WorldWideScience

Sample records for thallium 196

  1. Extracorporeal treatment for thallium poisoning

    DEFF Research Database (Denmark)

    Ghannoum, Marc; Nolin, Thomas D; Goldfarb, David S

    2012-01-01

    The EXtracorporeal TReatments In Poisoning (EXTRIP) workgroup was formed to provide recommendations on the use of extracorporeal treatment (ECTR) in poisoning. To test and validate its methods, the workgroup reviewed data for thallium (Tl)....

  2. Usefulness of Thallium Scan for Differential Diagnosis of Breast Mass

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Sang Kyun; Yum, Ha Yong; Lee, Chung Han; Choi, Kyung Hyun [Kosin University College of Medicine, Pusan (Korea, Republic of)

    1994-07-15

    The purpose of this study is to evaluate thallium scanning as a potential test in differentiating malignant from benign lesions of breast. Thirty-one female patients underwent thallium scan of the breast. After intravenous injection of 74-111 MBq(2-3 mCi)of thallium-201, anterior and lateral images were obtained. We compared thallium scans with pathological results. Of 11 patients with breast cancers, 10 cases (90.9%) were detected using thallium scan. Thallium scan obtained in one patient who had breast cancer but received several cycles of chemotherapy did not show thallium uptake. The smallest detectable cancer was 1.5 cm in diameter. In contrast, there is no thallium accumulation in breasts of 17 of 20 patients with benign disease (85%), Three cases of 13 fibrocystic disease show thallium uptake in their breast. In conclusion, thallium scan is an effective test in differentiating benign from malignant lesion.

  3. Thallium contamination of water in Canada

    Energy Technology Data Exchange (ETDEWEB)

    Cheam, V. [National Water Research Institute Branch, Burlington, ON (Canada). Aquatic Ecosystems Protection Research Branch

    2001-07-01

    A highly sensitive instrument, a Laser-Excited Atomic Fluorescence Spectrometer, has been developed to study thallium contamination in some important Canadian ecosystems from the Arctic (containing very low thallium concentration) to coal-related industries across Canada and even to the study of thallium toxicity in an invertebrate, Hyalella azteca. Overall, the data indicate that the coal power plants and mines contain higher thallium concentrations than the other ecosystems studied, and the eastern region has the highest Tl concentrations compared to other regions. The range of thallium concentration in ng/L for the Arctic snow and ice was between not detected and 8.4, for the Great Lakes waters 0.9 to 48, for pore waters 0.1 to 213, for western coal power plants and mines 0.1 to 1326, for central coal power plants 1.2 to 175, for eastern coal power plants and mines 0.2 to 23605, and for miscellaneous sites across Canada not detected to 4390 ng/L. Some of these high concentrations and those high ones reported in industrial wastewaters exceeded the chronic toxicity endpoints for Hyalella azteca mortality, growth and reproduction, and thus can cause serious distress to the environment. All data were integrated into a map of thallium distribution, the first one in Canada. Natural background level of thallium for the Arctic was estimated to be 0.02 to 0.03 pg/g.

  4. IRIS Toxicological Review of Thallium and Compounds ...

    Science.gov (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certain tumors. EPA's assessment of noncancer health effects and carcinogenic potential of thallium compounds was last prepared and added to the IRIS database between 1988 and 1990. The IRIS program is preparing an assessment that will incorporate current health effects information available for thallium and compounds, and current risk assessment methods. The IRIS assessment for thallium compounds will consist of a Toxicological Review and IRIS Summary. The Toxicological Review is a critical review of the physiochemical and toxicokinetic properties of a chemical, and its toxicity in humans and experimental systems. The assessment will present reference values for the noncancer effects of thallium compounds (RfD and Rfc), and a cancer assessment. The Toxicological Review and IRIS Summary have been subject to Agency review, Interagency review, and external scientific peer review. The final product will reflect the Agency opinion on the overall toxicity of thallium and compounds. EPA is undertaking an Integrated Risk Information System (IRIS) health assessment for thallium and compounds. IRIS is an EPA database containing Agency scientific positions on potential adverse human health effec

  5. Repeat thallium-201 SPECT in cerebral lymphoma.

    Science.gov (United States)

    Borggreve, F; Dierckx, R A; Crols, R; Mathijs, R; Appel, B; Vandevivere, J; Mariën, P; Martin, J J; De Deyn, P P

    1993-01-01

    The authors report on the contribution of Thallium-201 brain SPECT in the diagnosis and follow-up of a non-immunosuppressed patient, presenting with primary cerebral lymphoma. The tumoral process was at first not diagnosed on CT-scan, but Thallium-201 SPECT suggested a tumoral invasion. During corticosteroid treatment the tumor volume on CT-scan decreased, while on Thallium-201 SPECT there was an enhancement of the accumulation and an increasing tumor to non-tumor ratio. These scintigraphical findings more closely reflected the clinical course and the postmortem results.

  6. Thallium poisoning from maliciously contaminated food.

    Science.gov (United States)

    Meggs, W J; Hoffman, R S; Shih, R D; Weisman, R S; Goldfrank, L R

    1994-01-01

    Four young adults presented two days after one of them had received marzipan balls packaged in a box from an expensive candy manufacturer. Two ate one candy ball, while two others shared a third. The next day, variable gastrointestinal symptoms developed. On the third day, two patients developed painful paresthesiae of the hands and feet, an early but nonspecific clinical marker of thallium poisoning. A tentative diagnosis of thallium poisoning was made based on symptoms, and treatment was initiated. The remaining candies were radiographed. Metallic densities in the candies supported the diagnosis, and atomic absorption spectroscopy was used to quantitate thallium content. Each candy contained a potentially fatal dose. Five to seven days later, hypertension and tachycardia developed in the two patients who had ingested an entire candy. All patients developed alopecia but recovered without overt neurologic or other sequelae. While the diagnosis of thallium poisoning is often delayed until alopecia develops, an early diagnosis favors an effective treatment strategy.

  7. Thallium in mineral resources extracted in Poland

    Directory of Open Access Journals (Sweden)

    Bojakowska I.

    2013-04-01

    Full Text Available Thallium concentrations in primary mineral commodities extracted in Poland and processed in high temperatures were determined by ICP-MS method. Samples of hard and brown coal, copper-silver and zinclead ores, argillaceous and calcareous rocks of different genesis and age were analyzed. The highest thallium concentrations occur in the zinc-lead ores, the average content being of 52.1 mg/kg. The copper ores contain in average 1.4 mg/kg of thallium. Hard coals from the Upper Silesian Coal Basin display higher thallium content than those exploited in the Lublin Coal Basin. Brown coals from Turow deposit distinguish by much higher values, 0.7 mg/kg Tl, than those from huge Bełchatów and smaller Konin-Turek region deposits. Average thallium concentrations in clays used for ceramic materials are lower than 1 mg/kg, except of Mio-Pliocene Slowiany deposit. The average content of thallium in the studied limestone and dolomite raw materials for cement, lime, and metallurgical flux, and refractories is very low in comparison to the average amounts in the world carbonate rocks.

  8. Examining of Thallium in Cigarette Smokers.

    Science.gov (United States)

    Ghaderi, Amir; NasehGhafoori, Payam; Rasouli-Azad, Morad; Sehat, Mojtaba; Mehrzad, Fateme; Nekuei, Mina; Aaseth, Jan; Banafshe, Hamid Reza; Mehrpour, Omid

    2017-08-01

    Smoking is one of the sources of thallium which is considered as a toxic heavy metal. The aim of this study was to determine urinary thallium levels and related variables in smokers, compared to a control group. The study was conducted on 56 participants who had smoked continuously during the year before they were referred to Kashan Smoking Cessation Clinic. Fifty-three nonsmokers who were family members or friends of the smokers were selected as the control group. Urinary thallium was measured in both groups (n = 109) using atomic absorption spectrophotometry. The mean value (with SD) for urinary thallium in the smokers (10.16 ± 1.82 μg/L) was significantly higher than in the control group (2.39 ± 0.63 μg/L). There was a significant relationship between smoking duration and urinary thallium levels (P = 0.003). In a subgroup of smokers who was addicted to opium and opium residues (n = 9), the mean level of thallium (37.5 ± 13.09 μg/L) was significantly higher than in the other smokers (4.93 ± 4.45; P = 0.001). Multiple regression analysis showed opioid abuse, insomnia, and chronic obstructive pulmonary disease (COPD), together were strong predictors of urinary thallium levels in smokers. There was no significant difference in thallium level in hookah smokers (P = 0.299) or in those with COPD compared to other smokers (P = 0.375). Urinary thallium levels of smokers with clinical signs of depression, sleep disorders, memory loss, and sweating were higher than those of smokers without these signs. Since thallium, as other toxic metals is accumulated in the body, and cigarette smoking also involves carcinogenic exposures and health hazards for passively exposed people, the need for cigarette control policies is emphasized.

  9. Thallium-201 scintigraphy in unstable angina pectoris

    Energy Technology Data Exchange (ETDEWEB)

    Wackers, F.J.T.; Lie, K.I.; Liem, K.L.; Sokole, E.B.; Samson, G.; Van Der Schoot, J.B.; Durrer, D.

    1978-04-01

    Thallium-201 scintigraphy was performed during the pain free period in 98 patients with unstable angina. Scintiscans were positive in 39 patients, questionable in 27 patients and normal in 32 patients. Eighty-one patients responded favorably to treatment (group I). Seventeen patients had complicated courses (group II) and despite maximal treatment with propranolol either developed infarction (six patients) or continued to have angina necessitating coronary surgery (11 patients). In group I during the pain free period 26 of 81 patients had positive thallium-201 scans, whereas 20 patients had an abnormal ECG at that time; during angina 18 patients had transient ECG changes. In group II during the pain free period 13 of 17 patients had positive scans, whereas two patients had abnormal ECG at that time; during angina 12 patients showed transient ECG changes. The sensitivity to recognize group II was 76% for thallium-201 scintigraphy, 11% for ECG during the pain free period; 70% for ECG during angina; 94% for the combination of either positive scans or abnormal ECG. Thus, positive thallium-201 scans occur in patients with unstable angina, positive scans can be obtained during the pain free period, thallium-201 scans are more frequently positive in patients with complicated course.

  10. Thallium-201 uptake in a benign thymoma

    Energy Technology Data Exchange (ETDEWEB)

    Campeau, R.J.; Ey, E.H.; Varma, D.G.

    1986-07-01

    A 68-year-old woman was admitted with atypical angina. A chest radiograph showed an anterior mediastinal mass that was confirmed on CT. The mass was relatively avascular and separate from the heart and great vessels. She underwent stress thallium testing that demonstrated no exercise-induced ischemia; however, an abnormal focus of thallium activity was present in the anterior mediastinum on stress and redistribution images. Cardiac catheterization demonstrated a normal left ventriculogram, coronary arteries and thoracic aorta. Subsequent surgery and pathologic examination revealed the mass to be a benign thymoma arising in the right lobe of the thymus gland.

  11. Endogenous thiols enhance thallium toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Montes, Sergio; Rios, Camilo [Instituto Nacional de Neurologia y Neurocirugia, ' ' Manuel Velasco Suarez' ' , Departamento de Neuroquimica, Mexico, D.F (Mexico); Soriano, Luz; Monroy-Noyola, Antonio [Universidad Autonoma del Estado de Morelos, Laboratorio de Neuroproteccion, Facultad de Farmacia, Cuernavaca, Morelos (Mexico)

    2007-10-15

    Either L-methionine (L-met) or L-cysteine (L-cys), given alone and in combination with Prussian blue (PB) was characterized as treatment against acute thallium (Tl) toxicity in rats. Animals were intoxicated with 32 mg/kg Tl acetate corresponding to rat LD{sub 50}. Antidotal treatments were administered during 4 days, as follows: (1) vehicle, (2) L-met 100 mg/kg i.p. twice a day, (3) L-cys 100 mg/kg i.p. twice a day, (4) PB 50 mg/kg oral, twice a day, (5) L-met + PB and (6) L-cys + PB. Mortality was as follows: control 50%; L-met 80%; L-cys 80%; PB 20%; L-met + PB 90% and L-cys + PB 100%. In a different experiment, using 16 mg/kg of Tl, tissue levels of this metal were analyzed. PB treatment statistically diminished Tl content in body organs and brain regions (P < 0.01). Whereas, separate treatments of L-met and L-cys failed to decrease Tl content in organs and brain regions; while its administration in combination with PB (L-met + PB and L-cys + PB groups) lowered Tl levels in body organs in the same extent as PB group. Results indicate that L-met and L-cys administered alone or in combination with PB should not be considered suitable treatments against acute Tl toxic effects because this strategy failed to prevent mortality and Tl accumulation in brain. (orig.)

  12. Thallium in fractions of soil formed on floodplain terraces.

    Science.gov (United States)

    Jakubowska, Monika; Pasieczna, Anna; Zembrzuski, Wlodzimierz; Swit, Zbigniew; Lukaszewski, Zenon

    2007-01-01

    Two soils formed on the floodplain terrace of a rivulet flowing through the zinc-lead ore exploration area polluted with thallium and one soil from a floodplain terrace of the reference area were investigated in terms of thallium distribution between soil fractions. Such type of soil is formed on river floodplain terraces next to the main river channel and its composition records the history of river pollution. A sequential extraction of soil according to the BCR protocol was performed with an additional initial stage of extraction with water. Apart from labile thallium, thallium entrapped in the residual parent matter was also determined. Thallium was determined by flow-injection differential-pulse anodic stripping voltammetry. In all three cases, the major fraction is thallium entrapped in parent matter. Top soil from the polluted area contains 49.3% thallium entrapped in the residual parent matter, the bottom soil contains 41% while the reference soil contains 80% in this fraction. The major part of labile thallium is located in the reducible fraction (27.7% of total thallium in the top soil, 27% in the bottom soil and 12.4% of the reference soil). Second in terms of significance is the fraction of oxidizable thallium. The top soil contains 12% of total thallium concentration, the bottom soil contains 19% of total concentration, while the reference soil contains 4.1% of total concentration. The acid soluble/exchangeable fraction of thallium has almost the same significance as the oxidizable fraction. The top soil contains 10.4% of the total concentration, while the bottom soil contains 12% of the total concentration. Water soluble thallium concentration is very small. Comparison of the top and the bottom soil show that thallium has not been transported from the river channel onto the floodplain terrace over a long period.

  13. Characteristics of photoconductivity in thallium monosulfide single ...

    Indian Academy of Sciences (India)

    journal of. March 2007 physics pp. 467–479. Characteristics of photoconductivity in thallium monosulfide single crystals. I M ASHRAF, H A ELSHAIKH and A M BADR. Physics Department ... pendencies of carrier lifetime on light intensity, applied voltage and temperature are also ..... 14, 797 (1935) (in Japanese). [10] A T ...

  14. Extraction separation of thallium (III) from thallium (I) with n-octylaniline.

    Science.gov (United States)

    Shilimkar, Tulshidas N; Anuse, Mansing A; Patil, Kesharsingh J

    2002-01-01

    A novel method is developed for the extraction separation of thallium(III) from salicylate medium with n-octylaniline dissolved in toluene as an extractant. The optimum conditions have been determined by making a critical study of weak acid concentration, extractant concentration, period of equilibration and effect of solvent on the equilibria. The thallium (III) from the pregnant organic phase is stripped with acetate buffer solution (pH 4.7) and determined complexometrically with EDTA. The method affords the sequential separation of thallium(III) from thallium(I) and also commonly associated metal ions such as Al(III), Ga(III), In(III), Fe(III), Bi(III), Sb(III) and Pb(II). It is used for analysis of synthetic mixtures of associated metal ions and alloys. The method is highly selective, simple and reproducible. The reaction takes place at room temperature and requires 15-20 min for extraction and determination of thallium(III).

  15. Thallium bromide iodide crystal acoustic anisotropy examination.

    Science.gov (United States)

    Mantsevich, S N

    2017-03-01

    Thallium bromide iodide crystal also known as KRS-5 is the well known material used in far infrared radiation applications for optical windows and lenses fabrication. The main advantage of this material is the transparency in wide band of wavelengths from 0.53 to 50μm. Despite such advantages as transparency and large acousto-optic figure of merit values, KRS-5 is rarely used in acousto-optics. Nevertheless this material seems to be promising for far infrared acousto-optic applications. The acoustic and acousto-optic properties of KRS-5 needed for the full use in optoelectronics are not well understood to date. In this paper the detailed examination of thallium bromide iodide crystal acoustic properties is presented. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Thallium and its contents in Remata carbonate rocks

    Directory of Open Access Journals (Sweden)

    Kondelová Marcela

    1996-09-01

    Full Text Available The article presents at first the list of thallium own minerals and its isomorphic content in other minerals, especially in Slovakian ore deposits. This trace element was found in numerous dolomite-rock samples from Remata massif near Handlová. An interesting level of Tl content was analyzed in nonsilicified rocks; the highest content of Tl (and Ag are along the E – W line of disturbance. The presence of thallium in some limonitic aggregates in close Kremnica-gold deposit indicate any continuous relation. Some similarities to type gold deposits Carlin ( USA are discussed, even if no gold and discrete thallium phases were in Remata determined yet.

  17. 32 CFR 196.310 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Recruitment. 196.310 Section 196.310 National... Discrimination on the Basis of Sex in Admission and Recruitment Prohibited § 196.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 196.300 through 196.310 apply shall not discriminate on the...

  18. Tracing thallium contamination in soils using isotopes

    Science.gov (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Teper, Leslaw; Cabala, Jerzy; Rohovec, Jan; Penížek, Vít; Zádorová, Tereza; Pavlů, Lenka; Holubík, Ondřej; Drábek, Ondřej; Němeček, Karel; Houška, Jakub; Ash, Christopher

    2017-04-01

    We report the thallium (Tl) isotope record in moderately contaminated soils, which have been historically affected by emissions from coal-fired power plants. Our findings clearly demonstrate that Tl of anthropogenic (high-temperature) origin with light isotope composition was deposited onto the studied soils, where heavier Tl (ɛ205Tl -1) naturally occurs. The results show a positive linear relationship (R2 = 0.71) between 1/Tl and the isotope record, as determined for all the soils and bedrocks, also indicative of binary Tl mixing between two dominant reservoirs. We also identified significant Tl isotope variations within the products from coal combustion and thermo-desorption experiments with local Tl-rich coal pyrite. Bottom ash exhibited the heaviest Tl isotope composition (ɛ205Tl 0), followed by fly ash (ɛ205Tl between -2.5 and -2.8) and volatile Tl fractions (ɛ205Tl between -6.2 and -10.3), suggesting partial Tl isotope fractionations. Despite the evident role of soil processes in the isotope redistribution, we demonstrate that Tl contamination can be traced in soils, and propose that the isotope data represent a possible tool to aid our understanding of post-depositional Tl dynamics in surface environments for the future. This research was supported by the Czech Science Foundation (grant no. 14-01866S and 17-03211S).

  19. Catalytic properties of Thallium-containing mesoporous silicas

    Directory of Open Access Journals (Sweden)

    A. Baradji

    2017-02-01

    Full Text Available The benzylation of benzene by benzyl chloride over a series of Thallium-containing mesoporous silicas with different Tl contents has been investigated. These materials (Tl-HMS-n have been characterized by chemical analysis, N2 adsorption/desorption isotherm and X-ray diffraction (XRD. The mesoporous Thallium-containing materials showed both high activity and high selectivity for the benzylation of benzene. More interesting is the observation that these catalysts are always active and selective for large molecules like naphthenic compounds such as methoxynaphthalene.

  20. A comparison of the clinical relevance of thallium201 and ...

    African Journals Online (AJOL)

    Thallium-201 is at present the radiotracer of choice for the clinical evaluation of myocardial blood flow. Although different technetium-99m-isonitrile agents have been synthesised recently, only 99mTc-melhoxyisobutyl-isonitrile (99mTc_MIBI) has proved to hold promise for clinical implementation. The myocardial distribution ...

  1. Een bepalingsmethode voor thallium in regenwater met behulp van voltammetrie

    NARCIS (Netherlands)

    Struijs; J.; Wolfs; P.M.; Esseveld; F.G.van

    1985-01-01

    In dit rapport wordt een bepalingmethode beschreven voor thallium in het nanogram/liter-gebied, waarbij gebruik wordt gemaakt van differentiele pulse-anodic stripping voltammetry (DPASV) aan de dunne kwikfilm. Met deze techniek blijkt het mogelijk om de concentratie van dit element rechtstreeks

  2. IRIS Toxicological Review of Thallium and Compounds (External Review Draft)

    Science.gov (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certai...

  3. Band-Structure of Thallium by the LMTO Method

    DEFF Research Database (Denmark)

    Holtham, P. M.; Jan, J. P.; Skriver, Hans Lomholt

    1977-01-01

    The relativistic band structure of thallium has been calculated using the linear muffin-tin orbital (LMTO) method. The positions and extents of the bands were found to follow the Wigner-Seitz rule approximately, and the origin of the dispersion of the bands was established from the canonical s...

  4. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)

    A simple, rapid and selective complexometric method is proposed for the determination of thallium(III), using mercaptoethane(EtSH) as demasking agent. The sample solution containing Tl(III) is first complexed with excess EDTA and the surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using ...

  5. Selective Thallium (I Ion Sensor Based on Functionalised ZnO Nanorods

    Directory of Open Access Journals (Sweden)

    Z. H. Ibupoto

    2012-01-01

    Full Text Available Well controlled in length and highly aligned ZnO nanorods were grown on the gold-coated glass substrate by hydrothermal growth method. ZnO nanorods were functionalised with selective thallium (I ion ionophore dibenzyldiaza-18-crown-6 (DBzDA18C6. The thallium ion sensor showed wide linear potentiometric response to thallium (I ion concentrations ( M to  M with high sensitivity of 36.87 ± 1.49 mV/decade. Moreover, thallium (I ion demonstrated fast response time of less than 5 s, high selectivity, reproducibility, storage stability, and negligible response to common interferents. The proposed thallium (I ion-sensor electrode was also used as an indicator electrode in the potentiometric titration, and it has shown good stoichiometric response for the determination of thallium (I ion.

  6. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)

    NJD

    2005-10-08

    Oct 8, 2005 ... surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using xylenol orange as indicator. ... Reproducible and accurate results are obtained in the concentration range 4–80 mg of thallium with a relative error ≤ ±0.6% .... soluble and stable 1:1 complex with Tl(I) so formed.22 This was.

  7. Thallium in the hydrosphere of south west England

    Energy Technology Data Exchange (ETDEWEB)

    Law, Sin [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom); Turner, Andrew, E-mail: aturner@plymouth.ac.uk [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom)

    2011-12-15

    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L{sup -1}) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L{sup -1} were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration ({approx}1400 ng L{sup -1}) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. - Highlights: > Thallium concentrations have been measured in natural and waste waters from south west England. > Dissolved concentrations spanned three orders of magnitude and were highest in water from an abandoned mine. > Inputs associated with historical metal mine workings are the most important to the regional hydrosphere. - Concentrations of dissolved thallium in waters of south west England span two orders of magnitude and are greatest in water from an abandoned mine.

  8. 32 CFR 196.405 - Housing.

    Science.gov (United States)

    2010-07-01

    ... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196.405 Housing. (a... 32 National Defense 2 2010-07-01 2010-07-01 false Housing. 196.405 Section 196.405 National... different fees or requirements, or offer different services or benefits related to housing, except as...

  9. 46 CFR 196.34-10 - Use.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Use. 196.34-10 Section 196.34-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Work Vests § 196.34-10 Use. (a) Approved buoyant work vests are considered to be items of safety apparel and may be carried...

  10. 21 CFR 211.196 - Distribution records.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Distribution records. 211.196 Section 211.196 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR FINISHED PHARMACEUTICALS Records and Reports § 211.196...

  11. 46 CFR 196.15-10 - Sanitation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Sanitation. 196.15-10 Section 196.15-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Test, Drills, and Inspections § 196.15-10 Sanitation. (a) It shall be the duty of the master and chief engineer...

  12. 22 CFR 196.4 - Administering office.

    Science.gov (United States)

    2010-04-01

    ... AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.4 Administering office. The Department of State.... Pickering Foreign Affairs/Graduate Foreign Affairs Fellowship Program and grants to post-secondary... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Administering office. 196.4 Section 196.4...

  13. 32 CFR 196.500 - Employment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Employment. 196.500 Section 196.500 National... Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 196.500 Employment. (a) General. (1) No person shall, on the basis of sex, be excluded from participation in, be...

  14. Sodium dithionite as a selective demasking agent for the complexometric determination of thallium

    Directory of Open Access Journals (Sweden)

    PRAKASH SHETTY

    2005-11-01

    Full Text Available Sodium dithionite is proposed as a new demasking agent for the rapid and selective complexometric determination of thallium(III. In the presence of diverse metal ions, thallium (III was first complexed with excess EDTA and the surplus EDTAwas then titrated with a standard zinc sulphate solution at pH 5–6 (hexamine buffer using Xylenol Orange as the indicator. The EDTAequivalent to thallium was then released selectively with sodium dithionite and back titrated with a standard zinc sulphate solution as before. Reproducible and accurate results were obtained in the range 4–100 mg of thallium with a relative error of ±27 % and a coefficient of variation (n = 6 of not more than 0.30 %. The effects of various diverse ions were studied. The method was applied to the determination of thallium in its complexes and in alloys.

  15. Dicty_cDB: AHB196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available library) AHB196 (Link to dictyBase) - - - - AHB196P (Link to Original site) AHB196F 192 AHB196Z 564 AHB196P...AHB196P 736 - - Show AHB196 Library AH (Link to library) Clone ID AHB196 (Link to dictyBase) Atlas ID - NBRP...biol.tsukuba.ac.jp/CSM/AH/AHB1-D/AHB196Q.Seq.d/ Representative seq. ID AHB196P (Link to Original site)...site) Representative DNA sequence >AHB196 (AHB196Q) /CSM/AH/AHB1-D/AHB196Q.Seq.d/ ATGATTATTATAATTCAAATTA...vacuolar >> prediction for AHB196 is cyt 5' end seq. ID AHB196F 5' end seq. >AHB196F.Seq ATGATTATTATAATT

  16. [Efficiency of hemoperfusion on clearing thallium based on atomic absorption spectrometry].

    Science.gov (United States)

    Tian, Tian; Wang, Yongan; Nie, Zhiyong; Wang, Jiao; Peng, Xiaobo; Yuan, Ye; Li, Wanhua; Qiu, Zewu; Xue, Yanping; Xiong, Yiru

    2015-04-01

    To determine thallium in whole blood by atomic absorption detection method, and to investigate the eliminating effect of hemoperfusion (HP) for thallium in blood. The blood of Beagle dogs which had not exposed to thallium before were obtained for preparation of thallium nitrate ( TlNO3 )-containing solution in three concentrations according to the conversion formula based on animal weight and volume of blood. HP was performed in the simulated in vivo environment. The content of TlNO3 in blood of the next group was determined on the amount of TlNO3 for the last HP of the former dose group. Thallium quantity in different samples was measured with atomic absorption spectrometer blood samples before and after HP. Finally, the thallium concentration in blood was analyzed statistically. Thallium concentrations showed a good linear relationship in the range of 0-200 μg/L (r = 0.998 4). The intra-day precision (RSD) was lower than 4.913%, the intra-day recovery rate was 96.2%-111.9%; the inter-day precision (RSD) was lower than 7.502%, the inter-day recovery rate was 89.6%-105.2%. The concentration of thallium in blood was significantly reduced after HP per time in high, middle, and low dose groups [(453.43 ± 27.80) mg/L to (56.09 ± 14.44) mg/L in high dose group, F = 8.820, P = 0.003; (64.51 ± 13.60) mg/L to (3.19 ± 0.23) mg/L in middle dose group, F = 36.312, P = 0.000; (5.40 ± 0.98) mg/L to (0.38 ± 0.25) mg/L in low dose group, F = 46.240, P = 0.000 ]. The adsorption rate of four times of HP in high, middle and low dose group were (87.63 ± 2.48 )%, (95.06 ± 1.54 )% and (92.76 ± 4.87)%, respectively, without significant difference (F = 4.231, P = 0.070). The method for measuring thallium was established, and it shows a very stable, simple, sensitive for determination of thallium. HP can effectively remove thallium from blood. Thallium concentration can be reduced by 90% after four times of HP. HP is also effective even when thallium concentration is not high.

  17. Left ventricular dilatation and pulmonary thallium uptake after single-photon emission computer tomography using thallium-201 during adenosine-induced coronary hyperemia

    Energy Technology Data Exchange (ETDEWEB)

    Iskandrian, A.S.; Heo, J.; Nguyen, T.; Lyons, E.; Paugh, E. (Philadelphia Heart Institute, PA (USA))

    1990-10-01

    This study examined the implications of left ventricular (LV) dilatation and increased pulmonary thallium uptake during adenosine-induced coronary hyperemia. The lung-to-heart thallium ratio in the initial images was significantly higher in patients with coronary artery disease (CAD) than normal subjects; 0.48 +/- 0.16 in 3-vessel disease (n = 16), 0.43 +/- 0.10 in 2-vessel disease (n = 20), 0.43 +/- 0.08 in 1-vessel disease (n = 16) and 0.36 +/- 0.05 in normal subjects (n = 7) (p less than 0.001, 0.09 and 0.06, respectively). There was a significant correlation between the severity and the extent of the perfusion abnormality (determined from the polar maps) and the lung-to-heart thallium ratio (r = 0.51 and 0.52, respectively, p less than 0.0002). There was also a significant correlation between lung thallium washout and lung-to-heart thallium ratio (r = 0.42, p = 0.0009) and peak heart rate (r = -0.49, p less than 0.0001). The LV dilatation was mostly due to an increase in cavity dimension (30% increase) and to a lesser extent (6% increase) due to increase in LV size. (The cavity dimensions were measured from the short-axis slices at the midventricular level in the initial and delayed images). The dilation was seen in patients with CAD but not in the normal subjects. These changes correlated with the extent and severity of the thallium perfusion abnormality. Thus, adenosine-induced coronary hyperemia may cause LV dilation and increased lung thallium uptake on the basis of subendocardial ischemia.

  18. 32 CFR 196.510 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Recruitment. 196.510 Section 196.510 National... Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees. Where a recipient has been found to be presently...

  19. 32 CFR 196.540 - Advertising.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Advertising. 196.540 Section 196.540 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS... Advertising. A recipient shall not in any advertising related to employment indicate preference, limitation...

  20. 32 CFR 196.525 - Fringe benefits.

