an approximately 26-fold improvement of BLA production and export in B. licheniformis. Furthermore, a low-cost fermentation medium containing soybean meal and cottonseed meal for BLA production in shake-flasks and in a 15 liter bioreactor was developed and a BLA concentration of up to 17.6 mg per ml growth medium was attained. Conclusion This production level of BLA by B. licheniformis CBBD302(pHY-amyL is amongst the highest levels in Gram-positive bacteria reported so far.
VapD in Xylella fastidiosa Is a Thermostable Protein with Ribonuclease Activity.
Mendes, Juliano S; Santiago, André da S; Toledo, Marcelo A S; Rosselli-Murai, Luciana K; Favaro, Marianna T P; Santos, Clelton A; Horta, Maria Augusta C; Crucello, Aline; Beloti, Lilian L; Romero, Fabian; Tasic, Ljubica; de Souza, Alessandra A; de Souza, Anete P
2015-01-01
Xylella fastidiosa strain 9a5c is a gram-negative phytopathogen that is the causal agent of citrus variegated chlorosis (CVC), a disease that is responsible for economic losses in Brazilian agriculture. The most well-known mechanism of pathogenicity for this bacterial pathogen is xylem vessel occlusion, which results from bacterial movement and the formation of biofilms. The molecular mechanisms underlying the virulence caused by biofilm formation are unknown. Here, we provide evidence showing that virulence-associated protein D in X. fastidiosa (Xf-VapD) is a thermostable protein with ribonuclease activity. Moreover, protein expression analyses in two X. fastidiosa strains, including virulent (Xf9a5c) and nonpathogenic (XfJ1a12) strains, showed that Xf-VapD was expressed during all phases of development in both strains and that increased expression was observed in Xf9a5c during biofilm growth. This study is an important step toward characterizing and improving our understanding of the biological significance of Xf-VapD and its potential functions in the CVC pathosystem.
VapD in Xylella fastidiosa Is a Thermostable Protein with Ribonuclease Activity.
Directory of Open Access Journals (Sweden)
Juliano S Mendes
Full Text Available Xylella fastidiosa strain 9a5c is a gram-negative phytopathogen that is the causal agent of citrus variegated chlorosis (CVC, a disease that is responsible for economic losses in Brazilian agriculture. The most well-known mechanism of pathogenicity for this bacterial pathogen is xylem vessel occlusion, which results from bacterial movement and the formation of biofilms. The molecular mechanisms underlying the virulence caused by biofilm formation are unknown. Here, we provide evidence showing that virulence-associated protein D in X. fastidiosa (Xf-VapD is a thermostable protein with ribonuclease activity. Moreover, protein expression analyses in two X. fastidiosa strains, including virulent (Xf9a5c and nonpathogenic (XfJ1a12 strains, showed that Xf-VapD was expressed during all phases of development in both strains and that increased expression was observed in Xf9a5c during biofilm growth. This study is an important step toward characterizing and improving our understanding of the biological significance of Xf-VapD and its potential functions in the CVC pathosystem.
Kulesh, David A; Baker, Robert O; Loveless, Bonnie M; Norwood, David; Zwiers, Susan H; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P; Huggins, John; Jahrling, Peter B
2004-02-01
We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3'-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 x 10(7), 1.24 x 10(5), 1.24 x 10(3), and 1.24 x 10(1) genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs
Sliwinska, Agnieszka; Sitarek, Przemysław; Toma, Monika; Czarny, Piotr; Synowiec, Ewelina; Krupa, Renata; Wigner, Paulina; Bialek, Katarzyna; Kwiatkowski, Dominik; Korycinska, Anna; Majsterek, Ireneusz; Szemraj, Janusz; Galecki, Piotr; Sliwinski, Tomasz
2017-10-03
Neurodegeneration in Alzheimer's disease can be caused by accumulation of oxidative DNA damage resulting from altered expression of genes involved in the base excision repair system (BER). Promoter methylation can affect the profile of BER genes expression. Decreased expression of BER genes was observed in the brains of AD patients. The aim of our study was to compare the expression and methylation profiles of six genes coding for proteins involved in BER, namely: hOGG1, APE1, MUTYH, NEIL1, PARP1 and XRCC1, in the peripheral blood cells of AD patients and healthy volunteers. The study consisted of 100 persons diagnosed with Alzheimer's disease according to DSM-IV criteria, and 110 healthy volunteers. DNA and total RNA were isolated from venous blood cells. Promoter methylation profiles were obtained by High Resolution Melting (HRM) analysis of bisulfide converted DNA samples. Real-time PCR with TaqMan probes was employed for gene expression analysis. APE1, hOGG1, MUTYH, PARP1 and NEIL1 were significantly (pgenes. The methylation status of promoters is not associated with downregulation of BER genes. Our results show that downregulation of BER genes detected in peripheral blood samples could reflect the changes occurring in the brain of patients with AD, and may be a useful biomarker of this disease. Copyright © 2017 Elsevier Inc. All rights reserved.
Vijayalaxmi, S; Prakash, P; Jayalakshmi, S K; Mulimani, V H; Sreeramulu, K
2013-09-01
The alkaliphilic Bacillus halodurans strain PPKS-2 was shown to produce extracellular extreme alkaliphilic, halotolerent, detergent, and thermostable mannanase activity. The cultural conditions for the maximum enzyme production were optimized with respect to pH, temperature, NaCl, and inexpensive agro wastes as substrates. Mannanase production was enhanced more than 4-fold in the presence of 1 % defatted copra meal and 0.5 % peptone or feather hydrolysate at pH 11 and 40 °C. Mannanase was purified to 10.3-fold with 34.6 % yield by ion exchange and gel filtration chromatography methods. Its molecular mass was estimated to be 22 kDa by SDS-PAGE. The mannanase had maximal activity at pH 11 and 70 °C. This enzyme was active over a broad range of NaCl (0-16 %) and thermostable retaining 100 % of the original activity at 70 °C for 3 h. Immobilization of whole cells proved to be effective for continuous production of mannanase. Since the strain PPKS-2 grows on cheaper agro wastes such as defatted copra meal, corn husk, jowar bagasse, and wheat bran, these can be exploited for mannanase production on an industrial scale.
Niu, Chengtuo; Zhu, Linjiang; Hill, Annie; Alex Speers, R; Li, Qi
2017-01-01
To improve the thermostability and catalytic property of a mesophilic 1,3-1,4-β-glucanase by combinational mutagenesis and to test its effect in congress mashing. A mutant β-glucanase (rE-BglTO) constructed by combinational mutagenesis showed a 25 °C increase in optimal temperature (to 70 °C) a 19.5 °C rise in T 50 value and a 15.6 °C increase in melting temperature compared to wild-type enzyme. Its half-life values at 60 and 70 °C were 152 and 99 min, which were 370 and 800 % higher than those of wild-type enzyme. Besides, its specific activity and k cat value were 42,734 U mg -1 and 189 s -1 while its stability under acidic conditions was also improved. In flask fermentation, the catalytic activity of rE-BglTO reached 2381 U ml -1 , which was 63 % higher than that of wild-type enzyme. The addition of rE-BglTO in congress mashing decreased the filtration time and viscosity by 21.3 and 9.6 %, respectively. The mutant β-glucanase showed high catalytic activity and thermostability which indicated that rE-BglTO is a good candidate for application in the brewing industry.
Directory of Open Access Journals (Sweden)
Sigoillot Jean-Claude
2009-11-01
Full Text Available Abstract Background Mannans are key components of lignocellulose present in the hemicellulosic fraction of plant primary cell walls. Mannan endo-1,4-β-mannosidases (1,4-β-D-mannanases catalyze the random hydrolysis of β-1,4-mannosidic linkages in the main chain of β-mannans. Biodegradation of β-mannans by the action of thermostable mannan endo-1,4-β-mannosidase offers significant technical advantages in biotechnological industrial applications, i.e. delignification of kraft pulps or the pretreatment of lignocellulosic biomass rich in mannan for the production of second generation biofuels, as well as for applications in oil and gas well stimulation, extraction of vegetable oils and coffee beans, and the production of value-added products such as prebiotic manno-oligosaccharides (MOS. Results A gene encoding mannan endo-1,4-β-mannosidase or 1,4-β-D-mannan mannanohydrolase (E.C. 3.2.1.78, commonly termed β-mannanase, from Aspergillus niger BK01, which belongs to glycosyl hydrolase family 5 (GH5, was cloned and successfully expressed heterologously (up to 243 μg of active recombinant protein per mL in Pichia pastoris. The enzyme was secreted by P. pastoris and could be collected from the culture supernatant. The purified enzyme appeared glycosylated as a single band on SDS-PAGE with a molecular mass of approximately 53 kDa. The recombinant β-mannanase is highly thermostable with a half-life time of approximately 56 h at 70°C and pH 4.0. The optimal temperature (10-min assay and pH value for activity are 80°C and pH 4.5, respectively. The enzyme is not only active towards structurally different mannans but also exhibits low activity towards birchwood xylan. Apparent Km values of the enzyme for konjac glucomannan (low viscosity, locust bean gum galactomannan, carob galactomannan (low viscosity, and 1,4-β-D-mannan (from carob are 0.6 mg mL-1, 2.0 mg mL-1, 2.2 mg mL-1 and 1.5 mg mL-1, respectively, while the kcat values for these
Jeenduang, Nutjaree; Sangkaew, Boonnisa; Chantaracha, Pacharee; Chanchareonsri, Sirada; Plyduang, Thunyaluk; Thitdee, Wanida; Samae, Cathaleeya; Pitumanon, Wacharaporn
2017-03-01
Hibiscus sabdariffa L. (HS) and Gynostemma pentaphyllum Makino (GP) have been used as traditional medicines to treat diabetes and hypercholesterolemia. Nevertheless, there is interindividual variation in the metabolic responses to HS and GP consumption. This may be due to genetic factors. The aim of this study was to investigate the effects of HS and GP tea consumption on anthropometric data, fasting blood glucose (FBG), and lipid concentrations in hypercholesterolemia subjects with different genotypes of the APOE and CETP TaqIB polymorphisms. Forty-eight subjects with hypercholesterolemia were given either HS or GP tea for 30 days. Anthropometric and biochemical variables were determined, and APOE and CETP TaqIB polymorphisms were analyzed using the polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP). E4 (p=0.008) and homozygous B1B1 (p=0.010) carriers had significantly decreased HDL-C concentrations after HS consumption; in addition, B2 carriers who consumed HS showed significantly decreased triglyceride (TG) concentrations (p=0.039). Regarding GP consumption, non-E4 carriers had significantly decreased HDL-C (p=0.009) and FBG (p=0.042) concentrations. Furthermore, B2 carriers had significantly decreased total cholesterol (TC) (p=0.045), HDL-C (p=0.004), and FBG (p=0.026) concentrations. HS consumption may have beneficial effects with respect to TG concentrations in the B2 carriers, but it may adversely affect HDL-C concentrations in homozygous B1B1 and E4 carriers. In contrast, GP consumption may have favorable effects on TC and FBG concentrations but not on HDL-C concentrations for B2 and/or non-E4 carriers.
Reis, E M; Araujo, S; Lobato, J; Neves, A F; Costa, A V; Gonçalves, M A; Goulart, L R; Goulart, I M B
2014-05-01
Leprosy epidemiological studies have been restricted to Mycobacterium leprae DNA detection in nasal and oral mucosa samples with scarce literature on peripheral blood. We present the largest study applying quantitative real-time PCR (qPCR) for the detection of M. leprae DNA in peripheral blood samples of 200 untreated leprosy patients and 826 household contacts, with results associated with clinical and laboratory parameters. To detect M. leprae DNA a TaqMan qPCR assay targeting the M. leprae ML0024 genomic region was performed. The ML0024 qPCR in blood samples detected the presence of bacillus DNA in 22.0% (44/200) of the leprosy patients: 23.2% (16/69) in paucibacillary (PB), and 21.4% (28/131) in multibacillary (MB) patients. Overall positivity among contacts was 1.2% (10/826), with similar percentages regardless of whether the index case was PB or MB. After a follow-up period of 7 years, 26 contacts have developed leprosy. Comparing the results of healthy contacts with those that become ill, ML0024 qPCR positivity at the time of diagnosis of their index case represented an impressive 14.78-fold greater risk for leprosy onset (95% CI 3.6-60.8; p <0.0001). In brief, contacts with positive PCR in blood at diagnosis of index cases are at higher risk of later leprosy onset and this marker might be combined with other prognostic markers for management of contacts, which requires further studies. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
Kulesh, David A.; Baker, Robert O.; Loveless, Bonnie M.; Norwood, David; Zwiers, Susan H.; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P.; Huggins, John; Jahrling, Peter B.
2004-01-01
We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3′-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 × 107, 1.24 × 105, 1.24 × 103, and 1.24 × 101 genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs. However
Energy Technology Data Exchange (ETDEWEB)
Spreinat, A [Goettingen Univ. (Germany, F.R.). Inst. fuer Mikrobiologie; Antranikian, G [Technische Univ. Hamburg-Harburg, Hamburg (Germany, F. R.). Arbeitsbereich Biotechnologie 1
1990-08-01
A novel thermostable pullulanase, secreted by the thermophilic anaerobic bacterium Clostridium thermosulfurogenes EM1, was purified and characterized. Applying anion exchange chromatography and gel filtration the enzyme was purified 47-fold and had a specific activity of 200 units/mg. The molecular mass of this thermostable enzyme was determined to be 102 000 daltons and consisted of a single subunit. The enzyme was able to attack specifically the {alpha}-1,6-glycosidic linkages in pullulan and caused its complete hydrolysis to maltotriose. Surprisingly and unlike the enzyme from Klebsiella pneumoniae, the purified enzyme from this anaerobic thermophile exhibited, in addition to its debranching and pullulanase activity, an {alpha}-1,4 hydrolysing activity as well. By the action of this single polypeptide chain various branched and linear polysaccharides were completely converted to two major products, namely maltose and maltotriose. The K{sub m} values of this enzyme for pullulan and amylose were determined to be 1.33 mg/ml and 0.38 mg/ml, respectively. This debranching enzyme displays a temperature optimum at 60deg-65deg C and a pH optimum at 5.5-6.0. The application of this new class of pullulanase (pullulanase type II) in industry will significantly enhance the starch saccharification process. (orig.).
Directory of Open Access Journals (Sweden)
Yaqiong Zhao
2017-01-01
Full Text Available Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst is a devastating wheat disease worldwide. Potential application of near-infrared spectroscopy (NIRS in detection of pathogen amounts in latently Pst-infected wheat leaves was investigated for disease prediction and control. A total of 300 near-infrared spectra were acquired from the Pst-infected leaf samples in an incubation period, and relative contents of Pst DNA in the samples were obtained using duplex TaqMan real-time PCR arrays. Determination models of the relative contents of Pst DNA in the samples were built using quantitative partial least squares (QPLS, support vector regression (SVR, and a method integrated with QPLS and SVR. The results showed that the kQPLS-SVR model built with a ratio of training set to testing set equal to 3 : 1 based on the original spectra, when the number of the randomly selected wavelength points was 700, the number of principal components was 8, and the number of the built QPLS models was 5, was the best. The results indicated that quantitative detection of Pst DNA in leaves in the incubation period could be implemented using NIRS. A novel method for determination of latent infection levels of Pst and early detection of stripe rust was provided.
