WorldWideScience

Sample records for thallium 204

  1. Studies of photon spectra from a thallium-204 foil source as an aid to dosimetry and shielding

    CERN Document Server

    Francis, T M

    1976-01-01

    Beta ray foil sources incorporating nuclides such as thallium-204, promethium-147 and strontium-90 plus yttrium-90 ar increasingly used in industrial devices such as thickness gauges. These sources are so constructed that they give rise to complex photon spectra containing low energy Bremsstrahlung and X-rays characteristic of the constructional materials. The energy response of practical monitoring instruments is such that they are likely to underestimate the dose due to such spectra unless they are calibrated using appropriate spectra. This report describes a series of measurements carried out on a commercially available thallium-204 foil source and five commonly used shielding materials. The measurements made with a NaI(T1) spectrometer have been corrected for instrumental distortions to obtain the photon spectra in air. These spectra are presented and have been used to compute dose in air with the help of published data on mass energy-absorption coefficients. Also included in the report are data derived f...

  2. Extracorporeal treatment for thallium poisoning

    DEFF Research Database (Denmark)

    Ghannoum, Marc; Nolin, Thomas D; Goldfarb, David S

    2012-01-01

    The EXtracorporeal TReatments In Poisoning (EXTRIP) workgroup was formed to provide recommendations on the use of extracorporeal treatment (ECTR) in poisoning. To test and validate its methods, the workgroup reviewed data for thallium (Tl)....

  3. Usefulness of Thallium Scan for Differential Diagnosis of Breast Mass

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Sang Kyun; Yum, Ha Yong; Lee, Chung Han; Choi, Kyung Hyun [Kosin University College of Medicine, Pusan (Korea, Republic of)

    1994-07-15

    The purpose of this study is to evaluate thallium scanning as a potential test in differentiating malignant from benign lesions of breast. Thirty-one female patients underwent thallium scan of the breast. After intravenous injection of 74-111 MBq(2-3 mCi)of thallium-201, anterior and lateral images were obtained. We compared thallium scans with pathological results. Of 11 patients with breast cancers, 10 cases (90.9%) were detected using thallium scan. Thallium scan obtained in one patient who had breast cancer but received several cycles of chemotherapy did not show thallium uptake. The smallest detectable cancer was 1.5 cm in diameter. In contrast, there is no thallium accumulation in breasts of 17 of 20 patients with benign disease (85%), Three cases of 13 fibrocystic disease show thallium uptake in their breast. In conclusion, thallium scan is an effective test in differentiating benign from malignant lesion.

  4. Thallium contamination of water in Canada

    Energy Technology Data Exchange (ETDEWEB)

    Cheam, V. [National Water Research Institute Branch, Burlington, ON (Canada). Aquatic Ecosystems Protection Research Branch

    2001-07-01

    A highly sensitive instrument, a Laser-Excited Atomic Fluorescence Spectrometer, has been developed to study thallium contamination in some important Canadian ecosystems from the Arctic (containing very low thallium concentration) to coal-related industries across Canada and even to the study of thallium toxicity in an invertebrate, Hyalella azteca. Overall, the data indicate that the coal power plants and mines contain higher thallium concentrations than the other ecosystems studied, and the eastern region has the highest Tl concentrations compared to other regions. The range of thallium concentration in ng/L for the Arctic snow and ice was between not detected and 8.4, for the Great Lakes waters 0.9 to 48, for pore waters 0.1 to 213, for western coal power plants and mines 0.1 to 1326, for central coal power plants 1.2 to 175, for eastern coal power plants and mines 0.2 to 23605, and for miscellaneous sites across Canada not detected to 4390 ng/L. Some of these high concentrations and those high ones reported in industrial wastewaters exceeded the chronic toxicity endpoints for Hyalella azteca mortality, growth and reproduction, and thus can cause serious distress to the environment. All data were integrated into a map of thallium distribution, the first one in Canada. Natural background level of thallium for the Arctic was estimated to be 0.02 to 0.03 pg/g.

  5. IRIS Toxicological Review of Thallium and Compounds ...

    Science.gov (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certain tumors. EPA's assessment of noncancer health effects and carcinogenic potential of thallium compounds was last prepared and added to the IRIS database between 1988 and 1990. The IRIS program is preparing an assessment that will incorporate current health effects information available for thallium and compounds, and current risk assessment methods. The IRIS assessment for thallium compounds will consist of a Toxicological Review and IRIS Summary. The Toxicological Review is a critical review of the physiochemical and toxicokinetic properties of a chemical, and its toxicity in humans and experimental systems. The assessment will present reference values for the noncancer effects of thallium compounds (RfD and Rfc), and a cancer assessment. The Toxicological Review and IRIS Summary have been subject to Agency review, Interagency review, and external scientific peer review. The final product will reflect the Agency opinion on the overall toxicity of thallium and compounds. EPA is undertaking an Integrated Risk Information System (IRIS) health assessment for thallium and compounds. IRIS is an EPA database containing Agency scientific positions on potential adverse human health effec

  6. Repeat thallium-201 SPECT in cerebral lymphoma.

    Science.gov (United States)

    Borggreve, F; Dierckx, R A; Crols, R; Mathijs, R; Appel, B; Vandevivere, J; Mariën, P; Martin, J J; De Deyn, P P

    1993-01-01

    The authors report on the contribution of Thallium-201 brain SPECT in the diagnosis and follow-up of a non-immunosuppressed patient, presenting with primary cerebral lymphoma. The tumoral process was at first not diagnosed on CT-scan, but Thallium-201 SPECT suggested a tumoral invasion. During corticosteroid treatment the tumor volume on CT-scan decreased, while on Thallium-201 SPECT there was an enhancement of the accumulation and an increasing tumor to non-tumor ratio. These scintigraphical findings more closely reflected the clinical course and the postmortem results.

  7. Thallium poisoning from maliciously contaminated food.

    Science.gov (United States)

    Meggs, W J; Hoffman, R S; Shih, R D; Weisman, R S; Goldfrank, L R

    1994-01-01

    Four young adults presented two days after one of them had received marzipan balls packaged in a box from an expensive candy manufacturer. Two ate one candy ball, while two others shared a third. The next day, variable gastrointestinal symptoms developed. On the third day, two patients developed painful paresthesiae of the hands and feet, an early but nonspecific clinical marker of thallium poisoning. A tentative diagnosis of thallium poisoning was made based on symptoms, and treatment was initiated. The remaining candies were radiographed. Metallic densities in the candies supported the diagnosis, and atomic absorption spectroscopy was used to quantitate thallium content. Each candy contained a potentially fatal dose. Five to seven days later, hypertension and tachycardia developed in the two patients who had ingested an entire candy. All patients developed alopecia but recovered without overt neurologic or other sequelae. While the diagnosis of thallium poisoning is often delayed until alopecia develops, an early diagnosis favors an effective treatment strategy.

  8. Thallium in mineral resources extracted in Poland

    Directory of Open Access Journals (Sweden)

    Bojakowska I.

    2013-04-01

    Full Text Available Thallium concentrations in primary mineral commodities extracted in Poland and processed in high temperatures were determined by ICP-MS method. Samples of hard and brown coal, copper-silver and zinclead ores, argillaceous and calcareous rocks of different genesis and age were analyzed. The highest thallium concentrations occur in the zinc-lead ores, the average content being of 52.1 mg/kg. The copper ores contain in average 1.4 mg/kg of thallium. Hard coals from the Upper Silesian Coal Basin display higher thallium content than those exploited in the Lublin Coal Basin. Brown coals from Turow deposit distinguish by much higher values, 0.7 mg/kg Tl, than those from huge Bełchatów and smaller Konin-Turek region deposits. Average thallium concentrations in clays used for ceramic materials are lower than 1 mg/kg, except of Mio-Pliocene Slowiany deposit. The average content of thallium in the studied limestone and dolomite raw materials for cement, lime, and metallurgical flux, and refractories is very low in comparison to the average amounts in the world carbonate rocks.

  9. Examining of Thallium in Cigarette Smokers.

    Science.gov (United States)

    Ghaderi, Amir; NasehGhafoori, Payam; Rasouli-Azad, Morad; Sehat, Mojtaba; Mehrzad, Fateme; Nekuei, Mina; Aaseth, Jan; Banafshe, Hamid Reza; Mehrpour, Omid

    2017-08-01

    Smoking is one of the sources of thallium which is considered as a toxic heavy metal. The aim of this study was to determine urinary thallium levels and related variables in smokers, compared to a control group. The study was conducted on 56 participants who had smoked continuously during the year before they were referred to Kashan Smoking Cessation Clinic. Fifty-three nonsmokers who were family members or friends of the smokers were selected as the control group. Urinary thallium was measured in both groups (n = 109) using atomic absorption spectrophotometry. The mean value (with SD) for urinary thallium in the smokers (10.16 ± 1.82 μg/L) was significantly higher than in the control group (2.39 ± 0.63 μg/L). There was a significant relationship between smoking duration and urinary thallium levels (P = 0.003). In a subgroup of smokers who was addicted to opium and opium residues (n = 9), the mean level of thallium (37.5 ± 13.09 μg/L) was significantly higher than in the other smokers (4.93 ± 4.45; P = 0.001). Multiple regression analysis showed opioid abuse, insomnia, and chronic obstructive pulmonary disease (COPD), together were strong predictors of urinary thallium levels in smokers. There was no significant difference in thallium level in hookah smokers (P = 0.299) or in those with COPD compared to other smokers (P = 0.375). Urinary thallium levels of smokers with clinical signs of depression, sleep disorders, memory loss, and sweating were higher than those of smokers without these signs. Since thallium, as other toxic metals is accumulated in the body, and cigarette smoking also involves carcinogenic exposures and health hazards for passively exposed people, the need for cigarette control policies is emphasized.

  10. Experimental excitation functions of deuteron induced reactions on natural thallium up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Adam Rebeles, R., E-mail: radamreb@vub.ac.be [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Van den Winkel, P.; Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Tarkanyi, F.; Takacs, S. [Institute of Nuclear Research of the Hungarian Academy of Sciences, Debrecen H-4026 (Hungary)

    2012-10-01

    Excitation functions of deuteron induced reactions on natural thallium leading to the formation of {sup 204m,203m2+m1+g,202m,201m+g,200}Pb and {sup 202,201m+g,200m+g}Tl isotopes were determined up to 50 MeV. The cross sections were measured by an activation technique using stacked foil irradiation. The excitation functions of the investigated reactions are compared with data reported in literature and also with the theoretical results of TALYS nuclear reaction code. From the measured cross section data, the thick target yield for the medical interesting {sup 203}Pb isotope is calculated.

  11. Thallium-201 scintigraphy in unstable angina pectoris

    Energy Technology Data Exchange (ETDEWEB)

    Wackers, F.J.T.; Lie, K.I.; Liem, K.L.; Sokole, E.B.; Samson, G.; Van Der Schoot, J.B.; Durrer, D.

    1978-04-01

    Thallium-201 scintigraphy was performed during the pain free period in 98 patients with unstable angina. Scintiscans were positive in 39 patients, questionable in 27 patients and normal in 32 patients. Eighty-one patients responded favorably to treatment (group I). Seventeen patients had complicated courses (group II) and despite maximal treatment with propranolol either developed infarction (six patients) or continued to have angina necessitating coronary surgery (11 patients). In group I during the pain free period 26 of 81 patients had positive thallium-201 scans, whereas 20 patients had an abnormal ECG at that time; during angina 18 patients had transient ECG changes. In group II during the pain free period 13 of 17 patients had positive scans, whereas two patients had abnormal ECG at that time; during angina 12 patients showed transient ECG changes. The sensitivity to recognize group II was 76% for thallium-201 scintigraphy, 11% for ECG during the pain free period; 70% for ECG during angina; 94% for the combination of either positive scans or abnormal ECG. Thus, positive thallium-201 scans occur in patients with unstable angina, positive scans can be obtained during the pain free period, thallium-201 scans are more frequently positive in patients with complicated course.

  12. Thallium-201 uptake in a benign thymoma

    Energy Technology Data Exchange (ETDEWEB)

    Campeau, R.J.; Ey, E.H.; Varma, D.G.

    1986-07-01

    A 68-year-old woman was admitted with atypical angina. A chest radiograph showed an anterior mediastinal mass that was confirmed on CT. The mass was relatively avascular and separate from the heart and great vessels. She underwent stress thallium testing that demonstrated no exercise-induced ischemia; however, an abnormal focus of thallium activity was present in the anterior mediastinum on stress and redistribution images. Cardiac catheterization demonstrated a normal left ventriculogram, coronary arteries and thoracic aorta. Subsequent surgery and pathologic examination revealed the mass to be a benign thymoma arising in the right lobe of the thymus gland.

  13. Endogenous thiols enhance thallium toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Montes, Sergio; Rios, Camilo [Instituto Nacional de Neurologia y Neurocirugia, ' ' Manuel Velasco Suarez' ' , Departamento de Neuroquimica, Mexico, D.F (Mexico); Soriano, Luz; Monroy-Noyola, Antonio [Universidad Autonoma del Estado de Morelos, Laboratorio de Neuroproteccion, Facultad de Farmacia, Cuernavaca, Morelos (Mexico)

    2007-10-15

    Either L-methionine (L-met) or L-cysteine (L-cys), given alone and in combination with Prussian blue (PB) was characterized as treatment against acute thallium (Tl) toxicity in rats. Animals were intoxicated with 32 mg/kg Tl acetate corresponding to rat LD{sub 50}. Antidotal treatments were administered during 4 days, as follows: (1) vehicle, (2) L-met 100 mg/kg i.p. twice a day, (3) L-cys 100 mg/kg i.p. twice a day, (4) PB 50 mg/kg oral, twice a day, (5) L-met + PB and (6) L-cys + PB. Mortality was as follows: control 50%; L-met 80%; L-cys 80%; PB 20%; L-met + PB 90% and L-cys + PB 100%. In a different experiment, using 16 mg/kg of Tl, tissue levels of this metal were analyzed. PB treatment statistically diminished Tl content in body organs and brain regions (P < 0.01). Whereas, separate treatments of L-met and L-cys failed to decrease Tl content in organs and brain regions; while its administration in combination with PB (L-met + PB and L-cys + PB groups) lowered Tl levels in body organs in the same extent as PB group. Results indicate that L-met and L-cys administered alone or in combination with PB should not be considered suitable treatments against acute Tl toxic effects because this strategy failed to prevent mortality and Tl accumulation in brain. (orig.)

  14. Thallium in fractions of soil formed on floodplain terraces.

    Science.gov (United States)

    Jakubowska, Monika; Pasieczna, Anna; Zembrzuski, Wlodzimierz; Swit, Zbigniew; Lukaszewski, Zenon

    2007-01-01

    Two soils formed on the floodplain terrace of a rivulet flowing through the zinc-lead ore exploration area polluted with thallium and one soil from a floodplain terrace of the reference area were investigated in terms of thallium distribution between soil fractions. Such type of soil is formed on river floodplain terraces next to the main river channel and its composition records the history of river pollution. A sequential extraction of soil according to the BCR protocol was performed with an additional initial stage of extraction with water. Apart from labile thallium, thallium entrapped in the residual parent matter was also determined. Thallium was determined by flow-injection differential-pulse anodic stripping voltammetry. In all three cases, the major fraction is thallium entrapped in parent matter. Top soil from the polluted area contains 49.3% thallium entrapped in the residual parent matter, the bottom soil contains 41% while the reference soil contains 80% in this fraction. The major part of labile thallium is located in the reducible fraction (27.7% of total thallium in the top soil, 27% in the bottom soil and 12.4% of the reference soil). Second in terms of significance is the fraction of oxidizable thallium. The top soil contains 12% of total thallium concentration, the bottom soil contains 19% of total concentration, while the reference soil contains 4.1% of total concentration. The acid soluble/exchangeable fraction of thallium has almost the same significance as the oxidizable fraction. The top soil contains 10.4% of the total concentration, while the bottom soil contains 12% of the total concentration. Water soluble thallium concentration is very small. Comparison of the top and the bottom soil show that thallium has not been transported from the river channel onto the floodplain terrace over a long period.

  15. Characteristics of photoconductivity in thallium monosulfide single ...

    Indian Academy of Sciences (India)

    journal of. March 2007 physics pp. 467–479. Characteristics of photoconductivity in thallium monosulfide single crystals. I M ASHRAF, H A ELSHAIKH and A M BADR. Physics Department ... pendencies of carrier lifetime on light intensity, applied voltage and temperature are also ..... 14, 797 (1935) (in Japanese). [10] A T ...

  16. Extraction separation of thallium (III) from thallium (I) with n-octylaniline.

    Science.gov (United States)

    Shilimkar, Tulshidas N; Anuse, Mansing A; Patil, Kesharsingh J

    2002-01-01

    A novel method is developed for the extraction separation of thallium(III) from salicylate medium with n-octylaniline dissolved in toluene as an extractant. The optimum conditions have been determined by making a critical study of weak acid concentration, extractant concentration, period of equilibration and effect of solvent on the equilibria. The thallium (III) from the pregnant organic phase is stripped with acetate buffer solution (pH 4.7) and determined complexometrically with EDTA. The method affords the sequential separation of thallium(III) from thallium(I) and also commonly associated metal ions such as Al(III), Ga(III), In(III), Fe(III), Bi(III), Sb(III) and Pb(II). It is used for analysis of synthetic mixtures of associated metal ions and alloys. The method is highly selective, simple and reproducible. The reaction takes place at room temperature and requires 15-20 min for extraction and determination of thallium(III).

  17. Thallium bromide iodide crystal acoustic anisotropy examination.

    Science.gov (United States)

    Mantsevich, S N

    2017-03-01

    Thallium bromide iodide crystal also known as KRS-5 is the well known material used in far infrared radiation applications for optical windows and lenses fabrication. The main advantage of this material is the transparency in wide band of wavelengths from 0.53 to 50μm. Despite such advantages as transparency and large acousto-optic figure of merit values, KRS-5 is rarely used in acousto-optics. Nevertheless this material seems to be promising for far infrared acousto-optic applications. The acoustic and acousto-optic properties of KRS-5 needed for the full use in optoelectronics are not well understood to date. In this paper the detailed examination of thallium bromide iodide crystal acoustic properties is presented. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Thallium and its contents in Remata carbonate rocks

    Directory of Open Access Journals (Sweden)

    Kondelová Marcela

    1996-09-01

    Full Text Available The article presents at first the list of thallium own minerals and its isomorphic content in other minerals, especially in Slovakian ore deposits. This trace element was found in numerous dolomite-rock samples from Remata massif near Handlová. An interesting level of Tl content was analyzed in nonsilicified rocks; the highest content of Tl (and Ag are along the E – W line of disturbance. The presence of thallium in some limonitic aggregates in close Kremnica-gold deposit indicate any continuous relation. Some similarities to type gold deposits Carlin ( USA are discussed, even if no gold and discrete thallium phases were in Remata determined yet.

  19. A Case-Control Study of Prenatal Thallium Exposure and Low Birth Weight in China.

    Science.gov (United States)

    Xia, Wei; Du, Xiaofu; Zheng, Tongzhang; Zhang, Bin; Li, Yuanyuan; Bassig, Bryan A; Zhou, Aifen; Wang, Youjie; Xiong, Chao; Li, Zhengkuan; Yao, Yuanxiang; Hu, Jie; Zhou, Yanqiu; Liu, Juan; Xue, Weiyan; Ma, Yue; Pan, Xinyun; Peng, Yang; Xu, Shunqing

    2016-01-01

    Thallium (Tl) is a highly toxic heavy metal widely present in the environment. Case reports have suggested that maternal exposure to high levels of Tl during pregnancy is associated with low birth weight (LBW), but epidemiological data are limited. This study was designed to evaluate whether prenatal Tl exposure is associated with an increased risk of LBW. This case-control study involving 816 study participants (204 LBW cases and 612 matched controls) was conducted in Hubei Province, China, in 2012-2014. Tl concentrations were measured in maternal urine collected at delivery, and associations with LBW were evaluated using conditional logistic regression. Higher maternal urinary Tl levels were significantly associated with increased risk of LBW [crude odds ratio (OR) = 1.52; 95% CI: 1.00, 2.30 for the highest vs. lowest tertile], and the association was similarly elevated after adjustment for potential confounders (adjusted OR = 1.90; 95% CI: 1.01, 3.58 for the highest vs. lowest tertile). Stratified analyses showed slightly higher risk estimates for LBW associated with higher Tl levels for mothers case-control study to investigate the association between prenatal Tl exposure and LBW. The results suggest that prenatal exposure to high levels of Tl may be associated with an increased risk of LBW. Xia W, Du X, Zheng T, Zhang B, Li Y, Bassig BA, Zhou A, Wang Y, Xiong C, Li Z, Yao Y, Hu J, Zhou Y, Liu J, Xue W, Ma Y, Pan X, Peng Y, Xu S. 2016. A case-control study of prenatal thallium exposure and low birth weight in China. Environ Health Perspect 124:164-169; http://dx.doi.org/10.1289/ehp.1409202.

  20. Tracing thallium contamination in soils using isotopes

    Science.gov (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Teper, Leslaw; Cabala, Jerzy; Rohovec, Jan; Penížek, Vít; Zádorová, Tereza; Pavlů, Lenka; Holubík, Ondřej; Drábek, Ondřej; Němeček, Karel; Houška, Jakub; Ash, Christopher

    2017-04-01

    We report the thallium (Tl) isotope record in moderately contaminated soils, which have been historically affected by emissions from coal-fired power plants. Our findings clearly demonstrate that Tl of anthropogenic (high-temperature) origin with light isotope composition was deposited onto the studied soils, where heavier Tl (ɛ205Tl -1) naturally occurs. The results show a positive linear relationship (R2 = 0.71) between 1/Tl and the isotope record, as determined for all the soils and bedrocks, also indicative of binary Tl mixing between two dominant reservoirs. We also identified significant Tl isotope variations within the products from coal combustion and thermo-desorption experiments with local Tl-rich coal pyrite. Bottom ash exhibited the heaviest Tl isotope composition (ɛ205Tl 0), followed by fly ash (ɛ205Tl between -2.5 and -2.8) and volatile Tl fractions (ɛ205Tl between -6.2 and -10.3), suggesting partial Tl isotope fractionations. Despite the evident role of soil processes in the isotope redistribution, we demonstrate that Tl contamination can be traced in soils, and propose that the isotope data represent a possible tool to aid our understanding of post-depositional Tl dynamics in surface environments for the future. This research was supported by the Czech Science Foundation (grant no. 14-01866S and 17-03211S).

  1. The analysis of thallium in geological materials by radiochemical neutron activation and x-ray fluorescence spectrometry: a comparison

    Energy Technology Data Exchange (ETDEWEB)

    McGoldrick, P.J.; Robinson, P. [Tasmania Univ., Sandy Bay, TAS (Australia)

    1993-12-31

    Carrier-based radiochemical neutron activation (RNAA) is a precise and accurate technique for the analysis of Tl in geological materials. For about a decade, until the mid-80s, a procedure modified from Keays et al. (1974) was used at the University of Melbourne to analyse for Tl in a wide variety of geological materials. Samples of powdered rock weighing several hundred milligrams each were irradiated in HIFAR for between 12 hours and 1 week, and subsequently fused with a sodium hydroxide - sodium peroxide mixture and several milligrams of inactive Tl carrier. Following acid digestion of the fusion mixture anion exchange resin was used to separate Tl from the major radioactive rock constituents. The Tl was then stripped from the resin and purified as thallium iodide and a yield measured gravimetrically. Activity from {sup 204}Tl (a {beta}-emitter with a 3 8 year half-life) was measured and Tl determined by reference to pure chemical standards irradiated and processed along with the unkowns. Detection limits for the longer irradiations were about one part per billion. Precision was monitored by repeat analyses of `internal standard` rocks and was estimated to be about five to ten percent (one standard deviation). On the other hand, X-ray fluorescence spectrometry (XRF) was seen as an excellent cost-effective alternative for thallium analysis in geological samples, down to 1 ppm. 6 refs. 1 tab., 1 fig.

  2. Catalytic properties of Thallium-containing mesoporous silicas

    Directory of Open Access Journals (Sweden)

    A. Baradji

    2017-02-01

    Full Text Available The benzylation of benzene by benzyl chloride over a series of Thallium-containing mesoporous silicas with different Tl contents has been investigated. These materials (Tl-HMS-n have been characterized by chemical analysis, N2 adsorption/desorption isotherm and X-ray diffraction (XRD. The mesoporous Thallium-containing materials showed both high activity and high selectivity for the benzylation of benzene. More interesting is the observation that these catalysts are always active and selective for large molecules like naphthenic compounds such as methoxynaphthalene.

  3. A comparison of the clinical relevance of thallium201 and ...

    African Journals Online (AJOL)

    Thallium-201 is at present the radiotracer of choice for the clinical evaluation of myocardial blood flow. Although different technetium-99m-isonitrile agents have been synthesised recently, only 99mTc-melhoxyisobutyl-isonitrile (99mTc_MIBI) has proved to hold promise for clinical implementation. The myocardial distribution ...

  4. Een bepalingsmethode voor thallium in regenwater met behulp van voltammetrie

    NARCIS (Netherlands)

    Struijs; J.; Wolfs; P.M.; Esseveld; F.G.van

    1985-01-01

    In dit rapport wordt een bepalingmethode beschreven voor thallium in het nanogram/liter-gebied, waarbij gebruik wordt gemaakt van differentiele pulse-anodic stripping voltammetry (DPASV) aan de dunne kwikfilm. Met deze techniek blijkt het mogelijk om de concentratie van dit element rechtstreeks

  5. IRIS Toxicological Review of Thallium and Compounds (External Review Draft)

    Science.gov (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certai...

  6. Band-Structure of Thallium by the LMTO Method

    DEFF Research Database (Denmark)

    Holtham, P. M.; Jan, J. P.; Skriver, Hans Lomholt

    1977-01-01

    The relativistic band structure of thallium has been calculated using the linear muffin-tin orbital (LMTO) method. The positions and extents of the bands were found to follow the Wigner-Seitz rule approximately, and the origin of the dispersion of the bands was established from the canonical s...

  7. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)

    A simple, rapid and selective complexometric method is proposed for the determination of thallium(III), using mercaptoethane(EtSH) as demasking agent. The sample solution containing Tl(III) is first complexed with excess EDTA and the surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using ...

  8. Selective Thallium (I Ion Sensor Based on Functionalised ZnO Nanorods

    Directory of Open Access Journals (Sweden)

    Z. H. Ibupoto

    2012-01-01

    Full Text Available Well controlled in length and highly aligned ZnO nanorods were grown on the gold-coated glass substrate by hydrothermal growth method. ZnO nanorods were functionalised with selective thallium (I ion ionophore dibenzyldiaza-18-crown-6 (DBzDA18C6. The thallium ion sensor showed wide linear potentiometric response to thallium (I ion concentrations ( M to  M with high sensitivity of 36.87 ± 1.49 mV/decade. Moreover, thallium (I ion demonstrated fast response time of less than 5 s, high selectivity, reproducibility, storage stability, and negligible response to common interferents. The proposed thallium (I ion-sensor electrode was also used as an indicator electrode in the potentiometric titration, and it has shown good stoichiometric response for the determination of thallium (I ion.

  9. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)

    NJD

    2005-10-08

    Oct 8, 2005 ... surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using xylenol orange as indicator. ... Reproducible and accurate results are obtained in the concentration range 4–80 mg of thallium with a relative error ≤ ±0.6% .... soluble and stable 1:1 complex with Tl(I) so formed.22 This was.

  10. Thallium in the hydrosphere of south west England

    Energy Technology Data Exchange (ETDEWEB)

    Law, Sin [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom); Turner, Andrew, E-mail: aturner@plymouth.ac.uk [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom)

    2011-12-15

    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L{sup -1}) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L{sup -1} were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration ({approx}1400 ng L{sup -1}) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. - Highlights: > Thallium concentrations have been measured in natural and waste waters from south west England. > Dissolved concentrations spanned three orders of magnitude and were highest in water from an abandoned mine. > Inputs associated with historical metal mine workings are the most important to the regional hydrosphere. - Concentrations of dissolved thallium in waters of south west England span two orders of magnitude and are greatest in water from an abandoned mine.

  11. Sodium dithionite as a selective demasking agent for the complexometric determination of thallium

    Directory of Open Access Journals (Sweden)

    PRAKASH SHETTY

    2005-11-01

    Full Text Available Sodium dithionite is proposed as a new demasking agent for the rapid and selective complexometric determination of thallium(III. In the presence of diverse metal ions, thallium (III was first complexed with excess EDTA and the surplus EDTAwas then titrated with a standard zinc sulphate solution at pH 5–6 (hexamine buffer using Xylenol Orange as the indicator. The EDTAequivalent to thallium was then released selectively with sodium dithionite and back titrated with a standard zinc sulphate solution as before. Reproducible and accurate results were obtained in the range 4–100 mg of thallium with a relative error of ±27 % and a coefficient of variation (n = 6 of not more than 0.30 %. The effects of various diverse ions were studied. The method was applied to the determination of thallium in its complexes and in alloys.

  12. [Efficiency of hemoperfusion on clearing thallium based on atomic absorption spectrometry].

    Science.gov (United States)

    Tian, Tian; Wang, Yongan; Nie, Zhiyong; Wang, Jiao; Peng, Xiaobo; Yuan, Ye; Li, Wanhua; Qiu, Zewu; Xue, Yanping; Xiong, Yiru

    2015-04-01

    To determine thallium in whole blood by atomic absorption detection method, and to investigate the eliminating effect of hemoperfusion (HP) for thallium in blood. The blood of Beagle dogs which had not exposed to thallium before were obtained for preparation of thallium nitrate ( TlNO3 )-containing solution in three concentrations according to the conversion formula based on animal weight and volume of blood. HP was performed in the simulated in vivo environment. The content of TlNO3 in blood of the next group was determined on the amount of TlNO3 for the last HP of the former dose group. Thallium quantity in different samples was measured with atomic absorption spectrometer blood samples before and after HP. Finally, the thallium concentration in blood was analyzed statistically. Thallium concentrations showed a good linear relationship in the range of 0-200 μg/L (r = 0.998 4). The intra-day precision (RSD) was lower than 4.913%, the intra-day recovery rate was 96.2%-111.9%; the inter-day precision (RSD) was lower than 7.502%, the inter-day recovery rate was 89.6%-105.2%. The concentration of thallium in blood was significantly reduced after HP per time in high, middle, and low dose groups [(453.43 ± 27.80) mg/L to (56.09 ± 14.44) mg/L in high dose group, F = 8.820, P = 0.003; (64.51 ± 13.60) mg/L to (3.19 ± 0.23) mg/L in middle dose group, F = 36.312, P = 0.000; (5.40 ± 0.98) mg/L to (0.38 ± 0.25) mg/L in low dose group, F = 46.240, P = 0.000 ]. The adsorption rate of four times of HP in high, middle and low dose group were (87.63 ± 2.48 )%, (95.06 ± 1.54 )% and (92.76 ± 4.87)%, respectively, without significant difference (F = 4.231, P = 0.070). The method for measuring thallium was established, and it shows a very stable, simple, sensitive for determination of thallium. HP can effectively remove thallium from blood. Thallium concentration can be reduced by 90% after four times of HP. HP is also effective even when thallium concentration is not high.

  13. Left ventricular dilatation and pulmonary thallium uptake after single-photon emission computer tomography using thallium-201 during adenosine-induced coronary hyperemia

    Energy Technology Data Exchange (ETDEWEB)

    Iskandrian, A.S.; Heo, J.; Nguyen, T.; Lyons, E.; Paugh, E. (Philadelphia Heart Institute, PA (USA))

    1990-10-01

    This study examined the implications of left ventricular (LV) dilatation and increased pulmonary thallium uptake during adenosine-induced coronary hyperemia. The lung-to-heart thallium ratio in the initial images was significantly higher in patients with coronary artery disease (CAD) than normal subjects; 0.48 +/- 0.16 in 3-vessel disease (n = 16), 0.43 +/- 0.10 in 2-vessel disease (n = 20), 0.43 +/- 0.08 in 1-vessel disease (n = 16) and 0.36 +/- 0.05 in normal subjects (n = 7) (p less than 0.001, 0.09 and 0.06, respectively). There was a significant correlation between the severity and the extent of the perfusion abnormality (determined from the polar maps) and the lung-to-heart thallium ratio (r = 0.51 and 0.52, respectively, p less than 0.0002). There was also a significant correlation between lung thallium washout and lung-to-heart thallium ratio (r = 0.42, p = 0.0009) and peak heart rate (r = -0.49, p less than 0.0001). The LV dilatation was mostly due to an increase in cavity dimension (30% increase) and to a lesser extent (6% increase) due to increase in LV size. (The cavity dimensions were measured from the short-axis slices at the midventricular level in the initial and delayed images). The dilation was seen in patients with CAD but not in the normal subjects. These changes correlated with the extent and severity of the thallium perfusion abnormality. Thus, adenosine-induced coronary hyperemia may cause LV dilation and increased lung thallium uptake on the basis of subendocardial ischemia.

  14. Early detection of restenosis after successful percutaneous transluminal coronary angioplasty by exercise-redistribution Thallium scintigraphy

    NARCIS (Netherlands)

    W. Wijns (William); P.W.J.C. Serruys (Patrick); J.H.C. Reiber (Johan); P.J. de Feyter (Pim); M.J.B.M. van den Brand (Marcel); M.L. Simoons (Maarten); P.G. Hugenholtz (Paul)

    1985-01-01

    textabstractThe value of exercise testing and thallium scintigraphy in predicting recurrence of angina pectoris and restenosis after a primary successful transluminal coronary angioplasty (PTCA) was prospectively evaluated. In 89 patients, a symptom-limited exercise electrocardiogram (ECG) and

  15. Oral zinc sulphate in treatment of patients with thallium poisoning: A clinical therapeutic trial

    Directory of Open Access Journals (Sweden)

    Ahmed A. Al-Mohammadi

    2011-06-01

    Full Text Available Thallium poisoning is usually associated with typical dermatological features simulating that of zinc deficiency. The aim of this study was to evaluate the role of oral zinc sulphate in the treatment of patients with thallium poisoning.Materials and methods: This clinical therapeutic trial study was conducted in Departments of Dermatology of Baghdad and Basrah Teaching Hospitals from February 2008 - February 2010, where a total of 37 patients with thallium poisoning were enrolled.A detailed history was taken from all patients and complete clinical examination was performed. All patients received zinc sulphate in a dose of 5 mg/kg three times a day few days before confirming the diagnosis of thallium poisoning. Thallium in urine had been measured using the colorimetric method and was positive in all patients. After confirming the diagnosis of thallium poisoning, thallium antidotes Prussian blue was given to 32 patients.Results: Age range of 37 patients was 5-33 (24±5.3 years. The dermatological findings were mainly: anagen hair loss affected the scalp and limbs. Also, dusky ecchymotic red dermatitis like rash was observed on the face and dorsum of hands and legs, while neurological manifestations were mainly of peripheral neuropathy, were reported in 21 (55% patients. All patients but two responded promptly to a trial of zinc sulphate within few days.Conclusion: Oral Zinc sulphate appears to be an effective and safe treatment for thallium poisoning particularly for skin and hair features and in reducing its lethal progression and complications. J Clin Exp Invest 2011;2(2:133-7

  16. Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices

    Science.gov (United States)

    2014-02-01

    THALLIUM(I) IN REVERSE OSMOSIS AND CHLORINATED WATER MATRICES ECBC-TR-1127 Approved for public release; distribution is unlimited...3. DATES COVERED (From - To) Apr 2010 - Dec 2011 4. TITLE AND SUBTITLE Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices... osmosis (RO) and RO water with added chlorine (RO-Cl) was measured using inductively coupled plasma optical emission spectroscopy (ICP-OES) for a period of

  17. Thallium in the hydrosphere of south west England.

    Science.gov (United States)

    Law, Sin; Turner, Andrew

    2011-12-01

    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L(-1)) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L(-1) were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration (~1400 ng L(-1)) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Qualitative evaluation of coronary flow during anesthetic induction using thallium-201 perfusion scans

    Energy Technology Data Exchange (ETDEWEB)

    Kleinman, B.; Henkin, R.E.; Glisson, S.N.; el-Etr, A.A.; Bakhos, M.; Sullivan, H.J.; Montoya, A.; Pifarre, R.

    1986-02-01

    Qualitative distribution of coronary flow using thallium-201 perfusion scans immediately postintubation was studied in 22 patients scheduled for elective coronary artery bypass surgery. Ten patients received a thiopental (4 mg/kg) and halothane induction. Twelve patients received a fentanyl (100 micrograms/kg) induction. Baseline thallium-201 perfusion scans were performed 24 h prior to surgery. These scans were compared with the scans performed postintubation. A thallium-positive scan was accepted as evidence of relative hypoperfusion. Baseline hemodynamic and ECG data were obtained prior to induction of anesthesia. These data were compared with the data obtained postintubation. Ten patients developed postintubation thallium-perfusion scan defects (thallium-positive scan), even though there was no statistical difference between their baseline hemodynamics and hemodynamics at the time of intubation. There was no difference in the incidence of thallium-positive scans between those patients anesthetized by fentanyl and those patients anesthetized with thiopental-halothane. The authors conclude that relative hypoperfusion, and possibly ischemia, occurred in 45% of patients studied, despite stable hemodynamics, and that the incidence of these events was the same with two different anesthetic techniques.

  19. Comparison of thallium deposition with segmental perfusion in pigs with chronic hibernating myocardium.

    Science.gov (United States)

    Baldwa, Sunil; Rana, Muzamil; Canty, John M; Fallavollita, James A

    2008-12-01

    Viable, chronically dysfunctional myocardium with reduced resting flow (or hibernating myocardium) is an important prognostic factor in ischemic heart disease. Although thallium-201 imaging is frequently used to assess myocardial viability in patients with ischemic cardiomyopathy, there are limited data regarding its deposition in hibernating myocardium, and this data suggest that thallium retention may be supernormal compared with control myocardium. Accordingly, pigs (n=7) were chronically instrumented with a 1.5 mm Delrin stenosis on the proximal left anterior descending coronary artery (LAD) to produce hibernating myocardium. Four months later, severe anteroapical hypokinesis was documented with contrast ventriculography (wall motion score, 0.7+/-0.8; normal=3), and microsphere measurements confirmed reduced resting flow (LAD subendocardium, 0.78+/-0.34 vs. 0.96+/-0.24 ml.min(-1).g(-1) in remote; P<0.001). Absolute deposition of thallium-201 and insulin-stimulated [18F]-2 fluoro-2-deoxyglucose (FDG) were assessed over 1 h and compared with resting flow (n=704 samples). Thallium-201 deposition was only weakly correlated with perfusion (r2=0.20; P<0.001) and was more homogeneously distributed (relative dispersion, 0.12+/-0.03 vs. 0.29+/-0.10 for microsphere flow; P<0.01). Thus after 1 h relative thallium-201 (subendocardium LAD/remote, 0.96+/-0.16) overestimated relative perfusion (0.78+/-0.32; P<0.0001) and underestimated the relative reduction in flow. Viability was confirmed by both histology and preserved FDG uptake. We conclude that under resting conditions, thallium-201 redistribution in hibernating myocardium is nearly complete within 1 h, with similar deposition to remote myocardium despite regional differences in flow. These data suggest that in this time frame thallium-201 deposition may not discriminate hibernating myocardium from dysfunction myocardium with normal resting flow. Since hibernating myocardium has been associated with a worse prognosis

  20. Thallium uptake and biological behaviour in childhood brain tumours

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, E.J.; Howman-Giles, R.; Kellie, S.; Uren, R.F. [Royal Alexandra Hospital for Children, Sydney, NSW (Australia)

    1998-03-01

    Full text: The histopathological grade and radiological appearance of the diverse cerebral neoplasms in childhood frequently poorly reflect their biological behaviour. We examined thallium accumulation prior to treatment (and in several cases, at intervals there after) in 13 children to determine its usefulness as a tumour marker. 23 SPECT studies were acquired 20 minutes after the injection of 1-3 mCi of {sup 201}TI. Thallium index (TI), the ratio of counts in tumour/normal brain, was calculated. No uptake was seen in two patients (pts) with a Grade 1 cerebellar astrocytomas (disease free at 4/12 f/u). Three pts with medulloblastomas were studied. One pt showed intense uptake (Tl =12). His tumour (proliferative antigen stain Ki67 = 50%) recurred early after debulking surgery (Tl +ve prior to CT or MRI changes). The second pt was imaged at relapse (Ki67 = 60%) and showed intense uptake, Tl = 17. The third pt showed lower level uptake (Tl = 2), Ki67 = 5%, and is disease-free at 5/12 (as per {sup 201}TI and MRI). One pt with a Grade 1 brainstem glioma showed Tl = 5 and has progressed rapidly despite low grade histology. Four pts with chiasmatic-hypothalamic gliomas have been studied. Although these neoplasms are usually low grade histologically, their growth properties vary greatly. Two pts with Tl<2.5 have been conservatively managed because of slow tumour growth. The other two pts have Tl>3.5 and have required aggressive treatment for rapid disease progression. One pt with a large pilocytic astrocytoma of the optic chiasm showed Tl = 9.5. Active treatment was not undertaken. One pt with a pineal germ cell tumour showed avid {sup 201}TI uptake (Tl not performed) and has had two normal studies, and is clinically well, since BMT. Avid {sup 201}TI uptake also seen in one pt with cerebral neuroblastoma. (Died at 8/12 after Dx.) Thus, {sup 201}TI accumulates in histologically diverse paediatric neoplasms. The Tl appears to reflect biological behaviour in the limited

  1. Evaluation of muscular lesions in connective tissue diseases: thallium 201 muscular scans

    Energy Technology Data Exchange (ETDEWEB)

    Guillet, G.; Guillet, J.; Sanciaume, C.; Maleville, J.; Geniaux, M.; Morin, P.

    1988-04-01

    We performed thallium 201 muscle scans to assess muscular involvement in 40 patients with different connective tissue diseases (7 with dermatomyositis, 7 with systemic lupus erythematosus, 12 with progressive systemic scleroderma, 2 with calcinosis, Raynaud's phenomenon, esophageal involvement, sclerodactyly, and telangiectasia (CREST) syndrome, 3 with monomelic scleroderma, 6 with morphea, and 3 with Raynaud's disease). Only 12 of these patients complained of fatigability and/or myalgia. Electromyography was performed and serum levels of muscle enzymes were measured in all patients. Comparison of thallium 201 exercise recording with the other tests revealed that scan sensitivity is greater than electromyographic and serum muscle enzymes levels. Thallium 201 scans showed abnormal findings in 32 patients and revealed subclinical lesions in 18 patients, while electromyography findings were abnormal in 25 of these 32 patients. Serum enzyme levels were raised in only 8 patients. Thallium 201 scanning proved to be a useful guide for modifying therapy when laboratory data were conflicting. It was useful to evaluate treatment efficacy. Because our data indicate a 100% positive predictive value, we believe that thallium 201 scanning should be advised for severe systemic connective tissue diseases with discordant test results.

  2. Exercise-induced thallium-201 myocardial perfusion defects in angina pectoris without significant coronary artery stenosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakazato, Masayasu; Maruoka, Yuji; Sunagawa, Osahiko; Kinjo, Kunihiko; Tomori, Masayuki; Fukiyama, Koshiro (Ryukyu Univ., Nishihara, Okinawa (Japan). School of Medicine)

    1990-01-01

    We performed exercise thallium-201 myocardial scintigraphy in 32 patients with angina pectoris to study the incidence of perfusion defects, who had no significant organic stenosis on coronary angiography. None of them had myocardial infarction or cardiomyopathy. Thallium-201 myocardial scintigraphy and 12-lead ECG recording were performed during supine bicycle ergometer exercise. Perfusion defects in thallium-201 scintigrams in SPECT images were assessed during visual analysis by two observers. In the coronary angiograms obtained during intravenous infusion of nitroglycerin, the luminal diameter of 75% stenosis or less in the AHA classification was regarded as an insignificant organic stenosis. Myocardial perfusion defects in the thallium-201 scintigrams were detected in eight (25%) of the 32 patients. Six of these eight patients had variant angina documented during spontaneous attacks with ST elevations in standard 12-lead ECGs. Perfusion defects were demonstrated at the inferior or infero-posterior regions in six patients, one of whom had concomitant anteroseptal defect. The defects were not always accompanied by chest pain. All but one patient demonstrating inferior or inferoposterior defects showed ST depression in leads II, III and aV{sub F} on their ECGs, corresponding to inferior wall ischemia. The exception was a case with right bundle branch block. Thus, 25% of the patients with angina pectoris, who had no evidence of significant organic stenosis on their coronary angiograms, exhibited exercise-induced perfusion defects in their thallium-201 scintigrams. Coronary spasms might have caused myocardial ischemia in these patients. (author).

  3. 40 CFR 243.204 - Collection management.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Collection management. 243.204 Section 243.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES... and Recommended Procedures § 243.204 Collection management. ...

  4. 22 CFR 204.43 - Governing law.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Governing law. 204.43 Section 204.43 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT HOUSING GUARANTY STANDARD TERMS AND CONDITIONS Administration § 204.43 Governing law. This Guaranty shall be governed by and construed in accordance with the laws of...

  5. 40 CFR 240.204 - Water quality.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Water quality. 240.204 Section 240.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.204 Water quality. ...

  6. 22 CFR 204.41 - Arbitration.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Arbitration. 204.41 Section 204.41 Foreign... § 204.41 Arbitration. Any controversy or claim between A.I.D. and the Lender or any Assignee arising out of this Guaranty shall be settled by arbitration to be held in Washington, DC in accordance with the...

  7. 14 CFR 302.204 - Responsive documents.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Responsive documents. 302.204 Section 302.204 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF TRANSPORTATION (AVIATION PROCEEDINGS... Foreign Air Carrier Permit Licensing Proceedings § 302.204 Responsive documents. (a) Any person may file...

  8. 9 CFR 204.2 - Organization.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Organization. 204.2 Section 204.2... STOCKYARDS PROGRAMS), DEPARTMENT OF AGRICULTURE ORGANIZATION AND FUNCTIONS Public Information § 204.2 Organization. (a) The Grain Inspection, Packers and Stockyards Administration (Packers and Stockyards Programs...

  9. 27 CFR 31.204 - Mixed cocktails.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Mixed cocktails. 31.204 Section 31.204 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS ALCOHOL BEVERAGE DEALERS Reuse and Possession of Used Liquor Bottles § 31.204...

  10. 19 CFR 204.5 - Reports.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Reports. 204.5 Section 204.5 Customs Duties UNITED... ON AGRICULTURAL PROGRAMS § 204.5 Reports. After completion of its investigation, the Commission will transmit to the President a report of the results thereof, including its findings and recommendations based...

  11. 7 CFR 1416.204 - Application process.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Application process. 1416.204 Section 1416.204 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT... PROGRAMS Livestock Indemnity Program II § 1416.204 Application process. (a) Applicants must submit to CCC a...

  12. 40 CFR 204.57-4 - Testing.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Testing. 204.57-4 Section 204.57-4... STANDARDS FOR CONSTRUCTION EQUIPMENT Portable Air Compressors § 204.57-4 Testing. (a) The manufacturer shall... selected for testing pursuant to this subpart. (b) No maintenance will be performed on test compressors...

  13. 12 CFR 204.121 - Bankers' banks.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Bankers' banks. 204.121 Section 204.121 Banks... REQUIREMENTS OF DEPOSITORY INSTITUTIONS (REGULATION D) Interpretations § 204.121 Bankers' banks. (a)(1) The...' banks. (2) In its application of these requirements to specific institutions, the Board will use the...

  14. 48 CFR 243.204 - Administration.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Administration. 243.204... OF DEFENSE CONTRACT MANAGEMENT CONTRACT MODIFICATIONS Change Orders 243.204 Administration. Follow the procedures at PGI 243.204 for administration of change orders. ...

  15. 31 CFR 800.204 - Control.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Control. 800.204 Section 800.204... FOREIGN PERSONS Definitions § 800.204 Control. (a) The term control means the power, direct or indirect... in paragraphs (a)(1) through (9) of this section. (b) In examining questions of control in situations...

  16. 5 CFR 845.204 - Processing.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Processing. 845.204 Section 845.204 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE REGULATIONS (CONTINUED) FEDERAL EMPLOYEES RETIREMENT SYSTEM-DEBT COLLECTION Collection of Overpayment Debts § 845.204 Processing. (a) Notice...

  17. 40 CFR 204.55 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirements. 204.55 Section 204.55 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS NOISE EMISSION STANDARDS FOR CONSTRUCTION EQUIPMENT Portable Air Compressors § 204.55 Requirements. ...

  18. 40 CFR 204.55-2 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirements. 204.55-2 Section 204.55... NOISE EMISSION STANDARDS FOR CONSTRUCTION EQUIPMENT Portable Air Compressors § 204.55-2 Requirements. (a... requirements for purposes of testing by the Administrator and Selective Enforcement Auditing consist of: (1...

  19. 48 CFR 811.204 - Contract clause.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Contract clause. 811.204 Section 811.204 Federal Acquisition Regulations System DEPARTMENT OF VETERANS AFFAIRS COMPETITION AND ACQUISITION PLANNING DESCRIBING AGENCY NEEDS Using and Maintaining Requirements Documents 811.204 Contract...

  20. 42 CFR 93.204 - Contract.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Contract. 93.204 Section 93.204 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH ASSESSMENTS AND HEALTH EFFECTS... MISCONDUCT Definitions § 93.204 Contract. Contract means an acquisition instrument awarded under the HHS...

  1. 47 CFR 1.204 - Pleadings; definition.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Pleadings; definition. 1.204 Section 1.204....204 Pleadings; definition. As used in this subpart, the term pleading means any written notice, motion... paper filed with the Commission in a hearing proceeding. It does not include exhibits or documents...

  2. 32 CFR 204.4 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 204.4 Section 204.4 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS USER FEES § 204.4 Responsibilities. (a) The USD(C) shall develop and monitor policies governing user...

  3. Advanced crystal growth techniques for thallium bromide semiconductor radiation detectors

    Science.gov (United States)

    Datta, Amlan; Becla, Piotr; Guguschev, Christo; Motakef, Shariar

    2018-02-01

    Thallium Bromide (TlBr) is a promising room-temperature radiation detector candidate with excellent charge transport properties. Currently, Travelling Molten Zone (TMZ) technique is widely used for growth of semiconductor-grade TlBr crystals. However, there are several challenges associated with this type of crystal growth process including lower yield, high thermal stress, and low crystal uniformity. To overcome these shortcomings of the current technique, several different crystal growth techniques have been implemented in this study. These include: Vertical Bridgman (VB), Physical Vapor Transport (PVT), Edge-defined Film-fed Growth (EFG), and Czochralski Growth (Cz). Techniques based on melt pulling (EFG and Cz) were demonstrated for the first time for semiconductor grade TlBr material. The viability of each process along with the associated challenges for TlBr growth has been discussed. The purity of the TlBr crystals along with its crystalline and electronic properties were analyzed and correlated with the growth techniques. Uncorrected 662 keV energy resolutions around 2% were obtained from 5 mm x 5 mm x 10 mm TlBr devices with virtual Frisch-grid configuration.

  4. Thallium distribution in sediments from the Pearl river basin, China

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juan [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Jin; Chen, Yongheng [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Qi, Jianying [Department of Environmental Science and Engineering, Guangzhou University, Guangzhou (China); Lippold, Holger [Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Chunlin [Guangdong Provincial Academy of Environmental Science, Guangzhou (China)

    2010-10-15

    Thallium (Tl) is a rare element of high toxicity. Sediments sampled in three representative locations near industries utilizing Tl-containing raw materials from the Pearl River Basin, China were analyzed for their total Tl contents and the Tl contents in four sequentially extracted fractions (i.e., weak acid exchangeable, reducible, oxidizable, and residual fraction). The results reveal that the total Tl contents (1.25-19.1 {mu}g/g) in the studied sediments were slightly high to quite high compared with those in the Chinese background sediments. This indicates the apparent Tl contamination of the investigated sediments. However, with respect to the chemical fractions, Tl is mainly associated with the residual fraction (>60%) of the sediments, especially of those from the mining area of Tl-bearing pyrite minerals, indicating the relatively low mobility, and low bioavailability of Tl in these sediments. This obviously contrasts with the previous findings that Tl is mainly entrapped in the first three labile fractions of the contaminated samples. Possible reasons were given for the dominating association of Tl with the residual fraction (>95%) of the mining area sediments. The significant role of certain K-containing silicates or minerals of these sediments on retaining Tl in the residual fraction, discovered by this study, provides a special field of research opportunity for the Tl-containing wastewater treatment. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  5. [Graphite furnace atomic absorption spectrometry for determination of thallium in blood].

    Science.gov (United States)

    Zhang, Q L; Gao, G

    2016-04-20

    Colloidal palladium was used as chemical modifier in the determination of blood thallium by graphite furnace atomic absorption spectrometry. Blood samples were precipitated with 5% (V/V)nitric acid, and then determined by GFAAS with colloidal palladium used as a chemical modifier. 0.2% (W/V)sodium chloride was added in the standard series to improve the matrix matching between standard solution and sample. The detection limit was 0.2 μg/L. The correlation coefficient was 0.9991. The recoveries were between 93.9% to 101.5%.The relative standard deviations were between 1.8% to 2.7%.The certified reference material of whole blood thallium was determined and the result was within the reference range Conclusion: The method is accurate, simple and sensitive, and it can meet the needs of detection thallium in blood entirely.

  6. Myocardial perfusion defect on thallium-201 imaging in patients with chronic obstructive pulmonary disease

    Energy Technology Data Exchange (ETDEWEB)

    Mehrotra, P.P.; Weaver, Y.J.; Higginbotham, E.A.

    1983-08-01

    Six patients with angina pectoris had reversible perfusion defects on stress and redistribution thallium imaging. Three patients had a positive electrocardiographic response to exercise. No significant coronary artery lesions were seen on coronary arteriography in any of the six patients. All had mild to moderate hypoxemia at rest and physiologic evidence of chronic obstructive pulmonary disease as defined by the decrease in the ratio of forced expiratory volume at 1 second to forced vital capacity (FEV1/FVC X 100) or decrease in the forced midexpiratory flow rate (FEF25-75), or both. None had clinical findings suggestive of any of the reported causes of positive thallium scans in patients with normal coronary arteriograms. Cellular dysfunction produced by hypoxemia affecting the uptake of thallium seems to be the most likely mechanism of this abnormality.

  7. Early and delayed thallium-201 scintigraphy in thyroid nodules: the relationship between early thallium-201 uptake and perfusion

    Energy Technology Data Exchange (ETDEWEB)

    Derebek, E. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Biberoglu, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Kut, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yesil, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Saydam, S. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yilmaz, M. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yenici, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Igci, E. [Dept. of Radiology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Gokce, O. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Canda, S. [Dept. of Pathology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Bueyuekgebiz, A. [Dept. of Pediatrics, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Dogan, A.S. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Durak, H. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey)

    1996-05-01

    Seventy-six patients with tyroid nodules were studied. Initially, 75 MBq of thallium-201 was injected. The thyroid gland was imaged 15 min (early) and 3 h (delayed) after the injection. Thereafter, 185 MBq technetium-99m pertechnetate was injected. Immediately after the injection, a 1-min perfusion image was acquired, followed by an image at 20 min. Increased early and delayed {sup 201}Tl uptake compared with the contralateral thyroid tissue was adopted as the criterion for malignancy. Sensitivity, specificity and negative predictive values were found to be 85%, 64% and 78%, respectively, in operated patients, but these values were 86%, 87% and 95%, respectively, in the whole group, including patients followed with fine-needle aspiration biopsy. With the purpose of investigating the relationship between perfusion and early {sup 201}Tl uptake, bot perfusion and early images were graded comparing nodular activity with contralateral thyroid activity. There was a poor correlation between perfusion and {sup 201}Tl uptake. The correlation was even worse in hyperactive nodules. It is concluded that early and delayed {sup 201}Tl imaging should not be used in the differential diagnosis of cold nodules and that early {sup 201}Tl uptake seems to be more closely related to factors other than perfusion. (orig.)

  8. Overlapping toxic effect of long term thallium exposure on white mustard (Sinapis alba L.) photosynthetic activity.

    Science.gov (United States)

    Mazur, Radosław; Sadowska, Monika; Kowalewska, Łucja; Abratowska, Agnieszka; Kalaji, Hazem M; Mostowska, Agnieszka; Garstka, Maciej; Krasnodębska-Ostręga, Beata

    2016-09-02

    Heavy metal exposure affect plant productivity by interfering, directly and indirectly, with photosynthetic reactions. The toxic effect of heavy metals on photosynthetic reactions has been reported in wide-ranging studies, however there is paucity of data in the literature concerning thallium (Tl) toxicity. Thallium is ubiquitous natural trace element and is considered the most toxic of heavy metals; however, some plant species, such as white mustard (Sinapis alba L.) are able to accumulate thallium at very high concentrations. In this study we identified the main sites of the photosynthetic process inhibited either directly or indirectly by thallium, and elucidated possible detoxification mechanisms in S. alba. We studied the toxicity of thallium in white mustard (S. alba) growing plants and demonstrated that tolerance of plants to thallium (the root test) decreased with the increasing Tl(I) ions concentration in culture media. The root growth of plants exposed to Tl at 100 μg L(-1) for 4 weeks was similar to that in control plants, while in plants grown with Tl at 1,000 μg L(-1) root growth was strongly inhibited. In leaves, toxic effect became gradually visible in response to increasing concentration of Tl (100 - 1,000 μg L(-1)) with discoloration spreading around main vascular bundles of the leaf blade; whereas leaf margins remained green. Subsequent structural analyses using chlorophyll fluorescence, microscopy, and pigment and protein analysis have revealed different effects of varying Tl concentrations on leaf tissue. At lower concentration partial rearrangement of the photosynthetic complexes was observed without significant changes in the chloroplast structure and the pigment and protein levels. At higher concentrations, the decrease of PSI and PSII quantum yields and massive oxidation of pigments was observed in discolored leaf areas, which contained high amount of Tl. Substantial decline of the photosystem core proteins and disorder of the

  9. Stable room-temperature thallium bromide semiconductor radiation detectors

    Science.gov (United States)

    Datta, A.; Fiala, J.; Becla, P.; Motakef, Shariar

    2017-10-01

    Thallium bromide (TlBr) is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br- species, with an estimated electro-diffusion velocity of 10-8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br- ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation) for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  10. Thallium pollution in China: A geo-environmental perspective.