    Science.gov (United States)

    2010-07-01

    ... FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 196.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX... employment not subject to the provision of § 196.515. (b) Prohibitions. A recipient shall not: (1...

  1. Early detection of restenosis after successful percutaneous transluminal coronary angioplasty by exercise-redistribution Thallium scintigraphy

    NARCIS (Netherlands)

    W. Wijns (William); P.W.J.C. Serruys (Patrick); J.H.C. Reiber (Johan); P.J. de Feyter (Pim); M.J.B.M. van den Brand (Marcel); M.L. Simoons (Maarten); P.G. Hugenholtz (Paul)

    1985-01-01

    textabstractThe value of exercise testing and thallium scintigraphy in predicting recurrence of angina pectoris and restenosis after a primary successful transluminal coronary angioplasty (PTCA) was prospectively evaluated. In 89 patients, a symptom-limited exercise electrocardiogram (ECG) and

  2. Oral zinc sulphate in treatment of patients with thallium poisoning: A clinical therapeutic trial

    Directory of Open Access Journals (Sweden)

    Ahmed A. Al-Mohammadi

    2011-06-01

    Full Text Available Thallium poisoning is usually associated with typical dermatological features simulating that of zinc deficiency. The aim of this study was to evaluate the role of oral zinc sulphate in the treatment of patients with thallium poisoning.Materials and methods: This clinical therapeutic trial study was conducted in Departments of Dermatology of Baghdad and Basrah Teaching Hospitals from February 2008 - February 2010, where a total of 37 patients with thallium poisoning were enrolled.A detailed history was taken from all patients and complete clinical examination was performed. All patients received zinc sulphate in a dose of 5 mg/kg three times a day few days before confirming the diagnosis of thallium poisoning. Thallium in urine had been measured using the colorimetric method and was positive in all patients. After confirming the diagnosis of thallium poisoning, thallium antidotes Prussian blue was given to 32 patients.Results: Age range of 37 patients was 5-33 (24±5.3 years. The dermatological findings were mainly: anagen hair loss affected the scalp and limbs. Also, dusky ecchymotic red dermatitis like rash was observed on the face and dorsum of hands and legs, while neurological manifestations were mainly of peripheral neuropathy, were reported in 21 (55% patients. All patients but two responded promptly to a trial of zinc sulphate within few days.Conclusion: Oral Zinc sulphate appears to be an effective and safe treatment for thallium poisoning particularly for skin and hair features and in reducing its lethal progression and complications. J Clin Exp Invest 2011;2(2:133-7

  3. Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices

    Science.gov (United States)

    2014-02-01

    THALLIUM(I) IN REVERSE OSMOSIS AND CHLORINATED WATER MATRICES ECBC-TR-1127 Approved for public release; distribution is unlimited...3. DATES COVERED (From - To) Apr 2010 - Dec 2011 4. TITLE AND SUBTITLE Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices... osmosis (RO) and RO water with added chlorine (RO-Cl) was measured using inductively coupled plasma optical emission spectroscopy (ICP-OES) for a period of

  4. Thallium in the hydrosphere of south west England.

    Science.gov (United States)

    Law, Sin; Turner, Andrew

    2011-12-01

    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L(-1)) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L(-1) were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration (~1400 ng L(-1)) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Qualitative evaluation of coronary flow during anesthetic induction using thallium-201 perfusion scans

    Energy Technology Data Exchange (ETDEWEB)

    Kleinman, B.; Henkin, R.E.; Glisson, S.N.; el-Etr, A.A.; Bakhos, M.; Sullivan, H.J.; Montoya, A.; Pifarre, R.

    1986-02-01

    Qualitative distribution of coronary flow using thallium-201 perfusion scans immediately postintubation was studied in 22 patients scheduled for elective coronary artery bypass surgery. Ten patients received a thiopental (4 mg/kg) and halothane induction. Twelve patients received a fentanyl (100 micrograms/kg) induction. Baseline thallium-201 perfusion scans were performed 24 h prior to surgery. These scans were compared with the scans performed postintubation. A thallium-positive scan was accepted as evidence of relative hypoperfusion. Baseline hemodynamic and ECG data were obtained prior to induction of anesthesia. These data were compared with the data obtained postintubation. Ten patients developed postintubation thallium-perfusion scan defects (thallium-positive scan), even though there was no statistical difference between their baseline hemodynamics and hemodynamics at the time of intubation. There was no difference in the incidence of thallium-positive scans between those patients anesthetized by fentanyl and those patients anesthetized with thiopental-halothane. The authors conclude that relative hypoperfusion, and possibly ischemia, occurred in 45% of patients studied, despite stable hemodynamics, and that the incidence of these events was the same with two different anesthetic techniques.

  6. Dicty_cDB: CFD196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFD196 (Link to dictyBase) - - - Contig-U15664-1 CFD196Z (Link... to Original site) - - CFD196Z 567 - - - - Show CFD196 Library CF (Link to library) Clone ID CFD196 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/CF/CFD1-D/CFD196Q.Seq.d/ Representative seq. ID CFD19...6Z (Link to Original site) Representative DNA sequence >CFD196 (CFD196Q) /CSM/CF/CFD1-D/CFD196Q.Seq.d/ XXXXX...lenkv Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CFD196 (CFD196Q) /CSM/CF/CFD1-D/CFD

  7. Comparison of thallium deposition with segmental perfusion in pigs with chronic hibernating myocardium.

    Science.gov (United States)

    Baldwa, Sunil; Rana, Muzamil; Canty, John M; Fallavollita, James A

    2008-12-01

    Viable, chronically dysfunctional myocardium with reduced resting flow (or hibernating myocardium) is an important prognostic factor in ischemic heart disease. Although thallium-201 imaging is frequently used to assess myocardial viability in patients with ischemic cardiomyopathy, there are limited data regarding its deposition in hibernating myocardium, and this data suggest that thallium retention may be supernormal compared with control myocardium. Accordingly, pigs (n=7) were chronically instrumented with a 1.5 mm Delrin stenosis on the proximal left anterior descending coronary artery (LAD) to produce hibernating myocardium. Four months later, severe anteroapical hypokinesis was documented with contrast ventriculography (wall motion score, 0.7+/-0.8; normal=3), and microsphere measurements confirmed reduced resting flow (LAD subendocardium, 0.78+/-0.34 vs. 0.96+/-0.24 ml.min(-1).g(-1) in remote; P<0.001). Absolute deposition of thallium-201 and insulin-stimulated [18F]-2 fluoro-2-deoxyglucose (FDG) were assessed over 1 h and compared with resting flow (n=704 samples). Thallium-201 deposition was only weakly correlated with perfusion (r2=0.20; P<0.001) and was more homogeneously distributed (relative dispersion, 0.12+/-0.03 vs. 0.29+/-0.10 for microsphere flow; P<0.01). Thus after 1 h relative thallium-201 (subendocardium LAD/remote, 0.96+/-0.16) overestimated relative perfusion (0.78+/-0.32; P<0.0001) and underestimated the relative reduction in flow. Viability was confirmed by both histology and preserved FDG uptake. We conclude that under resting conditions, thallium-201 redistribution in hibernating myocardium is nearly complete within 1 h, with similar deposition to remote myocardium despite regional differences in flow. These data suggest that in this time frame thallium-201 deposition may not discriminate hibernating myocardium from dysfunction myocardium with normal resting flow. Since hibernating myocardium has been associated with a worse prognosis

  8. Dicty_cDB: CHF196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF196 (Link to dictyBase) - G01653 DDB0214909 Contig-U10711-1 CHF...196P (Link to Original site) CHF196F 627 CHF196Z 748 CHF196P 1355 - - Show CHF196 Library CH (Link to library) Clone ID CHF...Contig-U10711-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-D/CHF...196Q.Seq.d/ Representative seq. ID CHF196P (Link to Original site) Representative DNA sequence >CHF196 (CHF196Q) /CSM/CH/CHF...1-D/CHF196Q.Seq.d/ ATAATTAAACAACTCCTCTCATACGACAAATATATAAATATAGATACATAATAGTAATAA TAATAAT

  9. Thallium uptake and biological behaviour in childhood brain tumours

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, E.J.; Howman-Giles, R.; Kellie, S.; Uren, R.F. [Royal Alexandra Hospital for Children, Sydney, NSW (Australia)

    1998-03-01

    Full text: The histopathological grade and radiological appearance of the diverse cerebral neoplasms in childhood frequently poorly reflect their biological behaviour. We examined thallium accumulation prior to treatment (and in several cases, at intervals there after) in 13 children to determine its usefulness as a tumour marker. 23 SPECT studies were acquired 20 minutes after the injection of 1-3 mCi of {sup 201}TI. Thallium index (TI), the ratio of counts in tumour/normal brain, was calculated. No uptake was seen in two patients (pts) with a Grade 1 cerebellar astrocytomas (disease free at 4/12 f/u). Three pts with medulloblastomas were studied. One pt showed intense uptake (Tl =12). His tumour (proliferative antigen stain Ki67 = 50%) recurred early after debulking surgery (Tl +ve prior to CT or MRI changes). The second pt was imaged at relapse (Ki67 = 60%) and showed intense uptake, Tl = 17. The third pt showed lower level uptake (Tl = 2), Ki67 = 5%, and is disease-free at 5/12 (as per {sup 201}TI and MRI). One pt with a Grade 1 brainstem glioma showed Tl = 5 and has progressed rapidly despite low grade histology. Four pts with chiasmatic-hypothalamic gliomas have been studied. Although these neoplasms are usually low grade histologically, their growth properties vary greatly. Two pts with Tl<2.5 have been conservatively managed because of slow tumour growth. The other two pts have Tl>3.5 and have required aggressive treatment for rapid disease progression. One pt with a large pilocytic astrocytoma of the optic chiasm showed Tl = 9.5. Active treatment was not undertaken. One pt with a pineal germ cell tumour showed avid {sup 201}TI uptake (Tl not performed) and has had two normal studies, and is clinically well, since BMT. Avid {sup 201}TI uptake also seen in one pt with cerebral neuroblastoma. (Died at 8/12 after Dx.) Thus, {sup 201}TI accumulates in histologically diverse paediatric neoplasms. The Tl appears to reflect biological behaviour in the limited

  10. Evaluation of muscular lesions in connective tissue diseases: thallium 201 muscular scans

    Energy Technology Data Exchange (ETDEWEB)

    Guillet, G.; Guillet, J.; Sanciaume, C.; Maleville, J.; Geniaux, M.; Morin, P.

    1988-04-01

    We performed thallium 201 muscle scans to assess muscular involvement in 40 patients with different connective tissue diseases (7 with dermatomyositis, 7 with systemic lupus erythematosus, 12 with progressive systemic scleroderma, 2 with calcinosis, Raynaud's phenomenon, esophageal involvement, sclerodactyly, and telangiectasia (CREST) syndrome, 3 with monomelic scleroderma, 6 with morphea, and 3 with Raynaud's disease). Only 12 of these patients complained of fatigability and/or myalgia. Electromyography was performed and serum levels of muscle enzymes were measured in all patients. Comparison of thallium 201 exercise recording with the other tests revealed that scan sensitivity is greater than electromyographic and serum muscle enzymes levels. Thallium 201 scans showed abnormal findings in 32 patients and revealed subclinical lesions in 18 patients, while electromyography findings were abnormal in 25 of these 32 patients. Serum enzyme levels were raised in only 8 patients. Thallium 201 scanning proved to be a useful guide for modifying therapy when laboratory data were conflicting. It was useful to evaluate treatment efficacy. Because our data indicate a 100% positive predictive value, we believe that thallium 201 scanning should be advised for severe systemic connective tissue diseases with discordant test results.

  11. Exercise-induced thallium-201 myocardial perfusion defects in angina pectoris without significant coronary artery stenosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakazato, Masayasu; Maruoka, Yuji; Sunagawa, Osahiko; Kinjo, Kunihiko; Tomori, Masayuki; Fukiyama, Koshiro (Ryukyu Univ., Nishihara, Okinawa (Japan). School of Medicine)

    1990-01-01

    We performed exercise thallium-201 myocardial scintigraphy in 32 patients with angina pectoris to study the incidence of perfusion defects, who had no significant organic stenosis on coronary angiography. None of them had myocardial infarction or cardiomyopathy. Thallium-201 myocardial scintigraphy and 12-lead ECG recording were performed during supine bicycle ergometer exercise. Perfusion defects in thallium-201 scintigrams in SPECT images were assessed during visual analysis by two observers. In the coronary angiograms obtained during intravenous infusion of nitroglycerin, the luminal diameter of 75% stenosis or less in the AHA classification was regarded as an insignificant organic stenosis. Myocardial perfusion defects in the thallium-201 scintigrams were detected in eight (25%) of the 32 patients. Six of these eight patients had variant angina documented during spontaneous attacks with ST elevations in standard 12-lead ECGs. Perfusion defects were demonstrated at the inferior or infero-posterior regions in six patients, one of whom had concomitant anteroseptal defect. The defects were not always accompanied by chest pain. All but one patient demonstrating inferior or inferoposterior defects showed ST depression in leads II, III and aV{sub F} on their ECGs, corresponding to inferior wall ischemia. The exception was a case with right bundle branch block. Thus, 25% of the patients with angina pectoris, who had no evidence of significant organic stenosis on their coronary angiograms, exhibited exercise-induced perfusion defects in their thallium-201 scintigrams. Coronary spasms might have caused myocardial ischemia in these patients. (author).

  12. Advanced crystal growth techniques for thallium bromide semiconductor radiation detectors

    Science.gov (United States)

    Datta, Amlan; Becla, Piotr; Guguschev, Christo; Motakef, Shariar

    2018-02-01

    Thallium Bromide (TlBr) is a promising room-temperature radiation detector candidate with excellent charge transport properties. Currently, Travelling Molten Zone (TMZ) technique is widely used for growth of semiconductor-grade TlBr crystals. However, there are several challenges associated with this type of crystal growth process including lower yield, high thermal stress, and low crystal uniformity. To overcome these shortcomings of the current technique, several different crystal growth techniques have been implemented in this study. These include: Vertical Bridgman (VB), Physical Vapor Transport (PVT), Edge-defined Film-fed Growth (EFG), and Czochralski Growth (Cz). Techniques based on melt pulling (EFG and Cz) were demonstrated for the first time for semiconductor grade TlBr material. The viability of each process along with the associated challenges for TlBr growth has been discussed. The purity of the TlBr crystals along with its crystalline and electronic properties were analyzed and correlated with the growth techniques. Uncorrected 662 keV energy resolutions around 2% were obtained from 5 mm x 5 mm x 10 mm TlBr devices with virtual Frisch-grid configuration.

  13. Thallium distribution in sediments from the Pearl river basin, China

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juan [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Jin; Chen, Yongheng [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Qi, Jianying [Department of Environmental Science and Engineering, Guangzhou University, Guangzhou (China); Lippold, Holger [Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Chunlin [Guangdong Provincial Academy of Environmental Science, Guangzhou (China)

    2010-10-15

    Thallium (Tl) is a rare element of high toxicity. Sediments sampled in three representative locations near industries utilizing Tl-containing raw materials from the Pearl River Basin, China were analyzed for their total Tl contents and the Tl contents in four sequentially extracted fractions (i.e., weak acid exchangeable, reducible, oxidizable, and residual fraction). The results reveal that the total Tl contents (1.25-19.1 {mu}g/g) in the studied sediments were slightly high to quite high compared with those in the Chinese background sediments. This indicates the apparent Tl contamination of the investigated sediments. However, with respect to the chemical fractions, Tl is mainly associated with the residual fraction (>60%) of the sediments, especially of those from the mining area of Tl-bearing pyrite minerals, indicating the relatively low mobility, and low bioavailability of Tl in these sediments. This obviously contrasts with the previous findings that Tl is mainly entrapped in the first three labile fractions of the contaminated samples. Possible reasons were given for the dominating association of Tl with the residual fraction (>95%) of the mining area sediments. The significant role of certain K-containing silicates or minerals of these sediments on retaining Tl in the residual fraction, discovered by this study, provides a special field of research opportunity for the Tl-containing wastewater treatment. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  14. [Graphite furnace atomic absorption spectrometry for determination of thallium in blood].

    Science.gov (United States)

    Zhang, Q L; Gao, G

    2016-04-20

    Colloidal palladium was used as chemical modifier in the determination of blood thallium by graphite furnace atomic absorption spectrometry. Blood samples were precipitated with 5% (V/V)nitric acid, and then determined by GFAAS with colloidal palladium used as a chemical modifier. 0.2% (W/V)sodium chloride was added in the standard series to improve the matrix matching between standard solution and sample. The detection limit was 0.2 μg/L. The correlation coefficient was 0.9991. The recoveries were between 93.9% to 101.5%.The relative standard deviations were between 1.8% to 2.7%.The certified reference material of whole blood thallium was determined and the result was within the reference range Conclusion: The method is accurate, simple and sensitive, and it can meet the needs of detection thallium in blood entirely.

  15. Myocardial perfusion defect on thallium-201 imaging in patients with chronic obstructive pulmonary disease

    Energy Technology Data Exchange (ETDEWEB)

    Mehrotra, P.P.; Weaver, Y.J.; Higginbotham, E.A.

    1983-08-01

    Six patients with angina pectoris had reversible perfusion defects on stress and redistribution thallium imaging. Three patients had a positive electrocardiographic response to exercise. No significant coronary artery lesions were seen on coronary arteriography in any of the six patients. All had mild to moderate hypoxemia at rest and physiologic evidence of chronic obstructive pulmonary disease as defined by the decrease in the ratio of forced expiratory volume at 1 second to forced vital capacity (FEV1/FVC X 100) or decrease in the forced midexpiratory flow rate (FEF25-75), or both. None had clinical findings suggestive of any of the reported causes of positive thallium scans in patients with normal coronary arteriograms. Cellular dysfunction produced by hypoxemia affecting the uptake of thallium seems to be the most likely mechanism of this abnormality.

  16. Early and delayed thallium-201 scintigraphy in thyroid nodules: the relationship between early thallium-201 uptake and perfusion

    Energy Technology Data Exchange (ETDEWEB)

    Derebek, E. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Biberoglu, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Kut, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yesil, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Saydam, S. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yilmaz, M. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yenici, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Igci, E. [Dept. of Radiology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Gokce, O. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Canda, S. [Dept. of Pathology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Bueyuekgebiz, A. [Dept. of Pediatrics, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Dogan, A.S. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Durak, H. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey)

    1996-05-01

    Seventy-six patients with tyroid nodules were studied. Initially, 75 MBq of thallium-201 was injected. The thyroid gland was imaged 15 min (early) and 3 h (delayed) after the injection. Thereafter, 185 MBq technetium-99m pertechnetate was injected. Immediately after the injection, a 1-min perfusion image was acquired, followed by an image at 20 min. Increased early and delayed {sup 201}Tl uptake compared with the contralateral thyroid tissue was adopted as the criterion for malignancy. Sensitivity, specificity and negative predictive values were found to be 85%, 64% and 78%, respectively, in operated patients, but these values were 86%, 87% and 95%, respectively, in the whole group, including patients followed with fine-needle aspiration biopsy. With the purpose of investigating the relationship between perfusion and early {sup 201}Tl uptake, bot perfusion and early images were graded comparing nodular activity with contralateral thyroid activity. There was a poor correlation between perfusion and {sup 201}Tl uptake. The correlation was even worse in hyperactive nodules. It is concluded that early and delayed {sup 201}Tl imaging should not be used in the differential diagnosis of cold nodules and that early {sup 201}Tl uptake seems to be more closely related to factors other than perfusion. (orig.)

  17. Overlapping toxic effect of long term thallium exposure on white mustard (Sinapis alba L.) photosynthetic activity.

    Science.gov (United States)

    Mazur, Radosław; Sadowska, Monika; Kowalewska, Łucja; Abratowska, Agnieszka; Kalaji, Hazem M; Mostowska, Agnieszka; Garstka, Maciej; Krasnodębska-Ostręga, Beata

    2016-09-02

    Heavy metal exposure affect plant productivity by interfering, directly and indirectly, with photosynthetic reactions. The toxic effect of heavy metals on photosynthetic reactions has been reported in wide-ranging studies, however there is paucity of data in the literature concerning thallium (Tl) toxicity. Thallium is ubiquitous natural trace element and is considered the most toxic of heavy metals; however, some plant species, such as white mustard (Sinapis alba L.) are able to accumulate thallium at very high concentrations. In this study we identified the main sites of the photosynthetic process inhibited either directly or indirectly by thallium, and elucidated possible detoxification mechanisms in S. alba. We studied the toxicity of thallium in white mustard (S. alba) growing plants and demonstrated that tolerance of plants to thallium (the root test) decreased with the increasing Tl(I) ions concentration in culture media. The root growth of plants exposed to Tl at 100 μg L(-1) for 4 weeks was similar to that in control plants, while in plants grown with Tl at 1,000 μg L(-1) root growth was strongly inhibited. In leaves, toxic effect became gradually visible in response to increasing concentration of Tl (100 - 1,000 μg L(-1)) with discoloration spreading around main vascular bundles of the leaf blade; whereas leaf margins remained green. Subsequent structural analyses using chlorophyll fluorescence, microscopy, and pigment and protein analysis have revealed different effects of varying Tl concentrations on leaf tissue. At lower concentration partial rearrangement of the photosynthetic complexes was observed without significant changes in the chloroplast structure and the pigment and protein levels. At higher concentrations, the decrease of PSI and PSII quantum yields and massive oxidation of pigments was observed in discolored leaf areas, which contained high amount of Tl. Substantial decline of the photosystem core proteins and disorder of the

  18. Stable room-temperature thallium bromide semiconductor radiation detectors

    Science.gov (United States)

    Datta, A.; Fiala, J.; Becla, P.; Motakef, Shariar

    2017-10-01

    Thallium bromide (TlBr) is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br- species, with an estimated electro-diffusion velocity of 10-8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br- ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation) for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  19. Thallium pollution in China: A geo-environmental perspective.

    Science.gov (United States)

    Xiao, Tangfu; Yang, Fei; Li, Shehong; Zheng, Baoshan; Ning, Zengping

    2012-04-01

    It is well known that thallium (Tl) is a non-essential and toxic metal to human health, but less is known about the geo-environmentally-induced Tl pollution and its associated health impacts. High concentrations of Tl that are primarily associated with the epithermal metallogenesis of sulfide minerals have the potential of producing Tl pollution in the environment, which has been recognized as an emerging pollutant in China. This paper aims to review the research progress in China on Tl pollution in terms of the source, mobility, transportation pathway, and health exposure of Tl and to address the environmental concerns on Tl pollution in a geo-environmental perspective. Tl associated with the epithermal metallogenesis of sulfide minerals has been documented to disperse readily and accumulate through the geo-environmental processes of soil enrichment, water transportation and food crop growth beyond a mineralized zone. The enrichments of Tl in local soil, water, and crops may result in Tl pollution and consequent adverse health effects, e.g. chronic Tl poisoning. Investigation of the baseline Tl in the geo-environment, proper land use and health-related environmental planning and regulation are critical to prevent the Tl pollution. Examination of the human urinary Tl concentration is a quick approach to identify exposure of Tl pollution to humans. The experiences of Tl pollution in China can provide important lessons for many other regions in the world with similar geo-environmental contexts because of the high mobility and toxicity of Tl. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Stable room-temperature thallium bromide semiconductor radiation detectors

    Directory of Open Access Journals (Sweden)

    A. Datta

    2017-10-01

    Full Text Available Thallium bromide (TlBr is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br− species, with an estimated electro-diffusion velocity of 10−8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br− ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  1. Medical geology of arsenic, selenium and thallium in China.

    Science.gov (United States)

    Li, Shehong; Xiao, Tangfu; Zheng, Baoshan

    2012-04-01

    Arsenic (As), selenium (Se) and thallium (Tl) are three trace metals (metalloids) of high concern in China because deficiency or excess expose can cause a range of endemic diseases, such as endemic arsenism, selenosis, Keshan disease (KD), Kashin-Beck disease (KBD) and thallotoxicosis. These specific endemic diseases were attributable for overabundance or deficiency (mainly referring to selenium) of these three elements in the local environment as a result of natural geochemical processes and/or anthropologic activities. The geochemistry and human health impacts of these three trace elements have been intensively studied since the 1970s in China, in terms of geochemical sources, distribution, transportation, health impact pathways, and prevention/remediation measures. Endemic arsenism in China are induced from the exposures of high As in either drinking water or domestic combustion of As-rich coals. Both endemic selenium deficiency and selenosis occurred in China. The KD and KBD were related to the deficiency of Se in the low-Se geological belt with Se contents in soil less than 0.125mg/kg stretching from northeast to southwest of China. Endemic selenosis occurred in areas with high Se concentrations in soils derived from the Se-enriched black carbonaceous siliceous rocks, carbonaceous shale and slate. Endemic Tl poisoning occurred in southwestern China due to Tl contamination in local drinking water and vegetables surrounding the Tl-rich sulfide mineralized areas. Some measures have been taken to control and remedy the endemic diseases with significant effects in reducing health risk and damage of As, Se and Tl. However, the states of the endemic diseases of As, Se and Tl in China are still serious in some areas, and substantial research efforts regarding the health impacts of these elements are further required. This paper reviews the progress of medical geology of As, Se and Tl in China, and provides with some outlooks for future research directions. Copyright

  2. Dicty_cDB: VSF196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSF196 (Link to dictyBase) - - - Contig-U14518-1 VSF196E (Link to Original site) VSF196F...(Link to library) Clone ID VSF196 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig...Contig-U14518-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VS/VSF1-D/VSF196Q.Seq.d/ Representative...Representative seq. ID VSF196E (Link to Original site) Representative DNA sequence >VSF196 (VSF196Q) /CSM/VS/VSF1-D/VSF196Q...d/ CACACACGTTGTTGTTTACCTAATTTATATTTATTTAATAAATATCATATTTGGAATATT TACATATTACTAAATTTAAAATGGATGAAGATTATG

  3. 32 CFR 196.515 - Compensation.

    Science.gov (United States)

    2010-07-01

    ... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 196.515... distinctions in rates of pay or other compensation; (b) Results in the payment of wages to employees of one sex...

  4. 32 CFR 196.430 - Financial assistance.

    Science.gov (United States)

    2010-07-01

    ...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196... members of a particular sex specified therein; Provided, that the overall effect of the award of such sex...

  5. 32 CFR 196.450 - Athletics.

    Science.gov (United States)

    2010-07-01

    ... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196.450 Athletics. (a... interscholastic, intercollegiate, club, or intramural athletics offered by a recipient, and no recipient shall.... (1) A recipient that operates or sponsors interscholastic, intercollegiate, club, or intramural...

  6. Reference: 196 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available nt journal Ando Kohei|Hatano Kyoko|Ishizaki Yoko|Kato Ko|Kobori Maki|Nakahira Yoichi|Shiina Takashi|Shinmyo Atsuhiko|Takeba Go|Tsunoyama Yuichi ... 196 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u15807777i Ishizaki Yoko

  7. New CZT cardiac cameras and myocardial perfusion imaging with thallium 201; Nouvelles cameras cardiaques a semi-conducteur cadmium -zinc- telluride (CZT) et scintigraphies myocardiques au thallium 201

    Energy Technology Data Exchange (ETDEWEB)

    Songy, B. [Service de medecine et imagerie nucleaire, centre cardiologique du Nord (CCN), 93 - Saint-Denis (France)

    2010-08-15

    Myocardial perfusion imaging is widely used for management of coronary artery disease. However, it suffers from technical limitations. New cardiac cameras using CZT detectors are now available and increase spatial (x2) and energy (x2) resolutions and photons sensitivity (x5). We describe here the General Electric Discovery NM 530c new camera and summarize the validation studies with technetium agents and with thallium 201, protocols to reduce doses, ultrafast protocols and perspectives offered with this new technology. (author)

  8. Genotoxic and mutagenic effects of the diagnostic use of thallium-201 in nuclear medicine

    Energy Technology Data Exchange (ETDEWEB)

    Kelsey, K.T. (Harvard School of Public Health, Boston, MA (United States)); Donohoe, K.J. (Beth Israel Hospital, Boston, MA (United States). Div. of Nuclear Medicine); Baxter, Barbara; Memisoglu, Asli; Little, J.B.; Caggana, Michele; Liber, H.L. (Harvard School of Public Health, Boston, MA (United States))

    1991-07-01

    In order to investigate possible mutagenetic effects of in vivo exposure to low levels of ionizing radiation used in nuclear medicine, the authors examined hypoxanthine guanine phosphoribosyl transferase (hprt) mutant fraction (MF) and chromosome aberration (CA) frequency in 24 nuclear medicine patients before and after injection of thallium-201. The mean MF of the thallium-201-exposed cohort was 5.2{+-}4.4 x 10{sup -6} before injection exposure. No significant difference in MF was observed 24 h later. In 11 patients who were studied on a 3rd occasion, 30 days after thallium-201 exposure, there was again no significant difference in post-exposure as compared with the pre-exposure MF. The frequency of CA in peripheral blood lymphocytes was not significantly different, comparing pre- and 24h to 1 month post-radionuclide exposure . Thus, thallium-201 exposure was not associated with significant elevations in MF or CA frequency in lymphocytes of exposed individuals. (author). 40 refs.; 3 tabs.

  9. Systematics of c-axis Phonons in the Thallium- and Bismuth-Based Cuprate Superconductors

    NARCIS (Netherlands)

    Tsvetkov, A. A; Dulic, D.; Marel, D. van der; Damascelli, A.; Kaljushnaia, G. A.; Gorina, J. I.; Senturina, N. N.; Kolesnikov, N. N.; Ren, Z. F.; Wang, J. H.; Menovsky, A. A.; Palstra, T. T. M.

    2006-01-01

    Published in: Phys. Rev. B 60 (1999) 13196 Citing articles (CrossRef) citations recorded in [Science Citation Index] Abstract: We present grazing incidence reflectivity measurements in the far infrared region at temperatures above and below Tc for a series of thallium (Tl2Ba2CuO6, Tl2Ba2CaCu2O8) and

  10. Dipyridamole-thallium-201 tomography documenting improved myocardial perfusion with therapy in Kawasaki disease

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Spielmann, R.P.; Hausdorf, G.