International Nuclear Information System (INIS)
Muller, E.
2002-01-01
Several oxidative processes induce the formation of DNA lesions. In order to evaluate the biological and structural significance of such damage, several DNA lesions were inserted into synthetic oligonucleotides at defined sites. The research work aimed at describing the preparation of oligonucleotides t hat contained DNA damage and the evaluation of the biological properties of the lesions. A first part described the incorporation of radiation-induced lesions, namely (5'S,6S)-5',6-cyclo-5,6-dihydro-2'-deoxyuridine and (5'S,5S,6S)-5',6-cyclo-5-hydroxy-5,6-dihydro-2'-desoxyuridine into oligonucleotides. The modified DNA fragments were characterised by several spectroscopic and biochemical analyses including ESI MS, MALDI-TOF MS, CLHP and enzymatic digestions. During in vitro DNA synthesis by Taq DNA polymerase and Klenow exo fragment, the pyrimidine cyclo-nucleosides were found to block the progression of the enzymes. Then, repair studies by ADN N glycosylases, operating in the base excision repair pathway, have shown that the anhydro-nucleoside lesions were not recognised nor excised by Fpg, endo III, endo VIII, yNtg1 yNtg2 and yOgg1. Interestingly, the Latococcus lactis Fpg protein recognises (formation of a non covalent complex) but do not excise the damage. The incorporation into oligonucleotides of the (5R*) and (5S*) diastereoisomers of 1-[2-deoxy-β-D-erythro-pentofuranosyl]-5-hydroxy-hydantoin, generated by several oxidative processes was then described. In vitro DNA replication assays using modified oligonucleotides matrix showed a lethal potential of the latter base damage. Repair studies by ADN N-glycosylases showed that the damage was substrate for Fpg, endo III, endo VIII, Ntg1, Ntg2 and Fpg-L1. The rates of excision as inferred from the determination of the Michaelis kinetics constants were found to be affected by the presence of the damage. MALDI-TOF MS was used in order to gain insights into mechanistic aspects of oligonucleotides cleavage by the
Directory of Open Access Journals (Sweden)
Ishikawa Shumpei
2006-02-01
Full Text Available Abstract Background DNA copy number alterations are one of the main characteristics of the cancer cell karyotype and can contribute to the complex phenotype of these cells. These alterations can lead to gains in cellular oncogenes as well as losses in tumor suppressor genes and can span small intervals as well as involve entire chromosomes. The ability to accurately detect these changes is central to understanding how they impact the biology of the cell. Results We describe a novel algorithm called CARAT (Copy Number Analysis with Regression And Tree that uses probe intensity information to infer copy number in an allele-specific manner from high density DNA oligonuceotide arrays designed to genotype over 100, 000 SNPs. Total and allele-specific copy number estimations using CARAT are independently evaluated for a subset of SNPs using quantitative PCR and allelic TaqMan reactions with several human breast cancer cell lines. The sensitivity and specificity of the algorithm are characterized using DNA samples containing differing numbers of X chromosomes as well as a test set of normal individuals. Results from the algorithm show a high degree of agreement with results from independent verification methods. Conclusion Overall, CARAT automatically detects regions with copy number variations and assigns a significance score to each alteration as well as generating allele-specific output. When coupled with SNP genotype calls from the same array, CARAT provides additional detail into the structure of genome wide alterations that can contribute to allelic imbalance.
On-Demand Production of Flow-Reactor Cartridges by 3D Printing of Thermostable Enzymes.
Maier, Manfred; Radtke, Carsten P; Hubbuch, Jürgen; Niemeyer, Christof M; Rabe, Kersten S
2018-05-04
The compartmentalization of chemical reactions is an essential principle of life that provides a major source of innovation for the development of novel approaches in biocatalysis. To implement spatially controlled biotransformations, rapid manufacturing methods are needed for the production of biocatalysts that can be applied in flow systems. Whereas three-dimensional (3D) printing techniques offer high-throughput manufacturing capability, they are usually not compatible with the delicate nature of enzymes, which call for physiological processing parameters. We herein demonstrate the utility of thermostable enzymes in the generation of biocatalytic agarose-based inks for a simple temperature-controlled 3D printing process. As examples we utilized an esterase and an alcohol dehydrogenase from thermophilic organisms as well as a decarboxylase that was thermostabilized by directed protein evolution. We used the resulting 3D-printed parts for a continuous, two-step sequential biotransformation in a fluidic setup. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Construction and engineering of a thermostable self-sufficient cytochrome P450
Energy Technology Data Exchange (ETDEWEB)
Mandai, Takao; Fujiwara, Shinsuke [Nanobiotechnology Research Center and Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda 669-1337 (Japan); Imaoka, Susumu, E-mail: imaoka@kwansei.ac.jp [Nanobiotechnology Research Center and Department of Bioscience, School of Science and Technology, Kwansei Gakuin University, 2-1 Gakuen, Sanda 669-1337 (Japan)
2009-06-19
CYP175A1 is a thermophilic cytochrome P450 and hydroxylates {beta}-carotene. We previously identified a native electron transport system for CYP175A1. In this report, we constructed two fusion proteins consisting of CYP175A1, ferredoxin (Fdx), and ferredoxin-NADP{sup +} reductase (FNR): H{sub 2}N-CYP175A1-Fdx-FNR-COOH (175FR) and H{sub 2}N-CYP175A1-FNR-Fdx-COOH (175RF). Both 175FR and 175RF were expressed in Escherichia coli and purified. The V{sub max} value for {beta}-carotene hydroxylation was 25 times higher with 175RF than 175FR and 9 times higher with 175RF than CYP175A1 (non-fused protein), although the k{sub m} values of these enzymes were similar. 175RF retained 50% residual activity even at 80 {sup o}C. Furthermore, several mutants of the CYP175A1 domain of 175RF were prepared and one mutant (Q67G/Y68I) catalyzed the hydroxylation of an unnatural substrate, testosterone. Thus, this is the first report of a thermostable self-sufficient cytochrome P450 and the engineering of a thermophilic cytochrome P450 for the oxidation of an unnatural substrate.
Construction and engineering of a thermostable self-sufficient cytochrome P450
International Nuclear Information System (INIS)
Mandai, Takao; Fujiwara, Shinsuke; Imaoka, Susumu
2009-01-01
CYP175A1 is a thermophilic cytochrome P450 and hydroxylates β-carotene. We previously identified a native electron transport system for CYP175A1. In this report, we constructed two fusion proteins consisting of CYP175A1, ferredoxin (Fdx), and ferredoxin-NADP + reductase (FNR): H 2 N-CYP175A1-Fdx-FNR-COOH (175FR) and H 2 N-CYP175A1-FNR-Fdx-COOH (175RF). Both 175FR and 175RF were expressed in Escherichia coli and purified. The V max value for β-carotene hydroxylation was 25 times higher with 175RF than 175FR and 9 times higher with 175RF than CYP175A1 (non-fused protein), although the k m values of these enzymes were similar. 175RF retained 50% residual activity even at 80 o C. Furthermore, several mutants of the CYP175A1 domain of 175RF were prepared and one mutant (Q67G/Y68I) catalyzed the hydroxylation of an unnatural substrate, testosterone. Thus, this is the first report of a thermostable self-sufficient cytochrome P450 and the engineering of a thermophilic cytochrome P450 for the oxidation of an unnatural substrate.
Thermostable Bacteriocin BL8 from Bacillus licheniformis isolated from marine sediment.
Smitha, S; Bhat, S G
2013-03-01
To isolate and characterize bacteriocin, BL8, from the bacteria identified as Bacillus licheniformis from marine environment. One-hundred and twelve bacterial isolates from sediment and water samples collected off the coast of Cochin, India, were screened for antibacterial activity. Strain BTHT8, identified as Bacillus licheniformis, inhibited the growth of Gram-positive test organisms. The active component labelled as bacteriocin BL8 was partially purified by ammonium sulphate fractionation and was subjected to glycine SDS-PAGE. The band exhibiting antimicrobial activity was electroeluted and analysed using MALDI-TOF mass spectrometry, and the molecular mass was determined as 1.4 kDa. N-terminal amino acid sequencing of BL8 gave a 13 amino acid sequence stretch. Bacteriocin BL8 was stable even after boiling at 100 °C for 30 min and over a wide pH range of 1-12. A novel, pH-tolerant and thermostable bacteriocin BL8, active against the tested Gram-positive bacteria, was isolated from Bacillus licheniformis. This study reports a stable, low molecular weight bacteriocin from Bacillus licheniformis. This bacteriocin can be used to address two important applications: as a therapeutic agent and as a biopreservative in food processing industry. © 2012 The Society for Applied Microbiology.
Geometric Simulation Approach for Grading and Assessing the Thermostability of CALBs
Directory of Open Access Journals (Sweden)
B. Senthilkumar
2016-01-01
Full Text Available Candida antarctica lipase B (CALB is a known stable and highly active enzyme used widely in biodiesel synthesis. In this work, the stability of native (4K6G and mutant (4K5Q CALB was studied through various structural parameters using conformational sampling approach. The contours of polar surface area and surface area of mutant CALB were 11357.67 Å2 and 30007.4 Å2, respectively, showing an enhanced stability compared to native CALB with a statistically significant P value of < 0.0001. Moreover, simulated thermal denaturation of CALB, a process involving dilution of hydrogen bond, significantly shielded against different intervals of energy application in mutant CALB revealing its augmentation of structural rigidity against native CALB. Finally, computational docking analysis showed an increase in the binding affinity of CALB and its substrate (triglyceride in mutant CALB with Atomic Contact Energy (ACE of −91.23 kcal/mol compared to native CALB (ACE of −70.3 kcal/mol. The computational observations proposed that the use of mutant CALB (4K5Q could serve as a best template for production of biodiesel in the future. Additionally, it can also be used as a template to identify efficient thermostable lipases through further mutations.
Reconstitution of β-carotene hydroxylase activity of thermostable CYP175A1 monooxygenase
International Nuclear Information System (INIS)
Momoi, Kyoko; Hofmann, Ute; Schmid, Rolf D.; Urlacher, Vlada B.
2006-01-01
CYP175A1 is a thermostable P450 Monooxygenase from Thermus thermophilus HB27, demonstrating in vivo activity towards β-carotene. Activity of CYP175A1 was reconstituted in vitro using artificial electron transport proteins. First results were obtained in the mixture with a crude Escherichia coli cell extract at 37 o C. In this system, β-carotene was hydroxylated to β-cryptoxanthin. The result indicated the presence of electron transport enzymes among the E. coli proteins, which are suitable for CYP175A1. However, upon in vitro reconstitution of CYP175A1 activity with purified recombinant flavodoxin and flavodoxin reductase from E. coli, only very low β-cryptoxanthin production was observed. Remarkably, with another artificial electron transport system, putidaredoxin and putidaredoxin reductase from Pseudomonas putida, purified CYP175A1 enzyme hydroxylated β-carotene at 3- and also 3'-positions, resulting in β-cryptoxanthin and zeaxanthin. Under the optimal reaction conditions, the turnover rate of the enzyme reached 0.23 nmol β-cryptoxanthin produced per nmol P450 per min
Chevaliez, Stéphane; Dauvillier, Claude; Dubernet, Fabienne; Poveda, Jean-Dominique; Laperche, Syria; Hézode, Christophe; Pawlotsky, Jean-Michel
2017-04-01
Sensitive and accurate hepatitis B virus (HBV) DNA detection and quantification are essential to diagnose HBV infection, establish the prognosis of HBV-related liver disease, and guide the decision to treat and monitor the virological response to antiviral treatment and the emergence of resistance. Currently available HBV DNA platforms and assays are generally designed for batching multiple specimens within an individual run and require at least one full day of work to complete the analyses. The aim of this study was to evaluate the ability of the newly developed, fully automated, one-step Aptima HBV Quant assay to accurately detect and quantify HBV DNA in a large series of patients infected with different HBV genotypes. The limit of detection of the assay was estimated to be 4.5 IU/ml. The specificity of the assay was 100%. Intra-assay and interassay coefficients of variation ranged from 0.29% to 5.07% and 4.90% to 6.85%, respectively. HBV DNA levels from patients infected with HBV genotypes A to F measured with the Aptima HBV Quant assay strongly correlated with those measured by two commercial real-time PCR comparators (Cobas AmpliPrep/Cobas TaqMan HBV test, version 2.0, and Abbott RealTi m e HBV test). In conclusion, the Aptima HBV Quant assay is sensitive, specific, and reproducible and accurately quantifies HBV DNA in plasma samples from patients with chronic HBV infections of all genotypes, including patients on antiviral treatment with nucleoside or nucleotide analogues. The Aptima HBV Quant assay can thus confidently be used to detect and quantify HBV DNA in both clinical trials with new anti-HBV drugs and clinical practice. Copyright © 2017 American Society for Microbiology.
Dubois, Benjamin; Bertin, Pierre; Muhovski, Yordan; Escarnot, Emmanuelle; Mingeot, Dominique
2017-01-01
Celiac disease (CD) is caused by specific sequences of gluten proteins found in cereals such as bread wheat ( Triticum aestivum ssp. aestivum ) and spelt ( T. aestivum ssp. spelta ). Among them, the α-gliadins display the highest immunogenicity, with four T-cell stimulatory epitopes. The toxicity of each epitope sequence can be reduced or even suppressed according to the allelic form of each sequence. One way to address the CD problem would be to make use of this allelic variability in breeding programs to develop safe varieties, but tools to track the presence of toxic epitopes are required. The objective of this study was to develop a tool to accurately detect and quantify the immunogenic content of expressed α-gliadins of spelt and bread wheat. Four TaqMan probes that only hybridize to the canonical-i.e. toxic-form of each of the four epitopes were developed and their specificity was demonstrated. Six TaqMan probes targeting stable reference genes were also developed and constitute a tool to normalize qPCR data. The probes were used to measure the epitope expression levels of 11 contrasted spelt accessions and three ancestral diploid accessions of bread wheat and spelt. A high expression variability was highlighted among epitopes and among accessions, especially in Asian spelts, which showed lower epitope expression levels than the other spelts. Some discrepancies were identified between the canonical epitope expression level and the global amount of expressed α-gliadins, which makes the designed TaqMan probes a useful tool to quantify the immunogenic potential independently of the global amount of expressed α-gliadins. The results obtained in this study provide useful tools to study the immunogenic potential of expressed α-gliadin sequences from Triticeae accessions such as spelt and bread wheat. The application of the designed probes to contrasted spelt accessions revealed a high variability and interesting low canonical epitope expression levels in the
Bu, Yifan; Cui, Yinglu; Peng, Ying; Hu, Meirong; Tian, Yu'e; Tao, Yong; Wu, Bian
2018-04-01
Xylanases, which cleave the β-1,4-glycosidic bond between xylose residues to release xylooligosaccharides (XOS), are widely used as food additives, animal feeds, and pulp bleaching agents. However, the thermally unstable nature of xylanases would hamper their industrial application. In this study, we used in silico design in a glycoside hydrolase family (GH) 11 xylanase to stabilize the enzyme. A combination of the best mutations increased the apparent melting temperature by 14 °C and significantly enhanced thermostability and thermoactivation. The variant also showed an upward-shifted optimal temperature for catalysis without compromising its activity at low temperatures. Moreover, a 10-fold higher XOS production yield was obtained at 70 °C, which compensated the low yield obtained with the wild-type enzyme. Collectively, the variant constructed by the computational strategy can be used as an efficient biocatalyst for XOS production at industrially viable conditions.