    Science.gov (United States)

    Xiao, Tangfu; Yang, Fei; Li, Shehong; Zheng, Baoshan; Ning, Zengping

    2012-04-01

    It is well known that thallium (Tl) is a non-essential and toxic metal to human health, but less is known about the geo-environmentally-induced Tl pollution and its associated health impacts. High concentrations of Tl that are primarily associated with the epithermal metallogenesis of sulfide minerals have the potential of producing Tl pollution in the environment, which has been recognized as an emerging pollutant in China. This paper aims to review the research progress in China on Tl pollution in terms of the source, mobility, transportation pathway, and health exposure of Tl and to address the environmental concerns on Tl pollution in a geo-environmental perspective. Tl associated with the epithermal metallogenesis of sulfide minerals has been documented to disperse readily and accumulate through the geo-environmental processes of soil enrichment, water transportation and food crop growth beyond a mineralized zone. The enrichments of Tl in local soil, water, and crops may result in Tl pollution and consequent adverse health effects, e.g. chronic Tl poisoning. Investigation of the baseline Tl in the geo-environment, proper land use and health-related environmental planning and regulation are critical to prevent the Tl pollution. Examination of the human urinary Tl concentration is a quick approach to identify exposure of Tl pollution to humans. The experiences of Tl pollution in China can provide important lessons for many other regions in the world with similar geo-environmental contexts because of the high mobility and toxicity of Tl. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Stable room-temperature thallium bromide semiconductor radiation detectors

    Directory of Open Access Journals (Sweden)

    A. Datta

    2017-10-01

    Full Text Available Thallium bromide (TlBr is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br− species, with an estimated electro-diffusion velocity of 10−8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br− ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  12. Medical geology of arsenic, selenium and thallium in China.

    Science.gov (United States)

    Li, Shehong; Xiao, Tangfu; Zheng, Baoshan

    2012-04-01

    Arsenic (As), selenium (Se) and thallium (Tl) are three trace metals (metalloids) of high concern in China because deficiency or excess expose can cause a range of endemic diseases, such as endemic arsenism, selenosis, Keshan disease (KD), Kashin-Beck disease (KBD) and thallotoxicosis. These specific endemic diseases were attributable for overabundance or deficiency (mainly referring to selenium) of these three elements in the local environment as a result of natural geochemical processes and/or anthropologic activities. The geochemistry and human health impacts of these three trace elements have been intensively studied since the 1970s in China, in terms of geochemical sources, distribution, transportation, health impact pathways, and prevention/remediation measures. Endemic arsenism in China are induced from the exposures of high As in either drinking water or domestic combustion of As-rich coals. Both endemic selenium deficiency and selenosis occurred in China. The KD and KBD were related to the deficiency of Se in the low-Se geological belt with Se contents in soil less than 0.125mg/kg stretching from northeast to southwest of China. Endemic selenosis occurred in areas with high Se concentrations in soils derived from the Se-enriched black carbonaceous siliceous rocks, carbonaceous shale and slate. Endemic Tl poisoning occurred in southwestern China due to Tl contamination in local drinking water and vegetables surrounding the Tl-rich sulfide mineralized areas. Some measures have been taken to control and remedy the endemic diseases with significant effects in reducing health risk and damage of As, Se and Tl. However, the states of the endemic diseases of As, Se and Tl in China are still serious in some areas, and substantial research efforts regarding the health impacts of these elements are further required. This paper reviews the progress of medical geology of As, Se and Tl in China, and provides with some outlooks for future research directions. Copyright

  13. Yield and excitation function measurements of some nuclear reactions on natural thallium induced by protons leading to the production of medical radioisotopes {sup 201}Tl and {sup 203}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Al-Saleh, F.S.; Al-Harbi, A.A. [Girls College of Education, Riyadh (Saudi Arabia). Physics Dept.; Azzam, A. [Nuclear Research Center, Cairo (Egypt). Nuclear Physics Dept.

    2007-07-01

    Excitation functions for {sup 201}Pb, {sup 202m}Pb, {sup 203}Pb and {sup 204m}Pb radionuclides which are formed via proton induced reactions with natural thallium target have been measured from their respective threshold (E{sub thr}) to 27.5 MeV using activation technique. Natural copper foils were used to monitor the cyclotron beam. The integral yields (MBq/{mu}A h) of the produced radionuclides were calculated from the measured excitation functions. The optimum proton energy range for the production of {sup 203}Pb with low amount of impurities is (16-10 MeV) after 5 h of EOB. The experimental cross-sections for {sup nat}Tl(p,xn) reactions were compared with the cross-sections recommended by the IAEA and with earlier published data when it was possible. (orig.)

  14. Dicty_cDB: SHK204 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHK204 (Link to dictyBase) - - - - SHK204P (Link to Original site) SHK204F 617 SHK204Z...(Link to library) Clone ID SHK204 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig...Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SH/SHK2-A/SHK204Q.Seq.d/ Representative...Representative seq. ID SHK204P (Link to Original site) Representative DNA sequence >SHK204 (SHK204Q) /CSM/SH/SHK2-A/SHK204Q...ACTGTTGGCCTACTGGNATTGACCCGCAATTAGTAATTAGTAAAGNAATGAAATTAAAAC ATTTAACTATTTTTTTATTTATTTTTATTTATAGGTTTTTATTTGTTAAATCGGATTGTT

  15. New CZT cardiac cameras and myocardial perfusion imaging with thallium 201; Nouvelles cameras cardiaques a semi-conducteur cadmium -zinc- telluride (CZT) et scintigraphies myocardiques au thallium 201

    Energy Technology Data Exchange (ETDEWEB)

    Songy, B. [Service de medecine et imagerie nucleaire, centre cardiologique du Nord (CCN), 93 - Saint-Denis (France)

    2010-08-15

    Myocardial perfusion imaging is widely used for management of coronary artery disease. However, it suffers from technical limitations. New cardiac cameras using CZT detectors are now available and increase spatial (x2) and energy (x2) resolutions and photons sensitivity (x5). We describe here the General Electric Discovery NM 530c new camera and summarize the validation studies with technetium agents and with thallium 201, protocols to reduce doses, ultrafast protocols and perspectives offered with this new technology. (author)

  16. Genotoxic and mutagenic effects of the diagnostic use of thallium-201 in nuclear medicine

    Energy Technology Data Exchange (ETDEWEB)

    Kelsey, K.T. (Harvard School of Public Health, Boston, MA (United States)); Donohoe, K.J. (Beth Israel Hospital, Boston, MA (United States). Div. of Nuclear Medicine); Baxter, Barbara; Memisoglu, Asli; Little, J.B.; Caggana, Michele; Liber, H.L. (Harvard School of Public Health, Boston, MA (United States))

    1991-07-01

    In order to investigate possible mutagenetic effects of in vivo exposure to low levels of ionizing radiation used in nuclear medicine, the authors examined hypoxanthine guanine phosphoribosyl transferase (hprt) mutant fraction (MF) and chromosome aberration (CA) frequency in 24 nuclear medicine patients before and after injection of thallium-201. The mean MF of the thallium-201-exposed cohort was 5.2{+-}4.4 x 10{sup -6} before injection exposure. No significant difference in MF was observed 24 h later. In 11 patients who were studied on a 3rd occasion, 30 days after thallium-201 exposure, there was again no significant difference in post-exposure as compared with the pre-exposure MF. The frequency of CA in peripheral blood lymphocytes was not significantly different, comparing pre- and 24h to 1 month post-radionuclide exposure . Thus, thallium-201 exposure was not associated with significant elevations in MF or CA frequency in lymphocytes of exposed individuals. (author). 40 refs.; 3 tabs.

  17. Systematics of c-axis Phonons in the Thallium- and Bismuth-Based Cuprate Superconductors

    NARCIS (Netherlands)

    Tsvetkov, A. A; Dulic, D.; Marel, D. van der; Damascelli, A.; Kaljushnaia, G. A.; Gorina, J. I.; Senturina, N. N.; Kolesnikov, N. N.; Ren, Z. F.; Wang, J. H.; Menovsky, A. A.; Palstra, T. T. M.

    2006-01-01

    Published in: Phys. Rev. B 60 (1999) 13196 Citing articles (CrossRef) citations recorded in [Science Citation Index] Abstract: We present grazing incidence reflectivity measurements in the far infrared region at temperatures above and below Tc for a series of thallium (Tl2Ba2CuO6, Tl2Ba2CaCu2O8) and

  18. Dipyridamole-thallium-201 tomography documenting improved myocardial perfusion with therapy in Kawasaki disease

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Spielmann, R.P.; Hausdorf, G.

    1988-12-01

    Thallium-201 tomographic perfusion studies after pharmacologic vasodilation were performed in seven children (aged 2 years 8 months to 8 years 7 months), 3 to 20 months after the acute stage of the disease. In all patients coronary aneurysms were seen on cross-sectional echocardiograms. The scintigrams of six children showed no significant regional reduction of myocardial thallium-201 uptake. These children had remained asymptomatic in the follow-up period after the acute inflammatory stage of Kawasaki disease. Persistent and transient thallium defects were present in one child with acute posterolateral myocardial infarction; obstruction of two coronary vessels supplying the defect zones was confirmed by contrast angiography. After 8 months of treatment a follow-up nuclear scan showed marked reduction in the size of the defect and almost complete abolishment of the ischemic reaction. Thus tomographic thallium-201 perfusion scintigraphy in conjunction with vasodilation stress is useful to assess myocardial perfusion in children with Kawasaki disease and demonstrates marked improvement in regional perfusion after adequate medical therapy.

  19. Complexometric determination of thallium(III using ethanethiol as a selective masking agent

    Directory of Open Access Journals (Sweden)

    Karthikeyan J.

    2006-01-01

    Full Text Available A simple and selective complexometric method for the determination of thallium in presence of other metal ions is proposed based on the selective masking ability of ethanethiol towards thallium(III. Thallium present in a given sample solution is first complexed with a known excess of EDTA and the surplus EDTA is titrated with standard zinc sulphate solution at pH 5-6(hexamine using xylenol orange as the indicator. A 0.3% aqueous solution of ethanethiol is then added to displace EDTA from the Tl(III-EDTA complex. The released EDTA is titrated with standard zinc sulphate solution as before. Reproducible and accurate results are obtained for 3.70 mg to 74.07 mg of Tl (III with relative error less than ? 0.44% and coefficient of variation not more than 0.27%. The interference of various ions was studied and the method was used for the analysis of thallium in its synthetic alloy mixtures and also in complexes.

  20. Thallium-201: Autoradiography in pigmented mice and melanin-binding in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Tjaelve, H.; Nilsson, M.; Larsson, B. (Uppsala Univ. (Sweden))

    1982-01-01

    Autoradiography with /sup 201/Tl/sup +/ in C57Bl mice showed a strong labelling of the eye melanin and of pigmented hair follicles. An analysis of the affinity of thallium for pigment from cow eyes indicated a binding to three groups of sites and showed a marked sensitivity to the addition of H/sup +/-ions. The results are consistent with the conception that a binding of thallium occurs to the free carboxyl groups of the melanin and that the structure of the polymer has a marked influence on the affinity. Similar results have previously been obtained with other cations. There was no indication that the strong in vivo affinity of thallium to melanin is due to a more firm binding than for other cations which do not localize on melanin in vivo. Instead, the ability of cations to pass the melanocyte membranes and reach the melanin granules is probably decisive for whether a melanin-binding will take place in vivo. Toxic effects on the eye and epilation are symptoms of thallium intoxication which may be related to its melanin-binding. The fate of /sup 201/Tl/sup +/ in some other tissues is also described and discussed.

  1. Laser-assisted decay and optical spectroscopy studies of neutron-deficient thallium isotopes

    CERN Document Server

    Van Beveren, Céline; Huyse, Mark

    The neutron-deficient thallium isotopes with one proton less than the Z = 82 shell closure, are situated in an interesting region of the nuclear chart, notorious for intruder states and shape coexistence. Shape coexistence is the remarkable phenomenon in which two or more distinct types of deformation occur at low energy in the same atomic nucleus. Shape coexistence has been studied intensively, experimentally as well as theoretically in different nuclei in the light-lead region and the isomerism in the thallium isotopes was among the first indications of this phenomenon. Different shapes, whose structure has been linked to specific proton orbitals above and below the Z = 82 shell closure, are present at low energy in the neutron-deficient odd-mass thallium nuclei. In the odd-odd nuclei, the coupling of an unpaired proton and unpaired neutron gives rise to multiplets of low-lying states from which some can be isomeric. Since thallium has one proton missing in the major proton shell, and when approaching neutr...

  2. Clinical features and applications of thallium-201. With reference to scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tadashige

    1988-12-01

    Thallium-201 is not only used widely in myocardial imaging but also has a great potential in other various nuclear medicine imaging studies. This paper presents clinical features and applications of thallium-201, focusing on clinical trials with thallium-201 at the Shinshu University School of Medicine. Thallium-201 myocardial scintigraphy offers information on (1) ventricular position and morphology, (2) hypertrophy or dilatation of the left ventricle, (3) hypertrophy or dilatation of the right ventricle, (4) site and extent of myocardial ischemia and infarct, (5) myocardial blood flow, (6) pulmonary congestion or interstitial pulmonary edema, and (7) pericardial effusion. It can be used in the following evaluation or diagnosis: (1) acute or old myocardial infarction, (2) angina pectoris, (3) treatment strategy or prognosis of ischemic heart disease, (4) treatment strategy or observation of bypass graft or drug therapy, (5) hypertrophic or dilated idiopathic cardiomyopathy, (6) myocardial lesions induced by sarcoidosis, collagen disease, and neuro-muscular disease, (7) ventricular hypertrophy and pulmonary edema, and (9) pericarditis, pericardial effusion, and systolic pericarditis associated with underlying disease. The significance of tumor, liver, bone marrow scintigraphies is also referred to. (Namekawa, K) 69 refs.

  3. Optimised thallium precipitation in a waste water treatment system of the flue gas desulphurisation; Optimierte Thalliumabscheidung einer RAA

    Energy Technology Data Exchange (ETDEWEB)

    Ritzerfeld, Guenter [RWE Power AG, Bergheim (Germany); Birngruber, Ingolf [RWE Power AG, Hamm (Germany); Muelder, Thomas [RWE Power AG, Ibbenbueren (Germany)

    2011-07-01

    When co-combusting substitute fuels in power plants, the element Thallium should be checked in the drain of the waste water treatment system of flue gas desulphurisation. In 2005 Thallium-concentrations exceeding the limit value were determined for the first time as a consequence of the modified analysis of the supervisory authority. The previous lower Thallium concentrations with graphite tube-atomic absorption spectrometry were caused by the high chloride concentration in RAA waste water. The RAA operating mode was checked and changed. Equipment-related weak spots were detected and corrected. (orig.)

  4. Comparison of Polythionates as Precursors for the Formation of Thallium Sulfide Layers

    Directory of Open Access Journals (Sweden)

    Vitalijus JANICKIS

    2011-11-01

    Full Text Available The processes of obtaining layers of thallium, sulfides, TlxSy, by the sorption-diffusion method on polyamide 6 using solutions of lower polythionates - sodium trithionate and tetrathionate, Na2S3O6, Na2S4O6, potassium pentathionate, K2S5O6, and of dodecathionic acid, H2S12O6, as precursors of sulfur are compared. The concentration of sorbed sulfur increases with increasing the duration of treatment, the concentration and temperature of precursor solution. It rather significantly also depends on the nature - sulfurity of polythionate, i. e. on the number of sulfur atoms in the polythionate anion: effectiveness of sulfurization using solutions of dodecathionic acid is significantly higher than that of lower polythionates. Thallium sulfide layers are formed on the surface of polyamide after the treatment of sulfurized polymer with Tl(I salt solution. The concentration of thallium in the layer increases with the increase of initial sulfurization duration and in case of H2S12O6 solution used - on the temperature of this process. The results of X-ray diffraction analysis confirmed the formation of thallium sulfide layers in the surface of polyamide 6. The phase composition of layer changes depending on the conditions of initial treatment in a H2S12O6 solution. Five thallium sulfide phases, two forms of TlS, Tl2S2, Tl4S3 and Tl2S5 were identified in the composition of the layers treated for different time with a solution of dodecathionic acid at the temperature of 20 °C and 30 °C and then with Tl(I salt solution by X-ray diffraction but the maxima of TlS and Tl2S5 phases predominate in the diffractograms.http://dx.doi.org/10.5755/j01.ms.17.4.774

  5. Dicty_cDB: VFB204 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available (Link to library) VFB204 (Link to dictyBase) - G22101 DDB0186614 Contig-U02050-1 VFB204P (Link to Original...Original site) VFB204F 594 VFB204Z 248 VFB204P 842 - - Show VFB204 Library VF (Link to library) Clone ID VFB204...VFB204 (Link to dictyBase) Atlas ID - NBRP ID G22101 dictyBase ID DDB0186614 Link to Contig Contig-U02050-1...Contig-U02050-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VF/VFB2-A/VFB204Q.Seq.d/ Representative...Representative seq. ID VFB204P (Link to Original site) Representative DNA sequence >VFB204 (VFB204Q) /CSM/VF/VFB2-A/VFB204Q

  6. Dicty_cDB: CHR204 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR204 (Link to dictyBase) - - - Contig-U16471-1 CHR204P (Link to Original site) CHR...204F 167 CHR204Z 819 CHR204P 966 - - Show CHR204 Library CH (Link to library) Clone ID CHR... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR2-A/CHR204Q.Seq.d/ Representative seq. ID CHR...204P (Link to Original site) Representative DNA sequence >CHR204 (CHR204Q) /CSM/CH/CHR2-A/CHR2... significant alignments: (bits) Value CHR204 (CHR204Q) /CSM/CH/CHR2-A/CHR204Q.Seq

  7. Thermodynamic Study of Tl6SBr4 Compound and Some Regularities in Thermodynamic Properties of Thallium Chalcohalides

    Directory of Open Access Journals (Sweden)

    Dunya Mahammad Babanly

    2017-01-01

    Full Text Available The solid-phase diagram of the Tl-TlBr-S system was clarified and the fundamental thermodynamic properties of Tl6SBr4 compound were studied on the basis of electromotive force (EMF measurements of concentration cells relative to a thallium electrode. The EMF results were used to calculate the relative partial thermodynamic functions of thallium in alloys and the standard integral thermodynamic functions (-ΔfG0, -ΔfH0, and S0298 of Tl6SBr4 compound. All data regarding thermodynamic properties of thallium chalcogen-halides are generalized and comparatively analyzed. Consequently, certain regularities between thermodynamic functions of thallium chalcogen-halides and their binary constituents as well as degree of ionization (DI of chemical bonding were revealed.

  8. 41 CFR 50-204.66 - Acetylene.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Acetylene. 50-204.66..., Vapors, Fumes, Dusts, and Mists § 50-204.66 Acetylene. (a) The in-plant transfer, handling, storage, and utilization of acetylene in cylinders shall be in accordance with Compressed Gas Association Pamphlet G-1-1966...

  9. 7 CFR 1205.204 - Voting.

    Science.gov (United States)

    2010-01-01

    ... through the Internet during the voting period. A completed and signed CN-100 and supporting documentation....C. or through the Internet during the voting period. In addition, before the referendum, USDA shall... 7 Agriculture 10 2010-01-01 2010-01-01 false Voting. 1205.204 Section 1205.204 Agriculture...

  10. 24 CFR 100.204 - Reasonable accommodations.

    Science.gov (United States)

    2010-04-01

    ... HOUSING DISCRIMINATORY CONDUCT UNDER THE FAIR HOUSING ACT Prohibition Against Discrimination Because of... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Reasonable accommodations. 100.204 Section 100.204 Housing and Urban Development Regulations Relating to Housing and Urban Development OFFICE...

  11. 41 CFR 50-204.68 - Hydrogen.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Hydrogen. 50-204.68..., Vapors, Fumes, Dusts, and Mists § 50-204.68 Hydrogen. The in-plant transfer, handling, storage, and utilization of hydrogen shall be in accordance with Compressed Gas Association Pamphlets G-5.1-1961 and G-5.2...

  12. 17 CFR 204.6 - Agency review.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Agency review. 204.6 Section... COLLECTION Administrative Offset § 204.6 Agency review. (a) To the extent that a debt owed has not been... request to review a disputed debt must be submitted to the Commission official who provided notification...

  13. 44 CFR 204.42 - Eligible costs.

    Science.gov (United States)

    2010-10-01

    ... are providing services directly associated with eligible fire-related activities may be eligible. (2... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Eligible costs. 204.42 Section 204.42 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY, DEPARTMENT OF...

  14. 44 CFR 206.204 - Project performance.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Project performance. 206.204... § 206.204 Project performance. (a) General. This section describes the policies and procedures applicable during the performance of eligible work. (b) Advances of funds. Advances of funds will be made in...

  15. 22 CFR 204.42 - Notice.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Notice. 204.42 Section 204.42 Foreign Relations....42 Notice. Any communication to A.I.D. pursuant to this Guaranty shall be in writing in the English language, shall refer to the A.I.D. Housing Guaranty Project Number inscribed on the Eligible Note and...

  16. 13 CFR 400.204 - Loan terms.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Loan terms. 400.204 Section 400... PROGRAM Steel Guarantee Loans § 400.204 Loan terms. (a) All loans guaranteed under the Program shall be... States with remaining periods of maturity comparable to the term of the loan sought to be guaranteed. The...

  17. 13 CFR 500.204 - Loan terms.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Loan terms. 500.204 Section 500... GUARANTEED LOAN PROGRAM Oil and Gas Guaranteed Loans § 500.204 Loan terms. (a) All loans guaranteed under the... United States with remaining periods of maturity comparable to the term of the loan sought to be...

  18. 5 CFR 582.204 - Electronic disbursement.

    Science.gov (United States)

    2010-01-01

    ... 582.204 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS COMMERCIAL GARNISHMENT OF FEDERAL EMPLOYEES' PAY Service of Legal Process § 582.204 Electronic disbursement. The party... process will be honored beginning with the first remission of garnished funds. Written requests received...

  19. 22 CFR 204.12 - Guaranty eligibility.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Guaranty eligibility. 204.12 Section 204.12 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT HOUSING GUARANTY STANDARD TERMS AND CONDITIONS The... Investors only are entitled to the benefits of this Guaranty. Notes in order to achieve Eligible Note status...

  20. 22 CFR 204.11 - The Guaranty.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false The Guaranty. 204.11 Section 204.11 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT HOUSING GUARANTY STANDARD TERMS AND CONDITIONS The Guaranty... Investor compensation in Dollars equal to its Loss of Investment under the Eligible Note; provided, however...

  1. 17 CFR 204.75 - Collection services.

    Science.gov (United States)

    2010-04-01

    ... DEBT COLLECTION Miscellaneous: Credit Bureau Reporting, Collection Services § 204.75 Collection services. Section 13 of the Debt Collection Act (31 U.S.C. 3718) authorizes agencies to enter into... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Collection services. 204.75...

  2. 34 CFR 685.204 - Deferment.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Deferment. 685.204 Section 685.204 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION... dentistry. (iii)(A) For the purpose of paragraph (b)(1)(i)(A) of this section, the Secretary processes a...

  3. A calixarene-based ion-selective electrode for thallium(I) detection

    Energy Technology Data Exchange (ETDEWEB)

    Chester, Ryan [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Sohail, Manzar [Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia); Ogden, Mark I.; Mocerino, Mauro [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Pretsch, Ernö [ETH Zürich, Institute of Biogeochemistry and Pollutant Dynamics (IBP), Universitätstrasse 16, CH-8092, Zürich (Switzerland); De Marco, Roland, E-mail: rdemarc1@usc.edu.au [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia)

    2014-12-03

    Highlights: • Tuning of metal binding cavities in thallium(I) calixarene ionophores. • Novel calixarene-based ionophores with improved selectivity for thallium(I). • Sandwich membrane characterization of thallium(I) binding in novel calixarenes. • Improved selectivity and sensitivity with novel thallium(I) calixarene ionophores. • Solid contact ion-selective electrodes for novel thallium(I) calixarene ionophores. - Abstract: Three new calixarene Tl{sup +} ionophores have been utilized in Tl{sup +} ion-selective electrodes (ISEs) yielding Nernstian response in the concentration range of 10{sup −2}–10{sup −6} M TlNO{sub 3} with a non-optimized filling solution in a conventional liquid contact ISE configuration. The complex formation constants (log β{sub IL}) for two of the calixarene derivatives with thallium(I) (i.e. 6.44 and 5.85) were measured using the sandwich membrane technique, with the other ionophore immeasurable due to eventual precipitation of the ionophore during these long-term experiments. Furthermore, the unbiased selectivity coefficients for these ionophores displayed excellent selectivity against Zn{sup 2+}, Ca{sup 2+}, Ba{sup 2+}, Cu{sup 2+}, Cd{sup 2+} and Al{sup 3+} with moderate selectivity against Pb{sup 2+}, Li{sup +}, Na{sup +}, H{sup +}, K{sup +}, NH{sub 4}{sup +} and Cs{sup +}, noting that silver was the only significant interferent with these calixarene-based ionophores. When optimizing the filling solution in a liquid contact ISE, it was possible to achieve a lower limit of detection of approximately 8 nM according to the IUPAC definition. Last, the new ionophores were also evaluated in four solid-contact (SC) designs leading to Nernstian response, with the best response noted with a SC electrode utilizing a gold substrate, a poly(3-octylthiophene) (POT) ion-to-electron transducer and a poly(methyl methacrylate)–poly(decyl methacrylate) (PMMA–PDMA) co-polymer membrane. This electrode exhibited a slope of 58.4 mV decade

  4. Dicty_cDB: VHP204 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP204 (Link to dictyBase) - - - - VHP204P (Link to Original site) VHP204F 644 VHP...204Z 767 VHP204P 1391 - - Show VHP204 Library VH (Link to library) Clone ID VHP204 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHP...2-A/VHP204Q.Seq.d/ Representative seq. ID VHP204P (Link to... Original site) Representative DNA sequence >VHP204 (VHP204Q) /CSM/VH/VHP2-A/VHP204Q.Seq.d/ AACTCTCGAGTGCAAA

  5. Thallium Flux Assay for Measuring the Activity of Monovalent Cation Channels and Transporters.

    Science.gov (United States)

    Weaver, C David

    2018-01-01

    Monovalent cation channels are critically important for physiological processes ranging from the control of neuronal excitability to the maintenance of solute balance. Mutations in these channels are associated with a multiplicity of diseases and monovalent cation channel-modulating drugs are used as therapeutics. Techniques that allow the measurement of the activity of these ion channels are useful for exploring their many biological roles as well as enabling the discovery and characterization of ion channel modulators for the purposes of drug discovery. Although there are numerous techniques for measuring the activity of monovalent cation channels, the thallium flux assay technique is a widely used fluorescence-based approach. Described herein is a method for using the thallium-flux technique for detecting and quantifying the activity of small-molecule potassium channel modulators in 384-well plates.

  6. Comparative studies on right ventricular pressure and volume overloading by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Owada, K.; Tsukahara, Y.; Kijima, M.; Miyazaki, Y.; Ono, K. (Fukushima Medical Coll. (Japan))

    1982-03-01

    Thallium-201 myocardial scintigraphy was performed in 44 patients with various heart diseases including mitral stenosis, atrial septal defect, primary pulmonary hypertension, and left atrial myxoma. The morphological findings of right ventricular (RV) free wall on the scintigram and RV/IVS (interventricular septum) uptake ratio of the images obtained from the left anterior oblique projection were studied in the patients with RV pressure or volume overloading.

  7. Tunable frequency-stabilization of UV laser using a Hallow-Cathode Lamp of atomic thallium

    CERN Document Server

    Chen, Tzu-Ling; Shy, Jow-Tsong; Liu, Yi-Wei

    2013-01-01

    A frequency-stabilized ultraviolet laser system, locked to the thallium resonant transition of 377.5 nm, was demonstrated using a novel bichromatic spectroscopy technique for tuning the zero-crossing laser-lock point. The atomic thallium system is a promising candidate in atomic parity violation and permanent electric dipole moment experiments, and its 377.5 nm 6P1/2->7S1/2 transition is important for thallium laser cooling and trapping experiment. The pressure shift, owing to the high pressure bu?er gas of the hollow-cathode lamp, was observed using an atomic beam resonance as reference. Such a shift was corrected by adjusting the peak ratio of the two Doppler-free saturation pro?les resulted from two pumping beams with a 130 MHz frequency di?erence. The resulted frequency stability of the ultraviolet laser is ?0.5 MHz at 0.1 sec integration time. This scheme is compact and versatile for stabilizing UV laser systems, which acquire a sub-MHz stability and frequency tunability.

  8. Detection of human collateral circulation by vasodilation-thallium-201 tomography

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Salge, D.; Spielmann, R.P.; Montz, R.; Bleifeld, W. (University Hospital Eppendorf, Hamburg (Germany, F.R.))

    1990-04-15

    Coronary arteriolar vasodilation may provoke redistribution of flow to collateral-dependent jeopardized myocardium. To assess the physiologic significance of collaterals, 80 consecutive post-infarction patients (age 58 +/- 8 years) underwent vasodilation-redistribution thallium-201 tomographic imaging after administration of 0.56 mg of intravenous dipyridamole/kg body weight. Circumferential profile analysis of thallium-201 uptake and redistribution in representative left ventricular tomograms provided quantitative assessment of transient and fixed defects and separation between periinfarctional and distant inducible hypoperfusion. Tomographic perfusion data were correlated to wall motion and collateral circulation between distinct anatomic perfusion territories. Patients were grouped according to presence (59%) or absence (41%) of angiographically visible collateral channels to jeopardized myocardium. In the presence of collaterals, distant reversible defects were larger than in absence of collaterals (p less than 0.05); the extent of combined periinfarctional and distant redistribution was also larger in collateralized patients (p less than 0.025), whereas the size of the persistent perfusion defect was similar in both groups. By prospective analysis the tomographic perfusion pattern of combined periinfarctional and distant redistribution revealed a sensitivity of 85% and a specificity of 78% for the detection of significant collateral circulation in this group of patients. Thus, using the exhausted flow reserve as a diagnostic tool, vasodilation-thallium-201 tomography has the potential to identify and quantitate collateralized myocardium in post-infarction patients and may guide diagnostic and therapeutic decision-making.

  9. [Characterization of kale (Brassica oberacea var acephala) under thallium stress by in situ attenuated total reflection FTIR].

    Science.gov (United States)

    Yao, Yan; Zhang, Ping; Wang, Zhen-Chun; Chen, Yong-Heng

    2009-01-01

    The experiment was designed based on consumption of carbon dioxide through the photosynthesis of Brassica oberacea var acephala leaf, and the photosynthesis of kale leaf under thallium stress was investigated by in situ attenuated total reflection FTIR (in situ ATR-FTIR). The ATR-FTIR showed that the absorption peaks of leaves had no obvious difference between plants growing in thallium stress soil and plants growing in non-thallium pollution soil, and the strong peaks at 3,380 cm(-1) could be assigned to the absorption of water, carbohydrate, protein or amide; the strong peaks at 2,916 and 2,850 cm(-1) assigned to the absorption of carbohydrate or aliphatic compound; the peaks at 1,640 cm(-1) assigned to the absorption of water. However, as detected by the in situ ATR-FTIR, the double peaks (negative peaks) at 2,360 and 2,340 cm(-1) that are assigned to the absorption of CO2 appeared and became high gradually. It was showed that kale was carrying photosynthesis. At the same time, the carbon dioxide consumption speed of leaf under thallium stress was obviously larger than that of the blank It was expressed that photosynthesis under thallium stress was stronger than the blank All these represented that kale had certain tolerance to the heavy metal thallium. Meanwhile, the carbon dioxide consumption of grown-up leaf was more than that of young leaf whether or not under thallium stress. It was also indicated that the intensity of photosynthesis in grown-up leaf is higher than that in young leaf.

  10. 9 CFR 204.1 - Introduction.

    Science.gov (United States)

    2010-01-01

    ... Animals and Animal Products GRAIN INSPECTION, PACKERS AND STOCKYARDS ADMINISTRATION (PACKERS AND STOCKYARDS PROGRAMS), DEPARTMENT OF AGRICULTURE ORGANIZATION AND FUNCTIONS Public Information § 204.1 Introduction. The Grain Inspection, Packers and Stockyards Administration (Packers and Stockyards Programs...

  11. 41 CFR 109-50.204 - Limitations.

    Science.gov (United States)

    2010-07-01

    ... DISPOSAL AUTHORITIES 50.2-Math and Science Equipment Gift Program § 109-50.204 Limitations. (a) Excess and... (or unlimited) level of authority. (d) Gifts shall be serviceable and in working order. Disposal...

  12. Thallium and manganese complexes involved in the luminescence emission of potassium-bearing aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, Miguel A., E-mail: miguel.gomez@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garcia-Guinea, Javier, E-mail: guinea@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garrido, Fernando, E-mail: fernando.garrido@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Townsend, Peter D., E-mail: pdtownsend@gmail.com [School of Science and Technology, University of Sussex, Brighton BN1 9QH (United Kingdom); Marco, Jose-Francisco, E-mail: jfmarco@iqfr.csic.es [Instituto de Química-Física Rocasolano, CSIC, Calle Serrano 119, Madrid E-28006 (Spain)

    2015-03-15

    The luminescence emission at 285 nm in natural K-feldspar has been studied by Russian groups and associated with thallium ions in structural positions of K{sup +} sites as artificially thallium-doped feldspars display the same emission band. Here attention is focussed on spectra of CL emission bands centered near 285 and 560 nm from paragenetic adularia, moscovite and quartz micro-inclusions. With accesorial thallium they show clear resemblances to each other. Associated sedimentary and hydrothermal aluminosilicate samples collected from Guadalix (Madrid, Spain) were analyzed with a wide range of experimental techniques including Environmental Scanning Electron Microscopy (ESEM) with an attached X-Ray Energy-Dispersive Spectrometer (EDS) and a cathodoluminescence probe (CL) and Electron Probe Microanalysis (EPMA), X-Ray Fluorescence Spectrometry (XRF), Inductively Coupled Plasma-Optical Emission Spectrometry (ICP-OES), Differential and Thermogravimetric Analyses (DTA-TG), radioluminescence (RL), Mössbauer spectroscopy and X-Ray Photoelectron Spectrometry (XPS). The luminescence emission bands at 285 and 560 nm seem to be associated with hydrous thallium–manganese complexes bonded to potassium-bearing aluminosilicates since various minerals such as K-feldspar, moscovite and quartz micro-inclusions display similar CL spectra, accesorial thallium and hydroxyl groups. The presence of iron introduces a brown color which is attributed to submicroscopic iron oxides detectable in the optical and chemical microanalysis, but this does not contribute to the luminescence emission. The XPS Mn 2p spectrum of the adularia sample at room temperature is composed of a spin–orbit doublet plus clear shake-up satellite structure ∼4 eV above the main photoemision lines and is consistent with Mn{sup 2+} in good agreement with the observed luminescence emission at 560 nm for aluminosilicates produced by a {sup 4}T1({sup 4}G)→{sup 6}A1({sup 6}S) transition in tetrahedrally

  13. Diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic and thallium 201 perfusion imaging in stable coronary artery disease.

    Science.gov (United States)

    Walamies, M; Turjanmaa, V; Koskinen, M; Uusitalo, A

    1993-08-01

    The diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic cardiac imaging was studied in a group (n = 29) of patients with angiographically confirmed CAD using single photon emission computed tomography (SPECT). A symptom-limited exercise test was first done with IPPA, and 2 days later with thallium. Medications were not withheld during testing. Fourteen healthy control subjects participated in parallel IPPA and 15 in thallium tests. Data acquisition and output were comparable in the two imaging modalities. By testing various relatively simple criteria for abnormality we found that the semiquantitative interpretation was more accurate than the visual readings. The best compromise of accuracy with the scored criteria consisted of a sensitivity of 86% and a specificity of 86%, obtained with IPPA polar tomograms (mild exercise defect) and a sensitivity of 86% and a specificity of 80% obtained with thallium (regionally decreased washout). With visual interpretation alone, a sensitivity of 83% and a specificity of 71% was detected with IPPA (mild exercise defect) and 72% and 73%, respectively, with thallium (partial reversibility). The sensitivity of the exercise ECG alone was 62%. The results of this study imply that IPPA imaging could be a rational, uncomplicated clinical method for non-invasive diagnosis of CAD. The diagnostic ability of IPPA is at least as good as that of thallium, and it is possible to use them in succession.

  14. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging: A new marker of triple-vessel disease

    Energy Technology Data Exchange (ETDEWEB)

    Takeishi, Y.; Tono-oka, I.; Ikeda, K.; Komatani, A.; Tsuiki, K.; Yasui, S. (Yamagata Univ. School of Medicine (Japan))

    1991-02-01

    To investigate the significance and mechanism of dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging, we performed both dipyridamole thallium-201 imaging and dipyridamole radionuclide angiography on 83 patients with known angiograms. The dipyridamole/delayed ratio of the left ventricular dimension from the thallium-201 image was defined as the left ventricular dilatation ratio (LVDR). An LVDR greater than the mean + two standard deviations in patients without coronary artery disease was defined as abnormal. Twenty-two of 83 patients showed an abnormal LVDR, and 18 of the 22 patients (82%) had triple-vessel disease. By defect and washout analysis, the sensitivity and specificity for correctly identifying the patients as having triple-vessel disease was 72% and 76%, respectively, whereas LVDR had a sensitivity of 72% and a specificity of 93%. When LVDR was used in combination with the defect and washout criteria, sensitivity increased to 84% without a loss of specificity. In those 22 patients with abnormal LVDRs, end-diastolic volume measured by radionuclide angiography did not change after dipyridamole infusion. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging reflected relative subendocardial hypoperfusion induced by dipyridamole rather than actual chamber enlargement. The LVDR was moderately sensitive and highly specific for triple-vessel disease and provided complementary information to dipyridamole thallium-201 imaging.

  15. A preliminary investigation and evaluation of the thallium environmental impacts of the unmined Xiangquan thallium-only deposit in Hexian, China

    Science.gov (United States)

    Zhou, Taofa; Fan, Yu; Yuan, Feng; Cooke, David; Zhang, Xin; Li, Liangjun

    2008-03-01

    The Xiangquan Thallium-only deposit in Hexian, east China is a newly found near-surface and unmined shallow-seated thallium deposit. The 250t Tl deposit is hosted in Lower Ordovician Lunshan Group as lenticular and confined by northeast F1, F2 faults. The metallic minerals are dominated by pyrite, more than 95% Tl occurs in pyrite as tiny individual grains or as ‘‘invisible thallium”. Tl and other trace elements pollution in ecosystems such as soils, surface and ground waters and water sediments, plants and crops, and animal and human beings in Xiangquan near the Tl ore deposit have been investigated and evaluated. Results show that Tl as well as As and Sb in ecosystems in Xiangquan around the deposit have enriched, they came from Tl-pyrite in the ore bodies and in the parent rocks of weathered soils on top of the ore bodies and went into the nearby ecosystems through weathering, leaching and dissolving. In 2 km2 around the Xiaolongwang Mountain where the Tl ore deposit seated, soils, vegetables, crops have been polluted or heavily polluted by Tl, As and Sb. Farmlands near the ore body are not fit to grow vegetables and crops. Thermal Spring water in Xiangquan town and pond water close to the Tl deposit are not potable. Tl also enriches in human hair and urinate of villagers who live close to the Tl deposit. Even through the Tl-only deposit has put clear environmental impacts on the local environment and ecosystems around it, no serious consequences of Tl pollution have so far taken place due to unmining of the Tl deposit as well as the screen effect of the silicficious breccia cap on top of it. All this work adds new knowledge to understand Tl behavior in unmined Tl deposit, and also benefit to the local environmental protection and the future mineral resources exploration.

  16. {sup 201}Thallium SPECT, accuracy in astrocytoma diagnosis and treatment evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Kaellen, K

    1999-10-01

    The aims of the studies included in this thesis were: - to investigate the reliability of {sup 201}Thallium single photon emission computed tomography. Tl SPECT for preoperative diagnosis and histological staging of malignant astrocytomas in comparison with CT; - to develop a method for quantification of cerebral thallium uptake, and to evaluate the quantitative measurement in comparison with CT, for astrocytoma treatment follow-up purposes; - to compare quantitative Tl SPECT and proton magnetic resonance spectroscopy (H-MRS) with conventional MR imagingfor astrocytoma monitoring, and to evaluate associations between change of morphological tumour characteristics during treatment and changes of cerebral thallium uptake and metabolic ratios. Results and conclusions: - High TI-index, calculated as a ratio comparing tumour uptake to uptake in the contralateral hemisphere, is an indicator of highly malignant astrocytoma. Differentiation between the high-grade astrocytomas, the low-grade astrocytomas, and infectious lesions is only partial, with an overlap of Tl-indexes between these groups. High-grade astrocytomas that do not show contrast enhancement on CT, and astrocytomas with central necrosis and moderate ring-enhancement, tend to be underestimated when evaluated by Tl-index calculation. Tl SPECT is not a reliable method for non-invasive tumour staging among the group of highly malignant astrocytomas. - Quantification of cerebral TI-uptake, defining the volume of viable tumour tissue, is a new method for astrocytoma chemotherapy monitoring. Results suggest that the method provides prognostic information, and information of treatment efficacy, at an earlier stage than CT. - We did not find a higher accuracy of quantitative Tl SPECT than of MR for monitoring purposes and our results indicated that treatment induced MR changes were interrelated with TI-uptake variations. - Multi-voxel H-MRS was difficult to apply for astrocytoma treatment monitoring, due to the

  17. A Novel Ion - selective Polymeric Membrane Sensor for Determining Thallium(I) With High Selectivity

    Science.gov (United States)

    Kassim, Anuar; Rezayi, Majid; Ahmadzadeh, Saeid; Rounaghi, Gholamhossein; Mohajeri, Masoomeh; Azah Yusof, Noor; Tee, Tan Wee; Yook Heng, Lee; Halim Abdullah, Abd

    2011-02-01

    Thallium is a toxic metal that introduced into the environment mainly as a waste from the production of zinc, cadmium, and lead and by combustion of coal. Thallium causes gastrointestinal irritation and nerve damage when people are exposed to it for relatively short period of time. For long term, thallium has the potential to cause the following effects: change in blood chemistry, damage to liver, kidney, intestinal and testicular tissue, and hair loss. In this work a membrane was prepared by use of 4'-nitrobenzo -18-crown-6 (4'NB18C6) as an ion carrier, polyvinylchloride (PVC) as a matrix, and diocthylphetalate (DOP) as a plasticizer for making an ion selective electrode for measurement of Tl+ cation in solutions. The amount of 4'-nitrobenzo-18C6 and polyvinylchloride were optimized in the preparation of the membrane. The response of the electrode was Nernstian within the concentration range 1.0 × 10-8 to 1.0 × 10-1M. This sensor displays a drift in Nernstian response for this cation with increasing the amount of ionophore and decreasing the amount of polyvinylchloride.The results of potentiometric measurements showed that, this electrode also responses to Cu2+ Ni2+ and Pb2+ cations, but the electrode has a wider dynamic range and a lower detection limit to Tl+ cation. The effects of various parameters such as pH, different cations interferences, effect of the amount of ionophore and polyvinylchloride and time on response of the coated ion selective electrode were investigated. Finally the constructed electrode was used in complexometric and precipitation titrations of Tl+ cation with EDTA and KBr, respectively. The response of the fabricated electrode at concentration range from 1.0 × 10-8 to 1.0 × 10-1M is linear with a Nernstian slope of 57.27 mV.

  18. Oxidative stress and DNA damage in broad bean (Vicia faba L.) seedlings induced by thallium.

    Science.gov (United States)

    Radić, Sandra; Cvjetko, Petra; Glavas, Katarina; Roje, Vibor; Pevalek-Kozlina, Branka; Pavlica, Mirjana

    2009-01-01

    Thallium (Tl) is a metal of great toxicological concern because it is highly toxic to all living organisms through mechanisms that are yet poorly understood. Since Tl is accumulated by important crops, the present study aimed to analyze the biological effects induced by bioaccumulation of Tl in broad bean (Vicia faba L.) as well as the plant's antioxidative defense mechanisms usually activated by heavy metals. Thallium toxicity was related to production of reactive oxygen species in leaves and roots of broad bean seedlings following short-term (72 h) exposure to thallium (I) acetate (0, 0.5, 1, 5, and 10 mg/L) by evaluating DNA damage and oxidative stress parameters as well as antioxidative response. The possible antagonistic effect of potassium (K) was tested by combined treatment with 5 mg/L of Tl (Tl+) and 10 mg/L of potassium (K+) acetate. Accumulation of Tl+ in roots was 50 to 250 times higher than in broad bean shoots and was accompanied by increase in dry weight and proline. Despite responsive antioxidative defense (increased activities of superoxide dismutase, ascorbate peroxidase, and pyrogallol peroxidase), Tl+ caused oxidative damage to lipids and proteins as evaluated by malondialdehyde and carbonyl group levels, and induced DNA strand breaks. Combined treatment caused no oxidative alternations to lipids and proteins though it induced DNA damage. The difference in Tl-induced genotoxicity following both acellular and cellular exposure implies indirect DNA damage. Results obtained indicate that oxidative stress is involved in the mechanism of Tl toxicity and that the tolerance of broad bean to Tl is achieved, at least in part, through the increased activity of antioxidant enzymes.

  19. Thallium Intoxication Treated with Long-Term Hemodialysis, Forced Diuresis and Prussian Blue

    DEFF Research Database (Denmark)

    Larsen, Elfinn; Solgaard, Per Bent; Freund, L. Gade

    1978-01-01

    A 56 yr old woman, who ingested 2 g of thallium sulfate, was successfully treated with long-term hemodialysis for 200 h during 10 days, combined with forced diuresis and Prussian blue. The effect of the artificial kidney dialysis was determined by repeated analysis of the Tl concentration...... in the dialysis bath and in blood samples. During the 1st 120 h of hemodialysis, 143 mg of Tl was eliminated via the artificial kidney and 110 mg via the urinary tract. The present case of acute Tl intoxication is the 1st in which long-term hemodialysis has been used in the acute phase...

  20. Application of Hyphenated Techniques in Speciation Analysis of Arsenic, Antimony, and Thallium

    Science.gov (United States)

    Michalski, Rajmund; Szopa, Sebastian; Jabłońska, Magdalena; Łyko, Aleksandra

    2012-01-01

    Due to the fact that metals and metalloids have a strong impact on the environment, the methods of their determination and speciation have received special attention in recent years. Arsenic, antimony, and thallium are important examples of such toxic elements. Their speciation is especially important in the environmental and biomedical fields because of their toxicity, bioavailability, and reactivity. Recently, speciation analytics has been playing a unique role in the studies of biogeochemical cycles of chemical compounds, determination of toxicity and ecotoxicity of selected elements, quality control of food products, control of medicines and pharmaceutical products, technological process control, research on the impact of technological installation on the environment, examination of occupational exposure, and clinical analysis. Conventional methods are usually labor intensive, time consuming, and susceptible to interferences. The hyphenated techniques, in which separation method is coupled with multidimensional detectors, have become useful alternatives. The main advantages of those techniques consist in extremely low detection and quantification limits, insignificant interference, influence as well as high precision and repeatability of the determinations. In view of their importance, the present work overviews and discusses different hyphenated techniques used for arsenic, antimony, and thallium species analysis, in different clinical, environmental and food matrices. PMID:22654649

  1. Evaluation of myocardial abnormalities in collagen diseases by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru; Kagoshima, Tadashi; Sugihara, Kiyotaka (Nara Medical Univ., Kashihara (Japan)) (and others)

    1993-12-01

    This study was performed to evaluate myocardial abnormalities in patients with collagen diseases by exercise and rest thallium-201 myocardial scintigrams. A total of 65 patients without ischemic ECG changes, consisting of 18 with systemic lupus erythematosus (SLE), 18 with polymyositis (PM), 8 with progressive systemic sclerosis (PSS), and 21 with Sjoegren's syndrome (SjS), was enrolled in this study. Reversible exercise-induced defects scintigraphically suggesting myocardial ischemia were noted in 8 cases of SLE, 4 cases of PM, 4 cases of PSS, and 3 cases of SjS. Nineteen patients had exercise-induced defects and underwent cardiac catheterization, 8 of whom had normal coronary angiograms. Fixed hypoperfusion areas were observed in one case of SLE, 6 cases of PM and 3 cases of SjS. Rest thallium-201 myocardial scintigram disclosed hypoperfusion areas which were not induced by exercise in 2 cases of SLE, 3 cases of PM, one case of PSS and 5 cases of SjS. Echocardiogram showed no significant differences in ejection fraction and % fractional shortening between the disease groups and healthy control group. These findings suggest that patients with collagen diseases have abnormalities of coronary circulation at the level of the intramural vasculature before cardiac function impairment, myocardial fibrosis and functional abnormalities at the cell membrane. (author).

  2. Follow-up Thallium-201 scintigraphy after mantle field radiotherapy for Hodgkin's disease

    Energy Technology Data Exchange (ETDEWEB)

    Pierga, J.Y.; Girinski, T.; Henry-Amar, M. (Institut Gustave Roussy, Villejuif (France)); Maunoury, C.; Valette, H.; Tchernia, G.; Desgrez, A. (Centre Hospitalier de Bicetre, Le Kremlin-Bicetre (France)); Socie, G. (Institut Gustave Roussy, Villejuif (France) Hopital St Louis, Paris (France)); Cosset, J.M. (Institut Gustave Roussy, Villejuif (France) Institut Curie, Paris (France))

    1993-04-02

    Assessment of the long-term cardiac effects of mediastinal radiotherapy for Hodgkin's disease, by Thallium scintigraphy. 32 patients (14 males and 18 females) who underwent mantle field radiotherapy for Hodgkin's disease were included in this study. Twenty patients received 4 fractions of 2.5 Gy per week and 12, five fraction of 2 Gy per week, delivered on alternate days. All the patients, except three, performed exercise testing electrocardiogram and Thallium-201 tomoscintigraphy. The average time interval from completion of treatment to the study was 7 years (range 3--13 years). No patients had clinical symptoms of cardiac disease. Mean age at the time of the study was 35 years (range 23--48 years). Two electrocardiograms revealed left bundle branch block and the patients were excluded from the study. Only one out of 27 exercise electrocardiograms was abnormal in a patient with mitral valve prolapse, who was also excluded from the study. Twenty-six scintigraphies were evaluable. Twenty-two (85%) were clearly abnormal with partial or complete redistribution on delayed images. The anterior region was affected in 19 of these cases (86%). Four explorations were undoubtedly normal. Coronary angiography was not performed for ethical reasons in these asymptomatic patients. Despite possible false positive tests, the high rate of abnormality (85%) in this small series is striking. These preliminary data justify larger studies and a close long-term follow-up of these patients. 24 refs., 1 fig., 2 tabs.

  3. Thallium occurrence and partitioning in soils and sediments affected by mining activities in Madrid province (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, M.A.; Garcia-Guinea, J. [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain); Laborda, F. [Group of Analytical Spectroscopy and Sensors Group, Institute of Environmental Sciences, University of Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza (Spain); Garrido, F., E-mail: fernando.garrido@mncn.csic.es [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain)

    2015-12-01

    Thallium (Tl) and its compounds are toxic to biota even at low concentrations but little is known about Tl concentration and speciation in soils. An understanding of the source, mobility, and dispersion of Tl is necessary to evaluate the environmental impact of Tl pollution cases. In this paper, we examine the Tl source and dispersion in two areas affected by abandoned mine facilities whose residues remain dumped on-site affecting to soils and sediments of natural water courses near Madrid city (Spain). Total Tl contents and partitioning in soil solid phases as determined by means of a sequential extraction procedure were also examined in soils along the riverbeds of an ephemeral and a permanent streams collecting water runoff and drainage from the mines wastes. Lastly, electronic microscopy and cathodoluminescence probe are used as a suitable technique for Tl elemental detection on thallium-bearing phases. Tl was found mainly bound to quartz and alumino-phyllosilicates in both rocks and examined soils. Besides, Tl was also frequently found associated to organic particles and diatom frustules in all samples from both mine scenarios. These biogenic silicates may regulate the transfer of Tl into the soil-water system. - Highlights: • Abandoned mine residues are Tl sources in soils of Madrid catchment area. • Tl was associated to quartz and aluminosilicates in both rocks and soils. • Tl was frequently found associated to organic particles and diatom frustules. • Cathodoluminescence is a suitable technique for Tl detection on soils and rocks.

  4. [Detecting Thallium in Water Samples using Dispersive Liquid Phase Microextraction-Graphite Furnace Atomic Absorption Spectroscopy].

    Science.gov (United States)

    Zhu, Jing; Li, Yan; Zheng, Bo; Tang, Wei; Chen, Xiao; Zou, Xiao-li

    2015-11-01

    To develope a method of solvent demulsification dispersive liquid phase microextraction (SD-DLPME) based on ion association reaction coupled with graphite furnace atomic absorption spectroscopy (GFAAS) for detecting thallium in water samples. Methods Thallium ion in water samples was oxidized to Tl(III) with bromine water, which reacted with Cl- to form TlCl4-. The ionic associated compound with trioctylamine was obtained and extracted. DLPME was completed with ethanol as dispersive solvent. The separation of aqueous and organic phase was achieved by injecting into demulsification solvent without centrifugation. The extractant was collected and injected into GFAAS for analysis. With palladium colloid as matrix modifier, a two step drying and ashing temperature programming process was applied for high precision and sensitivity. The linear range was 0.05-2.0 microg/L, with a detection limit of 0.011 microg/L. The relative standard derivation (RSD) for detecting Tl in spiked water sample was 9.9%. The spiked recoveries of water samples ranged from 94.0% to 103.0%. The method is simple, sensitive and suitable for batch analysis of Tl in water samples.

  5. The learning machine in quantitative chemical analysis : Part I. Anodic Stripping Voltammetry of Cadmium, Lead and Thallium

    NARCIS (Netherlands)

    Bos, M.; Jasink, G.

    1978-01-01

    The linear learning machine method was applied to the determination of cadmium, lead and thallium down to 10-8 M by anodic stripping voltammetry at a hanging mercury drop electrode. With a total of three trained multicategory classifiers, concentrations of Cd, Pb and Tl could be predicted with an

  6. Thallium chloride 201Tl combined with single photon emission computed tomography (SPECT) in the evaluation of vestibular schwannoma growth

    DEFF Research Database (Denmark)

    Charabi, Samih Ahmed; Lassen, N A; Thomsen, J

    1997-01-01

    Thallium chloride 201Tl combined with SPECT was performed in a series of 29 patients with neuroradiological evidence of vestibular schwannoma (VS). The relative tumor uptake (U) and relative tumor concentration (C) of the radiotracer 201Tl was determined, and the cerebellum served as a reference...

  7. 20 CFR 633.204 - Responsibility review.

    Science.gov (United States)

    2010-04-01

    ....204 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR MIGRANT AND...) Established fraud or criminal activity within the organization. (4) Wilfull obstruction of the audit process... hand. (11) Failure to procure or arrange for audit coverage for any two year period when required by...

  8. 48 CFR 49.204 - Deductions.

    Science.gov (United States)

    2010-10-01

    ... TERMINATION OF CONTRACTS Additional Principles for Fixed-Price Contracts Terminated for Convenience 49.204... agreed price for any part of the termination inventory purchased or retained by the contractor, and the..., as determined by the TCO, of any part of the termination inventory that, before transfer of title to...

  9. 50 CFR 216.204 - Mitigation.

    Science.gov (United States)

    2010-10-01

    ..., DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking of Marine Mammals Incidental to Construction and Operation of Offshore Oil and Gas Facilities in the U.S. Beaufort Sea § 216.204 Mitigation. The activity identified in § 216.200(a) must be conducted in...

  10. 50 CFR 223.204 - Tribal plans.

    Science.gov (United States)

    2010-10-01

    ... Threatened Marine and Anadromous Species § 223.204 Tribal plans. (a) Limits on the prohibitions. The... impact on the biological requirements of the species, and will assess the effect of the Tribal Plan on... or not implementation of a Tribal Plan will appreciably reduce the likelihood of survival and...

  11. 17 CFR 204.62 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... COLLECTION Administrative Wage Garnishment § 204.62 Definitions. The following definitions apply to this... taxes and withholding taxes, but do not include any amount withheld pursuant to a court order. Employer... agency of the Federal Government. Garnishment means the process of withholding amounts from an employee's...

  12. 19 CFR 10.204 - Imported directly.

    Science.gov (United States)

    2010-04-01

    ... country, the articles in the shipment did not enter into the commerce of the non-beneficiary country while... country except for the purpose of sale other than at retail, and the articles are imported into the United... ARTICLES CONDITIONALLY FREE, SUBJECT TO A REDUCED RATE, ETC. Andean Trade Preference § 10.204 Imported...

  13. 12 CFR 509.204 - Hearing Procedure.

    Science.gov (United States)

    2010-01-01

    ... PROCEDURE IN ADJUDICATORY PROCEEDINGS Special Rules § 509.204 Hearing Procedure. (a) (1) The Director shall... filings to the Office of the Chief Counsel, Business Transactions Division. The Office of the Chief Counsel, Business Transactions Division shall serve in the manner provided in § 509.11 of this part, each...

  14. 15 CFR 971.204 - Environmental and use conflict analysis.

    Science.gov (United States)

    2010-01-01

    ... particulate matter dispersion Sediment characteristics (mineralogy, particle size, shape and density, and... analysis. 971.204 Section 971.204 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign... Applications Contents § 971.204 Environmental and use conflict analysis. (a) Environmental information...

  15. 42 CFR 50.204 - Informed consent requirement.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Informed consent requirement. 50.204 Section 50.204... APPLICABILITY Sterilization of Persons in Federally Assisted Family Planning Projects § 50.204 Informed consent requirement. Informed consent does not exist unless a consent form is completed voluntarily and in accordance...

  16. 40 CFR 86.204-94 - Section numbering; construction.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Section numbering; construction. 86.204-94 Section 86.204-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.204-94 Section numbering...

  17. 41 CFR 50-204.36 - Radiation standards for mining.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Radiation standards for mining. 50-204.36 Section 50-204.36 Public Contracts and Property Management Other Provisions Relating to... CONTRACTS Radiation Standards § 50-204.36 Radiation standards for mining. (a) For the purpose of this...

  18. 20 CFR 725.204 - Determination of relationship; spouse.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Determination of relationship; spouse. 725.204 Section 725.204 Employees' Benefits EMPLOYMENT STANDARDS ADMINISTRATION, DEPARTMENT OF LABOR...) § 725.204 Determination of relationship; spouse. (a) For the purpose of augmenting benefits, an...

  19. 48 CFR 243.204-70-2 - Price ceiling.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Price ceiling. 243.204-70-2 Section 243.204-70-2 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT CONTRACT MODIFICATIONS Change Orders 243.204-70-2 Price ceiling...

  20. 23 CFR 972.204 - Management systems requirements.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Management systems requirements. 972.204 Section 972.204... WILDLIFE SERVICE MANAGEMENT SYSTEMS Fish and Wildlife Service Management Systems § 972.204 Management systems requirements. (a) The FWS shall develop, establish and implement the management systems as...

  1. 41 CFR 50-204.1a - Variances.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Variances. 50-204.1a Section 50-204.1a Public Contracts and Property Management Other Provisions Relating to Public Contracts PUBLIC CONTRACTS, DEPARTMENT OF LABOR 204-SAFETY AND HEALTH STANDARDS FOR FEDERAL SUPPLY CONTRACTS Scope...