    1988-12-01

    Thallium-201 tomographic perfusion studies after pharmacologic vasodilation were performed in seven children (aged 2 years 8 months to 8 years 7 months), 3 to 20 months after the acute stage of the disease. In all patients coronary aneurysms were seen on cross-sectional echocardiograms. The scintigrams of six children showed no significant regional reduction of myocardial thallium-201 uptake. These children had remained asymptomatic in the follow-up period after the acute inflammatory stage of Kawasaki disease. Persistent and transient thallium defects were present in one child with acute posterolateral myocardial infarction; obstruction of two coronary vessels supplying the defect zones was confirmed by contrast angiography. After 8 months of treatment a follow-up nuclear scan showed marked reduction in the size of the defect and almost complete abolishment of the ischemic reaction. Thus tomographic thallium-201 perfusion scintigraphy in conjunction with vasodilation stress is useful to assess myocardial perfusion in children with Kawasaki disease and demonstrates marked improvement in regional perfusion after adequate medical therapy.

  11. Complexometric determination of thallium(III using ethanethiol as a selective masking agent

    Directory of Open Access Journals (Sweden)

    Karthikeyan J.

    2006-01-01

    Full Text Available A simple and selective complexometric method for the determination of thallium in presence of other metal ions is proposed based on the selective masking ability of ethanethiol towards thallium(III. Thallium present in a given sample solution is first complexed with a known excess of EDTA and the surplus EDTA is titrated with standard zinc sulphate solution at pH 5-6(hexamine using xylenol orange as the indicator. A 0.3% aqueous solution of ethanethiol is then added to displace EDTA from the Tl(III-EDTA complex. The released EDTA is titrated with standard zinc sulphate solution as before. Reproducible and accurate results are obtained for 3.70 mg to 74.07 mg of Tl (III with relative error less than ? 0.44% and coefficient of variation not more than 0.27%. The interference of various ions was studied and the method was used for the analysis of thallium in its synthetic alloy mixtures and also in complexes.

  12. Thallium-201: Autoradiography in pigmented mice and melanin-binding in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Tjaelve, H.; Nilsson, M.; Larsson, B. (Uppsala Univ. (Sweden))

    1982-01-01

    Autoradiography with /sup 201/Tl/sup +/ in C57Bl mice showed a strong labelling of the eye melanin and of pigmented hair follicles. An analysis of the affinity of thallium for pigment from cow eyes indicated a binding to three groups of sites and showed a marked sensitivity to the addition of H/sup +/-ions. The results are consistent with the conception that a binding of thallium occurs to the free carboxyl groups of the melanin and that the structure of the polymer has a marked influence on the affinity. Similar results have previously been obtained with other cations. There was no indication that the strong in vivo affinity of thallium to melanin is due to a more firm binding than for other cations which do not localize on melanin in vivo. Instead, the ability of cations to pass the melanocyte membranes and reach the melanin granules is probably decisive for whether a melanin-binding will take place in vivo. Toxic effects on the eye and epilation are symptoms of thallium intoxication which may be related to its melanin-binding. The fate of /sup 201/Tl/sup +/ in some other tissues is also described and discussed.

  13. Laser-assisted decay and optical spectroscopy studies of neutron-deficient thallium isotopes

    CERN Document Server

    Van Beveren, Céline; Huyse, Mark

    The neutron-deficient thallium isotopes with one proton less than the Z = 82 shell closure, are situated in an interesting region of the nuclear chart, notorious for intruder states and shape coexistence. Shape coexistence is the remarkable phenomenon in which two or more distinct types of deformation occur at low energy in the same atomic nucleus. Shape coexistence has been studied intensively, experimentally as well as theoretically in different nuclei in the light-lead region and the isomerism in the thallium isotopes was among the first indications of this phenomenon. Different shapes, whose structure has been linked to specific proton orbitals above and below the Z = 82 shell closure, are present at low energy in the neutron-deficient odd-mass thallium nuclei. In the odd-odd nuclei, the coupling of an unpaired proton and unpaired neutron gives rise to multiplets of low-lying states from which some can be isomeric. Since thallium has one proton missing in the major proton shell, and when approaching neutr...

  14. Clinical features and applications of thallium-201. With reference to scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tadashige

    1988-12-01

    Thallium-201 is not only used widely in myocardial imaging but also has a great potential in other various nuclear medicine imaging studies. This paper presents clinical features and applications of thallium-201, focusing on clinical trials with thallium-201 at the Shinshu University School of Medicine. Thallium-201 myocardial scintigraphy offers information on (1) ventricular position and morphology, (2) hypertrophy or dilatation of the left ventricle, (3) hypertrophy or dilatation of the right ventricle, (4) site and extent of myocardial ischemia and infarct, (5) myocardial blood flow, (6) pulmonary congestion or interstitial pulmonary edema, and (7) pericardial effusion. It can be used in the following evaluation or diagnosis: (1) acute or old myocardial infarction, (2) angina pectoris, (3) treatment strategy or prognosis of ischemic heart disease, (4) treatment strategy or observation of bypass graft or drug therapy, (5) hypertrophic or dilated idiopathic cardiomyopathy, (6) myocardial lesions induced by sarcoidosis, collagen disease, and neuro-muscular disease, (7) ventricular hypertrophy and pulmonary edema, and (9) pericarditis, pericardial effusion, and systolic pericarditis associated with underlying disease. The significance of tumor, liver, bone marrow scintigraphies is also referred to. (Namekawa, K) 69 refs.

  15. Optimised thallium precipitation in a waste water treatment system of the flue gas desulphurisation; Optimierte Thalliumabscheidung einer RAA

    Energy Technology Data Exchange (ETDEWEB)

    Ritzerfeld, Guenter [RWE Power AG, Bergheim (Germany); Birngruber, Ingolf [RWE Power AG, Hamm (Germany); Muelder, Thomas [RWE Power AG, Ibbenbueren (Germany)

    2011-07-01

    When co-combusting substitute fuels in power plants, the element Thallium should be checked in the drain of the waste water treatment system of flue gas desulphurisation. In 2005 Thallium-concentrations exceeding the limit value were determined for the first time as a consequence of the modified analysis of the supervisory authority. The previous lower Thallium concentrations with graphite tube-atomic absorption spectrometry were caused by the high chloride concentration in RAA waste water. The RAA operating mode was checked and changed. Equipment-related weak spots were detected and corrected. (orig.)

  16. Comparison of Polythionates as Precursors for the Formation of Thallium Sulfide Layers

    Directory of Open Access Journals (Sweden)

    Vitalijus JANICKIS

    2011-11-01

    Full Text Available The processes of obtaining layers of thallium, sulfides, TlxSy, by the sorption-diffusion method on polyamide 6 using solutions of lower polythionates - sodium trithionate and tetrathionate, Na2S3O6, Na2S4O6, potassium pentathionate, K2S5O6, and of dodecathionic acid, H2S12O6, as precursors of sulfur are compared. The concentration of sorbed sulfur increases with increasing the duration of treatment, the concentration and temperature of precursor solution. It rather significantly also depends on the nature - sulfurity of polythionate, i. e. on the number of sulfur atoms in the polythionate anion: effectiveness of sulfurization using solutions of dodecathionic acid is significantly higher than that of lower polythionates. Thallium sulfide layers are formed on the surface of polyamide after the treatment of sulfurized polymer with Tl(I salt solution. The concentration of thallium in the layer increases with the increase of initial sulfurization duration and in case of H2S12O6 solution used - on the temperature of this process. The results of X-ray diffraction analysis confirmed the formation of thallium sulfide layers in the surface of polyamide 6. The phase composition of layer changes depending on the conditions of initial treatment in a H2S12O6 solution. Five thallium sulfide phases, two forms of TlS, Tl2S2, Tl4S3 and Tl2S5 were identified in the composition of the layers treated for different time with a solution of dodecathionic acid at the temperature of 20 °C and 30 °C and then with Tl(I salt solution by X-ray diffraction but the maxima of TlS and Tl2S5 phases predominate in the diffractograms.http://dx.doi.org/10.5755/j01.ms.17.4.774

  17. Thermodynamic Study of Tl6SBr4 Compound and Some Regularities in Thermodynamic Properties of Thallium Chalcohalides

    Directory of Open Access Journals (Sweden)

    Dunya Mahammad Babanly

    2017-01-01

    Full Text Available The solid-phase diagram of the Tl-TlBr-S system was clarified and the fundamental thermodynamic properties of Tl6SBr4 compound were studied on the basis of electromotive force (EMF measurements of concentration cells relative to a thallium electrode. The EMF results were used to calculate the relative partial thermodynamic functions of thallium in alloys and the standard integral thermodynamic functions (-ΔfG0, -ΔfH0, and S0298 of Tl6SBr4 compound. All data regarding thermodynamic properties of thallium chalcogen-halides are generalized and comparatively analyzed. Consequently, certain regularities between thermodynamic functions of thallium chalcogen-halides and their binary constituents as well as degree of ionization (DI of chemical bonding were revealed.

  18. 46 CFR 196.40-15 - Load line marks.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Load line marks. 196.40-15 Section 196.40-15 Shipping... Markings on Vessels § 196.40-15 Load line marks. (a) Vessels assigned a load line shall have the deck line and the load line marks permanently marked or embossed as required by Subchapter E (Load Lines) of...

  19. 32 CFR 196.520 - Job classification and structure.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Job classification and structure. 196.520 Section 196.520 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE... Activities Prohibited § 196.520 Job classification and structure. A recipient shall not: (a) Classify a job...

  20. 22 CFR 19.6 - Court orders and divorce decrees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Court orders and divorce decrees. 19.6 Section 19.6 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR SPOUSES AND FORMER SPOUSES OF PARTICIPANTS IN THE FOREIGN SERVICE RETIREMENT AND DISABILITY SYSTEM § 19.6 Court orders and divorce decrees. ...

  1. 49 CFR 572.196 - Thorax without arm.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax without arm. 572.196 Section 572.196... Dummy, Small Adult Female § 572.196 Thorax without arm. (a) The thorax is part of the upper torso... (drawing 180-0000) with the arm (180-6000) on the impacted side removed. The dummy's thorax is equipped...

  2. 32 CFR 196.140 - Dissemination of policy.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Dissemination of policy. 196.140 Section 196.140 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED... FINANCIAL ASSISTANCE Introduction § 196.140 Dissemination of policy. (a) Notification of policy. (1) Each...

  3. 46 CFR 196.37-9 - Carbon dioxide alarm.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Carbon dioxide alarm. 196.37-9 Section 196.37-9 Shipping... Markings for Fire and Emergency Equipment, etc. § 196.37-9 Carbon dioxide alarm. (a) All carbon dioxide alarms shall be conspicuously identified: “WHEN ALARM SOUNDS—VACATE AT ONCE. CARBON DIOXIDE BEING...

  4. 46 CFR 196.37-47 - Portable magazine chests.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Portable magazine chests. 196.37-47 Section 196.37-47... Markings for Fire and Emergency Equipment, etc. § 196.37-47 Portable magazine chests. (a) Portable magazine chests shall be marked in letters at least 3 inches high: PORTABLE MAGAZINE CHEST — FLAMMABLE — KEEP...

  5. 46 CFR 196.85-1 - Magazine operation and control.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Magazine operation and control. 196.85-1 Section 196.85... OPERATIONS Magazine Control § 196.85-1 Magazine operation and control. (a) Keys to magazine spaces and magazine chests shall be kept in the sole control or custody of the Master or one delegated qualified...

  6. A calixarene-based ion-selective electrode for thallium(I) detection

    Energy Technology Data Exchange (ETDEWEB)

    Chester, Ryan [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Sohail, Manzar [Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia); Ogden, Mark I.; Mocerino, Mauro [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Pretsch, Ernö [ETH Zürich, Institute of Biogeochemistry and Pollutant Dynamics (IBP), Universitätstrasse 16, CH-8092, Zürich (Switzerland); De Marco, Roland, E-mail: rdemarc1@usc.edu.au [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia)

    2014-12-03

    Highlights: • Tuning of metal binding cavities in thallium(I) calixarene ionophores. • Novel calixarene-based ionophores with improved selectivity for thallium(I). • Sandwich membrane characterization of thallium(I) binding in novel calixarenes. • Improved selectivity and sensitivity with novel thallium(I) calixarene ionophores. • Solid contact ion-selective electrodes for novel thallium(I) calixarene ionophores. - Abstract: Three new calixarene Tl{sup +} ionophores have been utilized in Tl{sup +} ion-selective electrodes (ISEs) yielding Nernstian response in the concentration range of 10{sup −2}–10{sup −6} M TlNO{sub 3} with a non-optimized filling solution in a conventional liquid contact ISE configuration. The complex formation constants (log β{sub IL}) for two of the calixarene derivatives with thallium(I) (i.e. 6.44 and 5.85) were measured using the sandwich membrane technique, with the other ionophore immeasurable due to eventual precipitation of the ionophore during these long-term experiments. Furthermore, the unbiased selectivity coefficients for these ionophores displayed excellent selectivity against Zn{sup 2+}, Ca{sup 2+}, Ba{sup 2+}, Cu{sup 2+}, Cd{sup 2+} and Al{sup 3+} with moderate selectivity against Pb{sup 2+}, Li{sup +}, Na{sup +}, H{sup +}, K{sup +}, NH{sub 4}{sup +} and Cs{sup +}, noting that silver was the only significant interferent with these calixarene-based ionophores. When optimizing the filling solution in a liquid contact ISE, it was possible to achieve a lower limit of detection of approximately 8 nM according to the IUPAC definition. Last, the new ionophores were also evaluated in four solid-contact (SC) designs leading to Nernstian response, with the best response noted with a SC electrode utilizing a gold substrate, a poly(3-octylthiophene) (POT) ion-to-electron transducer and a poly(methyl methacrylate)–poly(decyl methacrylate) (PMMA–PDMA) co-polymer membrane. This electrode exhibited a slope of 58.4 mV decade

  7. Thallium Flux Assay for Measuring the Activity of Monovalent Cation Channels and Transporters.

    Science.gov (United States)

    Weaver, C David

    2018-01-01

    Monovalent cation channels are critically important for physiological processes ranging from the control of neuronal excitability to the maintenance of solute balance. Mutations in these channels are associated with a multiplicity of diseases and monovalent cation channel-modulating drugs are used as therapeutics. Techniques that allow the measurement of the activity of these ion channels are useful for exploring their many biological roles as well as enabling the discovery and characterization of ion channel modulators for the purposes of drug discovery. Although there are numerous techniques for measuring the activity of monovalent cation channels, the thallium flux assay technique is a widely used fluorescence-based approach. Described herein is a method for using the thallium-flux technique for detecting and quantifying the activity of small-molecule potassium channel modulators in 384-well plates.

  8. Comparative studies on right ventricular pressure and volume overloading by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Owada, K.; Tsukahara, Y.; Kijima, M.; Miyazaki, Y.; Ono, K. (Fukushima Medical Coll. (Japan))

    1982-03-01

    Thallium-201 myocardial scintigraphy was performed in 44 patients with various heart diseases including mitral stenosis, atrial septal defect, primary pulmonary hypertension, and left atrial myxoma. The morphological findings of right ventricular (RV) free wall on the scintigram and RV/IVS (interventricular septum) uptake ratio of the images obtained from the left anterior oblique projection were studied in the patients with RV pressure or volume overloading.

  9. Tunable frequency-stabilization of UV laser using a Hallow-Cathode Lamp of atomic thallium

    CERN Document Server

    Chen, Tzu-Ling; Shy, Jow-Tsong; Liu, Yi-Wei

    2013-01-01

    A frequency-stabilized ultraviolet laser system, locked to the thallium resonant transition of 377.5 nm, was demonstrated using a novel bichromatic spectroscopy technique for tuning the zero-crossing laser-lock point. The atomic thallium system is a promising candidate in atomic parity violation and permanent electric dipole moment experiments, and its 377.5 nm 6P1/2->7S1/2 transition is important for thallium laser cooling and trapping experiment. The pressure shift, owing to the high pressure bu?er gas of the hollow-cathode lamp, was observed using an atomic beam resonance as reference. Such a shift was corrected by adjusting the peak ratio of the two Doppler-free saturation pro?les resulted from two pumping beams with a 130 MHz frequency di?erence. The resulted frequency stability of the ultraviolet laser is ?0.5 MHz at 0.1 sec integration time. This scheme is compact and versatile for stabilizing UV laser systems, which acquire a sub-MHz stability and frequency tunability.

  10. Detection of human collateral circulation by vasodilation-thallium-201 tomography

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Salge, D.; Spielmann, R.P.; Montz, R.; Bleifeld, W. (University Hospital Eppendorf, Hamburg (Germany, F.R.))

    1990-04-15

    Coronary arteriolar vasodilation may provoke redistribution of flow to collateral-dependent jeopardized myocardium. To assess the physiologic significance of collaterals, 80 consecutive post-infarction patients (age 58 +/- 8 years) underwent vasodilation-redistribution thallium-201 tomographic imaging after administration of 0.56 mg of intravenous dipyridamole/kg body weight. Circumferential profile analysis of thallium-201 uptake and redistribution in representative left ventricular tomograms provided quantitative assessment of transient and fixed defects and separation between periinfarctional and distant inducible hypoperfusion. Tomographic perfusion data were correlated to wall motion and collateral circulation between distinct anatomic perfusion territories. Patients were grouped according to presence (59%) or absence (41%) of angiographically visible collateral channels to jeopardized myocardium. In the presence of collaterals, distant reversible defects were larger than in absence of collaterals (p less than 0.05); the extent of combined periinfarctional and distant redistribution was also larger in collateralized patients (p less than 0.025), whereas the size of the persistent perfusion defect was similar in both groups. By prospective analysis the tomographic perfusion pattern of combined periinfarctional and distant redistribution revealed a sensitivity of 85% and a specificity of 78% for the detection of significant collateral circulation in this group of patients. Thus, using the exhausted flow reserve as a diagnostic tool, vasodilation-thallium-201 tomography has the potential to identify and quantitate collateralized myocardium in post-infarction patients and may guide diagnostic and therapeutic decision-making.

  11. [Characterization of kale (Brassica oberacea var acephala) under thallium stress by in situ attenuated total reflection FTIR].

    Science.gov (United States)

    Yao, Yan; Zhang, Ping; Wang, Zhen-Chun; Chen, Yong-Heng

    2009-01-01

    The experiment was designed based on consumption of carbon dioxide through the photosynthesis of Brassica oberacea var acephala leaf, and the photosynthesis of kale leaf under thallium stress was investigated by in situ attenuated total reflection FTIR (in situ ATR-FTIR). The ATR-FTIR showed that the absorption peaks of leaves had no obvious difference between plants growing in thallium stress soil and plants growing in non-thallium pollution soil, and the strong peaks at 3,380 cm(-1) could be assigned to the absorption of water, carbohydrate, protein or amide; the strong peaks at 2,916 and 2,850 cm(-1) assigned to the absorption of carbohydrate or aliphatic compound; the peaks at 1,640 cm(-1) assigned to the absorption of water. However, as detected by the in situ ATR-FTIR, the double peaks (negative peaks) at 2,360 and 2,340 cm(-1) that are assigned to the absorption of CO2 appeared and became high gradually. It was showed that kale was carrying photosynthesis. At the same time, the carbon dioxide consumption speed of leaf under thallium stress was obviously larger than that of the blank It was expressed that photosynthesis under thallium stress was stronger than the blank All these represented that kale had certain tolerance to the heavy metal thallium. Meanwhile, the carbon dioxide consumption of grown-up leaf was more than that of young leaf whether or not under thallium stress. It was also indicated that the intensity of photosynthesis in grown-up leaf is higher than that in young leaf.

  12. 46 CFR 196.15-55 - Requirements for fuel oil.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Requirements for fuel oil. 196.15-55 Section 196.15-55... Test, Drills, and Inspections § 196.15-55 Requirements for fuel oil. (a) It shall be the duty of the chief engineer to cause an entry in the log to be made of each supply of fuel oil received on board...

  13. Thallium and manganese complexes involved in the luminescence emission of potassium-bearing aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, Miguel A., E-mail: miguel.gomez@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garcia-Guinea, Javier, E-mail: guinea@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garrido, Fernando, E-mail: fernando.garrido@mncn.csic.es [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Townsend, Peter D., E-mail: pdtownsend@gmail.com [School of Science and Technology, University of Sussex, Brighton BN1 9QH (United Kingdom); Marco, Jose-Francisco, E-mail: jfmarco@iqfr.csic.es [Instituto de Química-Física Rocasolano, CSIC, Calle Serrano 119, Madrid E-28006 (Spain)

    2015-03-15

    The luminescence emission at 285 nm in natural K-feldspar has been studied by Russian groups and associated with thallium ions in structural positions of K{sup +} sites as artificially thallium-doped feldspars display the same emission band. Here attention is focussed on spectra of CL emission bands centered near 285 and 560 nm from paragenetic adularia, moscovite and quartz micro-inclusions. With accesorial thallium they show clear resemblances to each other. Associated sedimentary and hydrothermal aluminosilicate samples collected from Guadalix (Madrid, Spain) were analyzed with a wide range of experimental techniques including Environmental Scanning Electron Microscopy (ESEM) with an attached X-Ray Energy-Dispersive Spectrometer (EDS) and a cathodoluminescence probe (CL) and Electron Probe Microanalysis (EPMA), X-Ray Fluorescence Spectrometry (XRF), Inductively Coupled Plasma-Optical Emission Spectrometry (ICP-OES), Differential and Thermogravimetric Analyses (DTA-TG), radioluminescence (RL), Mössbauer spectroscopy and X-Ray Photoelectron Spectrometry (XPS). The luminescence emission bands at 285 and 560 nm seem to be associated with hydrous thallium–manganese complexes bonded to potassium-bearing aluminosilicates since various minerals such as K-feldspar, moscovite and quartz micro-inclusions display similar CL spectra, accesorial thallium and hydroxyl groups. The presence of iron introduces a brown color which is attributed to submicroscopic iron oxides detectable in the optical and chemical microanalysis, but this does not contribute to the luminescence emission. The XPS Mn 2p spectrum of the adularia sample at room temperature is composed of a spin–orbit doublet plus clear shake-up satellite structure ∼4 eV above the main photoemision lines and is consistent with Mn{sup 2+} in good agreement with the observed luminescence emission at 560 nm for aluminosilicates produced by a {sup 4}T1({sup 4}G)→{sup 6}A1({sup 6}S) transition in tetrahedrally

  14. Diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic and thallium 201 perfusion imaging in stable coronary artery disease.

    Science.gov (United States)

    Walamies, M; Turjanmaa, V; Koskinen, M; Uusitalo, A

    1993-08-01

    The diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic cardiac imaging was studied in a group (n = 29) of patients with angiographically confirmed CAD using single photon emission computed tomography (SPECT). A symptom-limited exercise test was first done with IPPA, and 2 days later with thallium. Medications were not withheld during testing. Fourteen healthy control subjects participated in parallel IPPA and 15 in thallium tests. Data acquisition and output were comparable in the two imaging modalities. By testing various relatively simple criteria for abnormality we found that the semiquantitative interpretation was more accurate than the visual readings. The best compromise of accuracy with the scored criteria consisted of a sensitivity of 86% and a specificity of 86%, obtained with IPPA polar tomograms (mild exercise defect) and a sensitivity of 86% and a specificity of 80% obtained with thallium (regionally decreased washout). With visual interpretation alone, a sensitivity of 83% and a specificity of 71% was detected with IPPA (mild exercise defect) and 72% and 73%, respectively, with thallium (partial reversibility). The sensitivity of the exercise ECG alone was 62%. The results of this study imply that IPPA imaging could be a rational, uncomplicated clinical method for non-invasive diagnosis of CAD. The diagnostic ability of IPPA is at least as good as that of thallium, and it is possible to use them in succession.

  15. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging: A new marker of triple-vessel disease

    Energy Technology Data Exchange (ETDEWEB)

    Takeishi, Y.; Tono-oka, I.; Ikeda, K.; Komatani, A.; Tsuiki, K.; Yasui, S. (Yamagata Univ. School of Medicine (Japan))

    1991-02-01

    To investigate the significance and mechanism of dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging, we performed both dipyridamole thallium-201 imaging and dipyridamole radionuclide angiography on 83 patients with known angiograms. The dipyridamole/delayed ratio of the left ventricular dimension from the thallium-201 image was defined as the left ventricular dilatation ratio (LVDR). An LVDR greater than the mean + two standard deviations in patients without coronary artery disease was defined as abnormal. Twenty-two of 83 patients showed an abnormal LVDR, and 18 of the 22 patients (82%) had triple-vessel disease. By defect and washout analysis, the sensitivity and specificity for correctly identifying the patients as having triple-vessel disease was 72% and 76%, respectively, whereas LVDR had a sensitivity of 72% and a specificity of 93%. When LVDR was used in combination with the defect and washout criteria, sensitivity increased to 84% without a loss of specificity. In those 22 patients with abnormal LVDRs, end-diastolic volume measured by radionuclide angiography did not change after dipyridamole infusion. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging reflected relative subendocardial hypoperfusion induced by dipyridamole rather than actual chamber enlargement. The LVDR was moderately sensitive and highly specific for triple-vessel disease and provided complementary information to dipyridamole thallium-201 imaging.

  16. 21 CFR 133.196 - Swiss cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Swiss cheese for manufacturing. 133.196 Section... Standardized Cheese and Related Products § 133.196 Swiss cheese for manufacturing. Swiss cheese for manufacturing conforms to the definition and standard of identity prescribed for swiss cheese by § 133.195...

  17. 32 CFR 196.455 - Textbooks and curricular material.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Textbooks and curricular material. 196.455... Prohibited § 196.455 Textbooks and curricular material. Nothing in these Title IX regulations shall be interpreted as requiring or prohibiting or abridging in any way the use of particular textbooks or curricular...

  18. 46 CFR 196.37-13 - Fire extinguishing system controls.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Fire extinguishing system controls. 196.37-13 Section... VESSELS OPERATIONS Markings for Fire and Emergency Equipment, etc. § 196.37-13 Fire extinguishing system controls. (a) The control cabinets or spaces containing valves or manifolds for the various fire...

  19. 46 CFR 196.27-1 - Master's and officer's responsibility.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Master's and officer's responsibility. 196.27-1 Section... VESSELS OPERATIONS Lookouts § 196.27-1 Master's and officer's responsibility. (a) Nothing in this part shall exonerate any master or officer in command from the consequences of any neglect to keep a proper...

  20. 46 CFR 196.37-23 - Hand portable fire extinguishers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Hand portable fire extinguishers. 196.37-23 Section 196... extinguishers. (a) Each hand portable fire extinguisher shall be marked with a number and the location where... of hand portable fire extinguisher is carried, the numbering may be omitted. ...

  1. 22 CFR 196.1 - What is the Fellowship Program?

    Science.gov (United States)

    2010-04-01

    ... FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.1 What is the Fellowship Program? The Thomas R. Pickering Foreign Affairs/Graduate Foreign Affairs Fellowship Program is designed to attract... 22 Foreign Relations 1 2010-04-01 2010-04-01 false What is the Fellowship Program? 196.1 Section...

  2. A preliminary investigation and evaluation of the thallium environmental impacts of the unmined Xiangquan thallium-only deposit in Hexian, China

    Science.gov (United States)

    Zhou, Taofa; Fan, Yu; Yuan, Feng; Cooke, David; Zhang, Xin; Li, Liangjun

    2008-03-01

    The Xiangquan Thallium-only deposit in Hexian, east China is a newly found near-surface and unmined shallow-seated thallium deposit. The 250t Tl deposit is hosted in Lower Ordovician Lunshan Group as lenticular and confined by northeast F1, F2 faults. The metallic minerals are dominated by pyrite, more than 95% Tl occurs in pyrite as tiny individual grains or as ‘‘invisible thallium”. Tl and other trace elements pollution in ecosystems such as soils, surface and ground waters and water sediments, plants and crops, and animal and human beings in Xiangquan near the Tl ore deposit have been investigated and evaluated. Results show that Tl as well as As and Sb in ecosystems in Xiangquan around the deposit have enriched, they came from Tl-pyrite in the ore bodies and in the parent rocks of weathered soils on top of the ore bodies and went into the nearby ecosystems through weathering, leaching and dissolving. In 2 km2 around the Xiaolongwang Mountain where the Tl ore deposit seated, soils, vegetables, crops have been polluted or heavily polluted by Tl, As and Sb. Farmlands near the ore body are not fit to grow vegetables and crops. Thermal Spring water in Xiangquan town and pond water close to the Tl deposit are not potable. Tl also enriches in human hair and urinate of villagers who live close to the Tl deposit. Even through the Tl-only deposit has put clear environmental impacts on the local environment and ecosystems around it, no serious consequences of Tl pollution have so far taken place due to unmining of the Tl deposit as well as the screen effect of the silicficious breccia cap on top of it. All this work adds new knowledge to understand Tl behavior in unmined Tl deposit, and also benefit to the local environmental protection and the future mineral resources exploration.

  3. {sup 201}Thallium SPECT, accuracy in astrocytoma diagnosis and treatment evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Kaellen, K

    1999-10-01

    The aims of the studies included in this thesis were: - to investigate the reliability of {sup 201}Thallium single photon emission computed tomography. Tl SPECT for preoperative diagnosis and histological staging of malignant astrocytomas in comparison with CT; - to develop a method for quantification of cerebral thallium uptake, and to evaluate the quantitative measurement in comparison with CT, for astrocytoma treatment follow-up purposes; - to compare quantitative Tl SPECT and proton magnetic resonance spectroscopy (H-MRS) with conventional MR imagingfor astrocytoma monitoring, and to evaluate associations between change of morphological tumour characteristics during treatment and changes of cerebral thallium uptake and metabolic ratios. Results and conclusions: - High TI-index, calculated as a ratio comparing tumour uptake to uptake in the contralateral hemisphere, is an indicator of highly malignant astrocytoma. Differentiation between the high-grade astrocytomas, the low-grade astrocytomas, and infectious lesions is only partial, with an overlap of Tl-indexes between these groups. High-grade astrocytomas that do not show contrast enhancement on CT, and astrocytomas with central necrosis and moderate ring-enhancement, tend to be underestimated when evaluated by Tl-index calculation. Tl SPECT is not a reliable method for non-invasive tumour staging among the group of highly malignant astrocytomas. - Quantification of cerebral TI-uptake, defining the volume of viable tumour tissue, is a new method for astrocytoma chemotherapy monitoring. Results suggest that the method provides prognostic information, and information of treatment efficacy, at an earlier stage than CT. - We did not find a higher accuracy of quantitative Tl SPECT than of MR for monitoring purposes and our results indicated that treatment induced MR changes were interrelated with TI-uptake variations. - Multi-voxel H-MRS was difficult to apply for astrocytoma treatment monitoring, due to the

  4. A Novel Ion - selective Polymeric Membrane Sensor for Determining Thallium(I) With High Selectivity

    Science.gov (United States)

    Kassim, Anuar; Rezayi, Majid; Ahmadzadeh, Saeid; Rounaghi, Gholamhossein; Mohajeri, Masoomeh; Azah Yusof, Noor; Tee, Tan Wee; Yook Heng, Lee; Halim Abdullah, Abd

    2011-02-01

    Thallium is a toxic metal that introduced into the environment mainly as a waste from the production of zinc, cadmium, and lead and by combustion of coal. Thallium causes gastrointestinal irritation and nerve damage when people are exposed to it for relatively short period of time. For long term, thallium has the potential to cause the following effects: change in blood chemistry, damage to liver, kidney, intestinal and testicular tissue, and hair loss. In this work a membrane was prepared by use of 4'-nitrobenzo -18-crown-6 (4'NB18C6) as an ion carrier, polyvinylchloride (PVC) as a matrix, and diocthylphetalate (DOP) as a plasticizer for making an ion selective electrode for measurement of Tl+ cation in solutions. The amount of 4'-nitrobenzo-18C6 and polyvinylchloride were optimized in the preparation of the membrane. The response of the electrode was Nernstian within the concentration range 1.0 × 10-8 to 1.0 × 10-1M. This sensor displays a drift in Nernstian response for this cation with increasing the amount of ionophore and decreasing the amount of polyvinylchloride.The results of potentiometric measurements showed that, this electrode also responses to Cu2+ Ni2+ and Pb2+ cations, but the electrode has a wider dynamic range and a lower detection limit to Tl+ cation. The effects of various parameters such as pH, different cations interferences, effect of the amount of ionophore and polyvinylchloride and time on response of the coated ion selective electrode were investigated. Finally the constructed electrode was used in complexometric and precipitation titrations of Tl+ cation with EDTA and KBr, respectively. The response of the fabricated electrode at concentration range from 1.0 × 10-8 to 1.0 × 10-1M is linear with a Nernstian slope of 57.27 mV.