Directory of Open Access Journals (Sweden)
Kamau Edwin
2012-01-01
Full Text Available Abstract Background Anti-malarial drug resistance poses a threat to current global efforts towards control and elimination of malaria. Several methods are used in monitoring anti-malarial drug resistance. Molecular markers such as single nucleotide polymorphism (SNP for example are increasingly being used to identify genetic mutations related to anti-malarial drug resistance. Several methods are currently being used in analysis of SNP associated with anti-malarial drug resistance and although each one of these methods has unique strengths and shortcoming, there is still need to improve and/or develop new methods that will close the gap found in the current methods. Methods TaqMan Allelic Discrimination assays for detection of SNPs associated with anti-malarial drug resistance were designed for analysis on Applied Biosystems PCR platform. These assays were designed by submitting SNP sequences associated with anti-malarial drug resistance to Applied Biosystems website. Eleven SNPs associated with resistance to anti-malarial drugs were selected and tested. The performance of each SNP assay was tested by creating plasmid DNAs carrying codons of interests and analysing them for analysis. To test the sensitivity and specificity of each SNP assay, 12 clinical samples were sequenced at codons of interest and used in the analysis. Plasmid DNAs were used to establish the Limit of Detection (LoD for each assay. Results Data from genetic profiles of the Plasmodium falciparum laboratory strains and sequence data from 12 clinical samples was used as the reference method with which the performance of the SNP assays were compared to. The sensitivity and specificity of each SNP assay was establish at 100%. LoD for each assay was established at 2 GE, equivalent to less than 1 parasite/μL. SNP assays performed well in detecting mixed infection and analysis of clinical samples. Conclusion TaqMan Allelic Discrimination assay provides a good alternative tool in
Extração de DNA genômico de tecidos foliares maduros de espécies nativas do cerrado
Directory of Open Access Journals (Sweden)
Márcia Nara da Silva
2010-12-01
Full Text Available Grandes quantidades de contaminantes na amostra de DNA dificultam a obtenção de DNA genômico de qualidade durante a extração. A presença de polissacarídeos, fenóis e outros compostos secundários representa o principal problema com o procedimento de isolamento do DNA e sua aplicação subsequente, por inibir a atividade das enzimas Taq DNA polimera-se e enzimas de restrição. Neste estudo, descreveu-se um procedimento modificado baseado no hexadecyltrimethylammonium (CTAB, rendendo DNA genômico satisfatório para técnicas de manipulação subsequente, como reações de PCR e digestão com enzima de restrição. Nesse protocolo foram utilizadas diferentes concentrações de β-mercaptoetanol no tampão de extração (0,0; 0,2; 10; 15; 25; e 50 uL de β-mercaptoetanol/mL do tampão de extração: 100 mM de Tris-HCl, pH 8; 20 mM de EDTA; 1,4 mM de NaCl; 2% de CTAB; 1% de PVP, cujo procedimento foi aplicado no caso de folhas maduras e testado em Annona crassiflora (arati-cum, Eugenia dysenterica (cagaita, Anacardium humilis (caju-do-campo, Hancornia speciosa (mangaba e Caryocar brasiliense (pequi. O protocolo foi eficiente no isolamento de DNA livre de polissacarídeos e polifenóis, com rendimento do DNA com alto peso molecu-lar, utilizando-se concentrações a partir de 1% de β-mercaptoetanol no tampão de extração. O DNA isolado por esse método mostrou alta pureza, de acordo com as análises de digestão por restrição e amplificação por PCR.
Optimization of a protocol for extraction of Plasmodium falciparum ...
African Journals Online (AJOL)
STORAGESEVER
2008-05-16
May 16, 2008 ... compared to saponin lysed samples when such whole blood ... infected blood intended for extraction of P. falciparum RNA for DNA microarrays and other sensitive ... TaqMan® and LightCycler® technology, and other.
Nisoli, E; Brunani, A; Borgomainerio, E; Tonello, C; Dioni, L; Briscini, L; Redaelli, G; Molinari, E; Cavagnini, F; Carruba, M O
2007-06-01
Food is considered a reinforcing agent, like a variety of substances such as alcohol and other drugs of abuse that produce pleasure. Psychopathological traits related to food intake are demonstrated in eating disorders as in obesity with different genetic aspects for these diseases. Recently, the prevalence of TaqA1 allele has been associated to alcohol, drug abuse and carbohydrate preference. For this reason, the aim of this study was to evaluate if the presence of A1 allele, in eating disorders and obesity, is associated with some particular psycho-pathological characteristics. We studied the presence of TaqA1 in Italian subjects affected by obesity (n=71), anorexia (n=28), bulimia (n=20) and in control group (n=54). The Eating Disorders Inventory (EDI test) was used to evaluate the psychological profiles. Patients without alcohol and drugs abuse were selected (>125 ml/day). The A1+ allele, both in A1/A1 and A1/A2 genotypes, was not differently distributed among disease groups; on the contrary two EDI subscales (Drive for thinness and Ineffectiveness) resulted associated with A1+ allele without effect of the eating disease or obesity. These results confirm that the presence of A1+ allele is not simply related to body weight but the A1+ allele might be a marker of a genetic psychological condition in people with high risk to develop pathological eating behaviour.
Directory of Open Access Journals (Sweden)
FIGUEIREDO Luiz Tadeu Moraes
1997-01-01
Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination
Kimura, Yukihiro; Lyu, Shuwen; Okoshi, Akira; Okazaki, Koudai; Nakamura, Natsuki; Ohashi, Akira; Ohno, Takashi; Kobayashi, Manami; Imanishi, Michie; Takaichi, Shinichi; Madigan, Michael T; Wang-Otomo, Zheng-Yu
2017-05-18
The light harvesting-reaction center (LH1-RC) complex from a new thermophilic purple sulfur bacterium Allochromatium (Alc.) tepidum was isolated and characterized by spectroscopic and thermodynamic analyses. The purified Alc. tepidum LH1-RC complex showed a high thermostability comparable to that of another thermophilic purple sulfur bacterium Thermochromatium tepidum, and spectroscopic characteristics similar to those of a mesophilic bacterium Alc. vinosum. Approximately 4-5 Ca 2+ per LH1-RC were detected by inductively coupled plasma atomic emission spectroscopy and isothermal titration calorimetry. Upon removal of Ca 2+ , the denaturing temperature of the Alc. tepidum LH1-RC complex dropped accompanied by a blue-shift of the LH1 Q y absorption band. The effect of Ca 2+ was also observed in the resonance Raman shift of the C3-acetyl νC═O band of bacteriochlorophyll-a, indicating changes in the hydrogen-bonding interactions between the pigment and LH1 polypeptides. Thermodynamic parameters for the Ca 2+ -binding to the Alc. tepidum LH1-RC complex indicated that this reaction is predominantly driven by the largely favorable electrostatic interactions that counteract the unfavorable negative entropy change. Our data support a hypothesis that Alc. tepidum may be a transitional organism between mesophilic and thermophilic purple bacteria and that Ca 2+ is one of the major keys to the thermostability of LH1-RC complexes in purple bacteria.
Directory of Open Access Journals (Sweden)
Žel Jana
2008-03-01
Full Text Available Abstract Background The real-time polymerase chain reaction is currently the method of choice for quantifying nucleic acids in different DNA based quantification applications. It is widely used also for detecting and quantifying genetically modified components in food and feed, predominantly employing TaqMan® and SYBR® Green real-time PCR chemistries. In our study four alternative chemistries: Lux™, Plexor™, Cycling Probe Technology and LNA® were extensively evaluated and compared using TaqMan® chemistry as a reference system. Results Amplicons were designed on the maize invertase gene and the 5'-junction of inserted transgene and plant genomic DNA in MON 810 event. Real-time assays were subsequently compared for their efficiency in PCR amplification, limits of detection and quantification, repeatability and accuracy to test the performance of the assays. Additionally, the specificity of established assays was checked on various transgenic and non-transgenic plant species. The overall applicability of the designed assays was evaluated, adding practicability and costs issues to the performance characteristics. Conclusion Although none of the chemistries significantly outperformed the others, there are certain characteristics that suggest that LNA® technology is an alternative to TaqMan® when designing assays for quantitative analysis. Because LNA® probes are much shorter they might be especially appropriate when high specificity is required and where the design of a common TaqMan® probe is difficult or even impossible due to sequence characteristics. Plexor™ on the other hand might be a method of choice for qualitative analysis when sensitivity, low cost and simplicity of use prevail.
Cloning and shake flask expression of hrIDS-Like in Pichia pastoris
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... Restriction enzymes,. T4-ligase, Taq-DNA polymerase and culture media were from .... Each experiment was run at least 3 times, with a coef- ficient of variation ..... New York,. Greene Publishing ... Pichia expression kit. Protein ...
Two RFLPs in the 5 prime end of the human osteonectin (ON) gene
Energy Technology Data Exchange (ETDEWEB)
Schwartz, R C; Tsipouras, P [Univ. of Connecticut Health Center Farmington (USA); Young, M F [National Institutes of Health, Bethesda, MD (USA)
1988-09-26
On 164 is a 550 base pair cDNA clone at the 5{prime} end of the human osteonectin gene. The insert is an EcoRI fragment inserted into Bluescript. HincII identified a simple two allele polymorphism with a band at either 14 kb or 12.5 kb. TaqI identified a simple two allele polymorphism with a band at either 4.9 or 4.6 kb. 18 and 26 unrelated individuals from the CEPH panel were studied for the HincII and TaqI polymorphisms respectively. Autosomal dominant inheritance was demonstrated in 2 kindreds of 8 individuals for each polymorphism.
Molecular screening of S769N mutation for PFATPASE in subjects ...
African Journals Online (AJOL)
2016-03-09
Mar 9, 2016 ... International Journal of Medicine and Biomedical Research. Volume 5 Issue 1 January .... primer (F/R), and 1X dream Taq green DNA polymerase. One microliters of .... Medicine and Hygiene 2002;96:91–95. 25. World Health ...
Ghobadloo, Shahrokh M.; Balcerzak, Anna K.; Gargaun, Ana; Muharemagic, Darija; Mironov, Gleb G.; Capicciotti, Chantelle J.; Briard, Jennie G.; Ben, Robert N.; Berezovski, Maxim V.
2014-07-01
The inability of vaccines to retain sufficient thermostability has been an obstacle to global vaccination programs. To address this major limitation, we utilized carbohydrate-based ice recrystallization inhibitors (IRIs) to eliminate the cold chain and stabilize the potency of Vaccinia virus (VV), Vesicular Stomatitis virus (VSV) and Herpes virus-1 (HSV-1). The impact of these IRIs was tested on the potency of the viral vectors using a plaque forming unit assay following room temperature storage, cryopreservation with successive freeze-thaw cycles and lyophilization. Viral potency after storage with all three conditions demonstrated that N-octyl-gluconamide (NOGlc) recovered the infectivity of shelf stored VV, 5.6 Log10 PFU mL-1 during 40 days, and HSV-1, 2.7 Log10 PFU mL-1 during 9 days. Carbon-linked antifreeze glycoprotein analogue ornithine-glycine-glycine-galactose (OGG-Gal) increases the recovery of VV and VSV more than 1 Log10 PFU mL-1 after 10 freeze-thaw cycles. In VSV, cryostorage with OGG-Gal maintains high infectivity and reduces temperature-induced aggregation of viral particles by 2 times that of the control. In total, OGG-Gal and NOGlc preserve virus potency during cryostorage. Remarkably, NOGlc has potential to eliminate the cold chain and permit room temperature storage of viral vectors.
FireProt: Energy- and Evolution-Based Computational Design of Thermostable Multiple-Point Mutants.
Bednar, David; Beerens, Koen; Sebestova, Eva; Bendl, Jaroslav; Khare, Sagar; Chaloupkova, Radka; Prokop, Zbynek; Brezovsky, Jan; Baker, David; Damborsky, Jiri
2015-11-01
There is great interest in increasing proteins' stability to enhance their utility as biocatalysts, therapeutics, diagnostics and nanomaterials. Directed evolution is a powerful, but experimentally strenuous approach. Computational methods offer attractive alternatives. However, due to the limited reliability of predictions and potentially antagonistic effects of substitutions, only single-point mutations are usually predicted in silico, experimentally verified and then recombined in multiple-point mutants. Thus, substantial screening is still required. Here we present FireProt, a robust computational strategy for predicting highly stable multiple-point mutants that combines energy- and evolution-based approaches with smart filtering to identify additive stabilizing mutations. FireProt's reliability and applicability was demonstrated by validating its predictions against 656 mutations from the ProTherm database. We demonstrate that thermostability of the model enzymes haloalkane dehalogenase DhaA and γ-hexachlorocyclohexane dehydrochlorinase LinA can be substantially increased (ΔTm = 24°C and 21°C) by constructing and characterizing only a handful of multiple-point mutants. FireProt can be applied to any protein for which a tertiary structure and homologous sequences are available, and will facilitate the rapid development of robust proteins for biomedical and biotechnological applications.
FireProt: Energy- and Evolution-Based Computational Design of Thermostable Multiple-Point Mutants.
Directory of Open Access Journals (Sweden)
David Bednar
2015-11-01
Full Text Available There is great interest in increasing proteins' stability to enhance their utility as biocatalysts, therapeutics, diagnostics and nanomaterials. Directed evolution is a powerful, but experimentally strenuous approach. Computational methods offer attractive alternatives. However, due to the limited reliability of predictions and potentially antagonistic effects of substitutions, only single-point mutations are usually predicted in silico, experimentally verified and then recombined in multiple-point mutants. Thus, substantial screening is still required. Here we present FireProt, a robust computational strategy for predicting highly stable multiple-point mutants that combines energy- and evolution-based approaches with smart filtering to identify additive stabilizing mutations. FireProt's reliability and applicability was demonstrated by validating its predictions against 656 mutations from the ProTherm database. We demonstrate that thermostability of the model enzymes haloalkane dehalogenase DhaA and γ-hexachlorocyclohexane dehydrochlorinase LinA can be substantially increased (ΔTm = 24°C and 21°C by constructing and characterizing only a handful of multiple-point mutants. FireProt can be applied to any protein for which a tertiary structure and homologous sequences are available, and will facilitate the rapid development of robust proteins for biomedical and biotechnological applications.
Not so monofunctional--a case of thermostable Thermobifida fusca catalase with peroxidase activity.
Lončar, Nikola; Fraaije, Marco W
2015-03-01
Thermobifida fusca is a mesothermophilic organism known for its ability to degrade plant biomass and other organics, and it was demonstrated that it represents a rich resource of genes encoding for potent enzymes for biocatalysis. The thermostable catalase from T. fusca has been cloned and overexpressed in Escherichia coli with a yield of 400 mg/L. Heat treatment of disrupted cells at 60 °C for 1 h resulted in enzyme preparation of high purity; hence, no chromatography steps are needed for large-scale production. Except for catalyzing the dismutation of hydrogen peroxide, TfuCat was also found to catalyze oxidations of phenolic compounds. The catalase activity was comparable to other described catalases while peroxidase activity was quite remarkable with a k obs of nearly 1000 s(-1) for catechol. Site directed mutagenesis was used to alter the ratio of peroxidase/catalase activity. Resistance to inhibition by classic catalase inhibitors and an apparent melting temperature of 74 °C classifies this enzyme as a robust biocatalyst. As such, it could compete with other commercially available catalases while the relatively high peroxidase activity also offers new biocatalytic possibilities.
Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun
2016-11-01
A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.
A quantitative TaqMan PCR assay for the detection of Ureaplasma diversum.
Marques, Lucas M; Amorim, Aline T; Martins, Hellen Braga; Rezende, Izadora Souza; Barbosa, Maysa Santos; Lobão, Tassia Neves; Campos, Guilherme B; Timenetsky, Jorge
2013-12-27
Ureaplasma diversum in veterinary studies is an undesirable microbe, which may cause infection in bulls and may result in seminal vesiculitis, balanopostitis, and alterations in spermatozoids, whereas in cows, it may cause placentitis, fetal alveolitis, abortion, and birth of weak calves. U. diversum is released through organic secretions, especially semen, preputial and vaginal mucus, conjunctival secretion, and milk. The aim of the present study was to develop a TaqMan probe, highly sensitive and specific quantitative PCR (qPCR) assay for the detection and quantification of U. diversum from genital swabs of bovines. Primers and probes specific to U. diversum 16S rRNA gene were designed. The specificity, detection limit, intra- and inter-assay variability of qPCR to detect this ureaplasma was compared with the results of the conventional PCR assay (cPCR). Swabs of vaginal mucus from 169 cows were tested. The qPCR assay detected as few as 10 copies of U. diversum and was 100-fold more sensitive than the cPCR. No cross-reactivity with other Mollicutes or eubacteria was observed. U. diversum was detected in 79 swabs (46.42%) by qPCR, while using cPCR it was detected in 42 (25%) samples. The difference in cPCR and qPCR ureaplasma detection between healthy and sick animals was not statistically significant. But the U. diversum load in samples from animals with genital disorders was higher than in healthy animals. The qPCR assay developed herein is highly sensitive and specific for the detection and quantification of U. diversum in vaginal bovine samples. Copyright © 2013. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Yi-Ching Tung
2015-04-01
Full Text Available Roche modified the COBAS AmpliPrep/COBAS TaqMan human immunodeficiency virus type 1 (HIV-1 test version 1.0 (CAP/CTM v1.0, resulting in the COBAS AmpliPrep/COBAS TaqMan HIV-1 test version 2.0 (CAP/CTM v2.0. The aim of this study was to evaluate the performance of the CAP/CTM v2.0 and to compare this performance with that of the CAP/CTM v1.0. The study was conducted in a small local study group in Kaohsiung Medical University Hospital, Kaohsiung, Taiwan. A total of 86 plasma samples from HIV-1-seropositive patients were tested using the two assays. The correlation and concordance of results between the two assays were calculated. The CAP/CTM v2.0 generated higher values than did the CAP/CTM v1.0, and five samples (5.8% yielded a difference of > 1 log10 copies/mL. In addition, our data show that CAP/CTM v1.0 and CAP/CTM v2.0 yielded relatively consistent values for 23 samples with low viral loads (< 200 copies/mL. Furthermore, when viral loads were in a medium range (2–5 log10 copies/mL, the results of the two assays were more compatible. This study shows a good correlation between CAP/CTM v1.0 and v2.0 in HIV-1 viral load measurement. Further attention must be paid to those cases in which measured viral loads present larger differences between the two assays.
Target-Specific Assay for Rapid and Quantitative Detection of Mycobacterium chimaera DNA.
Zozaya-Valdés, Enrique; Porter, Jessica L; Coventry, John; Fyfe, Janet A M; Carter, Glen P; Gonçalves da Silva, Anders; Schultz, Mark B; Seemann, Torsten; Johnson, Paul D R; Stewardson, Andrew J; Bastian, Ivan; Roberts, Sally A; Howden, Benjamin P; Williamson, Deborah A; Stinear, Timothy P
2017-06-01
Mycobacterium chimaera is an opportunistic environmental mycobacterium belonging to the Mycobacterium avium - M. intracellulare complex. Although most commonly associated with pulmonary disease, there has been growing awareness of invasive M. chimaera infections following cardiac surgery. Investigations suggest worldwide spread of a specific M. chimaera clone, associated with contaminated hospital heater-cooler units used during the surgery. Given the global dissemination of this clone, its potential to cause invasive disease, and the laboriousness of current culture-based diagnostic methods, there is a pressing need to develop rapid and accurate diagnostic assays specific for M. chimaera Here, we assessed 354 mycobacterial genome sequences and confirmed that M. chimaera is a phylogenetically coherent group. In silico comparisons indicated six DNA regions present only in M. chimaera We targeted one of these regions and developed a TaqMan quantitative PCR (qPCR) assay for M. chimaera with a detection limit of 100 CFU/ml in whole blood spiked with bacteria. In vitro screening against DNA extracted from 40 other mycobacterial species and 22 bacterial species from 21 diverse genera confirmed the in silico -predicted specificity for M. chimaera Screening 33 water samples from heater-cooler units with this assay highlighted the increased sensitivity of PCR compared to culture, with 15 of 23 culture-negative samples positive by M. chimaera qPCR. We have thus developed a robust molecular assay that can be readily and rapidly deployed to screen clinical and environmental specimens for M. chimaera . Copyright © 2017 American Society for Microbiology.
Yang, Guang; Yao, Hua; Mozzicafreddo, Matteo; Ballarini, Patrizia; Pucciarelli, Sandra; Miceli, Cristina
2017-07-01
The α-amylases are endo-acting enzymes that hydrolyze starch by randomly cleaving the 1,4-α-d-glucosidic linkages between the adjacent glucose units in a linear amylose chain. They have significant advantages in a wide range of applications, particularly in the food industry. The eukaryotic α-amylase isolated from the Antarctic ciliated protozoon Euplotes focardii ( Ef Amy) is an alkaline enzyme, different from most of the α-amylases characterized so far. Furthermore, Ef Amy has the characteristics of a psychrophilic α-amylase, such as the highest hydrolytic activity at a low temperature and high thermolability, which is the major drawback of cold-active enzymes in industrial applications. In this work, we applied site-directed mutagenesis combined with rational design to generate a cold-active Ef Amy with improved thermostability and catalytic efficiency at low temperatures. We engineered two Ef Amy mutants. In one mutant, we introduced Pro residues on the A and B domains in surface loops. In the second mutant, we changed Val residues to Thr close to the catalytic site. The aim of these substitutions was to rigidify the molecular structure of the enzyme. Furthermore, we also analyzed mutants containing these combined substitutions. Biochemical enzymatic assays of engineered versions of Ef Amy revealed that the combination of mutations at the surface loops increased the thermostability and catalytic efficiency of the enzyme. The possible mechanisms responsible for the changes in the biochemical properties are discussed by analyzing the three-dimensional structural model. IMPORTANCE Cold-adapted enzymes have high specific activity at low and moderate temperatures, a property that can be extremely useful in various applications as it implies a reduction in energy consumption during the catalyzed reaction. However, the concurrent high thermolability of cold-adapted enzymes often limits their applications in industrial processes. The α-amylase from the
Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).
Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli
2018-02-26
Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.
Directory of Open Access Journals (Sweden)
Hugo Oliveira
Full Text Available Resistance rates are increasing among several problematic Gram-negative pathogens, a fact that has encouraged the development of new antimicrobial agents. This paper characterizes a Salmonella phage endolysin (Lys68 and demonstrates its potential antimicrobial effectiveness when combined with organic acids towards Gram-negative pathogens. Biochemical characterization reveals that Lys68 is more active at pH 7.0, maintaining 76.7% of its activity when stored at 4°C for two months. Thermostability tests showed that Lys68 is only completely inactivated upon exposure to 100°C for 30 min, and circular dichroism analysis demonstrated the ability to refold into its original conformation upon thermal denaturation. It was shown that Lys68 is able to lyse a wide panel of Gram-negative bacteria (13 different species in combination with the outer membrane permeabilizers EDTA, citric and malic acid. While the EDTA/Lys68 combination only inactivated Pseudomonas strains, the use of citric or malic acid broadened Lys68 antibacterial effect to other Gram-negative pathogens (lytic activity against 9 and 11 species, respectively. Particularly against Salmonella Typhimurium LT2, the combinatory effect of malic or citric acid with Lys68 led to approximately 3 to 5 log reductions in bacterial load/CFUs after 2 hours, respectively, and was also able to reduce stationary-phase cells and bacterial biofilms by approximately 1 log. The broad killing capacity of malic/citric acid-Lys68 is explained by the destabilization and major disruptions of the cell outer membrane integrity due to the acidity caused by the organic acids and a relatively high muralytic activity of Lys68 at low pH. Lys68 demonstrates good (thermostability properties that combined with different outer membrane permeabilizers, could become useful to combat Gram-negative pathogens in agricultural, food and medical industry.
Johnvesly, B; Manjunath, B R; Naik, G R
2002-03-01
Thermoalkaliphilic Bacillus sp. JB-99 was grown in a 250 ml Erlenmeyer flask containing 50 ml medium containing (g/l) Pigeon pea waste 10; NaNO3, 5.0; K2HPO4, 5.0; MgSO4 x 2H2O, 0.2 and Na2CO3, 10.0. Incubations were carried out at 50 degrees C on a rotary incubator shaker for 15 h. A high level of extra cellular thermostable protease activity was observed after 24 h incubation. The optimum temperature and pH for activity were 70 degrees C and 11, respectively, so this enzyme showed stable activity at high temperature and under alkaline conditions.
Detrimental effect of expression of Bt endotoxin Cry1Ac on in vitro ...
Indian Academy of Sciences (India)
(50 U) of reverse transcriptase. This cDNA pool ... reverse primers for each and 0.2 μL Taq polymerase (1 U). The initial ..... learned from B.t. toxin genes; in Genetic engineering (ed) JK ... KO 2007 Improved drought tolerance without undesired.
Isolation and characterization of a first set of nine polymorphic ...
Indian Academy of Sciences (India)
2014-08-12
Aug 12, 2014 ... efficient conservation and utilization of genetic resources. A number of ... Capital Territory (NCT) of Delhi and other Indian states. Microsatellite loci ... PCR reaction buffer, 0.2 mM dNTPs, and 500 ng template. DNA, 1 U Taq ...
Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul
2009-07-01
Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad
Directory of Open Access Journals (Sweden)
R. Mirnejad
2011-04-01
Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So
Genomic footprinting in mammalian cells with ultraviolet light
International Nuclear Information System (INIS)
Becker, M.M.; Wang, Z.; Grossmann, G.; Becherer, K.A.
1989-01-01
A simple and accurate genomic primer extension method has been developed to detect ultraviolet footprinting patterns of regulatory protein-DNA interactions in mammalian genomic DNA. The technique can also detect footprinting or sequencing patterns introduced into genomic DNA by other methods. Purified genomic DNA, containing either damaged bases or strand breaks introduced by footprinting or sequencing reactions, is first cut with a convenient restriction enzyme to reduce its molecular weight. A highly radioactive single-stranded DNA primer that is complementary to a region of genomic DNA whose sequence or footprint one wishes to examine is then mixed with 50 micrograms of restriction enzyme-cut genomic DNA. The primer is approximately 100 bases long and contains 85 radioactive phosphates, each of specific activity 3000 Ci/mmol (1 Ci = 37 GBq). A simple and fast method for preparing such primers is described. Following brief heat denaturation at 100 degrees C, the solution of genomic DNA and primer is cooled to 74 degrees C and a second solution containing Taq polymerase (Thermus aquaticus DNA polymerase) and the four deoxynucleotide triphosphates is added to initiate primer extension of genomic DNA. Taq polymerase extends genomic hybridized primer until its polymerization reaction is terminated either by a damaged base or strand break in genomic DNA or by the addition of dideoxynucleotide triphosphates in the polymerization reaction. The concurrent primer hybridization-extension reaction is terminated after 5 hr and unhybridized primer is digested away by mung bean nuclease. Primer-extended genomic DNA is then denatured and electrophoresed on a polyacrylamide sequencing gel, and radioactive primer extension products are revealed by autoradiography
Kumar, Satyendra; Pahujani, Shweta; Ola, R P; Kanwar, S S; Gupta, Reena
2006-06-01
A lipase from the thermophilic isolate Bacillus coagulans BTS-3 was produced and purified. The enzyme was purified 40-fold to homogeneity by ammonium sulfate precipitation and DEAE-Sepharose column chromatography. Its molecular weight was 31 kDa on SDS-PAGE. The purified lipase was immobilized on silica and its binding efficiency was found to be 60%. The enzyme took 60 min to bind maximally onto the support. The pH and temperature optima of immobilized lipase were same as those of the free enzyme, i.e. 8.5 and 55 degrees C, respectively. The immobilized enzyme had shown marked thermostability on the elevated temperatures of 55, 60, 65 and 70 degrees C. The immobilized enzyme was reused for eigth cycles as it retained almost 80% of its activity. The catalytic activity of immobilized enzyme was enhanced in n-hexane and ethanol. The immobilized enzyme when used for esterification of ethanol and propionic acid showed 96% conversion in n-hexane in 12 h at 55 degrees C.
International Nuclear Information System (INIS)
Hassanpour, S.; Khoylou, F.
2003-01-01
Plastic pipes owing to their flexibility, great lengths, easier handling and absence of corrosion have been used for hot-water installations. Crosslinked high-density polyethylene is one of the best materials, being used for this purpose. The useful lifetime of unstabilized polyethylene is predicted to vary from a few months in hot water (30-40 deg. C) to almost two years in cool water (0-10 deg. C). Polyethylene was mixed with different types of stabilizers, in order to increase its durability. The samples were irradiated at 100-150 kGy. The amount of gel fraction and the changes in mechanical properties were measured. Irradiated samples were immersed in hot water for 1000 h. The thermostability of the specimens and the existence of antioxidants were measured by the induction time technique using differential scanning calorimetry at different time intervals. Furthermore, the changes in chemical structure and mechanical properties of the samples during their immersion in hot water were determined
International Nuclear Information System (INIS)
Robinson, M.A.
1989-01-01
Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations
Directory of Open Access Journals (Sweden)
Kush Shrivastava
2015-10-01
Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.