  2. 41 CFR 50-204.1 - Scope and application.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Scope and application. 50-204.1 Section 50-204.1 Public Contracts and Property Management Other Provisions Relating to Public Contracts PUBLIC CONTRACTS, DEPARTMENT OF LABOR 204-SAFETY AND HEALTH STANDARDS FOR FEDERAL SUPPLY CONTRACTS...

  3. 12 CFR 204.8 - International banking facilities.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 2 2010-01-01 2010-01-01 false International banking facilities. 204.8 Section 204.8 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM RESERVE REQUIREMENTS OF DEPOSITORY INSTITUTIONS (REGULATION D) § 204.8 International banking facilities...

  4. 40 CFR 204.3 - Number and gender.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Number and gender. 204.3 Section 204.3... STANDARDS FOR CONSTRUCTION EQUIPMENT General Provisions § 204.3 Number and gender. As used in this part, words in the singular shall be deemed to import the plural, and words in the masculine gender shall be...

  5. 46 CFR 309.204 - Proof of loss.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Proof of loss. 309.204 Section 309.204 Shipping MARITIME... Supplies § 309.204 Proof of loss. Claims for reimbursement for total loss of stores and supplies may be... owner and the Chief, Division of Insurance, Maritime Administration, have agreed, in advance of the loss...

  6. 29 CFR 20.4 - Determination of delinquency; notice.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Determination of delinquency; notice. 20.4 Section 20.4 Labor Office of the Secretary of Labor FEDERAL CLAIMS COLLECTION Disclosure of Information to Credit Reporting Agencies § 20.4 Determination of delinquency; notice. (a) The agency head (or designee...

  7. 5 CFR 2638.204 - Deputy ethics official.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Deputy ethics official. 2638.204 Section 2638.204 Administrative Personnel OFFICE OF GOVERNMENT ETHICS GOVERNMENT ETHICS OFFICE OF GOVERNMENT ETHICS AND EXECUTIVE AGENCY ETHICS PROGRAM RESPONSIBILITIES Designated Agency Ethics Official § 2638.204...

  8. 24 CFR 904.204 - General requirements and information.

    Science.gov (United States)

    2010-04-01

    ... successful participation in the homeownership development. (i) An overload of information should be avoided... information. 904.204 Section 904.204 Housing and Urban Development Regulations Relating to Housing and Urban... § 904.204 General requirements and information. (a) The counseling and training program shall be...

  9. 31 CFR 586.204 - Prohibited new investment within Serbia.

    Science.gov (United States)

    2010-07-01

    ... Serbia. 586.204 Section 586.204 Money and Finance: Treasury Regulations Relating to Money and Finance... (SERBIA & MONTENEGRO) KOSOVO SANCTIONS REGULATIONS Prohibitions § 586.204 Prohibited new investment within Serbia. Except as otherwise provided in regulations, orders, directives, or licenses that may hereafter...

  10. 7 CFR 22.204 - Rural development committees.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Rural development committees. 22.204 Section 22.204 Agriculture Office of the Secretary of Agriculture RURAL DEVELOPMENT COORDINATION Roles and Responsibilities of Federal Government § 22.204 Rural development committees. State rural development committees...

  11. 48 CFR 952.204-77 - Computer security.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Computer security. 952.204-77 Section 952.204-77 Federal Acquisition Regulations System DEPARTMENT OF ENERGY CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 952.204-77 Computer security. As prescribed in 904.404(d)(7), the...

  12. 40 CFR 2.204 - Initial action by EPA office.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Initial action by EPA office. 2.204 Section 2.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC INFORMATION Confidentiality of Business Information § 2.204 Initial action by EPA office. (a) Situations requiring action...

  13. Bis(2-mercapto-1-R-imidazolyl)hydroborato complexes of aluminium, gallium, indium and thallium: compounds possessing gallium-gallium bonds and a trivalent thallium alkyl.

    Science.gov (United States)

    Yurkerwich, Kevin; Coleman, Fergal; Parkin, Gerard

    2010-08-14

    The reactions of bis(mercaptoimidazolyl)hydroborato derivatives [Bm(R)]M' (R = Me, Bu(t); M' = Li, Na, Tl) with MX(3) trihalides of aluminium, gallium and indium yield both 1:1 and 2:1 complexes of the types [Bm(R)]MX(2) and [Bm(R)](2)MX, respectively. Structurally characterized examples of the [Bm(R)]MX(2) series include [Bm(Me)]AlCl(2), [Bm(Me)]GaI(2), [Bm(Me)]InI(2), [Bm(Bu(t))]AlCl(2) and [Bm(Bu(t))]GaX(2) (X = Cl, Br, I), while structurally characterized examples of the [Bm(R)](2)MX series include [Bm(Bu(t))](2)InX (X = Cl, Br, I). In addition to the halide complexes, the trivalent dimethyl thallium complex [Bm(Bu(t))]TlMe(2) has been synthesized via the reaction of [Bm(Bu(t))]Tl with Me(2)TlCl. The reactions of [Bm(R)]M' with the monovalent halides, "GaI", InCl and InI, result in disproportionation. In the case of indium, the mononuclear complexes [Bm(Bu(t))](2)InI and [Bm(Bu(t))]InCl(kappa(2)-mim(Bu(t))) are obtained, whereas for gallium, dinuclear compounds that feature Ga-Ga bonds, namely [Bm(R)](GaI)(GaI)[Bm(R)] (R = Me, Bu(t)) have been isolated.

  14. Thallium stress testing does not predict cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Holley, J.L.; Fenton, R.A.; Arthur, R.S. (Univ. of Pittsburgh, PA (USA))

    1991-05-01

    This study assessed the usefulness of thallium stress testing as a predictor of perioperative cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation. Demographic factors influencing the exercise performance in these patients were also examined. The medical records of 189 consecutive patients with diabetic nephropathy who were evaluated for cadaveric renal transplantation were reviewed. Thallium stress testing was the initial examination of cardiovascular status in 141 patients. An adequate examination was one in which at least 70% of maximum heart rate was achieved. A thallium stress test was normal if there were no ST segment depressions on the electrocardiogram and no perfusion abnormalities on the thallium scan. Forty-four patients underwent cardiac catheterization as the initial evaluation (Group C) and four patients underwent transplantation without a formal cardiovascular evaluation (Group D). Sixty-four of the 141 patients undergoing thallium stress testing had an adequate and normal examination (Group A). The incidence of perioperative cardiac events in this group was 2%. Seventy-seven patients (Group B) had an abnormal (n = 41) or an inadequate (n = 36) thallium stress test and most (n = 61) then underwent coronary angiography. The use of beta-blockers was the only predictor of an abnormal or inadequate thallium stress test. Forty-three percent of patients with inadequate or abnormal thallium stress tests had significant coronary artery disease on cardiac catheterization. The perioperative risk of cardiac events was not different in Group A versus Groups B, C, and D combined. Survival of Group A and B patients was not different but was significantly longer than that of Group C patients.

  15. Standardization of a 204Tl radioactive solution.

    Science.gov (United States)

    Dias, Mauro S; Koskinas, Marina F

    2003-02-01

    The standardization of 204Tl is described. The efficiency tracing technique was applied using 134Cs as tracer. The 4(pi)beta-gamma coincidence system was used for the calibration. The (Laboratorio de Metrologia Nuclear) has participated in this comparison in collaboration with the Laboratório Nacional de Metrologia das Radiações Ionizantes, from Rio de Janeiro. Independent results using different techniques were developed by each of these laboratories and included in the comparison.

  16. Evaluation of thallium-201 scanning for detection of latent coronary artery disease

    Science.gov (United States)

    Johnson, P. C.; Leblanc, A.; Deboer, L.; Jhingran, S.

    1978-01-01

    The use of thallium imaging as a noninvasive method to accurately screen shuttle passengers for latent coronary artery disease was investigated. All radionuclide procedures were performed using an Anger type camera with a high resolution collimator. A minimum of 200,000 counts were collected for each image using a 20% window centered on the 69-83 keV X-rays. For the images obtained following injection with the patient at rest, the testing was begun 10 minutes after injection. Injections of TT during exercise were made at a point near the termination of the treadmill procedure as determined by either the appearance of ST segment changes on the electrocardiogram consistant with subendocardial ischemia, the appearance of angina-like chest pain in the patient or fatigue in the patient which required cessation of the test. The severity of heart disease was based on the medical history, physical exam, exercise electrocardiograms, chest X-rays and the coronary arteriogram.

  17. Thallium Analysis in Environmental Samples by Inductively Coupled Plasma Mass Spectrometry; Analisis de Talio en Muestras Ambientales por Espectrometria de Masas con Fuente de Plasma de Acoplamiento Inductivo

    Energy Technology Data Exchange (ETDEWEB)

    Higueras, I.; Fernandez, M.; Conde, E.; Gajate, A.

    2008-08-06

    Due to its high toxicity, thallium has been considered by the US Environmental Protection Agency as one of the priority pollutants to be controlled. While being a highly toxic element, thallium has been studied to a much lesser degree than other toxic elements, mainly because thallium is often undetected by classical analytical methods. Thallium is a rare and dispersed element that occurs mainly in sulfur-containing ores. Thus, it is a potential pollutant to surrounding environment, if Tl-rich mineral and/or their industrial wastes are not properly disposed. In this work an Inductively Coupled Plasma Mass Spectrometry analytical procedure has been developed in order to determine thallium in environmental solid samples and its application to the study of this element as a potential pollutant associated with natural and anthropogenic activities. The analytical procedure has been validated by the use of appropriate reference materials, and through the isotope dilution technique as a primary method of measurement. Finally, the developed procedure has been applied to several samples from a mining area, as one of the scenarios where thallium it is likely to occur. (Author) 87 refs.

  18. Evaluation of myocardial abnormalities in patients with collagen diseases by thallium-201 myocardial scintigram

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru (Nara Medical Univ., Kashihara (Japan))

    1992-08-01

    This study was performed to evaluate myocardial lesions in patients with collagen diseases by rest and exercise thallium-201 myocardial scintigraphies. A total of 76 patients without ischemic ECG changes, consisting of 27 cases of systemic lupus erythematosus (SLE), 17 cases of polymyositis or dermatomyositis (PM[center dot]DM), 11 cases of progressive systemic sclerosis (PSS), and 21 cases of Sjoegren's syndrome (SjS), were enrolled in this study. Reversible exercise-induced defects suggesting myocardial ischemia were noted in 12 cases of SLE, 5 cases of PM[center dot]DM, 3 cases of PSS, and 3 cases of SjS. Of the 23 patients who had exercise-induced defects, 9 patients showed normal coronary angiograms by cardiac catheterization. Fixed hypoperfusion areas were observed in 5 cases of SLE, 6 cases of PM[center dot]DM, 4 cases of PSS and 3 cases of SjS. Rest thallium-201 myocardial scintigraphy disclosed hypoperfusion areas, which were not induced by exercise, in 1 case of SLE, 4 cases of PM[center dot]DM, 1 case of PSS and 5 cases of SjS. Endomyocardial biopsy was performed on 20 patients. Myocardial lesions in PM[center dot]DM and PSS were more severe and wide spread than in SLE. Ejection fraction and fractional shortening evaluated by echocardiography had no significant differences between each disease group and the healthy control group. These findings suggest that patients with collagen diseases show the presence of abnormalities of coronary circulation at the level of the intramyocardial vasculature in the stage before impairment of cardiac function, myocardial fibrosis and functional abnormalities of the cell membrane level that were not dependent on myocardial ischemia. (author).

  19. Development and Applications of Thallium isotopes: a new proxy tracking the extent of manganese oxide burial

    Science.gov (United States)

    Owens, J. D.; Nielsen, S.; Ostrander, C.; Peterson, L. C.; Anbar, A. D.

    2015-12-01

    Thallium (Tl) isotopes are a new and potential powerful paleoredox proxy with the possibility to track bottom water oxygen conditions based on the burial flux of manganese oxides. Thallium has a residence time of ~20 thousand years, which is long enough to render modern oxic seawater conservative with respect to concentration and isotopes. The isotopic signature of Tl in the global ocean is driven mainly by two outputs (1) adsorption onto manganese oxides and (2) low temperature oceanic crust alteration. Importantly, the isotopic inputs of Tl are all nearly the same value; thus, the isotopic composition and flux of the outputs almost exclusively set the seawater signature. For relatively short term redox events it is reasonable to assume that the dominant isotope fractionation process is associated with manganese oxide precipitation because low temperature alteration is controlled by long-term average ocean crust production rates. We present a broad range of modern samples that span several open ocean profiles combined with water column and sediment profiles from the permanently anoxic basins of the Black Sea and Cariaco Basins. The open ocean shows no variation in depth profiles that encompass most of the major water masses in the Atlantic and Southern Oceans. The anoxic basins, however, reveal Tl isotope signatures closer to their inputs, which is likely due to basinal restriction. The authigenic fraction of organic-rich sediments from the Black Sea and Cariaco Basin capture the Tl isotope value of the overlying water column, which shows that Tl isotopes could be applied as a faithful deep time redox proxy. For the first time, we will present new data showing that Tl isotopes is tracking bottom water ocean oxygenation. We are applying this isotope system to ancient samples, testing the spatial and temporal variability of ocean oxygenation coinciding with major biogeochemical events.

  20. Thallium myocardial tomoscintigraphy: detection of ischemia during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease. Tomoscintigraphie myocardique au thallium: detection de l'ischemie provoquee par le sevrage de la ventilation assistee chez le bronchiteux chronique

    Energy Technology Data Exchange (ETDEWEB)

    Andre, L.; Valette, H.; Obama, S.; Archambaud, F.; Richard, C.; Teboul, J.L.; Hebert, J.L.; Auzepy, P.; Desgrez, A. (Hopital de Bicetre, 94 - Le Kremlin-Bicetre (FR))

    1990-01-01

    In order to evidence myocardial ischemia-leading to ventricular dysfunction-during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease, thallium myocardial tomography and gated blood pool studies were performed in 9 patients during mechanical ventilation and during weaning from mechanical ventilation. During the latter, results of gated blood pool studies showed a diffuse homogeneous left ventricular dysfunction. A fixed lower thallium uptake in the septum than in the lateral wall was found with the quantitative analysis of myocardial tomograms. Partial volume effect is likely the cause of this septal defect. The hypothesis of a diffuse ischemia cannot be excluded; but, without the absolute quantification of tomographic data, it cannot be proven.

  1. Septal myocardial perfusion imaging with thallium-201 in the diagnosis of proximal left anterior descending coronary artery disease

    Energy Technology Data Exchange (ETDEWEB)

    Pichard, A.D.; Wiener, I.; Martinez, E.; Horowitz, S.; Patterson, R.; Meller, J.; Goldsmith, S.J.; Gorlin, R.; Herman, M.V.

    1981-07-01

    The use of myocardial perfusion imaging (MPI) to identify obstructive coronary disease of the left anterior descending coronary artery proximal to the first septal perforator (prox LAD) was studied in 60 patients. Perfusion of the septum and anteroapical areas with thallium-201 injected during exercise was compared to results of coronary arteriography. Septal MPI defect was found in 92.3% of patients with obstruction of the proximal LAD, 27.7% of patients with obstruction of LAD distal to first septal perforator, 0% in patients with obstructions involving right or circumflex arteries, and in 10.5% of patients without coronary disease. Anteroapical MPI defects were found with similar frequency in the three groups with obstructive coronary disease. Septal MPI defect had a sensitivity of 92.3% and specificity of 85.4% in the diagnosis of proximal LAD disease. Normal septal perfusion with thallium-201 virtually excluded proximal LAD disease.

  2. Usefulness of rest-redistribution thallium scan for the indication of PTCA in an interesting case with acute myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chiba, Hiroshi; Nishimura, Tsunehiko; Mitani, Isao; Matsuo, Takeshi; Uehara, Toshiisa; Hayashida, Kohei; Sumiyoshi, Tetsuya; Haze, Kazuo

    1988-04-01

    A 72-year-old woman with acute myocardial infarction was received coronary thrombolytic therapy. After percutaneous transluminal coronary recanalization (PTCR), the stenosis of LAD became from 99 % to 90 %. Left ventriculogram showed dyskinesis of anterior wall in acute phase. After PTCR, she complained of postinfarctional angina. Thus, in order to evaluate the viability of anterior wall, serial thallium scintigraphy was performed at rest, which showed perfusion defect and redistribution of anterior wall. After percutaneous transluminal coronary angioplasty (PTCA), anterior wall motion became almost normal. The perfusion defect of anterior wall was also gradually disappeared. The serial thallium scintigraphy at rest is an useful method not only to evaluate the viability of myocardium in acute myocardial infarction, but also to follow the effect of PTCA.

  3. Rearrangement of beta,gamma-unsaturated esters with thallium trinitrate: synthesis of indans bearing a beta-keto ester moiety

    Directory of Open Access Journals (Sweden)

    Silva Jr. Luiz F.

    2006-01-01

    Full Text Available The rearrangement of beta,gamma-unsaturated esters, such as 2-(3,4-dihydronaphthalen-1-yl-propionic acid ethyl ester, with thallium trinitrate (TTN in acetic acid leads to 3-indan-1-yl-2-methyl-3-oxo-propionic acid ethyl ester in good yield, through a ring contraction reaction. The new indans thus obtained feature a beta-keto ester moiety, which would be useful for further functionalization.

  4. Formic acid electrooxidation on thallium-decorated shape-controlled platinum nanoparticles: an improvement in electrocatalytic activity

    OpenAIRE

    Busó-Rogero, Carlos; Perales-Rondón, Juan V.; Farias, Manuel J.S.; Vidal-Iglesias, Francisco J.; Solla-Gullón, José; Herrero, Enrique; Feliu, Juan M.

    2014-01-01

    Thallium modified shape-controlled Pt nanoparticles were prepared and their electrocatalytic activity towards formic acid electrooxidation was evaluated in 0.5 M sulfuric acid. The electrochemical and in situ FTIR spectroscopic results show a remarkable improvement in the electrocatalytic activity, especially in the low potential region (around 0.1–0.2 V vs. RHE). Cubic Pt nanoparticles modified with Tl were found to be more active than the octahedral Pt ones in the entire range of Tl coverag...

  5. Usefulness and limitations of thallium-201 myocardial scintigraphy in delineating location and size of prior myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Niess, G.S.; Logic, J.R.; Russell, R.O. Jr.; Rackley, C.E.; Rogers, W.J.

    1979-05-01

    Thirty-two patients were evaluated at a mean of 7 +- 2 months after infarction with a 12-lead ECG, resting /sup 201/Tl myocardial scintigram, biplane left ventriculogram, and coronary angiograms. From the left ventriculogram, asynergy was quantified as percent abnormally contracting segment (% ACS), the percent of end-diastolic circumference which was either akinetic or dyskinetic. Using a computerized planimetry system, we expressed /sup 201/Tl perfusion defects as a percentage of total potential thallium uptake. Of 21 patients with ECG evidence of prior transmural infarction, a /sup 201/Tl defect was present in 20, and angiographic asynergy was present in all 21. The site of prior infarction by ECG agreed with the /sup 201/T1 defect location in 24 of 32 patients and with site of angiographic asynergy in 23 of 32 patients. Scintigraphic defects were present in only four of 10 patients with ACS less than or equal to 6%, but scintigraphic defects were found in 20 of 22 patients with ACS > 6%. Thallium defect size correlated marginally with angiographic left ventricular ejection fraction but correlated closely with angiographic % ACS. Thallium defect size was similar among patients with one-, two-, or three-vessel coronary artery disease (greater than or equal to 70% stenosis), but thallium defect size was larger in patients with electrocardiographic evidence of transmural infarction or pulmonary capillary wedge pressure > 12 mm Hg. Thus, resting /sup 201/T1 myocardial scintigraphy is useful in localizing and quantifying the extent of prior myocardial infarction, but is insensitive to small infarcts (ACS < 6%).

  6. Determination of thallium at ultra-trace levels in water and biological samples using solid phase spectrophotometry.

    Science.gov (United States)

    Amin, Alaa S; El-Sharjawy, Abdel-Azeem M; Kassem, Mohammed A

    2013-06-01

    A new simple, very sensitive, selective and accurate procedure for the determination of trace amounts of thallium(III) by solid-phase spectrophotometry (SPS) has been developed. The procedure is based on fixation of Tl(III) as quinalizarin ion associate on a styrene-divinylbenzene anion-exchange resin. The absorbance of resin sorbed Tl(III) ion associate is measured directly at 636 and 830 nm. Thallium(I) was determined by difference measurements after oxidation of Tl(I) to Tl(III) with bromine. Calibration is linear over the range 0.5-12.0 μg L(-1) of Tl(III) with relative standard deviation (RSD) of 1.40% (n=10). The detection and quantification limits are 150 and 495 ng L(-1) using 0.6 g of the exchanger. The molar absorptivity and Sandell sensitivity are also calculated and found to be 1.31×10(7) L mol(-1)cm(-1) and 0.00156 ng cm(-2), respectively. The proposed procedure has been successfully applied to determine thallium in water, urine and serum samples. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. The efficient removal of thallium from sintering flue gas desulfurization wastewater in ferrous metallurgy using emulsion liquid membrane.

    Science.gov (United States)

    Yang, Li; Xiao, Jiangping; Shen, Yi; Liu, Xian; Li, Wensong; Wang, Weiyan; Yang, Yunquan

    2017-11-01

    The removal of thallium ions in flue gas desulfurization wastewater from ferrous metallurgic industry was studied by emulsion liquid membrane (ELM) method using 2-ethylhexyl phosphoric acid-2-ethylhexyl ester (P507) as carrier, aviation kerosene (AK) as organic solvent, polyisobutylene succinimide (T154) as surfactant, polyisobutylene (PIB) as additive, and sulfuric acid as internal reagent. Some important influence parameters such as concentrations of carrier, surfactant and stripping agent, agitation speed, extraction time, volume ratios of feed solution to emulsion phase and internal phase to membrane phase, and their effects on the removal efficiency of Tl in the ELM process were investigated and optimized. Under the optimum operating conditions of 2% of carrier, 5% of surfactant, 0.5 M of stripping agent, 350 rpm of agitation speed, 12.5:1 of volume ratio of feed solution to emulsion phase, and 3:1 volume ratio of membrane to internal phase, the maximum extraction efficiency of thallium reached 99.76% within 15-min reaction time. The ICP-MS analysis indicated that the thallium concentration in treated wastewater was below 5 μg/L and could meet the emission standard demand for industrial wastewater enacted by the local government of Hunan province of China. Meanwhile, the extraction of impurity ions calcium and magnesium in the ELM system was investigated. The result showed that an acidic environment would be in favor of the removal of Tl from calcium and magnesium contained in wastewater. Graphical abstract ᅟ.

  8. Thallium isotopes in metallurgical wastes/contaminated soils: A novel tool to trace metal source and behavior.

    Science.gov (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Chrastný, Vladislav; Penížek, Vít; Teper, Leslaw; Cabala, Jerzy; Voegelin, Andreas; Zádorová, Tereza; Oborná, Vendula; Drábek, Ondřej; Holubík, Ondřej; Houška, Jakub; Pavlů, Lenka; Ash, Christopher

    2018-02-05

    Thallium (Tl) concentration and isotope data have been recorded for contaminated soils and a set of industrial wastes that were produced within different stages of Zn ore mining and metallurgical processing of Zn-rich materials. Despite large differences in Tl levels of the waste materials (1-500mgkg-1), generally small changes in ε205Tl values have been observed. However, isotopically lighter Tl was recorded in fly ash (ε205Tl∼-4.1) than in slag (ε205Tl∼-3.3), implying partial isotope fractionation during material processing. Thallium isotope compositions in the studied soils reflected the Tl contamination (ε205Tl∼-3.8), despite the fact that the major pollution period ended more than 30 years ago. Therefore, we assume that former industrial Tl inputs into soils, if significant, can potentially be traced using the isotope tracing method. We also suggest that the isotope redistributions occurred in some soil (subsurface) horizons, with Tl being isotopically heavier than the pollution source, due to specific sorption and/or precipitation processes, which complicates the discrimination of primary Tl. Thallium isotope analysis proved to be a promising tool to aid our understanding of Tl behavior within the smelting process, as well as its post-depositional dynamics in the environmental systems (soils). Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Thallium-isotopic compositions of euxinic sediments as a proxy for global manganese-oxide burial

    Science.gov (United States)

    Owens, Jeremy D.; Nielsen, Sune G.; Horner, Tristan J.; Ostrander, Chadlin M.; Peterson, Larry C.

    2017-09-01

    Thallium (Tl) isotopes are a new and potentially powerful paleoredox proxy that may track bottom water oxygen conditions based on the global burial flux of manganese oxides. Thallium has a residence time of ∼20 thousand years, which is longer than the ocean mixing time, and it has been inferred that modern oxic seawater is conservative with respect to both concentration and isotopes. Marine sources of Tl have nearly identical isotopic values. Therefore, the Tl sinks, adsorption onto manganese oxides and low temperature oceanic crust alteration (the dominant seawater output), are the primary controls of the seawater isotopic composition. For relatively short-term, ∼million years, redox events it is reasonable to assume that the dominant mechanism that alters the Tl isotopic composition of seawater is associated with manganese oxide burial because large variability in low temperature ocean crust alteration is controlled by long-term, multi-million years, average ocean crust production rates. This study presents new Tl isotope data for an open ocean transect in the South Atlantic, and depth transects for two euxinic basins (anoxic and free sulfide in the water column), the Cariaco Basin and Black Sea. The Tl isotopic signature of open ocean seawater in the South Atlantic was found to be homogeneous with ε205Tl = -6.0 ± 0.3 (±2 SD, n = 41) while oxic waters from Cariaco and the Black Sea are -5.6 and -2.2, respectively. Combined with existing data from the Pacific and Arctic Oceans, our Atlantic data establish the conservatism of Tl isotopes in the global ocean. In contrast, partially- and predominantly-restricted basins reveal Tl isotope differences that vary between open-ocean (-6) and continental material (-2) ε205Tl, scaling with the degree of restriction. Regardless of the differences between basins, Tl is quantitatively removed from their euxinic waters below the chemocline. The burial of Tl in euxinic sediments is estimated to be an order of magnitude

  10. Thallium isotopes as a potential tracer for the origin of cratonic eclogites

    Science.gov (United States)

    Nielsen, Sune G.; Williams, Helen M.; Griffin, William L.; O'Reilly, Suzanne Y.; Pearson, Norman; Viljoen, Fanus

    2009-12-01

    Cratonic eclogites are inferred to originate either from subducted ocean crust or mantle melts accreted onto the roots of continents. These models have different implications for the growth of continents, but it is currently difficult to determine the origin of individual eclogite suites. Upper ocean crust altered at low temperatures and marine sediments both display high thallium (Tl) concentrations and strongly fractionated Tl isotope signatures relative to the ambient upper mantle. In this study we carry out the first examination of the suitability of Tl isotopes as a tracer for an ocean-crust origin of cratonic eclogites. We have analysed the Tl isotope composition of clinopyroxene and garnet in six eclogites from the Kaalvallei and Bellsbank kimberlite pipes in South Africa. Minerals were pre-cleaned with an HCl leaching technique and the leachates display variably light Tl isotope ratios. These most likely reflect low-temperature hydrothermal alteration occurring after eruption of the kimberlite that carried the eclogites to the surface. The leached mineral pairs all display identical Tl isotope ratios, strongly suggesting that the source of the analysed Tl is identical for each mineral pair. It is, however, not possible to exclude the possibility that the analysed Tl originates from kimberlitic material that was not removed by the cleaning procedure. Only one of the six samples exhibits a Tl isotope composition different from ambient mantle. Assuming that the Tl isotope signatures indeed represent the eclogite minerals and not any form of contamination, the Tl isotope composition in this sample is consistent with containing a minor component (low temperatures. Thallium isotopes may become one of the most sensitive indicators for the presence of low-T altered ocean crust because of the stark contrast in Tl concentration and isotopic composition between the mantle and altered ocean crust. In fact, no other chemical or isotopic tracer could have provided an

  11. Thallium-201 SPECT in the diagnosis of head and neck cancer.

    Science.gov (United States)

    Valdés Olmos, R A; Balm, A J; Hilgers, F J; Koops, W; Loftus, B M; Tan, I B; Muller, S H; Hoefnagel, C A; Gregor, R T

    1997-06-01

    The accuracy of SPECT with 201Tl-chloride for the diagnosis of primary tumors, lymph node metastases and recurrences in head and neck cancer was evaluated for clinical applicability. SPECT images, obtained 60 min after administration of 150 MBq 201Tl-chloride, were compared with clinical, CT and/or MRI and histology results. In addition, whole-body images were obtained to detect distant metastases. In 79 patients studied for primary tumors (principally larynix, hypopharynx, oropharynx, nasopharynx and oral cavity), 201Tl SPECT correctly identified 69 of 73 (95% versus 88% for CT/MRI) histologically confirmed malignancies including 63 squamous-cell carcinomas. The method localized four occult naso- and oropharynx carcinomas not seen on CT/MRI and was correctly negative in two patients without tumor and in three of four patients with no confirmed primary tumor in the head and neck. With respect to regional spread, only patients who had cervical lymph node dissection were evaluated, and the findings were recorded per side of the neck. Thallium-201 SPECT correctly identified metastases in 31 of 36 neck dissections with proven lymph node involvement (86%), was correctly negative in nine and false-positive in one. Although the sensitivity of CT/MRI was clearly higher (97%), considerably more false-positive cases affected its accuracy (81% versus 87% for SPECT). In 30 patients investigated for recurrences, 201Tl SPECT correctly identified 27 of 29 microscopically confirmed tumor sites (93%) and was correctly negative in seven. Sensitivity of CT/MRI was lower (76%), and a greater number of false-positives (seven versus three for SPECT) further decreased its accuracy (64% versus 87% for SPECT). Distant metastases were detected in five patients. Thallium-201 SPECT appears to be an accurate method for the diagnosis of head and neck cancer. The method is particularly useful for detection of occult head and neck tumors and for assessing recurrences. It also may be of

  12. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland.

    Science.gov (United States)

    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata

    2015-01-01

    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50% of the spawn samples, levels exceeded 20 mgTl/kg d.w. The issue of maternal transfer of thallium from females to oocytes is discussed. Due to a significant accumulation of thallium, spawn analysis can be used as a sensitive indicator of the presence of this element in the environment and may replace more invasive methods that involve the killing of adult animals. In those regions that are abundant in Zn-Pb ores, the spawn of amphibians may be a very important source of thallium contamination for predators. From among all tissues of the Bukowno adult toads, the livers have shown the highest accumulation of thallium (mean 3.98 mg/kg d.w. and maximum value--18.63). For as many as 96.5% of livers, concentrations exceeded 1.0 mgTl/kg d.w. which is treated as indicative of poisoning.

  13. In-situ pre-concentration through repeated sampling and pyrolysis for ultrasensitive determination of thallium in drinking water by electrothermal atomic absorption spectrometry.

    Science.gov (United States)

    Liu, Liwei; Zheng, Huaili; Xu, Bincheng; Xiao, Lang; Chigan, Yong; Zhangluo, Yilan

    2018-03-01

    In this paper, a procedure for in-situ pre-concentration in graphite furnace by repeated sampling and pyrolysis is proposed for the determination of ultra-trace thallium in drinking water by graphite furnace atomic absorption spectrometry (GF-AAS). Without any other laborious enrichment processes that routinely result in analyte loss and contamination, thallium was directly concentrated in the graphite furnace automatically and subsequently subject to analysis. The effects of several key factors, such as the temperature for pyrolysis and atomization, the chemical modifier, and the repeated sampling times were investigated. Under the optimized conditions, a limit of detection of 0.01µgL -1 was obtained, which fulfilled thallium determination in drinking water by GB 5749-2006 regulated by China. Successful analysis of thallium in certified water samples and drinking water samples was demonstrated, with analytical results in good agreement with the certified values and those by inductively coupled plasma mass spectrometry (ICP-MS), respectively. Routine spike-recovery tests with randomly selected drinking water samples showed satisfactory results of 80-96%. The proposed method is simple and sensitive for screening of ultra-trace thallium in drinking water samples. Copyright © 2017. Published by Elsevier B.V.

  14. 12 CFR 204.4 - Computation of required reserves.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Computation of required reserves. 204.4 Section... RESERVE REQUIREMENTS OF DEPOSITORY INSTITUTIONS (REGULATION D) § 204.4 Computation of required reserves... liabilities during a 14-day computation period ending every second Monday. (e) For institutions that file a...

  15. 14 CFR 415.204-415.400 - [Reserved

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false 415.204-415.400 Section 415.204-415.400 Aeronautics and Space COMMERCIAL SPACE TRANSPORTATION, FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF... Preflight Tests 4.3.4Trajectory and Debris Dispersion Data 4.3.5Flight Hazard Areas and Safety Clear Zones 4...

  16. 34 CFR 303.204 - Payments to the jurisdictions.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 2 2010-07-01 2010-07-01 false Payments to the jurisdictions. 303.204 Section 303.204 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION AND REHABILITATIVE SERVICES, DEPARTMENT OF EDUCATION EARLY INTERVENTION PROGRAM FOR INFANTS AND...

  17. 5 CFR 530.204 - Payment of excess amounts.

    Science.gov (United States)

    2010-01-01

    ... Section 530.204 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY RATES AND SYSTEMS (GENERAL) Aggregate Limitation on Pay § 530.204 Payment of excess amounts. (a) An agency must pay the amounts that were deferred because they were in excess of the aggregate limitation...

  18. 9 CFR 204.3 - Delegation of authority.

    Science.gov (United States)

    2010-01-01

    ... 204.3 Animals and Animal Products GRAIN INSPECTION, PACKERS AND STOCKYARDS ADMINISTRATION (PACKERS AND STOCKYARDS PROGRAMS), DEPARTMENT OF AGRICULTURE ORGANIZATION AND FUNCTIONS Public Information § 204.3... Regional Supervisors of the Grain Inspection, Packers and Stockyards Administration (Packers and Stockyards...

  19. 14 CFR 125.204 - Portable electronic devices.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Portable electronic devices. 125.204... Equipment Requirements § 125.204 Portable electronic devices. (a) Except as provided in paragraph (b) of... operation of, any portable electronic device on any U.S.-registered civil aircraft operating under this part...

  20. 5 CFR 301.204 - Status and trial period.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Status and trial period. 301.204 Section... EMPLOYMENT Overseas Limited Appointment § 301.204 Status and trial period. (a) An overseas limited employee... she is required to serve a trial period of 1 year when given an overseas limited appointment of...

  1. 40 CFR 204.5-2 - National security exemptions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false National security exemptions. 204.5-2... PROGRAMS NOISE EMISSION STANDARDS FOR CONSTRUCTION EQUIPMENT General Provisions § 204.5-2 National security... for a national security exemption is required. (c) For purposes of section 11(d) of the Act, any...

  2. 41 CFR 50-204.69 - Nitrous oxide.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Nitrous oxide. 50-204.69..., Vapors, Fumes, Dusts, and Mists § 50-204.69 Nitrous oxide. The piped systems for the in-plant transfer and distribution of nitrous oxide shall be designed, installed, maintained, and operated in accordance...

  3. 41 CFR 105-72.204 - Special award conditions.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Special award conditions. 105-72.204 Section 105-72.204 Public Contracts and Property Management Federal Property Management... award conditions. If an applicant or recipient: (a) Has a history of poor performance, (b) Is not...

  4. 15 CFR 2011.204 - Entry of specialty sugars.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Entry of specialty sugars. 2011.204... UNITED STATES TRADE REPRESENTATIVE ALLOCATION OF TARIFF-RATE QUOTA ON IMPORTED SUGARS, SYRUPS AND MOLASSES Specialty Sugar § 2011.204 Entry of specialty sugars. An importer or the importer's agent must...

  5. 22 CFR 204.14 - Transferability of guaranty; Note Register.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Transferability of guaranty; Note Register. 204.14 Section 204.14 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT HOUSING GUARANTY STANDARD... Assignee may assign, transfer or pledge the Eligible Notes to any Eligible Investor. Any such assignment...

  6. 22 CFR 204.15 - Paying agent obligations.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Paying agent obligations. 204.15 Section 204.15 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT HOUSING GUARANTY STANDARD TERMS AND CONDITIONS The... pursuant to the Paying and Transfer Agency Agreement shall not impair the Investor's or any Assignee's...

  7. 14 CFR 1214.204 - Patent and data rights.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Patent and data rights. 1214.204 Section... Substantial Investment in the STS Program § 1214.204 Patent and data rights. (a) When accommodating missions... purposes rights to inventions, patents and data resulting from such missions, subject to the user's...

  8. 6 CFR 27.204 - Minimum concentration by security issue.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Minimum concentration by security issue. 27.204... FACILITY ANTI-TERRORISM STANDARDS Chemical Facility Security Program § 27.204 Minimum concentration by... is present in a mixture, and the concentration of the chemical is equal to or greater than one...

  9. 44 CFR 204.3 - Definitions used throughout this part.

    Science.gov (United States)

    2010-10-01

    .... The ranking official responsible for overseeing the management of fire operations, planning, logistics... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Definitions used throughout this part. 204.3 Section 204.3 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY...

  10. The ECG component of Thallium-201 exercise testing impacts on cardiac intervention rates

    Energy Technology Data Exchange (ETDEWEB)

    Deague, J.; Salehi, N.; Grigg, L.; Lichtenstein, M.; Better, N. [Royal Melbourne Hospital, Parkville, VIC (Australia). Departments of Nuclear Medicine and Cardiology

    1998-06-01

    Full text: Thallium exercise testing (Tlex) offers superior sensitivity and specificity to exercise electrocardiography (ECG), but the value of the ECG data in Tlex remains poorly studied. While a normal Tlex is associated with an excellent prognosis, patients with a positive Tlex have a higher cardiac event rate. We aimed to see if a negative ECG Component of the Tlex (ECGTl) was associated with an improved outcome compared with a positive ECGTl, in those patients with a reversible Tlex defect. We followed 100 consecutive patients retrospectively with a reversible defect on Tlex (50 with negative and 50 with positive ECGTI) for 12 months. The ECG was reviewed as positive (1mm ST depression 0.08 seconds after J point or >2mm if on digoxin or prior ECG changes), negative, equivocal or uninterpretable. We excluded patients with pharmacological testing, and those with equivocal or uninterpretable ECGs. End-points included angiography, cardiac interventions and cardiac event rate (CER) incorporating unstable angina, acute myocardial infarction, and cardiac death. In conclusion 24% of patients with reversible defects on Tlex who had a negative ECGTI still proceeded to PTCA or CABG. Those with a positive ECGTI had a higher incidence of angiography and cardiac revascularisation, but this difference was only evident in patients with mild to moderate reversibility

  11. Redox-controlled release dynamics of thallium in periodically flooded arable soil.

    Science.gov (United States)

    Antić-Mladenović, Svetlana; Frohne, Tina; Kresović, Mirjana; Stärk, Hans-Joachim; Savić, Dubravka; Ličina, Vlado; Rinklebe, Jörg

    2017-07-01

    To our knowledge, this is the first work to mechanistically study the impact of the redox potential (E H ) and principal factors, such as pH, iron (Fe), manganese (Mn), dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), chlorides (Cl - ) and sulfates (SO 4 2- ), on the release dynamics of thallium (Tl) in periodically flooded soil. We simulated flooding using an automated biogeochemical microcosm system that allows for systematical control of pre-defined redox windows. The E H value was increased mechanistically at intervals of approximately 100 mV from reducing (-211 mV) to oxidizing (475 mV) conditions. Soluble Tl levels (0.02-0.28 μg L -1 ) increased significantly with increases in E H (r = 0.80, p soils along with a determination of the Tl species and monitoring of the Tl content in plants to achieve more detailed insight into soluble Tl behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. EFFECTS OF THALLIUM ON THE LARVAL DEVELOPMENT OF LUCILIA SERICATA MEIGEN 1826 AND PMI ESTIMATION

    Directory of Open Access Journals (Sweden)

    Arif Gökhan BAŞARAN

    2011-08-01

    Full Text Available Determination of larval growth rate of and forensic analysis of the age of Calliphoridae larvae on a corpse are useful evidence in legal investigations for the estimation of exact death time and time duration after death; post mortem interval. However many factors, such as temperature, tissue type and contamination of drugs and toxins, effect larval development of blow fly larvae and consequently theestimation of post mortem interval. The present study examined the larval growth rate of a forensically important blow fly species, Lucilia sericata Meigen 1826 in different concentrations (0,12; 0,25; 0,50; 1 and 2 μg/g of toxic heavy metal Thallium under controlled laboratory conditions. Body length and weight, death ratio of larvae and pupa between experimental and control groups were compared. Results demonstrated that the development rate of larvae between uncontaminated and contaminated diets varies significantly. In short, they molted later, reached maximum length more slowly and sometimesproduced significantly smaller pupae in contaminated food source. These results emphasized that the importance of determining the contamination rate of toxins in tissue for the forensic entomologist,while using development rates from standard curves based on larvae fed non-contaminated mediums.

  13. Value of transient dilation of the left ventricular cavity on stress thallium scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Sugihara, Hiroki; Shiga, Kouji; Umamoto, Ikuo (Kyoto Prefectural Univ. of Medicine (Japan)) (and others)

    1991-02-01

    This study was undertaken to evaluate the value of transient dilation of the left ventricular cavity on stress thallium scintigraphy in 80 patients with ischemic heart disease (IHD) and 50 with hypertrophic cardiomyopathy (HCM). Twenty persons without either coronary artery stenosis or heart disease were served as controls. Areas surrounded by maximum count points on the line of each 10deg on the short axis slice through the mid-cavity of the left ventricle were obtained at 10 minutes and at 3 hours after exercise. Transient dilation index (TDI) was obtained by dividing the area on early image by that on delayed image. TDI was significantly higher in patients with two or three vessel disease in the IHD group than the control group. High TDI was observed in 8% for one vessel disease, 40% for two vessel disease, and 80% for three vessel disease, contributing to the detection of multivessel IHD. In the HCM group of 80 patients, 24 (48%) had high TDI which was frequently associated with a history of chest pain and positive ECG findings at exercise. When these 24 HCM patients underwent exercise blood pool scintiscanning, left ventricular enddiastolic volume was similar before and at 10 minutes after exercise. These findings suggest that transient dilation of the left ventricular cavity after exercise may reflect subendocardial ischemia in both IHD and HCM. TDI would become a useful indicator for transient dilation of the left ventricular cavity. (N.K.).

  14. Clinicopathologic correlation study of thallium-201 myocardial scintigraphy in diagnosis of myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chida, Kouji; Sugiura, Masaya; Ohkawa, Shin-ichiro

    1987-05-01

    In a series of 1,000 consecutive autopsy cases, we evaluated the clinical utility of thallium-201 (Tl-201) myocardial scintigraphy and electrocardiography (ECG) in 101 patients who had been studied while alive. Fifty-five cases had myocardial infarctions (MI) at autopsy. The Tl-201 scintigram and ECG in diagnosis of MI showed sensitivities of 68 % and 60 %, specificities of 87 % and 83 %, and diagnostic accuracies of 76 % and 70 %, respectively. The sensitivity of the Tl-201 scintigram was 70 % in anterior MI, 80 % in postero-inferior MI, 25 % in lateral and subendocardial infarction. The sensitivity was 88 % for large massive MI, but was low in scattered (50 %) or middle-sized MI (17 %). The diagnostic limit of the resolution of Tl-201 scintigrams was 4.5 cm in long diameter. All 8 cases with MI of less than 4 cm could not be diagnosed with the technique. There were 48 cases of large MI (more than 5 cm), but 8 cases could not be diagnosed by scintigraphy because of non-transmural or scattered MI. A comparison of the Tl-201 scintigram and ECG showed that 27 cases out of 60 cases were diagnosed by both methods, 14 only by the Tl-201 scintigram, 9 only by ECG and 10 by neither method.

  15. Evaluation of myocardial damage in Duchenne's muscular dystrophy with thallium-201 myocardial SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Tamura, Takuhisa; Shibuya, Noritoshi (Kawatana National Hospital, Nagasaki (Japan)); Hashiba, Kunitake; Oku, Yasuhiko; Mori, Hideki; Yano, Katsusuke

    1993-01-01

    Myocardial damage and cardiopulmonary functions in patients with Duchenne's muscular dystrophy (DMD) were assessed using thallium-201 myocardial single-photon emission computed tomography (SPECT) and technetium-99m multigated radionuclide angiography. Twenty-five patients with DMD were divided into 4 groups according to percent of perfusion defect (%PD) calculated by the bull's-eye method and age. PD was detected in 24 (96.0%) of 25 patients with DMD, and it spread from the left ventricular lateral wall to the anterior wall and/or interventricular septum. PD was detected even in a 6-year-old DMD boy. Patients in Group I (%PD[>=]10% and age<15 years old) were shown to have a higher risk of left-sided heart failure without respiratory failure. Patients in Group II (%PD[>=]10 and age[>=]15) showed decreased pulmonary function and worsened arterial blood gas values as compared with Group IV (%PD<10 and age[>=]15). There was no significant difference in cardiac function among the 4 groups. It is postulated that myocardial damage in Group II patients is dependent primarily on a deficiency of dystrophin and on chronic respiratory failure, and that some of them are at risk of cardiopulmonary failure. It is concluded that myocardial SPECT is useful for the early diagnosis of myocardial damage and evaluation of cardiopulmonary function in DMD patients. (author).

  16. Role of relativity in high-pressure phase transitions of thallium.

    Science.gov (United States)

    Kotmool, Komsilp; Chakraborty, Sudip; Bovornratanaraks, Thiti; Ahuja, Rajeev

    2017-02-20

    We demonstrate the relativistic effects in high-pressure phase transitions of heavy element thallium. The known first phase transition from h.c.p. to f.c.c. is initially investigated by various relativistic levels and exchange-correlation functionals as implemented in FPLO method, as well as scalar relativistic scheme within PAW formalism. The electronic structure calculations are interpreted from the perspective of energetic stability and electronic density of states. The full relativistic scheme (FR) within L(S)DA performs to be the scheme that resembles mostly with experimental results with a transition pressure of 3 GPa. The s-p hybridization and the valence-core overlapping of 6s and 5d states are the primary reasons behind the f.c.c. phase occurrence. A recent proposed phase, i.e., a body-centered tetragonal (b.c.t.) phase, is confirmed with a small distortion from the f.c.c. phase. We have also predicted a reversible b.c.t. → f.c.c. phase transition at 800 GPa. This finding has been suggested that almost all the III-A elements (Ga, In and Tl) exhibit the b.c.t. → f.c.c. phase transition at extremely high pressure.

  17. High thallium concentrations in soils from sites of historical Ag, Pb, and Zn mining in western Małopolska (S Poland

    Directory of Open Access Journals (Sweden)

    Woch M. W.

    2013-04-01

    Full Text Available The aim of this study was to assess thallium concentration in topsoil originating from sites of historical mining of Ag, Pb and Zn in western Małopolska (S Poland. Soil samples were collected from 63 sites, sieved, ground and digested in hot HClO4. Thallium concentration was measured with an atomic absorption spectrometer. Thallium concentrations averaged 20.84 mg kg-1 and varied from 4.42 to 49.82 mg kg-1. In all studied soils they exceeded values typical for uncontaminated soils (0.02 to 2.8 mg Tl kg-1. This indicates that Tl contamination may threaten the environment and public health. Routine monitoring of Tl contamination in southern Poland is required.

  18. Preconcentration of thallium(III) with 2,6-bis( N-phenyl carbamoyl) pyridine on microcrystalline naphthalene prior to its trace determination in human serum spectrophotometrically

    Science.gov (United States)

    Rezaei, B.; Meghdadi, S.; Majidi, N.

    2007-05-01

    A novel, simple, sensitive and effective method has been developed for preconcentration of thallium on 2,6-bis( N-phenyl carbamoyl)pyridine-naphthalene adsorbent in the pH range 5.0-10.0, prior to its spectrophotometric determination, based on the oxidation of bromopyrogallol red at λ = 518 nm. This method makes it possible to quantitize thallium in the range of 3.0 × 10 -9 to 1.0 × 10 -5 M, with a detection limit (S/N = 3) of 1.2 × 10 -9 M. This procedure has been successfully applied to determine the ultra trace levels of thallium in the environmental and biological samples, free from the interference of some diverse ions. The precision, expressed as relative standard deviation of three measurements is better than 4.17%.

  19. Biphasic thallium 201 SPECT-imaging for the noninvasive diagnosis of myocardial perfusion abnormalities in a child with Kawasaki disease--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Hausdorf, G.; Nienaber, C.A.; Spielman, R.P.

    1988-02-01

    The mucocutaneous lymph node syndrome (Kawasaki disease) is of increasing importance for the pediatric cardiologist, for coronary aneurysms with the potential of thrombosis and subsequent stenosis can develop in the course of the disease. The authors report a 2 1/2-year-old female child in whom, fourteen months after the acute phase of Kawasaki disease, myocardial infarction occurred. Biphasic thallium 201 SPECT-imaging using dipyridamole depicted anterior wall ischemia and inferolateral infarction. This case demonstrates that noninvasive vasodilation-redistribution thallium 201 SPECT-imaging has the potential to predict reversible myocardial perfusion defects and myocardial necrosis, even in small infants with Kawasaki disease.

  20. Influence of the Dirac-Hartree-Fock starting potential on the parity-nonconserving electric-dipole-transition amplitudes in cesium and thallium

    Science.gov (United States)

    Perger, W. F.; Das, B. P.

    1987-01-01

    The parity-nonconserving electric-dipole-transition amplitudes for the 6s1/2-7s1/2 transition in cesium and the 6p1/2-7p1/2 transition in thallium have been calculated by the Dirac-Hartree-Fock method. The effects of using different Dirac-Hartree-Fock atomic core potentials are examined and the transition amplitudes for both the length and velocity gauges are given. It is found that the parity-nonconserving transition amplitudes exhibit a greater dependence on the starting potential for thallium than for cesium.

  1. Assessment of myocardial viability by dynamic tomographic iodine 123 iodophenylpentadecanoic acid imaging: comparison with rest-redistribution thallium 201 imaging.

    Science.gov (United States)

    Iskandrian, A S; Powers, J; Cave, V; Wasserleben, V; Cassell, D; Heo, J

    1995-01-01

    This study examined the ability of dynamic 123I-labeled iodophenylpentadecanoic acid (IPPA) imaging to detect myocardial viability in patients with left ventricular (LV) dysfunction caused by coronary artery disease. Serial 180-degree single-photon emission computed tomographic (SPECT) images (five sets, 8 minutes each) were obtained starting 4 minutes after injection of 2 to 6 mCi 123I at rest in 21 patients with LV dysfunction (ejection fraction [EF] 34% +/- 11%). The segmental uptake was compared with that of rest-redistribution 201Tl images (20 segments/study). The number of perfusion defects (reversible and fixed) was similar by IPPA and thallium (11 +/- 5 vs 10 +/- 5 segments/patient; difference not significant). There was agreement between IPPA and thallium for presence or absence (kappa = 0.78 +/- 0.03) and nature (reversible, mild fixed, or severe fixed) of perfusion defects (kappa = 0.54 +/- 0.04). However, there were more reversible IPPA defects than reversible thallium defects (7 +/- 4 vs 3 +/- 4 segments/patient; p = 0.001). In 14 patients the EF (by gated pool imaging) improved after coronary revascularization from 33% +/- 11% to 39% +/- 12% (p = 0.002). The number of reversible IPPA defects was greater in the seven patients who had improvement in EF than in the patients without such improvement (10 +/- 4 vs 5 +/- 4 segments/patient; p = 0.075). 123I-labeled IPPA SPECT imaging is a promising new technique for assessment of viability. Reversible defects predict recovery of LV dysfunction after coronary revascularization.

  2. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) of the thallium superconducting phases

    Science.gov (United States)

    Bayya, S. S.; Snyder, R. L.

    1994-05-01

    This paper explores the speed of reaction as a parameter to minimizing thallium loss. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) were developed for the synthesis of Tl-2212 and Tl-2223 superconductors using Cu metal powder as a fuel. A kitchen microwave oven was used to carry out MACS reactions. The samples were reacted for few seconds and led to the formation of the superconducting phases. Further explorations and modifications in the processing could lead to the formation of single phases by MACS.

  3. Tracking along-arc sediment inputs to the Aleutian arc using thallium isotopes

    Science.gov (United States)

    Nielsen, Sune G.; Yogodzinski, Gene; Prytulak, Julie; Plank, Terry; Kay, Suzanne M.; Kay, Robert W.; Blusztajn, Jerzy; Owens, Jeremy D.; Auro, Maureen; Kading, Tristan

    2016-05-01

    Sediment transport from the subducted slab to the mantle wedge is an important process in understanding the chemical and physical conditions of arc magma generation. The Aleutian arc offers an excellent opportunity to study sediment transport processes because the subducted sediment flux varies systematically along strike (Kelemen et al., 2003) and many lavas exhibit unambiguous signatures of sediment addition to the sub-arc mantle (Morris et al., 1990). However, the exact sediment contribution to Aleutian lavas and how these sediments are transported from the slab to the surface are still debated. Thallium (Tl) isotope ratios have great potential to distinguish sediment fluxes in subduction zones because pelagic sediments and low-temperature altered oceanic crust are highly enriched in Tl and display heavy and light Tl isotope compositions, respectively, compared with the upper mantle and continental crust. Here, we investigate the Tl isotope composition of lavas covering almost the entire Aleutian arc a well as sediments outboard of both the eastern (DSDP Sites 178 and 183) and central (ODP Hole 886C) portions of the arc. Sediment Tl isotope compositions change systematically from lighter in the Eastern to heavier in the Central Aleutians reflecting a larger proportion of pelagic sediments when distal from the North American continent. Lavas in the Eastern and Central Aleutians mirror this systematic change to heavier Tl isotope compositions to the west, which shows that the subducted sediment composition is directly translated to the arc east of Kanaga Island. Moreover, quantitative mixing models of Tl and Pb, Sr and Nd isotopes reveal that bulk sediment transfer of ∼0.6-1.0% by weight in the Eastern Aleutians and ∼0.2-0.6% by weight in the Central Aleutians can account for all four isotope systems. Bulk mixing models, however, require that fractionation of trace element ratios like Ce/Pb, Cs/Tl, and Sr/Nd in the Central and Eastern Aleutians occurs after

  4. Controls on thallium uptake during hydrothermal alteration of the upper ocean crust

    Science.gov (United States)

    Coggon, Rosalind M.; Rehkämper, Mark; Atteck, Charlotte; Teagle, Damon A. H.; Alt, Jeffrey C.; Cooper, Matthew J.

    2014-11-01

    Hydrothermal circulation is a fundamental component of global biogeochemical cycles. However, the magnitude of the high temperature axial hydrothermal fluid flux remains disputed, and the lower temperature ridge flank fluid flux is difficult to quantify. Thallium (Tl) isotopes behave differently in axial compared to ridge flank systems, with Tl near-quantitatively stripped from the intrusive crust by high temperature hydrothermal reactions, but added to the lavas during low temperature reaction with seawater. This contrasting behavior provides a unique approach to determine the fluid fluxes associated with axial and ridge flank environments. Unfortunately, our understanding of the Tl isotopic mass balance is hindered by poor knowledge of the mineralogical, physical and chemical controls on Tl-uptake by the ocean crust. Here we use analyses of basaltic volcanic upper crust from Integrated Ocean Drilling Program Hole U1301B on the Juan de Fuca Ridge flank, combined with published analyses of dredged seafloor basalts and upper crustal basalts from Holes 504B and 896A, to investigate the controls on Tl-uptake by mid-ocean ridge basalts and evaluate when in the evolution of the ridge flank hydrothermal system Tl-uptake occurs. Seafloor basalts indicate an association between basaltic uptake of Tl from cold seawater and uptake of Cs and Rb, which are known to partition into K-rich phases. Although there is no clear relationship between Tl and K contents of seafloor basalts, the data do not rule out the incorporation of at least some Tl into the same minerals as the alkali elements. In contrast, we find no relationship between the Tl content and either the abundance of secondary phyllosilicate minerals, or the K, Cs or Rb contents in upper crustal basalts. We conclude that the uptake of Tl and alkali elements during hydrothermal alteration of the upper crust involves different processes and/or mineral phases compared to those that govern seafloor weathering. Furthermore

  5. Chemistry and phase evolution during roasting of toxic thallium-bearing pyrite.

    Science.gov (United States)

    Lopez-Arce, Paula; Garcia-Guinea, Javier; Garrido, Fernando

    2017-08-01

    In the frame of a research project on microscopic distribution and speciation of geogenic thallium (Tl) from contaminated mine soils, Tl-bearing pyrite ore samples from Riotinto mining district (Huelva, SW Spain) were experimentally fired to simulate a roasting process. Concentration and volatility behavior of Tl and other toxic heavy metals was determined by quantitative ICP-MS, whereas semi-quantitative mineral phase transitions were identified by in situ thermo X-Ray Diffraction (HT-XRD) and Scanning Electron Microscopy with Energy Dispersive Spectroscopy (SEM-EDS) analyses after each firing temperature. Sample with initial highest amount of quartz (higher Si content), lowest quantity of pyrite and traces of jarosite (lower S content) developed hematite and concentrated Tl (from 10 up to 72 mg kg-1) after roasting at 900 °C in an oxidizing atmosphere. However, samples with lower or absent quartz content and higher pyrite amount mainly developed magnetite, accumulating Tl between 400 and 500 °C and releasing Tl from 700 up to 900 °C (from 10-29 mg kg-1 down to 4-1 mg kg-1). These results show the varied accumulative, or volatile, behaviors of one of the most toxic elements for life and environment, in which oxidation of Tl-bearing Fe sulfides produce Fe oxides wastes with or without Tl. The initial chemistry and mineralogy of pyrite ores should be taken into account in coal-fired power stations, cement or sulfuric acid production industry involving pyrite roasting processes, and steel, brick or paint industries, which use iron ore from roasted pyrite ash, where large amounts of Tl entail significant environmental pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Measurement of the parity nonconserving neutral weak interaction in atomic thallium

    Energy Technology Data Exchange (ETDEWEB)

    Bucksbaum, P.H.

    1980-11-01

    This thesis describes an experiment to measure parity nonconservation in atomic thallium. A frequency doubled, flashlamp pumped tunable dye laser is used to excite the 6P/sub 1/2/(F = 0) ..-->.. 7P/sub 1/2/(F = 1) transition at 292.7 nm, with circularly polarized light. An electrostatic field E of 100 to 300 V/cm causes this transition to occur via Stark induced electric dipole. Two field free transitions may also occur: a highly forbidden magnetic dipole M, and a parity nonconserving electric dipole epsilon/sub P/. The latter is presumed to be due to the presence of a weak neutral current interaction between the 6p valence electron and the nucleus, as predicted by gauge theories which unite the electromagnetic and weak interactions. Both M and epsilon/sub P/ interfere with the Stark amplitude ..beta..E to produce a polarization of the 7P/sub 1/2/ state. This is measured with a circularly polarized infrared laser beam probe, tuned to the 7P/sub 1/2/ ..-->.. 8S/sub 1/2/ transition. This selectively excites m/sub F/ = +1 or -1 components of the 7P/sub 1/2/ state, and the polarization is seen as an asymmetry in 8S ..-->.. 6P/sub 3/2/ fluorescence when the probe helicity is reversed. The polarization due to M is ..delta../sub M/ = -2M/(BETAE). It is used to calibrate the analyzing efficiency. The polarization due to epsilon/sub P/ is ..delta../sub P/ = 2i epsilon/sub P//(..beta..E), and can be distinguished from ..delta../sub M/ by its properties under reversal of the 292.7 nm photon helicity and reversal of the laser direction. A preliminary measurement yielded a parity violation in agreement with the gauge theory of Weinberg and Salam.