  5. Oxidative stress and DNA damage in broad bean (Vicia faba L.) seedlings induced by thallium.

    Science.gov (United States)

    Radić, Sandra; Cvjetko, Petra; Glavas, Katarina; Roje, Vibor; Pevalek-Kozlina, Branka; Pavlica, Mirjana

    2009-01-01

    Thallium (Tl) is a metal of great toxicological concern because it is highly toxic to all living organisms through mechanisms that are yet poorly understood. Since Tl is accumulated by important crops, the present study aimed to analyze the biological effects induced by bioaccumulation of Tl in broad bean (Vicia faba L.) as well as the plant's antioxidative defense mechanisms usually activated by heavy metals. Thallium toxicity was related to production of reactive oxygen species in leaves and roots of broad bean seedlings following short-term (72 h) exposure to thallium (I) acetate (0, 0.5, 1, 5, and 10 mg/L) by evaluating DNA damage and oxidative stress parameters as well as antioxidative response. The possible antagonistic effect of potassium (K) was tested by combined treatment with 5 mg/L of Tl (Tl+) and 10 mg/L of potassium (K+) acetate. Accumulation of Tl+ in roots was 50 to 250 times higher than in broad bean shoots and was accompanied by increase in dry weight and proline. Despite responsive antioxidative defense (increased activities of superoxide dismutase, ascorbate peroxidase, and pyrogallol peroxidase), Tl+ caused oxidative damage to lipids and proteins as evaluated by malondialdehyde and carbonyl group levels, and induced DNA strand breaks. Combined treatment caused no oxidative alternations to lipids and proteins though it induced DNA damage. The difference in Tl-induced genotoxicity following both acellular and cellular exposure implies indirect DNA damage. Results obtained indicate that oxidative stress is involved in the mechanism of Tl toxicity and that the tolerance of broad bean to Tl is achieved, at least in part, through the increased activity of antioxidant enzymes.

  6. Thallium Intoxication Treated with Long-Term Hemodialysis, Forced Diuresis and Prussian Blue

    DEFF Research Database (Denmark)

    Larsen, Elfinn; Solgaard, Per Bent; Freund, L. Gade

    1978-01-01

    A 56 yr old woman, who ingested 2 g of thallium sulfate, was successfully treated with long-term hemodialysis for 200 h during 10 days, combined with forced diuresis and Prussian blue. The effect of the artificial kidney dialysis was determined by repeated analysis of the Tl concentration...... in the dialysis bath and in blood samples. During the 1st 120 h of hemodialysis, 143 mg of Tl was eliminated via the artificial kidney and 110 mg via the urinary tract. The present case of acute Tl intoxication is the 1st in which long-term hemodialysis has been used in the acute phase...

  7. Experimental excitation functions of deuteron induced reactions on natural thallium up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Adam Rebeles, R., E-mail: radamreb@vub.ac.be [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Van den Winkel, P.; Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Tarkanyi, F.; Takacs, S. [Institute of Nuclear Research of the Hungarian Academy of Sciences, Debrecen H-4026 (Hungary)

    2012-10-01

    Excitation functions of deuteron induced reactions on natural thallium leading to the formation of {sup 204m,203m2+m1+g,202m,201m+g,200}Pb and {sup 202,201m+g,200m+g}Tl isotopes were determined up to 50 MeV. The cross sections were measured by an activation technique using stacked foil irradiation. The excitation functions of the investigated reactions are compared with data reported in literature and also with the theoretical results of TALYS nuclear reaction code. From the measured cross section data, the thick target yield for the medical interesting {sup 203}Pb isotope is calculated.

  8. Application of Hyphenated Techniques in Speciation Analysis of Arsenic, Antimony, and Thallium

    Science.gov (United States)

    Michalski, Rajmund; Szopa, Sebastian; Jabłońska, Magdalena; Łyko, Aleksandra

    2012-01-01

    Due to the fact that metals and metalloids have a strong impact on the environment, the methods of their determination and speciation have received special attention in recent years. Arsenic, antimony, and thallium are important examples of such toxic elements. Their speciation is especially important in the environmental and biomedical fields because of their toxicity, bioavailability, and reactivity. Recently, speciation analytics has been playing a unique role in the studies of biogeochemical cycles of chemical compounds, determination of toxicity and ecotoxicity of selected elements, quality control of food products, control of medicines and pharmaceutical products, technological process control, research on the impact of technological installation on the environment, examination of occupational exposure, and clinical analysis. Conventional methods are usually labor intensive, time consuming, and susceptible to interferences. The hyphenated techniques, in which separation method is coupled with multidimensional detectors, have become useful alternatives. The main advantages of those techniques consist in extremely low detection and quantification limits, insignificant interference, influence as well as high precision and repeatability of the determinations. In view of their importance, the present work overviews and discusses different hyphenated techniques used for arsenic, antimony, and thallium species analysis, in different clinical, environmental and food matrices. PMID:22654649

  9. Evaluation of myocardial abnormalities in collagen diseases by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru; Kagoshima, Tadashi; Sugihara, Kiyotaka (Nara Medical Univ., Kashihara (Japan)) (and others)

    1993-12-01

    This study was performed to evaluate myocardial abnormalities in patients with collagen diseases by exercise and rest thallium-201 myocardial scintigrams. A total of 65 patients without ischemic ECG changes, consisting of 18 with systemic lupus erythematosus (SLE), 18 with polymyositis (PM), 8 with progressive systemic sclerosis (PSS), and 21 with Sjoegren's syndrome (SjS), was enrolled in this study. Reversible exercise-induced defects scintigraphically suggesting myocardial ischemia were noted in 8 cases of SLE, 4 cases of PM, 4 cases of PSS, and 3 cases of SjS. Nineteen patients had exercise-induced defects and underwent cardiac catheterization, 8 of whom had normal coronary angiograms. Fixed hypoperfusion areas were observed in one case of SLE, 6 cases of PM and 3 cases of SjS. Rest thallium-201 myocardial scintigram disclosed hypoperfusion areas which were not induced by exercise in 2 cases of SLE, 3 cases of PM, one case of PSS and 5 cases of SjS. Echocardiogram showed no significant differences in ejection fraction and % fractional shortening between the disease groups and healthy control group. These findings suggest that patients with collagen diseases have abnormalities of coronary circulation at the level of the intramural vasculature before cardiac function impairment, myocardial fibrosis and functional abnormalities at the cell membrane. (author).

  10. Follow-up Thallium-201 scintigraphy after mantle field radiotherapy for Hodgkin's disease

    Energy Technology Data Exchange (ETDEWEB)

    Pierga, J.Y.; Girinski, T.; Henry-Amar, M. (Institut Gustave Roussy, Villejuif (France)); Maunoury, C.; Valette, H.; Tchernia, G.; Desgrez, A. (Centre Hospitalier de Bicetre, Le Kremlin-Bicetre (France)); Socie, G. (Institut Gustave Roussy, Villejuif (France) Hopital St Louis, Paris (France)); Cosset, J.M. (Institut Gustave Roussy, Villejuif (France) Institut Curie, Paris (France))

    1993-04-02

    Assessment of the long-term cardiac effects of mediastinal radiotherapy for Hodgkin's disease, by Thallium scintigraphy. 32 patients (14 males and 18 females) who underwent mantle field radiotherapy for Hodgkin's disease were included in this study. Twenty patients received 4 fractions of 2.5 Gy per week and 12, five fraction of 2 Gy per week, delivered on alternate days. All the patients, except three, performed exercise testing electrocardiogram and Thallium-201 tomoscintigraphy. The average time interval from completion of treatment to the study was 7 years (range 3--13 years). No patients had clinical symptoms of cardiac disease. Mean age at the time of the study was 35 years (range 23--48 years). Two electrocardiograms revealed left bundle branch block and the patients were excluded from the study. Only one out of 27 exercise electrocardiograms was abnormal in a patient with mitral valve prolapse, who was also excluded from the study. Twenty-six scintigraphies were evaluable. Twenty-two (85%) were clearly abnormal with partial or complete redistribution on delayed images. The anterior region was affected in 19 of these cases (86%). Four explorations were undoubtedly normal. Coronary angiography was not performed for ethical reasons in these asymptomatic patients. Despite possible false positive tests, the high rate of abnormality (85%) in this small series is striking. These preliminary data justify larger studies and a close long-term follow-up of these patients. 24 refs., 1 fig., 2 tabs.

  11. Thallium occurrence and partitioning in soils and sediments affected by mining activities in Madrid province (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, M.A.; Garcia-Guinea, J. [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain); Laborda, F. [Group of Analytical Spectroscopy and Sensors Group, Institute of Environmental Sciences, University of Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza (Spain); Garrido, F., E-mail: fernando.garrido@mncn.csic.es [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain)

    2015-12-01

    Thallium (Tl) and its compounds are toxic to biota even at low concentrations but little is known about Tl concentration and speciation in soils. An understanding of the source, mobility, and dispersion of Tl is necessary to evaluate the environmental impact of Tl pollution cases. In this paper, we examine the Tl source and dispersion in two areas affected by abandoned mine facilities whose residues remain dumped on-site affecting to soils and sediments of natural water courses near Madrid city (Spain). Total Tl contents and partitioning in soil solid phases as determined by means of a sequential extraction procedure were also examined in soils along the riverbeds of an ephemeral and a permanent streams collecting water runoff and drainage from the mines wastes. Lastly, electronic microscopy and cathodoluminescence probe are used as a suitable technique for Tl elemental detection on thallium-bearing phases. Tl was found mainly bound to quartz and alumino-phyllosilicates in both rocks and examined soils. Besides, Tl was also frequently found associated to organic particles and diatom frustules in all samples from both mine scenarios. These biogenic silicates may regulate the transfer of Tl into the soil-water system. - Highlights: • Abandoned mine residues are Tl sources in soils of Madrid catchment area. • Tl was associated to quartz and aluminosilicates in both rocks and soils. • Tl was frequently found associated to organic particles and diatom frustules. • Cathodoluminescence is a suitable technique for Tl detection on soils and rocks.

  12. [Detecting Thallium in Water Samples using Dispersive Liquid Phase Microextraction-Graphite Furnace Atomic Absorption Spectroscopy].

    Science.gov (United States)

    Zhu, Jing; Li, Yan; Zheng, Bo; Tang, Wei; Chen, Xiao; Zou, Xiao-li

    2015-11-01

    To develope a method of solvent demulsification dispersive liquid phase microextraction (SD-DLPME) based on ion association reaction coupled with graphite furnace atomic absorption spectroscopy (GFAAS) for detecting thallium in water samples. Methods Thallium ion in water samples was oxidized to Tl(III) with bromine water, which reacted with Cl- to form TlCl4-. The ionic associated compound with trioctylamine was obtained and extracted. DLPME was completed with ethanol as dispersive solvent. The separation of aqueous and organic phase was achieved by injecting into demulsification solvent without centrifugation. The extractant was collected and injected into GFAAS for analysis. With palladium colloid as matrix modifier, a two step drying and ashing temperature programming process was applied for high precision and sensitivity. The linear range was 0.05-2.0 microg/L, with a detection limit of 0.011 microg/L. The relative standard derivation (RSD) for detecting Tl in spiked water sample was 9.9%. The spiked recoveries of water samples ranged from 94.0% to 103.0%. The method is simple, sensitive and suitable for batch analysis of Tl in water samples.

  13. The learning machine in quantitative chemical analysis : Part I. Anodic Stripping Voltammetry of Cadmium, Lead and Thallium

    NARCIS (Netherlands)

    Bos, M.; Jasink, G.

    1978-01-01

    The linear learning machine method was applied to the determination of cadmium, lead and thallium down to 10-8 M by anodic stripping voltammetry at a hanging mercury drop electrode. With a total of three trained multicategory classifiers, concentrations of Cd, Pb and Tl could be predicted with an

  14. Thallium chloride 201Tl combined with single photon emission computed tomography (SPECT) in the evaluation of vestibular schwannoma growth

    DEFF Research Database (Denmark)

    Charabi, Samih Ahmed; Lassen, N A; Thomsen, J

    1997-01-01

    Thallium chloride 201Tl combined with SPECT was performed in a series of 29 patients with neuroradiological evidence of vestibular schwannoma (VS). The relative tumor uptake (U) and relative tumor concentration (C) of the radiotracer 201Tl was determined, and the cerebellum served as a reference...

  15. G196 epitope tag system: a novel monoclonal antibody, G196, recognizes the small, soluble peptide DLVPR with high affinity.

    Science.gov (United States)

    Tatsumi, Kasumi; Sakashita, Gyosuke; Nariai, Yuko; Okazaki, Kosuke; Kato, Hiroaki; Obayashi, Eiji; Yoshida, Hisashi; Sugiyama, Kanako; Park, Sam-Yong; Sekine, Joji; Urano, Takeshi

    2017-03-07

    The recognition specificity of monoclonal antibodies (mAbs) has made mAbs among the most frequently used tools in both basic science research and in clinical diagnosis and therapies. Precise determination of the epitope allows the development of epitope tag systems to be used with recombinant proteins for various purposes. Here we describe a new family of tag derived from the epitope recognized by a highly specific mAb G196. The minimal epitope was identified as the five amino acid sequence Asp-Leu-Val-Pro-Arg. Permutation analysis was used to characterize the binding requirements of mAb G196, and the variable regions of the mAb G196 were identified and structurally analyzed by X-ray crystallography. Isothermal titration calorimetry revealed the high affinity (Kd = 1.25 nM) of the mAb G196/G196-epitope peptide interaction, and G196-tag was used to detect several recombinant cytosolic and nuclear proteins in human and yeast cells. mAb G196 is valuable for developing a new peptide tagging system for cell biology and biochemistry research.

  16. 30 CFR 19.6 - Specific requirements for approval.

    Science.gov (United States)

    2010-07-01

    ..., EVALUATION, AND APPROVAL OF MINING PRODUCTS ELECTRIC CAP LAMPS § 19.6 Specific requirements for approval. (a... cord and cord armor, 2 and by the general behavior of the lamp equipment during the investigation. The...

  17. Bis(2-mercapto-1-R-imidazolyl)hydroborato complexes of aluminium, gallium, indium and thallium: compounds possessing gallium-gallium bonds and a trivalent thallium alkyl.

    Science.gov (United States)

    Yurkerwich, Kevin; Coleman, Fergal; Parkin, Gerard

    2010-08-14

    The reactions of bis(mercaptoimidazolyl)hydroborato derivatives [Bm(R)]M' (R = Me, Bu(t); M' = Li, Na, Tl) with MX(3) trihalides of aluminium, gallium and indium yield both 1:1 and 2:1 complexes of the types [Bm(R)]MX(2) and [Bm(R)](2)MX, respectively. Structurally characterized examples of the [Bm(R)]MX(2) series include [Bm(Me)]AlCl(2), [Bm(Me)]GaI(2), [Bm(Me)]InI(2), [Bm(Bu(t))]AlCl(2) and [Bm(Bu(t))]GaX(2) (X = Cl, Br, I), while structurally characterized examples of the [Bm(R)](2)MX series include [Bm(Bu(t))](2)InX (X = Cl, Br, I). In addition to the halide complexes, the trivalent dimethyl thallium complex [Bm(Bu(t))]TlMe(2) has been synthesized via the reaction of [Bm(Bu(t))]Tl with Me(2)TlCl. The reactions of [Bm(R)]M' with the monovalent halides, "GaI", InCl and InI, result in disproportionation. In the case of indium, the mononuclear complexes [Bm(Bu(t))](2)InI and [Bm(Bu(t))]InCl(kappa(2)-mim(Bu(t))) are obtained, whereas for gallium, dinuclear compounds that feature Ga-Ga bonds, namely [Bm(R)](GaI)(GaI)[Bm(R)] (R = Me, Bu(t)) have been isolated.

  18. Thallium stress testing does not predict cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Holley, J.L.; Fenton, R.A.; Arthur, R.S. (Univ. of Pittsburgh, PA (USA))

    1991-05-01

    This study assessed the usefulness of thallium stress testing as a predictor of perioperative cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation. Demographic factors influencing the exercise performance in these patients were also examined. The medical records of 189 consecutive patients with diabetic nephropathy who were evaluated for cadaveric renal transplantation were reviewed. Thallium stress testing was the initial examination of cardiovascular status in 141 patients. An adequate examination was one in which at least 70% of maximum heart rate was achieved. A thallium stress test was normal if there were no ST segment depressions on the electrocardiogram and no perfusion abnormalities on the thallium scan. Forty-four patients underwent cardiac catheterization as the initial evaluation (Group C) and four patients underwent transplantation without a formal cardiovascular evaluation (Group D). Sixty-four of the 141 patients undergoing thallium stress testing had an adequate and normal examination (Group A). The incidence of perioperative cardiac events in this group was 2%. Seventy-seven patients (Group B) had an abnormal (n = 41) or an inadequate (n = 36) thallium stress test and most (n = 61) then underwent coronary angiography. The use of beta-blockers was the only predictor of an abnormal or inadequate thallium stress test. Forty-three percent of patients with inadequate or abnormal thallium stress tests had significant coronary artery disease on cardiac catheterization. The perioperative risk of cardiac events was not different in Group A versus Groups B, C, and D combined. Survival of Group A and B patients was not different but was significantly longer than that of Group C patients.

  19. Evaluation of thallium-201 scanning for detection of latent coronary artery disease

    Science.gov (United States)

    Johnson, P. C.; Leblanc, A.; Deboer, L.; Jhingran, S.

    1978-01-01

    The use of thallium imaging as a noninvasive method to accurately screen shuttle passengers for latent coronary artery disease was investigated. All radionuclide procedures were performed using an Anger type camera with a high resolution collimator. A minimum of 200,000 counts were collected for each image using a 20% window centered on the 69-83 keV X-rays. For the images obtained following injection with the patient at rest, the testing was begun 10 minutes after injection. Injections of TT during exercise were made at a point near the termination of the treadmill procedure as determined by either the appearance of ST segment changes on the electrocardiogram consistant with subendocardial ischemia, the appearance of angina-like chest pain in the patient or fatigue in the patient which required cessation of the test. The severity of heart disease was based on the medical history, physical exam, exercise electrocardiograms, chest X-rays and the coronary arteriogram.

  20. Thallium Analysis in Environmental Samples by Inductively Coupled Plasma Mass Spectrometry; Analisis de Talio en Muestras Ambientales por Espectrometria de Masas con Fuente de Plasma de Acoplamiento Inductivo

    Energy Technology Data Exchange (ETDEWEB)

    Higueras, I.; Fernandez, M.; Conde, E.; Gajate, A.

    2008-08-06

    Due to its high toxicity, thallium has been considered by the US Environmental Protection Agency as one of the priority pollutants to be controlled. While being a highly toxic element, thallium has been studied to a much lesser degree than other toxic elements, mainly because thallium is often undetected by classical analytical methods. Thallium is a rare and dispersed element that occurs mainly in sulfur-containing ores. Thus, it is a potential pollutant to surrounding environment, if Tl-rich mineral and/or their industrial wastes are not properly disposed. In this work an Inductively Coupled Plasma Mass Spectrometry analytical procedure has been developed in order to determine thallium in environmental solid samples and its application to the study of this element as a potential pollutant associated with natural and anthropogenic activities. The analytical procedure has been validated by the use of appropriate reference materials, and through the isotope dilution technique as a primary method of measurement. Finally, the developed procedure has been applied to several samples from a mining area, as one of the scenarios where thallium it is likely to occur. (Author) 87 refs.

  1. A Case-Control Study of Prenatal Thallium Exposure and Low Birth Weight in China.

    Science.gov (United States)

    Xia, Wei; Du, Xiaofu; Zheng, Tongzhang; Zhang, Bin; Li, Yuanyuan; Bassig, Bryan A; Zhou, Aifen; Wang, Youjie; Xiong, Chao; Li, Zhengkuan; Yao, Yuanxiang; Hu, Jie; Zhou, Yanqiu; Liu, Juan; Xue, Weiyan; Ma, Yue; Pan, Xinyun; Peng, Yang; Xu, Shunqing

    2016-01-01

    Thallium (Tl) is a highly toxic heavy metal widely present in the environment. Case reports have suggested that maternal exposure to high levels of Tl during pregnancy is associated with low birth weight (LBW), but epidemiological data are limited. This study was designed to evaluate whether prenatal Tl exposure is associated with an increased risk of LBW. This case-control study involving 816 study participants (204 LBW cases and 612 matched controls) was conducted in Hubei Province, China, in 2012-2014. Tl concentrations were measured in maternal urine collected at delivery, and associations with LBW were evaluated using conditional logistic regression. Higher maternal urinary Tl levels were significantly associated with increased risk of LBW [crude odds ratio (OR) = 1.52; 95% CI: 1.00, 2.30 for the highest vs. lowest tertile], and the association was similarly elevated after adjustment for potential confounders (adjusted OR = 1.90; 95% CI: 1.01, 3.58 for the highest vs. lowest tertile). Stratified analyses showed slightly higher risk estimates for LBW associated with higher Tl levels for mothers case-control study to investigate the association between prenatal Tl exposure and LBW. The results suggest that prenatal exposure to high levels of Tl may be associated with an increased risk of LBW. Xia W, Du X, Zheng T, Zhang B, Li Y, Bassig BA, Zhou A, Wang Y, Xiong C, Li Z, Yao Y, Hu J, Zhou Y, Liu J, Xue W, Ma Y, Pan X, Peng Y, Xu S. 2016. A case-control study of prenatal thallium exposure and low birth weight in China. Environ Health Perspect 124:164-169; http://dx.doi.org/10.1289/ehp.1409202.

  2. Evaluation of myocardial abnormalities in patients with collagen diseases by thallium-201 myocardial scintigram

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru (Nara Medical Univ., Kashihara (Japan))

    1992-08-01

    This study was performed to evaluate myocardial lesions in patients with collagen diseases by rest and exercise thallium-201 myocardial scintigraphies. A total of 76 patients without ischemic ECG changes, consisting of 27 cases of systemic lupus erythematosus (SLE), 17 cases of polymyositis or dermatomyositis (PM[center dot]DM), 11 cases of progressive systemic sclerosis (PSS), and 21 cases of Sjoegren's syndrome (SjS), were enrolled in this study. Reversible exercise-induced defects suggesting myocardial ischemia were noted in 12 cases of SLE, 5 cases of PM[center dot]DM, 3 cases of PSS, and 3 cases of SjS. Of the 23 patients who had exercise-induced defects, 9 patients showed normal coronary angiograms by cardiac catheterization. Fixed hypoperfusion areas were observed in 5 cases of SLE, 6 cases of PM[center dot]DM, 4 cases of PSS and 3 cases of SjS. Rest thallium-201 myocardial scintigraphy disclosed hypoperfusion areas, which were not induced by exercise, in 1 case of SLE, 4 cases of PM[center dot]DM, 1 case of PSS and 5 cases of SjS. Endomyocardial biopsy was performed on 20 patients. Myocardial lesions in PM[center dot]DM and PSS were more severe and wide spread than in SLE. Ejection fraction and fractional shortening evaluated by echocardiography had no significant differences between each disease group and the healthy control group. These findings suggest that patients with collagen diseases show the presence of abnormalities of coronary circulation at the level of the intramyocardial vasculature in the stage before impairment of cardiac function, myocardial fibrosis and functional abnormalities of the cell membrane level that were not dependent on myocardial ischemia. (author).

  3. Development and Applications of Thallium isotopes: a new proxy tracking the extent of manganese oxide burial

    Science.gov (United States)

    Owens, J. D.; Nielsen, S.; Ostrander, C.; Peterson, L. C.; Anbar, A. D.

    2015-12-01

    Thallium (Tl) isotopes are a new and potential powerful paleoredox proxy with the possibility to track bottom water oxygen conditions based on the burial flux of manganese oxides. Thallium has a residence time of ~20 thousand years, which is long enough to render modern oxic seawater conservative with respect to concentration and isotopes. The isotopic signature of Tl in the global ocean is driven mainly by two outputs (1) adsorption onto manganese oxides and (2) low temperature oceanic crust alteration. Importantly, the isotopic inputs of Tl are all nearly the same value; thus, the isotopic composition and flux of the outputs almost exclusively set the seawater signature. For relatively short term redox events it is reasonable to assume that the dominant isotope fractionation process is associated with manganese oxide precipitation because low temperature alteration is controlled by long-term average ocean crust production rates. We present a broad range of modern samples that span several open ocean profiles combined with water column and sediment profiles from the permanently anoxic basins of the Black Sea and Cariaco Basins. The open ocean shows no variation in depth profiles that encompass most of the major water masses in the Atlantic and Southern Oceans. The anoxic basins, however, reveal Tl isotope signatures closer to their inputs, which is likely due to basinal restriction. The authigenic fraction of organic-rich sediments from the Black Sea and Cariaco Basin capture the Tl isotope value of the overlying water column, which shows that Tl isotopes could be applied as a faithful deep time redox proxy. For the first time, we will present new data showing that Tl isotopes is tracking bottom water ocean oxygenation. We are applying this isotope system to ancient samples, testing the spatial and temporal variability of ocean oxygenation coinciding with major biogeochemical events.

  4. Thallium myocardial tomoscintigraphy: detection of ischemia during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease. Tomoscintigraphie myocardique au thallium: detection de l'ischemie provoquee par le sevrage de la ventilation assistee chez le bronchiteux chronique

    Energy Technology Data Exchange (ETDEWEB)

    Andre, L.; Valette, H.; Obama, S.; Archambaud, F.; Richard, C.; Teboul, J.L.; Hebert, J.L.; Auzepy, P.; Desgrez, A. (Hopital de Bicetre, 94 - Le Kremlin-Bicetre (FR))

    1990-01-01

    In order to evidence myocardial ischemia-leading to ventricular dysfunction-during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease, thallium myocardial tomography and gated blood pool studies were performed in 9 patients during mechanical ventilation and during weaning from mechanical ventilation. During the latter, results of gated blood pool studies showed a diffuse homogeneous left ventricular dysfunction. A fixed lower thallium uptake in the septum than in the lateral wall was found with the quantitative analysis of myocardial tomograms. Partial volume effect is likely the cause of this septal defect. The hypothesis of a diffuse ischemia cannot be excluded; but, without the absolute quantification of tomographic data, it cannot be proven.

  5. Studies of photon spectra from a thallium-204 foil source as an aid to dosimetry and shielding

    CERN Document Server

    Francis, T M

    1976-01-01

    Beta ray foil sources incorporating nuclides such as thallium-204, promethium-147 and strontium-90 plus yttrium-90 ar increasingly used in industrial devices such as thickness gauges. These sources are so constructed that they give rise to complex photon spectra containing low energy Bremsstrahlung and X-rays characteristic of the constructional materials. The energy response of practical monitoring instruments is such that they are likely to underestimate the dose due to such spectra unless they are calibrated using appropriate spectra. This report describes a series of measurements carried out on a commercially available thallium-204 foil source and five commonly used shielding materials. The measurements made with a NaI(T1) spectrometer have been corrected for instrumental distortions to obtain the photon spectra in air. These spectra are presented and have been used to compute dose in air with the help of published data on mass energy-absorption coefficients. Also included in the report are data derived f...

  6. Septal myocardial perfusion imaging with thallium-201 in the diagnosis of proximal left anterior descending coronary artery disease

    Energy Technology Data Exchange (ETDEWEB)

    Pichard, A.D.; Wiener, I.; Martinez, E.; Horowitz, S.; Patterson, R.; Meller, J.; Goldsmith, S.J.; Gorlin, R.; Herman, M.V.

    1981-07-01

    The use of myocardial perfusion imaging (MPI) to identify obstructive coronary disease of the left anterior descending coronary artery proximal to the first septal perforator (prox LAD) was studied in 60 patients. Perfusion of the septum and anteroapical areas with thallium-201 injected during exercise was compared to results of coronary arteriography. Septal MPI defect was found in 92.3% of patients with obstruction of the proximal LAD, 27.7% of patients with obstruction of LAD distal to first septal perforator, 0% in patients with obstructions involving right or circumflex arteries, and in 10.5% of patients without coronary disease. Anteroapical MPI defects were found with similar frequency in the three groups with obstructive coronary disease. Septal MPI defect had a sensitivity of 92.3% and specificity of 85.4% in the diagnosis of proximal LAD disease. Normal septal perfusion with thallium-201 virtually excluded proximal LAD disease.