Pitetti, Raymond D; Laus, Stella; Wadowsky, Robert M
2003-08-01
Epstein-Barr virus (EBV) infectious mononucleosis is often diagnosed based on characteristic clinical features and either a positive heterophil antibody test or serology, both of which can be unreliable in young children. Real time quantitative PCR assays that measure EBV DNA load in serum or plasma are highly sensitive in young children, but serum and plasma contain inhibitors of PCR which must be removed by DNA extraction techniques. A real time TaqMan PCR assay was designed and evaluated for simultaneously measuring EBV DNA load and validating the removal of PCR inhibitors from serum samples. A serum sample was available from patients classified serologically as primary EBV infection (n = 28), EBV-seronegative (n = 25) and EBV-seropositive (n = 26). Patients were classified as having EBV infectious mononucleosis if they had specified clinical findings and > or =10% atypical lymphocytes in peripheral blood or had a positive Monospot test result. DNA was purified by a spin column method and tested in PCR reactions with primers for EBV DNA polymerase gene and internal control targets. Amplification of the two PCR products was measured in real time with separate TaqMan DNA probes labeled with various fluorescent reporters. The mean age of study patients was 9 years, 4 months. Twenty-one (75%) of the patients in the primary EBV infection group, one (4%) of the seronegatives and none of the seropositives had detectable EBV DNA. Within the primary infection group, those with detectable virus were more likely than those without detectable virus to have evidence of lymphadenopathy (14 of 16 vs.1 of 5; P = 0.011), higher mean atypical (11.7 vs.0.9%; P = 0.002) and absolute atypical (1.5 vs.0.1 x 109/l; P = 0.004) lymphocyte count, higher mean absolute lymphocyte count (4.7 vs.2.3 x 109/l; P = 0.026) and higher mean aspartate aminotransferase value (119.8 vs.37.3 IU/l; P = 0.036). Ten patients, all in the primary infection group, had EBV infectious mononucleosis, and all
Gaur, Rajeeva; Tiwari, Soni
2015-03-19
The rising concerns about the scarcity of fossil fuels, the emission of green house gasses and air pollution by incomplete combustion of fossil fuel have also resulted in an increasing focus on the use of cellulases to perform enzymatic hydrolysis of the lignocellulosic materials for the generation of bioethanol. The aim of this study was to isolate a potential thermo-solvent tolerant cellulase producing bacterium from natural resources, and then applied for purification and characterization. The purified enzyme was to be accessible for the bioethanol production as well as industrial exploitation (discuss in our next study). It is the first instance when thermo-solvent tolerant cellulase producing bacterium was isolated from soil sample. The culture was identified as Bacillus vallismortis RG-07 by 16S rDNA sequence analysis. Bacillus vallismortis RG-07 reported maximum cellulase production from sugarcane baggase (4105 U ml(-1)) used as agro-waste carbon source. The cellulase enzyme produced by the Bacillus sp. was purified by (NH4)2SO4 precipitation, ion exchange and gel filtration chromatography, with overall recovery of 28.8%. The molecular weight of purified cellulase was 80 kDa as revealed by SDS-PAGE and activity gel analysis. The optimum temperature and pH for enzyme activity was determined as 65°C and 7.0 and it retained 95 and 75% of activity even at 95°C, and 9.0 respectively. The enzyme activity was enhanced in the presence of organic solvents (30%) n-dodecane, iso-octane, n-decane, xylene, toluene, n-haxane, n-butanol, and cyclohexane, after prolonged incubation (7 days). The enzyme activity was also stimulated by Ca(2+), mercaptoethanol, Tween-60, and Sodium hypochloride whereas strongly inhibited by Hg. Kinetic analysis of purified enzyme showed the Km and Vmax to be 1.923 mg ml(-1) and 769.230 μg ml(-1) min(-1), respectively. The unique property of solvent-thermostable-alkalophilic, nature proves the potential candidature of this isolate for
Klinbunga, S; Khamnamtong, B; Puanglarp, N; Jarayabhand, P; Yoosukh, W; Menasveta, P
2005-01-01
Genetic diversity of oysters Crassostrea belcheri (Sowerby, 1871), C. iredalei (Faustino, 1932), Saccostrea cucullata (Born, 1778), S. forskali (Gmelin, 1791), and Striostrea (Parastriostrea) mytiloides (Lamarck, 1819) (Ostreoida, Mollusca) was analyzed by polymerase chain reaction - restriction fragment length polymorphism (PCR-RFLP) of 16S ribosomal DNA with AcsI, AluI, DdeI, DraI, RsaI, and TaqI, 18S ribosomal DNA with HinfI, and cytochrome oxidase subunit I with AcsI, DdeI and MboI. A total of 54 composite haplotypes were observed. Species-diagnostic markers were specifically found in C. belcheri, C. iredalei, and S. cucullata, but not in S. forskali and Striostrea mytiloides, which shared common composite haplotypes. Neighbor-joining trees constructed from genetic distances between pairs of composite haplotypes and species indicated large genetic differences between Crassostrea and Saccostrea (including Striostrea mytiloides), but closer relationships were observed within each genus. Four groups of unidentified oysters (Crassostrea sp. and Saccostrea sp. groups 1, 2, and 3) were also genetically analyzed. Fixed RFLP markers were found in Crassostrea sp. and Saccostrea sp. group 2, but not in Saccostrea sp. groups 1 and 3. Phylogenetic and genetic heterogeneity analyses indicated that Crassostrea sp. and Saccostrea sp. group 2 should be considered as newly unidentified oyster species in Thailand.
Directory of Open Access Journals (Sweden)
Owczarek Catherine M.
2002-01-01
Full Text Available Human alpha1-acid glycoprotein (AGP or orosomucoid (ORM is a major acute phase protein that is thought to play a crucial role in maintaining homeostasis. Human AGP is the product of a cluster of at least two adjacent genes located on HSA chromosome 9. Using a range of restriction endonucleases we have investigated DNA variation at the locus encoding the AGP genes in a panel of healthy Caucasians. Polymorphisms were identified using BamHI, EcoRI, BglII, PvuII, HindIII, TaqI and MspI. Non-random associations were found between the BamHI, EcoRI, BglII RFLPs. The RFLPs detected with PvuII, TaqI and MspI were all located in exon 6 of both AGP genes. The duplication of an AGP gene was observed in 11% of the indiviuals studied and was in linkage disequilibrium with the TaqI RFLP. The identification and characterization of these polymorphisms will prove useful for other population and forensic studies.
Decaro, Nicola; Amorisco, Francesca; Desario, Costantina; Lorusso, Eleonora; Camero, Michele; Bellacicco, Anna Lucia; Sciarretta, Rossana; Lucente, Maria Stella; Martella, Vito; Buonavoglia, Canio
2010-10-01
A TaqMan-based real-time PCR assay targeting the glycoprotein B-encoding gene was developed for diagnosis of canid herpesvirus 1 (CHV-1) infection. The established assay was highly specific, since no cross-reactions were observed with other canine DNA viruses, including canine parvovirus type 2, canine minute virus, or canine adenovirus types 1 and 2. The detection limit was 10(1) and 1.20 x 10(1) DNA copies per 10 microl(-1) of template for standard DNA and a CHV-1-positive kidney sample, respectively: about 1-log higher than a gel-based PCR assay targeting the thymidine kinase gene. The assay was also reproducible, as shown by satisfactory low intra-assay and inter-assay coefficients of variation. CHV-1 isolates of different geographical origins were recognised by the TaqMan assay. Tissues and clinical samples collected from three pups which died of CHV-1 neonatal infection were also tested, displaying a wide distribution of CHV-l DNA in their organs. Unlike other CHV-1-specific diagnostic methods, this quantitative assay permits simultaneous detection and quantitation of CHV-1 DNA in a wide range of canine tissues and body fluids, thus providing a useful tool for confirmation of a clinical diagnosis, for the study of viral pathogenesis and for evaluation of the efficacy of vaccines and antiviral drugs. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Cassler, M; Peterson, C L; Ledger, A; Pomponi, S A; Wright, A E; Winegar, R; McCarthy, P J; Lopez, J V
2008-04-01
In this report, real-time quantitative PCR (TaqMan qPCR) of the small subunit (SSU) 16S-like rRNA molecule, a universal phylogenetic marker, was used to quantify the relative abundance of individual bacterial members of a diverse, yet mostly unculturable, microbial community from a marine sponge. Molecular phylogenetic analyses of bacterial communities derived from Caribbean Lithistid sponges have shown a wide diversity of microbes that included at least six major subdivisions; however, very little overlap was observed between the culturable and unculturable microbial communities. Based on sequence data of three culture-independent Lithistid-derived representative bacteria, we designed probe/primer sets for TaqMan qPCR to quantitatively characterize selected microbial residents in a Lithistid sponge, Vetulina, metagenome. TaqMan assays included specificity testing, DNA limit of detection analysis, and quantification of specific microbial rRNA sequences such as Nitrospira-like microbes and Actinobacteria up to 172 million copies per microgram per Lithistid sponge metagenome. By contrast, qPCR amplification with probes designed for common previously cultured sponge-associated bacteria in the genera Rheinheimera and Marinomonas and a representative of the CFB group resulted in only minimal detection of the Rheiheimera in total DNA extracted from the sponge. These data verify that a large portion of the microbial community within Lithistid sponges may consist of currently unculturable microorganisms.
Tai, Hulin; Irie, Kiyofumi; Mikami, Shin-ichi; Yamamoto, Yasuhiko
2011-04-19
Careful scrutiny of the protein interior of Hydrogenobacter thermophilus cytochrome c(552) (HT) on the basis of its X-ray structure [Travaglini-Allocatelli, C., Gianni, S., Dubey, V. K., Borgia, A., Di Matteo, A., Bonivento, D., Cutruzzola, F., Bren, K. L., and Brunori, M. (2005) J. Biol. Chem. 280, 25729-25734] indicated that a void space, which is large enough to accommodate a methyl group, exists in the hydrophobic protein interior near the heme. We tried to reduce the void space through the replacement of a Val by Ile or Leu (Val/Ile or Val/Leu mutation), and then the structural and functional consequences of these two mutations were characterized in order to elucidate the relationship between the nature of the packing of hydrophobic residues and the functional properties of the protein. The study demonstrated striking differences in the structural and functional consequences between the two mutations. The Val/Ile mutation was found to cause further enhancement of the thermostability of the oxidized HT, as reflected in the increase of the denaturation temperature (T(m)) value by ∼ 3 deg, whereas the thermostability of the reduced form was essentially unaffected. As a result, the redox potential (E(m)) of the Val/Ile mutant exhibited a negative shift of ∼ 50 mV relative to that of the wild-type protein in an enthalpic manner, this being consistent with our previous finding that a protein with higher stability in its oxidized form exhibits a lower E(m) value [Terui, N., Tachiiri, N., Matsuo, H., Hasegawa, J., Uchiyama, S., Kobayashi, Y., Igarashi, Y., Sambongi, Y., and Yamamoto, Y. (2003) J. Am. Chem. Soc. 125, 13650-13651]. In contrast, the Val/Leu mutation led to a decrease in thermostability of both the redox forms of the protein, as reflected in the decreases of the T(m) values of the oxidized and reduced proteins by ∼ 3 and ∼ 5 deg, respectively, and the E(m) value of the Val/Leu mutant happened to be similar to that of the Val/Ile one. The E
Quadruplex genotype analysis at HumTH01, HumTPOX, HumCSF1PO and amelogenin Loci by FoLT-PCR
Energy Technology Data Exchange (ETDEWEB)
Lee, Y.H.; Lim, S.K.; Kang, P.W.; Choi, D.H.; Yoon, S.R.; Han, M.S. [National Institute of Scientific Investigation, Seoul (Korea)
1999-06-01
A simple and rapid procedure, called FoLT-PCR(Formamide Low Temperature-Polymerase Chain Reaction) was applied to amplifying DNA directly from various forensic biological evidences including human blood, saliva, hair root, or semen without any DNA preparative steps. We added washing step with non-ionic detergent, 1% Triton X-100, and used Taq DNA polymerase instead of Tth DNA polymerase to amplify 3 STR loci and gender allele simultaneously. Optimal concentration of formamide and annealing temperature were determined empirically to 8%(v/v), and 48{sup o} C respectively. We also compared this method with standard PCR. 8 refs., 4 figs.
Directory of Open Access Journals (Sweden)
Milena Alicja Stachelska
2017-01-01
Full Text Available The aim of this study was to design a time-effective method comprising a short pre-enrichment step in a non-selective broth in combination with the TaqMan probe applied in the real-time polymerase chain reaction to detect Yersinia enterocolitica strains in raw pork meat. The method enabled to detect 1 colony forming unit per 25 mg of Yersinia enterocolitica in pork meat. The specificity and reliability of the method was not diminished by the company of microflora naturally present in meat. The method was found successful to detect pathogenic Yersinia enterocolitica strains in pork meat. It is advised to be used for assessing the microbial risk and for controlling the microbial quality of meat and meat products.
Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi
2005-09-01
1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.
The Influence of Ḥāfiẓ on Muḥammad Taqī Bahār
Directory of Open Access Journals (Sweden)
Bahman Solati
2016-06-01
Full Text Available Looking through the eyes of Persian culture, we see that man is not all noetic; he is not driven by intellect or consistent in his use of reason. On the contrary, he is most moved by emotion. A perfect example: Persian philosophy is most commonly uttered in both poetry and prose. This is, I believe, where the brilliance of Persians rests, in the beauty of its language and the expression of its culture. The endurance of Iranian literature and language over two and a half millennia is remarkable and thus deserving of both thorough research and an in-depth study. Here, I attempt to demonstrate the influence of Ḥāfiẓ, one of the greatest classical poets of Persia who ever lived, on the thoughts, poetic language, and philosophy of the gifted nineteenth-century Persian poet Muḥammad Taqī Bahār, otherwise known as Malik al-Shu‘arā. I will accomplish this feat through close readings of the parts of Ḥāfiẓ’s poems and juxtapose them with Bahār’s poems. My contention here, is to demonstrate any direct or indirect influence Ḥāfiẓ had on Bahār, and to also measure the extent of Ḥāfiẓ’s reception during Bahār’s period. With some modifications, the translations of Ḥāfiẓ’s ghazals used herein follow those of Peter Avery, while other translations throughout the book are my own, unless otherwise stated. Keywords: Persian literature, languages, Persian contemporary and classical poetry, Hafiz, Styles and manners
DEFF Research Database (Denmark)
Jensen, Anders; Hagelskjær Kristensen, Lena; Prag, Jørgen
2007-01-01
Throat swabs from 61 patients, aged 18-32 years, with non-streptococcal tonsillitis (NST) and 92 healthy controls were examined for the presence of Fusobacterium necrophorum DNA using a novel TaqMan-based real-time quantitative PCR assay for F. necrophorum subspecies. The assay was based on the g...
Gamper, H.A.; Young, J.P.W.; Jones, D.L.; Hodge, A.
2008-01-01
To enable quantification of mycelial abundance in mixed-species environments, eight new TaqMan® real-time PCR assays were developed for five arbuscular mycorrhizal fungal (AMF, Glomeromycota) taxa. The assays targeted genes encoding 18S rRNA or actin, and were tested on DNA from cloned gene
Development and evaluation of Taqman assays for the differentiation of Dickeya (sub)species
Wolf, van der J.M.; Haas, de B.H.; Hoof, van R.A.; Haan, de E.G.; Bovenkamp, van den G.W.