  7. MRI and thallium-201 SPECT in the prediction of survival in glioma

    Energy Technology Data Exchange (ETDEWEB)

    Vos, Maaike J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Medical Center Haaglanden, Department of Neurology, PO Box 432, The Hague (Netherlands); Berkhof, Johannes [VU University Medical Center, Department of Epidemiology and Biostatistics, Amsterdam (Netherlands); Hoekstra, Otto S. [VU University Medical Center, Department of Nuclear Medicine and PET Research, Amsterdam (Netherlands); Bosma, Ingeborg; Sizoo, Eefje M.; Heimans, Jan J.; Reijneveld, Jaap C.; Postma, Tjeerd J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Sanchez, Esther [VU University Medical Center, Department of Radiology, Amsterdam (Netherlands); Lagerwaard, Frank J. [VU University Medical Center, Department of Radiation Oncology, Amsterdam (Netherlands); Buter, Jan [VU University Medical Center, Department of Medical Oncology, Amsterdam (Netherlands); Noske, David P. [VU University Medical Center, Department of Neurosurgery and Neuro-Oncology Research Group, Amsterdam (Netherlands)

    2012-06-15

    This paper aims to study the value of MRI and Thallium 201 ({sup 201}Tl) single-photon emission computed tomography (SPECT) in the prediction of overall survival (OS) in glioma patients treated with temozolomide (TMZ) and to evaluate timing of radiological follow-up. We included patients treated with TMZ chemoradiotherapy for newly diagnosed glioblastoma multiforme (GBM) and with TMZ for recurrent glioma. MRIs and {sup 201}Tl SPECTs were obtained at regular intervals. The value of both imaging modalities in predicting OS was examined using Cox regression analyses. Altogether, 138 MRIs and 113 {sup 201}Tl SPECTs in 46 patients were performed. Both imaging modalities were strongly related to OS (P {<=} 0.02). In newly diagnosed GBM patients, the last follow-up MRI (i.e., after six adjuvant TMZ courses) and SPECT (i.e., after three adjuvant TMZ courses) were the strongest predictors of OS (P = 0.01). In recurrent glioma patients, baseline measurements appeared to be the most predictive of OS (P < 0.01). The addition of one imaging modality to the other did not contribute to the prediction of OS. Both MRI and {sup 201}Tl SPECT are valuable in the prediction of OS. It is adequate to restrict to one of both modalities in the radiological follow-up during treatment. In the primary GBM setting, MRI after six adjuvant TMZ courses contributes significantly to the prediction of survival. In the recurrent glioma setting, baseline MRI appears to be a powerful predictor of survival, whereas follow-up MRIs during TMZ seem to be of little additional value. (orig.)

  8. Synthesis, calorimetric, structural and conductivity studies in a new thallium selenate tellurate adduct compound

    Energy Technology Data Exchange (ETDEWEB)

    Ktari, L. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Abdelhedi, M. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France); Bouhlel, N. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Dammak, M., E-mail: meddammak@yahoo.fr [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Cousson, A. [Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France)

    2009-08-05

    The crystal structure of the thallium selenate tellurate Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} (TlSeTe) was determined by X-ray diffraction method. The title compound crystallizes in the monoclinic system with P2{sub 1}/c space group. The following parameters are: a = 12.358(3) A; b = 7.231(1) A; c = 11.986(2) A; {beta} = 111.092(2){sup o}; Z = 4. The structure can be regarded as being built of isolated TeO{sub 6} octahedra and SeO{sub 4} tetrahedra. The Tl{sup +} cations are intercalated between these kinds of polyhedra. The main feature of this structure is the coexistence of two different and independent anions (SeO{sub 4}{sup 2-} and TeO{sub 6}{sup 6-}) in the same unit cell. The structure is stable due to O-H...O hydrogen bonds which link tetrahedral and octahedral groups. Crystals of Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} undergo three endothermal transitions at 373, 395 and 437 K. These transitions are detected by DSC and analyzed by dielectric measurements with impedance spectroscopy. The evolution of conductivity versus temperature showed the presence of a protonic conduction phase transition at 437 K. The phase transition at 373 K can be related to a structural phase transition, whereas the one at 395 K is ascribed as likely due to a ferroelectric-paraelectric phase transition.

  9. Electrochemical properties of modified copper-thallium hexacyanoferrate electrode in the presence of different univalent cations

    Energy Technology Data Exchange (ETDEWEB)

    Rutkowska, Iwona A.; Stroka, Jadwiga [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland); Galus, Zbigniew [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland)], E-mail: zbgalus@chem.uw.edu.pl

    2008-04-20

    The preparation of copper(II) hexacyanoferrate (CuHCF) films on the surface of gold electrodes as well as their characterization in solutions of various alkali metal and NH{sub 4}{sup +} cations and in the presence of thallium(I) are described. The electrochemical quartz crystal microbalance and cyclic voltammetric techniques were used. In 0.50 M lithium nitrate, even at submillimolar concentration of Tl(I), the formal potential of CuHCF was shifted to more positive values. At higher Tl(I) concentrations, the formal potential of the CuHCF redox reaction changed linearly with the logarithm of Tl(I) concentration (in the 0.50 M solution of lithium or another alkali metal nitrate). From such dependencies, selectivity coefficients K{sub Tl/M} were calculated, and they show that the CuHCF film on the gold electrode interacts preferentially with Tl(I). High affinity of Tl(I) to copper hexacyanoferrate, that was observed in the presence of alkali metal cations, was explained by relatively strong donor-acceptor interactions of Tl(I) ions with nitrogen in CN groups of the CuHCF film. It was also shown for simple M{sub 4}[Fe(CN){sub 6}] metal ferrocyanate salts (where M = Li{sup +}, Na{sup +}, K{sup +}, Rb{sup +}, Cs{sup +} and Tl{sup +}) that there is a preferential interaction of Tl{sup +} with CN group consistent with formation of a Tl-NC-Fe bridge.

  10. Quantitative evaluation of thallium-201 myocardial scintigram in coronary artery diseases

    Energy Technology Data Exchange (ETDEWEB)

    Mikada, Ken-etsu (Akita Univ. (Japan). School of Medicine)

    1992-11-01

    Quantitative indices from circumferential profile curves of thallium-201 ([sup 201]Tl) myocardial scintigram were evaluated for diagnostic utility in coronary artery diseases (CAD). Myocardial [sup 201]Tl scintigrams with single photon emission computed tomography (SPECT) were obtained 5 minutes (early) and 4 hours (delayed) after exercise in 20 normal subjects and 66 cases of CAD, of which 20 were angina pectoris without myocardial infarction (AP), 14 were subendocardial infarction (non-QMI) and 32 were Q-wave infarction (QMI). Tl counts, %Tl uptake and washout ratio (WR) were measured in 81 segments (9 apical segments of the slice from the longitudinal axis and all 72 segments of two slices from the short axis). A mean early defect (MED), a mean delayed defect (MDD), a mean delta washout rate (MDR), and a [Sigma] delayed defect ([Sigma]DD) were calculated from the areas which were below the two standard deviations of the mean %Tl uptake in normal subjects. A mean filling-in (MFI) was calculated from the difference of the %Tl uptake between early and delayed curves in each patient. In patients with CAD, the MED and MFI were higher, but MDW was lower with a more severe coronary stenosis, indicating that these indices were useful to detect myocardial hypo-perfuion. In severely stenotic regions, the MDD was higher in QMI than in AP and non-QMI, indicating that the ratio of infarct to the myocardium in the region was higher in QMI. In QMI, [Sigma]DD correlated well (r=0.723) with Total Wall Motion Scores with two-dimentional echocardiography which was directly related with infarct size. Further, MED, MFI and MDW were improved after aortocoronary bypass only in patients with patent graft. It is concluded that this quantitative evaluation with [sup 201]Tl-SPECT can provide an objective and quantitative estimate of regional myocardial ischemia and infarct. (author).

  11. Thallium-201 for cardiac stress tests: residual radioactivity worries patients and security.

    Science.gov (United States)

    Geraci, Matthew J; Brown, Norman; Murray, David

    2012-12-01

    A 47-year-old man presented to the Emergency Department (ED) in duress and stated he was "highly radioactive." There were no reports of nuclear disasters, spills, or mishaps in the local area. This report discusses the potential for thallium-201 (Tl-201) patients to activate passive radiation alarms days to weeks after nuclear stress tests, even while shielded inside industrial vehicles away from sensors. Characteristics of Tl-201, as used for medical imaging, are described. This patient was twice detained by Homeland Security Agents and searched after he activated radiation detectors at a seaport security checkpoint. Security agents deemed him not to be a threat, but they expressed concern regarding his health and level of personal radioactivity. The patient was subsequently barred from his job and sent to the hospital. Tl-201 is a widely used radioisotope for medical imaging. The radioactive half-life of Tl-201 is 73.1h, however, reported periods of extended personal radiation have been seen as far out as 61 days post-administration. This case describes an anxious, but otherwise asymptomatic patient presenting to the ED with detection of low-level personal radiation. Documentation should be provided to and carried by individuals receiving radionuclides for a minimum of five to six half-lives of the longest-lasting isotope provided. Patients receiving Tl-201 should understand the potential for security issues; reducing probable tense moments, confusion, and anxiety to themselves, their employers, security officials, and ED staff. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Usefulness of thallium-201 SPECT in the evaluation of tumor natures in intracranial meningiomas

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, Tetsuji; Nakano, Takahiro; Asano, Kenichiroh; Shimamura, Norihito; Ohkuma, Hiroki [Hirosaki University Graduate School of Medicine, Department of Neurosurgery, Hirosaki (Japan)

    2011-11-15

    Although intracranial meningiomas are regarded as benign tumors, some of them behave clinically as malignant tumors. Past reports suggest that MIB 1 and vascular endothelial growth factor (VEGF) in postoperative tumor specimens correlate with the aggressive nature of tumors, but preoperative prediction of such a nature is more useful for therapeutic planning for the tumor. The purpose of this study was to assess the usefulness of preoperative thallium-201 chloride single-photon emission computed tomography (Tl SPECT) to evaluate biological behavior in intracranial meningiomas. Tl SPECT was performed on 39 patients with intracranial meningioma and Tl uptake indices were calculated. The difference in the Tl uptake index between atypical meningiomas and other pathological types of meningioma was evaluated. Moreover, correlation of Tl uptake indices with the MIB1 labeling index was estimated. Tl uptake indices were also compared between VEGF strongly positive and weakly positive meningiomas. The delayed index of atypical meningioma was significantly higher than that of the other pathological types (p = 0.036). Significant correlation was found between the Tl uptake index in the delayed image and MIB1 labeling index (p < 0.0001, R{sup 2} = 0.36). Moreover, VEGF strongly positive meningiomas exhibited a significantly higher Tl uptake index compared to VEGF weakly positive meningiomas in both the early image and the delayed image (p = 0.029, 0.023, respectively). Tl uptake index may be a possible preoperative surrogate marker of MIB1 and VEGF that is useful in detecting aggressive natures in intracranial meningiomas. (orig.)

  13. Effective removal of trace thallium from surface water by nanosized manganese dioxide enhanced quartz sand filtration.

    Science.gov (United States)

    Huangfu, Xiaoliu; Ma, Chengxue; Ma, Jun; He, Qiang; Yang, Chun; Zhou, Jian; Jiang, Jin; Wang, Yaan

    2017-12-01

    Thallium (Tl) has drawn wide concern due to its high toxicity even at extremely low concentrations, as well as its tendency for significant accumulation in the human body and other organisms. The need to develop effective strategies for trace Tl removal from drinking water is urgent. In this study, the removal of trace Tl (0.5 μg L -1 ) by conventional quartz sand filtration enhanced by nanosized manganese dioxide (nMnO 2 ) has been investigated using typical surface water obtained from northeast China. The results indicate that nMnO 2 enhanced quartz sand filtration could remove trace Tl(I) and Tl(III) efficiently through the adsorption of Tl onto nMnO 2 added to a water matrix and onto nMnO 2 attached on quartz sand surfaces. Tl(III)-HA complexes might be responsible for higher residual Tl(III) in the effluent compared to residual Tl(I). Competitive Ca 2+ cations inhibit Tl removal to a certain extent because the Ca 2+ ions will occupy the Tl adsorption site on nMnO 2 . Moreover, high concentrations of HA (10 mgTOC L -1 ), which notably complexes with and dissolves nMnO 2 (more than 78%), resulted in higher residual Tl(I) and Tl(III). Tl(III)-HA complexes might also enhance Tl(III) penetration to a certain extent. Additionally, a higher pH level could enhance the removal of trace Tl from surface water. Finally, a slight increase of residual Tl was observed after backwash, followed by the reduction of the Tl concentration in the effluent to a "steady" state again. The knowledge obtained here may provide a potential strategy for drinking water treatment plants threatened by trace Tl. Copyright © 2017. Published by Elsevier Ltd.

  14. 36 CFR 20.4 - Revocation of permits; appeal.

    Science.gov (United States)

    2010-07-01

    ... INTERIOR ISLE ROYALE NATIONAL PARK; COMMERCIAL FISHING § 20.4 Revocation of permits; appeal. The Director... the Secretary, relating to the Park. A permittee, however, shall have the right to appeal to the...

  15. Reduced left ventricular cavitary activity ("black hole sign") in thallium-201 SPECT perfusion images of anteroapical transmural myocardial infarction.

    Science.gov (United States)

    Civelek, A C; Shafique, I; Brinker, J A; Durski, K; Weiss, J L; Links, J M; Natarajan, T K; Ozguven, M A; Wagner, H N

    1991-11-01

    Apparently reduced left ventricular (LV) cavitary thallium activity in both planar and tomographic perfusion images has been previously observed by these and other investigators. With single-photon emission computerized tomography, we have clinically noted that this "black hole sign" was associated with an aneurysm in the setting of a transmural anterior or anteroapical perfusion defect. We have now prospectively studied the etiology and predictive value of this sign in 84 consecutive patients with an anterior, anteroapical transmural perfusion defect. Of the 84 patients, 49 had both LV aneurysm (confirmed by contrast ventriculography, echocardiography or gated blood pool studies) and a black hole sign. Only 1 patient with an aneurysm did not have the black hole sign, and 2 without aneurysm did. Thus, it is concluded that this sign is highly accurate in diagnosing LV aneurysm. Because thallium-201 single-photon emission computerized tomography imaging is often performed as one of the first diagnostic tests soon after myocardial infarction, this has important clinical management implications.

  16. Pentoxifylline (Trental) does not inhibit dipyridamole-induced coronary hyperemia: Implications for dipyridamole-thallium-201 myocardial imaging

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Slinker, B.K. (Univ. of Vermont College of Medicine, Burlington (USA))

    1990-06-01

    Dipyridamole-thallium-201 imaging is often performed in patients unable to exercise because of peripheral vascular disease. Many of these patients are taking pentoxifylline (Trental), a methylxanthine derivative which may improve intermittent claudication. Whether pentoxifylline inhibits dipyridamole-induced coronary hyperemia like other methylxanthines such as theophylline and should be stopped prior to dipyridamole-thallium-201 imaging is unknown. Therefore, we studied the hyperemic response to dipyridamole in seven open-chest anesthetized dogs after pretreatment with either pentoxifylline (0, 7.5, or 15 mg/kg i.v.) or theophylline (3 mg/kg i.v.). Baseline circumflex coronary blood flows did not differ significantly among treatment groups. Dipyridamole significantly increased coronary blood flow before and after 7.5 or 15 mm/kg i.v. pentoxifylline (p less than 0.002). Neither dose of pentoxifylline significantly decreased the dipyridamole-induced hyperemia, while peak coronary blood flow was significantly lower after theophylline (p less than 0.01). We conclude that pentoxyifylline does not inhibit dipyridamole-induced coronary hyperemia even at high doses.

  17. Thallium-201 scintigraphy after dipyridamole infusion with low-level exercise. III Clinical significance and additional diagnostic value of ST segment depression and angina pectoris during the test

    NARCIS (Netherlands)

    G-J. Laarman (GertJan); P.W.J.C. Serruys (Patrick); J.F. Verzijlbergen (Fred); C.A.P.L. Ascoop (Carl); J. Azar

    1990-01-01

    textabstractIntravenous dipyridamole thallium testing is a useful alternative procedure for assessing coronary artery disease (CAD) in patients who are unable to perform maximal exercise tests. Ischaemic ST segment depression and angina pectoris are frequently observed during the test, in particular

  18. Indium-111 antimyosin antibody imaging and thallium-201 imaging. A comparative myocardial scintigraphic study using single-photon emission computed tomography in patients with myocarditis and dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Takehiko; Matsumori, Akira; Nohara, Ryuji; Konishi, Junji; Sasayama, Shigetake [Kyoto Univ. (Japan). Faculty of Medicine; Tamaki, Nagara

    1997-10-01

    Indium-111 antimyosin antibody imaging (a tracer of myocardial necrosis) and thallium-201 imaging (a tracer of myocardial perfusion) were compared in patients with myocarditis and dilated cardiomyopathy. The distribution of each tracer and antimyosin/thallium-201 overlapping were evaluated with single-photon emission computed tomography (SPECT). Scintigraphic data were classified into 5 patterns according to the distribution of both images and were compared with histologic findings of endomyocardial biopsy: AM-D, intense and diffuse antimyosin uptake and no perfusion abnormality (active myocarditis); AM-L, localized antimyosin uptake and no perfusion abnormality (active myocarditis); HM, no antimyosin uptake with or without perfusion abnormality (healed myocarditis); DCM-NH, diffuse antimyosin uptake and inhomogeneous thallium-201 uptake (dilated cardiomyopathy); DCM-PD, diffuse or localized antimyosin uptake and myocardial perfusion defect(s) (dilated cardiomyopathy). Patients with dilated-phase hypertrophic cardiomyopathy were frequently found in the DCM-PD group. Taken together, comparative antimyosin/thallium-201 SPECT images are useful for evaluating the activity of myocarditis and ongoing myocardial damage even in areas with no perfusion in patients with dilated cardiomyopathy. (author)

  19. Thallium-201 myocardial scintigraphy in patients with normal coronary arteries and normal left ventriculogram. Comparison with hemodynamic, metabolic and morphologic findings

    Energy Technology Data Exchange (ETDEWEB)

    Loesse, B.; Kuhn, H.; Rafflenbeul, D.; Kroenert, H.; Hort, W.; Feinendegen, L.E.; Loogen, F.

    1980-01-01

    36 consecutive patients with chest pain and/or severe ventricular dysrhythmias, but normal coronary arteries and normal left ventriculogram, underwent thallium-201 myocardial imaging at rest and during exercise. The myocardial scintigram was abnormal in 27 patients (group A) and normal in only 9 patients (group B).

  20. Preconcentration of thallium (I) by single drop microextraction with electrothermal atomic absorption spectroscopy detection using dicyclohexano-18-crown-6 as extractant system.

    Science.gov (United States)

    Chamsaz, Mahmoud; Arbab-Zavar, Mohammad Hossien; Darroudi, Abolfazl; Salehi, Thiery

    2009-08-15

    A simple single drop liquid-phase microextraction (SDME) technique, combined with electrothermal atomic absorption spectroscopy (ETAAS) is developed both to preconcentrate and determine thallium (I) ions in aqueous solutions. The ions were transferred from 10.0 ml of aqueous sample (donor phase) containing 0.5 ml of 1% picric acid as the ion-pair agent into a 3 microl microdrop of nitrobenzene (acceptor phase) containing dicyclohexano-18-crown-6 as the complexing agent. The latter will help to improve the extraction efficiency of the analyte. After the ions have been extracted, the acceptor drop was directly injected into a graphite furnace for thallium (I) determination. Several parameters such as the extracting solvent, extraction time, temperature, concentration of picric acid and crown ether, drop volume and stirring rate were examined. Under the optimized experimental conditions, the detection limit (L.O.D.) was 0.7 ng ml(-1). The relative standard deviation for five replicate analysis of 10 ng ml(-1) of thallium (I) was 5.1%. The calibration curve was linear in the range of 3-22 ng ml(-1). The results for determination of thallium in reference material, spiked tap water and seawater demonstrated the accuracy, recovery and applicability of the presented method. The enrichment factor was 50.

  1. Synthesis and application of a novel nanostructured ion-imprinted polymer for the preconcentration and determination of thallium(I) ions in water samples

    Energy Technology Data Exchange (ETDEWEB)

    Fayazi, M., E-mail: maryamfayazi64@yahoo.com [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, M. [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Taher, M.A. [Department of Chemistry, Faculty of Sciences, Shahid Bahonar University of Kerman, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, R. [Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of); Salavati, M.R. [Department of Chemistry, Faculty of Science, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of)

    2016-05-15

    Highlights: • A novel nanostructured thallium(I)-imprinted polymer was evaluated for trace detection of Tl(I). • The prepared sorbent displayed rapid extraction rate, high sensitivity and good reproducibility. • The proposed methodology was applied for quantification of Tl(I) in different water samples. - Abstract: A novel synthesized nanostructured ion-imprinted polymer (IIP) was investigated for the determination of trace amount of thallium(I). For this purpose, the thallium(I) IIP particles were synthesized using methacrylic acid (MAA) as the functional monomer, ethylene glycol dimethacrylate (EGDMA) as the cross-linker, methyl-2-[2-(2-2-[2-(methoxycarbonyl) phenoxy] ethoxyethoxy) ethoxy] benzoate as the chelating agent and 2,2-azobisisobutyronitrile (AIBN) as the initiator. The prepared IIP particles were characterized by field emission scanning electron microscopy (FE-SEM), Fourier transform infrared spectroscopy (FT-IR) and thermo gravimetric analysis (TGA). Various experimental factors such as pH, the amount of IIP particles, sorption and desorption time, sample volume, elution condition, and potentially interfering ions systematically examined. Under the optimum conditions, a sensitive response to Tl(I) within a wide concentration range (0.05–18 μg L{sup −1}) was achieved. The limit of detection (LOD, 3S{sub b}/m) was 6.3 ng L{sup −1}. The maximum adsorption capacity of the novel imprinted adsorbent for Tl(I) was calculated to be 18.3 mg g{sup −1}. The relative standard deviation (RSD) for eight replicate detections of 0.1 μg L{sup −1} of thallium(I) was found to be 4.0%. An enrichment factor (EF) of 100 was obtained by this method. The proposed technique was successfully applied to monitoring thallium in different water samples and the certified reference material.

  2. L-Tyrosine immobilized on multiwalled carbon nanotubes: A new substrate for thallium separation and speciation using stabilized temperature platform furnace-electrothermal atomic absorption spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco, Pablo H.; Gil, Raul A. [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina); Smichowski, Patricia, E-mail: smichows@cnea.gov.ar [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Rivadavia 1917, CP C1033 AAJ, Ciudad de Buenos Aires (Argentina); Comision Nacional de Energia Atomica, Gerencia Quimica, Av. Gral. Paz 1499, B1650KNA San Martin (Argentina); Polla, Griselda [Comision Nacional de Energia Atomica, Gerencia de Investigacion y Aplicaciones, Av.Gral. Paz 1499, B1650KNA San Martin (Argentina); Martinez, Luis D., E-mail: ldm@unsl.edu.ar [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina)

    2009-12-10

    An approach for the separation and determination of inorganic thallium species is described. A new sorbent, L-tyrosine-carbon nanotubes (L-tyr-CNTs), was used and applied to the analysis of tap water samples. At pH 5.0, L-tyr was selective only towards Tl(III), while total thallium was determined directly by stabilized temperature platform furnace-electrothermal atomic absorption spectrometry (STPF-ETAAS). The Tl(III) specie, which was retained by L-tyrosine, was quantitatively eluted from the column with 10% of nitric acid. An on-line breakthrough curve was used to determine the column capacity, which resulted to be 9.00 {mu}mol of Tl(III) g{sup -1} of L-tyr-CNTs with a molar ratio of 0.14 (moles of Tl bound to moles of L-tyr at pH 5). Transient peak areas revealed that Tl stripping from the column occurred instantaneously. Effects of sample flow rate, concentration and flow rate of the eluent, and interfering ions on the recovery of the analyte were systematically investigated. The detection limit for the determination of total thallium (3{sigma}) by STPF-ETAAS was 150 ng L{sup -1}. The detection limit (3{sigma}) for Tl(III) employing the separation system was 3 ng L{sup -1}, with an enrichment factor of 40. The precision of the method expressed as the relative standard deviation (RSD) resulted to be 3.4%. The proposed method was applied to the speciation and determination of inorganic thallium in tap water samples. The found concentrations were in the range of 0.88-0.91 {mu}g L{sup -1} of Tl(III), and 3.69-3.91 {mu}g L{sup -1} of total thallium.

  3. Tracing subducted sediment inputs to the Ryukyu arc-Okinawa Trough system: Evidence from thallium isotopes

    Science.gov (United States)

    Shu, Yunchao; Nielsen, Sune G.; Zeng, Zhigang; Shinjo, Ryuichi; Blusztajn, Jerzy; Wang, Xiaoyuan; Chen, Shuai

    2017-11-01

    Sediments are actively subducted in virtually every arc worldwide. However, quantifying their contributions to arc lavas and thereby establishing budgets of how sediments participate in slab-mantle interaction is challenging. In this contribution we use thallium (Tl) abundances and isotopic compositions of lavas from the Ryukyu arc (including south Kyushu) and its back-arc basin, Okinawa Trough, to investigate the influence of sediments from arc to back-arc. We also present extensive geochemical data for sediments and altered oceanic crust (AOC) outboard of the northern (DSDP Sites 296, 442B, 443 and 444) and central (DSDP Sites 294 and 295) part of the Ryukyu arc. The Tl isotopic compositions of sediments change systematically from lighter outboard of northern Ryukyu arc to heavier outboard of central Ryukyu arc. The feature reflects the dominance of terrigenous material and pelagic sedimentation outboard of the northern and central Ryukyu arc, respectively. Central and northern sections of Ryukyu arc and Okinawa Trough display larger range of Tl isotopic variation than southern section, which is consistent with more pelagic provenance for sediments outboard of central and northern Ryukyu arcs than that of expected sediments outboard of southern Ryukyu arc. Identical Tl, Sr, Nd and Pb isotope variations are found when comparing arc and back arc lavas, which indicates that sediments fluxes also account for the Tl isotopic variations in the Okinawa Trough lavas. Two-end-member mixing models of Tl with Pb, Sr and Nd isotopes require sediment inputs ofsediment end members predict very similar sediment fluxes when using Tl, Sr, Nd and Pb isotopes, which indicates that fractionation of these elements must have happened after mixing between mantle and sediments. This conclusion is corroborated by model calculations of mixing between sediment melts with fractionated Sr/Nd ratios and mantle wedge, which show that no arc lava plot on such mixing lines. Thus bulk sediment

  4. Comparison of arbutamine stress and treadmill exercise thallium-201 SPECT: Hemodynamics, safety profile and diagnostic accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Kiat, H.; Berman, D.S. [Cedars-Sinai Medical Centre, Los Angeles, California, LA (United States)

    1998-02-01

    Full text: Arbutamine (ARB), a new pharmacologic stress agent with enhanced chronotropic property compared to dobutamine, was compared with treadmill (TM) exercise testing (Ex) in a multicenter study using thallium-201 (Tl) SPECT. Of the total of 184 patients who underwent ARB, 69 also had TM stress and quantitative coronary angiography. Fifty-eight patients with a low pretest likelihood of CAD also underwent ARB study for evaluation of test specificity (normalcy rate). Tl scans were scored by a central laboratory using a 20 segment (seg)/scan visual analysis (5 point system: 0=normal, 4-absent uptake). Maximum heart rate (HR) by ARB and Ex was 122 vs 141 bpm (p<0.05). Mean %HR change from baseline was similar (79% vs 82%, respectively, p=ns). Maximum systolic BP for ARB and Ex was 173 vs 175 mmHg, and mean % change from baseline was 24% vs 28% (p=ns). Sensitivity for detecting CAD (270% stenosis) by ARB Tl was 94% and 97% by Ex Tl (p=ns). Stress Tl SPECT segmental agreement for presence of defect between ARB and Ex was 92% (kappa=0.8, p<0.001). Exact segmental stress Tl score (0-4 grading) agreement was 83 % (kappa=0.7, p<0.001). Among 346 segs with stress defects by both ARB and Ex defect reversibility agreement was 86% (kappa=0.7, p<0.001). The normalcy rate for ARB TI-SPECT among patients with a low likelihood of CAD was 90%. Adverse events were mostly mild (tremor: 23%, flushing: 10%, headache: 10%, paraesthesia: 8%, dizziness: 8%, hot flushes: 4%). Arrhythimia of clinical concern occurred in 8% (10/122) of ARB patients who had cardiac catheterisation and in 1.4% (1/69) of patients who had stress Tl. Of all 184 patients with ARB stress, ARB was discontinued due to arrhythmia in 7(5%) and 1 patient had IV Metoprolol for frequent ventricular couplets. Sustained arrhythmias were not observed

  5. Thallium Isotopes Tracking Mn-Oxide Burial - A Proxy for Deoxygenation During Oceanic Anoxic Event 2

    Science.gov (United States)

    Ostrander, C.; Owens, J. D.; Nielsen, S.

    2015-12-01

    Thallium (Tl) is proving to be a useful paleoredox proxy given that the Tl isotope composition of seawater is highly dependent on the magnitude of manganese (Mn) oxide burial in the ocean. In turn, Mn oxides require oxygen at the sediment-water interface to precipitate, linking the Tl isotope cycle to ocean oxygenation. Currently, the marine residence time of Tl is ~20kyrs and the Tl isotope composition of seawater is invariant, which suggests Tl isotopes could be a global tracer of marine Mn-oxide burial. Importantly, recent research suggests sediments deposited under a euxinic water column faithfully record the Tl isotope value of the overlying oxic water column (e.g. Black Sea and Cariaco Basin). Therefore, analysis of organic-rich black shales may prove useful in evaluating the seawater Tl isotope composition of past oceans and, hence, large-scale burial of Mn-oxides and the extent of bottom water ocean oxygenation. A logical test for this proxy is during the well-studied Cenomanian-Turonian boundary event termed Oceanic Anoxic Event 2 (OAE-2) at ~94 Ma. It is known that the global extent of anoxia and euxinia increased during this event, however, to what extent global bottom water deoxygenation occured is unconstrained. If deep water deoxygenation occurred, it would be hypothesized that Mn-oxide precipitation would decrease, resulting in a positive Tl isotope excursion during OAE-2. We have analyzed the Tl isotope composition of organic-rich black shales from Site 1258 of the Ocean Drilling Program (ODP) spanning the period before, during, and after OAE-2. Based on Fe redox proxies, the entire section is euxinic and thus no Mn-oxides are present (i.e. no local redox changes). Before the event, Tl isotope compositions are similar or slightly heavier than modern seawater values. Just prior to the onset of OAE-2, a positive shift occurs and is maintained until recovery, slightly before the termination of the event. The shift to heavier values and subsequent

  6. Geochemical translocation of thallium in the sediments from the North River, China

    Science.gov (United States)

    Liu, J.

    2016-12-01

    Thallium (Tl) is a highly toxic rare heavy metal. As a sulphophile element, it usually occurs in numerous sulphide minerals (such as pyrite, galena, sphlerite). Guangdong north region, known as the hometown of nonferrous metals, has abundant containing Tl mineral resources. Numerous industrial activities, such as mining, smelting, and electroplating are also flourishing. In 2010, a serious Tl pollution in the North River (a major river in the Northern Guangdong Province) shocked the society. The Tl pollution in water appeared to be under control after that incident. But in fact, even if the wastewater discharge of pollution sources has been controlled, the potential risk of heavy metal pollution in the sediments of the North River still exists, for the metals are easy to precipitate and accumulate into sediment from water. So far, Tl pollution in sediments has been studied to a very limited extent. In this paper, we investigated the content and vertical distribution characteristics of Tl and some other related heavy metals in a typical sediment profile from the North River by using inductively coupled plasma mass spectrometry (ICP-MS). Then the Pb isotopic compositions in the sediments were measured by using multi-inductively coupled plasma mass spectrometry (MC-ICP-MS). Several sediments from typical layers were also subjected to sequential extraction procedure for investigating the geochemical fractions of Tl. The risk of Tl and other metal pollution was finally assessed by calculating geo-accumulation indexes (Igeo) and potential ecological risk. The results showed that: (1) Tl concentrations range 1.03 mg/kg to 3.13 mg/kg with a mean of 1.89 mg/kg, three times higher than that in local background soil; (2) Tl content generally increased with depth with some fluctuations and significant correlations were found between Tl and Pb, Zn, Cd, Cu, and Ni; (3) About 46 % to 70 % in sediment cores were resided in the residual fraction; (4) Igeo showed that the studied

  7. Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact

    Science.gov (United States)

    Hu, Ningjing; Liu, Jihua; Shi, Xuefa

    2015-04-01

    Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact Hu Ningjing, Liu Jihua, Shi Xuefa First Institute of Oceanography, State Oceanic Administration, Qingdao 266061, China Thallium (Tl), a non-essential and highly toxic trace metal, is listed as priority toxic pollutant by the United States Environmental Protection Agency (USEPA) (Keith and Telliard, 1979). However, its geochemical cycling in aquatic environment has received far less attention than that of many other trace metals. This has been attributed to relatively little commercial interest in Tl and, until recently, problems inherent in its detection at environmental concentrations (Meeravali and Jiang, 2008). In this study, we investigated the sources, distribution and fate of Tl in surface sediments of the Bohai Sea (BS), China, based on the datasets of total Tl and chemical speciation of Tl of 408 surface sediment samples in the total entire BS. The enrichment factors and chemical speciation of Tl indicated that Tl in BS was dominated by natural Tl, although anthropogenic Tl contamination was observed in the Liuguhe River mouth; the mud deposits are the sinks of Tl and the regional currents and tide systems play a key role on the accumulation of Tl in BS. The distribution of Tl consistent with that of MnO and Fe2O3 as well as the level of Fe-Mn fraction is relatively high, indicating MnO and Fe2O3 influence the geochemical behaviors of Tl in the BS. Although the positive correlation between Tl and TOC is observed for the samples in the BS, however, level of Tl in oxidizable faction could be neglected, suggesting TOC might not be a major factor affecting the concentration of Tl in BS. The low proportion of Tl in the non-residual fraction dominated by the Fe-Mn oxides suggested that the labile Tl was controlled by the Fe-Mn oxides and Tl has a low bioavailability and a minor potential threat to biota in BS. Acknowledgements: this work

  8. Fractionation and Mobility of Thallium in Volcanic Ashes after Eruption of Eyjafjallajökull (2010) in Iceland.

    Science.gov (United States)

    Karbowska, Bozena; Zembrzuski, Wlodzimierz

    2016-07-01

    Volcanic ash contains thallium (Tl), which is highly toxic to the biosphere. The aim of this study was to determine the Tl concentration in fractions of volcanic ash samples originating from the Eyjafjallajökull volcano. A sequential extraction scheme allowed for a study of element migration in the environment. Differential pulse anodic stripping voltammetry using a flow measuring system was selected as the analytical method to determine Tl content. The highest average content of Tl in volcanic ash was determined in the fraction entrapped in the aluminosilicate matrix (0.329 µg g(-1)), followed by the oxidizable fraction (0.173 µg g(-1)). The lowest content of Tl was found in the water soluble fraction (0.001 µg g(-1)); however, this fraction is important due to the fact that Tl redistribution among all the fractions occurs through the aqueous phase.

  9. Determination of gold, indium, tellurium and thallium in the same sample digest of geological materials by atomic-absorption spectroscopy and two-step solvent extraction

    Science.gov (United States)

    Hubert, A.E.; Chao, T.T.

    1985-01-01

    A rock, soil, or stream-sediment sample is decomposed with hydrofluoric acid, aqua regia, and hydrobromic acid-bromine solution. Gold, thallium, indium and tellurium are separated and concentrated from the sample digest by a two-step MIBK extraction at two concentrations of hydrobromic add. Gold and thallium are first extracted from 0.1M hydrobromic acid medium, then indium and tellurium are extracted from 3M hydrobromic acid in the presence of ascorbic acid to eliminate iron interference. The elements are then determined by flame atomic-absorption spectrophotometry. The two-step solvent extraction can also be used in conjunction with electrothermal atomic-absorption methods to lower the detection limits for all four metals in geological materials. ?? 1985.

  10. 9 CFR 113.204 - Mink Enteritis Vaccine, Killed Virus.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Mink Enteritis Vaccine, Killed Virus..., DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.204 Mink Enteritis Vaccine, Killed Virus. Mink Enteritis Vaccine...

  11. 40 CFR 156.204 - Modification and waiver of requirements.

    Science.gov (United States)

    2010-07-01

    ... accordance with § 154.25(c) of this chapter that a pesticide should be placed in Special Review because the pesticide meets or exceeds the criteria for human health effects of § 154.7(a)(1)(2) or (6) of this chapter...) PESTICIDE PROGRAMS LABELING REQUIREMENTS FOR PESTICIDES AND DEVICES Worker Protection Statements § 156.204...

  12. 204 Chandra N Farm and Swapan K Ghosh

    Indian Academy of Sciences (India)

    204 Chandra N Farm and Swapan K Ghosh. Figure 4. Calculated density profiles of the ions and the solvent molecules at selected values of wall separation; ( ----- ' -): counter-ions, (--~-~-~»): co—ions, ( ): solvent molecules. (system parameters as in figure 3). experimentally observed forces in neutral liquids. With a view to ...

  13. 41 CFR 50-204.75 - Transportation safety.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Transportation safety. 50... Transportation Safety § 50-204.75 Transportation safety. Any requirements of the U.S. Department of Transportation under 49 CFR Parts 171-179 and Parts 390-397 and 14 CFR Part 103 shall be applied to...

  14. 41 CFR 50-204.5 - Machine guarding.

    Science.gov (United States)

    2010-07-01

    .... Milling machines. Power saws. Jointers. Portable power tools. Forming rolls and calenders. (d) Revolving...) Machines designed for a fixed location shall be securely anchored to prevent walking or moving. ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Machine guarding. 50-204...

  15. 23 CFR 230.204 - Implementation of supportive services.

    Science.gov (United States)

    2010-04-01

    ... 230.204 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION CIVIL RIGHTS EXTERNAL... the State highway agency provides supportive services by contract, formal advertising is not required by FHWA; however, the State highway agency shall solicit proposals from such qualified sources as...

  16. 44 CFR 204.53 - Certifying costs and payments.

    Science.gov (United States)

    2010-10-01

    ... Procedures § 204.53 Certifying costs and payments. (a) By submitting applicants' Project Worksheets to us, the Grantee is certifying that all costs reported on applicant Project Worksheets were incurred for work that was performed in compliance with FEMA laws, regulations, policy and guidance applicable to...

  17. 48 CFR 204.470-2 - National security exclusion.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false National security... Within Industry 204.470-2 National security exclusion. (a) The U.S.-IAEA AP permits the United States... associated with such activities, with direct national security significance. (b) In order to ensure that all...

  18. 14 CFR 1216.204 - General implementation requirements.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false General implementation requirements. 1216... QUALITY Floodplain and Wetlands Management § 1216.204 General implementation requirements. (a) Each NASA... roadways, bridges and utility systems in coastal floodplains or wetlands which provide long-term support...

  19. 5 CFR 870.204 - Annual rates of pay.

    Science.gov (United States)

    2010-01-01

    ..., subpart M, of this chapter. (b) To convert a pay rate of other than annual salary to an annual rate... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Annual rates of pay. 870.204 Section 870... rates of pay. (a) (1) An insured employee's annual pay is his/her annual rate of basic pay as fixed by...

  20. 41 CFR 50-204.10 - Occupational noise exposure.

    Science.gov (United States)

    2010-07-01

    ... CONTRACTS General Safety and Health Standards § 50-204.10 Occupational noise exposure. (a) Protection against the effects of noise exposure shall be provided when the sound levels exceed those shown in Table... conservation program shall be administered. Table I permissible noise exposures 1 Duration per day, hours Sound...

  1. 15 CFR 970.204 - Environmental and use conflict analysis.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Environmental and use conflict... REGULATIONS OF THE ENVIRONMENTAL DATA SERVICE DEEP SEABED MINING REGULATIONS FOR EXPLORATION LICENSES Applications Contents § 970.204 Environmental and use conflict analysis. (a) Environmental information. To...

  2. 5 CFR 734.204 - Participation in political organizations.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Participation in political organizations... SERVICE REGULATIONS (CONTINUED) POLITICAL ACTIVITIES OF FEDERAL EMPLOYEES Permitted Activities § 734.204 Participation in political organizations. An employee may: (a) Be a member of a political party or other...

  3. 31 CFR 587.204 - Evasions; attempts; conspiracies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Evasions; attempts; conspiracies. 587... MONTENEGRO) MILOSEVIC SANCTIONS REGULATIONS Prohibitions § 587.204 Evasions; attempts; conspiracies. (a... after the effective date that evades or avoids, has the purpose of evading or avoiding, or attempts to...

  4. 31 CFR 541.204 - Evasions; attempts; conspiracies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Evasions; attempts; conspiracies. 541... § 541.204 Evasions; attempts; conspiracies. (a) Except as otherwise authorized, and notwithstanding any... the purpose of evading or avoiding, or attempts to violate any of the prohibitions set forth in this...

  5. 31 CFR 588.204 - Evasions; attempts; conspiracies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Evasions; attempts; conspiracies. 588... Prohibitions § 588.204 Evasions; attempts; conspiracies. (a) Except as otherwise authorized, and... avoids, has the purpose of evading or avoiding, or attempts to violate any of the prohibitions set forth...

  6. 31 CFR 536.204 - Evasions; attempts; conspiracies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Evasions; attempts; conspiracies. 536... Prohibitions § 536.204 Evasions; attempts; conspiracies. Any transaction for the purpose of, or which has the... set forth in this part, is hereby prohibited. Any attempt to violate the prohibitions set forth in...

  7. 31 CFR 597.204 - Evasions; attempts; conspiracies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Evasions; attempts; conspiracies. 597... REGULATIONS Prohibitions § 597.204 Evasions; attempts; conspiracies. Any transaction for the purpose of, or... the prohibitions set forth in this part, is hereby prohibited. Any attempt to violate the prohibitions...

  8. 31 CFR 598.204 - Evasions; attempts; conspiracies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Evasions; attempts; conspiracies. 598... REGULATIONS Prohibitions § 598.204 Evasions; attempts; conspiracies. Except to the extent provided in... the effect of evading or avoiding, and any endeavor, attempt, or conspiracy to violate any of the...

  9. 48 CFR 52.204-8 - Annual Representations and Certifications.

    Science.gov (United States)

    2010-10-01

    ..., Central Contractor Registration. (iv) 52.204-5, Women-Owned Business (Other Than Small Business). This... will exceed the simplified acquisition threshold and the contract is not for acquisition of commercial...) Alternate I. ___(x) 52.227-15, Representation of Limited Rights Data and Restricted Computer Software. (d...

  10. 42 CFR 460.204 - Financial recordkeeping and reporting requirements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Financial recordkeeping and reporting requirements...-INCLUSIVE CARE FOR THE ELDERLY (PACE) Data Collection, Record Maintenance, and Reporting § 460.204 Financial... financial statements. (c) Accepted reporting practices. Except as specified under Medicare principles of...

  11. 17 CFR 204.77 - Referrals to collection agencies.

    Science.gov (United States)

    2010-04-01

    ... RELATING TO DEBT COLLECTION Miscellaneous: Credit Bureau Reporting, Collection Services § 204.77 Referrals to collection agencies. (a) The Commission has authority to contract for collection services to... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Referrals to collection...

  12. Ginseng Purified Dry Extract, BST204, Improved Cancer Chemotherapy-Related Fatigue and Toxicity in Mice

    National Research Council Canada - National Science Library

    Park, Hyun-Jung; Shim, Hyun Soo; Kim, Jeom Yong; Kim, Joo Young; Park, Sun Kyu; Shim, Insop

    2015-01-01

    .... BST204 was prepared by incubating crude ginseng extract with ginsenoside-β-glucosidase. The purpose of the present study was to examine the effects of BST204, mixture of ginsenosides on 5-fluorouracil...

  13. 41 CFR 50-204.6 - Medical services and first aid.

    Science.gov (United States)

    2010-07-01

    ... first aid. 50-204.6 Section 50-204.6 Public Contracts and Property Management Other Provisions Relating... SUPPLY CONTRACTS General Safety and Health Standards § 50-204.6 Medical services and first aid. (a) The... trained to render first aid. First aid supplies approved by the consulting physician shall be readily...

  14. 40 CFR 204.57-7 - Acceptance and rejection of batch sequence.

    Science.gov (United States)

    2010-07-01

    ... sequence. 204.57-7 Section 204.57-7 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 204.57-7 Acceptance and rejection of batch sequence. (a) The manufacturer will continue to inspect consecutive batches until the batch sequence is accepted or rejected. The batch sequence will be accepted or...

  15. 41 CFR 50-204.35 - Application for variations from radiation levels.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Application for variations from radiation levels. 50-204.35 Section 50-204.35 Public Contracts and Property Management Other... FOR FEDERAL SUPPLY CONTRACTS Radiation Standards § 50-204.35 Application for variations from radiation...

  16. 12 CFR 204.122 - Secondary market activities of international banking facilities.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Secondary market activities of international banking facilities. 204.122 Section 204.122 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF...) Interpretations § 204.122 Secondary market activities of international banking facilities. (a) Questions have been...

  17. 40 CFR 721.4587 - Lithium manganese oxide (LiMn204) (generic name).

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Lithium manganese oxide (LiMn204... Specific Chemical Substances § 721.4587 Lithium manganese oxide (LiMn204) (generic name). (a) Chemical... as lithium manganese oxide (LiMn204) (P-96-175) is subject to reporting under this section for the...

  18. 31 CFR 538.204 - Prohibited importation of goods or services from Sudan.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Prohibited importation of goods or services from Sudan. 538.204 Section 538.204 Money and Finance: Treasury Regulations Relating to Money and... REGULATIONS Prohibitions § 538.204 Prohibited importation of goods or services from Sudan. Except as otherwise...

  19. 44 CFR 204.23 - Processing a request for a fire management assistance declaration.

    Science.gov (United States)

    2010-10-01

    ... ASSISTANCE GRANT PROGRAM Declaration Process § 204.23 Processing a request for a fire management assistance... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Processing a request for a fire management assistance declaration. 204.23 Section 204.23 Emergency Management and Assistance...

  20. 12 CFR 747.204 - Notice of intention to terminate insured status.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Notice of intention to terminate insured status. 747.204 Section 747.204 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS AFFECTING... Status § 747.204 Notice of intention to terminate insured status. Unless correction of the practices...

  1. 48 CFR 52.204-5 - Women-Owned Business (Other Than Small Business).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Women-Owned Business (Other Than Small Business). 52.204-5 Section 52.204-5 Federal Acquisition Regulations System FEDERAL... Provisions and Clauses 52.204-5 Women-Owned Business (Other Than Small Business). As prescribed in 4.607(b...

  2. 41 CFR 109-38.204-50 - Records of exempted motor vehicles.

    Science.gov (United States)

    2010-07-01

    ... motor vehicles. 109-38.204-50 Section 109-38.204-50 Public Contracts and Property Management Federal... AVIATION, TRANSPORTATION, AND MOTOR VEHICLES 38-MOTOR EQUIPMENT MANAGEMENT 38.2-Registration, Identification, and Exemptions § 109-38.204-50 Records of exempted motor vehicles. The Director, Office of...

  3. 48 CFR 25.204 - Evaluating offers of foreign construction material.

    Science.gov (United States)

    2010-10-01

    ... foreign construction material. 25.204 Section 25.204 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS FOREIGN ACQUISITION Buy American Act-Construction Materials 25.204 Evaluating offers of foreign construction material. (a) Offerors proposing to use foreign...

  4. 48 CFR 1325.204 - Evaluating offers of foreign construction material.

    Science.gov (United States)

    2010-10-01

    ... foreign construction material. 1325.204 Section 1325.204 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE SOCIOECONOMIC PROGRAMS FOREIGN ACQUISITION Buy American Act-Construction Materials 1325.204 Evaluating offers of foreign construction material. The designee authorized to specify a...

  5. 48 CFR 625.204 - Evaluating offers of foreign construction material.

    Science.gov (United States)

    2010-10-01

    ... foreign construction material. 625.204 Section 625.204 Federal Acquisition Regulations System DEPARTMENT OF STATE SOCIOECONOMIC PROGRAMS FOREIGN ACQUISITION Buy American Act-Construction Materials 625.204 Evaluating offers of foreign construction material. (b) The head of the contracting activity is the agency...

  6. 48 CFR 204.7205 - Novation agreements, mergers and sales of assets.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Novation agreements, mergers and sales of assets. 204.7205 Section 204.7205 Federal Acquisition Regulations System DEFENSE... 204.7205 Novation agreements, mergers and sales of assets. Contracting officers shall process and...

  7. 48 CFR 204.7206 - Using CAGE codes to identify agents and brokers.

    Science.gov (United States)

    2010-10-01

    ... identify agents and brokers. 204.7206 Section 204.7206 Federal Acquisition Regulations System DEFENSE... 204.7206 Using CAGE codes to identify agents and brokers. Authorized agents and brokers are entities... code will be assigned to the agent/broker establishment in addition to any codes assigned to the...

  8. 5 CFR 2610.204 - When an application may be filed.

    Science.gov (United States)

    2010-01-01

    ....204 Section 2610.204 Administrative Personnel OFFICE OF GOVERNMENT ETHICS ORGANIZATION AND PROCEDURES IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT Information Required From Applicants § 2610.204 When an... the Office of Government Ethics' final disposition of the proceeding. (b) For purposes of this rule...

  9. Comparison of glucose-insulin-thallium-201 infusion single photon emission computed tomography (SPECT), stress-redistribution-reinjection thallium-201 SPECT and low dose dobutamine echocardiography for prediction of reversible dysfunction

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, Hiroki; Kondo, Makoto; Motohiro, Masayuki; Usami, Satoru [Shimada Municipal Hospital, Shizuoka (Japan)

    2001-12-01

    The usefulness of glucose-insulin-thallium-201 (GI-Tl) infusion single photon emission computed tomography (SPECT) in predicting reversible dysfunction has not been evaluated, so the present study recruited 20 patients with regional ischemic dysfunction for investigation. All patients underwent GI-Tl SPECT, post-stress Tl reinjection imaging and low dose dobutamine echocardiography. The diagnostic accuracy of these 3 techniques in predicting functional recovery was evaluated by receiver operating characteristic (ROC) analysis. In segments with functional recovery, regional Tl activities of GI-Tl SPECT were significantly higher than those of reinjection imaging (p<0.05), although there were no significant differences in segments without recovery. The area under the ROC curve for GI-Tl SPECT (0.75{+-}0.06) was greater than that for reinjection imaging (0.68{+-}0.07). The optimal cutoff values to identify viable myocardium were considered to be 55% of peak activity for GI-Tl SPECT and 50% for reinjection imaging. At this cutoff point, the sensitivity and specificity for detection of functional recovery were, respectively, 85% and 61% for GI-Tl SPECT, and 73% and 61% for reinjection imaging. Dobutamine echocardiography had the same sensitivity (85%), but lower specificity (48%) than GI-Tl SPECT. Continuous infusion of GI-Tl solution enhances regional Tl uptake compared with conventional post-stress reinjection imaging. This study suggests that GI-Tl SPECT is superior to reinjection imaging and dobutamine echocardiography in predicting functional recovery after ischemic left ventricular dysfunction. (author)

  10. Detection and dosimetry of gamma ray emitted from thallium-201 and technetium-99m based on chemiluminescence technique

    Energy Technology Data Exchange (ETDEWEB)

    Shourian, Mostafa [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Tavakoli, Hassan, E-mail: tavakoli@ibb.ut.ac.i [Faculty of Medicine, Department of Physiology and Biophysics, Faculty of Medicine, Baqiyatollah University of Medical Sciences, P.O. Box 19395-6558, Tehran (Iran, Islamic Republic of); Ghourchian, Hedayatollah, E-mail: hadi@ibb.ut.ac.i [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Rafiee-Pour, Hossain-Ali [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of)

    2010-09-15

    This report describes the detection and dosimetry of gamma ray emitted from Thallium-201 ({sup 201}Tl) and Technetium-99m ({sup 99m}Tc) based on chemiluminescence technique. H{sub 2}O{sub 2} produced by two gamma emitter radioisotopes of {sup 201}Tl and {sup 99m}Tc were quantitatively measured by chemiluminescence method. Upon producing H{sub 2}O{sub 2} in a luminol alkaline solution, in the presence of diperiodatocuprate, as catalyst a chemical reaction was accrued and consequently the emitted light was measured. The determined H{sub 2}O{sub 2} concentration was correlated with the gamma ray detection and dosimetry. The sensitivity of chemiluminescence technique for {sup 201}Tl and {sup 99m}Tc dosimetry was determined to be 0.20 and 0.08 MBq/l (Mega Becquerel per liter) respectively (R.S.D. = %5, N = 3). The plotted calibration curves showed detection limits of 3.24 and 1.76 MBq/l for {sup 201}Tl and {sup 99m}Tc, respectively.

  11. Myocardial infarction diagnosis with body surface potential mapping, electrocardiography, vectorcardiography and thallium-201 scintigraphy: a correlative study with left ventriculography.

    Science.gov (United States)

    Ackaoui, A; Nadeau, R; Sestier, F; Savard, P; Primeau, R; Lemieux, R; Descary, M C

    1985-01-01

    In 35 subjects with typical or atypical angina and/or documented myocardial infarction (MI), body surface potential maps (BSPMs), ECG, VCG and rest Thallium-201 (T1-201) have been compared to left ventriculography (LVG). BSPMs were recorded with 26 ECGs, and BSPM abnormalities for MI cases were considered to be areas of normally positive potentials that have become negative. Subjects with MI were classified according to the segmental localization and degree of asynergy on LVG. Moderate anterolateral and apical asynergy were found to correlate with BSPM diagnosis of anterolateral MI and ischemia, severe anterolateral and apical asynergy with BSPM diagnosis of anterolateral MI and ischemia, and moderate diaphragmatic and/or posterobasal asynergy with BSPM diagnosis of posterior MI. Simultaneous anterior and posterior asynergy were found for BSPM diagnosis of anterior with posterior MI. Subjects with no LVG asynergy had normal BSPMs. BSPM diagnosis had the highest correlation coefficient with the LVG diagnosis (r = 0.88). ECG and VCG showed similar results with r = 0.65 and 0.71 respectively, while T1-201 had r = 0.55. The examination of our BSPMs, as well as the ECG, VCG and T1-201, did not permit to detect apical damage in presence of anterior MI, and posterobasal damage in the presence of inferoposterior MI. It is concluded that BSPMs are slightly superior to ECG and VCG for diagnosis of MI.

  12. Thallium release from acid mine drainages: Speciation in river and tap water from Valdicastello mining district (northwest Tuscany).

    Science.gov (United States)

    Campanella, Beatrice; Casiot, Corinne; Onor, Massimo; Perotti, Martina; Petrini, Riccardo; Bramanti, Emilia

    2017-08-15

    In this work we present an advantageous method for the simultaneous separation and detection of Tl(I) and Tl(III) species through ion chromatography coupled with on-line inductively coupled plasma - mass spectrometry. Chromatographic separation between Tl(III) and Tl(I) was achieved in less than two minutes. The method was validated by recovery experiments on real samples, and by comparing the sum of the concentrations of individual Tl species with total thallium values obtained from continuous flow ICP-MS. The experimental procedure offers an accurate, sensitive and interference-free method for Tl speciation at trace levels in environmental samples. This allowed us to investigate the Tl speciation in acid mine drainages (AMD), surface waters and springs in a mining catchment in Valdicastello Carducci (Tuscany, Italy), where severe Tl contamination ad been evidenced previously. This study shows for the first time that Tl(III), in addition to Tl(I), is present in considerable amounts in water samples affected by acid mining outflow, raising the question of the origin of this thermodynamically unstable species. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. 41 CFR 50-204.72 - Safe practices for welding and cutting on containers which have held combustibles.

    Science.gov (United States)

    2010-07-01

    ... welding and cutting on containers which have held combustibles. 50-204.72 Section 50-204.72 Public... OF LABOR 204-SAFETY AND HEALTH STANDARDS FOR FEDERAL SUPPLY CONTRACTS Gases, Vapors, Fumes, Dusts, and Mists § 50-204.72 Safe practices for welding and cutting on containers which have held...

  14. 48 CFR 53.204-1 - Safeguarding classified information within industry (DD Form 254, DD Form 441).

    Science.gov (United States)

    2010-10-01

    ... information within industry (DD Form 254, DD Form 441). 53.204-1 Section 53.204-1 Federal Acquisition....204-1 Safeguarding classified information within industry (DD Form 254, DD Form 441). The following... specified in subpart 4.4 and the clause at 52.204-2: (a) DD Form 254 (Department of Defense (DOD)), Contract...

  15. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland

    OpenAIRE

    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata

    2014-01-01

    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50 % of the spawn samples, levels exceeded 20 mgTl/kg d.w. The iss...