  7. Usefulness of rest-redistribution thallium scan for the indication of PTCA in an interesting case with acute myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chiba, Hiroshi; Nishimura, Tsunehiko; Mitani, Isao; Matsuo, Takeshi; Uehara, Toshiisa; Hayashida, Kohei; Sumiyoshi, Tetsuya; Haze, Kazuo

    1988-04-01

    A 72-year-old woman with acute myocardial infarction was received coronary thrombolytic therapy. After percutaneous transluminal coronary recanalization (PTCR), the stenosis of LAD became from 99 % to 90 %. Left ventriculogram showed dyskinesis of anterior wall in acute phase. After PTCR, she complained of postinfarctional angina. Thus, in order to evaluate the viability of anterior wall, serial thallium scintigraphy was performed at rest, which showed perfusion defect and redistribution of anterior wall. After percutaneous transluminal coronary angioplasty (PTCA), anterior wall motion became almost normal. The perfusion defect of anterior wall was also gradually disappeared. The serial thallium scintigraphy at rest is an useful method not only to evaluate the viability of myocardium in acute myocardial infarction, but also to follow the effect of PTCA.

  8. Rearrangement of beta,gamma-unsaturated esters with thallium trinitrate: synthesis of indans bearing a beta-keto ester moiety

    Directory of Open Access Journals (Sweden)

    Silva Jr. Luiz F.

    2006-01-01

    Full Text Available The rearrangement of beta,gamma-unsaturated esters, such as 2-(3,4-dihydronaphthalen-1-yl-propionic acid ethyl ester, with thallium trinitrate (TTN in acetic acid leads to 3-indan-1-yl-2-methyl-3-oxo-propionic acid ethyl ester in good yield, through a ring contraction reaction. The new indans thus obtained feature a beta-keto ester moiety, which would be useful for further functionalization.

  9. Formic acid electrooxidation on thallium-decorated shape-controlled platinum nanoparticles: an improvement in electrocatalytic activity

    OpenAIRE

    Busó-Rogero, Carlos; Perales-Rondón, Juan V.; Farias, Manuel J.S.; Vidal-Iglesias, Francisco J.; Solla-Gullón, José; Herrero, Enrique; Feliu, Juan M.

    2014-01-01

    Thallium modified shape-controlled Pt nanoparticles were prepared and their electrocatalytic activity towards formic acid electrooxidation was evaluated in 0.5 M sulfuric acid. The electrochemical and in situ FTIR spectroscopic results show a remarkable improvement in the electrocatalytic activity, especially in the low potential region (around 0.1–0.2 V vs. RHE). Cubic Pt nanoparticles modified with Tl were found to be more active than the octahedral Pt ones in the entire range of Tl coverag...

  10. Usefulness and limitations of thallium-201 myocardial scintigraphy in delineating location and size of prior myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Niess, G.S.; Logic, J.R.; Russell, R.O. Jr.; Rackley, C.E.; Rogers, W.J.

    1979-05-01

    Thirty-two patients were evaluated at a mean of 7 +- 2 months after infarction with a 12-lead ECG, resting /sup 201/Tl myocardial scintigram, biplane left ventriculogram, and coronary angiograms. From the left ventriculogram, asynergy was quantified as percent abnormally contracting segment (% ACS), the percent of end-diastolic circumference which was either akinetic or dyskinetic. Using a computerized planimetry system, we expressed /sup 201/Tl perfusion defects as a percentage of total potential thallium uptake. Of 21 patients with ECG evidence of prior transmural infarction, a /sup 201/Tl defect was present in 20, and angiographic asynergy was present in all 21. The site of prior infarction by ECG agreed with the /sup 201/T1 defect location in 24 of 32 patients and with site of angiographic asynergy in 23 of 32 patients. Scintigraphic defects were present in only four of 10 patients with ACS less than or equal to 6%, but scintigraphic defects were found in 20 of 22 patients with ACS > 6%. Thallium defect size correlated marginally with angiographic left ventricular ejection fraction but correlated closely with angiographic % ACS. Thallium defect size was similar among patients with one-, two-, or three-vessel coronary artery disease (greater than or equal to 70% stenosis), but thallium defect size was larger in patients with electrocardiographic evidence of transmural infarction or pulmonary capillary wedge pressure > 12 mm Hg. Thus, resting /sup 201/T1 myocardial scintigraphy is useful in localizing and quantifying the extent of prior myocardial infarction, but is insensitive to small infarcts (ACS < 6%).

  11. Determination of thallium at ultra-trace levels in water and biological samples using solid phase spectrophotometry.

    Science.gov (United States)

    Amin, Alaa S; El-Sharjawy, Abdel-Azeem M; Kassem, Mohammed A

    2013-06-01

    A new simple, very sensitive, selective and accurate procedure for the determination of trace amounts of thallium(III) by solid-phase spectrophotometry (SPS) has been developed. The procedure is based on fixation of Tl(III) as quinalizarin ion associate on a styrene-divinylbenzene anion-exchange resin. The absorbance of resin sorbed Tl(III) ion associate is measured directly at 636 and 830 nm. Thallium(I) was determined by difference measurements after oxidation of Tl(I) to Tl(III) with bromine. Calibration is linear over the range 0.5-12.0 μg L(-1) of Tl(III) with relative standard deviation (RSD) of 1.40% (n=10). The detection and quantification limits are 150 and 495 ng L(-1) using 0.6 g of the exchanger. The molar absorptivity and Sandell sensitivity are also calculated and found to be 1.31×10(7) L mol(-1)cm(-1) and 0.00156 ng cm(-2), respectively. The proposed procedure has been successfully applied to determine thallium in water, urine and serum samples. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. The efficient removal of thallium from sintering flue gas desulfurization wastewater in ferrous metallurgy using emulsion liquid membrane.

    Science.gov (United States)

    Yang, Li; Xiao, Jiangping; Shen, Yi; Liu, Xian; Li, Wensong; Wang, Weiyan; Yang, Yunquan

    2017-11-01

    The removal of thallium ions in flue gas desulfurization wastewater from ferrous metallurgic industry was studied by emulsion liquid membrane (ELM) method using 2-ethylhexyl phosphoric acid-2-ethylhexyl ester (P507) as carrier, aviation kerosene (AK) as organic solvent, polyisobutylene succinimide (T154) as surfactant, polyisobutylene (PIB) as additive, and sulfuric acid as internal reagent. Some important influence parameters such as concentrations of carrier, surfactant and stripping agent, agitation speed, extraction time, volume ratios of feed solution to emulsion phase and internal phase to membrane phase, and their effects on the removal efficiency of Tl in the ELM process were investigated and optimized. Under the optimum operating conditions of 2% of carrier, 5% of surfactant, 0.5 M of stripping agent, 350 rpm of agitation speed, 12.5:1 of volume ratio of feed solution to emulsion phase, and 3:1 volume ratio of membrane to internal phase, the maximum extraction efficiency of thallium reached 99.76% within 15-min reaction time. The ICP-MS analysis indicated that the thallium concentration in treated wastewater was below 5 μg/L and could meet the emission standard demand for industrial wastewater enacted by the local government of Hunan province of China. Meanwhile, the extraction of impurity ions calcium and magnesium in the ELM system was investigated. The result showed that an acidic environment would be in favor of the removal of Tl from calcium and magnesium contained in wastewater. Graphical abstract ᅟ.

  13. Thallium isotopes in metallurgical wastes/contaminated soils: A novel tool to trace metal source and behavior.

    Science.gov (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Chrastný, Vladislav; Penížek, Vít; Teper, Leslaw; Cabala, Jerzy; Voegelin, Andreas; Zádorová, Tereza; Oborná, Vendula; Drábek, Ondřej; Holubík, Ondřej; Houška, Jakub; Pavlů, Lenka; Ash, Christopher

    2018-02-05

    Thallium (Tl) concentration and isotope data have been recorded for contaminated soils and a set of industrial wastes that were produced within different stages of Zn ore mining and metallurgical processing of Zn-rich materials. Despite large differences in Tl levels of the waste materials (1-500mgkg-1), generally small changes in ε205Tl values have been observed. However, isotopically lighter Tl was recorded in fly ash (ε205Tl∼-4.1) than in slag (ε205Tl∼-3.3), implying partial isotope fractionation during material processing. Thallium isotope compositions in the studied soils reflected the Tl contamination (ε205Tl∼-3.8), despite the fact that the major pollution period ended more than 30 years ago. Therefore, we assume that former industrial Tl inputs into soils, if significant, can potentially be traced using the isotope tracing method. We also suggest that the isotope redistributions occurred in some soil (subsurface) horizons, with Tl being isotopically heavier than the pollution source, due to specific sorption and/or precipitation processes, which complicates the discrimination of primary Tl. Thallium isotope analysis proved to be a promising tool to aid our understanding of Tl behavior within the smelting process, as well as its post-depositional dynamics in the environmental systems (soils). Copyright © 2017 Elsevier B.V. All rights reserved.

  14. 32 CFR 196.445 - Marital or parental status.

    Science.gov (United States)

    2010-07-01

    ...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196... a student's actual or potential parental, family, or marital status that treats students differently...

  15. Phenotype abnormality: 196 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 196 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u702i decreased number... of shoot-borne shoot system in organ named trichome ... trichome ... present in fewer numbers in organism ... shoot-borne shoot system ...

  16. Phenotype-gene: 196 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 196 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u3ria224u1194i decreased sensitivity under influence... http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u17347412i decreased sensitivity under influence o

  17. 32 CFR 196.400 - Education programs or activities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Education programs or activities. 196.400... (CONTINUED) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...

  18. 38 CFR 17.196 - Aid for hospital care.

    Science.gov (United States)

    2010-07-01

    ... quarters of nursing home care patients or domiciliary members, and meet such other minimum standards as the... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Aid for hospital care. 17... to States for Care of Veterans in State Homes § 17.196 Aid for hospital care. Aid may be paid to the...

  19. Thallium-isotopic compositions of euxinic sediments as a proxy for global manganese-oxide burial

    Science.gov (United States)

    Owens, Jeremy D.; Nielsen, Sune G.; Horner, Tristan J.; Ostrander, Chadlin M.; Peterson, Larry C.

    2017-09-01

    Thallium (Tl) isotopes are a new and potentially powerful paleoredox proxy that may track bottom water oxygen conditions based on the global burial flux of manganese oxides. Thallium has a residence time of ∼20 thousand years, which is longer than the ocean mixing time, and it has been inferred that modern oxic seawater is conservative with respect to both concentration and isotopes. Marine sources of Tl have nearly identical isotopic values. Therefore, the Tl sinks, adsorption onto manganese oxides and low temperature oceanic crust alteration (the dominant seawater output), are the primary controls of the seawater isotopic composition. For relatively short-term, ∼million years, redox events it is reasonable to assume that the dominant mechanism that alters the Tl isotopic composition of seawater is associated with manganese oxide burial because large variability in low temperature ocean crust alteration is controlled by long-term, multi-million years, average ocean crust production rates. This study presents new Tl isotope data for an open ocean transect in the South Atlantic, and depth transects for two euxinic basins (anoxic and free sulfide in the water column), the Cariaco Basin and Black Sea. The Tl isotopic signature of open ocean seawater in the South Atlantic was found to be homogeneous with ε205Tl = -6.0 ± 0.3 (±2 SD, n = 41) while oxic waters from Cariaco and the Black Sea are -5.6 and -2.2, respectively. Combined with existing data from the Pacific and Arctic Oceans, our Atlantic data establish the conservatism of Tl isotopes in the global ocean. In contrast, partially- and predominantly-restricted basins reveal Tl isotope differences that vary between open-ocean (-6) and continental material (-2) ε205Tl, scaling with the degree of restriction. Regardless of the differences between basins, Tl is quantitatively removed from their euxinic waters below the chemocline. The burial of Tl in euxinic sediments is estimated to be an order of magnitude

  20. Thallium isotopes as a potential tracer for the origin of cratonic eclogites

    Science.gov (United States)

    Nielsen, Sune G.; Williams, Helen M.; Griffin, William L.; O'Reilly, Suzanne Y.; Pearson, Norman; Viljoen, Fanus

    2009-12-01

    Cratonic eclogites are inferred to originate either from subducted ocean crust or mantle melts accreted onto the roots of continents. These models have different implications for the growth of continents, but it is currently difficult to determine the origin of individual eclogite suites. Upper ocean crust altered at low temperatures and marine sediments both display high thallium (Tl) concentrations and strongly fractionated Tl isotope signatures relative to the ambient upper mantle. In this study we carry out the first examination of the suitability of Tl isotopes as a tracer for an ocean-crust origin of cratonic eclogites. We have analysed the Tl isotope composition of clinopyroxene and garnet in six eclogites from the Kaalvallei and Bellsbank kimberlite pipes in South Africa. Minerals were pre-cleaned with an HCl leaching technique and the leachates display variably light Tl isotope ratios. These most likely reflect low-temperature hydrothermal alteration occurring after eruption of the kimberlite that carried the eclogites to the surface. The leached mineral pairs all display identical Tl isotope ratios, strongly suggesting that the source of the analysed Tl is identical for each mineral pair. It is, however, not possible to exclude the possibility that the analysed Tl originates from kimberlitic material that was not removed by the cleaning procedure. Only one of the six samples exhibits a Tl isotope composition different from ambient mantle. Assuming that the Tl isotope signatures indeed represent the eclogite minerals and not any form of contamination, the Tl isotope composition in this sample is consistent with containing a minor component (low temperatures. Thallium isotopes may become one of the most sensitive indicators for the presence of low-T altered ocean crust because of the stark contrast in Tl concentration and isotopic composition between the mantle and altered ocean crust. In fact, no other chemical or isotopic tracer could have provided an

  1. Thallium-201 SPECT in the diagnosis of head and neck cancer.

    Science.gov (United States)

    Valdés Olmos, R A; Balm, A J; Hilgers, F J; Koops, W; Loftus, B M; Tan, I B; Muller, S H; Hoefnagel, C A; Gregor, R T

    1997-06-01

    The accuracy of SPECT with 201Tl-chloride for the diagnosis of primary tumors, lymph node metastases and recurrences in head and neck cancer was evaluated for clinical applicability. SPECT images, obtained 60 min after administration of 150 MBq 201Tl-chloride, were compared with clinical, CT and/or MRI and histology results. In addition, whole-body images were obtained to detect distant metastases. In 79 patients studied for primary tumors (principally larynix, hypopharynx, oropharynx, nasopharynx and oral cavity), 201Tl SPECT correctly identified 69 of 73 (95% versus 88% for CT/MRI) histologically confirmed malignancies including 63 squamous-cell carcinomas. The method localized four occult naso- and oropharynx carcinomas not seen on CT/MRI and was correctly negative in two patients without tumor and in three of four patients with no confirmed primary tumor in the head and neck. With respect to regional spread, only patients who had cervical lymph node dissection were evaluated, and the findings were recorded per side of the neck. Thallium-201 SPECT correctly identified metastases in 31 of 36 neck dissections with proven lymph node involvement (86%), was correctly negative in nine and false-positive in one. Although the sensitivity of CT/MRI was clearly higher (97%), considerably more false-positive cases affected its accuracy (81% versus 87% for SPECT). In 30 patients investigated for recurrences, 201Tl SPECT correctly identified 27 of 29 microscopically confirmed tumor sites (93%) and was correctly negative in seven. Sensitivity of CT/MRI was lower (76%), and a greater number of false-positives (seven versus three for SPECT) further decreased its accuracy (64% versus 87% for SPECT). Distant metastases were detected in five patients. Thallium-201 SPECT appears to be an accurate method for the diagnosis of head and neck cancer. The method is particularly useful for detection of occult head and neck tumors and for assessing recurrences. It also may be of

  2. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland.

    Science.gov (United States)

    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata

    2015-01-01

    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50% of the spawn samples, levels exceeded 20 mgTl/kg d.w. The issue of maternal transfer of thallium from females to oocytes is discussed. Due to a significant accumulation of thallium, spawn analysis can be used as a sensitive indicator of the presence of this element in the environment and may replace more invasive methods that involve the killing of adult animals. In those regions that are abundant in Zn-Pb ores, the spawn of amphibians may be a very important source of thallium contamination for predators. From among all tissues of the Bukowno adult toads, the livers have shown the highest accumulation of thallium (mean 3.98 mg/kg d.w. and maximum value--18.63). For as many as 96.5% of livers, concentrations exceeded 1.0 mgTl/kg d.w. which is treated as indicative of poisoning.

  3. In-situ pre-concentration through repeated sampling and pyrolysis for ultrasensitive determination of thallium in drinking water by electrothermal atomic absorption spectrometry.

    Science.gov (United States)

    Liu, Liwei; Zheng, Huaili; Xu, Bincheng; Xiao, Lang; Chigan, Yong; Zhangluo, Yilan

    2018-03-01

    In this paper, a procedure for in-situ pre-concentration in graphite furnace by repeated sampling and pyrolysis is proposed for the determination of ultra-trace thallium in drinking water by graphite furnace atomic absorption spectrometry (GF-AAS). Without any other laborious enrichment processes that routinely result in analyte loss and contamination, thallium was directly concentrated in the graphite furnace automatically and subsequently subject to analysis. The effects of several key factors, such as the temperature for pyrolysis and atomization, the chemical modifier, and the repeated sampling times were investigated. Under the optimized conditions, a limit of detection of 0.01µgL -1 was obtained, which fulfilled thallium determination in drinking water by GB 5749-2006 regulated by China. Successful analysis of thallium in certified water samples and drinking water samples was demonstrated, with analytical results in good agreement with the certified values and those by inductively coupled plasma mass spectrometry (ICP-MS), respectively. Routine spike-recovery tests with randomly selected drinking water samples showed satisfactory results of 80-96%. The proposed method is simple and sensitive for screening of ultra-trace thallium in drinking water samples. Copyright © 2017. Published by Elsevier B.V.

  4. The ECG component of Thallium-201 exercise testing impacts on cardiac intervention rates

    Energy Technology Data Exchange (ETDEWEB)

    Deague, J.; Salehi, N.; Grigg, L.; Lichtenstein, M.; Better, N. [Royal Melbourne Hospital, Parkville, VIC (Australia). Departments of Nuclear Medicine and Cardiology

    1998-06-01

    Full text: Thallium exercise testing (Tlex) offers superior sensitivity and specificity to exercise electrocardiography (ECG), but the value of the ECG data in Tlex remains poorly studied. While a normal Tlex is associated with an excellent prognosis, patients with a positive Tlex have a higher cardiac event rate. We aimed to see if a negative ECG Component of the Tlex (ECGTl) was associated with an improved outcome compared with a positive ECGTl, in those patients with a reversible Tlex defect. We followed 100 consecutive patients retrospectively with a reversible defect on Tlex (50 with negative and 50 with positive ECGTI) for 12 months. The ECG was reviewed as positive (1mm ST depression 0.08 seconds after J point or >2mm if on digoxin or prior ECG changes), negative, equivocal or uninterpretable. We excluded patients with pharmacological testing, and those with equivocal or uninterpretable ECGs. End-points included angiography, cardiac interventions and cardiac event rate (CER) incorporating unstable angina, acute myocardial infarction, and cardiac death. In conclusion 24% of patients with reversible defects on Tlex who had a negative ECGTI still proceeded to PTCA or CABG. Those with a positive ECGTI had a higher incidence of angiography and cardiac revascularisation, but this difference was only evident in patients with mild to moderate reversibility

  5. Redox-controlled release dynamics of thallium in periodically flooded arable soil.

    Science.gov (United States)

    Antić-Mladenović, Svetlana; Frohne, Tina; Kresović, Mirjana; Stärk, Hans-Joachim; Savić, Dubravka; Ličina, Vlado; Rinklebe, Jörg

    2017-07-01

    To our knowledge, this is the first work to mechanistically study the impact of the redox potential (E H ) and principal factors, such as pH, iron (Fe), manganese (Mn), dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), chlorides (Cl - ) and sulfates (SO 4 2- ), on the release dynamics of thallium (Tl) in periodically flooded soil. We simulated flooding using an automated biogeochemical microcosm system that allows for systematical control of pre-defined redox windows. The E H value was increased mechanistically at intervals of approximately 100 mV from reducing (-211 mV) to oxidizing (475 mV) conditions. Soluble Tl levels (0.02-0.28 μg L -1 ) increased significantly with increases in E H (r = 0.80, p soils along with a determination of the Tl species and monitoring of the Tl content in plants to achieve more detailed insight into soluble Tl behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. EFFECTS OF THALLIUM ON THE LARVAL DEVELOPMENT OF LUCILIA SERICATA MEIGEN 1826 AND PMI ESTIMATION

    Directory of Open Access Journals (Sweden)

    Arif Gökhan BAŞARAN

    2011-08-01

    Full Text Available Determination of larval growth rate of and forensic analysis of the age of Calliphoridae larvae on a corpse are useful evidence in legal investigations for the estimation of exact death time and time duration after death; post mortem interval. However many factors, such as temperature, tissue type and contamination of drugs and toxins, effect larval development of blow fly larvae and consequently theestimation of post mortem interval. The present study examined the larval growth rate of a forensically important blow fly species, Lucilia sericata Meigen 1826 in different concentrations (0,12; 0,25; 0,50; 1 and 2 μg/g of toxic heavy metal Thallium under controlled laboratory conditions. Body length and weight, death ratio of larvae and pupa between experimental and control groups were compared. Results demonstrated that the development rate of larvae between uncontaminated and contaminated diets varies significantly. In short, they molted later, reached maximum length more slowly and sometimesproduced significantly smaller pupae in contaminated food source. These results emphasized that the importance of determining the contamination rate of toxins in tissue for the forensic entomologist,while using development rates from standard curves based on larvae fed non-contaminated mediums.

  7. Value of transient dilation of the left ventricular cavity on stress thallium scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Sugihara, Hiroki; Shiga, Kouji; Umamoto, Ikuo (Kyoto Prefectural Univ. of Medicine (Japan)) (and others)

    1991-02-01

    This study was undertaken to evaluate the value of transient dilation of the left ventricular cavity on stress thallium scintigraphy in 80 patients with ischemic heart disease (IHD) and 50 with hypertrophic cardiomyopathy (HCM). Twenty persons without either coronary artery stenosis or heart disease were served as controls. Areas surrounded by maximum count points on the line of each 10deg on the short axis slice through the mid-cavity of the left ventricle were obtained at 10 minutes and at 3 hours after exercise. Transient dilation index (TDI) was obtained by dividing the area on early image by that on delayed image. TDI was significantly higher in patients with two or three vessel disease in the IHD group than the control group. High TDI was observed in 8% for one vessel disease, 40% for two vessel disease, and 80% for three vessel disease, contributing to the detection of multivessel IHD. In the HCM group of 80 patients, 24 (48%) had high TDI which was frequently associated with a history of chest pain and positive ECG findings at exercise. When these 24 HCM patients underwent exercise blood pool scintiscanning, left ventricular enddiastolic volume was similar before and at 10 minutes after exercise. These findings suggest that transient dilation of the left ventricular cavity after exercise may reflect subendocardial ischemia in both IHD and HCM. TDI would become a useful indicator for transient dilation of the left ventricular cavity. (N.K.).

  8. Clinicopathologic correlation study of thallium-201 myocardial scintigraphy in diagnosis of myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chida, Kouji; Sugiura, Masaya; Ohkawa, Shin-ichiro

    1987-05-01

    In a series of 1,000 consecutive autopsy cases, we evaluated the clinical utility of thallium-201 (Tl-201) myocardial scintigraphy and electrocardiography (ECG) in 101 patients who had been studied while alive. Fifty-five cases had myocardial infarctions (MI) at autopsy. The Tl-201 scintigram and ECG in diagnosis of MI showed sensitivities of 68 % and 60 %, specificities of 87 % and 83 %, and diagnostic accuracies of 76 % and 70 %, respectively. The sensitivity of the Tl-201 scintigram was 70 % in anterior MI, 80 % in postero-inferior MI, 25 % in lateral and subendocardial infarction. The sensitivity was 88 % for large massive MI, but was low in scattered (50 %) or middle-sized MI (17 %). The diagnostic limit of the resolution of Tl-201 scintigrams was 4.5 cm in long diameter. All 8 cases with MI of less than 4 cm could not be diagnosed with the technique. There were 48 cases of large MI (more than 5 cm), but 8 cases could not be diagnosed by scintigraphy because of non-transmural or scattered MI. A comparison of the Tl-201 scintigram and ECG showed that 27 cases out of 60 cases were diagnosed by both methods, 14 only by the Tl-201 scintigram, 9 only by ECG and 10 by neither method.

  9. Evaluation of myocardial damage in Duchenne's muscular dystrophy with thallium-201 myocardial SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Tamura, Takuhisa; Shibuya, Noritoshi (Kawatana National Hospital, Nagasaki (Japan)); Hashiba, Kunitake; Oku, Yasuhiko; Mori, Hideki; Yano, Katsusuke

    1993-01-01

    Myocardial damage and cardiopulmonary functions in patients with Duchenne's muscular dystrophy (DMD) were assessed using thallium-201 myocardial single-photon emission computed tomography (SPECT) and technetium-99m multigated radionuclide angiography. Twenty-five patients with DMD were divided into 4 groups according to percent of perfusion defect (%PD) calculated by the bull's-eye method and age. PD was detected in 24 (96.0%) of 25 patients with DMD, and it spread from the left ventricular lateral wall to the anterior wall and/or interventricular septum. PD was detected even in a 6-year-old DMD boy. Patients in Group I (%PD[>=]10% and age<15 years old) were shown to have a higher risk of left-sided heart failure without respiratory failure. Patients in Group II (%PD[>=]10 and age[>=]15) showed decreased pulmonary function and worsened arterial blood gas values as compared with Group IV (%PD<10 and age[>=]15). There was no significant difference in cardiac function among the 4 groups. It is postulated that myocardial damage in Group II patients is dependent primarily on a deficiency of dystrophin and on chronic respiratory failure, and that some of them are at risk of cardiopulmonary failure. It is concluded that myocardial SPECT is useful for the early diagnosis of myocardial damage and evaluation of cardiopulmonary function in DMD patients. (author).

  10. Role of relativity in high-pressure phase transitions of thallium.

    Science.gov (United States)

    Kotmool, Komsilp; Chakraborty, Sudip; Bovornratanaraks, Thiti; Ahuja, Rajeev

    2017-02-20

    We demonstrate the relativistic effects in high-pressure phase transitions of heavy element thallium. The known first phase transition from h.c.p. to f.c.c. is initially investigated by various relativistic levels and exchange-correlation functionals as implemented in FPLO method, as well as scalar relativistic scheme within PAW formalism. The electronic structure calculations are interpreted from the perspective of energetic stability and electronic density of states. The full relativistic scheme (FR) within L(S)DA performs to be the scheme that resembles mostly with experimental results with a transition pressure of 3 GPa. The s-p hybridization and the valence-core overlapping of 6s and 5d states are the primary reasons behind the f.c.c. phase occurrence. A recent proposed phase, i.e., a body-centered tetragonal (b.c.t.) phase, is confirmed with a small distortion from the f.c.c. phase. We have also predicted a reversible b.c.t. → f.c.c. phase transition at 800 GPa. This finding has been suggested that almost all the III-A elements (Ga, In and Tl) exhibit the b.c.t. → f.c.c. phase transition at extremely high pressure.

  11. High thallium concentrations in soils from sites of historical Ag, Pb, and Zn mining in western Małopolska (S Poland

    Directory of Open Access Journals (Sweden)

    Woch M. W.

    2013-04-01

    Full Text Available The aim of this study was to assess thallium concentration in topsoil originating from sites of historical mining of Ag, Pb and Zn in western Małopolska (S Poland. Soil samples were collected from 63 sites, sieved, ground and digested in hot HClO4. Thallium concentration was measured with an atomic absorption spectrometer. Thallium concentrations averaged 20.84 mg kg-1 and varied from 4.42 to 49.82 mg kg-1. In all studied soils they exceeded values typical for uncontaminated soils (0.02 to 2.8 mg Tl kg-1. This indicates that Tl contamination may threaten the environment and public health. Routine monitoring of Tl contamination in southern Poland is required.

  12. Preconcentration of thallium(III) with 2,6-bis( N-phenyl carbamoyl) pyridine on microcrystalline naphthalene prior to its trace determination in human serum spectrophotometrically

    Science.gov (United States)

    Rezaei, B.; Meghdadi, S.; Majidi, N.

    2007-05-01

    A novel, simple, sensitive and effective method has been developed for preconcentration of thallium on 2,6-bis( N-phenyl carbamoyl)pyridine-naphthalene adsorbent in the pH range 5.0-10.0, prior to its spectrophotometric determination, based on the oxidation of bromopyrogallol red at λ = 518 nm. This method makes it possible to quantitize thallium in the range of 3.0 × 10 -9 to 1.0 × 10 -5 M, with a detection limit (S/N = 3) of 1.2 × 10 -9 M. This procedure has been successfully applied to determine the ultra trace levels of thallium in the environmental and biological samples, free from the interference of some diverse ions. The precision, expressed as relative standard deviation of three measurements is better than 4.17%.

  13. 46 CFR 196.30-20 - Breaking of safety valve seal.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Breaking of safety valve seal. 196.30-20 Section 196.30... OPERATIONS Reports of Accidents, Repairs, and Unsafe Equipment § 196.30-20 Breaking of safety valve seal. (a) If at any time it is necessary to break the seal on a safety valve for any purpose, the Chief...

  14. 22 CFR 196.3 - Grants to post-secondary education institutions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grants to post-secondary education institutions. 196.3 Section 196.3 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.3 Grants to post...

  15. 22 CFR 196.2 - How is the Fellowship Program administered?

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false How is the Fellowship Program administered? 196.2 Section 196.2 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.2 How is the Fellowship Program...

  16. Biphasic thallium 201 SPECT-imaging for the noninvasive diagnosis of myocardial perfusion abnormalities in a child with Kawasaki disease--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Hausdorf, G.; Nienaber, C.A.; Spielman, R.P.

    1988-02-01

    The mucocutaneous lymph node syndrome (Kawasaki disease) is of increasing importance for the pediatric cardiologist, for coronary aneurysms with the potential of thrombosis and subsequent stenosis can develop in the course of the disease. The authors report a 2 1/2-year-old female child in whom, fourteen months after the acute phase of Kawasaki disease, myocardial infarction occurred. Biphasic thallium 201 SPECT-imaging using dipyridamole depicted anterior wall ischemia and inferolateral infarction. This case demonstrates that noninvasive vasodilation-redistribution thallium 201 SPECT-imaging has the potential to predict reversible myocardial perfusion defects and myocardial necrosis, even in small infants with Kawasaki disease.

  17. Influence of the Dirac-Hartree-Fock starting potential on the parity-nonconserving electric-dipole-transition amplitudes in cesium and thallium

    Science.gov (United States)

    Perger, W. F.; Das, B. P.