2014-01-01
TaqMan assays were developed for the detection of seven Dickeya species, namely D. dianthicola, D. dadantii, D. paradisiaca, D. chrysanthemi, D. zeae, D. dieffenbachiae and D. solani. Sequences of the gene coding for dnaX were used for the design of primers and probes. In studies with axenic
Nielsen, Martin K; Peterson, David S; Monrad, Jesper; Thamsborg, Stig M; Olsen, Susanne N; Kaplan, Ray M
2008-03-01
Strongylus vulgaris is an important strongyle nematode with high pathogenic potential infecting horses world-wide. Several decades of intensive anthelmintic use has virtually eliminated clinical disease caused by S. vulgaris, but has also caused high levels of anthelmintic resistance in equine small strongyle (cyathostomin) nematodes. Recommendations aimed at limiting the development of anthelmintic resistance by reducing treatment intensity raises a simultaneous demand for reliable and accurate diagnostic tools for detecting important parasitic pathogens. Presently, the only means available to differentiate among strongyle species in a faecal sample is by identifying individual L3 larvae following a two week coproculture procedure. The aim of the present study is to overcome this diagnostic obstacle by developing a fluorescence-based quantitative PCR assay capable of identifying S. vulgaris eggs in faecal samples from horses. Species-specific primers and a TaqMan probe were designed by alignment of published ribosomal DNA sequences of the second internal transcribed spacer of cyathostomin and Strongylus spp. nematodes. The assay was tested for specificity and optimized using genomic DNA extracted from identified male worms of Strongylus and cyathostomin species. In addition, eggs were collected from adult female worms and used to evaluate the quantitative potential of the assay. Statistically significant linear relationships were found between egg numbers and cycle of threshold (Ct) values. PCR results were unaffected by the presence of cyathostomin DNA in the sample and there was no indication of PCR inhibition by faecal sources. A field evaluation on faecal samples obtained from four Danish horse farms revealed a good agreement with the traditional larval culture (kappa-value=0.78), but with a significantly higher performance of the PCR assay. An association between Ct values and S. vulgaris larval counts was statistically significant. The present assay can
DEFF Research Database (Denmark)
Shetty, Radhakrishna; Vestergaard, Mike; Jessen, Flemming
2017-01-01
processes occur at elevated temperature. We present in this paper, the discovery, cloning and characterisation of a novel recombinant thermostable gluten degrading enzyme, a proline specific prolyl endoprotease (PEP) from Sphaerobacter thermophiles. The molecular mass of the prolyl endopeptidase......Gluten free products have emerged during the last decades, as a result of a growing public concern and technological advancements allowing gluten reduction in food products. One approach is to use gluten degrading enzymes, typically at low or ambient temperatures, whereas many food production...... was estimated to be 77 kDa by using SDS-PAGE. Enzyme activity assays with a synthetic dipeptide Z-Gly-Pro-p-nitroanilide as the substrate revealed that the enzyme had optimal activity at pH 6.6 and was most active from pH 5.0-8.0. The optimum temperature was 63 °C and residual activity after one hour incubation...
Directory of Open Access Journals (Sweden)
Pichapak Sriyapai
2015-06-01
Full Text Available A thermostable esterase gene (hydS14 was cloned from an Actinomadura sp. S14 gene library. The gene is 777 bp in length and encodes a polypeptide of 258 amino acid residues with no signal peptide, no N-glycosylation site and a predicted molecular mass of 26,604 Da. The encoded protein contains the pentapeptide motif (GYSLG and catalytic triad (Ser88-Asp208-His235 of the esterase/lipase superfamily. The HydS14 sequence shows 46%–64% identity to 23 sequences from actinomycetes (23 α/β-hydrolases, has three conserved regions, and contains the novel motif (GY(FSLG, which distinguishes it from other clusters in the α/β-hydrolase structural superfamily. A plasmid containing the coding region (pPICZαA-hydS14 was used to express HydS14 in Pichia pastoris under the control of the AOXI promoter. The recombinant HydS14 collected from the supernatant had a molecular mass of ~30 kDa, which agrees with its predicted molecular mass without N-glycosylation. HydS14 had an optimum temperature of approximately 70 °C and an optimum pH of 8.0. HydS14 was stable at 50 and 60 °C for 120 min, with residual activities of above 80% and above 90%, respectively, as well as 50% activity at pH 6.0–8.0 and pH 9.0, respectively. The enzyme showed higher activity with p-nitrophenyl-C2 and C4. The Km and Vmax values for p-nitrophenyl-C4 were 0.21 ± 0.02 mM and 37.07 ± 1.04 μmol/min/mg, respectively. The enzyme was active toward short-chain p-nitrophenyl ester (C2–C6, displaying optimal activity with p-nitrophenyl-C4 (Kcat/Km = 11.74 mM−1·S−1. In summary, HydS14 is a thermostable esterase from Actinomadura sp. S14 that has been cloned and expressed for the first time in Pichia pastoris.
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
Chen, Ziwei; Xu, Wei; Zhang, Wenli; Zhang, Tao; Jiang, Bo; Mu, Wanmeng
2018-04-01
l-Hexoses are rare sugars that are important components and precursors in the synthesis of biological compounds and pharmaceutical drugs. l-Rhamnose isomerase (L-RI, EC 5.3.1.14) is an aldose-ketose isomerase that plays a significant role in the production of l-sugars. In this study, a thermostable, l-sugar-producing L-RI from the hyperthermophile Caldicellulosiruptor obsidiansis OB47 was characterized. The recombinant L-RI displayed maximal activity at pH 8.0 and 85 °C and was significantly activated by Co 2+ . It exhibited a relatively high thermostability, with measured half-lives of 24.75, 11.55, 4.15 and 3.30 h in the presence of Co 2+ at 70, 75, 80 and 85 °C, respectively. Specific activities of 277.6, 57.9, 13.7 and 9.6 U mg -1 were measured when l-rhamnose, l-mannose, d-allose and l-fructose were used as substrates, respectively. l-Rhamnulose was produced with conversion ratios of 44.0% and 38.6% from 25 and 50 g L -1 l-rhamnose, respectively. l-Fructose was also efficiently produced by the L-RI, with conversion ratios of 67.0% and 58.4% from 25 and 50 g L -1 l-mannose, respectively. The recombinant L-RI could effectively catalyze the formation of l-rhamnulose and l-fructose, suggesting that it was a promising candidate for industrial production of l-rhamnulose and l-fructose. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Association of Taq I, Fok I and Apa I polymorphisms in Vitamin D Receptor (VDR) gene with leprosy.
Neela, Venkata Sanjeev Kumar; Suryadevara, Naveen Chandra; Shinde, Vidya Gouri; Pydi, Satya Sudheer; Jain, Suman; Jonnalagada, Subbanna; Singh, Surya Satyanarayana; Valluri, Vijaya Lakshmi; Anandaraj, M P J S
2015-06-01
Vitamin D Receptor (VDR) is a transacting transcription factor which mediates immunomodulatory function and plays a key role in innate and adaptive immune responses through its ligand and polymorphisms in VDR gene may affect its regulatory function. To investigate the association of three VDR gene polymorphisms (TaqI rs731236, FokI rs2228570 and ApaI rs7975232) with leprosy. The study group includes 404 participants of which 222 were leprosy patients (paucibacillary=87, multibacillary=135) and 182 healthy controls. Genotyping was done using PCR-RFLP technique. Statistical analysis was performed using SNP Stats and PLINK software. The VDR FokI (rs2228570) ff genotype, ApaI (rs7975232) AA, Aa genotype and haplotype T-f-a, T-F-A were positively associated with leprosy when compared to healthy controls. The two variants at Fok and Apa positions in VDR gene are significantly associated with leprosy. Genotypes at FokI (ff), ApaI (aa) and haplotype (T-F-a, T-f-a) may contribute to the risk of developing leprosy by altering VDR phenotype/levels subsequently modulation of immune response. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Partial Purification and Characterization of a Thermostable β-Mannanase from Aspergillus foetidus
Directory of Open Access Journals (Sweden)
Juliana da Conceição Infante de Marco
2015-10-01
Full Text Available An extracellular β-mannanase was isolated from samples of crude extract of the mesophilic fungus Aspergillus foetidus grown on soybean husk as a carbon source. The induction profile showed that β-mannanase reached a maximum activity level (2.0 IU/mL on the 15th day of cultivation. The enzyme was partially purified by ultrafiltration and gel filtration chromatography procedures and was named Man 58. Sodium dodecyl sulfate-polyacrilamide electrophoresis and zymogram analysis of Man 58 showed two bands of approximately 43 and 45 kDa with β-mannanase activity. Ultrafiltration showed that β-mannanase activity was only detected in the concentrated sample. Man 58 was most active at 60 °C and at pH 4.0. It was thermostable in the temperature range of 40–60 °C for eleven days, and the half-life at 70 °C was ten days. Man 58 showed Km and Vmax values of 3.29 mg/mL and 1.76 IU/mL respectively, with locust bean gum as a substrate. It was mostly activated by FeSO4 and CoCl2 and inhibited by MgSO4, FeCl3, CuSO4, MgCl2, ZnCl2, ZnSO4, CaCl2, CuCl2, KCl and ethylenediaminetetraacetic acid (EDTA. Phenolic compounds did not inhibit the enzyme. On the other hand, auto-hydrolysis liquor showed an inhibitory effect on Man 58 activity.
Sigoillot Jean-Claude; Kim-Anh To; Haltrich Dietmar; Berrin Jean-Guy; Thi-Thu Dang; Bien-Cuong Do; Yamabhai Montarop
2009-01-01
Abstract Background Mannans are key components of lignocellulose present in the hemicellulosic fraction of plant primary cell walls. Mannan endo-1,4-β-mannosidases (1,4-β-D-mannanases) catalyze the random hydrolysis of β-1,4-mannosidic linkages in the main chain of β-mannans. Biodegradation of β-mannans by the action of thermostable mannan endo-1,4-β-mannosidase offers significant technical advantages in biotechnological industrial applications, i.e. delignification of kraft pulps or the pret...
Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur
2017-05-17
Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.
Poirier, Danielle; Renaud, Frédéric; Dewar, Vincent; Strodiot, Laurent; Wauters, Florence; Janimak, Jim; Shimada, Toshio; Nomura, Tatsuya; Kabata, Koki; Kuruma, Koji; Kusano, Takayuki; Sakai, Masaki; Nagasaki, Hideo; Oyamada, Takayoshi
2017-11-01
Alternatives to syringe-based administration are considered for vaccines. Intradermal vaccination with dissolvable microneedle arrays (MNA) appears promising in this respect, as an easy-to-use and painless method. In this work, we have developed an MNA patch (MNAP) made of hydroxyethyl starch (HES) and chondroitin sulphate (CS). In swines, hepatitis B surface antigen (HBsAg) formulated with the saponin QS-21 as adjuvant, both incorporated in HES-based MNAP, demonstrated the same level of immunogenicity as a commercially available aluminum-adjuvanted HBsAg vaccine, after two immunizations 28 days apart. MNAP application was associated with transient skin reactions (erythema, lump, scab), particularly evident when the antigen was delivered with the adjuvant. The thermostability of the adjuvanted antigen when incorporated in the HES-based matrix was also assessed by storing MNAP at 37, 45 or 50 °C for up to 6 months. We could demonstrate that antigenicity was retained at 37 and 45 °C and only a 10% loss was observed after 6 months at 50 °C. Our results are supportive of MNAP as an attractive alternative to classical syringe-based vaccination. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
DEFF Research Database (Denmark)
Hoffmann, B.; Freuling, C. M.; Wakeley, P. R.
2010-01-01
To improve the diagnosis of classical rabies virus with molecular methods, a validated, ready-to-use, real-time reverse transcription-PCR (RT-PCR) assay was developed. In a first step, primers and 6-carboxyfluorescien-labeled TaqMan probes specific for rabies virus were selected from the consensus...... sequence of the nucleoprotein gene of 203 different rabies virus sequences derived from GenBank. The selected primer-probe combination was highly specific and sensitive. During validation using a sample set of rabies virus strains from the virus archives of the Friedrich-Loeffler-Institut (FLI; Germany......), the Veterinary Laboratories Agency (VLA; United Kingdom), and the DTU National Veterinary Institute (Lindholm, Denmark), covering the global diversity of rabies virus lineages, it was shown that both the newly developed assay and a previously described one had some detection failures. This was overcome...
Platts-Mills, James A.; Gratz, Jean; Mduma, Esto; Svensen, Erling; Amour, Caroline; Liu, Jie; Maro, Athanasia; Saidi, Queen; Swai, Ndealilia; Kumburu, Happiness; McCormick, Benjamin J. J.; Kibiki, Gibson; Houpt, Eric R.
2014-01-01
Etiologic studies of diarrhea are limited by uneven diagnostic methods and frequent asymptomatic detection of enteropathogens. Polymerase chain reaction-based stool pathogen quantification may help distinguish clinically significant infections. We performed a nested case-control study of diarrhea in infants from a community-based birth cohort in Tanzania. We tested 71 diarrheal samples and pre-diarrheal matched controls with a laboratory-developed TaqMan Array Card for 19 enteropathogens. With qualitative detection, no pathogens were significantly associated with diarrhea. When pathogen quantity was considered, rotavirus (odds ratio [OR] = 2.70 per log10 increase, P < 0.001), astrovirus (OR = 1.49, P = 0.01), and Shigella/enteroinvasive Escherichia coli (OR = 1.47, P = 0.04) were associated with diarrhea. Enterotoxigenic E. coli (0.15 SD decline in length-for-age z score after 3 months per log10 increase, P < 0.001) and Campylobacter jejuni/C. coli (0.11 SD decline, P = 0.003) in pre-diarrheal stools were associated with poor linear growth. Quantitative analysis can help refine the association between enteropathogens and disease in endemic settings. PMID:24189366
Evaluation of a TaqMan Array Card for Detection of Central Nervous System Infections.
Onyango, Clayton O; Loparev, Vladimir; Lidechi, Shirley; Bhullar, Vinod; Schmid, D Scott; Radford, Kay; Lo, Michael K; Rota, Paul; Johnson, Barbara W; Munoz, Jorge; Oneko, Martina; Burton, Deron; Black, Carolyn M; Neatherlin, John; Montgomery, Joel M; Fields, Barry
2017-07-01
Infections of the central nervous system (CNS) are often acute, with significant morbidity and mortality. Routine diagnosis of such infections is limited in developing countries and requires modern equipment in advanced laboratories that may be unavailable to a number of patients in sub-Saharan Africa. We developed a TaqMan array card (TAC) that detects multiple pathogens simultaneously from cerebrospinal fluid. The 21-pathogen CNS multiple-pathogen TAC (CNS-TAC) assay includes two parasites ( Balamuthia mandrillaris and Acanthamoeba ), six bacterial pathogens ( Streptococcus pneumonia e, Haemophilus influenzae , Neisseria meningitidis , Mycoplasma pneumoniae , Mycobacterium tuberculosis , and Bartonella ), and 13 viruses (parechovirus, dengue virus, Nipah virus, varicella-zoster virus, mumps virus, measles virus, lyssavirus, herpes simplex viruses 1 and 2, Epstein-Barr virus, enterovirus, cytomegalovirus, and chikungunya virus). The card also includes human RNase P as a nucleic acid extraction control and an internal manufacturer control, GAPDH (glyceraldehyde-3-phosphate dehydrogenase). This CNS-TAC assay can test up to eight samples for all 21 agents within 2.5 h following nucleic acid extraction. The assay was validated for linearity, limit of detection, sensitivity, and specificity by using either live viruses (dengue, mumps, and measles viruses) or nucleic acid material (Nipah and chikungunya viruses). Of 120 samples tested by individual real-time PCR, 35 were positive for eight different targets, whereas the CNS-TAC assay detected 37 positive samples across nine different targets. The CNS-TAC assays showed 85.6% sensitivity and 96.7% specificity. Therefore, the CNS-TAC assay may be useful for outbreak investigation and surveillance of suspected neurological disease. Copyright © 2017 American Society for Microbiology.