  16. Molecular characterization of the 17D-204 yellow fever vaccine.

    Science.gov (United States)

    Salmona, Maud; Gazaigne, Sandrine; Mercier-Delarue, Severine; Garnier, Fabienne; Korimbocus, Jehanara; Colin de Verdière, Nathalie; LeGoff, Jerome; Roques, Pierre; Simon, François

    2015-10-05

    The worldwide use of yellow fever (YF) live attenuated vaccines came recently under close scrutiny as rare but serious adverse events have been reported. The population identified at major risk for these safety issues were extreme ages and immunocompromised subjects. Study NCT01426243 conducted by the French National Agency for AIDS research is an ongoing interventional study to evaluate the safety of the vaccine and the specific immune responses in HIV-infected patients following 17D-204 vaccination. As a preliminary study, we characterized the molecular diversity from E gene of the single 17D-204 vaccine batch used in this clinical study. Eight vials of lyophilized 17D-204 vaccine (Stamaril, Sanofi-Pasteur, Lyon, France) of the E5499 batch were reconstituted for viral quantification, cloning and sequencing of C/prM/E region. The average rate of virions per vial was 8.68 ± 0.07 log₁₀ genome equivalents with a low coefficient of variation (0.81%). 246 sequences of the C/prM/E region (29-33 per vials) were generated and analyzed for the eight vials, 25 (10%) being defective and excluded from analyses. 95% of sequences had at least one nucleotide mutation. The mutations were observed on 662 variant sites distributed through all over the 1995 nucleotides sequence and were mainly non-synonymous (66%). Genome variability between vaccine vials was highly homogeneous with a nucleotide distance ranging from 0.29% to 0.41%. Average p-distances observed for each vial were also homogeneous, ranging from 0.15% to 0.31%. This study showed a homogenous YF virus RNA quantity in vaccine vials within a single lot and a low clonal diversity inter and intra vaccine vials. These results are consistent with a recent study showing that the main mechanism of attenuation resulted in the loss of diversity in the YF virus quasi-species. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Effects of potassium channel opener on the kinetics of thallium-201 in in-vitro and in-vivo

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.; Kim, E. J.; Ahn, B. C.; Chae, S. C.; Lee, K. B. [College of Medicine, Kyungpook National Univ., Taegu (Korea, Republic of); Kim, C. K. [Mt. Sinai Medical School, New York (United States)

    1997-07-01

    Potassium channel opener (K-opener) opens membrane ATP-sensitive K{sup +}-channel and induces and increase in potassium efflux from cells. K-openers are powerful smooth muscle relaxants and currently used as antihypertensive, antianginal drugs or bronchodilators in clinic. Pharmacologic potency of newly synthesized K-opener is being evaluated with efflux capacity of preincubated Rb-83 from the isolated aortic vascular tissue preparation. Thallium has similar characteristics to those of rubidium and potassium in vivo. To evaluate the effect of pinacidil (a potent K-opener) on Tl-201 biokinetics, we have performed uptake/washout studies in cultured myocytes, and mice biodistribution study. Primary culture of spontaneous contracting myocytes was undertake from hearts of newborn Sprague-Dawley rat. Different concentration of pinacidil (100nM or 10uM) was co-incubated with Tl-201 in HBSS buffer to evaluate its effect on cellular uptake, or challenged to myocyte preparations pre-incubated with Tl-201 for washout study. Pinacidil was injected into mice simultaneous or 10-min after Tl-201 injection, and organ uptake and whole body retention ratio was measured using gamma counter or dose calibrator. Co-incubation of pinacidil with Tl-201 resulted in a decrease in Tl uptake into myocytes by 1.6 - 2.5 times, and an increase in washout by 1.6 - 3.1 times. Pinacidil injection resulted in mild decrease in blood, heart and liver uptake in mice, bur renal uptake was markedly decreased in a dose dependent manner. These results suggest that the pinacidil Tl-201 kinetics and may potentially affect the interpretation of Tl-201 myocardial imaging.

  18. Functional Significance of Angiographic Collaterals in Patients with Totally Occluded Right Coronary Artery: Intracoronary Thallium-201 Scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Do Yun; Lee, Jong Doo; Cho, Seung Yun; Shim, Won Heum; Ha, Jong Won; Kim, Han Soo; Kwon, Hyuk Moon; Jang, Yang Soo; Chung, Nam Sik; Kim, Sung Soon [Yonsei University College of Medicine, Seoul (Korea, Republic of); Park, Chang Yun; Kim, Young Soo [Inje University College of Medicine, Seoul (Korea, Republic of)

    1993-07-15

    To compare the myocardial viability in patients suffering from total occlusion of the right coronary artery (RCA) with the angiographic collaterals, intracoronary injection of Thallium-201 (T1-201) was done to 14 coronary artery disease (CAD) patients (pts) with total occlusion of RCA and into four normal subjects for control. All 14 CAD pts had Grade 2 or 3 collateral circulations. There were 14 male and 4 females, and their ages ranged from 31 to 70 years. In nine pts, T1-201 was injected into left main coronary artery (LCA) (300 approx 350 mu Ci) to evaluate the myocardial viability of RCA territory through collateral circulations. The remaining five pts received T1-201 into RCA (200-250 mu Ci) because two had intraarterial bridging collaterals and three had previous successful PTCA. Planar and SPECT myocardial perfusion images were obtained 30 minutes, and four to five hours after T1-201 reinjection. Intravenous T1-201 reinjection (six pts) or {sup 99m}Tc-MIBI (two pts) were also performed in eight CAD pts. Intracoronary myocardial perfusion images were compared with intravenous T1-201(IV T1-201) images, EGG, and ventriculography. Intracoronary TI-201 images proved to be superior to that of IV T1-201 due to better myocardial to background uptake ratio and more effective in the detection of viable tissue. We also found that perfusion defects were smaller on intracoronary T1-201 images than those on the IV T1-201. All of the 14 CAD pts had either mostly viable myocardium (seven pts) or large area of T1-201 perfusion (seven pts) in RCA territory, however ventriculographic wall motion and ECG did not correlate well with intracoronary myocardial perfusion images. In conclusion, total RCA occlusion patients with well developed collateral circulation had large area of viable myocardial in the corresponding territory.

  19. Disease stage classification in hypertrophic cardiomyopathy by dual analysis of iodine-123-labeled metaiodobenzylguanidine and thallium-201 myocardial scintigraphies

    Energy Technology Data Exchange (ETDEWEB)

    Hiasa, Go [Ehime Univ., Matsuyama (Japan). School of Medicine

    2001-08-01

    Many patients with hypertrophic cardiomyopathy (HCM) gradually changes from typical myocardial hypertrophy to dilated cardiomyopathy-like features. However, it is difficult to estimate the disease stage in HCM. To determine the disease stage, dual analysis of iodine-123-labeled metaiodobenzylguanidine ({sup 123}I-MIBG) and thallium-201 ({sup 201}Tl) myocardial scintigraphies were performed in 108 HCM patients. According to the scintigraphic distribution patterns, patients were divided into three groups. Group A (n=15): normal distributions of both {sup 123}I-MIBG and {sup 201}Tl, group B (n=71): normal {sup 201}Tl and low {sup 123}I-MIBG patterns, group C (n=22): low distributions of both scintigraphies. The decrease in {sup 201}Tl uptake was observed in only group C. Concerning {sup 123}I-MIBG, heart-to-mediastinum ratio (H/M) and washout rate (WOR) had good correlations with left ventricular systolic functions. H/M was decreased and WOR was increased in order of C, B and A groups. Left ventricular diastolic function reflected by isovolumic relaxation time was longer in group B than in group A. Attenuated left ventricular hypertrophy, enlarged left ventricular volumes, impaired left ventricular functions and serious clinical symptoms were observed in only group C. Myocardial sympathetic abnormalities in group B may be mainly due to myocardial hypertrophy, and those in group C may be due to myocardial injury. Dual analysis of {sup 123}I-MIBG and {sup 201}Tl scintigraphies may be useful to classify disease stages of HCM. (author)

  20. New quaternary thallium indium germanium selenide TlInGe2Se6: Crystal and electronic structure

    Science.gov (United States)

    Khyzhun, O. Y.; Parasyuk, O. V.; Tsisar, O. V.; Piskach, L. V.; Myronchuk, G. L.; Levytskyy, V. O.; Babizhetskyy, V. S.

    2017-10-01

    Crystal structure of a novel quaternary thallium indium germanium selenide TlInGe2Se6 was investigated by means of powder X-ray diffraction method. It was determined that the compound crystallizes in the trigonal space group R3 with the unit cell parameters a = 10.1798(2) Å, c = 9.2872(3) Å. The relationship with similar structures was discussed. The as-synthesized TlInGe2Se6 ingot was tested with X-ray photoelectron spectroscopy (XPS) and X-ray emission spectroscopy (XES). In particular, the XPS valence-band and core-level spectra were recorded for initial and Ar+ ion-bombarded surfaces of the sample under consideration. The XPS data allow for statement that the TlInGe2Se6 surface is rigid with respect to Ar+ ion-bombardment. Particularly, Ar+ ion-bombardment (3.0 keV, 5 min duration, ion current density fixed at 14 μA/cm2) did not cause substantial modifications of stoichiometry in topmost surface layers. Furthermore, comparison on a common energy scale of the XES Se Kβ2 and Ge Kβ2 bands and the XPS valence-band spectrum reveals that the principal contributions of the Se 4p and Ge 4p states occur in the upper and central portions of the valence band of TlInGe2Se6, respectively, with also their substantial contributions in other portions of the band. The bandgap energy of TlInGe2Se6 at the level of αg=103 cm-1 is equal to 2.38 eV at room temperature.

  1. 29 CFR 778.204 - “Clock pattern” premium pay.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false âClock patternâ premium pay. 778.204 Section 778.204 Labor... Excluded From the âRegular Rateâ Extra Compensation Paid for Overtime § 778.204 “Clock pattern” premium pay... pursuance of an applicable employment contract or collective bargaining agreement,” and the rates of pay and...

  2. Synthesis, Characterization and Antibacterial Studies of N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide and Its Neodymium(III and Thallium(III Complexes

    Directory of Open Access Journals (Sweden)

    Lawrence Nnamdi Obasi

    2017-02-01

    Full Text Available N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide (NBTCS was synthesized by condensation reaction of 4-chlorobenzenesulphonyl chloride and 2-aminobenzothiazole in acetone under reflux. Neodymium(III and thallium(III complexes of the ligand were also synthesized. Both ligand and metal complexes were characterized using UV-Vis, IR, 1H- and 13C-NMR spectroscopies, elemental analysis and molar conductance measurement. IR studies revealed that the ligand is tridentate and coordinates to the metal ions through nitrogen and oxygen atoms of the sulphonamide group and nitrogen atom attached to benzothiazole ring. The neodymium(III complex displays a coordination number of eight while thallium(III complex displays a coordination number of six. The ligand and its complexes were screened in vitro for their antibacterial activities against Escherichia coli strains (E. coli 6 and E. coli 13, Proteus species, Staphylococcus aureus and Pseudomonas aeruginosa using the agar well diffusion technique. The synthesized compounds were found to be more active against the microorganisms screened relative to ciprofloxacin, gentamicin and co-trimoxazole.

  3. Comparative study of body surface isopotential map, left ventriculogram and thallium-201 myocardial scintigram in patients with old lateral myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Naoyuki

    1988-01-01

    In 16 patients with old lateral myocardial infarction, body surface isopotential maps and 12 lead electrocardiograms were compared with left ventriculographic findings. In addition 8 of these subjects were performed thallium-201 myocardial scintigraphy in order to determine the location and extent of myocardial necrosis. Common 12 lead electrocardiographic findings of the subjects were initial Q waves more than 30 msec and inverted T waves in only aVL lead. The patients were classified into 4 groups according to the location and extent of ventricular wall motion abnormalities group I (6 cases) showed hypokinesis in the anterior segment, group II (5 cases): akinesis in the anterior segment and hypokinesis in the seg. 6, group III (4 cases): hypokinesis in the anterior segment and seg. 7, group IV (1 case): hypokinesis in the anterior segment and seg. 4, 7. And each of the 4 groups demonstrated characteristic findings of surface isopotential maps. Group II with coexisting hypokinesis in the seg. 6 showed surface isopotential maps additional pattern of anterior myocardial infarction, and group III with coexisting hypokinesis in the seg. 7 showed additional patterns of posterior myocardial infarction. The classification according to the abnormality of ventricular wall motion was also conformed with the thallium-201 myocardial scintigraphic findings except one case. These results suggest that body surface isopotential map is more useful than the 12 lead electrocardiogram in detecting the location and extent of left ventricular wall motion abnormality in patients with old lateral myocardial infarction. (author) 53 refs.

  4. Serial thallium-201 imaging at rest in patients with unstable and stable angina pectoris: relationship of myocardial perfusion at rest to presenting clinical syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Okada, R.D.; Boucher, C.A.; Phillips, H.R.; Strauss, H.W.; Pohost, G.M.

    1983-07-01

    In order to determine whether there are differences in myocardial perfusion at rest among patients with various unstable and stable angina syndromes, serial thallium-201 imaging was performed at rest in 19 patients presenting with rapidly worsening exertional angina (unstable angina, group A), 12 patients with rest angina alone without exertional symptoms (unstable angina, group B), and 34 patients with chronic stable angina. No patient had an episode of angina within 4 hours of study. Nineteen of 19 (100%) patients in group A demonstrated transient defects compared to only 3 of 12 (25%) patients in group B (p less than 0.0001) and 4 of 34 (12%) stable angina patients (p less than 0.0001). The majority of zones demonstrating transient defects in group A were associated with hypokinesis of the corresponding left ventriculogram segment without associated ECG evidence of previous infarction. There were no significant differences in the frequency of persistent thallium defects, severity of angiographic coronary artery disease, or frequency of regional wall motion abnormalities of myocardial segments supplied by stenotic coronary arteries among the three groups of patients. Transient defects have been shown to reflect reduction in regional coronary blood flow to viable myocardium. Therefore, we conclude that regional resting hypoperfusion of viable myocardium is far more common in patients with exertional unstable angina symptoms than in patients with rest angina alone or chronic stable angina.

  5. 48 CFR 52.204-9 - Personal Identity Verification of Contractor Personnel.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Personal Identity Verification of Contractor Personnel. 52.204-9 Section 52.204-9 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of...

  6. 7 CFR 205.204 - Seeds and planting stock practice standard.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Seeds and planting stock practice standard. 205.204... Requirements § 205.204 Seeds and planting stock practice standard. (a) The producer must use organically grown seeds, annual seedlings, and planting stock: Except, That, (1) Nonorganically produced, untreated seeds...

  7. 17 CFR 275.204A-1 - Investment adviser codes of ethics.

    Science.gov (United States)

    2010-04-01

    ... ethics. 275.204A-1 Section 275.204A-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... codes of ethics. (a) Adoption of code of ethics. If you are an investment adviser registered or required... enforce a written code of ethics that, at a minimum, includes: (1) A standard (or standards) of business...

  8. 40 CFR 204.58-3 - Instructions for maintenance, use, and repair.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Instructions for maintenance, use, and repair. 204.58-3 Section 204.58-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... to secure an unfair competitive advantage. They should not restrict replacement equipment to original...

  9. 28 CFR 301.204 - Continuation of lost-time wages.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Continuation of lost-time wages. 301.204... ACCIDENT COMPENSATION Lost-Time Wages § 301.204 Continuation of lost-time wages. (a) Once approved, the inmate shall receive lost-time wages until the inmate: (1) Is released; (2) Is transferred to another...

  10. 42 CFR 3.204 - Privilege of patient safety work product.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Privilege of patient safety work product. 3.204... PROVISIONS PATIENT SAFETY ORGANIZATIONS AND PATIENT SAFETY WORK PRODUCT Confidentiality and Privilege Protections of Patient Safety Work Product § 3.204 Privilege of patient safety work product. (a) Privilege...

  11. Assessment of the myostatin Q204X allele using an allelic discrimination assay

    Directory of Open Access Journals (Sweden)

    Ana M. Sifuentes-Rincón

    2006-01-01

    Full Text Available An allelic discrimination assay was designed and used to determine the genotypic and allelic frequencies of the myostatin (MSTN gene Q204X allele from two Mexican Full-French herds. The assay is a simple high throughput genotyping method that could be applied to investigate the effect of the Q204X allele on the Charolais breed.

  12. 48 CFR 3052.204-70 - Security requirements for unclassified information technology resources.

    Science.gov (United States)

    2010-10-01

    ... unclassified information technology resources. 3052.204-70 Section 3052.204-70 Federal Acquisition Regulations... for unclassified information technology resources. As prescribed in (HSAR) 48 CFR 3004.470-3, insert a clause substantially the same as follows: Security Requirements for Unclassified Information Technology...

  13. 17 CFR 204.55 - Change in notification to Financial Management Service.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Change in notification to Financial Management Service. 204.55 Section 204.55 Commodity and Securities Exchanges SECURITIES AND... Financial Management Service. After the Commission sends FMS notification of an individual's liability for a...

  14. 7 CFR 1710.204 - Filing requirements for borrowers that must maintain an approved load forecast on an ongoing basis.

    Science.gov (United States)

    2010-01-01

    ... an approved load forecast on an ongoing basis. 1710.204 Section 1710.204 Agriculture Regulations of... AND PRE-LOAN POLICIES AND PROCEDURES COMMON TO ELECTRIC LOANS AND GUARANTEES Load Forecasts § 1710.204 Filing requirements for borrowers that must maintain an approved load forecast on an ongoing basis. (a...

  15. 8 CFR 204.7 - Preservation of benefits contained in savings clause of Immigration and Nationality Act...

    Science.gov (United States)

    2010-01-01

    ... savings clause of Immigration and Nationality Act Amendments of 1976. 204.7 Section 204.7 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS IMMIGRANT PETITIONS Immigrant Visa Petitions § 204.7 Preservation of benefits contained in savings clause of Immigration and Nationality Act...

  16. 24 CFR 960.204 - Denial of admission for criminal activity or drug abuse by household members.

    Science.gov (United States)

    2010-04-01

    ... activity or drug abuse by household members. 960.204 Section 960.204 Housing and Urban Development... HOUSING Admission § 960.204 Denial of admission for criminal activity or drug abuse by household members...) Persons subject to sex offender registration requirement. The PHA must establish standards that prohibit...

  17. Syndrome of diminished vasodilator reserve of the coronary microcirculation (microvascular angina or syndrome X): Diagnosis by combined atrial pacing and thallium 201 imaging--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Magarian, G.J.; Palac, R.; Reinhart, S. (Veterans Administration Medical Center, Portland, OR (USA))

    1990-08-01

    Patients with angina-like chest pain without evidence of epicardial coronary artery disease or coronary arterial vasospasm are becoming increasingly recognized. These are often related to noncardiac causes including esophageal, musculoskeletal, and hyperventilatory or panic states. However, recently a subgroup of such patients are being recognized as having true myocardial ischemia and chest pain on the basis of diminished coronary microvascular vasodilatory reserve (microvascular ischemia or Syndrome X). The authors describe such a patient who was found to have replication of anginal pain associated with a reversible ischemic defect on thallium 201 imaging during atrial pacing, suggesting ischemia in this myocardial segment. Resolution of angina and ST segment electrocardiographic changes of ischemia occurred with cessation of pacing. We believe this is the first report of a patient with this form of myocardial ischemia diagnosed by this method and should be considered in patients with anginal chest pain after significant coronary artery disease and coronary vasospasm have been excluded.

  18. Determination of perfusion defect area in experimental myocardial infarction. A comparison between 201-thallium and sup 99m Tc methoxy-isobutyl-isonitril (MIBI)

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, K.D.; Rohmann, S.; Bahavar, H.; Grebe, S.F.; Schaper, W.; Schlepper, M. (Kerckhoff-Klinik, Bad Nauheim (Germany))

    1991-08-01

    To assess the accuracy of two myocardial perfusion markers in quantifying defect size, the left anterior descending coronary artery (LAD) was occluded in 13 porcine hearts. Fourty minutes later 55 MBq {sup 201}TI and 370 MBq {sup 99m}Tc-MIBI were simultaneously injected i.v. in 10 animals. After injection and in vivo double nuclide SPECT acquisition, the risk area was demarcated with fluorescein (FI) dye in 5 animals. The in vitro defect area determined by {sup 201}TI was significant larger (15.8 {+-} 27%) than those of {sup 99m}Tc-MIBI, while FI compared to Tc showed no statistical difference. Thus, in a pig model Tc-MIBI was more accurate with ex vivo imaging. With SPECT thallium imaging defect size was overestimated. In vivo there was a distinct trend with Tc-MIBI studies to underestimate the defect size up to 16%. (orig.).

  19. High thallium content in rocks associated with Au-As-Hg-Tl and coal mineralization and its adverse environmental potential in SW Guizhou, China

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, T.F.; Guha, J.; Boyle, D. [Chinese Academy of Science, Guiyang (China)

    2004-08-15

    This study is focused on high concentrations of Tl in rocks in SW Guizhou, China, that are related to several widely scattered disseminated gold-mercury-arsenic and coal deposits, and a primary Tl deposit within an Au-As-Hg-Tl metallogenic belt of the Huijiabao anticline. The Tl, Hg and As in the Lanmuchang Hg-Tl deposit area are associated with the abundant occurrence of sulfide minerals such as lorandite, realgar, orpiment and cinnabar. Concentrations of Tl range from 100 to 35 000 ppm in sulfide ores, and 39-490 ppm in host rocks. The enrichment of Au, Tl, Hg, As, and Sb in the Yanshang gold mineralized area reflects the occurrence of Au mineralization and its mineral assemblage of Tl-Hg-As-Sb sulfides. Thallium ranges from 0.22 to 16 ppm in Au ores and host rocks. Thallium in coals is enriched up to 46 ppm within the Au-As-Hg-TI metallogenic belt, and is derived from the regional Au-As-Hg-Tl mineralization. Mercury and As show a similar distribution to Tl with high concentrations in sulfide ores, coals and host rocks. Human populations living near and downstream of Tl deposits and Tl-bearing ore deposits are susceptible to Tl contamination because of its high toxicity and high uptake rate by crops. The dispersion of Tl, Hg and As associated with the primary mineralization of Au-As-Hg-TI can be traced through physical erosion and chemical weathering, producing secondary dispersion into sods, groundwater and surface water and crops. Mining activities compound the natural processes, readily dispersing Tl into the surface environment.

  20. Functional significance of myocardial perfusion defects induced by dipyridamole using thallium-201 single-photon emission computed tomography and two-dimensional echocardiography

    Energy Technology Data Exchange (ETDEWEB)

    Jain, A.; Suarez, J.; Mahmarian, J.J.; Zoghbi, W.A.; Quinones, M.A.; Verani, M.S. (Baylor College of Medicine, Houston, TX (USA))

    1990-10-01

    The mechanisms responsible for inhomogeneous myocardial blood flow after oral administration of a large dose (300 mg) of dipyridamole were assessed in 27 patients with serial thallium-201 single-photon emission computed tomography (SPECT) and simultaneous 2-dimensional echocardiograms. Myocardial tomographic images were obtained 50 minutes and 3 to 4 hours after administration of dipyridamole. Two-dimensional echocardiograms were recorded at baseline and then every 15 minutes for 60 minutes. Dipyridamole caused only a mild reduction in blood pressure (from 129 +/- 18 to 126 +/- 16 mm Hg) and a mild increase in heart rate (from 69 +/- 15 to 73 +/- 4 beats/min). Sixteen patients had perfusion defects after dipyridamole by SPECT, which underwent partial or total filling-in. Fourteen of these patients (87.5%) had either a new abnormality or further deterioration of a preexisting wall motion abnormality by 2-dimensional echocardiography, and thus were considered to have developed transient ischemia during dipyridamole administration. Ten of 11 patients (91%) with normal perfusion or fixed defects by SPECT had no further deterioration in wall motion after oral dipyridamole, and were thus considered to have no evidence of myocardial ischemia. In conclusion, most patients with transient thallium-201 defects after dipyridamole develop transient worsening of resting wall motion by 2-dimensional echocardiography, suggestive of true myocardial ischemia. Because myocardial oxygen demand, as indicated by the heart rate-blood pressure product, did not change significantly, the mechanism of myocardial ischemia in these patients is likely to be diminished regional blood flow related to a subendocardial steal induced by dipyridamole.

  1. miR-204-5p suppresses cell proliferation by inhibiting IGFBP5 in papillary thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Lianyong; Wang, Jingnan; Li, Xiangqi; Ma, Junhua; Shi, Chao; Zhu, Hongling; Xi, Qian; Zhang, Jichen; Zhao, Xuemei; Gu, Mingjun, E-mail: mjgugonglihos@yeah.net

    2015-02-20

    microRNAs (miRNAs) are frequently dysregulated in human malignancies. It was recently shown that miR-204-5p is downregulated in papillary thyroid carcinoma (PTC); however, the functional significance of this observation is not known. This study investigated the role of miR-204-5p in PTC. Overexpressing miR-204-5p suppressed PTC cell proliferation and induced cell cycle arrest and apoptosis. The results of a luciferase reporter assay showed that miR-204-5p can directly bind to the 3′ untranslated region (UTR) of insulin-like growth factor-binding protein 5 (IGFBP5) mRNA, and IGFBP5 overexpression partially reversed the growth-inhibitory effects of miR-204-5p. These results indicate that miR-204-5p acts as a tumor suppressor in PTC by regulating IGFBP5 expression and that miR-204-5p can potentially serve as an antitumorigenic agent in the treatment of PTC. - Highlights: • miR-204-5p expression is downregulated in PTC tissues and cell lines. • miR-204-5p suppresses proliferation and promotes apoptosis in PTC cells. • miR-204-5p suppresses IGFBP5 expression by direct binding to the 3′-UTR. • IGFBP5 overexpression reverses the effects of miR-204-5p.

  2. Yeast Interacting Proteins Database: YMR204C, YJL185C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YMR204C INP1 Peripheral membrane protein of peroxisomes involved in peroxisomal inheritance... of peroxisomes involved in peroxisomal inheritance Rows with this bait as bait Rows with this bait as bait

  3. Tank characterization report for single-shell tank 241-C-204

    Energy Technology Data Exchange (ETDEWEB)

    Conner, J.M.

    1996-09-12

    This document summarizes the information on the historical uses, present status, and the sampling and analysis results of waste stored in Tank 241-C-204. This report supports the requirements of Tri Party Agreement Milestone M 44 09.

  4. Yeast Interacting Proteins Database: YPL204W, YER095W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YPL204W HRR25 Protein kinase involved in regulating diverse events including vesicu... gene name HRR25 Bait description Protein kinase involved in regulating diverse events including vesicular t

  5. Tank 241-T-204, core 188 analytical results for the final report

    Energy Technology Data Exchange (ETDEWEB)

    Nuzum, J.L.

    1997-07-24

    TANK 241-T-204, CORE 188, ANALYTICAL RESULTS FOR THE FINAL REPORT. This document is the final laboratory report for Tank 241 -T-204. Push mode core segments were removed from Riser 3 between March 27, 1997, and April 11, 1997. Segments were received and extruded at 222-8 Laboratory. Analyses were performed in accordance with Tank 241-T-204 Push Mode Core Sampling and analysis Plan (TRAP) (Winkleman, 1997), Letter of instruction for Core Sample Analysis of Tanks 241-T-201, 241- T-202, 241-T-203, and 241-T-204 (LAY) (Bell, 1997), and Safety Screening Data Qual@ Objective (DO) ODukelow, et al., 1995). None of the subsamples submitted for total alpha activity (AT) or differential scanning calorimetry (DC) analyses exceeded the notification limits stated in DO. The statistical results of the 95% confidence interval on the mean calculations are provided by the Tank Waste Remediation Systems Technical Basis Group and are not considered in this report.

  6. Ginseng Purified Dry Extract, BST204, Improved Cancer Chemotherapy-Related Fatigue and Toxicity in Mice.

    Science.gov (United States)

    Park, Hyun-Jung; Shim, Hyun Soo; Kim, Jeom Yong; Kim, Joo Young; Park, Sun Kyu; Shim, Insop

    2015-01-01

    Cancer related fatigue (CRF) is one of the most common side effects of cancer and its treatments. A large proportion of cancer patients experience cancer-related physical and central fatigue so new strategies are needed for treatment and improved survival of these patients. BST204 was prepared by incubating crude ginseng extract with ginsenoside-β-glucosidase. The purpose of the present study was to examine the effects of BST204, mixture of ginsenosides on 5-fluorouracil (5-FU)-induced CRF, the glycogen synthesis, and biochemical parameters in mice. The mice were randomly divided into the following groups: the naïve normal (normal), the HT-29 cell inoculated (xenograft), xenograft and 5-FU treated (control), xenograft + 5-FU + BST204-treated (100 and 200 mg/kg) (BST204), and xenograft + 5-FU + modafinil (13 mg/kg) treated group (modafinil). Running wheel activity and forced swimming test were used for evaluation of CRF. Muscle glycogen, serum inflammatory cytokines, aspartic aminotransferase (AST), alanine aminotransferase (ALT), creatinine (CRE), white blood cell (WBC), neutrophil (NEUT), red blood cell (RBC), and hemoglobin (HGB) were measured. Treatment with BST204 significantly increased the running wheel activity and forced swimming time compared to the control group. Consistent with the behavioral data, BST204 markedly increased muscle glycogen activity and concentrations of WBC, NEUT, RBC, and HGB. Also, tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6), AST, ALT, and CRE levels in the serum were significantly reduced in the BST204-treated group compared to the control group. This result suggests that BST204 may improve chemotherapy-related fatigue and adverse toxic side effects.

  7. Ginseng Purified Dry Extract, BST204, Improved Cancer Chemotherapy-Related Fatigue and Toxicity in Mice

    Directory of Open Access Journals (Sweden)

    Hyun-Jung Park

    2015-01-01

    Full Text Available Cancer related fatigue (CRF is one of the most common side effects of cancer and its treatments. A large proportion of cancer patients experience cancer-related physical and central fatigue so new strategies are needed for treatment and improved survival of these patients. BST204 was prepared by incubating crude ginseng extract with ginsenoside-β-glucosidase. The purpose of the present study was to examine the effects of BST204, mixture of ginsenosides on 5-fluorouracil (5-FU-induced CRF, the glycogen synthesis, and biochemical parameters in mice. The mice were randomly divided into the following groups: the naïve normal (normal, the HT-29 cell inoculated (xenograft, xenograft and 5-FU treated (control, xenograft + 5-FU + BST204-treated (100 and 200 mg/kg (BST204, and xenograft + 5-FU + modafinil (13 mg/kg treated group (modafinil. Running wheel activity and forced swimming test were used for evaluation of CRF. Muscle glycogen, serum inflammatory cytokines, aspartic aminotransferase (AST, alanine aminotransferase (ALT, creatinine (CRE, white blood cell (WBC, neutrophil (NEUT, red blood cell (RBC, and hemoglobin (HGB were measured. Treatment with BST204 significantly increased the running wheel activity and forced swimming time compared to the control group. Consistent with the behavioral data, BST204 markedly increased muscle glycogen activity and concentrations of WBC, NEUT, RBC, and HGB. Also, tumor necrosis factor-α (TNF-α and interleukin-6 (IL-6, AST, ALT, and CRE levels in the serum were significantly reduced in the BST204-treated group compared to the control group. This result suggests that BST204 may improve chemotherapy-related fatigue and adverse toxic side effects.

  8. Pax6 regulates gene expression in the vertebrate lens through miR-204.

    Science.gov (United States)

    Shaham, Ohad; Gueta, Karen; Mor, Eyal; Oren-Giladi, Pazit; Grinberg, Dina; Xie, Qing; Cvekl, Ales; Shomron, Noam; Davis, Noa; Keydar-Prizant, Maya; Raviv, Shaul; Pasmanik-Chor, Metsada; Bell, Rachel E; Levy, Carmit; Avellino, Raffaella; Banfi, Sandro; Conte, Ivan; Ashery-Padan, Ruth

    2013-01-01

    During development, tissue-specific transcription factors regulate both protein-coding and non-coding genes to control differentiation. Recent studies have established a dual role for the transcription factor Pax6 as both an activator and repressor of gene expression in the eye, central nervous system, and pancreas. However, the molecular mechanism underlying the inhibitory activity of Pax6 is not fully understood. Here, we reveal that Trpm3 and the intronic microRNA gene miR-204 are co-regulated by Pax6 during eye development. miR-204 is probably the best known microRNA to function as a negative modulator of gene expression during eye development in vertebrates. Analysis of genes altered in mouse Pax6 mutants during lens development revealed significant over-representation of miR-204 targets among the genes up-regulated in the Pax6 mutant lens. A number of new targets of miR-204 were revealed, among them Sox11, a member of the SoxC family of pro-neuronal transcription factors, and an important regulator of eye development. Expression of Trpm/miR-204 and a few of its targets are also Pax6-dependent in medaka fish eyes. Collectively, this study identifies a novel evolutionarily conserved mechanism by which Pax6 controls the down-regulation of multiple genes through direct up-regulation of miR-204.

  9. Pax6 regulates gene expression in the vertebrate lens through miR-204.

    Directory of Open Access Journals (Sweden)

    Ohad Shaham

    Full Text Available During development, tissue-specific transcription factors regulate both protein-coding and non-coding genes to control differentiation. Recent studies have established a dual role for the transcription factor Pax6 as both an activator and repressor of gene expression in the eye, central nervous system, and pancreas. However, the molecular mechanism underlying the inhibitory activity of Pax6 is not fully understood. Here, we reveal that Trpm3 and the intronic microRNA gene miR-204 are co-regulated by Pax6 during eye development. miR-204 is probably the best known microRNA to function as a negative modulator of gene expression during eye development in vertebrates. Analysis of genes altered in mouse Pax6 mutants during lens development revealed significant over-representation of miR-204 targets among the genes up-regulated in the Pax6 mutant lens. A number of new targets of miR-204 were revealed, among them Sox11, a member of the SoxC family of pro-neuronal transcription factors, and an important regulator of eye development. Expression of Trpm/miR-204 and a few of its targets are also Pax6-dependent in medaka fish eyes. Collectively, this study identifies a novel evolutionarily conserved mechanism by which Pax6 controls the down-regulation of multiple genes through direct up-regulation of miR-204.

  10. Genetic variation of the gene coding for microRNA-204 (miR-204) is a risk factor in acute myeloid leukaemia.

    Science.gov (United States)

    Butrym, Aleksandra; Łacina, Piotr; Kuliczkowski, Kazimierz; Bogunia-Kubik, Katarzyna; Mazur, Grzegorz

    2018-01-30

    MicroRNAs (miRNAs or miRs) are small molecules known to be involved in post-transcriptional gene expression. Many of them have been shown to influence risk for various diseases. Recent studies suggest that lower expression of miR-204, a gene coding for miRNA-204, is correlated with shorter survival in patients with acute myeloid leukaemia (AML). This observation prompted us to analyse the effect of two polymorphisms of the miR-204 gene, one in the upstream flanking region (rs718447 A > G) and the other inside the gene itself (rs112062096 A > G), both also in intron 3 of the TRPM3 gene. The study was conducted on DNA samples isolated from AML patients (n = 95) and healthy individuals (n = 148), who were genotyped using the Light SNiP assays. The miR-204 rs718447 GG homozygosity was found to constitute a risk factor associated with susceptibility to AML (73/95 vs 92/148, AML patients vs healthy controls, OR = 2.020, p = 0.017). Additionally, this genotype was more frequent in patients with subtypes M0-M1 in the French-American-British (FAB) classification as compared to patients with subtypes M2-M7 (23/25 vs 39/57, p = 0.026). We also found that presence of allele A was linked to longer survival of AML patients. Our results show that polymorphism in miR-204 flanking region may constitute a risk and prognostic factor in AML.

  11. Effects of Potassium-Channel Opener on Thallium-201 Kinetics: In-vitro Study in Rat Myocyte Preparations and In-vivo Mice Biodistribution Study

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jae Tae; Kim, Eun Ji; Ahn, Byeong Cheol; Son, Kang Kyun; Lee, Kyu Bo [Kyungpook National University School of Medicine, Taegu (Korea, Republic of); Ha, Jeoung Hee [Youngnam University Medical School, Taegu (Korea, Republic of); Kim, Chun Ki [Mt. Sinai School of Medicine, New York (United States)

    1996-10-15

    Potassium channel opener (K-opener) opens ATP-sensitive K{sup +}-channel located at membrane and induces potassium efflux from cytosol, resulting in intracellular hyperpolarization. Newly synthesized K-opener is currently examined for pharmacologic potency by means of rubidium release test from smooth muscle strip preincubated with Rb-86. Since in-vive behavior of thallium is similar to that of rubidium, we hypothesized that K-opener can alter T1-201 kinetics in vivo. This study was prepared to investigate the effects of pinacidil (one of potent K-openers) on the T1-201 uptake and clearance in cultured myocyte, and in-vivo biodistribution in mice. Spontaneous contracting myocytes were prepared to imitate in-vivo condition from 20 hearts of 3-5 days old Sprague-Dawley rat and cultured for 3-5 days before use (5 X 105 cells/ml). Pinacidil was dissolved in 10% DMSO solution at a final concentration of 100nM or 10uM and was co-incubated with T1-201 in HBSS buffer for 20-min to evaluate its effect on cellular T1-uptake, or challenged to cell preparation pre-incubated with T1-201 for washout study. Two, 40 or 100 mg of pinacidil was injected intravenously into ICR mice at 10 min after 5 muCi T1-201 injection, and organ uptake and whole body retention rate were measured at different time points. Co-incubation of pinacidil with T1-201 resulted in a decrease in T1-201 uptake into cultured myocyte by 1.6 to 2.5 times, depending on pinacidil concentration and activity of T1-201 used. Pinacidil enhanced T1-201 washout by 1.6-3.1 times from myocyte preparations pre-incubated with T1-201. Pinacidil treatment appears to be resulted in mild decreases in blood and liver activity in normal mice, in contrast, renal and cardiac uptake were mildly decreased in a dose dependent manner. Whole body retention ratios of T1-201 were lower at 24 hour after injection with 100 mg of pinacidil than control. These results suggest that treatment with K-opener may affect the interpretation of T1

  12. Determination of particle mass deposition according to Bergerhoff; Performance characteristics of the measurement of particle mass deposition and its portions of lead, cadmium, zinc and thallium. Bestimmung des Staubniederschlags nach Bergerhoff; Verfahrenskenngroessen fuer die Messung des Staubniederschlags und seiner Anteile an Blei, Cadmium, Zink und Thallium

    Energy Technology Data Exchange (ETDEWEB)

    Gehrig, R. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Faesi, C. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Hofer, P. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe)

    1993-05-01

    The requirements concerning quality assurance have increased considerably in the field of immission control. Well founded values for detection limits and confidence limits have to be given. Based on the statistical analysis of long term data series of deposition measurements of particle mass (Berghoff method), lead, cadmium, zinc and thallium performance characteristics were established for very differently polluted sites. The resulting detection limits as well as confidence limits are low enough for a reliable control of the respective immission limit values. It is further shown that the use of plastic buckets instead of the glass buckets required by the VDI guideline or the addition of a protecting agent to avoid freezing does not affect the measurements significantly. (orig.)

  13. Preparation, Characterization, and In Vivo Pharmacoscintigraphy Evaluation of an Intestinal Release Delivery System of Prussian Blue for Decorporation of Cesium and Thallium

    Directory of Open Access Journals (Sweden)

    Nidhi Sandal

    2017-01-01

    Full Text Available Background. Prussian blue (PB, ferric hexacyanoferrate is approved by US-FDA for internal decorporation of Cesium-137 (137Cs and Thallium-201 (201Tl. Aim. Since PB is a costly drug, pH-dependent oral delivery system of PB was developed using calcium alginate matrix system. Methods. Alginate (Alg beads containing PB were optimized by gelation of sodium alginate with calcium ions and effect of varying polymer concentration on encapsulation efficiency and release profile was investigated. Scanning electron microscopy (SEM was carried out to study surface morphology. Adsorption efficacy of Alg-PB beads for 201Tl was evaluated and compared with native PB. In vivo pH-dependent release of the formulation was studied in humans using gamma scintigraphy. Results. Encapsulation efficiencies of Alg-PB beads with 0.5, 1.0, 1.5, and 2.0% polymer solution were 99.9, 91, 92, and 93%, respectively. SEM and particle size analysis revealed differences between formulations in their appearance and size distribution. No drug release was seen in acidic media (pH of 1-2 while complete release was observed at pH of 6.8. Dissolution data was fitted to various mathematical models and beads were found to follow Hixson-Crowell mechanism of release. The pH-dependent release of beads was confirmed in vivo by pharmacoscintigraphy in humans.

  14. Replacement of a photomultiplier tube in a 2-inch thallium-doped sodium iodide gamma spectrometer with silicon photomultipliers and a light guide

    Directory of Open Access Journals (Sweden)

    Chankyu Kim

    2015-06-01

    Full Text Available The thallium-doped sodium iodide [NaI(Tl] scintillation detector is preferred as a gamma spectrometer in many fields because of its general advantages. A silicon photomultiplier (SiPM has recently been developed and its application area has been expanded as an alternative to photomultiplier tubes (PMTs. It has merits such as a low operating voltage, compact size, cheap production cost, and magnetic resonance compatibility. In this study, an array of SiPMs is used to develop an NaI(Tl gamma spectrometer. To maintain detection efficiency, a commercial NaI(Tl 2′ × 2′ scintillator is used, and a light guide is used for the transport and collection of generated photons from the scintillator to the SiPMs without loss. The test light guides were fabricated with polymethyl methacrylate and reflective materials. The gamma spectrometer systems were set up and included light guides. Through a series of measurements, the characteristics of the light guides and the proposed gamma spectrometer were evaluated. Simulation of the light collection was accomplished using the DETECT 97 code (A. Levin, E. Hoskinson, and C. Moison, University of Michigan, USA to analyze the measurement results. The system, which included SiPMs and the light guide, achieved 14.11% full width at half maximum energy resolution at 662 keV.

  15. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: a comparative dual-isotope study.

    Science.gov (United States)

    Zimmermann, R; Rauch, B; Kapp, M; Bubeck, B; Neumann, F J; Seitz, F; Stokstad, P; Mall, G; Tillmanns, H; Kübler, W

    1992-01-01

    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were administered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for 201Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r = 0.75, p or = 75% (IP-PA: 70.0%, 201Tl: 66.3%, P = NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P = 0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29% +/- 11% vs 44% +/- 11% in normal myocardium, P IPPA is essentially as sensitive as scintigraphy with 201Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability.

  16. Dynamic low dose I-123-iodophenylpentadecanoic acid metabolic cardiac imaging; Comparison to myocardial biopsy and reinjection SPECT thallium in ischemic cardiomyopathy and cardiac transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Murray, G.L.; Magill, H.L. [Baptist Memorial Hospital (United States); Schad, N.C.

    1993-12-01

    Recognition of stunned and hibernating myocardium is essential in this era of cardiac revascularization. Positron emission tomography (PET) accurately identifies viability but is costly and unavailable to most patients. Dynamic low dose I-123-iodophenylpentadecanoic acid (IPPA) metabolic cardiac imaging is a potentially cost-effective alternative to PET. Using transmural myocardial biopsies obtained during coronary bypass surgery as the viability gold standard, resting IPPA imaging agreed with 39/43 (91%) biopsies, with a sensitivity for viability of 33/36(92%) and a specificity of 6/7 (86%) in patients with severe ischemic cardiomyopathy. Eighty percent of IPPA viable, infarcted segments improved wall motion postoperatively. Furthermore, when compared to reinjection thallium (SPECT-Tl) scans after myocardial infarction, there was IPPA-Tl concordance in 27/35 (77%)(Kappa=0.536, p=0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-Tl, 26/35 (74%) vs. 18/35 (51%)(p=0.047). Finally, when compared to transvenous endomyocardial biopsy for detecting rejection following cardiac transplantation, IPPA sensitivity for {>=}Grade II rejection was 100%, and IPPA screening assessment for the necessity of biopsy could result in a 31% cost-savings. Therefore, IPPA metabolic cardiac imaging is a safe, inexpensive technique with a promising future. (author).

  17. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: A comparative dual-isotope study

    Energy Technology Data Exchange (ETDEWEB)

    Zimmermann, R.; Rauch, B.; Kapp, M.; Neumann, F.J.; Seitz, F.; Kuebler, W. (Heidelberg Univ. (Germany). Dept. of Cardiology); Bubeck, B. (Heidelberg Univ. (Germany). Dept. of Nuclear Medicine); Mall, G. (Heidelberg Univ. (Germany). Dept. of Pathology); Tillmanns, H. (Giessen Univ. (Germany). Dept. of Cardiology); Stokstad, P.

    1992-11-01

    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were adminstered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for {sup 201}Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r=0.75, p<0.001). Both tracers also revealed a similar sensitivity for the identification of individual coronary artery stenoses {>=}75% (IPPA: 70%, {sup 201}Tl: 66.3%, P=NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P=0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29%{+-}11% vs 44%{+-}11% in normal myocardium, P<0.05). The data indicate that serial myocardial scintigraphy with IPPA is essentially as sensitive as scintigraphy with {sup 201}Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability. (orig.).

  18. Myocardial viability assessment with dynamic low-dose iodine-123-iodophenylpentadecanoic acid metabolic imaging: comparison with myocardial biopsy and reinjection SPECT thallium after myocardial infarction.

    Science.gov (United States)

    Murray, G L; Schad, N C; Magill, H L; Vander Zwaag, R

    1994-04-01

    Aggressive cardiac revascularization requires recognition of stunned and hibernating myocardium, and cost considerations may well govern the technique used. Dynamic low-dose (1 mCi) [123I]iodophenylpentadecanoic acid (IPPA) metabolic imaging is a potential alternative to PET using either 18FDG or 15O-water. Resting IPPA images were obtained from patients with severe ischemic cardiomyopathy, and transmural myocardial biopsies were obtained during coronary bypass surgery to confirm viability. Thirty-nine of 43 (91%) biopsies confirmed the results of the IPPA images with a sensitivity for viability of 33/36 (92%) and a specificity of 6/7 (86%). Postoperatively, wall motion improved in 80% of IPPA-viable, dysfunctional segments. Furthermore, when compared to reinjection thallium (SPECT-TI) scans after myocardial infarction, IPPA-SPECT-TI concordance occurred in 27/35 (77%) (K = 0.536, p = 0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-TI, 26/35 (74%) versus 18/35 (51%) (p = 0.047). Metabolic IPPA cardiac viability imaging is a safe, inexpensive technique that may be a useful alternative to PET.

  19. Identification and Decay Studies of New, Neutron-Rich Isotopes of Bismuth, Lead and Thallium by means of a Pulsed Release Element Selective Method

    CERN Multimedia

    Mills, A; Kugler, E; Van duppen, P L E; Lettry, J

    2002-01-01

    % IS354 \\\\ \\\\ It is proposed to produce, identify and investigate at ISOLDE new, neutron-rich isotopes of bismuth, lead and thallium at the mass numbers A=215 to A=218. A recently tested operation mode of the PS Booster-ISOLDE complex, taking an advantage of the unique pulsed proton beam structure, will be used together with a ThC target in order to increase the selectivity. The decay properties of new nuclides will be studied by means of $\\beta$-, $\\gamma$- and X- ray spectroscopy methods. The expected information on the $\\beta$-half-lives and excited states will be used for testing and developing the nuclear structure models ``south-east'' of $^{208}$Pb, and will provide input data for the description of the r-process path at very heavy nuclei. The proposed study of the yields and the decay properties of those heavy nuclei produced in the spallation of $^{232}$Th by a 1~GeV proton beam contributes also the data necessary for the simulations of a hybrid accelerator-reactor system.

  20. Thallium contamination in arable soils and vegetables around a steel plant-A newly-found significant source of Tl pollution in South China.

    Science.gov (United States)

    Liu, Juan; Luo, Xuwen; Wang, Jin; Xiao, Tangfu; Chen, Diyun; Sheng, Guodong; Yin, Meiling; Lippold, Holger; Wang, Chunlin; Chen, Yongheng

    2017-05-01

    Thallium (Tl) is a highly toxic rare element. Severe Tl poisoning can cause neurological brain damage or even death. The present study was designed to investigate contents of Tl and other associated heavy metals in arable soils and twelve common vegetables cultivated around a steel plant in South China, a newly-found initiator of Tl pollution. Potential health risks of these metals to exposed population via consumption of vegetables were examined by calculating hazard quotients (HQ). The soils showed a significant contamination with Tl at a mean concentration of 1.34 mg/kg. The Tl levels in most vegetables (such as leaf lettuce, chard and pak choy) surpassed the maximum permissible level (0.5 mg/kg) according to the environmental quality standards for food in Germany. Vegetables like leaf lettuce, chard, pak choy, romaine lettuce and Indian beans all exhibited bioconcentration factors (BCF) and transfer factors (TF) for Tl higher than 1, indicating a hyperaccumulation of Tl in these plants. Although the elevated Tl levels in the vegetables at present will not immediately pose significant non-carcinogenic health risks to residents, it highlights the necessity of a permanent monitoring of Tl contamination in the steel-making areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Thallium-201 is comparable to technetium-99m-sestamibi for estimating cardiac function in patients with abnormal myocardial perfusion imaging

    Directory of Open Access Journals (Sweden)

    Ming-Che Wu

    2015-11-01

    Full Text Available We analyzed the left-ventricular functional data obtained by cardiac-gated single-photon emission computed tomography myocardial perfusion imaging (MPI with thallium-201 (Tl-201 and technetium-99m-sestamibi (MIBI protocols in different groups of patients, and compared the data between Tl-201 and MIBI. Two hundred and seventy-two patients undergoing dipyridamole stress/redistribution Tl-201 MPI and 563 patients undergoing 1-day rest/dipyridamole stress MIBI MPI were included. Higher mean stress ejection fraction (EF, rest EF, and change in EF (ΔEF were noticed in the normal MPI groups by both Tl-201 and MIBI protocols. Higher mean EF was observed in the females with normal MPI results despite their higher mean age. Comparisons between the Tl-201 and MIBI groups suggested a significant difference in all functional parameters, except for the rest end diastolic volume/end systolic volume and ΔEF between groups with negative MPI results. For the positive MPI groups, there was no significant difference in all parameters, except for the change in end diastolic volume and change in end systolic volume after stress between both protocols. The Tl-201 provides comparable left-ventricular functional data to MIBI cardiac-gated single-photon emission computed tomography in patients with positive MPI results, and may therefore be undertaken routinely for incremental functional information that is especially valuable to this patient group.

  2. Usefulness of thallium-201 myocardial scintigraphy during hyperventilation and accelerated exercise test in patients with vasospastic angina and nearly normal coronary artery

    Energy Technology Data Exchange (ETDEWEB)

    Sueda, Shozo; Mineoi, Kazuaki; Kondou, Tadashi [Takanoko Hospital, Matsuyama, Ehime (Japan)] [and others

    1998-04-01

    The usefulness of thallium-201 ({sup 201}Tl) myocardial scintigraphy was studied in 109 patients with vasospastic angina who had nearly normal coronary arteries (degree of stenosis <50%). Coronary spasm was confirmed by pharmacologic agents in all 109 patients from January 1991 to June 1996. The appearance rate of visual redistribution on {sup 201}Tl myocardial scintigraphy was compared between four groups, 34 patients performing graded bicycle ergometer exercise starting at a work load of 50 W with increments of 25 W every 3 min (Ergo(3) group), 14 patients performing hyperventilation for 5 min (HV(5) group), 31 patients performing bicycle ergometer exercise with increments of 25 W every 1 min after 5 min hyperventilation (HV(5)+Ergo(1) group), and 30 patients at rest (Rest group). The value of the visual redistribution rate on {sup 201}Tl myocardial scintigrams in the HV(5)+Ergo(l) group (65%) was higher than that in the patients of other groups (Ergo(3) 41%, HV(5) 43%, Rest 33%). However, there were no significant differences between the four groups. Stress {sup 201}Tl imaging after hyperventilation and accelerated exercise is useful to disclose ischemic evidence in about two thirds of patients with vasospastic angina and nearly normal coronary arteries, whereas about 40% of patients had visual redistribution on {sup 201}Tl myocardial scintigrams by performing standard procedures. (author)

  3. On-line preconcentration of ultra-trace thallium(I in water samples with titanium dioxide nanoparticles and determination by graphite furnace atomic absorption spectrometry

    Directory of Open Access Journals (Sweden)

    Saeid Asadpour

    2016-11-01

    Full Text Available A new method has been developed for the determination of Tl(I based on simultaneous sorption and preconcentration with a microcolumn packed with TiO2 nanoparticle with a high specific surface area prepared by Sonochemical synthesis prior to its determination by graphite furnace atomic absorption spectrometry (GFAAS. The optimum experimental parameters for preconcentration of thallium, such as elution condition, pH, and sample volume and flow rate have been investigated. Tl(I can be quantitatively retained by TiO2 nanoparticles at pH 9.0, then eluted completely with 1.0 mol L−1 HCl. The adsorption capacity of TiO2 nanoparticles for Tl(I was found to be 25 mg g−1. Also detection limit, precision (RSD, n = 8 and enrichment factor for Tl(I were 87 ng L−1, 6.4% and 100, respectively. The method has been applied for the determination of trace amounts of Tl(I in some environmental water samples with satisfactory results.

  4. Thallium-201 single photon emission computed tomography (SPECT) in patients with Duchenne's progressive muscular dystrophy. A histopathologic correlation study

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, Toru; Yanagisawa, Atsuo; Sakata, Konomi; Shimoyama, Katsuya; Yoshino, Hideaki; Ishikawa, Kyozo [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine; Sakata, Hitomi; Ishihara, Tadayuki

    2001-02-01

    The pathomorphologic mechanism responsible for abnormal perfusion imaging during thallium-201 myocardial single photon emission computed tomography ({sup 201}Tl-SPECT) in patients with Duchenne's progressive muscular dystrophy (DMD) was investigated. Hearts from 7 patients with DMD were evaluated histopathologically at autopsy and the results correlated with findings on initial and delayed resting {sup 201}Tl-SPECT images. The location of segments with perfusion defects correlated with the histopathologically abnormal segments in the hearts. Both the extent and degree of myocardial fibrosis were severe, especially in the posterolateral segment of the left ventricle. Severe transmural fibrosis and severe fatty infiltration were common in segments with perfusion defects. In areas of redistribution, the degree of fibrosis appeared to be greater than in areas of normal perfusion; and intermuscular edema was prominent. Thus, the degree and extent of perfusion defects detected by {sup 201}Tl-SPECT were compatible with the histopathology. The presence of the redistribution phenomenon may indicate ongoing fibrosis. Initial and delayed resting {sup 201}Tl-SPECT images can predict the site and progress of myocardial degeneration in patients with DMD. (author)

  5. 14 CFR 204.6 - Certificated and commuter air carriers proposing a change in operations, ownership, or management...

    Science.gov (United States)

    2010-01-01

    ... proposing a change in operations, ownership, or management which is not substantial. 204.6 Section 204.6... carriers proposing a change in operations, ownership, or management which is not substantial. Carriers proposing to make a change which would not substantially affect their operations, management, or ownership...

  6. 12 CFR 204.131 - Participation by a depository institution in the secondary market for its own time deposits.

    Science.gov (United States)

    2010-01-01

    ... the secondary market for its own time deposits. 204.131 Section 204.131 Banks and Banking FEDERAL... secondary market for its own time deposits. (a) Background. In 1982, the Board issued an interpretation concerning the effect of a member bank's purchase of its own time deposits in the secondary market in order...

  7. 30 CFR 204.215 - Are the information collection requirements in this subpart approved by the Office of Management...

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Are the information collection requirements in this subpart approved by the Office of Management and Budget (OMB)? 204.215 Section 204.215 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT ALTERNATIVES...

  8. 45 CFR 2540.204 - What procedures must I follow in conducting a National Service Criminal History Check for a...

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false What procedures must I follow in conducting a National Service Criminal History Check for a covered position? 2540.204 Section 2540.204 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE GENERAL ADMINISTRATIVE PROVISIONS Requirements...

  9. 75 FR 12731 - Foreign-Trade Zone 204-Tri-Cities Area, Tennessee/Virginia; Application for Expansion

    Science.gov (United States)

    2010-03-17

    ... Foreign-Trade Zones Board Foreign-Trade Zone 204--Tri-Cities Area, Tennessee/Virginia; Application for Expansion An application has been submitted to the Foreign-Trade Zones (FTZ) Board (the Board) by the Tri-Cities Airport Commission, grantee of FTZ 204, requesting authority to expand its zone to include a site...

  10. 75 FR 38979 - Expansion/Reorganization of Foreign-Trade Zone 204, Tri-Cities Area, TN/VA

    Science.gov (United States)

    2010-07-07

    ... Foreign-Trade Zones Board Expansion/Reorganization of Foreign-Trade Zone 204, Tri-Cities Area, TN/VA...), the Foreign-Trade Zones Board (the Board) adopts the following Order: Whereas, the Tri-Cities Airport... FTZ 204 to include a site in Bristol, Tennessee, adjacent to the Tri-Cities Customs and Border...

  11. 8 CFR 204.307 - Who may file a Form I-800A or Form I-800.

    Science.gov (United States)

    2010-01-01

    .... immigration law. If an alien spouse is present in a lawful status other than the status of an alien lawfully... alien who, if living in the United States, holds a lawful status under U.S. immigration law; and (3) The.... 204.307 Section 204.307 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS...

  12. Survival of Cochlear Spiral Ganglion Neurons Improved In vivo by Anti-miR204 via TMPRSS3.

    Science.gov (United States)

    Peng, A; Li, Y; Pan, X; Ge, S; Wang, Q; Li, S; Zhu, G; Liu, J

    2015-05-08

    Sensorineural hearing loss (SNHL) is caused by damage to hair cells followed by degeneration of the spiral ganglion neurons (SGNs), and cochlear implanting is an effective treatment. Unfortunately, the progressive hearing loss is still found due to ongoing degeneration of cochlear SGNs. The aim of this study was to investigate the neuroprotective effect of anti-miR204 on SGNs in vivo. Our recent in vitro work suggested that anti-miR204 could be a potential therapeutic strategy in SNHL via rescue cochlear SGNs. In order to further our knowledge of miR204 on SGNs in vivo, we made a kanamycin ototoxicity model and then virus containing the anti-miR204 gene (AAV1-anti-miR204) was microinjected into the cochlear of the model to monitor the effect. The SGNs were rescued by anti-miR204 in the kanamycin ototoxicity mouse group compared to the sham group. Moreover, expression of TMPRSS3 in SGNs was saved by anti-miR204 treatment. Anti-miR204 might be an alternate way to alleviate the degeneration of cochlear SGNs of kanamycin ototoxicity mice.

  13. 33 CFR 165.T14-204 - Safety Zone; fixed mooring balls, south of Barbers Pt Harbor Channel, Oahu, Hawaii.

    Science.gov (United States)

    2010-07-01

    ..., south of Barbers Pt Harbor Channel, Oahu, Hawaii. 165.T14-204 Section 165.T14-204 Navigation and... Pt Harbor Channel, Oahu, Hawaii. (a) Location. The following area is a safety zone: All waters... position is approximately 2,500 yards south of Barbers Point Harbor channel buoy #2, Oahu, Hawaii. This...

  14. 20 CFR 702.204 - Employer's report; penalty for failure to furnish and or falsifying.

    Science.gov (United States)

    2010-04-01

    ... AND PROCEDURE Claims Procedures Employer's Reports § 702.204 Employer's report; penalty for failure to furnish and or falsifying. Any employer, insurance carrier, or self-insured employer who knowingly and... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Employer's report; penalty for failure to...