    1987-01-01

    The parity-nonconserving electric-dipole-transition amplitudes for the 6s1/2-7s1/2 transition in cesium and the 6p1/2-7p1/2 transition in thallium have been calculated by the Dirac-Hartree-Fock method. The effects of using different Dirac-Hartree-Fock atomic core potentials are examined and the transition amplitudes for both the length and velocity gauges are given. It is found that the parity-nonconserving transition amplitudes exhibit a greater dependence on the starting potential for thallium than for cesium.

  18. Assessment of myocardial viability by dynamic tomographic iodine 123 iodophenylpentadecanoic acid imaging: comparison with rest-redistribution thallium 201 imaging.

    Science.gov (United States)

    Iskandrian, A S; Powers, J; Cave, V; Wasserleben, V; Cassell, D; Heo, J

    1995-01-01

    This study examined the ability of dynamic 123I-labeled iodophenylpentadecanoic acid (IPPA) imaging to detect myocardial viability in patients with left ventricular (LV) dysfunction caused by coronary artery disease. Serial 180-degree single-photon emission computed tomographic (SPECT) images (five sets, 8 minutes each) were obtained starting 4 minutes after injection of 2 to 6 mCi 123I at rest in 21 patients with LV dysfunction (ejection fraction [EF] 34% +/- 11%). The segmental uptake was compared with that of rest-redistribution 201Tl images (20 segments/study). The number of perfusion defects (reversible and fixed) was similar by IPPA and thallium (11 +/- 5 vs 10 +/- 5 segments/patient; difference not significant). There was agreement between IPPA and thallium for presence or absence (kappa = 0.78 +/- 0.03) and nature (reversible, mild fixed, or severe fixed) of perfusion defects (kappa = 0.54 +/- 0.04). However, there were more reversible IPPA defects than reversible thallium defects (7 +/- 4 vs 3 +/- 4 segments/patient; p = 0.001). In 14 patients the EF (by gated pool imaging) improved after coronary revascularization from 33% +/- 11% to 39% +/- 12% (p = 0.002). The number of reversible IPPA defects was greater in the seven patients who had improvement in EF than in the patients without such improvement (10 +/- 4 vs 5 +/- 4 segments/patient; p = 0.075). 123I-labeled IPPA SPECT imaging is a promising new technique for assessment of viability. Reversible defects predict recovery of LV dysfunction after coronary revascularization.

  19. Octupole vibration in the superdeformed {sup 196}Pb nucleus; Vibration octupolaire dans le noyau superdeforme {sup 196}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Bouneau, S.; Azaiez, F.; Duprat, J. [Experimental Research Division, Inst. de Physique Nucleaire, Paris-11 Univ., 91 - Orsay (France)] [and others

    1999-11-01

    The study of the superdeformed (SD) {sup 196}Pb nucleus has been revisited using the EUROGAM phase 2 spectrometer. All the three observed excited SD bands were found to decay to the Yrast SD band through, presumably, E1 transitions, allowing relative spin and excited energy assignments. Comparisons with calculation using the random phase approximation suggests that all three excited bands can be interpreted as octupole vibrational structures. (authors) 5 refs., 1 fig.

  20. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) of the thallium superconducting phases

    Science.gov (United States)

    Bayya, S. S.; Snyder, R. L.

    1994-05-01

    This paper explores the speed of reaction as a parameter to minimizing thallium loss. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) were developed for the synthesis of Tl-2212 and Tl-2223 superconductors using Cu metal powder as a fuel. A kitchen microwave oven was used to carry out MACS reactions. The samples were reacted for few seconds and led to the formation of the superconducting phases. Further explorations and modifications in the processing could lead to the formation of single phases by MACS.

  1. Independent regulation of vertebral number and vertebral identity by microRNA-196 paralogs.

    Science.gov (United States)

    Wong, Siew Fen Lisa; Agarwal, Vikram; Mansfield, Jennifer H; Denans, Nicolas; Schwartz, Matthew G; Prosser, Haydn M; Pourquié, Olivier; Bartel, David P; Tabin, Clifford J; McGlinn, Edwina

    2015-09-01

    The Hox genes play a central role in patterning the embryonic anterior-to-posterior axis. An important function of Hox activity in vertebrates is the specification of different vertebral morphologies, with an additional role in axis elongation emerging. The miR-196 family of microRNAs (miRNAs) are predicted to extensively target Hox 3' UTRs, although the full extent to which miR-196 regulates Hox expression dynamics and influences mammalian development remains to be elucidated. Here we used an extensive allelic series of mouse knockouts to show that the miR-196 family of miRNAs is essential both for properly patterning vertebral identity at different axial levels and for modulating the total number of vertebrae. All three miR-196 paralogs, 196a1, 196a2, and 196b, act redundantly to pattern the midthoracic region, whereas 196a2 and 196b have an additive role in controlling the number of rib-bearing vertebra and positioning of the sacrum. Independent of this, 196a1, 196a2, and 196b act redundantly to constrain total vertebral number. Loss of miR-196 leads to a collective up-regulation of numerous trunk Hox target genes with a concomitant delay in activation of caudal Hox genes, which are proposed to signal the end of axis extension. Additionally, we identified altered molecular signatures associated with the Wnt, Fgf, and Notch/segmentation pathways and demonstrate that miR-196 has the potential to regulate Wnt activity by multiple mechanisms. By feeding into, and thereby integrating, multiple genetic networks controlling vertebral number and identity, miR-196 is a critical player defining axial formulae.

  2. Tracking along-arc sediment inputs to the Aleutian arc using thallium isotopes

    Science.gov (United States)

    Nielsen, Sune G.; Yogodzinski, Gene; Prytulak, Julie; Plank, Terry; Kay, Suzanne M.; Kay, Robert W.; Blusztajn, Jerzy; Owens, Jeremy D.; Auro, Maureen; Kading, Tristan

    2016-05-01

    Sediment transport from the subducted slab to the mantle wedge is an important process in understanding the chemical and physical conditions of arc magma generation. The Aleutian arc offers an excellent opportunity to study sediment transport processes because the subducted sediment flux varies systematically along strike (Kelemen et al., 2003) and many lavas exhibit unambiguous signatures of sediment addition to the sub-arc mantle (Morris et al., 1990). However, the exact sediment contribution to Aleutian lavas and how these sediments are transported from the slab to the surface are still debated. Thallium (Tl) isotope ratios have great potential to distinguish sediment fluxes in subduction zones because pelagic sediments and low-temperature altered oceanic crust are highly enriched in Tl and display heavy and light Tl isotope compositions, respectively, compared with the upper mantle and continental crust. Here, we investigate the Tl isotope composition of lavas covering almost the entire Aleutian arc a well as sediments outboard of both the eastern (DSDP Sites 178 and 183) and central (ODP Hole 886C) portions of the arc. Sediment Tl isotope compositions change systematically from lighter in the Eastern to heavier in the Central Aleutians reflecting a larger proportion of pelagic sediments when distal from the North American continent. Lavas in the Eastern and Central Aleutians mirror this systematic change to heavier Tl isotope compositions to the west, which shows that the subducted sediment composition is directly translated to the arc east of Kanaga Island. Moreover, quantitative mixing models of Tl and Pb, Sr and Nd isotopes reveal that bulk sediment transfer of ∼0.6-1.0% by weight in the Eastern Aleutians and ∼0.2-0.6% by weight in the Central Aleutians can account for all four isotope systems. Bulk mixing models, however, require that fractionation of trace element ratios like Ce/Pb, Cs/Tl, and Sr/Nd in the Central and Eastern Aleutians occurs after

  3. Controls on thallium uptake during hydrothermal alteration of the upper ocean crust

    Science.gov (United States)

    Coggon, Rosalind M.; Rehkämper, Mark; Atteck, Charlotte; Teagle, Damon A. H.; Alt, Jeffrey C.; Cooper, Matthew J.

    2014-11-01

    Hydrothermal circulation is a fundamental component of global biogeochemical cycles. However, the magnitude of the high temperature axial hydrothermal fluid flux remains disputed, and the lower temperature ridge flank fluid flux is difficult to quantify. Thallium (Tl) isotopes behave differently in axial compared to ridge flank systems, with Tl near-quantitatively stripped from the intrusive crust by high temperature hydrothermal reactions, but added to the lavas during low temperature reaction with seawater. This contrasting behavior provides a unique approach to determine the fluid fluxes associated with axial and ridge flank environments. Unfortunately, our understanding of the Tl isotopic mass balance is hindered by poor knowledge of the mineralogical, physical and chemical controls on Tl-uptake by the ocean crust. Here we use analyses of basaltic volcanic upper crust from Integrated Ocean Drilling Program Hole U1301B on the Juan de Fuca Ridge flank, combined with published analyses of dredged seafloor basalts and upper crustal basalts from Holes 504B and 896A, to investigate the controls on Tl-uptake by mid-ocean ridge basalts and evaluate when in the evolution of the ridge flank hydrothermal system Tl-uptake occurs. Seafloor basalts indicate an association between basaltic uptake of Tl from cold seawater and uptake of Cs and Rb, which are known to partition into K-rich phases. Although there is no clear relationship between Tl and K contents of seafloor basalts, the data do not rule out the incorporation of at least some Tl into the same minerals as the alkali elements. In contrast, we find no relationship between the Tl content and either the abundance of secondary phyllosilicate minerals, or the K, Cs or Rb contents in upper crustal basalts. We conclude that the uptake of Tl and alkali elements during hydrothermal alteration of the upper crust involves different processes and/or mineral phases compared to those that govern seafloor weathering. Furthermore

  4. Chemistry and phase evolution during roasting of toxic thallium-bearing pyrite.

    Science.gov (United States)

    Lopez-Arce, Paula; Garcia-Guinea, Javier; Garrido, Fernando

    2017-08-01

    In the frame of a research project on microscopic distribution and speciation of geogenic thallium (Tl) from contaminated mine soils, Tl-bearing pyrite ore samples from Riotinto mining district (Huelva, SW Spain) were experimentally fired to simulate a roasting process. Concentration and volatility behavior of Tl and other toxic heavy metals was determined by quantitative ICP-MS, whereas semi-quantitative mineral phase transitions were identified by in situ thermo X-Ray Diffraction (HT-XRD) and Scanning Electron Microscopy with Energy Dispersive Spectroscopy (SEM-EDS) analyses after each firing temperature. Sample with initial highest amount of quartz (higher Si content), lowest quantity of pyrite and traces of jarosite (lower S content) developed hematite and concentrated Tl (from 10 up to 72 mg kg-1) after roasting at 900 °C in an oxidizing atmosphere. However, samples with lower or absent quartz content and higher pyrite amount mainly developed magnetite, accumulating Tl between 400 and 500 °C and releasing Tl from 700 up to 900 °C (from 10-29 mg kg-1 down to 4-1 mg kg-1). These results show the varied accumulative, or volatile, behaviors of one of the most toxic elements for life and environment, in which oxidation of Tl-bearing Fe sulfides produce Fe oxides wastes with or without Tl. The initial chemistry and mineralogy of pyrite ores should be taken into account in coal-fired power stations, cement or sulfuric acid production industry involving pyrite roasting processes, and steel, brick or paint industries, which use iron ore from roasted pyrite ash, where large amounts of Tl entail significant environmental pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Measurement of the parity nonconserving neutral weak interaction in atomic thallium

    Energy Technology Data Exchange (ETDEWEB)

    Bucksbaum, P.H.

    1980-11-01

    This thesis describes an experiment to measure parity nonconservation in atomic thallium. A frequency doubled, flashlamp pumped tunable dye laser is used to excite the 6P/sub 1/2/(F = 0) ..-->.. 7P/sub 1/2/(F = 1) transition at 292.7 nm, with circularly polarized light. An electrostatic field E of 100 to 300 V/cm causes this transition to occur via Stark induced electric dipole. Two field free transitions may also occur: a highly forbidden magnetic dipole M, and a parity nonconserving electric dipole epsilon/sub P/. The latter is presumed to be due to the presence of a weak neutral current interaction between the 6p valence electron and the nucleus, as predicted by gauge theories which unite the electromagnetic and weak interactions. Both M and epsilon/sub P/ interfere with the Stark amplitude ..beta..E to produce a polarization of the 7P/sub 1/2/ state. This is measured with a circularly polarized infrared laser beam probe, tuned to the 7P/sub 1/2/ ..-->.. 8S/sub 1/2/ transition. This selectively excites m/sub F/ = +1 or -1 components of the 7P/sub 1/2/ state, and the polarization is seen as an asymmetry in 8S ..-->.. 6P/sub 3/2/ fluorescence when the probe helicity is reversed. The polarization due to M is ..delta../sub M/ = -2M/(BETAE). It is used to calibrate the analyzing efficiency. The polarization due to epsilon/sub P/ is ..delta../sub P/ = 2i epsilon/sub P//(..beta..E), and can be distinguished from ..delta../sub M/ by its properties under reversal of the 292.7 nm photon helicity and reversal of the laser direction. A preliminary measurement yielded a parity violation in agreement with the gauge theory of Weinberg and Salam.

  6. MRI and thallium-201 SPECT in the prediction of survival in glioma

    Energy Technology Data Exchange (ETDEWEB)

    Vos, Maaike J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Medical Center Haaglanden, Department of Neurology, PO Box 432, The Hague (Netherlands); Berkhof, Johannes [VU University Medical Center, Department of Epidemiology and Biostatistics, Amsterdam (Netherlands); Hoekstra, Otto S. [VU University Medical Center, Department of Nuclear Medicine and PET Research, Amsterdam (Netherlands); Bosma, Ingeborg; Sizoo, Eefje M.; Heimans, Jan J.; Reijneveld, Jaap C.; Postma, Tjeerd J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Sanchez, Esther [VU University Medical Center, Department of Radiology, Amsterdam (Netherlands); Lagerwaard, Frank J. [VU University Medical Center, Department of Radiation Oncology, Amsterdam (Netherlands); Buter, Jan [VU University Medical Center, Department of Medical Oncology, Amsterdam (Netherlands); Noske, David P. [VU University Medical Center, Department of Neurosurgery and Neuro-Oncology Research Group, Amsterdam (Netherlands)

    2012-06-15

    This paper aims to study the value of MRI and Thallium 201 ({sup 201}Tl) single-photon emission computed tomography (SPECT) in the prediction of overall survival (OS) in glioma patients treated with temozolomide (TMZ) and to evaluate timing of radiological follow-up. We included patients treated with TMZ chemoradiotherapy for newly diagnosed glioblastoma multiforme (GBM) and with TMZ for recurrent glioma. MRIs and {sup 201}Tl SPECTs were obtained at regular intervals. The value of both imaging modalities in predicting OS was examined using Cox regression analyses. Altogether, 138 MRIs and 113 {sup 201}Tl SPECTs in 46 patients were performed. Both imaging modalities were strongly related to OS (P {<=} 0.02). In newly diagnosed GBM patients, the last follow-up MRI (i.e., after six adjuvant TMZ courses) and SPECT (i.e., after three adjuvant TMZ courses) were the strongest predictors of OS (P = 0.01). In recurrent glioma patients, baseline measurements appeared to be the most predictive of OS (P < 0.01). The addition of one imaging modality to the other did not contribute to the prediction of OS. Both MRI and {sup 201}Tl SPECT are valuable in the prediction of OS. It is adequate to restrict to one of both modalities in the radiological follow-up during treatment. In the primary GBM setting, MRI after six adjuvant TMZ courses contributes significantly to the prediction of survival. In the recurrent glioma setting, baseline MRI appears to be a powerful predictor of survival, whereas follow-up MRIs during TMZ seem to be of little additional value. (orig.)

  7. Synthesis, calorimetric, structural and conductivity studies in a new thallium selenate tellurate adduct compound

    Energy Technology Data Exchange (ETDEWEB)

    Ktari, L. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Abdelhedi, M. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France); Bouhlel, N. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Dammak, M., E-mail: meddammak@yahoo.fr [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Cousson, A. [Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France)

    2009-08-05

    The crystal structure of the thallium selenate tellurate Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} (TlSeTe) was determined by X-ray diffraction method. The title compound crystallizes in the monoclinic system with P2{sub 1}/c space group. The following parameters are: a = 12.358(3) A; b = 7.231(1) A; c = 11.986(2) A; {beta} = 111.092(2){sup o}; Z = 4. The structure can be regarded as being built of isolated TeO{sub 6} octahedra and SeO{sub 4} tetrahedra. The Tl{sup +} cations are intercalated between these kinds of polyhedra. The main feature of this structure is the coexistence of two different and independent anions (SeO{sub 4}{sup 2-} and TeO{sub 6}{sup 6-}) in the same unit cell. The structure is stable due to O-H...O hydrogen bonds which link tetrahedral and octahedral groups. Crystals of Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} undergo three endothermal transitions at 373, 395 and 437 K. These transitions are detected by DSC and analyzed by dielectric measurements with impedance spectroscopy. The evolution of conductivity versus temperature showed the presence of a protonic conduction phase transition at 437 K. The phase transition at 373 K can be related to a structural phase transition, whereas the one at 395 K is ascribed as likely due to a ferroelectric-paraelectric phase transition.

  8. Electrochemical properties of modified copper-thallium hexacyanoferrate electrode in the presence of different univalent cations

    Energy Technology Data Exchange (ETDEWEB)

    Rutkowska, Iwona A.; Stroka, Jadwiga [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland); Galus, Zbigniew [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland)], E-mail: zbgalus@chem.uw.edu.pl

    2008-04-20

    The preparation of copper(II) hexacyanoferrate (CuHCF) films on the surface of gold electrodes as well as their characterization in solutions of various alkali metal and NH{sub 4}{sup +} cations and in the presence of thallium(I) are described. The electrochemical quartz crystal microbalance and cyclic voltammetric techniques were used. In 0.50 M lithium nitrate, even at submillimolar concentration of Tl(I), the formal potential of CuHCF was shifted to more positive values. At higher Tl(I) concentrations, the formal potential of the CuHCF redox reaction changed linearly with the logarithm of Tl(I) concentration (in the 0.50 M solution of lithium or another alkali metal nitrate). From such dependencies, selectivity coefficients K{sub Tl/M} were calculated, and they show that the CuHCF film on the gold electrode interacts preferentially with Tl(I). High affinity of Tl(I) to copper hexacyanoferrate, that was observed in the presence of alkali metal cations, was explained by relatively strong donor-acceptor interactions of Tl(I) ions with nitrogen in CN groups of the CuHCF film. It was also shown for simple M{sub 4}[Fe(CN){sub 6}] metal ferrocyanate salts (where M = Li{sup +}, Na{sup +}, K{sup +}, Rb{sup +}, Cs{sup +} and Tl{sup +}) that there is a preferential interaction of Tl{sup +} with CN group consistent with formation of a Tl-NC-Fe bridge.

  9. Quantitative evaluation of thallium-201 myocardial scintigram in coronary artery diseases

    Energy Technology Data Exchange (ETDEWEB)

    Mikada, Ken-etsu (Akita Univ. (Japan). School of Medicine)

    1992-11-01

    Quantitative indices from circumferential profile curves of thallium-201 ([sup 201]Tl) myocardial scintigram were evaluated for diagnostic utility in coronary artery diseases (CAD). Myocardial [sup 201]Tl scintigrams with single photon emission computed tomography (SPECT) were obtained 5 minutes (early) and 4 hours (delayed) after exercise in 20 normal subjects and 66 cases of CAD, of which 20 were angina pectoris without myocardial infarction (AP), 14 were subendocardial infarction (non-QMI) and 32 were Q-wave infarction (QMI). Tl counts, %Tl uptake and washout ratio (WR) were measured in 81 segments (9 apical segments of the slice from the longitudinal axis and all 72 segments of two slices from the short axis). A mean early defect (MED), a mean delayed defect (MDD), a mean delta washout rate (MDR), and a [Sigma] delayed defect ([Sigma]DD) were calculated from the areas which were below the two standard deviations of the mean %Tl uptake in normal subjects. A mean filling-in (MFI) was calculated from the difference of the %Tl uptake between early and delayed curves in each patient. In patients with CAD, the MED and MFI were higher, but MDW was lower with a more severe coronary stenosis, indicating that these indices were useful to detect myocardial hypo-perfuion. In severely stenotic regions, the MDD was higher in QMI than in AP and non-QMI, indicating that the ratio of infarct to the myocardium in the region was higher in QMI. In QMI, [Sigma]DD correlated well (r=0.723) with Total Wall Motion Scores with two-dimentional echocardiography which was directly related with infarct size. Further, MED, MFI and MDW were improved after aortocoronary bypass only in patients with patent graft. It is concluded that this quantitative evaluation with [sup 201]Tl-SPECT can provide an objective and quantitative estimate of regional myocardial ischemia and infarct. (author).

  10. Thallium-201 for cardiac stress tests: residual radioactivity worries patients and security.

    Science.gov (United States)

    Geraci, Matthew J; Brown, Norman; Murray, David

    2012-12-01

    A 47-year-old man presented to the Emergency Department (ED) in duress and stated he was "highly radioactive." There were no reports of nuclear disasters, spills, or mishaps in the local area. This report discusses the potential for thallium-201 (Tl-201) patients to activate passive radiation alarms days to weeks after nuclear stress tests, even while shielded inside industrial vehicles away from sensors. Characteristics of Tl-201, as used for medical imaging, are described. This patient was twice detained by Homeland Security Agents and searched after he activated radiation detectors at a seaport security checkpoint. Security agents deemed him not to be a threat, but they expressed concern regarding his health and level of personal radioactivity. The patient was subsequently barred from his job and sent to the hospital. Tl-201 is a widely used radioisotope for medical imaging. The radioactive half-life of Tl-201 is 73.1h, however, reported periods of extended personal radiation have been seen as far out as 61 days post-administration. This case describes an anxious, but otherwise asymptomatic patient presenting to the ED with detection of low-level personal radiation. Documentation should be provided to and carried by individuals receiving radionuclides for a minimum of five to six half-lives of the longest-lasting isotope provided. Patients receiving Tl-201 should understand the potential for security issues; reducing probable tense moments, confusion, and anxiety to themselves, their employers, security officials, and ED staff. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Usefulness of thallium-201 SPECT in the evaluation of tumor natures in intracranial meningiomas

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, Tetsuji; Nakano, Takahiro; Asano, Kenichiroh; Shimamura, Norihito; Ohkuma, Hiroki [Hirosaki University Graduate School of Medicine, Department of Neurosurgery, Hirosaki (Japan)

    2011-11-15

    Although intracranial meningiomas are regarded as benign tumors, some of them behave clinically as malignant tumors. Past reports suggest that MIB 1 and vascular endothelial growth factor (VEGF) in postoperative tumor specimens correlate with the aggressive nature of tumors, but preoperative prediction of such a nature is more useful for therapeutic planning for the tumor. The purpose of this study was to assess the usefulness of preoperative thallium-201 chloride single-photon emission computed tomography (Tl SPECT) to evaluate biological behavior in intracranial meningiomas. Tl SPECT was performed on 39 patients with intracranial meningioma and Tl uptake indices were calculated. The difference in the Tl uptake index between atypical meningiomas and other pathological types of meningioma was evaluated. Moreover, correlation of Tl uptake indices with the MIB1 labeling index was estimated. Tl uptake indices were also compared between VEGF strongly positive and weakly positive meningiomas. The delayed index of atypical meningioma was significantly higher than that of the other pathological types (p = 0.036). Significant correlation was found between the Tl uptake index in the delayed image and MIB1 labeling index (p < 0.0001, R{sup 2} = 0.36). Moreover, VEGF strongly positive meningiomas exhibited a significantly higher Tl uptake index compared to VEGF weakly positive meningiomas in both the early image and the delayed image (p = 0.029, 0.023, respectively). Tl uptake index may be a possible preoperative surrogate marker of MIB1 and VEGF that is useful in detecting aggressive natures in intracranial meningiomas. (orig.)

  12. Effective removal of trace thallium from surface water by nanosized manganese dioxide enhanced quartz sand filtration.

    Science.gov (United States)

    Huangfu, Xiaoliu; Ma, Chengxue; Ma, Jun; He, Qiang; Yang, Chun; Zhou, Jian; Jiang, Jin; Wang, Yaan

    2017-12-01

    Thallium (Tl) has drawn wide concern due to its high toxicity even at extremely low concentrations, as well as its tendency for significant accumulation in the human body and other organisms. The need to develop effective strategies for trace Tl removal from drinking water is urgent. In this study, the removal of trace Tl (0.5 μg L -1 ) by conventional quartz sand filtration enhanced by nanosized manganese dioxide (nMnO 2 ) has been investigated using typical surface water obtained from northeast China. The results indicate that nMnO 2 enhanced quartz sand filtration could remove trace Tl(I) and Tl(III) efficiently through the adsorption of Tl onto nMnO 2 added to a water matrix and onto nMnO 2 attached on quartz sand surfaces. Tl(III)-HA complexes might be responsible for higher residual Tl(III) in the effluent compared to residual Tl(I). Competitive Ca 2+ cations inhibit Tl removal to a certain extent because the Ca 2+ ions will occupy the Tl adsorption site on nMnO 2 . Moreover, high concentrations of HA (10 mgTOC L -1 ), which notably complexes with and dissolves nMnO 2 (more than 78%), resulted in higher residual Tl(I) and Tl(III). Tl(III)-HA complexes might also enhance Tl(III) penetration to a certain extent. Additionally, a higher pH level could enhance the removal of trace Tl from surface water. Finally, a slight increase of residual Tl was observed after backwash, followed by the reduction of the Tl concentration in the effluent to a "steady" state again. The knowledge obtained here may provide a potential strategy for drinking water treatment plants threatened by trace Tl. Copyright © 2017. Published by Elsevier Ltd.

  13. 78 FR 14512 - Foreign-Trade Zone 196-Fort Worth, TX, Foreign-Trade Subzone 196A-TTI, Inc., Approval of...

    Science.gov (United States)

    2013-03-06

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 196--Fort Worth, TX, Foreign-Trade Subzone 196A--TTI, Inc... Foreign-Trade Zones (FTZ) Board docketed an application submitted by Alliance Corridor, Inc., grantee of...

  14. 78 FR 2657 - Foreign-Trade Zone 196-Fort Worth, TX, Foreign-Trade Subzone 196A-TTI, Inc.; Application for...

    Science.gov (United States)

    2013-01-14

    ... Foreign-Trade Zones Board Foreign-Trade Zone 196--Fort Worth, TX, Foreign-Trade Subzone 196A--TTI, Inc.; Application for Additional Subzone Site An application has been submitted to the Foreign-Trade Zones Board... Foreign- Trade Zones Act, as amended (19 U.S.C. 81a-81u), and the regulations of the Board (15 CFR part...

  15. Reduced left ventricular cavitary activity ("black hole sign") in thallium-201 SPECT perfusion images of anteroapical transmural myocardial infarction.

    Science.gov (United States)

    Civelek, A C; Shafique, I; Brinker, J A; Durski, K; Weiss, J L; Links, J M; Natarajan, T K; Ozguven, M A; Wagner, H N

    1991-11-01

    Apparently reduced left ventricular (LV) cavitary thallium activity in both planar and tomographic perfusion images has been previously observed by these and other investigators. With single-photon emission computerized tomography, we have clinically noted that this "black hole sign" was associated with an aneurysm in the setting of a transmural anterior or anteroapical perfusion defect. We have now prospectively studied the etiology and predictive value of this sign in 84 consecutive patients with an anterior, anteroapical transmural perfusion defect. Of the 84 patients, 49 had both LV aneurysm (confirmed by contrast ventriculography, echocardiography or gated blood pool studies) and a black hole sign. Only 1 patient with an aneurysm did not have the black hole sign, and 2 without aneurysm did. Thus, it is concluded that this sign is highly accurate in diagnosing LV aneurysm. Because thallium-201 single-photon emission computerized tomography imaging is often performed as one of the first diagnostic tests soon after myocardial infarction, this has important clinical management implications.

  16. The analysis of thallium in geological materials by radiochemical neutron activation and x-ray fluorescence spectrometry: a comparison

    Energy Technology Data Exchange (ETDEWEB)

    McGoldrick, P.J.; Robinson, P. [Tasmania Univ., Sandy Bay, TAS (Australia)

    1993-12-31

    Carrier-based radiochemical neutron activation (RNAA) is a precise and accurate technique for the analysis of Tl in geological materials. For about a decade, until the mid-80s, a procedure modified from Keays et al. (1974) was used at the University of Melbourne to analyse for Tl in a wide variety of geological materials. Samples of powdered rock weighing several hundred milligrams each were irradiated in HIFAR for between 12 hours and 1 week, and subsequently fused with a sodium hydroxide - sodium peroxide mixture and several milligrams of inactive Tl carrier. Following acid digestion of the fusion mixture anion exchange resin was used to separate Tl from the major radioactive rock constituents. The Tl was then stripped from the resin and purified as thallium iodide and a yield measured gravimetrically. Activity from {sup 204}Tl (a {beta}-emitter with a 3 8 year half-life) was measured and Tl determined by reference to pure chemical standards irradiated and processed along with the unkowns. Detection limits for the longer irradiations were about one part per billion. Precision was monitored by repeat analyses of `internal standard` rocks and was estimated to be about five to ten percent (one standard deviation). On the other hand, X-ray fluorescence spectrometry (XRF) was seen as an excellent cost-effective alternative for thallium analysis in geological samples, down to 1 ppm. 6 refs. 1 tab., 1 fig.

  17. Pentoxifylline (Trental) does not inhibit dipyridamole-induced coronary hyperemia: Implications for dipyridamole-thallium-201 myocardial imaging

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Slinker, B.K. (Univ. of Vermont College of Medicine, Burlington (USA))

    1990-06-01

    Dipyridamole-thallium-201 imaging is often performed in patients unable to exercise because of peripheral vascular disease. Many of these patients are taking pentoxifylline (Trental), a methylxanthine derivative which may improve intermittent claudication. Whether pentoxifylline inhibits dipyridamole-induced coronary hyperemia like other methylxanthines such as theophylline and should be stopped prior to dipyridamole-thallium-201 imaging is unknown. Therefore, we studied the hyperemic response to dipyridamole in seven open-chest anesthetized dogs after pretreatment with either pentoxifylline (0, 7.5, or 15 mg/kg i.v.) or theophylline (3 mg/kg i.v.). Baseline circumflex coronary blood flows did not differ significantly among treatment groups. Dipyridamole significantly increased coronary blood flow before and after 7.5 or 15 mm/kg i.v. pentoxifylline (p less than 0.002). Neither dose of pentoxifylline significantly decreased the dipyridamole-induced hyperemia, while peak coronary blood flow was significantly lower after theophylline (p less than 0.01). We conclude that pentoxyifylline does not inhibit dipyridamole-induced coronary hyperemia even at high doses.