DEFF Research Database (Denmark)
Oliveira, Hugo; Thiagarajan, Viruthachalam; Walmagh, Maarten
2014-01-01
Resistance rates are increasing among several problematic Gram-negative pathogens, a fact that has encouraged the development of new antimicrobial agents. This paper characterizes a Salmonella phage endolysin (Lys68) and demonstrates its potential antimicrobial effectiveness when combined...... with organic acids towards Gram-negative pathogens. Biochemical characterization reveals that Lys68 is more active at pH 7.0, maintaining 76.7% of its activity when stored at 4°C for two months. Thermostability tests showed that Lys68 is only completely inactivated upon exposure to 100°C for 30 min......, and circular dichroism analysis demonstrated the ability to refold into its original conformation upon thermal denaturation. It was shown that Lys68 is able to lyse a wide panel of Gram-negative bacteria (13 different species) in combination with the outer membrane permeabilizers EDTA, citric and malic acid...
Expression of an Aspergillus niger Phytase Gene (phyA) in Saccharomyces cerevisiae
Han, Yanming; Wilson, David B.; Lei, Xin gen
1999-01-01
Phytase improves the bioavailability of phytate phosphorus in plant foods to humans and animals and reduces phosphorus pollution of animal waste. Our objectives were to express an Aspergillus niger phytase gene (phyA) in Saccharomyces cerevisiae and to determine the effects of glycosylation on the phytase’s activity and thermostability. A 1.4-kb DNA fragment containing the coding region of the phyA gene was inserted into the expression vector pYES2 and was expressed in S. cerevisiae as an active, extracellular phytase. The yield of total extracellular phytase activity was affected by the signal peptide and the medium composition. The expressed phytase had two pH optima (2 to 2.5 and 5 to 5.5) and a temperature optimum between 55 and 60°C, and it cross-reacted with a rabbit polyclonal antibody against the wild-type enzyme. Due to the heavy glycosylation, the expressed phytase had a molecular size of approximately 120 kDa and appeared to be more thermostable than the commercial enzyme. Deglycosylation of the phytase resulted in losses of 9% of its activity and 40% of its thermostability. The recombinant phytase was effective in hydrolyzing phytate phosphorus from corn or soybean meal in vitro. In conclusion, the phyA gene was expressed as an active, extracellular phytase in S. cerevisiae, and its thermostability was affected by glycosylation. PMID:10223979
Gutarra, Melissa L E; Godoy, Mateus G; Maugeri, Francisco; Rodrigues, Maria Isabel; Freire, Denise M G; Castilho, Leda R
2009-11-01
The production of a lipase by a wild-type Brazilian strain of Penicillium simplicissimum in solid-state fermentation of babassu cake, an abundant residue of the oil industry, was studied. The enzyme production reached about 90 U/g in 72 h, with a specific activity of 4.5 U/mg of total proteins. The crude lipase showed high activities at 35-60 degrees C and pH 4.0-6.0, with a maximum activity at 50 degrees C and pH 4.0-5.0. Enzyme stability was enhanced at pH 5.0 and 6.0, with a maximum half-life of 5.02 h at 50 degrees C and pH 5.0. Thus, this lipase shows a thermophilic and thermostable behavior, what is not common among lipases from mesophilic filamentous fungi. The crude enzyme catalysed the hydrolysis of triglycerides and p-nitrophenyl esters (C4:0-C18:0), preferably acting on substrates with medium-chain fatty acids. This non-purified lipase in addition to interesting properties showed a reduced production cost making feasible its applicability in many fields.
Al-Shehri, Hajri; Koukounari, Artemis; Stanton, Michelle C; Adriko, Moses; Arinaitwe, Moses; Atuhaire, Aaron; Kabatereine, Narcis B; Stothard, J Russell
2018-03-21
Programmatic surveillance of intestinal schistosomiasis during control can typically use four diagnostic tests, either singularly or in combination, but these have yet to be cross-compared directly. Our study assembled a complete diagnostic dataset, inclusive of infection intensities, from 258 children from five Ugandan primary schools. The schools were purposely selected as typical of the endemic landscape near Lake Albert and reflective of high- and low-transmission settings. Overall prevalence was: 44.1% (95% CI 38.0-50.2) by microscopy of duplicate Kato-Katz smears from two consecutive stools, 56.9% (95% CI 50.8-63.0) by urine-circulating cathodic antigen (CCA) dipstick, 67.4% (95% CI 61.6-73.1) by DNA-TaqMan® and 75.1% (95% CI 69.8-80.4) by soluble egg antigen enzyme-linked immunosorbent assay (SEA-ELISA). A cross-comparison of diagnostic sensitivities, specificities, positive and negative predictive values was undertaken, inclusive of a latent class analysis (LCA) with a LCA-model estimate of prevalence by each school. The latter ranged from 9.6% to 100.0%, and prevalence by school for each diagnostic test followed a static ascending order or monotonic series of Kato-Katz, urine-CCA dipstick, DNA-TaqMan® and SEA-ELISA. We confirm that Kato-Katz remains a satisfactory diagnostic standalone in high-transmission settings but in low-transmission settings should be augmented or replaced by urine-CCA dipsticks. DNA-TaqMan® appears suitable in both endemic settings though is only implementable if resources permit. In low-transmission settings, SEA-ELISA remains the method of choice to evidence an absence infection. We discuss the pros and cons of each method concluding that future surveillance of intestinal schistosomiasis would benefit from a flexible, context-specific approach both in choice and application of each diagnostic method, rather than a single one-size fits all approach.
Kobayashi, Yukihiro; Kuriyama, Takuma; Nakagawara, Ryoko; Aihara, Michiko; Hamada-Sato, Naoko
2016-10-01
Parvalbumin was identified as a major fish allergen, and has been well investigated. Collagen was identified as a second allergen; however, its allergenic properties remain uncharacterized. Although fish is an important staple in coastal countries, its thermostability is unknown. Therefore, we aimed to determine the thermostability of fish collagen as an allergen. Meat of seven bony and four cartilaginous fishes was heated at various temperatures and times, and extracts were analyzed using SDS-PAGE, IgE-ELISA, and SPTs. Collagen was dissolved from heated meat of Pacific mackerel into a crude extract. Collagen in the extracts was degraded at a high heating load-140 °C (10 min) or 100 °C (320 min). However, ELISA revealed the IgE reactivities of patients' sera with the extracts were unchanged even after heating the samples. Patients strongly reacted to extract proteins of other bony fish, which were detected by patients' IgE even after heating at 100 °C (320 min). In contrast, reactivities of the extracts of cartilaginous fish were lower than those of bony fish. SPTs in one patient revealed that all bony and cartilaginous fish extracts prepared from heated meat elicited allergic reactions. The IgE reactivity of patients' sera to fish collagen in extracts was retained even when fish meat was treated by a high heating load. As for the fish collagen, the IgE reactivities to cartilaginous fish were lower than that to bony fish. Reducing IgE reactivity to fish meat using heat is difficult, and other modalities will be required to produce hypoallergenic fish meat. Copyright © 2016 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.
Bhattacharya, Abhishek; Shrivastava, Ankita; Sharma, Anjana
2013-06-01
Carbonic anhydrase (CA) was purified from Micrococcus lylae and Micrococcus luteus with 49.90 and 53.8 % yield, respectively, isolated from calcium carbonate kilns. CA from M. lylae retained 80 % stability in the pH and temperature range of 6.0-8.0 and 35-45 °C, respectively. However, CA from M. luteus was stable in the pH and temperature range of 7.5-10.0 and 35-55 °C, respectively. Cross-linked enzyme aggregates (CLEAs) raised the transition temperature of M. lylae and M. luteus CA up to 67.5 and 74.0 °C, while the operational stability (T(1/20) of CA at 55 °C was calculated to be 7.7 and 12.0 h, respectively. CA from both the strains was found to be monomeric in nature with subunit molecular weight and molecular mass of 29 kDa. Ethoxozolamide was identified as the most potent inhibitor based on both IC(50) values and inhibitory constant measurement (K(i)). The K(m) and V(max) for M. lylae CA (2.31 mM; 769.23 μmol/mg/min) and M. luteus CA (2.0 mM; 1,000 μmol/mg/min) were calculated from Lineweaver-Burk plots in terms of esterase activity. Enhanced thermostability of CLEAs alleviates its role in operational stability for application at an on-site scrubber. The characteristic profile of purified CA from Micrococcus spp. advocates its effective application in biomimetic CO(2) sequestration.
Bosshart, Andreas; Hee, Chee Seng; Bechtold, Matthias; Schirmer, Tilman; Panke, Sven
2015-03-02
Functional promiscuity of enzymes can often be harnessed as the starting point for the directed evolution of novel biocatalysts. Here we describe the divergent morphing of an engineered thermostable variant (Var8) of a promiscuous D-tagatose epimerase (DTE) into two efficient catalysts for the C3 epimerization of D-fructose to D-psicose and of L-sorbose to L-tagatose. Iterative single-site randomization and screening of 48 residues in the first and second shells around the substrate-binding site of Var8 yielded the eight-site mutant IDF8 (ninefold improved kcat for the epimerization of D-fructose) and the six-site mutant ILS6 (14-fold improved epimerization of L-sorbose), compared to Var8. Structure analysis of IDF8 revealed a charged patch at the entrance of its active site; this presumably facilitates entry of the polar substrate. The improvement in catalytic activity of variant ILS6 is thought to relate to subtle changes in the hydration of the bound substrate. The structures can now be used to select additional sites for further directed evolution of the ketohexose epimerase. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rahman, D Y; Sarian, F D; van Wijk, A; Martinez-Garcia, M; van der Maarel, M J E C
2017-01-01
The demand for natural food colorants is growing as consumers question the use of artificial colorants more and more. The phycobiliprotein C-phycocyanin of Arthospira platensis is used as a natural blue colorant in certain food products. The thermoacidophilic red microalga Cyanidioschyzon merolae might provide an alternative source of phycocyanin. Cyanidioschyzon merolae belongs to the order Cyanidiophyceae of the phylum Rhodophyta. Its natural habitat are sulfuric hot springs and geysers found near volcanic areas in, e.g., Yellowstone National Park in the USA and in Java, Indonesia. It grows optimally at a pH between 0.5 and 3.0 and at temperatures up to 56 °C. The low pH at which C . merolae grows minimizes the risk of microbial contamination and could limit production loss. As C . merolae lacks a cell wall, phycocyanin with a high purity number of 9.9 could be extracted by an osmotic shock using a simple ultrapure water extraction followed by centrifugation. The denaturation midpoint at pH 5 was 83 °C, being considerably higher than the A . platensis phycocyanin (65 °C). The C . merolae phycocyanin was relatively stable at pH 4 and 5 up to 80 °C. The high thermostability at slightly acidic pH makes the C . merolae phycocyanin an interesting alternative to A . platensis phycocyanin as a natural blue food colorant.
Wu, Dingxin; Wang, Linchun; Li, Yuwei; Zhao, Shumiao; Peng, Nan; Liang, Yunxiang
2016-02-01
An exo-β-D-glucosaminidase (AorCsxA) from Aspergillus oryzae FL402 was heterologously expressed and purified. The deduced amino acid sequence indicated that AorCsxA belonged to glycoside hydrolase family 2. AorCsxA digested colloid chitosan into glucosamine but not into chitosan oligosaccharides, demonstrating exo-β-D-glucosaminidase (CsxA) activity. AorCsxA exhibited optimal activity at pH 5.5 and 50°C; however, the enzyme expressed in Pichia pastoris (PpAorCsxA) showed much stronger thermostability at 50°C than that expressed in Escherichia coli (EcAorCsxA), which may be related to glycosylation. AorCsxA activity was inhibited by EDTA and most of the tested metal ions. A single amino acid mutation (F769W) in AorCsxA significantly enhanced the specific activity and hydrolysis velocity as revealed by comparison of Vmax and kcat values with those of the wild-type enzyme. The three-dimensional structure suggested the tightened pocket at the active site of F769W enabled efficient substrate binding. The AorCsxA gene was heterologously expressed in P. pastoris, and one transformant was found to produce 222 U/ml activity during the high-cell-density fermentation. This AorCsxA-overexpressing P. pastoris strain is feasible for large-scale production of AorCsxA.
McCutchen-Maloney, Sandra L.
2002-01-01
Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.
Harvey, John J; Chester, Stephanie; Burke, Stephen A; Ansbro, Marisela; Aden, Tricia; Gose, Remedios; Sciulli, Rebecca; Bai, Jing; DesJardin, Lucy; Benfer, Jeffrey L; Hall, Joshua; Smole, Sandra; Doan, Kimberly; Popowich, Michael D; St George, Kirsten; Quinlan, Tammy; Halse, Tanya A; Li, Zhen; Pérez-Osorio, Ailyn C; Glover, William A; Russell, Denny; Reisdorf, Erik; Whyte, Thomas; Whitaker, Brett; Hatcher, Cynthia; Srinivasan, Velusamy; Tatti, Kathleen; Tondella, Maria Lucia; Wang, Xin; Winchell, Jonas M; Mayer, Leonard W; Jernigan, Daniel; Mawle, Alison C
2016-02-01
In this study, a multicenter evaluation of the Life Technologies TaqMan(®) Array Card (TAC) with 21 custom viral and bacterial respiratory assays was performed on the Applied Biosystems ViiA™ 7 Real-Time PCR System. The goal of the study was to demonstrate the analytical performance of this platform when compared to identical individual pathogen specific laboratory developed tests (LDTs) designed at the Centers for Disease Control and Prevention (CDC), equivalent LDTs provided by state public health laboratories, or to three different commercial multi-respiratory panels. CDC and Association of Public Health Laboratories (APHL) LDTs had similar analytical sensitivities for viral pathogens, while several of the bacterial pathogen APHL LDTs demonstrated sensitivities one log higher than the corresponding CDC LDT. When compared to CDC LDTs, TAC assays were generally one to two logs less sensitive depending on the site performing the analysis. Finally, TAC assays were generally more sensitive than their counterparts in three different commercial multi-respiratory panels. TAC technology allows users to spot customized assays and design TAC layout, simplify assay setup, conserve specimen, dramatically reduce contamination potential, and as demonstrated in this study, analyze multiple samples in parallel with good reproducibility between instruments and operators. Copyright © 2015 Elsevier B.V. All rights reserved.
Method of generating ploynucleotides encoding enhanced folding variants
Energy Technology Data Exchange (ETDEWEB)
Bradbury, Andrew M.; Kiss, Csaba; Waldo, Geoffrey S.
2017-05-02
The invention provides directed evolution methods for improving the folding, solubility and stability (including thermostability) characteristics of polypeptides. In one aspect, the invention provides a method for generating folding and stability-enhanced variants of proteins, including but not limited to fluorescent proteins, chromophoric proteins and enzymes. In another aspect, the invention provides methods for generating thermostable variants of a target protein or polypeptide via an internal destabilization baiting strategy. Internally destabilization a protein of interest is achieved by inserting a heterologous, folding-destabilizing sequence (folding interference domain) within DNA encoding the protein of interest, evolving the protein sequences adjacent to the heterologous insertion to overcome the destabilization (using any number of mutagenesis methods), thereby creating a library of variants. The variants in the library are expressed, and those with enhanced folding characteristics selected.