  15. A JESD204B-Compliant Architecture for Remote and Deterministic-Latency Operation

    Science.gov (United States)

    Giordano, Raffaele; Izzo, Vincenzo; Perrella, Sabrina; Aloisio, Alberto

    2017-06-01

    High-speed analog-to-digital converters (ADCs) are key components in a huge variety of systems, including trigger and data acquisition (TDAQ) systems of nuclear and subnuclear physics experiments. Over the last decades, the sample rate and dynamic range of high-speed ADCs underwent a continuous growth, and it required the development of suitable interface protocols, such as the new JESD204B serial interface protocol. In this paper, we present an original JESD204B-compliant architecture we designed, which is able to operate an ADC in a remote fashion. Our design includes a deterministic-latency high-speed serial link, which is the only connection between the local and remote logic of the architecture and which preserves the deterministic timing features of the protocol. By means of our solution, it is possible to read data out of several converters, even remote to each other, and keep them operating synchronously. Our link also supports forward error correction (FEC) capabilities, in the view of the operation in radiation areas (e.g., on-detector in TDAQ systems). We describe an implementation of our concept in a latest generation field programmable gate array (Xilinx Kintex-7 325T) for reading data from a high-speed JESD204B-compliant ADC. We present measurements of the jitter of JESD204B timing-critical signals forwarded over the link and of latency determinism of the FEC-protected link.

  16. RESULTS OF AIRPLANE TU-204-300 OPERATED BY "VLADIVOSTOK AVIA" COMPANY FUEL FLOW MONITIRING

    Directory of Open Access Journals (Sweden)

    G. E. Maslennikova

    2014-01-01

    Full Text Available This article describes the results obtained from continuous monitoring of fuel flow on the airplanes Tu-204-300, operated by the aircompany "Vladivostok Avia". The reasons for the change in the cost of each copy of airplane and changes in fuel characteristics due to pilots manner of flying.

  17. 42 CFR 412.204 - Payment to hospitals located in Puerto Rico.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Payment to hospitals located in Puerto Rico. 412... Payment System for Inpatient Operating Costs for Hospitals Located in Puerto Rico § 412.204 Payment to hospitals located in Puerto Rico. (a) FY 1988 through FY 1997. For discharges occurring on or after October...

  18. 13 CFR 126.204 - May a qualified HUBZone SBC have affiliates?

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false May a qualified HUBZone SBC have... PROGRAM Requirements to be a Qualified HUBZone SBC § 126.204 May a qualified HUBZone SBC have affiliates? A concern may have affiliates provided that the aggregate size of the concern and all of its...

  19. 40 CFR 141.204 - Tier 3 Public Notice-Form, manner, and frequency of notice.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Tier 3 Public Notice-Form, manner, and... Drinking Water Violations § 141.204 Tier 3 Public Notice—Form, manner, and frequency of notice. (a) Which violations or situations require a Tier 3 public notice? Table 1 of this section lists the violation...

  20. 10 CFR 35.204 - Permissible molybdenum-99, strontium-82, and strontium-85 concentrations.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Permissible molybdenum-99, strontium-82, and strontium-85... Unsealed Byproduct Material-Written Directive Not Required § 35.204 Permissible molybdenum-99, strontium-82, and strontium-85 concentrations. (a) A licensee may not administer to humans a radiopharmaceutical...

  1. 8 CFR 204.310 - Filing requirements for Form I-800A.

    Science.gov (United States)

    2010-01-01

    ... States national or an alien who holds a lawful status under U.S. immigration law. (iv) A copy of the....310 Section 204.310 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS... the operation of State law must be noted and explained when the Form I-800A is filed. (viii) A home...

  2. 48 CFR 51.204 - Use of interagency fleet management system (IFMS) vehicles and related services.

    Science.gov (United States)

    2010-10-01

    ... Contractor Use of Interagency Fleet Management System (IFMS) 51.204 Use of interagency fleet management system (IFMS) vehicles and related services. Contractors authorized to use interagency fleet management... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Use of interagency fleet...

  3. 45 CFR 46.204 - Research involving pregnant women or fetuses.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Research involving pregnant women or fetuses. 46... PROTECTION OF HUMAN SUBJECTS Additional Protections for Pregnant Women, Human Fetuses and Neonates Involved in Research § 46.204 Research involving pregnant women or fetuses. Pregnant women or fetuses may be...

  4. 7 CFR 1744.204 - Rural development investments that do not meet the ratio requirements.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 11 2010-01-01 2010-01-01 false Rural development investments that do not meet the... GUARANTEED AND INSURED TELEPHONE LOANS Borrower Investments § 1744.204 Rural development investments that do... consider, on a case-by-case basis, requests for approval of rural development investments not constituting...

  5. 42 CFR 420.204 - Principals convicted of a program-related crime.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Principals convicted of a program-related crime... and Control Information § 420.204 Principals convicted of a program-related crime. (a) Information... the facts and circumstances of the specific case, including the nature and severity of the crime...

  6. 5 CFR 430.204 - Agency performance appraisal system(s).

    Science.gov (United States)

    2010-01-01

    ... Other Employees § 430.204 Agency performance appraisal system(s). (a) Each agency as defined at section... parameters for the application and operation of performance appraisal within the agency for the employees...) Communicating performance plans to employees at the beginning of an appraisal period; (iii) Evaluating each...

  7. 31 CFR 500.803 - Customs procedures; merchandise specified in § 500.204.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Customs procedures; merchandise... CONTROL REGULATIONS Procedures § 500.803 Customs procedures; merchandise specified in § 500.204. (a) With... United States, directors of customs shall not accept or allow any: (1) Entry for consumption (including...

  8. 31 CFR 515.803 - Customs procedures; merchandise specified in § 515.204.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Customs procedures; merchandise... CONTROL REGULATIONS Procedures § 515.803 Customs procedures; merchandise specified in § 515.204. (a) With... thereto) whether or not such merchandise has been imported into the United States, collectors of customs...

  9. 41 CFR 109-38.204-4 - Report of exempted motor vehicles.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Report of exempted motor..., TRANSPORTATION, AND MOTOR VEHICLES 38-MOTOR EQUIPMENT MANAGEMENT 38.2-Registration, Identification, and Exemptions § 109-38.204-4 Report of exempted motor vehicles. DOE offices shall provide upon request the...

  10. 29 CFR 779.204 - Common types of “enterprise.”

    Science.gov (United States)

    2010-07-01

    ... Business Unit § 779.204 Common types of “enterprise.” (a) The single establishment business. In the... purpose and there is both unified operation and common control. The entire business is the unit for... control into a unified business system or economic unit to serve a common business purpose. (S. Rept. 145...

  11. Iodine-123 phenylpentadecanoic acid and single photon emission computed tomography in identifying left ventricular regional metabolic abnormalities in patients with coronary heart disease: comparison with thallium-201 myocardial tomography.

    Science.gov (United States)

    Hansen, C L; Corbett, J R; Pippin, J J; Jansen, D E; Kulkarni, P V; Ugolini, V; Henderson, E; Akers, M; Buja, L M; Parkey, R W

    1988-07-01

    Iodine-123 phenylpentadecanoic acid (IPPA) is a synthetic long chain fatty acid with myocardial kinetics similar to palmitate. Two hypotheses were tested in this study. The first hypothesis was that IPPA imaging with single photon emission computed tomography (SPECT) is useful in the identification of patients with coronary artery disease. Fourteen normal volunteers (aged 27 +/- 2 years) and 33 patients (aged 54 +/- 11 years) with stable symptomatic coronary artery disease and at least one major coronary artery with luminal diameter narrowing greater than or equal to 70% were studied with symptom-limited maximal exercise testing. The IPPA (6 to 8 mCi) was injected 1 min before the termination of exercise, and tomographic imaging was performed beginning at 9 min and repeated at 40 min after the injection of IPPA. Nine of the normal volunteers and 13 of the patients had a second examination performed at rest on another day. Using the limits of normal as 2 SD from the normal mean values, 27 of the 33 patients with coronary artery disease demonstrated abnormalities in either the initial distribution or the clearance of IPPA, or both. Nineteen of the 33 patients had a maximal variation of activity distribution of greater than or equal to 25% on the 9 min IPPA images. Twenty-two of the 33 patients had a maximal variation in IPPA washout greater than 17% and 17 had a washout rate less than or equal to 2%. There was good agreement between the location of significant coronary artery stenoses and abnormalities in the initial distribution and clearance of IPPA. The second hypothesis tested was that IPPA imaging is as or more sensitive and, therefore, complementary to thallium-201 imaging in the identification of exercise-induced ischemia in patients. Twenty-five of the 33 patients underwent both thallium-201 and IPPA tomographic imaging after symptom-limited maximal exercise testing. The amount of exercise performed by each patient during both studies was similar. Twenty

  12. Luminescent one- and two-dimensional extended structures and a loosely associated dimer based on platinum(II)-thallium(I) backbones.

    Science.gov (United States)

    Forniés, Juan; García, Ana; Lalinde, Elena; Moreno, M Teresa

    2008-05-05

    Neutralization reactions between (NBu4)2[ trans-Pt(C 6F5)2(CN)2] 1 and (NBu4)2[cis-Pt(C6F5)2(CN)2] 2 with TlPF 6 have been carried out, and the resulting structures of [trans,trans,trans-Tl2{Pt(C6F5)2(CN)2}.(CH3COCH3) ] n [4.(CH3COCH3)2] n and {Tl[Tl{cis-Pt(C6F5)2(CN)2}].(H2O)} n [5.(H2O)] n have been determined by X-ray crystallography. Remarkably, the change from trans to cis geometry on the platinum substrate causes a significant decrease in the Pt(II)...Tl(I) metallophilic interaction. Thus, the platinum center in the trans fragment easily connects with two Tl(I) ions forming a distorted pseudo-octahedron PtTl2, which generates a final two-dimensional layered structure by secondary additional intermolecular Tl(I)...N(CN) interactions. However, the [cis-Pt(C6F5)2(CN)2] (2-) fragment interacts strongly with just one Tl center leading to an extended helical [-Pt-Tl-Pt-Tl-] n(n-) chain. In this case, the second thallium center neutralizes the anionic chain mainly through Tl...N(CN) ( intra) and Tl...F(C 6F 5) (intra and inter)actions. The reaction of TlPF 6 with the monoanionic fragment (NBu4)[cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)] 3 yields the discrete associated dimer [Tl{cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)}] 2 [ 6] 2. Dimer [ 6] 2 could be described as two square pyramids with the thallium atoms in the apical positions, connected through Tl...N(cyano) interactions. The final heteropolynuclear Pt-Tl complexes, except 4 at room temperature, show bright emission in the solid state when irradiated with UV-vis radiation, in contrast to the precursors 1 and 3, which are not luminescent. This difference indicates that the emissions in 4- 6 are presumably related to the interaction between the metal centers. The Pt-Tl bonding interactions and, consequently, the emissive properties are lost in solution at room temperature, as shown by the conductivity and NMR measurements. However, variable-concentration luminescence measurements in glassy acetonitrile solutions

  13. Simultaneous dual myocardial imaging with iodine-123-[beta]-methyl iodophenyl-pentadecanoic acid (BMIPP) and thallium-201 in patients with coronary heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Tawarahara, Kei; Kurata, Chinori; Taguchi, Takahisa; Aoshima, Shigeyuki; Okayama, Kenichi; Kobayashi, Akira; Yamazaki, Noboru; Kaneko, Masao (Hamamatsu Univ. School of Medicine, Shizuoka (Japan))

    1994-02-01

    To assess the clinical value of simultaneous dual myocardial imaging with iodine-123-[beta]-methyl-iodophenyl-pentadecanoic acid ([sup 123]I-BMIPP) and thallium-201 ([sup 201]TL), myocardial imaging was performed at rest and during execise in seven patients with coronary heart disease. When [sup 123]I-BMIPP and [sup 201]Tl images were compared, the initial exercise and resting images agreed 87% and 64%, respectively. In the initial resting images, the regional uptake of [sup 123]I-BMIPP was frequently less than that of [sup 201]Tl. The incidence of exercise-induced reversible defects by [sup 201]Tl in the Tl>BMIPP regions was significantly higher than that in the Tl=BMIPP regions (57% vs 4%, p<0.01) and the incidence of coronary narrowing of more than 90% in the Tl>BMIPP regions was also significantly higher than that in the Tl=BMIPP regions (91% vs 38%, p<0.01). In addition, this disparity (Tl>BMIPP) was found more frequently in regions with abnormal wall motion than in regions with normal wall motion (hypokinetic regions; 68%, severe hypokinetic or akinetic regions; 50%, vs normokinetic regions; 4%, p<0.01). In contrast, the uptake of [sup 123]I-BMIPP correlated closely with that of [sup 201]Tl in normal myocardium and the uptake of both [sup 123]I-BMIPP and [sup 201]Tl was severely reduced in myocardium with severe ischemia during exercise and prior infarction. These results indicate that dual myocardial imaging with [sup 123]I-BMIPP and [sup 201]Tl may provide a unique means of identifying patients with metabolically disturbed myocardium, such as hibernating and stunned myocardium. (author).

  14. Imaging of brain tumors in AIDS patients by means of dual-isotope thallium-201 and technetium-99m sestamibi single-photon emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    De La Pena, R.C.; Ketonen, L.; Villanueva-Meyer, J. [Dept. of Radiology, Univ. of Texas, Galveston (United States)

    1998-10-01

    Our aim was to evaluate the use of dual-isotope thallium-201 (Tl) and technetium-99m sestamibi (sestamibi) simultaneous acquisition in brain single-photon emission tomography (SPET) for the differentiation between brain lymphoma and benign central nervous system (CNS) lesions in AIDS patients. Thirty-six consecutive patients with enhancing mass lesions on magnetic resonance (MR) imaging were included in the study. SPET of the brain was performed to obtain simultaneous Tl and sestamibi images. Regions-of-interest were drawn around the lesion and on the contralateral side to calculate uptake ratios. The final diagnosis was reached by pathologic findings in 17 patients and clinical and/or MR follow-up in 19 patients. Of the 36 patients, 11 had brain lymphoma, 1 glioblastoma multiforme, 15 toxoplasmosis and 9 other benign CNS lesions. Correlation between SPET and the final diagnosis revealed in 10 true-positive, 23 true-negative, 1 false-positive and 2 false-negative studies. All patients with toxoplasmosis had negative scans. A patient with a purulent infection had positive scans. Tl and sestamibi scans were concordant in every lesion. The same lesions that took up Tl were also visualized with sestamibi. However, sestamibi scans showed higher lesion-to-normal tissue uptake ratios (3.7{+-}1.8) compared with those of Tl (2.3{+-}0.8, P<0.002). Simultaneous acquisition of Tl and sestamibi can help differentiate CNS lymphoma from benign brain lesions in AIDS patients. (orig.) With 2 figs., 2 tabs., 34 refs.

  15. Technetium-99m pyrophosphate/thallium-201 dual-isotope SPECT imaging predicts reperfusion injury in patients with acute myocardial infarction after reperfusion

    Energy Technology Data Exchange (ETDEWEB)

    Akutsu, Yasushi; Kaneko, Kyouichi; Kodama, Yusuke; Li, Hui-Ling; Nishimura, Hideki; Hamazaki, Yuji; Kobayashi, Youichi [Showa University School of Medicine, Division of Cardiology, Department of Medicine, Tokyo (Japan); Suyama, Jumpei; Shinozuka, Akira; Gokan, Takehiko [Showa University School of Medicine, Department of Radiology, Tokyo (Japan)

    2009-02-15

    Microcirculatory failure after reperfusion is clinically indicated to cause reperfusion injury whereas excessive intracellular calcium ion overload is experimentally proved as a key mechanism of reperfusion injury. We hypothesized that technetium-99m ({sup 99m}Tc) pyrophosphate (Tc-PYP) uptake in injured but viable infarct-related myocardium with preserved myocardial perfusion after reperfusion estimated by thallium-201 ({sup 201}Tl) uptake would be associated with final functional recovery. Dual-isotope Tc-PYP/{sup 201}Tl single-photon emission computed tomography (SPECT) was performed 2 days after successful reperfusion therapy in patients with first acute myocardial infarction, and 50 patients (63 {+-} 13 years old, female 22%) with preserved {sup 201}Tl uptakes of {>=}50% in reperfused myocardium was followed for 1 month. Tc-PYP uptake was assessed as the heart-to-sternum (H/S) ratio. Two-dimensional echocardiography was also performed 2 days and 1 month after reperfusion to evaluate functional recovery. High Tc-PYP uptake, defined as the H/S ratio {>=}0.81, was predictive of chronic phase no functional recovery (73.7% in 14 of 19 patients with high uptake vs 16.1% in five of 31 patients without those, p < 0.0001). After adjustment for potential confounding variables, including electrocardiographic persistent ST segment elevation at 1 h after reperfusion, high Tc-PYP uptake remained independently predictive of no functional recovery with odds ratio of 8.7 (95% confidential interval = 2 to 38.7; p = 0.005). High Tc-PYP uptake in reperfused but viable infarct-related myocardium was a powerful predictor of no functional recovery, which may reflect excessive intracellular calcium ion overload caused by reperfusion injury. Tc-PYP/{sup 201}Tl dual-isotope SPECT imaging can provide prognostic information after reperfusion. (orig.)

  16. BaHg2Tl2. An unusual polar intermetallic phase with strong differentiation between the neighboring elements mercury and thallium.

    Science.gov (United States)

    Dai, Jing-Cao; Gupta, Shalabh; Gourdon, Olivier; Kim, Hyun-Jeong; Corbett, John D

    2009-06-24

    High yields of the novel BaHg(2)Tl(2) are achieved from reactions of the appropriate cast alloys at approximately 400 degrees C. (Isotypic SrHg(2)Tl(2) also exists.) The tetragonal barium structure (P4(2)/mnm, a = 10.606 A, c = 5.159 A) was refined from both single-crystal X-ray and neutron powder diffraction data in order to ensure the atom site assignments although distances and calculated atom site population also support the results. The Hg and Tl network atoms are distinctive in their functions and bonding. Parallel chains of Hg hexagons and of Tl tetrahedra along c are constructed from polyhedra that share opposed like edges, and these are in turn interconnected by Hg-Tl bonds. Overall, the number of Tl-Tl bonds per cell exceeds the Hg-Hg type by 20:12, but these are approximately 1:2 each in bonding according to their average -ICOHP values (related to overlap populations). Barium is bound within a close 15-atom polyhedron, 12 atoms of which are the more electronegative Hg. LMTO-ASA calculations show that scalar relativistic effects are particularly important for Hg 5d-6s mixing in Hg-Hg and Hg-Tl bonding, whereas relatively separate Tl 6s and 6p states are more important in Tl-Tl interactions. The 6p states of Hg and Tl and 5d of Ba define a dominant conduction band around E(F), and the phase is metallic and Pauli-like paramagnetic. The thallium characteristics here are close to those in numerous alkali-metal-Tl cluster systems. Other active metal-mercury phases that have been studied theoretically are all distinctly electron-richer and more reduced, and without appreciable net 5d, 6s contributions to Hg-Hg bonding.

  17. 7 CFR 810.204 - Grades and grade requirements for Six-rowed Malting barley and Six-rowed Blue Malting barley.

    Science.gov (United States)

    2010-01-01

    ... barley and Six-rowed Blue Malting barley. 810.204 Section 810.204 Agriculture Regulations of the... Standards for Barley Principles Governing the Application of Standards § 810.204 Grades and grade requirements for Six-rowed Malting barley and Six-rowed Blue Malting barley. Grade Minimum limits of— Test...

  18. Deep Ly alpha imaging of two z=2.04 GRB host galaxy fields

    DEFF Research Database (Denmark)

    Fynbo, J.P.U.; Møller, Per; Thomsen, Bente

    2002-01-01

    We report on the results of deep narrow-band Lyalpha and broad-band U and I imaging of the fields of two Gamma-Ray bursts at redshift z = 2.04 (GRB 000301C and GRB 000926). We find that the host galaxy of GRB 000926 is an extended (more than 2 arcsec), strong Lyalpha emitter with a rest-frame equ......We report on the results of deep narrow-band Lyalpha and broad-band U and I imaging of the fields of two Gamma-Ray bursts at redshift z = 2.04 (GRB 000301C and GRB 000926). We find that the host galaxy of GRB 000926 is an extended (more than 2 arcsec), strong Lyalpha emitter with a rest...

  19. Neutron capture at the s-process branching points $^{171}$Tm and $^{204}$Tl

    CERN Multimedia

    Branching points in the s-process are very special isotopes for which there is a competition between the neutron capture and the subsequent b-decay chain producing the heavy elements beyond Fe. Typically, the knowledge on the associated capture cross sections is very poor due to the difficulty in obtaining enough material of these radioactive isotopes and to measure the cross section of a sample with an intrinsic activity; indeed only 2 out o the 21 ${s}$-process branching points have ever been measured by using the time-of-flight method. In this experiment we aim at measuring for the first time the capture cross sections of $^{171}$Tm and $^{204}$Tl, both of crucial importance for understanding the nucleosynthesis of heavy elements in AGB stars. The combination of both (n,$\\gamma$) measurements on $^{171}$Tm and $^{204}$Tl will allow one to accurately constrain neutron density and the strength of the 13C(α,n) source in low mass AGB stars. Additionally, the cross section of $^{204}$Tl is also of cosmo-chrono...

  20. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma.

    Science.gov (United States)

    Lin, J D; Kao, P F; Weng, H F; Lu, W T; Huang, M J

    1998-07-01

    Radioactive iodine (131I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. 201Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative 131I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of 201Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of 131I and 201Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative 201Tl and 131I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. 201Tl imaging was performed before the 131I studies. Of the 62 patients who underwent 201Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the 201Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic 131I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by 201Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative 201Tl scans, 11 had positive findings on 131I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on 131I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative 201Tl and 131I scans, 15 had elevated serum Tg levels. Among these, local recurrence followed by lung metastases was manifested in

  1. MRI and thallium features of pigmented villonodular synovitis and giant cell tumours of tendon sheaths: a retrospective single centre study of imaging and literature review.

    Science.gov (United States)

    Lynskey, Samuel J; Pianta, Marcus J

    2015-01-01

    The purpose of this study was to characterize the MRI and thallium-201 ((201)TI) scintigraphy attributes of pigmented villonodular synovitis (PVNS) and giant cell tumours of tendon sheaths (GCTTS). The epidemiology of these uncommon lesions was also assessed and less commonly encountered pathology reported on including multifocality, necrosis and concurrent malignancy. A retrospective single centre review of MRI and (201)TI scintigraphy findings for 83 surgically proven or biopsy-proven consecutive cases of PVNS was undertaken. Radiological findings including lesion size, (201)TI uptake (as a marker of metabolic activity), location, extent and patient demographics were correlated with biopsy and surgical specimen histology. Typical appearances are described, as well as less common imaging manifestations. The study period encompassed all patients presenting or referred to a tertiary bone and soft-tissue tumour referral centre with PVNS or GCTTS between 1 January 2007 and the 1 December 2013. Lesions occur most commonly around the knee joint in the fourth decade of life, with younger patients showing a tendency to occur in the hip. Features of PVNS and GTTS include bone erosion, ligamentous and cartilage replacement, muscle infiltration and multifocality. MR signal characteristics were variable but post-contrast enhancement was near-universal. 14 of 83 cases showed no uptake of (201)TI and revealed a statistically significant smaller average axial dimension of 19.8 mm than lesions displaying active (201)TI uptake of 36.4 mm, p = 0.016. Four lesions demonstrated central necrosis on gross histology, two of each from both the (201)TI-avid and (201)TI-non-avid groups. MR is the imaging modality of choice when considering the diagnosis of these uncommon tumours. (201)TI scintigraphy as a marker of metabolic activity further adds minimal value although small lesions can appear to lack (201)TI avidity. This article depicts typical imaging findings of PVNS/GCTTS and

  2. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Lin Jen-Der; Weng Hsiao-Fen; Lu Wen-Tsoung [Division of Endocrinology and Metabolism, Chang Gung Memorial Hospital (Taiwan, Province of China); Kao Pan-Fu; Huang Miau-Ju [Department of Nuclear Medicine, Chang Gung Memorial Hospital, Taiwan (Taiwan, Province of China)

    1998-07-01

    Radioactive iodine ({sup 131}I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. {sup 201}Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative {sup 131}I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of {sup 201}Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of {sup 131}I and {sup 201}Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative {sup 201}Tl and {sup 131}I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. {sup 201}Tl imaging was performed before the {sup 131}I studies. Of the 62 patients who underwent {sup 201}Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the {sup 201}Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic {sup 131}I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by {sup 201}Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative {sup 201}Tl scans, 11 had positive findings on {sup 131}I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on {sup 131}I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative {sup 201}Tl and {sup 131}I

  3. Effects of adenosine and a selective A2A adenosine receptor agonist on hemodynamic and thallium-201 and technetium-99m-sestaMIBI biodistribution and kinetics.

    Science.gov (United States)

    Mekkaoui, Choukri; Jadbabaie, Farid; Dione, Donald P; Meoli, David F; Purushothaman, Kailasnath; Belardinelli, Luiz; Sinusas, Albert J

    2009-10-01

    The purpose of this study was to compare a selective A(2A) adenosine receptor agonist (regadenoson) with adenosine in clinically relevant canine models with regard to effects on hemodynamics and thallium-201 ((201)Tl) and technetium-99m ((99m)Tc)-sestaMIBI biodistribution and kinetics. The clinical application of vasodilator stress for perfusion imaging requires consideration of the effects of these vasodilating agents on systemic hemodynamics, coronary flow, and radiotracer uptake and clearance kinetics. Sequential imaging and arterial blood sampling was performed on control, anesthetized closed-chest canines (n = 7) to evaluate radiotracer biodistribution and kinetics after either a bolus administration of regadenoson (2.5 microg/kg) or 4.5-min infusion of adenosine (280 microg/kg). The effects of regadenoson on coronary flow and myocardial radiotracer uptake were then evaluated in an open-chest canine model of a critical stenosis (n = 7). Results from ex vivo single-photon emission computed tomography were compared with tissue well-counting. The use of regadenoson compared favorably with adenosine in regard to the duration and magnitude of the hemodynamic effects and the effect on (201)Tl and (99m)Tc-sestaMIBI biodistribution and kinetics. The arterial blood clearance half-time was significantly faster for (99m)Tc-sestaMIBI (regadenoson: 1.4 +/- 0.03 min; adenosine: 1.5 +/- 0.08 min) than for (201)Tl (regadenoson: 2.5 +/- 0.16 min, p adenosine: 2.7 +/- 0.04 min, p regadenoson stress was significantly greater than the relative perfusion defect with (99m)Tc-sestaMIBI (0.69 +/- 0.03%, p regadenoson produced a hyperemic response comparable to a standard infusion of adenosine. The biodistribution and clearance of both (201)Tl and (99m)Tc-sestaMIBI during regadenoson were similar to adenosine vasodilation. Ex vivo perfusion images under the most ideal conditions permitted detection of a critical stenosis, although (201)Tl offered significant advantages over (99m

  4. Comparison of 8-frame and 16-frame thallium-201 gated myocardial perfusion SPECT for determining left ventricular systolic and diastolic parameters.

    Science.gov (United States)

    Kurisu, Satoshi; Sumimoto, Yoji; Ikenaga, Hiroki; Watanabe, Noriaki; Ishibashi, Ken; Dohi, Yoshihiro; Fukuda, Yukihiro; Kihara, Yasuki

    2017-07-01

    The myocardial perfusion single photon emission computed tomography synchronized with the electrocardiogram (gated SPECT) has been widely used for the assessment of left ventricular (LV) systolic and diastolic functions using Quantitative gated SPECT. The aim of this study was to compare the effects of 8-frame and 16-frame thallium-201 (Tl-201) gated SPECT for determining LV systolic and diastolic parameters. The study population included 42 patients with suspected coronary artery disease who underwent gated SPECT by clinical indication. LV systolic and diastolic parameters were assessed on 8-frame and 16-frame gated SPECT. There were good correlations in end-diastolic volume (r = 0.99, p < 0.001), end-systolic volume (ESV) (r = 0.97, p < 0.001) and ejection fraction (EF) (r = 0.95, p < 0.001) between 8-frame and 16-frame gated SPECT. Bland-Altman plot showed a significant negative slope of -0.08 in EDV indicating a larger difference for larger EDV. Eight-frame gated SPECT overestimated ESV by 2.3 ml, and underestimated EF by -4.2% than 16-frame gated SPECT. There were good correlations in peak filling rate (PFR) (r = 0.87, p < 0.001), one third mean filling rate (r = 0.87, p < 0.001) and time to PFR (r = 0.61, p < 0.001) between 8-frame and 16-frame gated SPECT. Eight-frame gated SPECT underestimated PFR by -0.22 than 16-frame gated SPECT. Eight-frame gated SPECT estimated as much MFR/3 and TPFR as 16-frame gated SPECT. According to the data, the study suggested that 8-frame Tl-201 gated SPECT could underestimate systolic and/or diastolic parameter when compared with 16-frame gated SPECT.

  5. Histological and Pathological Assessment of miR-204 and SOX4 Levels in Gastric Cancer Patients.

    Science.gov (United States)

    Yuan, Xiao; Wang, Shuanhu; Liu, Mulin; Lu, Zhen; Zhan, Yanqing; Wang, Wenbin; Xu, A-Man

    2017-01-01

    Gastric cancer is one of the most common cancers and the efficient therapeutic methods are limited. Further study of the exact molecular mechanism of gastric cancer to develop novel targeted therapies is necessary and urgent. We herein systematically examined that miR-204 suppressed both proliferation and metastasis of gastric cancer AGS cells. miR-204 directly targeted SOX4. In clinical tissue research, we determined that miR-204 was expressed much lower and SOX4 expressed much higher in gastric cancer tissues compared with normal gastric tissues. Associated analysis with clinicopathological parameters in gastric cancer patients showed miR-204 was associated with no lymph node metastasis and early tumor stages whereas SOX4 was associated with lymph node metastasis and advanced tumor stages. In addition, miR-204 and SOX4 were negatively correlated in tissues from gastric cancer patients. Our findings examined the important role of miR-204 and SOX4 played in gastric cancer, and they could be used as candidate therapeutic targets for gastric cancer therapy.

  6. Comparison of plateletpheresis on the Fresenius AS.TEC 204 and Haemonetics MCS 3p.

    Science.gov (United States)

    Ranganathan, Sudha

    2007-02-01

    This is an attempt at comparing two cell separators for plateletpheresis, namely the Fresenius AS.TEC 204 and Haemonetics MCS 3p, at a tertiary care center in India. Donors who weighed between 55-75 kg, who had a hematocrit of 41-43%, and platelet counts of 250x10(3)-400x10(3)/microl were selected for the study. The comparability of the donors who donated on the two cell separators were analysed by t-test independent samples and no significant differences were found (P>0.05). The features compared were time taken for the procedure, volume processed on the separators, adverse reactions of the donors, quality control of the product, separation efficiency of the separators, platelet loss in the donors after the procedure, and the predictor versus the actual yield of platelets given by the cell separator. The volume processed to get a target yield of >3x10(11) was equal to 2.8-3.2 l and equal in both the cell separators. Symptoms of citrate toxicity were seen in 4 and 2.5% of donors who donated on the MCS 3p and the AS.TEC 204, respectively, and 3 and 1% of donors, respectively, had vasovagal reactions. All the platelet products collected had a platelet count of >3x10(11); 90% of the platelet products collected on the AS.TEC 204 attained the predicted yield that was set on the cell separator where as 75% of the platelet products collected on the MCS 3p attained the target yield. Quality control of the platelets collected on both the cell separators complied with the standards except that 3% of the platelets collected on the MCS 3p had a visible red cell contamination. The separation efficiency of the MCS 3p was higher, 50-52% as compared to the 40-45% on the AS.TEC 204. A provision of double venous access, less adverse reactions, negligible RBC contamination with a better predictor yield of platelets makes the AS.TEC 204 a safer and more reliable alternative than the widely used Haemonetics MCS 3p. Copyright (c) 2006 Wiley-Liss, Inc.

  7. Networking automation of ECI’s G-204 electronic engineering laboratory

    Directory of Open Access Journals (Sweden)

    Hernán Paz Penagos

    2010-04-01

    Full Text Available Increased use (by students and teachers of the “Escuela Colombiana de Ingeniería Julio Garavito” Electronic Engineering laboratories during the last year has congested access to these laboratories; the School’s Electronic Engineering (Ecitronica programme’s applied Electronic studies’ centre research group thus proposed, designed and developed a research prolect taking advantage of G building’s electrical distribution to offer access facilities, laboratory equipment control, energy saving and improved service quality. The G-204 laboratory’s network sys- tem will have an access control subsystem with client–main computer architecture. The latter consists of a user, schedule, group and work-bank database; the user is connected from any computer (client to the main computer through Internet to reserve his/her turn at laboratory practice by selecting the schedule, group, work-bank, network type required (1Ф or 3Ф and registering co-workers. Access to the G-204 laboratory on the day and time of practice is made by means of an intelligent card reader. Information of public interest produced and controlled by the main computer is displayed on three LCD screens located on one of G building’s second floor walls, as is an electronic clock. The G-204 laboratory temperature and time are continually updated. Work-banks are enabled or disabled by the main computer; the work banks are provided with power (beginning of practice or disconnected (end of practice or due to eventualities to protect the equipment, save energy, facilitate monitors and supervise the logistics of the state of the equipment at the end of each practice. The research group was organised into Transmission Line and Applications sub-groups. Power Line Communications PLC technology was used for to exploring digital modulation alternatives, coding and detecting errors, coupling, data transmission protocols and new applications, all based on channel estimation (networking

  8. MiR-204 silencing in intraepithelial to invasive cutaneous squamous cell carcinoma progression

    OpenAIRE

    Toll, Agust?; Salgado, Roc?o; Espinet, Blanca; D?az-Lagares, Angel; Hern?ndez-Ruiz, Eugenia; Andrades, Evelyn; Sandoval, Juan; Esteller, Manel; Pujol, Ram?n M; Hern?ndez-Mu?oz, Inmaculada

    2016-01-01

    Background Cutaneous squamous cell carcinoma (cSCC) is the second most common skin cancer and frequently progresses from an actinic keratosis (AK), a sun-induced keratinocyte intraepithelial neoplasia (KIN). Epigenetic mechanisms involved in the phenomenon of progression from AK to cSCC remain to be elicited. Methods Expression of microRNAs in sun-exposed skin, AK and cSCC was analysed by Agilent microarrays. DNA methylation of miR-204 promoter was determined by bisulphite treatment and pyros...

  9. Report of Apollo 204 Review Board to the Administrator, National Aeronautics and Space Administration . Appendix F ; Schedule of Physical Evidence

    Science.gov (United States)

    1967-01-01

    Immediately following the Apollo 204 accident of January 27, 1961. all associated equipment and material were impounded. Release of this equipment and material for normal use was under the close control of the Apollo 204 Review Board. Apollo Review Board Administrative Procedure No. 11, February 11, 1961, established the Apollo 204 Review Board Material Release Record (MRR). This MRR was the official form used to release material from full impoundment and was valid only after being approved by the Board and signed by a Member. The form was used as the authority to place any impounded item into one of the three Categories defined in Administrative Procedure No. 11. This appendix contains all of the authorized MRR's. Each item submitted on an MRR was given a control number; a description, including the part number and serial number; the relevance and location to the accident; any constraints before release; and the control category. The categories placed on the equipment were as follows: Category A - Items which may have a significant influence or bearing on the results or findings of the Apollo 204 Review Board; Category B - All material other than Category A which is considered relevant to the Apollo 204 Review Board investigation; Category C - Material released from Board jurisdiction. Several classes of equipment were released by special Board action prior to the establishment of the MRR system. The operating procedure for release of these classes is Enclosure F-l to this appendix.

  10. An activin A/BMP2 chimera, AB204, displays bone-healing properties superior to those of BMP2.

    Science.gov (United States)

    Yoon, Byung-Hak; Esquivies, Luis; Ahn, Chihoon; Gray, Peter C; Ye, Sang-Kyu; Kwiatkowski, Witek; Choe, Senyon

    2014-09-01

    Recombinant bone morphogenetic protein 2 (rhBMP2) has been used clinically to treat bone fractures in human patients. However, the high doses of rhBMP2 required for a therapeutic response can cause undesirable side effects. Here, we demonstrate that a novel Activin A/BMP2 (AB2) chimera, AB204, promotes osteogenesis and bone healing much more potently and effectively than rhBMP2. Remarkably, 1 month of AB204 treatment completely heals tibial and calvarial defects of critical size in mice at a concentration 10-fold lower than a dose of rhBMP2 that only partially heals the defect. We determine the structure of AB204 to 2.3 Å that reveals a distinct BMP2-like fold in which the Activin A sequence segments confer insensitivity to the BMP2 antagonist Noggin and an affinity for the Activin/BMP type II receptor ActRII that is 100-fold greater than that of BMP2. The structure also led to our identification of a single Activin A-derived amino acid residue, which, when mutated to the corresponding BMP2 residue, resulted in a significant increase in the affinity of AB204 for its type I receptor BMPRIa and a further enhancement in AB204's osteogenic potency. Together, these findings demonstrate that rationally designed AB2 chimeras can provide BMP2 substitutes with enhanced potency for treating non-union bone fractures. © 2014 American Society for Bone and Mineral Research.

  11. Corrective Action Decision Document for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada, Rev. No. 0

    Energy Technology Data Exchange (ETDEWEB)

    Robert Boehlecke

    2004-04-01

    The six bunkers included in CAU 204 were primarily used to monitor atmospheric testing or store munitions. The ''Corrective Action Investigation Plan (CAIP) for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada'' (NNSA/NV, 2002a) provides information relating to the history, planning, and scope of the investigation; therefore, it will not be repeated in this CADD. This CADD identifies potential corrective action alternatives and provides a rationale for the selection of a recommended corrective action alternative for each CAS within CAU 204. The evaluation of corrective action alternatives is based on process knowledge and the results of investigative activities conducted in accordance with the CAIP (NNSA/NV, 2002a) that was approved prior to the start of the Corrective Action Investigation (CAI). Record of Technical Change (ROTC) No. 1 to the CAIP (approval pending) documents changes to the preliminary action levels (PALs) agreed to by the Nevada Division of Environmental Protection (NDEP) and DOE, National Nuclear Security Administration Nevada Site Office (NNSA/NSO). This ROTC specifically discusses the radiological PALs and their application to the findings of the CAU 204 corrective action investigation. The scope of this CADD consists of the following: (1) Develop corrective action objectives; (2) Identify corrective action alternative screening criteria; (3) Develop corrective action alternatives; (4) Perform detailed and comparative evaluations of corrective action alternatives in relation to corrective action objectives and screening criteria; and (5) Recommend and justify a preferred corrective action alternative for each CAS within CAU 204.

  12. 41 CFR 302-9.204 - What is the “authorized point of origin” when I transport my POV from my post of duty?

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false What is the âauthorized point of originâ when I transport my POV from my post of duty? 302-9.204 Section 302-9.204 Public Contracts and Property Management Federal Travel Regulation System RELOCATION ALLOWANCES TRANSPORTATION AND...

  13. 25 CFR 900.204 - Is FTCA the exclusive remedy for a non-medical related tort claim arising out of the performance...

    Science.gov (United States)

    2010-04-01

    ... HEALTH AND HUMAN SERVICES CONTRACTS UNDER THE INDIAN SELF-DETERMINATION AND EDUCATION ASSISTANCE ACT... contractor or employee based upon performance of non-medical-related functions under a self-determination... tort claim arising out of the performance of a self-determination contract? 900.204 Section 900.204...

  14. 41 CFR 302-4.204 - If my spouse does not accompany me but travels unaccompanied at a different time, what per diem...

    Science.gov (United States)

    2010-07-01

    ... accompany me but travels unaccompanied at a different time, what per diem rate will he/she receive? 302-4.204 Section 302-4.204 Public Contracts and Property Management Federal Travel Regulation System... my spouse does not accompany me but travels unaccompanied at a different time, what per diem rate...

  15. 42 CFR 495.204 - Incentive payments to qualifying MA organizations for MA-EPs and MA-affiliated eligible hospitals.

    Science.gov (United States)

    2010-10-01

    ... for MA-EPs and MA-affiliated eligible hospitals. 495.204 Section 495.204 Public Health CENTERS FOR... CERTIFICATION STANDARDS FOR THE ELECTRONIC HEALTH RECORD TECHNOLOGY INCENTIVE PROGRAM Requirements Specific to...-EPs and MA-affiliated eligible hospitals. (a) General rule. A qualifying MA organization receives an...

  16. Breakup mechanisms for 7Li + 197Au, 204Pb systems at sub-barrier energies

    Directory of Open Access Journals (Sweden)

    Luong D.H.

    2013-12-01

    Full Text Available Coincidence measurements of breakup fragments were carried out for the 7Li + 197Au and 204Pb systems at sub-barrier energies. The mechanisms triggering breakup, and time-scales of each process, were identified through the reaction Q-values and the relative energy of the breakup fragments. Binary breakup of 7Li were found to be predominantly triggered by nucleon transfer, with p-pickup leading to 8Be → α + α decay being the preferred breakup mode. From the time-scales of each process, the coincidence yields were separated into prompt and delayed components, allowing the identification of breakup process important in the suppression of complete fusion of 7Li at above-barrier energies.

  17. Cortical Morphogenesis during Embryonic Development Is Regulated by miR-34c and miR-204

    DEFF Research Database (Denmark)

    Veno, Morten T.; Veno, Susanne T.; Rehberg, Kati

    2017-01-01

    The porcine brain closely resembles the human brain in aspects such as development and morphology. Temporal miRNA profiling in the developing embryonic porcine cortex revealed a distinct set of miRNAs, including miR-34c and miR-204, which exhibited a highly specific expression profile across...

  18. 78 FR 12716 - Reorganization of Foreign-Trade Zone 204 Under Alternative Site Framework Tri-Cities, Tennessee...

    Science.gov (United States)

    2013-02-25

    ... Foreign-Trade Zones Board Reorganization of Foreign-Trade Zone 204 Under Alternative Site Framework Tri-Cities, Tennessee/Virginia Pursuant to its authority under the Foreign-Trade Zones Act of June 18, 1934, as amended (19 U.S.C. 81a-81u), the Foreign-Trade Zones Board (the Board) adopts the following Order...

  19. The 17D-204 and 17DD yellow fever vaccines: an overview of major similarities and subtle differences.

    Science.gov (United States)

    Ferreira, Clarissa de Castro; Campi-Azevedo, Ana Carolina; Peruhype-Magalhāes, Vanessa; Costa-Pereira, Christiane; Albuquerque, Cleandro Pires de; Muniz, Luciana Feitosa; Yokoy de Souza, Talita; Oliveira, Ana Cristina Vanderley; Martins-Filho, Olindo Assis; da Mota, Licia Maria Henrique

    2017-11-27

    The yellow fever vaccine is a live attenuated virus vaccine that is considered one of the most efficient vaccines produced to date. The original 17D strain generated the substrains 17D-204 and 17DD, which are used for the current production of vaccines against yellow fever. The 17D-204 and 17DD substrains present subtle differences in their nucleotide compositions, which can potentially lead to variations in immunogenicity and reactogenicity. We will address the main changes in the immune responses induced by the 17D-204 and 17DD yellow fever vaccines and report similarities and differences between these vaccines in cellular and humoral immunity . This is a relevant issue in view of the re-emergence of yellow fever in Uganda in 2016 and in Brazil in the beginning of 2017. Areas covered: This article will be divided into 8 sections that will analyze the innate immune response, adaptive immune response, humoral response, production of cytokines, immunity in children, immunity in the elderly, gene expression and adverse reactions. Expert commentary: The 17D-204 and 17DD yellow fever vaccines present similar immunogenicity, with strong activation of the cellular and humoral immune responses. Additionally, both vaccines have similar adverse effects, which are mostly mild and thus are considered safe.

  20. 5 CFR 894.204 - May I be enrolled in more than one dental or vision plan at a time?

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false May I be enrolled in more than one dental... PROGRAM Coverage and Types of Enrollment § 894.204 May I be enrolled in more than one dental or vision plan at a time? You may be enrolled in a FEDVIP dental plan and a separate FEDVIP vision plan at the...

  1. 20 CFR 718.204 - Total disability and disability causation defined; criteria for determining total disability and...

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Total disability and disability causation defined; criteria for determining total disability and total disability due to pneumoconiosis. 718.204... MINE HEALTH AND SAFETY ACT OF 1969, AS AMENDED STANDARDS FOR DETERMINING COAL MINERS' TOTAL DISABILITY...

  2. Micro-RNA-204 Participates in TMPRSS2/ERG Regulation and Androgen Receptor Reprogramming in Prostate Cancer.

    Science.gov (United States)

    Todorova, Krassimira; Metodiev, Metodi V; Metodieva, Gergana; Mincheff, Milcho; Fernández, Nelson; Hayrabedyan, Soren

    2017-02-01

    Cancer progression is driven by genome instability incurred rearrangements such as transmembrane protease, serine 2 (TMPRSS2)/v-ets erythroblastosis virus E26 oncogene (ERG) that could possibly turn some of the tumor suppressor micro-RNAs into pro-oncogenic ones. Previously, we found dualistic miR-204 effects, acting either as a tumor suppressor or as an oncomiR in ERG fusion-dependent manner. Here, we provided further evidence for an important role of miR-204 for TMPRSS2/ERG and androgen receptor (AR) signaling modulation and fine tuning that prevents TMPRSS2/ERG overexpression in prostate cancer. Based on proximity-based ligation assay, we designed a novel method for detection of TMPRSS2/ERG protein products. We found that miR-204 is TMPRSS2/ERG oncofusion negative regulator, and this was mediated by DNA methylation of TMPRSS2 promoter. Transcriptional factors runt-related transcription factor 2 (RUNX2) and ETS proto-oncogene 1 (ETS1) were positive regulators of TMPRSS2/ERG expression and promoter hypo-methylation. Clustering of patients' sera for fusion protein, transcript expression, and wild-type ERG transcript isoforms, demonstrated not all patients harboring fusion transcripts had fusion protein products, and only few fusion positive ones exhibited increased wild-type ERG transcripts. miR-204 upregulated AR through direct promoter hypo-methylation, potentiated by the presence of ERG fusion and RUNX2 and ETS1. Proteomics studies provided evidence that miR-204 has dualistic role in AR cancer-related reprogramming, promoting prostate cancer-related androgen-responsive genes and AR target genes, as well as AR co-regulatory molecules. miR-204 methylation regulation was supported by changes in molecules responsible for chromatin remodeling, DNA methylation, and its regulation. In summary, miR-204 is a mild regulator of the AR function during the phase of preserved AR sensitivity as the latter one is required for ERG-fusion translocation.

  3. Genomic loss of tumor suppressor miRNA-204 promotes cancer cell migration and invasion by activating AKT/mTOR/Rac1 signaling and actin reorganization.

    Directory of Open Access Journals (Sweden)

    J Saadi Imam

    Full Text Available Increasing evidence suggests that chromosomal regions containing microRNAs are functionally important in cancers. Here, we show that genomic loci encoding miR-204 are frequently lost in multiple cancers, including ovarian cancers, pediatric renal tumors, and breast cancers. MiR-204 shows drastically reduced expression in several cancers and acts as a potent tumor suppressor, inhibiting tumor metastasis in vivo when systemically delivered. We demonstrated that miR-204 exerts its function by targeting genes involved in tumorigenesis including brain-derived neurotrophic factor (BDNF, a neurotrophin family member which is known to promote tumor angiogenesis and invasiveness. Analysis of primary tumors shows that increased expression of BDNF or its receptor tropomyosin-related kinase B (TrkB parallel a markedly reduced expression of miR-204. Our results reveal that loss of miR-204 results in BDNF overexpression and subsequent activation of the small GTPase Rac1 and actin reorganization through the AKT/mTOR signaling pathway leading to cancer cell migration and invasion. These results suggest that microdeletion of genomic loci containing miR-204 is directly linked with the deregulation of key oncogenic pathways that provide crucial stimulus for tumor growth and metastasis. Our findings provide a strong rationale for manipulating miR-204 levels therapeutically to suppress tumor metastasis.

  4. Significance of exercise-induced ST segment depression in patients with myocardial infarction involving the left circumflex artery. Evaluation by exercise thallium-201 myocardial single photon emission computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Koitabashi, Norimichi; Toyama, Takuji; Hoshizaki, Hiroshi [Gunma Prefectural Cardiovascular Center, Maebashi (Japan)] [and others

    2000-04-01

    The significance of exercise-induced ST segment depression in patients with left circumflex artery involvement was investigated by comparing exercise electrocardiography with exercise thallium-201 single photon emission computed tomography (Tl-SPECT) and the wall motion estimated by left ventriculography. Tl-SPECT and exercise electrocardiography were simultaneously performed in 51 patients with left circumflex artery involvement (angina pectoris 30, myocardial infarction 21). In patients with myocardial infarction, exercise-induced ST depression was frequently found in the V{sub 2}, V{sub 3} and V{sub 4} leads. In patients with angina pectoris, ST depression was frequently found in the II, III, aV{sub F}, V{sub 5} and V{sub 6} leads. There was no obvious difference in the leads of ST depression in patients with myocardial infarction with ischemia and without ischemia on Tl-SPECT images. In patients with myocardial infarction, the lateral wall motion of the infarcted area evaluated by left ventriculography was more significantly impaired in the patients with ST depression than without ST depression (p<0.01). Exercise-induced ST depression in the precordial leads possibly reflects wall motion abnormality rather than ischemia in the lateral infarcted myocardium. (author)

  5. Pharmacokinetics and tissue distribution of ginsenoside Rh2 and Rg3 epimers after oral administration of BST204, a purified ginseng dry extract, in rats.

    Science.gov (United States)

    Bae, Soo Hyeon; Park, Jung Bae; Zheng, Yu Fen; Jang, Min Jung; Kim, Sun Ok; Kim, Jeom Yong; Yoo, Young Hyo; Yoon, Kee Dong; Oh, Euichaul; Bae, Soo Kyung

    2014-12-01

    1. BST204, a purified ginseng dry extract containing a high concentration of racemic Rh2 and Rg3 mixtures, is being developed for supportive care use in cancer patients in Korea. This study investigates the pharmacokinetics and tissue distribution of BST204 in rats. 2. After oral administration of BST204, only the S epimers, S-Rh2 and S-Rg3, could be determined in rat plasma. The poor absorption of the R-epimers, R-Rh2 and R-Rg3, may be attributed to lower membrane permeability and extensive intestinal oxygenation and/or deglycosylation into metabolites. The AUC and Cmax values of both S-Rh2 and S-Rg3 after BST204 oral administration were proportional to the administered BST204 doses ranged from 400 mg/kg to 2000 mg/kg, which suggested linear pharmacokinetic properties. 3. There were no statistically significant differences in the pharmacokinetics of S-Rh2 and S-Rg3 after oral administration of pure S-Rh2 (31.5 mg/kg) and S-Rg3 (68 mg/kg) compared with oral administration of BST204, 1000 mg/kg. These indicated that the presence of other components of BST204 extract did not influence the pharmacokinetic behavior of S-Rh2 and S-Rg3. 4. After oral dosing of BST204, S-Rh2 and S-Rg3 were distributed mainly to the liver and gastrointestinal tract in rats. 5. Our finding may help to understand pharmacokinetic characteristics of S-Rh2, R-Rh2, S-Rg3, and R-Rg3, comprehensively, and provide useful information in clinical application of BST204.

  6. Evaluation of Energy-Related Inventions Program: An Empirical Analysis of 204 Inventions

    Energy Technology Data Exchange (ETDEWEB)

    Brown, M.A.

    1987-01-01

    This report is an evaluation of the Energy-Related Inventions Program (ERIP). It assesses the program's effectiveness and impacts, characterizes participating inventions and inventors, and identifies correlates of successful commercialization in order to suggest possible improvements. Seventy of the 204 ERIP inventions that were studied were successfully introduced into the market, accounting for more than $200M in sales from 1976 through 1984. During 1984, 921 full-time equivalent employees were supported directly by ERIP inventors or their licensees. (Estimates of indirect economic impacts are also contained in the report.) Data on patterns of fund raising clearly show a need for assistance by programs like ERIP. Commercially successful inventors shared several traits. They had less formal education, fewer patents, more work experience in small firms, more outside funding early in their work, more shared responsibility with others for invention development, more management experience, and greater previous experience with starting new businesses. Recommendations are made regarding: (1) priorities for allocating ERIP grants; (2) improved efficiency of the NBS/DOE operations; (3) delivery of technical and commercialization assistance to grant recipients; and (4) further evaluation research.

  7. Identification of vortex structures in a cohort of 204 intracranial aneurysms.

    Science.gov (United States)

    Varble, Nicole; Trylesinski, Gabriel; Xiang, Jianping; Snyder, Kenneth; Meng, Hui

    2017-05-01

    An intracranial aneurysm (IA) is a cerebrovascular pathology that can lead to death or disability if ruptured. Abnormal wall shear stress (WSS) has been associated with IA growth and rupture, but little is known about the underlying flow physics related to rupture-prone IAs. Previous studies, based on analysis of a few aneurysms or partial views of three-dimensional vortex structures, suggest that rupture is associated with complex vortical flow inside IAs. To further elucidate the relevance of vortical flow in aneurysm pathophysiology, we studied 204 patient IAs (56 ruptured and 148 unruptured). Using objective quantities to identify three-dimensional vortex structures, we investigated the characteristics associated with aneurysm rupture and if these features correlate with previously proposed WSS and morphological characteristics indicative of IA rupture. Based on the Q-criterion definition of a vortex, we quantified the degree of the aneurysmal region occupied by vortex structures using the volume vortex fraction (vVF) and the surface vortex fraction (sVF). Computational fluid dynamics simulations showed that the sVF, but not the vVF, discriminated ruptured from unruptured aneurysms. Furthermore, we found that the near-wall vortex structures co-localized with regions of inflow jet breakdown, and significantly correlated to previously proposed haemodynamic and morphologic characteristics of ruptured IAs. © 2017 The Author(s).

  8. Skin Cancer: ClinicoPathological Study of 204 Patients in Southern Governorates of Yemen.

    Science.gov (United States)

    AlZou, Amer Bin; Thabit, Mazen Abood Bin; AlSakkaf, Khalid Abdulla; Basaleem, Huda Omer

    2016-01-01

    Skin cancer is a group of heterogeneous malignancies, in general classified into nonmelanoma skin cancer (NMSC) and melanoma skin cancer (MSC). Incidences are high in many parts in the world with considerable geographical and racial variation. In the Yemen, there has been scarce information about skin cancer. The aim of this study was to evaluate the demographic characteristics and histological trend of skin cancer in Southern Governorates of Yemen. This retrospective study covered 204 cases of skin cancer at the Modern Histopathology Laboratory and Aden Cancer Registry and Research Center, Faculty of Medicine and Health Sciences, University of Aden, for the period 20062013. Data were classified regarding different demographic and tumor related variables and analyzed using CanReg4 for cancer registry and SPSS (version 21). The commonest encountered skin cancer was NMSC (93.1%). Generally, skin cancer appears slightly more frequently in females than males with a 1:1.06 male: female ratio, with a mean age of 62.9 years. Slightly higher than onethird (36.3%) were from Aden governorate. The head and neck proved to be the most common site in both males and females (58%). Basal cell carcinoma (BCC) is the most common histological type of skin cancer (50.5%). Skin cancer is a common cancer in patients living in southern governorates of Yemen. The pattern appears nearly similar to the international figures with a low incidence of MSC.

  9. The VIMOS Public Extragalactic Survey (VIPERS). First Data Release of 57 204 spectroscopic measurements

    Science.gov (United States)

    Garilli, B.; Guzzo, L.; Scodeggio, M.; Bolzonella, M.; Abbas, U.; Adami, C.; Arnouts, S.; Bel, J.; Bottini, D.; Branchini, E.; Cappi, A.; Coupon, J.; Cucciati, O.; Davidzon, I.; De Lucia, G.; de la Torre, S.; Franzetti, P.; Fritz, A.; Fumana, M.; Granett, B. R.; Ilbert, O.; Iovino, A.; Krywult, J.; Le Brun, V.; Le Fèvre, O.; Maccagni, D.; Małek, K.; Marulli, F.; McCracken, H. J.; Paioro, L.; Polletta, M.; Pollo, A.; Schlagenhaufer, H.; Tasca, L. A. M.; Tojeiro, R.; Vergani, D.; Zamorani, G.; Zanichelli, A.; Burden, A.; Di Porto, C.; Marchetti, A.; Marinoni, C.; Mellier, Y.; Moscardini, L.; Nichol, R. C.; Peacock, J. A.; Percival, W. J.; Phleps, S.; Wolk, M.

    2014-02-01

    We present the first Public Data Release (PDR-1) of the VIMOS Public Extragalactic Survey (VIPERS). It comprises 57 204 spectroscopic measurements together with all additional information necessary for optimal scientific exploitation of the data, in particular the associated photometric measurements and quantification of the photometric and survey completeness. VIPERS is an ESO Large Programme designed to build a spectroscopic sample of ≃100 000 galaxies with iAB accessing the data through the survey database (http://vipers.inaf.it) where all information can be queried interactively. Based on observations collected at the European Southern Observatory, Cerro Paranal, Chile, using the Very Large Telescope under programs 182.A-0886 and partly 070.A-9007. Also based on observations obtained with MegaPrime/MegaCam, a joint project of CFHT and CEA/DAPNIA, at the Canada-France-Hawaii Telescope (CFHT), which is operated by the National Research Council (NRC) of Canada, the Institut National des Sciences de l'Univers of the Centre National de la Recherche Scientifique (CNRS) of France, and the University of Hawaii. This work is based in part on data products produced at TERAPIX and the Canadian Astronomy Data Centre as part of the Canada-France-Hawaii Telescope Legacy Survey, a collaborative project of NRC and CNRS. The VIPERS web site is http://vipers.inaf.it/

  10. [Disability evaluation of 204 cases of children with brain injury in road traffic accidents].

    Science.gov (United States)

    Liu, Kuan-lin; Zhang, Xian-guo; Kong, Bin; Huang, Si-xing

    2010-08-01

    To study the types, characteristics and common complications as well as disability assessment for the children with craniocerebral injury in the road traffic accidents. Data from 204 cases of children with cranio-injury in road traffic accidents were collected and were statistically analyzed according to the location injured, complication, the type of complication and the severity of disability. There were 64 cases of simple diffuse primary craniocerebral injury, 80 cases of simple local primary cranio-injury, 24 cases of diffuse secondary craniocerebral injury and 36 cases of local secondary cranio-injury. The main complications included traumatic epilepsy (14, 6.9%), traumatic cerebral infarction (9, 4.4%), traumatic hydrocephalus (7, 3.4%) and traumatic mental disorder (5, 2.5%). Among the children with cranio-injury due to road traffic accidents, simple primary cranio-injury was the most common result, whereas the traumatic epilepsy and traumatic cerebral infarction were the major types of complications. The assessment criteria for body impairment of the children with craniocerebral injury in the road traffic accidents should be broadened accordingly, with addition of certain specific items for children.