  18. Thallium-201 scintigraphy after dipyridamole infusion with low-level exercise. III Clinical significance and additional diagnostic value of ST segment depression and angina pectoris during the test

    NARCIS (Netherlands)

    G-J. Laarman (GertJan); P.W.J.C. Serruys (Patrick); J.F. Verzijlbergen (Fred); C.A.P.L. Ascoop (Carl); J. Azar

    1990-01-01

    textabstractIntravenous dipyridamole thallium testing is a useful alternative procedure for assessing coronary artery disease (CAD) in patients who are unable to perform maximal exercise tests. Ischaemic ST segment depression and angina pectoris are frequently observed during the test, in particular

  19. Indium-111 antimyosin antibody imaging and thallium-201 imaging. A comparative myocardial scintigraphic study using single-photon emission computed tomography in patients with myocarditis and dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Takehiko; Matsumori, Akira; Nohara, Ryuji; Konishi, Junji; Sasayama, Shigetake [Kyoto Univ. (Japan). Faculty of Medicine; Tamaki, Nagara

    1997-10-01

    Indium-111 antimyosin antibody imaging (a tracer of myocardial necrosis) and thallium-201 imaging (a tracer of myocardial perfusion) were compared in patients with myocarditis and dilated cardiomyopathy. The distribution of each tracer and antimyosin/thallium-201 overlapping were evaluated with single-photon emission computed tomography (SPECT). Scintigraphic data were classified into 5 patterns according to the distribution of both images and were compared with histologic findings of endomyocardial biopsy: AM-D, intense and diffuse antimyosin uptake and no perfusion abnormality (active myocarditis); AM-L, localized antimyosin uptake and no perfusion abnormality (active myocarditis); HM, no antimyosin uptake with or without perfusion abnormality (healed myocarditis); DCM-NH, diffuse antimyosin uptake and inhomogeneous thallium-201 uptake (dilated cardiomyopathy); DCM-PD, diffuse or localized antimyosin uptake and myocardial perfusion defect(s) (dilated cardiomyopathy). Patients with dilated-phase hypertrophic cardiomyopathy were frequently found in the DCM-PD group. Taken together, comparative antimyosin/thallium-201 SPECT images are useful for evaluating the activity of myocarditis and ongoing myocardial damage even in areas with no perfusion in patients with dilated cardiomyopathy. (author)

  20. Thallium-201 myocardial scintigraphy in patients with normal coronary arteries and normal left ventriculogram. Comparison with hemodynamic, metabolic and morphologic findings

    Energy Technology Data Exchange (ETDEWEB)

    Loesse, B.; Kuhn, H.; Rafflenbeul, D.; Kroenert, H.; Hort, W.; Feinendegen, L.E.; Loogen, F.

    1980-01-01

    36 consecutive patients with chest pain and/or severe ventricular dysrhythmias, but normal coronary arteries and normal left ventriculogram, underwent thallium-201 myocardial imaging at rest and during exercise. The myocardial scintigram was abnormal in 27 patients (group A) and normal in only 9 patients (group B).

  1. Preconcentration of thallium (I) by single drop microextraction with electrothermal atomic absorption spectroscopy detection using dicyclohexano-18-crown-6 as extractant system.

    Science.gov (United States)

    Chamsaz, Mahmoud; Arbab-Zavar, Mohammad Hossien; Darroudi, Abolfazl; Salehi, Thiery

    2009-08-15

    A simple single drop liquid-phase microextraction (SDME) technique, combined with electrothermal atomic absorption spectroscopy (ETAAS) is developed both to preconcentrate and determine thallium (I) ions in aqueous solutions. The ions were transferred from 10.0 ml of aqueous sample (donor phase) containing 0.5 ml of 1% picric acid as the ion-pair agent into a 3 microl microdrop of nitrobenzene (acceptor phase) containing dicyclohexano-18-crown-6 as the complexing agent. The latter will help to improve the extraction efficiency of the analyte. After the ions have been extracted, the acceptor drop was directly injected into a graphite furnace for thallium (I) determination. Several parameters such as the extracting solvent, extraction time, temperature, concentration of picric acid and crown ether, drop volume and stirring rate were examined. Under the optimized experimental conditions, the detection limit (L.O.D.) was 0.7 ng ml(-1). The relative standard deviation for five replicate analysis of 10 ng ml(-1) of thallium (I) was 5.1%. The calibration curve was linear in the range of 3-22 ng ml(-1). The results for determination of thallium in reference material, spiked tap water and seawater demonstrated the accuracy, recovery and applicability of the presented method. The enrichment factor was 50.

  2. Synthesis and application of a novel nanostructured ion-imprinted polymer for the preconcentration and determination of thallium(I) ions in water samples

    Energy Technology Data Exchange (ETDEWEB)

    Fayazi, M., E-mail: maryamfayazi64@yahoo.com [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, M. [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Taher, M.A. [Department of Chemistry, Faculty of Sciences, Shahid Bahonar University of Kerman, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, R. [Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of); Salavati, M.R. [Department of Chemistry, Faculty of Science, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of)

    2016-05-15

    Highlights: • A novel nanostructured thallium(I)-imprinted polymer was evaluated for trace detection of Tl(I). • The prepared sorbent displayed rapid extraction rate, high sensitivity and good reproducibility. • The proposed methodology was applied for quantification of Tl(I) in different water samples. - Abstract: A novel synthesized nanostructured ion-imprinted polymer (IIP) was investigated for the determination of trace amount of thallium(I). For this purpose, the thallium(I) IIP particles were synthesized using methacrylic acid (MAA) as the functional monomer, ethylene glycol dimethacrylate (EGDMA) as the cross-linker, methyl-2-[2-(2-2-[2-(methoxycarbonyl) phenoxy] ethoxyethoxy) ethoxy] benzoate as the chelating agent and 2,2-azobisisobutyronitrile (AIBN) as the initiator. The prepared IIP particles were characterized by field emission scanning electron microscopy (FE-SEM), Fourier transform infrared spectroscopy (FT-IR) and thermo gravimetric analysis (TGA). Various experimental factors such as pH, the amount of IIP particles, sorption and desorption time, sample volume, elution condition, and potentially interfering ions systematically examined. Under the optimum conditions, a sensitive response to Tl(I) within a wide concentration range (0.05–18 μg L{sup −1}) was achieved. The limit of detection (LOD, 3S{sub b}/m) was 6.3 ng L{sup −1}. The maximum adsorption capacity of the novel imprinted adsorbent for Tl(I) was calculated to be 18.3 mg g{sup −1}. The relative standard deviation (RSD) for eight replicate detections of 0.1 μg L{sup −1} of thallium(I) was found to be 4.0%. An enrichment factor (EF) of 100 was obtained by this method. The proposed technique was successfully applied to monitoring thallium in different water samples and the certified reference material.

  3. L-Tyrosine immobilized on multiwalled carbon nanotubes: A new substrate for thallium separation and speciation using stabilized temperature platform furnace-electrothermal atomic absorption spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco, Pablo H.; Gil, Raul A. [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina); Smichowski, Patricia, E-mail: smichows@cnea.gov.ar [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Rivadavia 1917, CP C1033 AAJ, Ciudad de Buenos Aires (Argentina); Comision Nacional de Energia Atomica, Gerencia Quimica, Av. Gral. Paz 1499, B1650KNA San Martin (Argentina); Polla, Griselda [Comision Nacional de Energia Atomica, Gerencia de Investigacion y Aplicaciones, Av.Gral. Paz 1499, B1650KNA San Martin (Argentina); Martinez, Luis D., E-mail: ldm@unsl.edu.ar [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina)

    2009-12-10

    An approach for the separation and determination of inorganic thallium species is described. A new sorbent, L-tyrosine-carbon nanotubes (L-tyr-CNTs), was used and applied to the analysis of tap water samples. At pH 5.0, L-tyr was selective only towards Tl(III), while total thallium was determined directly by stabilized temperature platform furnace-electrothermal atomic absorption spectrometry (STPF-ETAAS). The Tl(III) specie, which was retained by L-tyrosine, was quantitatively eluted from the column with 10% of nitric acid. An on-line breakthrough curve was used to determine the column capacity, which resulted to be 9.00 {mu}mol of Tl(III) g{sup -1} of L-tyr-CNTs with a molar ratio of 0.14 (moles of Tl bound to moles of L-tyr at pH 5). Transient peak areas revealed that Tl stripping from the column occurred instantaneously. Effects of sample flow rate, concentration and flow rate of the eluent, and interfering ions on the recovery of the analyte were systematically investigated. The detection limit for the determination of total thallium (3{sigma}) by STPF-ETAAS was 150 ng L{sup -1}. The detection limit (3{sigma}) for Tl(III) employing the separation system was 3 ng L{sup -1}, with an enrichment factor of 40. The precision of the method expressed as the relative standard deviation (RSD) resulted to be 3.4%. The proposed method was applied to the speciation and determination of inorganic thallium in tap water samples. The found concentrations were in the range of 0.88-0.91 {mu}g L{sup -1} of Tl(III), and 3.69-3.91 {mu}g L{sup -1} of total thallium.

  4. Tracing subducted sediment inputs to the Ryukyu arc-Okinawa Trough system: Evidence from thallium isotopes

    Science.gov (United States)

    Shu, Yunchao; Nielsen, Sune G.; Zeng, Zhigang; Shinjo, Ryuichi; Blusztajn, Jerzy; Wang, Xiaoyuan; Chen, Shuai

    2017-11-01

    Sediments are actively subducted in virtually every arc worldwide. However, quantifying their contributions to arc lavas and thereby establishing budgets of how sediments participate in slab-mantle interaction is challenging. In this contribution we use thallium (Tl) abundances and isotopic compositions of lavas from the Ryukyu arc (including south Kyushu) and its back-arc basin, Okinawa Trough, to investigate the influence of sediments from arc to back-arc. We also present extensive geochemical data for sediments and altered oceanic crust (AOC) outboard of the northern (DSDP Sites 296, 442B, 443 and 444) and central (DSDP Sites 294 and 295) part of the Ryukyu arc. The Tl isotopic compositions of sediments change systematically from lighter outboard of northern Ryukyu arc to heavier outboard of central Ryukyu arc. The feature reflects the dominance of terrigenous material and pelagic sedimentation outboard of the northern and central Ryukyu arc, respectively. Central and northern sections of Ryukyu arc and Okinawa Trough display larger range of Tl isotopic variation than southern section, which is consistent with more pelagic provenance for sediments outboard of central and northern Ryukyu arcs than that of expected sediments outboard of southern Ryukyu arc. Identical Tl, Sr, Nd and Pb isotope variations are found when comparing arc and back arc lavas, which indicates that sediments fluxes also account for the Tl isotopic variations in the Okinawa Trough lavas. Two-end-member mixing models of Tl with Pb, Sr and Nd isotopes require sediment inputs ofsediment end members predict very similar sediment fluxes when using Tl, Sr, Nd and Pb isotopes, which indicates that fractionation of these elements must have happened after mixing between mantle and sediments. This conclusion is corroborated by model calculations of mixing between sediment melts with fractionated Sr/Nd ratios and mantle wedge, which show that no arc lava plot on such mixing lines. Thus bulk sediment

  5. Comparison of arbutamine stress and treadmill exercise thallium-201 SPECT: Hemodynamics, safety profile and diagnostic accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Kiat, H.; Berman, D.S. [Cedars-Sinai Medical Centre, Los Angeles, California, LA (United States)

    1998-02-01

    Full text: Arbutamine (ARB), a new pharmacologic stress agent with enhanced chronotropic property compared to dobutamine, was compared with treadmill (TM) exercise testing (Ex) in a multicenter study using thallium-201 (Tl) SPECT. Of the total of 184 patients who underwent ARB, 69 also had TM stress and quantitative coronary angiography. Fifty-eight patients with a low pretest likelihood of CAD also underwent ARB study for evaluation of test specificity (normalcy rate). Tl scans were scored by a central laboratory using a 20 segment (seg)/scan visual analysis (5 point system: 0=normal, 4-absent uptake). Maximum heart rate (HR) by ARB and Ex was 122 vs 141 bpm (p<0.05). Mean %HR change from baseline was similar (79% vs 82%, respectively, p=ns). Maximum systolic BP for ARB and Ex was 173 vs 175 mmHg, and mean % change from baseline was 24% vs 28% (p=ns). Sensitivity for detecting CAD (270% stenosis) by ARB Tl was 94% and 97% by Ex Tl (p=ns). Stress Tl SPECT segmental agreement for presence of defect between ARB and Ex was 92% (kappa=0.8, p<0.001). Exact segmental stress Tl score (0-4 grading) agreement was 83 % (kappa=0.7, p<0.001). Among 346 segs with stress defects by both ARB and Ex defect reversibility agreement was 86% (kappa=0.7, p<0.001). The normalcy rate for ARB TI-SPECT among patients with a low likelihood of CAD was 90%. Adverse events were mostly mild (tremor: 23%, flushing: 10%, headache: 10%, paraesthesia: 8%, dizziness: 8%, hot flushes: 4%). Arrhythimia of clinical concern occurred in 8% (10/122) of ARB patients who had cardiac catheterisation and in 1.4% (1/69) of patients who had stress Tl. Of all 184 patients with ARB stress, ARB was discontinued due to arrhythmia in 7(5%) and 1 patient had IV Metoprolol for frequent ventricular couplets. Sustained arrhythmias were not observed

  6. Thallium Isotopes Tracking Mn-Oxide Burial - A Proxy for Deoxygenation During Oceanic Anoxic Event 2

    Science.gov (United States)

    Ostrander, C.; Owens, J. D.; Nielsen, S.

    2015-12-01

    Thallium (Tl) is proving to be a useful paleoredox proxy given that the Tl isotope composition of seawater is highly dependent on the magnitude of manganese (Mn) oxide burial in the ocean. In turn, Mn oxides require oxygen at the sediment-water interface to precipitate, linking the Tl isotope cycle to ocean oxygenation. Currently, the marine residence time of Tl is ~20kyrs and the Tl isotope composition of seawater is invariant, which suggests Tl isotopes could be a global tracer of marine Mn-oxide burial. Importantly, recent research suggests sediments deposited under a euxinic water column faithfully record the Tl isotope value of the overlying oxic water column (e.g. Black Sea and Cariaco Basin). Therefore, analysis of organic-rich black shales may prove useful in evaluating the seawater Tl isotope composition of past oceans and, hence, large-scale burial of Mn-oxides and the extent of bottom water ocean oxygenation. A logical test for this proxy is during the well-studied Cenomanian-Turonian boundary event termed Oceanic Anoxic Event 2 (OAE-2) at ~94 Ma. It is known that the global extent of anoxia and euxinia increased during this event, however, to what extent global bottom water deoxygenation occured is unconstrained. If deep water deoxygenation occurred, it would be hypothesized that Mn-oxide precipitation would decrease, resulting in a positive Tl isotope excursion during OAE-2. We have analyzed the Tl isotope composition of organic-rich black shales from Site 1258 of the Ocean Drilling Program (ODP) spanning the period before, during, and after OAE-2. Based on Fe redox proxies, the entire section is euxinic and thus no Mn-oxides are present (i.e. no local redox changes). Before the event, Tl isotope compositions are similar or slightly heavier than modern seawater values. Just prior to the onset of OAE-2, a positive shift occurs and is maintained until recovery, slightly before the termination of the event. The shift to heavier values and subsequent

  7. Geochemical translocation of thallium in the sediments from the North River, China

    Science.gov (United States)

    Liu, J.

    2016-12-01

    Thallium (Tl) is a highly toxic rare heavy metal. As a sulphophile element, it usually occurs in numerous sulphide minerals (such as pyrite, galena, sphlerite). Guangdong north region, known as the hometown of nonferrous metals, has abundant containing Tl mineral resources. Numerous industrial activities, such as mining, smelting, and electroplating are also flourishing. In 2010, a serious Tl pollution in the North River (a major river in the Northern Guangdong Province) shocked the society. The Tl pollution in water appeared to be under control after that incident. But in fact, even if the wastewater discharge of pollution sources has been controlled, the potential risk of heavy metal pollution in the sediments of the North River still exists, for the metals are easy to precipitate and accumulate into sediment from water. So far, Tl pollution in sediments has been studied to a very limited extent. In this paper, we investigated the content and vertical distribution characteristics of Tl and some other related heavy metals in a typical sediment profile from the North River by using inductively coupled plasma mass spectrometry (ICP-MS). Then the Pb isotopic compositions in the sediments were measured by using multi-inductively coupled plasma mass spectrometry (MC-ICP-MS). Several sediments from typical layers were also subjected to sequential extraction procedure for investigating the geochemical fractions of Tl. The risk of Tl and other metal pollution was finally assessed by calculating geo-accumulation indexes (Igeo) and potential ecological risk. The results showed that: (1) Tl concentrations range 1.03 mg/kg to 3.13 mg/kg with a mean of 1.89 mg/kg, three times higher than that in local background soil; (2) Tl content generally increased with depth with some fluctuations and significant correlations were found between Tl and Pb, Zn, Cd, Cu, and Ni; (3) About 46 % to 70 % in sediment cores were resided in the residual fraction; (4) Igeo showed that the studied

  8. MicroRNA-196a as a Potential Diagnostic Biomarker for Esophageal Squamous Cell Carcinoma.

    Science.gov (United States)

    Fendereski, Mona; Zia, Mohammad Farid; Shafiee, Mohammad; Safari, Forousan; Saneie, Mohammad Hosien; Tavassoli, Manoochehr

    2017-02-07

    We observed significant up-regulation of miR-196a in esophageal squamous cell carcinoma (ESCC) as compared with their adjacent normal tissue (p = .002). Receiver operating characteristics curve analysis confirmed the suitability of miR-196a as a potential tumor marker for diagnosis of ESCC. Furthermore, analysis of miR-196a levels in saliva samples determined an average of 27-fold up-regulations in ESCC patients compared with healthy group. Our results suggest that salivary miR-196a may be a suitable noninvasive biomarker for diagnosis of ESCC. In addition, molecular pathway enrichment analysis of microRNA (miR)-196a determined focal adhesion, spliceosome and p53 signaling pathways as the most relevant pathways with miR-196a targetome.

  9. Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact

    Science.gov (United States)

    Hu, Ningjing; Liu, Jihua; Shi, Xuefa

    2015-04-01

    Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact Hu Ningjing, Liu Jihua, Shi Xuefa First Institute of Oceanography, State Oceanic Administration, Qingdao 266061, China Thallium (Tl), a non-essential and highly toxic trace metal, is listed as priority toxic pollutant by the United States Environmental Protection Agency (USEPA) (Keith and Telliard, 1979). However, its geochemical cycling in aquatic environment has received far less attention than that of many other trace metals. This has been attributed to relatively little commercial interest in Tl and, until recently, problems inherent in its detection at environmental concentrations (Meeravali and Jiang, 2008). In this study, we investigated the sources, distribution and fate of Tl in surface sediments of the Bohai Sea (BS), China, based on the datasets of total Tl and chemical speciation of Tl of 408 surface sediment samples in the total entire BS. The enrichment factors and chemical speciation of Tl indicated that Tl in BS was dominated by natural Tl, although anthropogenic Tl contamination was observed in the Liuguhe River mouth; the mud deposits are the sinks of Tl and the regional currents and tide systems play a key role on the accumulation of Tl in BS. The distribution of Tl consistent with that of MnO and Fe2O3 as well as the level of Fe-Mn fraction is relatively high, indicating MnO and Fe2O3 influence the geochemical behaviors of Tl in the BS. Although the positive correlation between Tl and TOC is observed for the samples in the BS, however, level of Tl in oxidizable faction could be neglected, suggesting TOC might not be a major factor affecting the concentration of Tl in BS. The low proportion of Tl in the non-residual fraction dominated by the Fe-Mn oxides suggested that the labile Tl was controlled by the Fe-Mn oxides and Tl has a low bioavailability and a minor potential threat to biota in BS. Acknowledgements: this work

  10. Fractionation and Mobility of Thallium in Volcanic Ashes after Eruption of Eyjafjallajökull (2010) in Iceland.

    Science.gov (United States)

    Karbowska, Bozena; Zembrzuski, Wlodzimierz

    2016-07-01

    Volcanic ash contains thallium (Tl), which is highly toxic to the biosphere. The aim of this study was to determine the Tl concentration in fractions of volcanic ash samples originating from the Eyjafjallajökull volcano. A sequential extraction scheme allowed for a study of element migration in the environment. Differential pulse anodic stripping voltammetry using a flow measuring system was selected as the analytical method to determine Tl content. The highest average content of Tl in volcanic ash was determined in the fraction entrapped in the aluminosilicate matrix (0.329 µg g(-1)), followed by the oxidizable fraction (0.173 µg g(-1)). The lowest content of Tl was found in the water soluble fraction (0.001 µg g(-1)); however, this fraction is important due to the fact that Tl redistribution among all the fractions occurs through the aqueous phase.

  11. Nested reactor chamber and operation for Hg-196 isotope separation process

    Science.gov (United States)

    Grossman, M.W.

    1991-10-08

    The present invention is directed to an apparatus for use in [sup 196]Hg separation and its method of operation. Specifically, the present invention is directed to a nested reactor chamber useful for [sup 196]Hg isotope separation reactions avoiding the photon starved condition commonly encountered in coaxial reactor systems. 6 figures.

  12. 46 CFR 196.15-30 - Emergency lighting and power systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Emergency lighting and power systems. 196.15-30 Section... VESSELS OPERATIONS Test, Drills, and Inspections § 196.15-30 Emergency lighting and power systems. (a) Where fitted, it shall be the duty of the master to see that the emergency lighting and power systems...

  13. 75 FR 64248 - Approval for Manufacturing Authority Foreign-Trade Zone 196 ATC Logistics & Electronics (Cell...

    Science.gov (United States)

    2010-10-19

    ... & Electronics (Cell Phone Kitting) Fort Worth, TX Pursuant to its authority under the Foreign-Trade Zones Act of... following Order: Whereas, ATC Logistics & Electronics (ATCLE), an operator of Foreign-Trade Zone 196, has... procedures within FTZ 196 on behalf of ATC Logistics & Electronics, as described in the application and...

  14. 46 CFR 196.45-1 - Master and chief engineer responsible.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Master and chief engineer responsible. 196.45-1 Section... VESSELS OPERATIONS Carrying of Excess Steam § 196.45-1 Master and chief engineer responsible. (a) It shall be the duty of the master and the engineer in charge of the boilers of any vessel to require that a...

  15. Determination of gold, indium, tellurium and thallium in the same sample digest of geological materials by atomic-absorption spectroscopy and two-step solvent extraction

    Science.gov (United States)

    Hubert, A.E.; Chao, T.T.

    1985-01-01

    A rock, soil, or stream-sediment sample is decomposed with hydrofluoric acid, aqua regia, and hydrobromic acid-bromine solution. Gold, thallium, indium and tellurium are separated and concentrated from the sample digest by a two-step MIBK extraction at two concentrations of hydrobromic add. Gold and thallium are first extracted from 0.1M hydrobromic acid medium, then indium and tellurium are extracted from 3M hydrobromic acid in the presence of ascorbic acid to eliminate iron interference. The elements are then determined by flame atomic-absorption spectrophotometry. The two-step solvent extraction can also be used in conjunction with electrothermal atomic-absorption methods to lower the detection limits for all four metals in geological materials. ?? 1985.

  16. Anisotropies in the HI gas distribution toward 3C 196

    Science.gov (United States)

    Kalberla, P. M. W.; Kerp, J.

    2016-10-01

    Context. The local Galactic Hi gas was found to contain cold neutral medium (CNM) filaments that are aligned with polarized dust emission. These filaments appear to be dominated by the magnetic field and in this case turbulence is expected to show distinct anisotropies. Aims: We use the Galactic Effelsberg-Bonn Hi Survey (EBHIS) to derive 2D turbulence spectra for the Hi distribution in direction to 3C 196 and two more comparison fields. Methods: Prior to Fourier transform we apply a rotational symmetric 50% Tukey window to apodize the data. We derive average as well as position angle dependent power spectra. Anisotropies in the power distribution are defined as the ratio of the spectral power in orthogonal directions. Results: We find strong anisotropies. For a narrow range in position angle, in direction perpendicular to the filaments and the magnetic field, the spectral power is on average more than an order of magnitude larger than parallel. In the most extreme case the anisotropy reaches locally a factor of 130. Anisotropies increase on average with spatial frequency as predicted by Goldreich & Sridhar (1995, ApJ, 438, 763), at the same time the Kolmogorov spectral index remains almost unchanged. The strongest anisotropies are observable for a narrow range in velocity and decay with a power law index close to -8/3, almost identical to the average isotropic spectral index of -2.9 Faraday depth.

  17. Comparison of glucose-insulin-thallium-201 infusion single photon emission computed tomography (SPECT), stress-redistribution-reinjection thallium-201 SPECT and low dose dobutamine echocardiography for prediction of reversible dysfunction

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, Hiroki; Kondo, Makoto; Motohiro, Masayuki; Usami, Satoru [Shimada Municipal Hospital, Shizuoka (Japan)

    2001-12-01

    The usefulness of glucose-insulin-thallium-201 (GI-Tl) infusion single photon emission computed tomography (SPECT) in predicting reversible dysfunction has not been evaluated, so the present study recruited 20 patients with regional ischemic dysfunction for investigation. All patients underwent GI-Tl SPECT, post-stress Tl reinjection imaging and low dose dobutamine echocardiography. The diagnostic accuracy of these 3 techniques in predicting functional recovery was evaluated by receiver operating characteristic (ROC) analysis. In segments with functional recovery, regional Tl activities of GI-Tl SPECT were significantly higher than those of reinjection imaging (p<0.05), although there were no significant differences in segments without recovery. The area under the ROC curve for GI-Tl SPECT (0.75{+-}0.06) was greater than that for reinjection imaging (0.68{+-}0.07). The optimal cutoff values to identify viable myocardium were considered to be 55% of peak activity for GI-Tl SPECT and 50% for reinjection imaging. At this cutoff point, the sensitivity and specificity for detection of functional recovery were, respectively, 85% and 61% for GI-Tl SPECT, and 73% and 61% for reinjection imaging. Dobutamine echocardiography had the same sensitivity (85%), but lower specificity (48%) than GI-Tl SPECT. Continuous infusion of GI-Tl solution enhances regional Tl uptake compared with conventional post-stress reinjection imaging. This study suggests that GI-Tl SPECT is superior to reinjection imaging and dobutamine echocardiography in predicting functional recovery after ischemic left ventricular dysfunction. (author)

  18. 75 FR 15413 - Approval for Processing Authority, Foreign-Trade Zone 196, ATC Logistics & Electronics (Personal...

    Science.gov (United States)

    2010-03-29

    ... & Electronics (Personal Navigation Devices), Fort Worth, Texas Pursuant to its authority under the Foreign-Trade...) adopts the following Order: Whereas, ATC Logistics & Electronics, an operator of Foreign-Trade Zone 196...

  19. Detection and dosimetry of gamma ray emitted from thallium-201 and technetium-99m based on chemiluminescence technique

    Energy Technology Data Exchange (ETDEWEB)

    Shourian, Mostafa [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Tavakoli, Hassan, E-mail: tavakoli@ibb.ut.ac.i [Faculty of Medicine, Department of Physiology and Biophysics, Faculty of Medicine, Baqiyatollah University of Medical Sciences, P.O. Box 19395-6558, Tehran (Iran, Islamic Republic of); Ghourchian, Hedayatollah, E-mail: hadi@ibb.ut.ac.i [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Rafiee-Pour, Hossain-Ali [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of)

    2010-09-15

    This report describes the detection and dosimetry of gamma ray emitted from Thallium-201 ({sup 201}Tl) and Technetium-99m ({sup 99m}Tc) based on chemiluminescence technique. H{sub 2}O{sub 2} produced by two gamma emitter radioisotopes of {sup 201}Tl and {sup 99m}Tc were quantitatively measured by chemiluminescence method. Upon producing H{sub 2}O{sub 2} in a luminol alkaline solution, in the presence of diperiodatocuprate, as catalyst a chemical reaction was accrued and consequently the emitted light was measured. The determined H{sub 2}O{sub 2} concentration was correlated with the gamma ray detection and dosimetry. The sensitivity of chemiluminescence technique for {sup 201}Tl and {sup 99m}Tc dosimetry was determined to be 0.20 and 0.08 MBq/l (Mega Becquerel per liter) respectively (R.S.D. = %5, N = 3). The plotted calibration curves showed detection limits of 3.24 and 1.76 MBq/l for {sup 201}Tl and {sup 99m}Tc, respectively.

  20. Myocardial infarction diagnosis with body surface potential mapping, electrocardiography, vectorcardiography and thallium-201 scintigraphy: a correlative study with left ventriculography.

    Science.gov (United States)

    Ackaoui, A; Nadeau, R; Sestier, F; Savard, P; Primeau, R; Lemieux, R; Descary, M C

    1985-01-01

    In 35 subjects with typical or atypical angina and/or documented myocardial infarction (MI), body surface potential maps (BSPMs), ECG, VCG and rest Thallium-201 (T1-201) have been compared to left ventriculography (LVG). BSPMs were recorded with 26 ECGs, and BSPM abnormalities for MI cases were considered to be areas of normally positive potentials that have become negative. Subjects with MI were classified according to the segmental localization and degree of asynergy on LVG. Moderate anterolateral and apical asynergy were found to correlate with BSPM diagnosis of anterolateral MI and ischemia, severe anterolateral and apical asynergy with BSPM diagnosis of anterolateral MI and ischemia, and moderate diaphragmatic and/or posterobasal asynergy with BSPM diagnosis of posterior MI. Simultaneous anterior and posterior asynergy were found for BSPM diagnosis of anterior with posterior MI. Subjects with no LVG asynergy had normal BSPMs. BSPM diagnosis had the highest correlation coefficient with the LVG diagnosis (r = 0.88). ECG and VCG showed similar results with r = 0.65 and 0.71 respectively, while T1-201 had r = 0.55. The examination of our BSPMs, as well as the ECG, VCG and T1-201, did not permit to detect apical damage in presence of anterior MI, and posterobasal damage in the presence of inferoposterior MI. It is concluded that BSPMs are slightly superior to ECG and VCG for diagnosis of MI.

  1. Thallium release from acid mine drainages: Speciation in river and tap water from Valdicastello mining district (northwest Tuscany).