Nielsen, Peter B; Petersen, Maja S; Ystaas, Viviana; Andersen, Rolf V; Hansen, Karin M; Blaabjerg, Vibeke; Refstrup, Mette
2012-10-01
Classical hereditary hemochromatosis involves the HFE-gene and diagnostic analysis of the DNA variants HFE p.C282Y (c.845G>A; rs1800562) and HFE p.H63D (c.187C>G; rs1799945). The affected protein alters the iron homeostasis resulting in iron overload in various tissues. The aim of this study was to validate the TaqMan-based Sample-to-SNP protocol for the analysis of the HFE-p.C282Y and p.H63D variants with regard to accuracy, usefulness and reproducibility compared to an existing SNP protocol. The Sample-to-SNP protocol uses an approach where the DNA template is made accessible from a cell lysate followed by TaqMan analysis. Besides the HFE-SNPs other eight SNPs were used as well. These SNPs were: Coagulation factor II-gene F2 c.20210G>A, Coagulation factor V-gene F5 p.R506Q (c.1517G>A; rs121917732), Mitochondria SNP: mt7028 G>A, Mitochondria SNP: mt12308 A>G, Proprotein convertase subtilisin/kexin type 9-gene PCSK9 p.R46L (c.137G>T), Plutathione S-transferase pi 1-gene GSTP1 p.I105V (c313A>G; rs1695), LXR g.-171 A>G, ZNF202 g.-118 G>T. In conclusion the Sample-to-SNP kit proved to be an accurate, reliable, robust, easy to use and rapid TaqMan-based SNP detection protocol, which could be quickly implemented in a routine diagnostic or research facility. Copyright © 2012. Published by Elsevier B.V.
DNA expressions - A formal notation for DNA
Vliet, Rudy van
2015-01-01
We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Directory of Open Access Journals (Sweden)
Shalini RAI
2014-03-01
Full Text Available This study reports utilization of mixture of wheat and barley bran (1:1 for the production of thermostable alpha-amylase enzyme through a spore former, heat tolerant strain of Bacillus amyloliquefaciens in solid state fermentation. Maximum yield of alpha-amylase (252.77 U mL-1 was obtained in following optimized conditions, inoculums size 2 mL (2 × 106 CFU/mL, moisture 80%, pH 7±0.02, NaCl (3%, temperature 38±1°C, incubation for 72 h, maltose (1% and tryptone (1%. After SSF crude enzyme was purified via ammonium sulfate precipitation, ion exchange and column chromatography by DEAE Cellulose. Purified protein showed a molecular weight of 42 kDa by SDS-PAGE electrophoresis. After purification, purified enzyme was characterized against several enzymes inhibitors such as temperature, NaCl, pH, metal and surfactants. Pure enzyme was highly active over broad temperature (50-70°C, NaCl concentration (0.5-4 M, and pH (6-10 ranges, indicating it’s a thermoactive and alkali-stable nature. Moreover, CaCl2, MnCl2, =-mercaptoethanol were found to stimulate the amylase activity, whereas FeCl3, sodium dodecyl sulfate (SDS, CuCl3 and ethylenediaminetetraacetic acid (EDTA strongly inhibited the enzyme. Moreover, enzyme specificity and thermal stability conformed by degradation of different soluble starch up to 55°C. Therefore, the present study proved that the extracellular alpha-amylase extracted through wheat flour residues by organism B. amyloliquefaciens MCCB0075, both have considerable potential for industrial application owing to its properties.
Crystal structure of a thermostable Old Yellow Enzyme from Thermus scotoductus SA-01
International Nuclear Information System (INIS)
Opperman, Diederik J.; Sewell, Bryan T.; Litthauer, Derek; Isupov, Mikhail N.; Littlechild, Jennifer A.; Heerden, Esta van
2010-01-01
Recent characterization of the chromate reductase (CrS) from the thermophile Thermus scotoductus SA-01 revealed this enzyme to be related to the Old Yellow Enzyme (OYE) family. Here, we report the structure of a thermostable OYE homolog in its holoform at 2.2 A as well as its complex with p-hydroxybenzaldehyde (pHBA). The enzyme crystallized as octamers with the monomers showing a classical TIM barrel fold which upon dimerization yields the biologically active form of the protein. A sulfate ion is bound above the si-side of the non-covalently bound FMN cofactor in the oxidized solved structure but is displaced upon pHBA binding. The active-site architecture is highly conserved as with other members of this enzyme family. The pHBA in the CrS complex is positioned by hydrogen bonding to the two conserved catalytic-site histidines. The most prominent structural difference between CrS and other OYE homologs is the size of the 'capping domain'. Thermostabilization of the enzyme is achieved in part through increased proline content within loops and turns as well as increased intersubunit interactions through hydrogen bonding and complex salt bridge networks. CrS is able to reduce the C=C bonds of α,β-unsaturated carbonyl compounds with a preference towards cyclic substrates however no activity was observed towards β-substituted substrates. Mutational studies have confirmed the role of Tyr177 as the proposed proton donor although reduction could still occur at a reduced rate when this residue was mutated to phenylalanine.
Experimental study on the thermostable property of aramid fiber reinforced PE-RT pipes
Directory of Open Access Journals (Sweden)
Guoquan Qi
2015-11-01
Full Text Available Flexible composite pipes are advantageous in ultra high strength, high modulus, pH and corrosion resistance and light weight, but there are still some hidden safety troubles because they are poorer in thermostable capacity. Therefore, test samples of flexible composite pipes were prepared with high-temperature polythene (PE-RT as the neck bush and aramid fiber as the reinforcement layer. Experimental study was conducted by using HPHT vessel and differential thermal scanner for different working conditions, different temperatures, whole-pipe pressure-bearing capacity and 1000 h viability. It is shown by the environmental compatibility test that high temperature has little effect on the weight, Vicat softening temperature, mechanical properties and structures of neck bush PE-RT, but exerts an obvious effect on the tensility and whole-pipe water pressure blasting of the reinforcement aramid fiber. Besides, the drop of whole-pipe pressure-bearing capacity is caused by deformation and breaking of aramid fibers when the reinforcement layer is under the force of internal pressure. Finally, disorientation and crystallization of molecular thermal motion occur with the rise of temperature, so amorphous orientation reduces, crystallinity factor and crystalline orientation factor increase gradually, thus, disorientation of macromolecular chains increases and tensile strength decreases. It is concluded that this type of flexible composite pipe can smoothly pass 1000 h viability test. And it is recommended that it be used in the situations with temperature not higher than 95 °C and internal pressure not higher than 4 MPa.
Alkylating agent (MNU)-induced mutation in space environment
Ohnishi, T.; Takahashi, A.; Ohnishi, K.; Takahashi, S.; Masukawa, M.; Sekikawa, K.; Amano, T.; Nakano, T.; Nagaoka, S.
2001-01-01
In recent years, some contradictory data about the effects of microgravity on radiation-induced biological responses in space experiments have been reported. We prepared a damaged template DNA produced with an alkylating agent (N-methyl-N-nitroso urea; MNU) to measure incorrect base-incorporation during DNA replication in microgravity. We examined whether mutation frequency is affected by microgravity during DNA replication for a DNA template damaged by an alkylating agent. Using an in vitro enzymatic reaction system, DNA synthesis by Taq polymerase or polymerase III was done during a US space shuttle mission (Discovery, STS-91). After the flight, DNA replication and mutation frequencies were measured. We found that there was almost no effect of microgravity on DNA replication and mutation frequency. It is suggested that microgravity might not affect at the stage of substrate incorporation in induced-mutation frequency.
Zhang, Guo-Qing; Wu, Ying-Ying; Ng, Tzi-Bun; Chen, Qing-Jun; Wang, He-Xiang
2013-01-01
A monomeric phytase with a molecular mass of 14 kDa was acquired from fresh fruiting bodies of the shiitake mushroom Lentinus edodes. The isolation procedure involved chromatography on DEAE-cellulose, CM-cellulose, Q-Sepharose, Affi-gel blue gel, and a final fast protein liquid chromatography-gel filtration on Superdex 75. The purified phytase demonstrated the unique N-terminal amino acid sequence DPKRTDQVN, which exhibited no sequence similarity with those of other phytases previously reported. It expressed its maximal activity at pH 5.0 and 37°C. Phytase activity manifested less than 20% change in activity over the pH range of 3.0–9.0, considerable thermostability with more than 60% residual activity at 70°C, and about 40% residual activity at 95°C. It displayed a wide substrate specificity on a variety of phosphorylated compounds with the following ranking: ATP > fructose-6-phosphate > AMP > glucose-6-phosphate > ADP > sodium phytate > β-glycerophosphate. The phytase activity was moderately stimulated by Ca2+, but inhibited by Al3+, Mn2+, Zn2+, and Cu2+ at a tested concentration of 5 mM. PMID:23586045
Directory of Open Access Journals (Sweden)
Guo-Qing Zhang
2013-01-01
Full Text Available A monomeric phytase with a molecular mass of 14 kDa was acquired from fresh fruiting bodies of the shiitake mushroom Lentinus edodes. The isolation procedure involved chromatography on DEAE-cellulose, CM-cellulose, Q-Sepharose, Affi-gel blue gel, and a final fast protein liquid chromatography-gel filtration on Superdex 75. The purified phytase demonstrated the unique N-terminal amino acid sequence DPKRTDQVN, which exhibited no sequence similarity with those of other phytases previously reported. It expressed its maximal activity at pH 5.0 and 37°C. Phytase activity manifested less than 20% change in activity over the pH range of 3.0–9.0, considerable thermostability with more than 60% residual activity at 70°C, and about 40% residual activity at 95°C. It displayed a wide substrate specificity on a variety of phosphorylated compounds with the following ranking: ATP > fructose-6-phosphate > AMP > glucose-6-phosphate > ADP > sodium phytate > β-glycerophosphate. The phytase activity was moderately stimulated by Ca2+, but inhibited by Al3+, Mn2+, Zn2+, and Cu2+ at a tested concentration of 5 mM.
DEFF Research Database (Denmark)
Kølvraa, S; Gregersen, N; Blakemore, A I
1991-01-01
RFLP haplotypes in the region containing the medium-chain acyl-CoA dehydrogenase (MCAD) gene on chromosome 1 have been determined in patients with MCAD deficiency. The RFLPs were detected after digestion of patient DNA with the enzymes BanII. PstI and TaqI and with an MCAD cDNA-clone as a probe....... Of 32 disease-causing alleles studied, 31 possessed the previously published A----G point-mutation at position 985 of the cDNA. This mutation has been shown to result in inactivity of the MCAD enzyme. In at least 30 of the 31 alleles carrying this G985 mutation a specific RFLP haplotype was present...
Energy Technology Data Exchange (ETDEWEB)
Klingeberg, M [Goettingen Univ. (Germany, F.R.). Inst. fuer Mikrobiologie; Vorlop, K D [Technische Univ. Braunschweig (Germany, F.R.). Inst. fuer Technische Chemie; Antranikian, G [Technische Univ. Hamburg-Harburg, Hamburg (Germany, F. R.). Arbeitsbereich Biotechnologie 1
1990-08-01
For the production of cell-free thermostable {alpha}-amylases and pullulanases various anaerobic thermophilic bacteria that belong to the genera Clostridium and Thermoanaerobacter were immobilized in calcium alginate gel beads. The entrapment of bacteria was performed in full was well as in hollow spheres. An optimal limited medium, which avoided bacterial outgrowth, was developed for the cultivation of immobilized organisms at 60deg C using 0.4% starch as substrate. Compared to non-immobilized cells these techniques allowed a significant increase (up to 5.6-fold) in the specific activities of the extracellular enzymes formed. An increase in the productivity of extracellular enzymes was observed after immobilization of bacteria in full spheres. In the case of C. thermosaccharolyticum, for instance, the productivity was raised from 90 units (U)/10{sup 12} cells up to 700 U/10{sup 12} cells. Electrophoretic analysis of the secreted proteins showed that in all cases most of the amylolytic enzymes formed were released into the culture medium. Proteins that had a molecular mass of less than 450 000 daltons could easily diffuse through the gel matrix. Cultivation of immobilized bacteria in semi-continuous and fed-batch cultures was also accompanied by an elevation in the concentration of cell-free enzymes. (orig.).
Report for the NGFA-5 project.
Energy Technology Data Exchange (ETDEWEB)
Jaing, C; Jackson, P; Thissen, J; Wollard, J; Gardner, S; McLoughlin, K
2011-11-15
The objective of this project is to provide DHS a comprehensive evaluation of the current genomic technologies including genotyping, TaqMan PCR, multiple locus variable tandem repeat analysis (MLVA), microarray and high-throughput DNA sequencing in the analysis of biothreat agents from complex environmental samples. To effectively compare the sensitivity and specificity of the different genomic technologies, we used SNP TaqMan PCR, MLVA, microarray and high-throughput illumine and 454 sequencing to test various strains from B. anthracis, B. thuringiensis, BioWatch aerosol filter extracts or soil samples that were spiked with B. anthracis, and samples that were previously collected during DHS and EPA environmental release exercises that were known to contain B. thuringiensis spores. The results of all the samples against the various assays are discussed in this report.
Effect of Eucommia ulmoides extract on osteoblast proliferation
African Journals Online (AJOL)
reduce body fat, restore vascular elasticity, treat diuresis, exert broad-spectrum anti-bacterial activity, excite the central nervous system, and ... min and plated in 96-well reaction plates in triplicate. Each reaction included 10 μL 2× SYBR. Premix Ex Taq, 1 μL forward primer, 1 μL reverse primer (Table 1), 3 μL cDNA, and 5 μL.
Monitoring paneer for Listeria monocytogenes- A high risk food ...
African Journals Online (AJOL)
Dr.Batish
2012-05-15
May 15, 2012 ... Taq DNA polymerase (Boehringer Mannheim). Appropriate positive and negative controls with each reaction were also set up. The PCR parametres included initial denaturation at 95°C for 4 min followed by. 25 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s ...
Ajayi, Oyeyemi O; Adefenwa, Mufliat A; Agaviezor, Brilliant O; Ikeobi, Christian O N; Wheto, Matthew; Okpeku, Moses; Amusan, Samuel A; Yakubu, Abdulmojeed; De Donato, Marcos; Peters, Sunday O; Imumorin, Ikhide G
2014-02-01
The tenascin-XB (TNXB) gene has antiadhesive effects, functions in matrix maturation in connective tissues, and localizes to the major histocompatibility complex class III region. We hypothesized that it may influence adaptive physiological response through an effect on blood vessel function. We identified a novel g.1324 A→G polymorphism at a TaqI recognition site in a 454 bp fragment of ovine TNXB and genotyped it in 150 Nigerian sheep using PCR-RFLP. The missense mutation changes glutamic acid (GAA) to glycine (GGA). Among SNP genotypes, significant differences (P bone length. Interaction effects of breed, SNP genotype, and geographic location had a significant effect (P < 0.05) on chest girth. The SNP genotype was significantly (P < 0.05) associated with physiological traits of pulse rate and skin temperature. The observed effect of this novel polymorphism may be mediated through its role in connective tissue biology, requiring further association and functional studies.
Regulating DNA Self-assembly by DNA-Surface Interactions.
Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde
2017-12-14
DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.