  11. β-delayed γ-ray spectroscopy of 203,204Au and 200-202Pt

    Science.gov (United States)

    Morales, A. I.; Benlliure, J.; Górska, M.; Grawe, H.; Verma, S.; Regan, P. H.; Podolyák, Zs.; Pietri, S.; Kumar, R.; Casarejos, E.; Algora, A.; Alkhomashi, N.; Álvarez-Pol, H.; Benzoni, G.; Blazhev, A.; Boutachkov, P.; Bruce, A. M.; Cáceres, L. S.; Cullen, I. J.; Denis Bacelar, A. M.; Doornenbal, P.; Estévez-Aguado, M. E.; Farrelly, G.; Fujita, Y.; Garnsworthy, A. B.; Gelletly, W.; Gerl, J.; Grebosz, J.; Hoischen, R.; Kojouharov, I.; Kurz, N.; Lalkovski, S.; Liu, Z.; Mihai, C.; Molina, F.; Mücher, D.; Prokopowicz, W.; Rubio, B.; Schaffner, H.; Steer, S. J.; Tamii, A.; Tashenov, S.; Valiente-Dobón, J. J.; Walker, P. M.; Wollersheim, H. J.; Woods, P. J.

    2013-07-01

    The β decay of five heavy, neutron-rich nuclei, 203,204Pt and 200-202Ir, has been investigated following relativistic cold fragmentation reactions of lead projectiles using the FRS+RISING setup at GSI. This paper reports on the study of the low-lying states in the decay daughter nuclei 203,204Au and 200-202Pt. The characteristic γ rays for each nucleus have been determined using β-delayed γ-ray spectroscopy. Tentative level schemes, relative intensities, and apparent β feedings are provided. These data are compared with shell-model calculations, which indicate a substantial contribution to the total β strength from high-energy first-forbidden β-decay transitions in this mass region.

  12. Genome Sequence of Vibrio campbellii Strain UMTGB204, a Marine Bacterium Isolated from a Green Barrel Tunicate

    Science.gov (United States)

    Gan, Huan You; Noor, Mohd Ezhar Mohd; Saari, Nur Azna; Musa, Najiah; Mustapha, Baharim; Usup, Gires

    2015-01-01

    Vibrio campbellii strain UMTGB204 was isolated from a green barrel tunicate. The genome of this strain comprises 5,652,224 bp with 5,014 open reading frames, 9 rRNAs, and 116 tRNAs. It contains genes related to virulence and environmental tolerance. Gene clusters for the biosynthesis of nonribosomal peptides and bacteriocin were also identified. PMID:25814609

  13. Coupled-channel analysis for 20.4 MeV energy of p-64 Zn inelastic ...

    Indian Academy of Sciences (India)

    In this study, a coupled-channel (CC) analysis of the elastic and the inelastic scattering of 20.4 MeV polarized protons from a 64Zn target leading to the deformed 2+, 3 − , 2 2 + states was performed. The CC potential parameters and the deformation parameters of the excited states corresponding to the best fit to the ...

  14. Corrective Action Decision Document for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada: Revision 0, Including Errata Sheet

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office

    2004-04-01

    This Corrective Action Decision Document identifies the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office's corrective action alternative recommendation for each of the corrective action sites (CASs) within Corrective Action Unit (CAU) 204: Storage Bunkers, Nevada Test Site (NTS), Nevada, under the Federal Facility Agreement and Consent Order. An evaluation of analytical data from the corrective action investigation, review of current and future operations at each CAS, and a detailed comparative analysis of potential corrective action alternatives were used to determine the appropriate corrective action for each CAS. There are six CASs in CAU 204, which are all located between Areas 1, 2, 3, and 5 on the NTS. The No Further Action alternative was recommended for CASs 01-34-01, 02-34-01, 03-34-01, and 05-99-02; and a Closure in Place with Administrative Controls recommendation was the preferred corrective action for CASs 05-18-02 and 05-33-01. These alternatives were judged to meet all requirements for the technical components evaluated as well as applicable state and federal regulations for closure of the sites and will eliminate potential future exposure pathways to the contaminated media at CAU 204.

  15. miR-10a and miR-204 as a Potential Prognostic Indicator in Low-Grade Gliomas

    Directory of Open Access Journals (Sweden)

    Ju Cheol Son

    2017-04-01

    Full Text Available This study aimed to identify and characterize microRNAs (miRNAs that are related to radiosensitivity in low-grade gliomas (LGGs. The miRNA expression levels in radiosensitive and radioresistant LGGs were compared using The Cancer Genome Atlas database, and differentially expressed miRNAs were identified using the EBSeq package. The miRNA target genes were predicted using Web databases. Fifteen miRNAs were differentially expressed between the groups, with miR-10a and miR-204 being related to overall survival (OS of patients with LGG. Patients with upregulated miR-10a expression had a higher mortality rate and shorter OS time, whereas patients with downregulated miR-204 expression had a lower mortality rate and longer OS time. Two genes, HSP90AA1 and CREB5 , were targets for both miRNAs. Thus, this study suggests that expression of miR-10a and miR-204 is significantly related to both radiosensitivity and the survival of patients with LGG. These miRNAs could therefore act as clinical biomarkers for LGG prognosis and diagnosis.

  16. Hanford Tanks 241-C-203 and 241 C 204: Residual Waste Contaminant Release Model and Supporting Data

    Energy Technology Data Exchange (ETDEWEB)

    Deutsch, William J.; Krupka, Kenneth M.; Lindberg, Michael J.; Cantrell, Kirk J.; Brown, Christopher F.; Schaef, Herbert T.

    2007-05-23

    This report was revised in May 2007 to correct 90Sr values in Chapter 3. The changes were made on page 3.9, paragraph two and Table 3.10; page 3.16, last paragraph on the page; and Tables 3.21 and 3.31. The rest of the text remains unchanged from the original report issued in October 2004. This report describes the development of release models for key contaminants that are present in residual sludge remaining after closure of Hanford Tanks 241-C-203 (C-203) and 241-C-204 (C-204). The release models were developed from data generated by laboratory characterization and testing of samples from these two tanks. Key results from this work are (1) future releases from the tanks of the primary contaminants of concern (99Tc and 238U) can be represented by relatively simple solubility relationships between infiltrating water and solid phases containing the contaminants; and (2) high percentages of technetium-99 in the sludges (20 wt% in C-203 and 75 wt% in C-204) are not readily water leachable, and, in fact, are very recalcitrant. This is similar to results found in related studies of sludges from Tank AY-102. These release models are being developed to support the tank closure risk assessments performed by CH2M HILL Hanford Group, Inc., for the U.S. Department of Energy.

  17. Hanford Tanks 241-C-203 and 241-C-204: Residual Waste Contaminant Release Model and Supporting Data

    Energy Technology Data Exchange (ETDEWEB)

    Deutsch, William J.; Krupka, Kenneth M.; Lindberg, Michael J.; Cantrell, Kirk J.; Brown, Christopher F.; Schaef, Herbert T.

    2004-10-28

    This report describes the development of release models for key contaminants that are present in residual sludge remaining after closure of Hanford Tanks 241-C-203 (C-203) and 241-C-204 (C-204). The release models were developed from data generated by laboratory characterization and testing of samples from these two tanks. Key results from this work are (1) future releases from the tanks of the primary contaminants of concern (99Tc and 238U) can be represented by relatively simple solubility relationships between infiltrating water and solid phases containing the contaminants; and (2) high percentages of technetium-99 in the sludges (20 wt% in C-203 and 75 wt% in C-204) are not readily water leachable, and, in fact, are very recalcitrant. This is similar to results found in related studies of sludges from Tank AY-102. These release models are being developed to support the tank closure risk assessments performed by CH2M HILL Hanford Group, Inc., for the U.S. Department of Energy.

  18. Comparison of the osteogenesis and fusion rates between activin A/BMP-2 chimera (AB204) and rhBMP-2 in a beagle's posterolateral lumbar spine model.

    Science.gov (United States)

    Zheng, Guang Bin; Yoon, Byung-Hak; Lee, Jae Hyup

    2017-10-01

    Activin A/BMP-2 chimera (AB204) could promote bone healing more effectively than recombinant bone morphogenetic protein 2 (rhBMP-2) with much lower dose in a rodent model, but there is no report about the effectiveness of AB204 in a large animal model. The purpose of this study was to compare the osteogenesis and fusion rate between AB204 and rhBMP-2 using biphasic calcium phosphate (BCP) as a carrier in a beagle's posterolateral lumbar fusion model. This is a randomized control animal study. Seventeen male beagle dogs were included. Bilateral posterolateral fusion was performed at the L1-L2 and L4-L5 levels. Biphasic calcium phosphate (2 cc), rhBMP-2 (50 µg)+BCP (2 cc), or AB204 (50 µg)+BCP (2 cc) were implanted into the intertransverse space randomly. X-ray was performed at 4 and 8 weeks. After 8 weeks, the animals were sacrificed, and new bone formation and fusion rate were evaluated by manual palpation, computed tomography (CT), and undecalcified histology. The AB204 group showed significantly higher fusion rate (90%) than the rhBMP-2 group (15%) or the Osteon group (6.3%) by manual palpation. On x-ray and CT assessment, fusion rate and the volume of newly formed bone were also significantly higher in AB204 group than other groups. In contrast, more osteolysis was found in rhBMP-2 group (40%) than in AB204 group (10%) on CT study. In histologic results, new bone formation was sufficient between transverse processes in AB204 group, and obvious trabeculation and bone remodeling were observed. But in rhBMP-2 group, new bone formation was less than AB204 group and osteolysis was observed between the intertransverse spaces. A low dose of AB204 with BCP as a carrier significantly promotes the fusion rate in a large animal model when compared with the rhBMP-2. These findings demonstrate that AB204 could be an alternative to rhBMP-2 to improve fusion rate. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Network modeling identifies molecular functions targeted by miR-204 to suppress head and neck tumor metastasis.

    Directory of Open Access Journals (Sweden)

    Younghee Lee

    2010-04-01

    Full Text Available Due to the large number of putative microRNA gene targets predicted by sequence-alignment databases and the relative low accuracy of such predictions which are conducted independently of biological context by design, systematic experimental identification and validation of every functional microRNA target is currently challenging. Consequently, biological studies have yet to identify, on a genome scale, key regulatory networks perturbed by altered microRNA functions in the context of cancer. In this report, we demonstrate for the first time how phenotypic knowledge of inheritable cancer traits and of risk factor loci can be utilized jointly with gene expression analysis to efficiently prioritize deregulated microRNAs for biological characterization. Using this approach we characterize miR-204 as a tumor suppressor microRNA and uncover previously unknown connections between microRNA regulation, network topology, and expression dynamics. Specifically, we validate 18 gene targets of miR-204 that show elevated mRNA expression and are enriched in biological processes associated with tumor progression in squamous cell carcinoma of the head and neck (HNSCC. We further demonstrate the enrichment of bottleneckness, a key molecular network topology, among miR-204 gene targets. Restoration of miR-204 function in HNSCC cell lines inhibits the expression of its functionally related gene targets, leads to the reduced adhesion, migration and invasion in vitro and attenuates experimental lung metastasis in vivo. As importantly, our investigation also provides experimental evidence linking the function of microRNAs that are located in the cancer-associated genomic regions (CAGRs to the observed predisposition to human cancers. Specifically, we show miR-204 may serve as a tumor suppressor gene at the 9q21.1-22.3 CAGR locus, a well established risk factor locus in head and neck cancers for which tumor suppressor genes have not been identified. This new strategy

  20. EFFECT OF UV IRRADIATION ON THE DYEING OF COTTON FABRIC WITH REACTIVE BLUE 204

    Directory of Open Access Journals (Sweden)

    ROŞU Liliana

    2017-05-01

    Full Text Available Reactive dyes are synthetic organic compounds used on a wide scale in textile industry, for painting materials of different types and compositions (e.g. 100% cotton, wool, natural satin, viscose, synthetic fibres. Reactive dyes are solid compounds (powders completely water soluble at normal temperature and pressure conditions. Their structures contain chromophore groups, which generate colour, and auxochrome groups, which determine the compounds water solubility and the capacity to fix to the textile fiber. Such organic compounds absorb UV-Vis radiations at specific wavelengths, corresponding to maximum absorbtion peaks, in both solution and dyed fiber. The human organism, through the dyed clothing, comes in direct contact with those dyes which can undergo modifications once exposed to UV radiations, having the posibility to reach the organism via cutanated transport. As it is known, the provoked negative effects are stronger during summer when UV radiations are more intense and in order to reduce their intensity dark coloured clothing is avoided. Dyes can be transformed in compounds which are easily absorbed into the skin. Some of these metabolites can be less toxic than the original corresponding dye, whilst others, such as free radicals, are potentially cancerous. Knowledge of the biological effects of the organic dyes, reactive dyes in particular, correlated with their structural and physical characteristics, permanently consists an issue of high scientific and practical interest and its solution may contribute in the diminishing of risk factors and improving of population health. UV radiation influence on the structural and colour modifications of textile materials were studied. Colour modifications are due to structural changes in aromatic and carbonil groups. In most cases photo-oxidative processes were identified in the dye structure. Dyeing was performed using non-irradiated and irradiated cotton painted with reactive blue dye 204.

  1. Diagnostic value of thallium-201 myocardial perfusion IQ-SPECT without and with computed tomography-based attenuation correction to predict clinically significant and insignificant fractional flow reserve: A single-center prospective study.

    Science.gov (United States)

    Tanaka, Haruki; Takahashi, Teruyuki; Ohashi, Norihiko; Tanaka, Koichi; Okada, Takenori; Kihara, Yasuki

    2017-12-01

    The aim of this study was to clarify the predictive value of fractional flow reserve (FFR) determined by myocardial perfusion imaging (MPI) using thallium (Tl)-201 IQ-SPECT without and with computed tomography-based attenuation correction (CT-AC) for patients with stable coronary artery disease (CAD).We assessed 212 angiographically identified diseased vessels using adenosine-stress Tl-201 MPI-IQ-SPECT/CT in 84 consecutive, prospectively identified patients with stable CAD. We compared the FFR in 136 of the 212 diseased vessels using visual semiquantitative interpretations of corresponding territories on MPI-IQ-SPECT images without and with CT-AC.FFR inversely correlated most accurately with regional summed difference scores (rSDS) in images without and with CT-AC (r = -0.584 and r = -0.568, respectively, both P < .001). Receiver-operating characteristics analyses using rSDS revealed an optimal FFR cut-off of <0.80 without and with CT-AC. Although the diagnostic accuracy of FFR <0.80 did not significantly differ, FFR ≥0.82 was significantly more accurate with, than without CT-AC. Regions with rSDS ≥2 without or with CT-AC predicted FFR <0.80, and those with rSDS ≤1 without and with CT-AC predicted FFR ≥0.81, with 73% and 83% sensitivity, 84% and 67% specificity, and 79% and 75% accuracy, respectively.Although limited by the sample size and the single-center design, these findings showed that the IQ-SPECT system can predict FFR at an optimal cut-off of <0.80, and we propose a novel application of CT-AC to MPI-IQ-SPECT for predicting clinically significant and insignificant FFR even in nonobese patients. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  2. Dual myocardial single photon emission computed tomography (SPECT) using thallium-201 and I-123-{beta}-methyl-i-pentadecanoic acid in patients with Duchenne's progressive muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Shimoyama, Katsuya [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine

    1999-10-01

    Dual single photon emission computed tomography (SPECT) was performed in 31 patients with Duchenne's progressive muscular dystrophy (DMD) using {sup 123}I-{beta}-methyl pentadecanoic acid (BMIPP) for myocardial fatty acid metabolism and {sup 201}thallium (Tl)-chloride for myocardial perfusion. The left ventricle was divided into 9 segments, and accumulation of the radiotracers was assessed visually for each segment to calculate defect score for each tracer. There was some degree of decrease in myocardial accumulation of both tracers in all DMD patients. Reduced accumulation was most common at the apex (BMIPP: 67%, Tl: 63%), followed by the posterior wall, lateral wall, and anterior wall. On the other hand, reduced accumulation was less common at the septum. BMIPP showed a higher accumulation than Tl in all segments but the septum. When BMIPP defect score was larger than Tl defect score, BMIPP defect score tended to increase during 4 years follow-up (p<0.042). However, when Tl defect score was larger than BMIPP defect score, an increase in Tl defect score was slight. A significant negative correlation was found between the sum of the BMIPP and Tl defect scores and the left ventricular ejection fraction (LVEF) (r=0.66, p<0.0001). According to the histo-pathological study of two autopsied hearts, severe myocardial fibrosis was seen in segments with fixed perfusion defect. In addition, the mismatched segments of BMIPP defect score > Tl defect score revealed a slight fibrosis or normal myocardium. It can be concluded that the dual SPECT myocardial scintigraphy using BMIPP and Tl provides accurate information about disease progression of the heart in patients with DMD by detecting abnormalities of the myocardial metabolism of each substance, thereby enabling the assessment of left ventricular function. (author)

  3. Suppression of TLR4-mediated inflammatory response by macrophage class A scavenger receptor (CD204)

    Energy Technology Data Exchange (ETDEWEB)

    Ohnishi, Koji; Komohara, Yoshihiro; Fujiwara, Yukio; Takemura, Kenichi [Department of Cell Pathology, Graduate School of Medical Sciences, Faculty of Life Sciences, Kumamoto University, Kumamoto (Japan); Lei, XiaoFeng [Department of Cell Pathology, Graduate School of Medical Sciences, Faculty of Life Sciences, Kumamoto University, Kumamoto (Japan); Department of Biochemistry, Showa University School of Medicine, Tokyo (Japan); Nakagawa, Takenobu [Department of Cell Pathology, Graduate School of Medical Sciences, Faculty of Life Sciences, Kumamoto University, Kumamoto (Japan); Sakashita, Naomi [Department of Cell Pathology, Graduate School of Medical Sciences, Faculty of Life Sciences, Kumamoto University, Kumamoto (Japan); Department of Human Pathology, Institute of Health Biosciences, The University of Tokushima, Tokushima (Japan); Takeya, Motohiro, E-mail: takeya@kumamoto-u.ac.jp [Department of Cell Pathology, Graduate School of Medical Sciences, Faculty of Life Sciences, Kumamoto University, Kumamoto (Japan)

    2011-08-05

    Highlights: {yields} We focused on the interaction between SR-A and TLR4 signaling in this study. {yields} SR-A deletion promoted NF{kappa}B activation in macrophages in septic model mouse. {yields} SR-A suppresses both MyD88-dependent and -independent TLR4 signaling in vitro. {yields} SR-A clears LPS binding to TLR4 which resulting in the suppression of TLR4 signals. -- Abstract: The class A scavenger receptor (SR-A, CD204), one of the principal receptors expressed on macrophages, has been found to regulate inflammatory response and attenuate septic endotoxemia. However, the detailed mechanism of this process has not yet been well characterized. To clarify the regulative mechanisms of lipopolysaccharide (LPS)-induced macrophage activation by SR-A, we evaluated the activation of Toll-like receptor 4 (TLR4)-mediated signaling molecules in SR-A-deficient (SR-A{sup -/-}) macrophages. In a septic shock model, the blood levels of tumor necrosis factor (TNF)-{alpha}, interleukin (IL)-6 and interferon (IFN)-{beta} were significantly increased in SR-A{sup -/-} mice compared to wild-type mice, and elevated nuclear factor kappa B (NF{kappa}B) activation was detected in SR-A{sup -/-} macrophages. SR-A deletion increased the production of pro-inflammatory cytokines, and the phosphorylation of mitogen-activated protein kinase (MAPK) and NF{kappa}B in vitro. SR-A deletion also promoted the nuclear translocation of NF{kappa}B and IFN regulatory factor (IRF)-3. In addition, a competitive binding assay with acetylated low-density lipoprotein, an SR-A-specific ligand, and anti-SR-A antibody induced significant activation of TLR4-mediated signaling molecules in wild-type macrophages but not in SR-A{sup -/-} macrophages. These results suggest that SR-A suppresses the macrophage activation by inhibiting the binding of LPS to TLR4 in a competitive manner and it plays a pivotal role in the regulation of the LPS-induced inflammatory response.

  4. Neutron Capture Cross Sections of the s-Process Branching Points 147Pm, 171Tm, and 204Tl

    Science.gov (United States)

    Guerrero, Carlos; Domingo-Pardo, Cesar; Lerendegui-Marco, Jorge; Casanovas, Adria; Cortes-Giraldo, Miguel A.; Dressler, Rugard; Halfon, Shlomi; Heinitz, Stephan; Kivel, Niko; Köster, Ulli; Paul, Michael; Quesada-Molina, Jose Manuel; Schumann, Dorothea; Tarifeño-Saldivia, Ariel; Tessler, Moshe; Weissman, Leo

    The neutron capture cross section of several key unstable isotopes acting as branching points in the s-process are crucial for stellar nucleosynthesis studies, but they are very challenging to measure due to the difficult production of sufficient sample material, the high activity of the resulting samples, and the actual (n, γ) measurement, for which high neutron fluxes and effective background rejection capabilities are required. As part of a new program to measure some of these important branching points, radioactive targets of 147Pm, 171Tm, and 204Tl have been produced by irradiation of stable isotopes (146Nd, 170Er, and 203Tl) at the Institut Laue-Langevin (ILL) high flux reactor. After breeding in the reactor and a certain cooling period, the resulting mixed 204Tl/203Tl sample was used directly while 147Pm and 171Tm were radiochemically separated in non-carrier-added quality at the Paul Scherrer Institut (PSI), then prepared as targets. A set of theses samples has been used for time-of-flight measurements at the CERN n_TOF facility using the 19 and 185 m beam lines, during 2014 and 2015. The capture cascades were detected with a set of four C6D6 scintillators, allowing to observe the associated neutron capture resonances. The results presented in this work are the first ever determination of the resonance capture cross sections of 147Pm, 171Tm, and 204Tl. Activation experiments on the same 147Pm and 171Tm targets with a high-intensity quasi-Maxwellian flux of neutrons have been performed using the SARAF accelerator and the Liquid-Lithium Target (LiLiT) in order to extract the corresponding Maxwellian Average Cross Section (MACS). The experimental setups are here described together with the first, preliminary results of the n_TOF measurement.

  5. Completion Report for Well ER-20-4 Corrective Action Units 101 and 102: Central and Western Pahute Mesa

    Energy Technology Data Exchange (ETDEWEB)

    NSTec Environmental Management

    2011-04-30

    Well ER-20-4 was drilled for the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office in support of the Nevada Environmental Restoration Project at the Nevada National Security Site, Nye County, Nevada. The well was drilled in August and September 2010 as part of the Pahute Mesa Phase II drilling program. The primary purpose of the well was to investigate the possibility of radionuclide transport from up-gradient underground nuclear tests conducted in central Pahute Mesa. This well also provided detailed hydrogeologic information in the Tertiary volcanic section that will help reduce uncertainties within the Pahute Mesa-Oasis Valley hydrostratigraphic framework model.

  6. Results of a Phase 2, Randomized,Vehicle-Controlled Study Evaluating the Efficacy,Tolerability, and Safety of Daily or Twice Daily SB204 for the Treatment of Acne Vulgaris.

    Science.gov (United States)

    Eichenfield, Lawrence F; Gold, Linda Stein; Nahm, Walter K; Cook-Bolden, Fran E; Pariser, David M

    2016-12-01

    This randomized, double-blind, placebo-controlled, Phase 2 study compared efficacy, tolerability, and safety of SB204 once or twice daily to vehicle in the treatment of acne vulgaris. Eligible subjects were to be between 12 and 40 years old, have facial acne vulgaris with 25 to 70 non-inflammatory lesions, 20 to 40 inflammatory lesions, no more than 2 nodules, and a baseline Investigator's Global Assessment (IGA) score of moderate or severe. The co-primary efficacy endpoints were the absolute change in inflammatory and non-inflammatory lesion counts and IGA success rate (baseline to week 12). Safety assessments included reported adverse events (AEs), physical examinations, and laboratory testing. Tolerability was evaluated by the investigators based on the occurrence and severity of erythema, scaling, dryness, pruritus, and burning/stinging. A total of 213 subjects were randomized: 27 subjects to vehicle once daily; 29 subjects to vehicle twice daily; 53 subjects to SB204 2% twice daily; 52 subjects to SB204 4% once daily; and 52 subjects to SB204 4% twice daily. When compared to vehicle, treatment with all 3 SB204 regimens significantly reduced the absolute inflammatory lesion count and SB204 4% once daily reduced the absolute non-inflammatory lesion count. Treatment with SB204 4% once daily demonstrated a significant reduction in percent inflammatory lesions by week 4. There were no significant differences in the IGA success rates between groups at the end of treatment. All treatment regimens of SB204 were found to be safe and well tolerated. When compared to vehicle, SB204 2% and SB204 4% significantly decreased the absolute inflammatory lesion count and SB204 4% once daily also significantly decreased the absolute non-inflammatory lesion count in subjects with acne vulgaris treated for 12 weeks. Treatment with SB204 2% and 4% was found to be safe and well tolerated. J Drugs Dermatol. 2016;15(12):1496-1502.

  7. Molecular characterization, tissue tropism, and genetic variability of the novel Mupapillomavirus type HPV204 and phylogenetically related types HPV1 and HPV63.

    Directory of Open Access Journals (Sweden)

    Anja Šterbenc

    Full Text Available HPV204 is the only newly identified Mupapillomavirus (Mu-PV type in more than a decade. To comprehensively characterize HPV204, we performed a detailed molecular analysis of the viral genome and evaluated its clinical relevance in comparison to the other Mu-PVs, HPV1 and HPV63. The 7,227-bp long genome of HPV204 exhibits typical genomic organization of Mu-PVs with eight open reading frames (ORFs (E6, E7, E1, E2, E8, E4, L2, and L1. We developed three type-specific quantitative real-time PCRs and used them to test a representative collection (n = 1,006 of various HPV-associated benign and malignant neoplasms, as well as samples of clinically normal cutaneous, mucosal, and mucocutaneous origins. HPV204, HPV1, and HPV63 were detected in 1.1%, 2.7%, and 1.9% of samples tested, respectively, and were present in skin and mucosa, suggesting dual tissue tropism of all Mu-PVs. To evaluate the etiological role of Mu-PVs in the development of HPV-associated neoplasms, Mu-PV viral loads per single cell were estimated. HPV1 and HPV63 were present in high viral copy numbers in 3/43 and 1/43 cutaneous warts, respectively, and were identified as the most likely causative agents of these warts. HPV204 viral load was extremely low in a single HPV204-positive cutaneous wart (7.4 × 10-7 viral copies/cell. Hence, etiological association between HPV204 and the development of cutaneous warts could not be established. To the best of our knowledge, this is the first study to evaluate the genetic variability of Mu-PVs by sequencing complete LCR genomic regions of HPV204, HPV1, and HPV63. We detected several nucleotide substitutions and deletions within the LCR genomic regions of Mu-PVs and identified two genetic variants of HPV204 and HPV63 and five genetic variants of HPV1.

  8. The Effects of Polyvinyl Pyridine-N-Oxide (P204) on the Cytopathogenic Action of Chrysotile Asbestos in vivo and in vitro

    Science.gov (United States)

    Davis, J. M. G.

    1972-01-01

    A series of experiments was undertaken to test the action of polyvinyl pyridine-N-oxide (P204) on the cytopathic effects of chrysotile asbestos dust in experimental animals. Organ culture studies were undertaken using pieces of guinea-pig lung, and in addition to this the lesions produced by the intrapleural injection of chrysotile were studied after treatment with varying doses of P204. The results from both series of experiments were unfortunately negative and P204 appeared unable to modify asbestos lesions in any way. These findings contrast sharply with the marked ability of P204 to protect tissues from the effects of silica dust. It is suggested that these differences are due to the fact that while silica is rapidly toxic to macrophages, asbestos is not and many healthy macrophages and giant cells can be found in asbestos lesions packed with dust several weeks after injection. The fibrous tissue that is eventually produced in response to asbestos dust is probably produced by a slower and more insidious process than that stimulated by silica, and this process is not modified by the presence of P204. ImagesFig. 6Figs. 1-3Figs. 4-5 PMID:4345811

  9. Evaluation of myocardial flow reserve using pharmacological stress thallium-201 single-photon emission computed tomography: is there a difference between total arterial off-pump coronary artery bypass grafting and conventional coronary artery bypass grafting?

    Science.gov (United States)

    Lee, Jae Won; Ryu, Sang Wan; Song, Hyun; Kim, Kyung Sun; Yang, Yu Jung; Moon, Dae Hyeuk

    2004-01-01

    The advantage of total arterial off-pump coronary bypass grafting (OPCAB) over conventional onpump coronary artery bypass grafting with 1 internal thoracic artery and veins (CCAB) in terms of myocardial flow reserve has not been studied. We studied these procedures using thallium- 201 perfusion single-photon emission computed tomography (Tl-201 perfusion SPECT). Between 1997 and 2001, 152 patients were recruited from our database (OPCAB, n = 100; CCAB, n = 52). All patients underwent pharmacological stress Tl-201 perfusion SPECT 3 to 12 months after bypass surgery. Myocardial perfusion was analyzed semiquantitatively with a 5-point scoring system in a 20-segment model (0, normal, to 4, absence of uptake). Summed stress (SSS), rest (SRS), and difference score (SDS) of the entire myocardium as well as average scores (ASS, ARS, ADS) of individual walls (anterior, septal, lateral, and inferior) were compared by Student t test as well as by repeated-measures analysis of variance with Bonferroni correction. The SSS, SRS, and SDS of OPCAB versus those of CCAB were 6.86 +/- 0.72 versus 7.17 +/- 0.92, 3.95 +/- 0.57 versus 3.75 +/- 0.73, and 2.91 +/- 0.47 versus 3.42 +/- 0.74 (P > .05). However, the lateral wall showed lower scores in OPCAB (ASS, 0.18 versus 0.41, P = .015; ARS, 0.12 versus 0.20, P = .168; ADS, 0.06 versus 0.21, P = .031). The septal wall had higher scores in OPCAB (ASS, 0.33 versus 0.12, P = .003; ARS, 0.18 versus 0.07, P = .037; ADS, 0.14 versus 0.04, P = .030). The anterior and inferior walls were not different between the 2 groups. OPCAB led to results similar to those of CCAB. The better results in the lateral wall have been the effect of grafting radial artery rather than vein. The similarity in myocardial reserve in the inferior wall between the 2 groups needs further study. There was no deleterious effect of off-pump as opposed to on-pump CAB.

  10. Inhibition of smooth muscle contraction and platelet aggregation by peptide 204–212 of lipocortin 5: an attempt to define some structure requirements

    Directory of Open Access Journals (Sweden)

    K. G. Mugridge

    1993-01-01

    Full Text Available Peptide 204–212 of lipocortin (LC 5 inhibited porcine pancreatic phospholipase A2 (PLA2 induced rat stomach strip contractions and ADP induced rabbit platelet aggregation in a concentration dependent manner (IC30 of 10 μM and 400 μM, respectively. The first two amino acids are not necessary since the eptapeptide 206–212 was equipotent in both assays (IC30 of 12.5 μM and 420 μM. Of the two pentapeptides 204–208 and 208–212 only the latter showed inhibitory activity in both models although the potency was much reduced (IC30 of 170 μM and 630 μM compared with that of the parent nonapeptide. Comparison of peptide 204–212 effects with those of its analogues on LC1 and LC2 indicate that lysine 208 and aspartic acid 211 are essential in order to maintain a fully active nonapeptide.

  11. A humanized monoclonal antibody neutralizes yellow fever virus strain 17D-204 in vitro but does not protect a mouse model from disease.

    Science.gov (United States)

    Calvert, Amanda E; Dixon, Kandice L; Piper, Joseph; Bennett, Susan L; Thibodeaux, Brett A; Barrett, Alan D T; Roehrig, John T; Blair, Carol D

    2016-07-01

    The yellow fever virus (YFV) vaccine 17D-204 is considered safe and effective, yet rare severe adverse events (SAEs), some resulting in death, have been documented following vaccination. Individuals exhibiting post-vaccinal SAEs are ideal candidates for antiviral monoclonal antibody (MAb) therapy; the time until appearance of clinical signs post-exposure is usually short and patients are quickly hospitalized. We previously developed a murine-human chimeric monoclonal antibody (cMAb), 2C9-cIgG, reactive with both virulent YFV and 17D-204, and demonstrated its ability to prevent and treat YF disease in both AG129 mouse and hamster models of infection. To counteract possible selection of 17D-204 variants that escape neutralization by treatment with a single MAb (2C9-cIgG), we developed a second cMAb, 864-cIgG, for use in combination with 2C9-cIgG in post-vaccinal therapy. MAb 864-cIgG recognizes/neutralizes only YFV 17D-204 vaccine substrain and binds to domain III (DIII) of the viral envelope protein, which is different from the YFV type-specific binding site of 2C9-cIgG in DII. Although it neutralized 17D-204 in vitro, administration of 864-cIgG had no protective capacity in the interferon receptor-deficient AG129 mouse model of 17D-204 infection. The data presented here show that although DIII-specific 864-cIgG neutralizes virus infectivity in vitro, it does not have the ability to abrogate disease in vivo. Therefore, combination of 864-cIgG with 2C9-cIgG for treatment of YF vaccination SAEs does not appear to provide an improvement on 2C9-cIgG therapy alone. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. How to Use the ADI-R for Classifying Autism Spectrum Disorders? Psychometric Properties of Criteria from the Literature in 1,204 Dutch Children

    Science.gov (United States)

    de Bildt, Annelies; Oosterling, Iris J.; van Lang, Natasja D. J.; Kuijper, Sanne; Dekker, Vera; Sytema, Sjoerd; Oerlemans, Anoek M.; van Steijn, Daphne J.; Visser, Janne C.; Rommelse, Nanda N.; Minderaa, Ruud B.; van Engeland, Herman; van der Gaag, Rutger-Jan; Buitelaar, Jan K.; de Jonge, Maretha V.

    2013-01-01

    The algorithm of the Autism Diagnostic Interview-Revised provides criteria for autism versus non-autism according to DSM-IV. Criteria for the broader autism spectrum disorders are needed. This study investigated the validity of seven sets of criteria from the literature, in 1,204 Dutch children (aged 3-18 years) with and without mental…

  13. miR-204 acts as a tumor suppressor in human bladder cancer cell T24 by targeting antiapoptotic BCL2

    National Research Council Canada - National Science Library

    Hwang, Thomas I-Sheng; Lin, Ji-Fan; Lin, Yi-Chia; Chen, Hung-En; Chou, Kuang-Yu; Tsai, Te-Fu

    2016-01-01

    .... We previously reported detecting dysregulated micro-RNAs (miRNAs) in human BC tissues. Using an miRNA targeting database, we found that miR-204, which is downregulated in BC, targets the B-cell lymphoma 2 gene (BCL2...

  14. Evaluation of the in vitro/in vivo drug interaction potential of BST204, a purified dry extract of ginseng, and its four bioactive ginsenosides through cytochrome P450 inhibition/induction and UDP-glucuronosyltransferase inhibition.

    Science.gov (United States)

    Zheng, Yu Fen; Bae, Soo Hyeon; Choi, Eu Jin; Park, Jung Bae; Kim, Sun Ok; Jang, Min Jung; Park, Gyu Hwan; Shin, Wan Gyoon; Oh, Euichaul; Bae, Soo Kyung

    2014-06-01

    We evaluated the potential of BST204, a purified dry extract of ginseng, to inhibit or induce human liver cytochrome P450 enzymes (CYPs) and UDP-glucuronosyltransferases (UGTs) in vitro to assess its safety. In vitro drug interactions of four bioactive ginsenosides of BST204, S-Rg3, R-Rg3, S-Rh2, and R-Rh2, were also evaluated. We demonstrated that BST204 slightly inhibited CYP2C8, CYP2D6, CYP2C9, and CYP2B6 activities with IC50 values of 17.4, 26.8, 31.5, and 49.7μg/mL, respectively. BST204 also weakly inhibited UGT1A1, UGT1A9, and UGT2B7 activities with IC50 values of 14.5, 26.6, and 31.5μg/mL, respectively. The potential inhibition by BST204 of the three UGT activities might be attributable to S-Rg3, at least in part, as its inhibitory pattern was similar to that of BST204. However, BST204 showed no time-dependent inactivation of the nine CYPs studied. In addition, BST204 did not induce CYP1A2, 2B6, or 3A4/5. On the basis of an in vivo interaction studies, our data strongly suggest that BST204 is unlikely to cause clinically significant drug-drug interactions mediated via inhibition or induction of most CYPs or UGTs involved in drug metabolism in vivo. Our findings offer a clearer understanding and possibility to predict drug-drug interactions for the safe use of BST204 in clinical practice. Copyright © 2014. Published by Elsevier Ltd.

  15. Corrective Action Decision Document for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada, Revision 0 with ROTC 1, 2, and Errata

    Energy Technology Data Exchange (ETDEWEB)

    Wickline, Alfred

    2004-04-01

    This Corrective Action Decision Document (CADD) has been prepared for Corrective Action Unit (CAU) 204 Storage Bunkers, Nevada Test Site (NTS), Nevada, in accordance with the ''Federal Facility Agreement and Consent Order'' (FFACO) that was agreed to by the State of Nevada; U.S. Department of Energy (DOE); and the U.S. Department of Defense (FFACO, 1996). The NTS is approximately 65 miles (mi) north of Las Vegas, Nevada (Figure 1-1). The Corrective Action Sites (CASs) within CAU 204 are located in Areas 1, 2, 3, and 5 of the NTS, in Nye County, Nevada (Figure 1-2). Corrective Action Unit 204 is comprised of the six CASs identified in Table 1-1. As shown in Table 1-1, the FFACO describes four of these CASs as bunkers one as chemical exchange storage and one as a blockhouse. Subsequent investigations have identified four of these structures as instrumentation bunkers (CASs 01-34-01, 02-34-01, 03-34-01, 05-33-01), one as an explosives storage bunker (CAS 05-99-02), and one as both (CAS 05-18-02). The six bunkers included in CAU 204 were primarily used to monitor atmospheric testing or store munitions. The ''Corrective Action Investigation Plan (CAIP) for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada'' (NNSA/NV, 2002a) provides information relating to the history, planning, and scope of the investigation; therefore, it will not be repeated in this CADD. This CADD identifies potential corrective action alternatives and provides a rationale for the selection of a recommended corrective action alternative for each CAS within CAU 204. The evaluation of corrective action alternatives is based on process knowledge and the results of investigative activities conducted in accordance with the CAIP (NNSA/NV, 2002a) that was approved prior to the start of the Corrective Action Investigation (CAI). Record of Technical Change (ROTC) No. 1 to the CAIP (approval pending) documents changes to the preliminary action levels

  16. Implication of the miR-184 and miR-204 competitive RNA network in control of mouse secondary cataract.

    Science.gov (United States)

    Hoffmann, Andrea; Huang, Yusen; Suetsugu-Maki, Rinako; Ringelberg, Carol S; Tomlinson, Craig R; Del Rio-Tsonis, Katia; Tsonis, Panagiotis A

    2012-05-09

    The high recurrence rate of secondary cataract (SC) is caused by the intrinsic differentiation activity of residual lens epithelial cells after extra-capsular lens removal. The objective of this study was to identify changes in the microRNA (miRNA) expression profile during mouse SC formation and to selectively manipulate miRNA expression for potential therapeutic intervention. To model SC, mouse cataract surgery was performed and temporal changes in the miRNA expression pattern were determined by microarray analysis. To study the potential SC counterregulative effect of miRNAs, a lens capsular bag in vitro model was used. Within the first 3 wks after cataract surgery, microarray analysis demonstrated SC-associated expression pattern changes of 55 miRNAs. Of the identified miRNAs, miR-184 and miR-204 were chosen for further investigations. Manipulation of miRNA expression by the miR-184 inhibitor (anti-miR-184) and the precursor miRNA for miR-204 (pre-miR-204) attenuated SC-associated expansion and migration of lens epithelial cells and signs of epithelial to mesenchymal transition such as α-smooth muscle actin expression. In addition, pre-miR-204 attenuated SC-associated expression of the transcription factor Meis homeobox 2 (MEIS2). Examination of miRNA target binding sites for miR-184 and miR-204 revealed an extensive range of predicted target mRNA sequences that were also a target to a complex network of other SC-associated miRNAs with possible opposing functions. The identification of the SC-specific miRNA expression pattern together with the observed in vitro attenuation of SC by anti-miR-184 and pre-miR-204 suggest that miR-184 and miR-204 play a significant role in the control of SC formation in mice that is most likely regulated by a complex competitive RNA network.

  17. Cu0.02Ti0.94Nb2.04O7: An advanced anode material for lithium-ion batteries of electric vehicles

    Science.gov (United States)

    Yang, Chao; Lin, Chunfu; Lin, Shiwei; Chen, Yongjun; Li, Jianbao

    2016-10-01

    To explore advanced anode materials for lithium-ion batteries of electric vehicles, Cu2+/Nb5+ co-doped TiNb2O7 is studied. Cu0.02Ti0.94Nb2.04O7 is successfully fabricated using a facile solid-state reaction. X-ray diffraction analyses combined with Rietveld refinements demonstrate that the trace Cu2+/Nb5+ co-doping does not destroy the shear ReO3 crystal structure of TiNb2O7 but increases the lattice parameters and unit cell volume. Specific surface area tests and scanning electron microscopy images reveal a smaller average particle size in Cu0.02Ti0.94Nb2.04O7. Due to the increased unit cell volume and free 3d electrons in Cu2+ ions, the Li+-ion diffusion coefficient and electronic conductivity of Cu0.02Ti0.94Nb2.04O7 are respectively enhanced by 14.8 times and at least 220 times. Consequently, Cu0.02Ti0.94Nb2.04O7 exhibits advanced electrochemical properties in terms of specific capacity, rate capability and cyclic stability. At 0.1 C, it delivers a large first-cycle discharge/charge capacity of 346/315 mAh g-1. At 10 C, it still provides a large capacity of 182 mAh g-1 with tiny loss of only 1.2% over 1000 cycles. In sharp contrast, TiNb2O7 shows a small capacity of only 90 mAh g-1 and large loss of 59.8%. Therefore, Cu0.02Ti0.94Nb2.04O7 possesses great potential for the application in lithium-ion batteries for electric vehicles.

  18. Characteristics of photoconductivity in thallium monosulfide single ...

    Indian Academy of Sciences (India)

    Pramana – Journal of Physics. Current Issue : Vol. 90, Issue 1 · Current Issue Volume 90 | Issue 1. January 2018. Home · Volumes & Issues · Special Issues · Forthcoming Articles · Search · Editorial Board · Information for Authors · Subscription ...

  19. Deconvolution of [sup 204]Tl/[sup 36]Cl and [sup 147]Pm/[sup 45]Ca dual mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Grau Carles, A. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain)); Rodriguez Barquero, L. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain)); Grau Malonda, A. (Inst. de Investigacion Basica, CIEMAT, Madrid (Spain))

    1994-01-22

    Technical characteristics of liquid scintillation counting include high counting efficiency, well-defined sample preparation procedures and a high capacity to measure a large number of samples. However, poor resolution and quenching limit the capability of measuring double-labeled samples when the maximum beta-ray energies are close. The simultaneous standardization of [sup 35]S and [sup 14]C was described in a previous paper, involving an improved spectrum unfolding method. This procedure has been tested with two other types of close maximum beta-energy nuclides: [sup 204]Tl and [sup 36]Cl have 710 and 763 keV maximum beta-energies respectively, and cannot be standardized simultaneously by double window methods. However, spectral shape differences permit their deconvolution with great accuracy. Both [sup 147]Pm and [sup 45]Ca (224 and 255 keV maximum beta-energies) have also been standardized. Samples with different quench values and activity ratios have been assayed, and the limitations have been determined. (orig.)

  20. GASP. IV. A Muse View of Extreme Ram-pressure-stripping in the Plane of the Sky: The Case of Jellyfish Galaxy JO204

    Science.gov (United States)

    Gullieuszik, Marco; Poggianti, Bianca M.; Moretti, Alessia; Fritz, Jacopo; Jaffé, Yara L.; Hau, George; Bischko, Jan C.; Bellhouse, Callum; Bettoni, Daniela; Fasano, Giovanni; Vulcani, Benedetta; D'Onofrio, Mauro; Biviano, Andrea

    2017-09-01

    In the context of the GAs Stripping Phenomena in galaxies with Muse (GASP) survey, we present the characterization of JO204, a jellyfish galaxy in A957, a relatively low-mass cluster with M=4.4× {10}14 {M}⊙ . This galaxy shows a tail of ionized gas that extends up to 30 kpc from the main body in the opposite direction of the cluster center. No gas emission is detected in the galaxy outer disk, suggesting that gas-stripping is proceeding outside-in. The stellar component is distributed as a regular disk galaxy; the stellar kinematics shows a symmetric rotation curve with a maximum radial velocity of 200 km s-1 out to 20 kpc from the galaxy center. The radial velocity of the gas component in the central part of the disk follows the distribution of the stellar component; the gas kinematics in the tail retains the rotation of the galaxy disk, indicating that JO204 is moving at high speed in the intracluster medium. Both the emission and radial-velocity maps of the gas and stellar components indicate ram-pressure as the most likely primary mechanism for gas-stripping, as expected given that JO204 is close to the cluster center and it is likely at the first infall in the cluster. The spatially resolved star formation history of JO204 provides evidence that the onset of ram-pressure-stripping occurred in the last 500 Myr, quenching the star formation activity in the outer disk, where the gas has been already completely stripped. Our conclusions are supported by a set of hydrodynamic simulations.

  1. Comparison of the live attenuated yellow fever vaccine 17D-204 strain to its virulent parental strain Asibi by deep sequencing.

    Science.gov (United States)

    Beck, Andrew; Tesh, Robert B; Wood, Thomas G; Widen, Steven G; Ryman, Kate D; Barrett, Alan D T

    2014-02-01

    The first comparison of a live RNA viral vaccine strain to its wild-type parental strain by deep sequencing is presented using as a model the yellow fever virus (YFV) live vaccine strain 17D-204 and its wild-type parental strain, Asibi. The YFV 17D-204 vaccine genome was compared to that of the parental strain Asibi by massively parallel methods. Variability was compared on multiple scales of the viral genomes. A modeled exploration of small-frequency variants was performed to reconstruct plausible regions of mutational plasticity. Overt quasispecies diversity is a feature of the parental strain, whereas the live vaccine strain lacks diversity according to multiple independent measurements. A lack of attenuating mutations in the Asibi population relative to that of 17D-204 was observed, demonstrating that the vaccine strain was derived by discrete mutation of Asibi and not by selection of genomes in the wild-type population. Relative quasispecies structure is a plausible correlate of attenuation for live viral vaccines. Analyses such as these of attenuated viruses improve our understanding of the molecular basis of vaccine attenuation and provide critical information on the stability of live vaccines and the risk of reversion to virulence.

  2. Food sources of total omega 6 fatty acids (18:2 + 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

    Science.gov (United States)

    Food sources of total omega 6 fatty acids (18:2 + 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

  3. Food sources of arachidonic acid (PFA 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

    Science.gov (United States)

    Food sources of arachidonic acid (PFA 20:4), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006

  4. Oral Nucleos(t)ide Analogs Alone After Liver Transplantation in Chronic Hepatitis B With Preexisting rt204 Mutation.

    Science.gov (United States)

    Fung, James; Wong, Tiffany; Chok, Kenneth; Chan, Albert; Sin, Sui-Ling; Cheung, Tan-To; Dai, Wing-Chiu; Ng, Kelvin; Ng, Kevin; Man, Kwan; Seto, Wai-Kay; Lai, Ching-Lung; Yuen, Man-Fung; Lo, Chung-Mau

    2017-10-01

    There is currently limited data regarding the use of oral antiviral therapy alone without hepatitis B immune globulin for chronic hepatitis B patients with preexisting lamivudine (LAM) resistance (LAM-R) undergoing liver transplantation. This is a cohort study determining the effectiveness and long-term outcome in this group of patients. Fifty-seven consecutive chronic hepatitis B patients with preexisting rt204 LAM-R mutations or virological load refractory to LAM undergoing liver transplantation were included, with a median follow-up of 73 months. Fifty-five (96.5%) patients received a regimen that included the use of nucleotide analogs. The cumulative rate of hepatitis B surface antigen seroclearance at 1, 5, and 10 years was 82%, 88%, and 91%, respectively. At the time of transplantation, 39 (72%) patients had detectable hepatitis B virus (HBV) DNA, with a median of 4.5 log copies/mL. The cumulative rate of HBV undetectability was 91% at 1 year, increasing to 100% by 5 years. After 1 year of liver transplantation, over 90% of the patients had undetectable HBV DNA, and from 8 years onward, 100% had undetectable HBV DNA. The overall long-term survival was excellent, with a 12-year survival of 87%. There was no HBV-related graft loss, and no retransplantation or deaths due to HBV reactivation. Oral antiviral therapy alone without hepatitis B immune globulin is highly effective in preventing HBV reactivation and graft loss from recurrent hepatitis B after liver transplantation in patients with preexisting LAM resistance HBV. The long-term outcome was excellent, with survival of 87% at 12 years after transplantation, without any mortality related to HBV reactivation.

  5. 204 - 207 Suleiman

    African Journals Online (AJOL)

    DR. AMIN

    2011-12-02

    Dec 2, 2011 ... ABSTRACT. Powders prepared from parts of different plant species indigenous to Nigeria were tested by various Nigerian scientists under laboratory conditions for their insecticidal activities against the common insect pests of maize and cowpea, i.e. Sitophilus zeamais and Callosobruchus maculatus.

  6. Validation of expression patterns for nine miRNAs in 204 lymph-node negative breast cancers.

    Directory of Open Access Journals (Sweden)

    Kristin Jonsdottir

    Full Text Available INTRODUCTION: Although lymph node negative (LN- breast cancer patients have a good 10-years survival (∼85%, most of them still receive adjuvant therapy, while only some benefit from this. More accurate prognostication of LN- breast cancer patient may reduce over- and under-treatment. Until now proliferation is the strongest prognostic factor for LN- breast cancer patients. The small molecule microRNA (miRNA has opened a new window for prognostic markers, therapeutic targets and/or therapeutic components. Previously it has been shown that miR-18a/b, miR-25, miR-29c and miR-106b correlate to high proliferation. METHODS: The current study validates nine miRNAs (miR-18a/b miR-25, miR-29c, miR-106b, miR375, miR-424, miR-505 and let-7b significantly correlated with established prognostic breast cancer biomarkers. Total RNA was isolated from 204 formaldehyde-fixed paraffin embedded (FFPE LN- breast cancers and analyzed with quantitative real-time Polymerase Chain Reaction (qPCR. Independent T-test was used to detect significant correlation between miRNA expression level and the different clinicopathological features for breast cancer. RESULTS: Strong and significant associations were observed for high expression of miR-18a/b, miR-106b, miR-25 and miR-505 to high proliferation, oestrogen receptor negativity and cytokeratin 5/6 positivity. High expression of let-7b, miR-29c and miR-375 was detected in more differentiated tumours. Kaplan-Meier survival analysis showed that patients with high miR-106b expression had an 81% survival rate vs. 95% (P = 0.004 for patients with low expression. CONCLUSION: High expression of miR-18a/b are strongly associated with basal-like breast cancer features, while miR-106b can identify a group with higher risk for developing distant metastases in the subgroup of Her2 negatives. Furthermore miR-106b can identify a group of patients with 100% survival within the otherwise considered high risk group of patients with

  7. Corrective Action Investigation Plan for Corrective Action Unit 204: Storage Bunkers, Nevada Test Site, Nevada (December 2002, Revision No.: 0), Including Record of Technical Change No. 1

    Energy Technology Data Exchange (ETDEWEB)

    NNSA/NSO

    2002-12-12

    The Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect the data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit (CAU) 204 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 204 is located on the Nevada Test Site approximately 65 miles northwest of Las Vegas, Nevada. This CAU is comprised of six Corrective Action Sites (CASs) which include: 01-34-01, Underground Instrument House Bunker; 02-34-01, Instrument Bunker; 03-34-01, Underground Bunker; 05-18-02, Chemical Explosives Storage; 05-33-01, Kay Blockhouse; 05-99-02, Explosive Storage Bunker. Based on site history, process knowledge, and previous field efforts, contaminants of potential concern for Corrective Action Unit 204 collectively include radionuclides, beryllium, high explosives, lead, polychlorinated biphenyls, total petroleum hydrocarbons, silver, warfarin, and zinc phosphide. The primary question for the investigation is: ''Are existing data sufficient to evaluate appropriate corrective actions?'' To address this question, resolution of two decision statements is required. Decision I is to ''Define the nature of contamination'' by identifying any contamination above preliminary action levels (PALs); Decision II is to ''Determine the extent of contamination identified above PALs. If PALs are not exceeded, the investigation is completed. If PALs are exceeded, then Decision II must be resolved. In addition, data will be obtained to support waste management decisions. Field activities will include radiological land area surveys, geophysical surveys to identify any subsurface metallic and nonmetallic debris, field screening for applicable contaminants of potential concern, collection and analysis of surface and subsurface soil samples from biased locations

  8. The cross sections and energy spectra of the particle emission in proton induced reaction on 204,206,207,208Pb and 209Bi

    Directory of Open Access Journals (Sweden)

    Zhang Zhengjun

    2017-01-01

    Full Text Available All cross sections of proton induced reactions, angular distributions, energy spectra and double differential cross sections of neutron, proton, deuteron, triton, helium and alpha-particle emissions for p+ 204,206,207,208Pb, 209Bi reactions are consistently calculated and analyzed at incident proton energies below 200 MeV. The optical model, the distorted wave Born approximation theory, the unified Hauser-Feshbach and exciton model which includes the improved Iwamoto-Harada model are used. Theoretically calculated results are compared with the existing experimental data.

  9. Measurement of the neutron capture cross section of the s-only isotope 204Pb from 1 eV to 440 keV

    CERN Document Server

    Domingo-Pardo, C.; Aerts, G.; Alvarez-Pol, H.; Alvarez-Velarde, F.; Andriamonje, S.; Andrzejewski, J.; Assimakopoulos, P.; Audouin, L.; Badurek, G.; Baumann, P.; Becvar, F.; Berthoumieux, E.; Bisterzo, S.; Calvino, F.; Cano-Ott, D.; Capote, R.; Carrapico, C.; Cennini, P.; Chepel, V.; Chiaveri, E.; Colonna, N.; Cortes, G.; Couture, A.; Cox, J.; Dahlfors, M.; David, S.; Dillmann, I.; Dolfini, R.; Dridi, W.; Duran, I.; Eleftheriadis, C.; Embid-Segura, M.; Ferrant, L.; Ferrari, A.; Ferreira-Marques, R.; Fitzpatrick, L.; Frais-Koelbl, H.; Fujii, K.; Furman, W.; Gallino, R.; Goncalves, I.; Gonzalez-Romero, E.; Goverdovski, A.; Gramegna, F.; Griesmayer, E.; Guerrero, C.; Gunsing, F.; Haas, B.; Haight, R.; Heil, M.; Herrera-Martinez, A.; Igashira, M.; Isaev, S.; Jericha, E.; Kadi, Y.; Kappeler, F.; Karamanis, D.; Karadimos, D.; Kerveno, M.; Ketlerov, V.; Koehler, P.; Konovalov, V.; Kossionides, E.; Krticka, M.; Lamboudis, C.; Leeb, H.; Lindote, A.; Lopes, I.; Lozano, M.; Lukic, S.; Marganiec, J.; Marrone, S.; Mastinu, P.; Mengoni, A.; Milazzo, P.M.; Moreau, C.; Mosconi, M.; Neves, F.; Oberhummer, H.; Oshima, M.; O'Brien, S.; Pancin, J.; Papachristodoulou, C.; Papadopoulos, C.; Paradela, C.; Patronis, N.; Pavlik, A.; Pavlopoulos, P.; Perrot, L.; Plag, R.; Plompen, A.; Plukis, A.; Poch, A.; Pretel, C.; Quesada, J.; Rauscher, T.; Reifarth, R.; Rosetti, M.; Rubbia, C.; Rudolf, G.; Rullhusen, P.; Salgado, J.; Sarchiapone, L.; Savvidis, I.; Stephan, C.; Tagliente, G.; Tain, J.L.; Tassan-Got, L.; Tavora, L.; Terlizzi, R.; Vannini, G.; Vaz, P.; Ventura, A.; Villamarin, D.; Vincente, M.C.; Vlachoudis, V.; Vlastou, R.; Voss, F.; Walter, S.; Wendler, H.; Wiescher, M.; Wisshak, K.

    2007-01-01

    The neutron capture cross section of 204Pb has been measured at the CERN n_TOF installation with high resolution in the energy range from 1 eV to 440 keV. An R-matrix analysis of the resolved resonance region, between 1 eV and 100 keV, was carried out using the SAMMY code. In the interval between 100 keV and 440 keV we report the average capture cross section. The background in the entire neutron energy range could be reliably determined from the measurement of a 208Pb sample. Other systematic effects in this measurement could be investigated and precisely corrected by means of detailed Monte Carlo simulations. We obtain a Maxwellian average capture cross section for 204Pb at kT=30 keV of 79(3) mb, in agreement with previous experiments. However our cross section at kT=5 keV is about 35% larger than the values reported so far. The implications of the new cross section for the s-process abundance contributions in the Pb/Bi region are discussed.

  10. Phosphorylation of Ser-204 and Tyr-405 in human malonyl-CoA decarboxylase expressed in silkworm Bombyx mori regulates catalytic decarboxylase activity.

    Science.gov (United States)

    Hwang, In-Wook; Makishima, Yu; Suzuki, Tomohiro; Kato, Tatsuya; Park, Sungjo; Terzic, Andre; Chung, Shin-Kyo; Park, Enoch Y

    2015-11-01

    Decarboxylation of malonyl-CoA to acetyl-CoA by malonyl-CoA decarboxylase (MCD; EC 4.1.1.9) is a vital catalytic reaction of lipid metabolism. While it is established that phosphorylation of MCD modulates the enzymatic activity, the specific phosphorylation sites associated with the catalytic function have not been documented due to lack of sufficient production of MCD with proper post-translational modifications. Here, we used the silkworm-based Bombyx mori nucleopolyhedrovirus (BmNPV) bacmid system to express human MCD (hMCD) and mapped phosphorylation effects on enzymatic function. Purified MCD from silkworm displayed post-translational phosphorylation and demonstrated coherent enzymatic activity with high yield (-200 μg/silkworm). Point mutations in putative phosphorylation sites, Ser-204 or Tyr-405 of hMCD, identified by bioinformatics and proteomics analyses reduced the catalytic activity, underscoring the functional significance of phosphorylation in modulating decarboxylase-based catalysis. Identified phosphorylated residues are distinct from the decarboxylation catalytic site, implicating a phosphorylation-induced global conformational change of MCD as responsible in altering catalytic function. We conclude that phosphorylation of Ser-204 and Tyr-405 regulates the decarboxylase function of hMCD leveraging the silkworm-based BmNPV bacmid expression system that offers a fail-safe eukaryotic production platform implementing proper post-translational modification such as phosphorylation.

  11. Pahute Mesa Well Development and Testing Analyses for Wells ER-20-8 and ER-20-4, Nevada National Security Site, Nye County, Nevada, Revision 0

    Energy Technology Data Exchange (ETDEWEB)

    Greg Ruskauff and Sam Marutzky

    2012-09-01

    Wells ER-20-4 and ER-20-8 were drilled during fiscal year (FY) 2009 and FY 2010 (NNSA/NSO, 2011a and b). The closest underground nuclear test detonations to the area of investigation are TYBO (U-20y), BELMONT (U-20as), MOLBO (U-20ag), BENHAM (U-20c), and HOYA (U-20 be) (Figure 1-1). The TYBO, MOLBO, and BENHAM detonations had working points located below the regional water table. The BELMONT and HOYA detonation working points were located just above the water table, and the cavity for these detonations are calculated to extend below the water table (Pawloski et al., 2002). The broad purpose of Wells ER-20-4 and ER-20-8 is to determine the extent of radionuclide-contaminated groundwater, the geologic formations, groundwater geochemistry as an indicator of age and origin, and the water-bearing properties and hydraulic conditions that influence radionuclide migration. Well development and testing is performed to determine the hydraulic properties at the well and between other wells, and to obtain groundwater samples at the well that are representative of the formation at the well. The area location, wells, underground nuclear detonations, and other features are shown in Figure 1-1. Hydrostratigraphic cross sections A-A’, B-B’, C-C’, and D-D’ are shown in Figures 1-2 through 1-5, respectively.

  12. Tank Vapor Characterization Project: Headspace vapor characterization of Hanford Waste Tank 241-C-204: Results from samples collected on 07/02/96

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, B.L.; Evans, J.C.; Pool, K.H. [and others

    1997-01-01

    This report describes the analytical results of vapor samples taken from the headspace of the waste storage tank 241-C-204 (Tank C-204) at the Hanford Site in Washington State. The results described in this report were obtained to characterize the vapors present in the tank headspace and to support safety evaluations and tank farm operations. The results include air concentrations of selected inorganic and organic analytes and grouped compounds from samples obtained by Westinghouse Hanford Company (WHC) and provided for analysis to Pacific Northwest National Laboratory (PNNL). Analyses were performed by the Vapor Analytical Laboratory (VAL) at PNNL. Analyte concentrations were based on analytical results and, where appropriate, sample volumes provided by WHC. A summary of the inorganic analytes, permanent gases, and total non-methane organic compounds is listed in Table S.1. The three highest concentration analytes detected in SUMMA{trademark} canister and triple sorbent trap samples are also listed in Table S.1. Detailed descriptions of the analytical results appear in the appendices.

  13. LANDRON, Olivier. Le catholicisme vert. Histoire des relations entre l’Église et la nature au XXe siècle. Paris, Les Éditions du Cerf, 2008, 527 p. ISBN 978-2-204-08658-5

    Directory of Open Access Journals (Sweden)

    Luis Martínez Andrade

    2010-01-01

    Full Text Available Resenha do livro LANDRON, Olivier. Le catholicisme vert. Histoire des relations entre l’Église et la nature au XXe siècle. Paris, Les Éditions du Cerf, 2008, 527 p. ISBN 978-2-204-08658-5

  14. miR-204 Shifts the Epithelial to Mesenchymal Transition in Concert with the Transcription Factors RUNX2, ETS1, and cMYB in Prostate Cancer Cell Line Model

    Directory of Open Access Journals (Sweden)

    Krassimira Todorova

    2014-01-01

    Full Text Available Epithelial to mesenchymal transition is an essential step in advanced cancer development. Many master transcription factors shift their expression to drive this process, while noncoding RNAs families like miR-200 are found to restrict it. In this study we investigated how the tumor suppressor miR-204 and several transcription factors modulate main markers of mesenchymal transformation like E- and N-cadherin, SLUG, VEGF, and SOX-9 in prostate cancer cell line model (LNCaP, PC3, VCaP, and NCI-H660. We found that SLUG, E-cadherin, and N-cadherin are differentially modulated by miR-204, using miR-204 specific mimics and inhibitors and siRNA gene silencing (RUNX2, ETS-1, and cMYB. The genome perturbation associated TMPRSS2-ERG fusion coincided with shift from tumor-suppressor to tumor-promoting activity of this miRNA. The ability of miR-204 to suppress cancer cell viability and migration was lost in the fusion harboring cell lines. We found differential E-cadherin splicing corroborating to miR-204 modulatory effects. RUNX2, ETS1, and cMYB are involved in the regulation of E-cadherin, N-cadherin, and VEGFA expression. RUNX2 knockdown results in SOX9 downregulation, while ETS1 and cMYB silencing result in SOX9 upregulation in VCaP cells. Their expression was found to be also methylation dependent. Our study provides means for understanding cancer heterogeneity in regard to adapted therapeutic approaches development.

  15. Progressive Lower Extremity Weakness and Axonal Sensorimotor Polyneuropathy from a Mutation in KIF5A (c.611G>A;p.Arg204Gln

    Directory of Open Access Journals (Sweden)

    Nivedita U. Jerath

    2015-01-01

    Full Text Available Introduction. Hereditary Spastic Paraplegia (HSP is a rare hereditary disorder that primarily involves progressive spasticity of the legs (hamstrings, quadriceps, and calves. Methods. A 27-year-old gentleman was a fast runner and able to play soccer until age 9 when he developed slowly progressive weakness. He was wheelchair-bound by age 25. He was evaluated by laboratory testing, imaging, electrodiagnostics, and molecular genetics. Results. Electrodiagnostic testing revealed an axonal sensorimotor polyneuropathy. Genetic testing for HSP in 2003 was negative; repeat testing in 2013 revealed a mutation in KIF5A (c.611G>A;p.Arg204Gln. Conclusions. A recent advance in neurogenetics has allowed for more genes and mutations to be identified; over 76 different genetic loci for HSP and 59 gene products are currently known. Even though our patient had a sensorimotor polyneuropathy on electrodiagnostic testing and a 2003 HSP genetic panel that was negative, a repeat HSP genetic panel was performed in 2013 due to the advancement in neurogenetics. This revealed a mutation in KIF5A.

  16. Gravity wave generation and propagation during geomagnetic storms over Kiruna (67.8°N, 20.4°E

    Directory of Open Access Journals (Sweden)

    P. R. Fagundes

    1995-04-01

    Full Text Available Atmospheric gravity waves, detected over Kiruna (67.8°N, 20.4°E during geomagnetic storms, are presented and analysed. The data include direct measurements of the OI 630.0 nm emission line intensity, the x-component of the local geomagnetic field and thermospheric (meridional and zonal wind velocities derived from the OI 630.0 nm Doppler shift observed with an imaging Fabry-Perot interferometer (IFPI. A low pass band filter technique was used to determine short-period variations in the thermospheric meridional wind velocities observed during geomagnetic storms. These short-period variations in the meridional wind velocities, which are identified as due to gravity waves, are compared to the corresponding variations observed in the OI 630.0 nm emission line intensity, x-component of the local geomagnetic field and the location of the auroral electrojet. A cross-correlation analysis was used to calculate the propagation velocities of the observed gravity waves.

  17. The spectrum of Familial Mediterranean Fever gene (MEFV) mutations and genotypes in Iran, and report of a novel missense variant (R204H).

    Science.gov (United States)

    Ebadi, Nader; Shakoori, Abbas; Razipour, Masoumeh; Salmaninejad, Arash; Zarifian Yeganeh, Razieh; Mehrabi, Saman; Raeeskarami, Seyed Reza; Khaleghian, Malihea; Azhideh, Hamidreza

    2017-12-01

    Familial Mediterranean Fever (FMF) is an autosomal recessive disorder, characterized by recurrent and self-limited episodes of fever, abdominal pain, synovitis and pleuritis. FMF as the most common inherited monogenic autoinflammatory disease mainly affects ethnic groups of the Mediterranean basin, Arab, Jewish, Turkish, Armenian North Africans and Arabic descent. In the present study, we selected 390 unrelated FMF patients according to the Tel-Hashomer criteria, and analyzed all patients for 12 most common mutations of MEFV gene by reverse hybridization assay (FMF strip assay). We also investigated exon 2 and 10 of MEFV gene in 78 patients by Sanger sequencing. According to strip assay results, at least one mutation was found in 234 patients (60%), and no mutation was found in other 156 patients (40%). The five most common mutations and allelic frequencies were M694V (13.6%), E148Q (10.4%), M694I (6.5%), V726A (4.1%), and M680I (3.8%). Moreover, we detected a novel missense variant (R204H, c.611 G > A) (SCV000297822) and following rare mutations among sequenced samples; R202Q, P115T, G304R, and E230K. This study describes the MEFV mutations spectrum and distribution in Iranian population, and shows different mutation patterns among Iranian ethnicities. Moreover, M694V is the most common MEFV mutation in Iran. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  18. Microbial community structures in methane hydrate baring deep marine sediments from the Peru Margin (ODP Leg. 201) and the Cascadia Margin (ODP Leg. 204)

    Science.gov (United States)

    Inagaki, F.; Nunoura, T.; Suzuki, M.; Takai, K.; Nealson, K. H.; Horikoshi, K.; Delwiche, M.; Colwell, F. S.; Jorgensen, B. B.

    2003-12-01

    Current estimates of biomass in deep subseafloor sediments recovered by the Ocean Drilling Program (ODP) have lead to the conclusion that the subseafloor environment potentially represents the largest biosphere on Earth. However, neither the microbial diversity and distribution that live there nor the relationship between metabolic characteristics and geological, geochemical settings are poorly understood yet. We present here the vertical profiles of microbial community structures occurring in methane hydrate baring subseafloor sediments collected from the Peru Margin (ODP Leg 201, site 1230) and Cascadia Margin (ODP Leg 204, sites 1244, 1245, 1251). Organic rich marine sediment core lacking methane hydrates obtained from the Peru Margin (ODP Leg 201, site 1227) was also investigated as a reference site. Quantitative-PCR analysis of archaeal rDNA population and molecular phylogenetic analyses of over 3,000 archaeal and bacterial 16S rDNA clones were demonstrated vertically through the ODP sediment core columns, comparing with data from geochemical analyses. On the basis of the results from microbiology and geochemistry, we discuss the relationship between the distribution of previously unknown microbial communities and the potential source of biogenic methane associated with the formation of hydrates in two geologically discrete deep-subseafloor environments.

  19. Depth profile of production yields of {sup nat}Pb(p, xn) {sup 206,205,204,203,202,201}Bi nuclear reactions

    Energy Technology Data Exchange (ETDEWEB)

    Mokhtari Oranj, Leila [Division of Advanced Nuclear Engineering, POSTECH, Pohang 37673 (Korea, Republic of); Jung, Nam-Suk; Kim, Dong-Hyun; Lee, Arim; Bae, Oryun [Pohang Accelerator Laboratory, POSTECH, Pohang 37673 (Korea, Republic of); Lee, Hee-Seock, E-mail: lee@postech.ac.kr [Pohang Accelerator Laboratory, POSTECH, Pohang 37673 (Korea, Republic of)

    2016-11-01

    Experimental and simulation studies on the depth profiles of production yields of {sup nat}Pb(p, xn) {sup 206,205,204,203,202,201}Bi nuclear reactions were carried out. Irradiation experiments were performed at the high-intensity proton linac facility (KOMAC) in Korea. The targets, irradiated by 100-MeV protons, were arranged in a stack consisting of natural Pb, Al, Au foils and Pb plates. The proton beam intensity was determined by activation analysis method using {sup 27}Al(p, 3p1n){sup 24}Na, {sup 197}Au(p, p1n){sup 196}Au, and {sup 197}Au(p, p3n){sup 194}Au monitor reactions and also by Gafchromic film dosimetry method. The yields of produced radio-nuclei in the {sup nat}Pb activation foils and monitor foils were measured by HPGe spectroscopy system. Monte Carlo simulations were performed by FLUKA, PHITS/DCHAIN-SP, and MCNPX/FISPACT codes and the calculated data were compared with the experimental results. A satisfactory agreement was observed between the present experimental data and the simulations.

  20. Depth profiles of production yields of natPb(p, xn206,205,204,203,202 Bi reactions using 100-MeV proton beam

    Directory of Open Access Journals (Sweden)

    Oranj Leila Mokhtari

    2017-01-01

    Full Text Available In this study, results of the experimental study on the depth profiles of production yields of 206,205,204,203,202Bi radio-nuclei in the natural Pb target irradiated by a 100-MeV proton beam are presented. Irradiation was performed at proton linac facility (KOMAC in Korea. The target, irradiated by 100-MeV protons, was arranged in a stack consisting of natural Pb, Al, Au foils and Pb plates. The proton beam intensity was determined by activation analysis method using 27Al(p, 3p1n24Na, 197Au(p, p1n196Au, and 197Au(p, p3n194Au monitor reactions and also using dosimetry method by a Gafchromic film. The production yields of produced Bi radio-nuclei in the natural Pb foils and monitor reactions were measured by gamma-ray spectroscopy. Monte Carlo simulations were performed by FLUKA, PHITS, and MCNPX codes and compared with the measurements in order to verify validity of physical models and nuclear data libraries in the Monte Carlo codes. A fairly good agreement was observed between the present experimental data and the simulations by FLUKA, PHITS, and MCNPX. However, physical models and the nuclear data relevant to the end of range of protons in the codes need to be improved.

  1. Yellow fever vaccine: comparison of the neurovirulence of new 17D-204 Stamaril™ seed lots and RK 168-73 strain.

    Science.gov (United States)

    Moulin, Jean-Claude; Silvano, Jérémy; Barban, Véronique; Riou, Patrice; Allain, Caroline

    2013-07-01

    The neurovirulence of two new candidate 17D-204 Stamaril™ working seed lots and that of two reference preparations were compared. The Stamaril™ working seed lots have been used for more than twenty years for the manufacturing of vaccines of acceptable safety and efficacy. The preparation designated RK 168-73 and provided by the Robert Koch Institute was used as a reference. It was confirmed that RK 168-73 strain was not a good virus control in our study because it has a very low neurovirulence regarding both the clinical and histopathological scores in comparison with Stamaril™ strain and is not representative of a vaccine known to be satisfactory in use. The results were reinforced by the phenotypic characterization by plaque assay demonstrating that RK 168-73 was very different from the Stamaril™ vaccine, and by sequencing results showing 4 mutations between Stamaril™ and RK 168-73 viruses leading to amino acid differences in the NS4B and envelop proteins. Copyright © 2013 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

  2. $^{204m}$Pb: A new Probe for TDPAC Experiments in Biology Complementing the Well Established Probes $^{111}$Cd and $^{199m}$Hg

    CERN Multimedia

    2002-01-01

    The short-lived nuclear probes $\\,^{111m}$Cd( t$_{1/2}$ = 49 min) , $^{199m}$Hg ( t$_{1/2}$ = 43 min) , and $^{204m}$Pb( t$_{1/2}$ = 43 min) supplied by ISOLDE are used to study the interaction of metals with biological macromolecules like, e.g., DNA and proteins. The structure and dynamics of metal sites in biomolecules are important in determining the functional efficiency of these macromolecules. Many life processes are based on such interactions. In order to study those metal sites close to physiological conditions a highly sensitive spectroscopic method is required, like Time Differential Perturbed Angular Correlation (TDPAC). Here, a radioactive atom is placed at the site of interest and by correlating the emitted $\\gamma$-quanta in space and on a nanosecond time scale local structural information is provided via the Nuclear Quadrupole Interaction. These investigations will allow a deeper insight into the adaptivity and rigidity of metal sites in the blue copper proteins (electron transfer proteins), th...

  3. [Relationship between hepatitis B virus polymerase gene mutation patterns of rtM204I/V and pre-core/basal core promoter mutations].

    Science.gov (United States)

    Yan, Li; Wang, Jie-Fei; Wang, Zhan-Hui; Sun, Jian; Zhou, Bin; Hou, Jinlin

    2014-12-01

    To investigate the relationship between mutations of rtM204V/I (methionine to valine or isoleucine at position rt204 of reverse transcriptase domain) in the hepatitis B virus (HBV) polymerase gene and the G1896A and G1899A single mutations in the pre-eore (PC) region and the A1762T and G1764A double-mutations in the basal core promoter (BCP) region. A total of 2,849 hepatitis B complete genome sequences were retrieved from the GenBank/EMBL/DDBJ. The amino acid sequence of the of reverse transcriptase domain and genome sequences of the PC region and the BCP region were aligned using MEGA4 software. Data were calculated using Microsoft Excel and evaluated using SPSS 13.0 statistical software. Among the 2, 849 HBV complete genome sequences, 217 (8%) strains were identified with Y(I/V) DD and 120 of those had the YIDD mutation and 97 had the YVDD mutation. Of the 1543 strains (54.2%) with PC-BCP mutations, seven mutation patterns of G 1896A-G 1899A-G 1896A-G 1899A-A 1762T/G 1764A, A 1762T/G 1764AG 1896A, A 1762T/G 1764A-G 1899A, and A 1762T/G 1764A-G 1896A-G 1899A were identified. of YMDD and PC-BCP had a higher incidence than the single YMDD mutation (76% vs 24.0%, x2=45.283, P=0.000). The double-mutations of YIDD and PC-BCP had a higher incidence than the double-mutation of YVDD and PC-BCP (85% vs 64.9%, x2=11.836, P=0.000). The double-mutation for lamivudine resistance of YMDD and PC-BCP had a higher incidence than the double pre-existent YMDD and PC-BCP mutations (89.3% vs 58.9%, x2=27.084, P=0.000). The three mutation patterns of G1896A-G1899A (P=0.000, OR=7.573), A1762T/G1764A-G1899A (P=0.000, OR=6.539) and A1762T/G1764A-G1896A-G1899A (P=0.000, OR=6.596) were associated with a greater risk of developing the YIDD mutation, according to binary logistic analysis. There is a relationship between the HBV YI/VDD mutation and PC-BCP mutations. Different PC-BCP mutation patterns have different effects on the YI/VDD mutation.

  4. Identification and analysis of phenotypic resistance characteristics of a novel mutation rtL180M+A181C+M204V in HBV reverse-transcriptase region of a patient with chronic hepatitis B

    Directory of Open Access Journals (Sweden)

    Jia-hui LIU

    2012-06-01

    Full Text Available Objective  To identify a novel mutation rtA181C in HBV reverse-transcriptase (RT region of a chronic hepatitis B (CHB patient receiving sequential anti-HBV nucleoside/nucleotide analogues, and to analyze its phenotypic resistance characteristics. Methods  A 43-year-old CHB patient was identified in 302 Hospital of PLA in June 2010, serum HBV DNA was extracted and the HBV RT gene was amplified by nested PCR. The direct PCR sequencing and clonal sequencing were performed, and 12 drug-resistance-associated sites were analyzed. The recombinant plasmids pTriEx-HBV1.1 containing representative variation in RT region were constructed and transfected into HepG2 cells. The cell medium was supplemented with various concentrations of lamivudine, adefovir, entecavir and tenofovir 4 hours post-transfection. Four days later, HBV DNA level in the cell supernatant was quantified by real time PCR and the viral phenotypic resistance characteristics was analyzed. Results  The patient receiving lamivudine for 36 months, adefovir for 14 months, and entecavir for 29 months consecutively, and viral rebound and biochemical breakthrough subsequently occurred. HBV DNA increased to 1.1×106IU/ml, and ALT level increased to 235U/L. rtL180M+A181V+M204V mutation was identified in HBV RT region, and clonal analysis showed that 9 of 18 clones for rtL180M+A181V+M204V, 7 of 18 for rtL180M+A181C+M204V, 1 of 18 for rtV173L+L180M+A181V, and 1 of 18 for wild type virus were obtained. The viral replication capacity showed that wild type>rtV173L+L180M+A181V>rtL180M+A181C+M204V>rtL180M+A181V+M204V. Compared to the wild type virus, rtL180M+A181V+M204V and rtV173L+L180M+A181V variants were relatively less susceptible to lamivudine and adefovir, while rtL180M+A181C+M204V variant was less susceptible to lamivudine and entecavir. Conclusions  Long-term sequential treatment with nucleoside/nucleotide analogues may lead to occurrence of multidrug resistance; production of novel

  5. Reproductive performance and pre-weaning mortality: Preliminary analysis of 27,221 purebred female dogs and 204,537 puppies in France.

    Science.gov (United States)

    Chastant-Maillard, S; Guillemot, C; Feugier, A; Mariani, C; Grellet, A; Mila, H

    2017-04-01

    The objective of this study was to describe efficiency of reproduction of purebred dogs in field breeding conditions, from mating to weaning in France. Data were collected between 2010 and 2014 in 5,667 French breeding kennels via a reproduction management software (Breeding Management System, Royal Canin, Aimargues, France). Effect of breed size (Mini: adult body weight 40 kg), age of dam and male on pregnancy rate, abortion rate and litter size were evaluated by multivariable models. Data on 45,913 heats (all with mating), from 27,221 bitches from 248 breeds, were analysed. At mating, mean age (±SD) was 3.1 ± 1.8 years for bitches and 3.3 ± 2.0 for males. Males originated from the same kennel as the females in 88.5% of the matings. Based on breeder's evaluation of the pregnancy status, pregnancy rate (number of pregnant females based on breeders declaration/number of heats) was 87.8% and abortion rate was 6.8%. Finally, 81.9% of the mated females gave birth to a litter. On 37,946 litters (204,537 puppies), mean litter size was 5.4 ± 2.8 puppies (range 1-24), which was influenced by breed size and dam age (p breed size and within a breed size, by breed. Despite probable approximations (as data originate from breeders declaration), this large-scale analysis provides reference values on reproductive performance in dogs. © 2016 Blackwell Verlag GmbH.

  6. Thallium in the marine environment: first ecotoxicological assessments in the Guadalquivir estuary and its potential adverse effect on the donana european natural reserve after the Aznalcollar mining spill (SW Spain); Talio en el medio marino: primera valoracion ecotoxicologica en el estuario del Guadalquivir y su efecto potencial adverso en la reserva natural de donana despues del vertido minero de Aznalcollar (SW de Espana).

    Energy Technology Data Exchange (ETDEWEB)

    DelValls, T.A [Departamento de Quimica Fisica, Facultad de Ciencias del Mar, Universidad de Cadiz, Puerto Real, Cadiz (Spain); Saenz, V; Arias, A.M; Blasco, J [Instituto de Ciencias Marinas de Andalucia, CSIC, Puerto Real, Cadiz (Spain)

    1999-06-01

    Thallium (Tl) is an extremely toxic but little-studied element in the marine environment and practically no information has been reported on the levels of Tl in marine organisms. After the Aznalcollar mining Spill (April 1998), high levels of metals were put into the environment. This acud-contaminated medium was responsible for the initial pollution effects measured in the Guadiamar River, which is an affluent of the Guadalquivir River and very close to the biggest natural reserve in Europe (Donana). Four different species were used in the monitoring from April to September 1998 and a sediment field bioassay to check bioacumulation was performed. We present the first ecotoxicological evaluation of the mining spill in the Guadalquivir River, with reference to Tl, a little-known metal. Also, Pb and Cd data were compared to Tl during field sediment testing. Results show low levels of this metal in all of the organisms studied and they do not show any increase in the level of this metal, ranging from 40 to 90 ng g{sup -}1, 80 to 210 ng g{sup -}1, 15 to 98 ng g{sup -}1 and 75 to 125 whole body dry weight for Scrobicularia plana, Liza ramada (muscle), Crassostrea angulata and Uca Tangeri, respectively. These are the first field data of Tl concentration measured using estuarine organisms. Field sediment toxicity test results confirm those obtained during the monitoring: Tl is not bioaccumulated by the organisms (C. angulata) used in the test. The sequence in bioaccumulation of metals was Cd > Pb > Tl. Both studies, bioaccumulation and sediment toxicity, should be maintained during the next few years to really evaluate the potential effect of the mining spill on the ecosystem and society. [Spanish] El talio (Tl) es un elemento extremadamente toxico aunque poco estudiado en el medio marino y la informacion sobre niveles de Tl en organismos marinos con anterioridad al presente trabajo es practicamente nula. Despues del vertido minero de Aznalcollar (abril de 1998) se

  7. faas determination of thallium after preconcentration using nitroso-s ...

    African Journals Online (AJOL)

    EXPERIMENTAL. Apparatus. A Shimadzu AA-670 flame atomic absorption spectrophotometer was used in the following conditions: wavelength: 276.8 nm, lamp ... hydrogen phosphate and 0.1 M sodium dihydrogen phosphate and 0.5 M aqueous ammonia and ... The residue was dried at the room temperature in the folds.

  8. Thallium-201 accumulation in cerebral candidiasis: Unexpected finding on SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Tonami, N.; Matsuda, H.; Ooba, H.; Yokoyama, K.; Hisada, K.; Ikeda, K.; Yamashita, J. (Kanazawa Univ. (Japan))

    1990-06-01

    The authors present an unexpected finding of Tl-201 uptake in the intracerebral lesions due to candidiasis. SPECT demonstrated the extent of the lesions and a high target-to-background ratio. The regions where abnormal Tl-201 accumulation was seen were nearly consistent with CT scans of those enhanced by a contrast agent. After treatment, most of the abnormal Tl-201 accumulation disappeared.

  9. Thallium Toxicity: The Problem; An Analytical Approach; An Antidotal Study

    Science.gov (United States)

    1993-05-15

    Nixon CE: The 1932 thallotoxi- cosis outbreak in California. JAMA 100:1315-1319, 1933. 21. Aoyama H, Yoshida M, Yamamura Y: Acute poisoning by...lower extremities); ataxia; muscle/joint pain; aptosis; strabismis; facial palsy; mydriasis; psychotic signs (permanent neurological and psychiatric

  10. Sequential thallium-201 myocardial scintigraphy after acute infarction in man

    Energy Technology Data Exchange (ETDEWEB)

    Fletcher, J.W.; Mueller, H.S.; Rao, P.S.

    1980-07-01

    Three sequential Tl-201 myocardial perfusion studies were performed in 21 patients (18 men, 3 women) with first acute transmural myocardia infarction. The Tl-201 image defect size was determined with a semiquantitative visual scoring method and temporal changes in image defect size were compared to CK-MB infarct size and enzymatic evidence of progressive myocardial necrosis and infarct extension. Progressive decreases in Tl-201 image defect size were observed and the visual score in all 21 patients decreased significantly from 6.5 +- 3.7 (mean +- SD) on day 1 to 4.9 +- 3.5 on day 12. Eleven patients without evidence of infarct extension had significantly lower infarct size, a significant decrease in visual score by the 12th day and had significantly smaller Tl-201 defects at all three study times compared to 10 patients with infarct extension. Seven of 10 (70%) with extension had an initial visual score greater than or equal to 7 compared to only 2/11 (18%) without extension. The temporal behavior of Tl-201 image defects is related to the size of the infarction and presence or absence of extension. Sequential studies comparing early initial and subsequent defect size may assist in evaluating the behavior of ischemic and infarcted myocardium in the postinfarction period.

  11. A comparison of the clinical relevance of thallium- 201 and ...

    African Journals Online (AJOL)

    1990-09-01

    Sep 1, 1990 ... group of 20 patients, who underwent both 201TI single photon emission computed tomography and 99mTc_MIBI study as well as coronary angiography. The sensitivity for predicting a lesion ranged from 25% to 88% in different areas of the heart and was comparable for the two radiophannaceuticals. The.

  12. Thallium isotope variations in anthropogenically-affected soils

    Science.gov (United States)

    Vanek, Ales; Chrastny, Vladislav; Penizek, Vit; Mihaljevic, Martin; Komarek, Michael; Cabala, Jerzy

    2014-05-01

    Our preliminary data from soils impacted by long-term Tl deposition in the vicinity of a primary/secondary Zn smelter at Olkusz (Poland) indicate apparent variability of ɛ205Tl within soil profiles. The identified ɛ205Tl values presented for the forest soil profile reached -1.7 in the surface/organic horizon, +1.9 in the organo-mineral horizon (Ap), and +1.0 in the mineral horizon (C). This finding suggests both the enrichment of 203Tl isotope in the topsoil, as well as its preferential release during smelting operations, as "lighter" Tl tends to enter the emissions during a high-temperature process. The maximum ɛ205Tl value in the subsurface horizon Ap is in accordance with the concentration peak of oxalate-extractable Mn, indicating the presence of amorphous/poorly-crystalline Mn oxides with a potential to isotopically fractionate Tl toward the "heavier" fraction. The Tl isotope signature in the bottom horizon probably reflects the composition of a local geochemical anomaly of Tl. However, a portion of mobile (anthropogenic) Tl with negative ɛ205Tl moving downwards in the soil profile cannot be neglected. In general, there is no detailed information about the biogeochemical cycling and variations of Tl isotopes in areas affected by significant anthropogenic inputs of the metal (e.g., coal burning and primary metallurgy); the questions of the degree to which the factors such as soil (and sediment) chemistry, mineralogy, local biota, and pollution source control Tl isotope fractionation remain unresolved. Therefore, further research on the topic is needed before any principal conclusions will be made.

  13. FCJ-204 Degrees of Freedom

    Directory of Open Access Journals (Sweden)

    Elena Knox

    2016-12-01

    Full Text Available This paper critiques a choreographed performance of embodied agency by a ‘very humanlike’ (Ishiguro, 2006 gynoid robot. It draws on my experience in 2013 with Actroid-F (or Geminoid-F, designed by ATR Hiroshi Ishiguro Laboratories, when I created six artworks making up Actroid Series I. My analysis here proceeds from and through the part-programmed, part-puppeteered actions and vocalisations of Actroid-F for my six-minute video Radical Hospitality, in which the robotic gynoid actor performs compound negotiations of embodied authority, docility, and compliance. Design of ‘very humanlike’ androids risks instilling into robotic agents existing and discriminatory societal standards. My performance, installation and screen works trouble the gendered aesthetics predominant in this realm of engineering design.

  14. MO-E-17A-08: Attenuation-Based Size Adjusted, Scanner-Independent Organ Dose Estimates for Head CT Exams: TG 204 for Head CT

    Energy Technology Data Exchange (ETDEWEB)

    McMillan, K; Bostani, M; Cagnon, C; McNitt-Gray, M [UCLA School of Medicine, Los Angeles, CA (United States); Zankl, M [Helmholtz Zentrum Munchen GmbH, Neuherberg (Germany); DeMarco, J [UCLA Department of Radiation Oncology, Los Angeles, CA (United States)

    2014-06-15

    Purpose: AAPM Task Group 204 described size specific dose estimates (SSDE) for body scans. The purpose of this work is to use a similar approach to develop patient-specific, scanner-independent organ dose estimates for head CT exams using an attenuation-based size metric. Methods: For eight patient models from the GSF family of voxelized phantoms, dose to brain and lens of the eye was estimated using Monte Carlo simulations of contiguous axial scans for 64-slice MDCT scanners from four major manufacturers. Organ doses were normalized by scannerspecific 16 cm CTDIvol values and averaged across all scanners to obtain scanner-independent CTDIvol-to-organ-dose conversion coefficients for each patient model. Head size was measured at the first slice superior to the eyes; patient perimeter and effective diameter (ED) were measured directly from the GSF data. Because the GSF models use organ identification codes instead of Hounsfield units, water equivalent diameter (WED) was estimated indirectly. Using the image data from 42 patients ranging from 2 weeks old to adult, the perimeter, ED and WED size metrics were obtained and correlations between each metric were established. Applying these correlations to the GSF perimeter and ED measurements, WED was calculated for each model. The relationship between the various patient size metrics and CTDIvol-to-organ-dose conversion coefficients was then described. Results: The analysis of patient images demonstrated the correlation between WED and ED across a wide range of patient sizes. When applied to the GSF patient models, an exponential relationship between CTDIvol-to-organ-dose conversion coefficients and the WED size metric was observed with correlation coefficients of 0.93 and 0.77 for the brain and lens of the eye, respectively. Conclusion: Strong correlation exists between CTDIvol normalized brain dose and WED. For the lens of the eye, a lower correlation is observed, primarily due to surface dose variations. Funding

  15. Pb(II) and Hg(II) binding to $\\textit{de novo}$ designed proteins studied by $^{204m}$Pb- and $^{199m}$Hg-Perturbed Angular Correlation of $\\gamma$-rays (PAC) spectroscopy : Clues to heavy metal toxicity

    CERN Multimedia

    2002-01-01

    $\\textit{De novo}$ design of proteins combined with PAC spectroscopy offers a unique and powerful approach to the study of fundamental chemistry of heavy metal-protein interactions, and thus of the mechanisms underlying heavy metal toxicity. In this project we focus on Pb(II) and Hg(II) binding to designed three stranded coiled coil proteins with one or two binding sites, mimicking a variety of naturally occurring thiolate-rich metal ion binding sites in proteins. The $^{204m}$Pb- and $^{199m}$Hg-PAC experiments will complement data already recorded with EXAFS, NMR, UV-Vis and CD spectroscopies.

  16. Excitation functions of $^{nat}$Pb(d,x)$^{206,205,204,203,202}$Bi, $^{203cum,202m,201cum}$Pb and $^{202cum,201cum}$Tl reactions up to 50 MeV

    OpenAIRE

    Ditrói, F.; Tárkányi, F.; Takács, S.; Hermanne, A.; Ignatyuk, A. V.

    2014-01-01

    Cross-sections of deuteron induced nuclear reactions on lead were measured up to 50 MeV using the standard stacked foil irradiation technique and high resolution $\\gamma$-ray spectrometry. Experimental cross-sections and derived integral yields are presented for the $^{nat}$Pb(d,x)$^{206,205,204,203,202}$Bi, $^{203cum,202m,201cum}$Pb and $^{202cum,201cum}$Tl reactions. The experimental data were compared with the results from literature and with the data in the TENDL-2013 library (obtained wi...

  17. High-titer lactic acid production from NaOH-pretreated corn stover by Bacillus coagulans LA204 using fed-batch simultaneous saccharification and fermentation under non-sterile condition.

    Science.gov (United States)

    Hu, Jinlong; Zhang, Zhenting; Lin, Yanxu; Zhao, Shumiao; Mei, Yuxia; Liang, Yunxiang; Peng, Nan

    2015-04-01

    Lactic acid (LA) is an important chemical with various industrial applications. Non-food feedstock is commercially attractive for use in LA production; however, efficient LA fermentation from lignocellulosic biomass resulting in both high yield and titer faces technical obstacles. In this study, the thermophilic bacterium Bacillus coagulans LA204 demonstrated considerable ability to ferment glucose, xylose, and cellobiose to LA. Importantly, LA204 produces LA from several NaOH-pretreated agro stovers, with remarkably high yields through simultaneous saccharification and fermentation (SSF). A fed-batch SSF process conducted at 50°C and pH 6.0, using a cellulase concentration of 30 FPU (filter paper unit)/g stover and 10 g/L yeast extract in a 5-L bioreactor, was developed to produce LA from 14.4% (w/w) NaOH-pretreated non-sterile corn stover. LA titer, yield, and average productivity reached 97.59 g/L, 0.68 g/g stover, and 1.63 g/L/h, respectively. This study presents a feasible process for lignocellulosic LA production from abundant agro stovers. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Factors associated with grade 3 or 4 treatment-related toxicity in women with advanced or recurrent cervical cancer: an exploratory analysis of NRG Oncology/Gynecologic Oncology Group trials 179 and 204.

    Science.gov (United States)

    Chase, Dana M; Kauderer, James; Wenzel, Lari; Ramondetta, Lois; Cella, David; Long, Harry J; Monk, Bradley J

    2015-02-01

    This study aimed to describe pretreatment patient characteristics and baseline quality-of-life scores as they relate to the development of grade 3 or 4 toxicity in patients receiving chemotherapy for advanced/recurrent cervical cancer. The study sample was drawn from Gynecologic Oncology Group protocols 179 and 204. Grade 3 or 4 toxicities were considered in 4 specified categories as follows: peripheral neuropathy, fatigue, hematological, and gastrointestinal (GI). The data variables explored included age, stage, pretreatment radiation, performance status (PS) at treatment initiation, and baseline Functional Assessment of Cancer Therapy-Cervix (FACT-Cx) score. A logistic regression model was developed with various adverse events as binary (0/1) outcomes. Six hundred seventy-three patient-reported questionnaires were used in the analyses. At baseline, pain was the most severe patient-reported symptom. Baseline line-item patient concerns did demonstrate specific correlations with the development of individual toxicities. In 401 patients who were enrolled on Gynecologic Oncology Group 204 (fatigue not measured on 179), a worse PS predicted the development of grade 3 or 4 fatigue (odds ratio, 2.78; 95% confidence interval, 1.66-4.68). Exposure to previous radiation, treatment regimen, and a worse FACT-Cx score were associated with the reporting of both grade 3 or 4 leukopenia (P < 0.05) and anemia (P < 0.0005). Performance status and treatment regimen (P < 0.05) were associated with the development of grade 3 or 4 thrombocytopenia. Age and treatment regimen (P < 0.05) were associated with the development of grade 3 or 4 neutropenia. The FACT-Cx score (P = 0.0016) predicted grade 3 or 4 GI toxicity. The development of fatigue, hematological, and GI toxicity might be predictable based on factors other than treatment assignment such as age, PS, and patient-reported quality-of-life measurement.

  19. Automatización del laboratorio de ingeniería electrónica G-204 de la ECI a través de una red inmótica

    Directory of Open Access Journals (Sweden)

    Hernán Paz Penagos

    2006-09-01

    Full Text Available El aumento de usuarios (estudiantes y profesores de los laboratorios de ingeniería electrónica de la Escuela Colombiana de Ingeniería JULIO GARAVITO en el último año ha congestionado el acceso a dichos laboratorios, razón por la cual el Centro de Estudios de Electrónica Aplicada, Grupo de Investigación “Ecitrónica8 del programa de ingeniería electrónica de la escuela, propuso, diseñó y desarrolló un proyecto de investigación que aprovecha el tendido de distribución eléctrica del edificio G para ofrecer facilidades de acceso, control de equipos de laboratorio, ahorro de energía y mejoramiento de la calidad de servicio. El sistema de la red inmótica para el laboratorio G-204 estará constituida con los siguientes subsistemas: a. Un control de acceso con una arquitectura cliente - servidor; en este último reposa una base de datos de los usuarios, horarios, equipos y mesas de trabajo; el usuario se conecta desde cualquier computador (cliente al servidor a través de Internet para separar el turno de su práctica de laboratorio; en esa operación selecciona el horario, los equipos, la mesa, el tipo de red que requiere (monofásica o trifásica y registra a sus compañeros de trabajo. El acceso al laboratorio G-204, en el día y la hora de su práctica, se realiza mediante un lector de tarjetas inteligentes. b. Control de información de un aviso publicitario y de un reloj electrónico: desde el servidor se genera y controla el envió de información de interés a un aviso publicitario conformado por tres pantallas LCD ubicadas en una de las paredes del segundo piso del edificio G; así mismo, se actualiza continuamente la hora y se informa sobre la temperatura del laboratorio G-204. c. Habilitación o deshabilitación de los bancos de trabajo: mediante un control on-off, con mando desde el servidor, se energizan (al inicio de la práctica o desenergizan (al final de la práctica o ante eventualidades los bancos de trabajo para

  20. Inhibitory effect of juniperonic acid (Delta-5c,11c,14c,17c-20:4, omega-3) on bombesin-induced proliferation of Swiss 3T3 cells.

    Science.gov (United States)

    Morishige, Jun-ichi; Amano, Naoki; Hirano, Kaoru; Nishio, Hiroaki; Tanaka, Tamotsu; Satouchi, Kiyoshi

    2008-09-01

    Juniperonic acid (Delta-5c,11c,14c,17c-20:4, JA) is a polymethylene-interrupted (PMI) fatty acid that occurs in Biota orientalis. In this study, we found that JA has an antiproliferative activity. Swiss 3T3 cells were preloaded with fatty acids before stimulation with bombesin, a mitogenic neuropeptide, and proliferation of the cells was assessed by [(3)H]thymidine incorporation. Preloading of linoleic acid (Delta-9c,12c-18:2) significantly enhanced bombesin-induced proliferation. In contrast, preloading of eicosapentaenoic acid (Delta-5c,8c,11c,14c,17c-20:5, EPA) suppressed proliferation. Likewise, cells preloaded with JA showed a significantly curtailed response to bombesin. The antiproliferative potency of JA was equivalent to that of EPA. Sciadonic acid (Delta-5c,11c,14c-20:3), an omega-6 analogue of JA did not show antiproliferative activity, suggesting the importance of the omega-3 double bond rather than the PMI structure. The EPA-like activity of JA may be involved in the pharmaceutical activity of biota seeds, a psychoactive Chinese traditional medicine.

  1. Neutron capture measurements on Tl-isotopes at Dance

    Energy Technology Data Exchange (ETDEWEB)

    Couture, A.; Reifarth, R.; Bredeweg, T.A.; Haight, R.C.; Jandel, M.; Mertz, A.F.; O' Donnell, J.M.; Rundberg, R.S.; Ullmann, J.L.; Viera, D.J.; Wouters, J.M. [Los Alamos National Laboratory, NM (United States); Baker, J.D. [Idaho National Laboratory, Idaho Falls, ID (United States)

    2008-07-01

    The thallium isotopes play an important role in the s-process nucleosynthesis at the s-process endpoint. Furthermore, {sup 204}Tl is one of few branch point isotopes in the endpoint region. The understanding of branch point isotopes provides modeling constraints on the temperatures and neutron densities during which the process takes place. The production of s-only {sup 204}Pb is controlled almost entirely by {sup 204}Tl. Measurements of the capture cross-sections of the stable Tl isotopes have recently been made using the DANCE 4{pi} array at LANSCE. This provides needed resonance information in the region as well as preparing the way for measurements of as yet unmeasured capture cross-section of the unstable {sup 204}Tl. (authors)

  2. Investigation of thallium fluxes from subaerial volcanism-Implications for the present and past mass balance of thallium in the oceans

    Science.gov (United States)

    Baker, R.G.A.; Rehkamper, M.; Hinkley, T.K.; Nielsen, S.G.; Toutain, J.P.

    2009-01-01

    A suite of 34 volcanic gas condensates and particulates from Kilauea (Hawaii), Mt. Etna and Vulcano (Italy), Mt. Merapi (Indonesia), White Island and Mt. Nguaruhoe (New Zealand) were analysed for both Tl isotope compositions and Tl/Pb ratios. When considered together with published Tl-Pb abundance data, the measurements provide globally representative best estimates of Tl/Pb = 0.46 ?? 0.25 and ??205Tl = -1.7 ?? 2.0 for the emissions of subaerial volcanism to the atmosphere and oceans (??205Tl is the deviation of the 205Tl/203Tl isotope ratio from NIST SRM 997 isotope standard in parts per 10,000). Compared to igneous rocks of the crust and mantle, volcanic gases were found to have (i) Tl/Pb ratios that are typically about an order of magnitude higher, and (ii) significantly more variable Tl isotope compositions but a mean ??205Tl value that is indistinguishable from estimates for the Earth's mantle and continental crust. The first observation can be explained by the more volatile nature of Tl compared to Pb during the production of volcanic gases, whilst the second reflects the contrasting and approximately balanced isotope fractionation effects that are generated by partial evaporation of Tl during magma degassing and partial Tl condensation as a result of the cooling and differentiation of volcanic gases. Mass balance calculations, based on results from this and other recent Tl isotope studies, were carried out to investigate whether temporal changes in the volcanic Tl fluxes could be responsible for the dramatic shift in the ??205Tl value of the oceans at ???55 Ma, which has been inferred from Tl isotope time series data for ferromanganese crusts. The calculations demonstrate that even large changes in the marine Tl input fluxes from volcanism and other sources are unable to significantly alter the Tl isotope composition of the oceans. Based on modelling, it is shown that the large inferred change in the ??205Tl value of seawater is best explained if the oceans of the early Cenozoic featured significantly larger Tl output fluxes to oxic pelagic sediments, whilst the sink fluxes to altered ocean crust remained approximately constant. ?? 2009 Elsevier Ltd.

  3. 204-IJBCS-Article-Paul Noupa

    African Journals Online (AJOL)

    RHUMSIKI

    Cyanotis longifolia. Bulbostylis hispidula. Hyparrhenia suplumosa. Crotalaria occidentalis. Striga aspera. Ascolepsis sp. Cyperus sp. Crotalaria lachnophora. Triumfetta pentandra. Andropogon mannii. Ctenium newtonii. Desmodium adscendens. Dissotis decumbens. Eragrostis atrovirens. Ipomoea obscura. Microchloa sp.

  4. 40 CFR 204.54 - Test procedures.

    Science.gov (United States)

    2010-07-01

    ...+ Antilog L 5/10]) Where: L=The average A-weighted sound level (in decibels) L 1=The A-weighted sound level (in decibels) at microphone position 1 L 2=The A-weighted sound level (in decibels) at microphone position 2 L 3=The A-weighted sound level (in decibels) at microphone position 3 L 4=The A-weighted sound...

  5. 35__200 - 204__Musa - Toxicity

    African Journals Online (AJOL)

    User

    significant effect of Alanine Aminotransferase (ALT) and Aspartate Aminotransferase (AST); however there was significant (p < 0.05) .... cell (WBC) count and differential WBC count using the method of Tietz (1985). Tissue histology: Kidney ..... proliferation of matured lymphocytes. The extract therefore, may not have caused ...

  6. 18 CFR 157.204 - Application procedure.

    Science.gov (United States)

    2010-04-01

    ..., DEPARTMENT OF ENERGY REGULATIONS UNDER NATURAL GAS ACT APPLICATIONS FOR CERTIFICATES OF PUBLIC CONVENIENCE... gas company; the state under the laws of which the applicant is organized or authorized to do business... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Application procedure...

  7. 28_197 - 204_Saminu et al.,

    African Journals Online (AJOL)

    pc

    Thurechtand Howdle, 2009) and other various media (Mertoglu, et.al., 2005). ism involved in RAFT polymerisation ... 2009; Smith, et.al., 2010; Wager, et.al., 2004; Wang, et.al., 2006; Zhou, et.al., 2007).Synthetic procedures require the .... The decomposition pro of the copolymers were measured u thermogravimetric analysis ...

  8. 7 CFR 20.4 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... performance bond or letter of credit from the foreign buyer is included in this definition and such a... whose place of doing business with respect to the transaction is outside the United States. Foreign buyer or foreign seller includes a person who maintains a place of doing business outside the United...

  9. 48 CFR 952.204-2 - Security.

    Science.gov (United States)

    2010-10-01

    ... nuclear material in the production of energy, but excluding data declassified or removed from the... control which are required to be reported to the Securities and Exchange Commission, the Federal Trade...

  10. 48 CFR 2052.204-70 - Security.

    Science.gov (United States)

    2010-10-01

    ... financial information, including Commission plans, policies, reports, financial plans, internal data... use of special nuclear material in the production of energy, but does not include data declassified or...

  11. 5 CFR 9701.204 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... locality and special rate supplements. Classification, also referred to as job evaluation, means the process of analyzing and assigning a job or position to an occupational series, cluster, and band for pay..., Librarian Series). Position or Job means the duties, responsibilities, and related competency requirements...

  12. 5 CFR 9901.204 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... meaning given that term in § 9901.103. Classification, also referred to as job evaluation, means the process of analyzing and assigning a job or position to an occupational series, official title, career... meaning given that term in § 9901.103. Position or job means the duties, responsibilities, and related...

  13. 8 CFR 204.301 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... child's life so that the parent's whereabouts are unknown, there is no reasonable expectation of the... child, or to have disappeared from the child's life, in the same manner as would apply to any other... life; or (2) The child's father, when the competent authority has determined that the child's mother...

  14. Publications | Page 204 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    National development plans focus upon energy and water separately, often not integrating the other sector''s resource use. This contributes to programme failures in the long run. Research is needed to inform and assist government in making the right decisions around renewable energies. A... Managing International ...

  15. Publications | Page 204 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    IDRC works with developing-country researchers and institutions to build local capacity through funding, knowledge sharing, and training. Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. We share the results of our funded ...

  16. 29 CFR 1614.204 - Class complaints.

    Science.gov (United States)

    2010-07-01

    ... that discriminates against the group on the basis of their race, color, religion, sex, national origin...; (ii) A description of the issues accepted as part of the class complaint; (iii) An explanation of the... entitled to reasonable development of evidence on matters relevant to the issues raised in the complaint...

  17. 12 CFR 268.204 - Class complaints.

    Science.gov (United States)

    2010-01-01

    ... discriminates against the group on the basis of their race, color, religion, sex, national origin, age or... of the complaint; (ii) A description of the issues accepted as part of the class complaint; (iii) An.... Both parties are entitled to reasonable development of evidence on matters relevant to the issues...

  18. 7 CFR 1901.204 - Compliance reviews.

    Science.gov (United States)

    2010-01-01

    ... determine the way in which they were recruited. (iv) Interview informed local community leaders, including minority leaders, if any to determine if the facility is operating without discrimination because of race, color, or national origin. (3) Recording results of reviews—(i) Association, Watershed, Resource...

  19. 48 CFR 204.7000 - Scope.

    Science.gov (United States)

    2010-10-01

    ..., contracts, and related instruments; and (b) Does not apply to solicitations or orders for communication service authorizations issued by the Defense Information Technology Contracting Organization of the Defense Information Systems Agency in accordance with 239.7407-2. ...

  20. 48 CFR 204.7101 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... Definitions. Accounting classification reference number (ACRN) means any combination of a two position alpha/numeric code used as a method of relating the accounting classification citation to detailed line item... in this subpart, means an item for which a firm price has been established in the basic contract or...

  1. Reference: 204 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ified in Arabidopsis based on a growth defect of the dark-grown hypocotyl and an abnormal composition of the...on defects of cells in the central cylinder. These defects were accompanied by changes in the non-cellulosic polysaccharide compositi...on, including the accumulation of ectopic callose. Interestingly, in contrast to ot

  2. 40 CFR 96.204 - Applicability.

    Science.gov (United States)

    2010-07-01

    ... combustion turbine serving at any time, since the later of November 15, 1990 or the start-up of the unit's combustion chamber, a generator with nameplate capacity of more than 25 MWe producing electricity for sale. (2) If a stationary boiler or stationary combustion turbine that, under paragraph (a)(1) of this...

  3. 40 CFR 97.204 - Applicability.

    Science.gov (United States)

    2010-07-01

    ...: any stationary, fossil-fuel-fired boiler or stationary, fossil-fuel-fired combustion turbine serving... generator with nameplate capacity of more than 25 MWe producing electricity for sale. (2) If a stationary boiler or stationary combustion turbine that, under paragraph (a)(1) of this section, is not a CAIR SO2...

  4. 5 CFR 2635.204 - Exceptions.

    Science.gov (United States)

    2010-01-01

    ... technology. At the conclusion of his speech, the association presents the employee a framed map with a market... speech in support of the candidate. (g) Widely attended gatherings and other events—(1) Speaking and... significance of the employee's role in any such matter, the purpose of the event, the identity of other...

  5. TU-AB-204-04: Partnerships

    Energy Technology Data Exchange (ETDEWEB)

    Ochs, R. [Food & Drug Administration Center for Devices and Radiological Health (United States)

    2016-06-15

    The responsibilities of the Food and Drug Administration (FDA) have increased since the inception of the Food and Drugs Act in 1906. Medical devices first came under comprehensive regulation with the passage of the 1938 Food, Drug, and Cosmetic Act. In 1971 FDA also took on the responsibility for consumer protection against unnecessary exposure to radiation-emitting devices for home and occupational use. However it was not until 1976, under the Medical Device Regulation Act, that the FDA was responsible for the safety and effectiveness of medical devices. This session will be presented by the Division of Radiological Health (DRH) and the Division of Imaging, Diagnostics, and Software Reliability (DIDSR) from the Center for Devices and Radiological Health (CDRH) at the FDA. The symposium will discuss on how we protect and promote public health with a focus on medical physics applications organized into four areas: pre-market device review, post-market surveillance, device compliance, current regulatory research efforts and partnerships with other organizations. The pre-market session will summarize the pathways FDA uses to regulate the investigational use and commercialization of diagnostic imaging and radiation therapy medical devices in the US, highlighting resources available to assist investigators and manufacturers. The post-market session will explain the post-market surveillance and compliance activities FDA performs to monitor the safety and effectiveness of devices on the market. The third session will describe research efforts that support the regulatory mission of the Agency. An overview of our regulatory research portfolio to advance our understanding of medical physics and imaging technologies and approaches to their evaluation will be discussed. Lastly, mechanisms that FDA uses to seek public input and promote collaborations with professional, government, and international organizations, such as AAPM, International Electrotechnical Commission (IEC), Image Gently, and the Quantitative Imaging Biomarkers Alliance (QIBA) among others, to fulfill FDA’s mission will be discussed. Learning Objectives: Understand FDA’s pre-market and post-market review processes for medical devices Understand FDA’s current regulatory research activities in the areas of medical physics and imaging products Understand how being involved with AAPM and other organizations can also help to promote innovative, safe and effective medical devices J. Delfino, nothing to disclose.

  6. 29 CFR 541.204 - Educational establishments.

    Science.gov (United States)

    2010-07-01

    ... establishment” includes special schools for mentally or physically disabled or gifted children, regardless of... of instructing, measuring and testing the learning potential and achievement of students... work such as administering school testing programs, assisting students with academic problems and...

  7. 5 CFR 950.204 - Local eligibility.

    Science.gov (United States)

    2010-01-01

    ... defined as providing or conducting real services, benefits, assistance or program activities covering 30 percent of a state's geographic boundaries or providing or conducting real services, benefits, assistance... met on the basis of services provided solely through an “800” telephone number, the internet, the U.S...

  8. 12 CFR 204.2 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... death, incompetency, marriage, divorce, attachment, or otherwise by operation of law or a transfer on... Agreement Corporation organized under the laws of the United States, the sum, if positive, of the following... foreign parent institution, or by non-United States offices of an affiliated Edge or Agreement Corporation...

  9. 30 CFR 75.204 - Roof bolting.

    Science.gov (United States)

    2010-07-01

    ... accessories addressed in ASTM F432-95, “Standard Specification for Roof and Rock Bolts and Accessories,” the.... (4) In each roof bolting cycle, the actual torque or tension of the first tensioned roof bolt... during each roof bolting cycle shall be tested during or immediately after the first row of bolts has...

  10. 14 CFR 204.2 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... the board of directors and other managing officers are citizens of the United States, which is under... common responsibilities in both companies. (l) Substantial change in operations, ownership, or management includes, but is not limited to, the following events: (1) Changes in operations from charter to scheduled...

  11. 49 CFR 172.204 - Shipper's certification.

    Science.gov (United States)

    2010-10-01

    ... regulations.” (b) Exceptions. (1) Except for a hazardous waste, no certification is required for a hazardous material offered for transportation by motor vehicle and transported: (i) In a cargo tank supplied by the... contains radioactive material intended for use in, or incident to, research, or medical diagnosis or...

  12. 46 CFR 197.204 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... structurally. Commercial diver means a diver engaged in underwater work for hire excluding sport and... mode means a type of diving requiring SCUBA, surface-supplied air, or surface-supplied mixed-gas...

  13. 35__200 - 204__Musa - Toxicity

    African Journals Online (AJOL)

    User

    ABSTRACT. Sub-acute toxicity profile of Rheumatic Tea Formula (RTF), a polyherbal tea consisting of Salix alba, Eucalyptus globulus and Albizia chevalieri was investigated in wistar rats of both sexes. Wistar rats were orally administered three different doses of ethanol extract of RTF for 28 days after which the effect on ...

  14. 40 CFR 204.2 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... ballistics of meter dynamic characteristics as specified by American National Standard S1.4-1971 or... of a metering characteristic and weighing A, B, or C as specified in American National Standard...

  15. 23 CFR 646.204 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS RAILROADS Railroad... aspect upon the approach or presence of a train. Preliminary engineering shall mean the work necessary to... rapid transit, commuter and street railroads. Utility shall mean the lines and facilities for producing...

  16. Publications | Page 204 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Three decades of war have changed household and family structures, with an unprecedented increase in the number of female-headed households. Findings provide insight on the impact of state ICT policies and programmes regarding women''s engagement with new media. In terms of government policy,.

  17. 21 CFR 10.204 - General.

    Science.gov (United States)

    2010-04-01

    ... written media access to its proceedings, so that members of the press would have the opportunity to provide first-hand reports. However, because electronic media coverage presents certain difficulties that... PROCEDURES Electronic Media Coverage of Public Administrative Proceedings; Guideline on Policy and Procedures...

  18. 19 CFR 201.204 - Salary offset.

    Science.gov (United States)

    2010-04-01

    ... applicable. (7) Failure to appear. If, in the absence of good cause shown (e.g., illness), the employee or..., based on materially changed circumstances, including, but not limited to, catastrophic illness, divorce...

  19. INCLUSIÓN Y ACUMULACIÓN DE NA+ EN DIFERENTES ÓRGANOS DE LA VARIEDAD DE TRIGO CUBA-C-204 COMO RESPUESTA AL ESTRÉS SALINO

    Directory of Open Access Journals (Sweden)

    Leandris Argentel

    2016-06-01

    Full Text Available Se determinó la capacidad de inclusión y los sitios de retención de cationes en una variedad de trigo harinero Cuba-C-204, como posible indicador de toxicidad iónica y daño celular después de tratamiento salino, mediante técnicas de espectrofotometría de absorción atómica, fijación y microanálisis en diferentes órganos de la planta. Plantas fueron cultivadas por 35 días en condiciones de hidroponía en solución nutritiva con dos tratamientos (salinizada y control, con 88 mM de NaCl y sin NaCl, respectivamente. Se cuantificó el contenido catiónico en raíces, vainas y hojas, y en una muestra aleatoria de cada órgano seccionado. Como resultado del tratamiento salino observase que hubo mayor acumulación de Na+ y Ca2+ en los diferentes órganos. En la parte de la raíz más próxima al tallo, y en la base y parte media de la vaina se observó inclusión y concentración significativas de Na+. En la hoja el Na+ se acumuló en la parte más próxima a la lígula y el ápice, estando ausente en la parte media de la hoja. La mayor interferencia nutricional obtenida fue Na+/K+ en las vainas de las hojas, con una relación iónica media de 0.45. El contenido de Ca2+ en todos los casos fue superior en las plantas que crecieron en el medio salino y su concentración aumentó desde la raíz hasta las hojas. Existió congruencia entre los análisis espectrofotométricos y lo observado por microscopía electrónica. Los resultados obtenidos permiten aumentar el conocimiento que se tiene de la variedad como fuente de resistencia al estrés salino.

  20. Two new examples of very short thallium-transition metal contacts

    DEFF Research Database (Denmark)

    Karanovic, Ljiljana; Poleti, Dejan; Balic Zunic, Tonci

    2008-01-01

    Two new sulphosalts Tl3Ag3Sb2S6, (1) and Tl(3)Ag(3)AS(2)S(6), (2) were prepared in reaction of synthetic binary sulfides: argentite (Ag2S), carlinite (Tl2S) and orpiment (As2O3) or stibnite (Sb2S3), and their crystal structures have been determined using single-crystal data. The compounds are iso....... It is also pointed out that if only valence shell electrons are considered (Tl-Ag)(2+) group is isoelectronic with the (Hg-Hg)(2+) ion, therefore new examples of short Tl-Ag contacts could be expected. (C) 2007 Elsevier B.V. All rights reserved....