    Science.gov (United States)

    Campanella, Beatrice; Casiot, Corinne; Onor, Massimo; Perotti, Martina; Petrini, Riccardo; Bramanti, Emilia

    2017-08-15

    In this work we present an advantageous method for the simultaneous separation and detection of Tl(I) and Tl(III) species through ion chromatography coupled with on-line inductively coupled plasma - mass spectrometry. Chromatographic separation between Tl(III) and Tl(I) was achieved in less than two minutes. The method was validated by recovery experiments on real samples, and by comparing the sum of the concentrations of individual Tl species with total thallium values obtained from continuous flow ICP-MS. The experimental procedure offers an accurate, sensitive and interference-free method for Tl speciation at trace levels in environmental samples. This allowed us to investigate the Tl speciation in acid mine drainages (AMD), surface waters and springs in a mining catchment in Valdicastello Carducci (Tuscany, Italy), where severe Tl contamination ad been evidenced previously. This study shows for the first time that Tl(III), in addition to Tl(I), is present in considerable amounts in water samples affected by acid mining outflow, raising the question of the origin of this thermodynamically unstable species. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland

    OpenAIRE

    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata

    2014-01-01

    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50 % of the spawn samples, levels exceeded 20 mgTl/kg d.w. The iss...

  3. Effects of potassium channel opener on the kinetics of thallium-201 in in-vitro and in-vivo

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.; Kim, E. J.; Ahn, B. C.; Chae, S. C.; Lee, K. B. [College of Medicine, Kyungpook National Univ., Taegu (Korea, Republic of); Kim, C. K. [Mt. Sinai Medical School, New York (United States)

    1997-07-01

    Potassium channel opener (K-opener) opens membrane ATP-sensitive K{sup +}-channel and induces and increase in potassium efflux from cells. K-openers are powerful smooth muscle relaxants and currently used as antihypertensive, antianginal drugs or bronchodilators in clinic. Pharmacologic potency of newly synthesized K-opener is being evaluated with efflux capacity of preincubated Rb-83 from the isolated aortic vascular tissue preparation. Thallium has similar characteristics to those of rubidium and potassium in vivo. To evaluate the effect of pinacidil (a potent K-opener) on Tl-201 biokinetics, we have performed uptake/washout studies in cultured myocytes, and mice biodistribution study. Primary culture of spontaneous contracting myocytes was undertake from hearts of newborn Sprague-Dawley rat. Different concentration of pinacidil (100nM or 10uM) was co-incubated with Tl-201 in HBSS buffer to evaluate its effect on cellular uptake, or challenged to myocyte preparations pre-incubated with Tl-201 for washout study. Pinacidil was injected into mice simultaneous or 10-min after Tl-201 injection, and organ uptake and whole body retention ratio was measured using gamma counter or dose calibrator. Co-incubation of pinacidil with Tl-201 resulted in a decrease in Tl uptake into myocytes by 1.6 - 2.5 times, and an increase in washout by 1.6 - 3.1 times. Pinacidil injection resulted in mild decrease in blood, heart and liver uptake in mice, bur renal uptake was markedly decreased in a dose dependent manner. These results suggest that the pinacidil Tl-201 kinetics and may potentially affect the interpretation of Tl-201 myocardial imaging.

  4. Functional Significance of Angiographic Collaterals in Patients with Totally Occluded Right Coronary Artery: Intracoronary Thallium-201 Scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Do Yun; Lee, Jong Doo; Cho, Seung Yun; Shim, Won Heum; Ha, Jong Won; Kim, Han Soo; Kwon, Hyuk Moon; Jang, Yang Soo; Chung, Nam Sik; Kim, Sung Soon [Yonsei University College of Medicine, Seoul (Korea, Republic of); Park, Chang Yun; Kim, Young Soo [Inje University College of Medicine, Seoul (Korea, Republic of)

    1993-07-15

    To compare the myocardial viability in patients suffering from total occlusion of the right coronary artery (RCA) with the angiographic collaterals, intracoronary injection of Thallium-201 (T1-201) was done to 14 coronary artery disease (CAD) patients (pts) with total occlusion of RCA and into four normal subjects for control. All 14 CAD pts had Grade 2 or 3 collateral circulations. There were 14 male and 4 females, and their ages ranged from 31 to 70 years. In nine pts, T1-201 was injected into left main coronary artery (LCA) (300 approx 350 mu Ci) to evaluate the myocardial viability of RCA territory through collateral circulations. The remaining five pts received T1-201 into RCA (200-250 mu Ci) because two had intraarterial bridging collaterals and three had previous successful PTCA. Planar and SPECT myocardial perfusion images were obtained 30 minutes, and four to five hours after T1-201 reinjection. Intravenous T1-201 reinjection (six pts) or {sup 99m}Tc-MIBI (two pts) were also performed in eight CAD pts. Intracoronary myocardial perfusion images were compared with intravenous T1-201(IV T1-201) images, EGG, and ventriculography. Intracoronary TI-201 images proved to be superior to that of IV T1-201 due to better myocardial to background uptake ratio and more effective in the detection of viable tissue. We also found that perfusion defects were smaller on intracoronary T1-201 images than those on the IV T1-201. All of the 14 CAD pts had either mostly viable myocardium (seven pts) or large area of T1-201 perfusion (seven pts) in RCA territory, however ventriculographic wall motion and ECG did not correlate well with intracoronary myocardial perfusion images. In conclusion, total RCA occlusion patients with well developed collateral circulation had large area of viable myocardial in the corresponding territory.

  5. Disease stage classification in hypertrophic cardiomyopathy by dual analysis of iodine-123-labeled metaiodobenzylguanidine and thallium-201 myocardial scintigraphies

    Energy Technology Data Exchange (ETDEWEB)

    Hiasa, Go [Ehime Univ., Matsuyama (Japan). School of Medicine

    2001-08-01

    Many patients with hypertrophic cardiomyopathy (HCM) gradually changes from typical myocardial hypertrophy to dilated cardiomyopathy-like features. However, it is difficult to estimate the disease stage in HCM. To determine the disease stage, dual analysis of iodine-123-labeled metaiodobenzylguanidine ({sup 123}I-MIBG) and thallium-201 ({sup 201}Tl) myocardial scintigraphies were performed in 108 HCM patients. According to the scintigraphic distribution patterns, patients were divided into three groups. Group A (n=15): normal distributions of both {sup 123}I-MIBG and {sup 201}Tl, group B (n=71): normal {sup 201}Tl and low {sup 123}I-MIBG patterns, group C (n=22): low distributions of both scintigraphies. The decrease in {sup 201}Tl uptake was observed in only group C. Concerning {sup 123}I-MIBG, heart-to-mediastinum ratio (H/M) and washout rate (WOR) had good correlations with left ventricular systolic functions. H/M was decreased and WOR was increased in order of C, B and A groups. Left ventricular diastolic function reflected by isovolumic relaxation time was longer in group B than in group A. Attenuated left ventricular hypertrophy, enlarged left ventricular volumes, impaired left ventricular functions and serious clinical symptoms were observed in only group C. Myocardial sympathetic abnormalities in group B may be mainly due to myocardial hypertrophy, and those in group C may be due to myocardial injury. Dual analysis of {sup 123}I-MIBG and {sup 201}Tl scintigraphies may be useful to classify disease stages of HCM. (author)

  6. New quaternary thallium indium germanium selenide TlInGe2Se6: Crystal and electronic structure

    Science.gov (United States)

    Khyzhun, O. Y.; Parasyuk, O. V.; Tsisar, O. V.; Piskach, L. V.; Myronchuk, G. L.; Levytskyy, V. O.; Babizhetskyy, V. S.

    2017-10-01

    Crystal structure of a novel quaternary thallium indium germanium selenide TlInGe2Se6 was investigated by means of powder X-ray diffraction method. It was determined that the compound crystallizes in the trigonal space group R3 with the unit cell parameters a = 10.1798(2) Å, c = 9.2872(3) Å. The relationship with similar structures was discussed. The as-synthesized TlInGe2Se6 ingot was tested with X-ray photoelectron spectroscopy (XPS) and X-ray emission spectroscopy (XES). In particular, the XPS valence-band and core-level spectra were recorded for initial and Ar+ ion-bombarded surfaces of the sample under consideration. The XPS data allow for statement that the TlInGe2Se6 surface is rigid with respect to Ar+ ion-bombardment. Particularly, Ar+ ion-bombardment (3.0 keV, 5 min duration, ion current density fixed at 14 μA/cm2) did not cause substantial modifications of stoichiometry in topmost surface layers. Furthermore, comparison on a common energy scale of the XES Se Kβ2 and Ge Kβ2 bands and the XPS valence-band spectrum reveals that the principal contributions of the Se 4p and Ge 4p states occur in the upper and central portions of the valence band of TlInGe2Se6, respectively, with also their substantial contributions in other portions of the band. The bandgap energy of TlInGe2Se6 at the level of αg=103 cm-1 is equal to 2.38 eV at room temperature.

  7. miR-196a targets netrin 4 and regulates cell proliferation and migration of cervical cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jie [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China); Zheng, Fangxia [Department of Radiotherapy, Liaocheng People’s Hospital, Liaocheng 252000 (China); Yu, Gang [Department for Disease Control, Tumor Hospital of Liaocheng, Liaocheng 252000 (China); Yin, Yanhua, E-mail: yinyanhuablk@163.com [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China); Lu, Qingyang [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China)

    2013-11-01

    Highlights: •miR-196a was overexpressed in cervical cancer tissue compared to normal tissue. •miR-196a expression elevated proliferation and migration of cervical cancer cells. •miR-196a inhibited NTN4 expression by binding 3′-UTR region of NTN4 mRNA. •NTN4 inversely correlated with miR-196a expression in cervical tissue and cell line. •NTN4 expression was low in cervical cancer tissue compared to normal tissue. -- Abstract: Recent research has uncovered tumor-suppressive and oncogenic potential of miR-196a in various tumors. However, the expression and mechanism of its function in cervical cancer remains unclear. In this study, we assess relative expression of miR-196a in cervical premalignant lesions, cervical cancer tissues, and four cancer cell lines using quantitative real-time PCR. CaSki and HeLa cells were treated with miR-196a inhibitors, mimics, or pCDNA/miR-196a to investigate the role of miR-196a in cancer cell proliferation and migration. We demonstrated that miR-196a was overexpressed in cervical intraepithelial neoplasia 2–3 and cervical cancer tissue. Moreover, its expression contributes to the proliferation and migration of cervical cancer cells, whereas inhibiting its expression led to a reduction in proliferation and migration. Five candidate targets of miR-196a chosen by computational prediction and Cervical Cancer Gene Database search were measured for their mRNA in both miR-196a-overexpressing and -depleted cancer cells. Only netrin 4 (NTN4) expression displayed an inverse association with miR-196a. Fluorescent reporter assays revealed that miR-196a inhibited NTN4 expression by targeting one binding site in the 3′-untranslated region (3′-UTR) of NTN4 mRNA. Furthermore, qPCR and Western blot assays verified NTN4 expression was downregulated in cervical cancer tissues compared to normal controls, and in vivo mRNA level of NTN4 inversely correlated with miR-196a expression. In summary, our findings provide new insights about the

  8. Synthesis, Characterization and Antibacterial Studies of N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide and Its Neodymium(III and Thallium(III Complexes

    Directory of Open Access Journals (Sweden)

    Lawrence Nnamdi Obasi

    2017-02-01

    Full Text Available N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide (NBTCS was synthesized by condensation reaction of 4-chlorobenzenesulphonyl chloride and 2-aminobenzothiazole in acetone under reflux. Neodymium(III and thallium(III complexes of the ligand were also synthesized. Both ligand and metal complexes were characterized using UV-Vis, IR, 1H- and 13C-NMR spectroscopies, elemental analysis and molar conductance measurement. IR studies revealed that the ligand is tridentate and coordinates to the metal ions through nitrogen and oxygen atoms of the sulphonamide group and nitrogen atom attached to benzothiazole ring. The neodymium(III complex displays a coordination number of eight while thallium(III complex displays a coordination number of six. The ligand and its complexes were screened in vitro for their antibacterial activities against Escherichia coli strains (E. coli 6 and E. coli 13, Proteus species, Staphylococcus aureus and Pseudomonas aeruginosa using the agar well diffusion technique. The synthesized compounds were found to be more active against the microorganisms screened relative to ciprofloxacin, gentamicin and co-trimoxazole.

  9. Comparative study of body surface isopotential map, left ventriculogram and thallium-201 myocardial scintigram in patients with old lateral myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Naoyuki

    1988-01-01

    In 16 patients with old lateral myocardial infarction, body surface isopotential maps and 12 lead electrocardiograms were compared with left ventriculographic findings. In addition 8 of these subjects were performed thallium-201 myocardial scintigraphy in order to determine the location and extent of myocardial necrosis. Common 12 lead electrocardiographic findings of the subjects were initial Q waves more than 30 msec and inverted T waves in only aVL lead. The patients were classified into 4 groups according to the location and extent of ventricular wall motion abnormalities group I (6 cases) showed hypokinesis in the anterior segment, group II (5 cases): akinesis in the anterior segment and hypokinesis in the seg. 6, group III (4 cases): hypokinesis in the anterior segment and seg. 7, group IV (1 case): hypokinesis in the anterior segment and seg. 4, 7. And each of the 4 groups demonstrated characteristic findings of surface isopotential maps. Group II with coexisting hypokinesis in the seg. 6 showed surface isopotential maps additional pattern of anterior myocardial infarction, and group III with coexisting hypokinesis in the seg. 7 showed additional patterns of posterior myocardial infarction. The classification according to the abnormality of ventricular wall motion was also conformed with the thallium-201 myocardial scintigraphic findings except one case. These results suggest that body surface isopotential map is more useful than the 12 lead electrocardiogram in detecting the location and extent of left ventricular wall motion abnormality in patients with old lateral myocardial infarction. (author) 53 refs.

  10. Serial thallium-201 imaging at rest in patients with unstable and stable angina pectoris: relationship of myocardial perfusion at rest to presenting clinical syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Okada, R.D.; Boucher, C.A.; Phillips, H.R.; Strauss, H.W.; Pohost, G.M.

    1983-07-01

    In order to determine whether there are differences in myocardial perfusion at rest among patients with various unstable and stable angina syndromes, serial thallium-201 imaging was performed at rest in 19 patients presenting with rapidly worsening exertional angina (unstable angina, group A), 12 patients with rest angina alone without exertional symptoms (unstable angina, group B), and 34 patients with chronic stable angina. No patient had an episode of angina within 4 hours of study. Nineteen of 19 (100%) patients in group A demonstrated transient defects compared to only 3 of 12 (25%) patients in group B (p less than 0.0001) and 4 of 34 (12%) stable angina patients (p less than 0.0001). The majority of zones demonstrating transient defects in group A were associated with hypokinesis of the corresponding left ventriculogram segment without associated ECG evidence of previous infarction. There were no significant differences in the frequency of persistent thallium defects, severity of angiographic coronary artery disease, or frequency of regional wall motion abnormalities of myocardial segments supplied by stenotic coronary arteries among the three groups of patients. Transient defects have been shown to reflect reduction in regional coronary blood flow to viable myocardium. Therefore, we conclude that regional resting hypoperfusion of viable myocardium is far more common in patients with exertional unstable angina symptoms than in patients with rest angina alone or chronic stable angina.

  11. MicroRNA-196a Is a Putative Diagnostic Biomarker and Therapeutic Target for Laryngeal Cancer

    Science.gov (United States)

    Saito, Koichiro; Inagaki, Koji; Kamimoto, Takahiro; Ito, Yoko; Sugita, Toshiaki; Nakajo, Satoko; Hirasawa, Akira; Iwamaru, Arifumi; Ishikura, Takashi; Hanaoka, Hideki; Okubo, Keisuke; Onozaki, Tokio; Zama, Takeru

    2013-01-01

    Background MicroRNA (miRNA) is an emerging subclass of small non-coding RNAs that regulates gene expression and has a pivotal role for many physiological processes including cancer development. Recent reports revealed the role of miRNAs as ideal biomarkers and therapeutic targets due to their tissue- or disease-specific nature. Head and neck cancer (HNC) is a major cause of cancer-related mortality and morbidity, and laryngeal cancer has the highest incidence in it. However, the molecular mechanisms involved in laryngeal cancer development remain to be known and highly sensitive biomarkers and novel promising therapy is necessary. Methodology/Principal Findings To explore laryngeal cancer-specific miRNAs, RNA from 5 laryngeal surgical specimens including cancer and non-cancer tissues were hybridized to microarray carrying 723 human miRNAs. The resultant differentially expressed miRNAs were further tested by using quantitative real time PCR (qRT-PCR) on 43 laryngeal tissue samples including cancers, noncancerous counterparts, benign diseases and precancerous dysplasias. Significant expressional differences between matched pairs were reproduced in miR-133b, miR-455-5p, and miR-196a, among which miR-196a being the most promising cancer biomarker as validated by qRT-PCR analyses on additional 84 tissue samples. Deep sequencing analysis revealed both quantitative and qualitative deviation of miR-196a isomiR expression in laryngeal cancer. In situ hybridization confirmed laryngeal cancer-specific expression of miR-196a in both cancer and cancer stroma cells. Finally, inhibition of miR-196a counteracted cancer cell proliferation in both laryngeal cancer-derived cells and mouse xenograft model. Conclusions/Significance Our study provided the possibilities that miR-196a might be very useful in diagnosing and treating laryngeal cancer. PMID:23967217

  12. 32 CFR 196.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Military and merchant marine educational... OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 196.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  13. 32 CFR 196.425 - Counseling and use of appraisal and counseling materials.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Counseling and use of appraisal and counseling... Programs or Activities Prohibited § 196.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on the basis of sex in the counseling or...

  14. 75 FR 30372 - Foreign-Trade Zone 196 Temporary/Interim Manufacturing Authority ATC Logistics & Electronics...

    Science.gov (United States)

    2010-06-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 196 Temporary/Interim Manufacturing Authority ATC Logistics... Secretary of the Foreign-Trade Zones (FTZ) Board filed an application submitted by the ATC Logistics...

  15. 32 CFR 196.535 - Effect of state or local law or other requirements.

    Science.gov (United States)

    2010-07-01

    ... SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS... in Education Programs or Activities Prohibited § 196.535 Effect of state or local law or other... 32 National Defense 2 2010-07-01 2010-07-01 false Effect of state or local law or other...

  16. 28 CFR 19.6 - Responsibility of DOJ organizational units for program implementation and implementation procedures.

    Science.gov (United States)

    2010-07-01

    ...) Each component shall submit a quarterly report to the General Services Staff, Justice Management... Administration DEPARTMENT OF JUSTICE USE OF PENALTY MAIL IN THE LOCATION AND RECOVERY OF MISSING CHILDREN § 19.6... General Services Staff, Justice Management Division (JMD), will be the liaison between the National Center...

  17. 27 CFR 44.196a - To a foreign-trade zone.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false To a foreign-trade zone... Shipment § 44.196a To a foreign-trade zone. Where tobacco products, and cigarette papers and tubes are removed from a factory or an export warehouse for delivery to a foreign-trade zone, under zone restricted...

  18. 78 FR 66330 - Foreign-Trade Zone 196-Fort Worth, Texas, Authorization of Production Activity, Flextronics...

    Science.gov (United States)

    2013-11-05

    ... Foreign-Trade Zones Board Foreign-Trade Zone 196--Fort Worth, Texas, Authorization of Production Activity, Flextronics International USA, Inc. (Mobile Phone Assembly and Kitting), Fort Worth, Texas On June 14, 2013, Flextronics International USA, Inc. submitted a notification of proposed production activity to the Foreign...

  19. Spin vectors of asteroids 21 Lutetia, 196 Philomela, 250 Bettina, 337 Devosa, and 804 Hispania

    Science.gov (United States)

    Michalowski, Tadeusz

    1992-01-01

    Such parameters as shape, orientation of spin axis, prograde or retrograde rotation are important for understanding the collisional evolution of asteroids since the primordial epochs of solar system history. These parameters remain unknown for most asteroids and poorly constrained for all but a few. This work presents results for five asteroids: 21, 196, 250, 337, and 804.

  20. 37 CFR 2.196 - Times for taking action: Expiration on Saturday, Sunday or Federal holiday.

    Science.gov (United States)

    2010-07-01

    ... UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE RULES OF PRACTICE IN TRADEMARK CASES General Information and Correspondence in Trademark Cases § 2.196 Times for taking action: Expiration on... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Times for taking action...

  1. Yeast Interacting Proteins Database: YGR196C, YBR260C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGR196C FYV8 Protein of unknown function, required for survival upon exposure to K1...n, required for survival upon exposure to K1 killer toxin Rows with this bait as bait Rows with this bait as

  2. 42 CFR 84.196 - Harnesses; installation and construction; minimum requirements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Harnesses; installation and construction; minimum... SERVICES OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Chemical Cartridge Respirators § 84.196 Harnesses; installation and construction; minimum...

  3. 46 CFR 196.37-33 - Instructions for changing steering gear.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Instructions for changing steering gear. 196.37-33... steering gear. (a) Instructions in at least 1/2 inch letters and figures shall be posted in the steering engineroom, relating in order, the different steps to be taken in changing to the emergency steering gear...

  4. 27 CFR 44.196 - To district director of customs for consumption as supplies on commercial vessels and aircraft.

    Science.gov (United States)

    2010-04-01

    ... for consumption as supplies on commercial vessels and aircraft. Where tobacco products, or cigarette... customs for consumption as supplies on commercial vessels and aircraft. 44.196 Section 44.196 Alcohol... (CONTINUED) TOBACCO EXPORTATION OF TOBACCO PRODUCTS AND CIGARETTE PAPERS AND TUBES, WITHOUT PAYMENT OF TAX...

  5. Phosphorylation of the leukemic oncoprotein EVI1 on serine 196 modulates DNA binding, transcriptional repression and transforming ability.

    Directory of Open Access Journals (Sweden)

    Daniel J White

    Full Text Available The EVI1 (ecotropic viral integration site 1 gene at 3q26 codes for a transcriptional regulator with an essential role in haematopoiesis. Overexpression of EVI1 in acute myeloid leukaemia (AML is frequently associated with 3q26 rearrangements and confers extremely poor prognosis. EVI1 mediates transcriptional regulation, signalling, and epigenetic modifications by interacting with DNA, proteins and protein complexes. To explore to what extent protein phosphorylation impacts on EVI1 functions, we analysed endogenous EVI1 protein from a high EVI1 expressing Fanconi anaemia (FA derived AML cell line. Mass spectrometric analysis of immunoprecipitated EVI1 revealed phosphorylation at serine 196 (S196 in the sixth zinc finger of the N-terminal zinc finger domain. Mutated EVI1 with an aspartate substitution at serine 196 (S196D, which mimics serine phosphorylation of this site, exhibited reduced DNA-binding and transcriptional repression from a gene promotor selectively targeted by the N-terminal zinc finger domain. Forced expression of the S196D mutant significantly reduced EVI1 mediated transformation of Rat1 fibroblasts. While EVI1-mediated serial replating of murine haematopoietic progenitors was maintained by EVI1-S196D, this was associated with significantly higher Evi1-trancript levels compared with WT-EVI1 or EVI1-S196A, mimicking S196 non-phosphorylated EVI1. These data suggest that EVI1 function is modulated by phosphorylation of the first zinc finger domain.

  6. Syndrome of diminished vasodilator reserve of the coronary microcirculation (microvascular angina or syndrome X): Diagnosis by combined atrial pacing and thallium 201 imaging--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Magarian, G.J.; Palac, R.; Reinhart, S. (Veterans Administration Medical Center, Portland, OR (USA))

    1990-08-01

    Patients with angina-like chest pain without evidence of epicardial coronary artery disease or coronary arterial vasospasm are becoming increasingly recognized. These are often related to noncardiac causes including esophageal, musculoskeletal, and hyperventilatory or panic states. However, recently a subgroup of such patients are being recognized as having true myocardial ischemia and chest pain on the basis of diminished coronary microvascular vasodilatory reserve (microvascular ischemia or Syndrome X). The authors describe such a patient who was found to have replication of anginal pain associated with a reversible ischemic defect on thallium 201 imaging during atrial pacing, suggesting ischemia in this myocardial segment. Resolution of angina and ST segment electrocardiographic changes of ischemia occurred with cessation of pacing. We believe this is the first report of a patient with this form of myocardial ischemia diagnosed by this method and should be considered in patients with anginal chest pain after significant coronary artery disease and coronary vasospasm have been excluded.

  7. Determination of perfusion defect area in experimental myocardial infarction. A comparison between 201-thallium and sup 99m Tc methoxy-isobutyl-isonitril (MIBI)

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, K.D.; Rohmann, S.; Bahavar, H.; Grebe, S.F.; Schaper, W.; Schlepper, M. (Kerckhoff-Klinik, Bad Nauheim (Germany))

    1991-08-01

    To assess the accuracy of two myocardial perfusion markers in quantifying defect size, the left anterior descending coronary artery (LAD) was occluded in 13 porcine hearts. Fourty minutes later 55 MBq {sup 201}TI and 370 MBq {sup 99m}Tc-MIBI were simultaneously injected i.v. in 10 animals. After injection and in vivo double nuclide SPECT acquisition, the risk area was demarcated with fluorescein (FI) dye in 5 animals. The in vitro defect area determined by {sup 201}TI was significant larger (15.8 {+-} 27%) than those of {sup 99m}Tc-MIBI, while FI compared to Tc showed no statistical difference. Thus, in a pig model Tc-MIBI was more accurate with ex vivo imaging. With SPECT thallium imaging defect size was overestimated. In vivo there was a distinct trend with Tc-MIBI studies to underestimate the defect size up to 16%. (orig.).

  8. High thallium content in rocks associated with Au-As-Hg-Tl and coal mineralization and its adverse environmental potential in SW Guizhou, China

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, T.F.; Guha, J.; Boyle, D. [Chinese Academy of Science, Guiyang (China)

    2004-08-15

    This study is focused on high concentrations of Tl in rocks in SW Guizhou, China, that are related to several widely scattered disseminated gold-mercury-arsenic and coal deposits, and a primary Tl deposit within an Au-As-Hg-Tl metallogenic belt of the Huijiabao anticline. The Tl, Hg and As in the Lanmuchang Hg-Tl deposit area are associated with the abundant occurrence of sulfide minerals such as lorandite, realgar, orpiment and cinnabar. Concentrations of Tl range from 100 to 35 000 ppm in sulfide ores, and 39-490 ppm in host rocks. The enrichment of Au, Tl, Hg, As, and Sb in the Yanshang gold mineralized area reflects the occurrence of Au mineralization and its mineral assemblage of Tl-Hg-As-Sb sulfides. Thallium ranges from 0.22 to 16 ppm in Au ores and host rocks. Thallium in coals is enriched up to 46 ppm within the Au-As-Hg-TI metallogenic belt, and is derived from the regional Au-As-Hg-Tl mineralization. Mercury and As show a similar distribution to Tl with high concentrations in sulfide ores, coals and host rocks. Human populations living near and downstream of Tl deposits and Tl-bearing ore deposits are susceptible to Tl contamination because of its high toxicity and high uptake rate by crops. The dispersion of Tl, Hg and As associated with the primary mineralization of Au-As-Hg-TI can be traced through physical erosion and chemical weathering, producing secondary dispersion into sods, groundwater and surface water and crops. Mining activities compound the natural processes, readily dispersing Tl into the surface environment.

  9. Functional significance of myocardial perfusion defects induced by dipyridamole using thallium-201 single-photon emission computed tomography and two-dimensional echocardiography

    Energy Technology Data Exchange (ETDEWEB)

    Jain, A.; Suarez, J.; Mahmarian, J.J.; Zoghbi, W.A.; Quinones, M.A.; Verani, M.S. (Baylor College of Medicine, Houston, TX (USA))

    1990-10-01

    The mechanisms responsible for inhomogeneous myocardial blood flow after oral administration of a large dose (300 mg) of dipyridamole were assessed in 27 patients with serial thallium-201 single-photon emission computed tomography (SPECT) and simultaneous 2-dimensional echocardiograms. Myocardial tomographic images were obtained 50 minutes and 3 to 4 hours after administration of dipyridamole. Two-dimensional echocardiograms were recorded at baseline and then every 15 minutes for 60 minutes. Dipyridamole caused only a mild reduction in blood pressure (from 129 +/- 18 to 126 +/- 16 mm Hg) and a mild increase in heart rate (from 69 +/- 15 to 73 +/- 4 beats/min). Sixteen patients had perfusion defects after dipyridamole by SPECT, which underwent partial or total filling-in. Fourteen of these patients (87.5%) had either a new abnormality or further deterioration of a preexisting wall motion abnormality by 2-dimensional echocardiography, and thus were considered to have developed transient ischemia during dipyridamole administration. Ten of 11 patients (91%) with normal perfusion or fixed defects by SPECT had no further deterioration in wall motion after oral dipyridamole, and were thus considered to have no evidence of myocardial ischemia. In conclusion, most patients with transient thallium-201 defects after dipyridamole develop transient worsening of resting wall motion by 2-dimensional echocardiography, suggestive of true myocardial ischemia. Because myocardial oxygen demand, as indicated by the heart rate-blood pressure product, did not change significantly, the mechanism of myocardial ischemia in these patients is likely to be diminished regional blood flow related to a subendocardial steal induced by dipyridamole.

  10. MicroRNA-196b Inhibits Cell Growth and Metastasis of Lung Cancer Cells by Targeting Runx2.

    Science.gov (United States)

    Bai, Xiaoxue; Meng, Lin; Sun, Huijie; Li, Zhuo; Zhang, Xiufang; Hua, Shucheng

    2017-01-01

    Lung cancer is one of the most common causes of cancer related deaths worldwide. The role of several microRNAs (miRNAs) including miR-196b in different cancers has already been established. The study was aimed to explore the role of miR-196b in lung cancer and its possible underlying mechanism. Human lung cancer cell line A549 was transfected with miR-196b mimic, miR-196b inhibitor and corresponding controls. Then cell viability, migration, invasion, and apoptosis of A549 lung cancer cells either with overexpression or with suppression of miR-196b were estimated sequentially. Next, dual luciferase activity assay was performed to clarify whether Runx2 was a direct target of miR-196b. Finally, the expressions of main factors associated with epithelial mesenchymal transition (EMT), PI3K/AKT/GSK3β, Smad, and JNK pathways were detected by western blot. MiR-196b expression was significantly decreased in A549, H1650 and H1299 cell lines compared with in WI-38 and HEL-1 cell lines. Overexpression of miR-196b suppressed cell viability, migration, invasion, and induced apoptosis as well as inhibited TGF-β induced EMT process in A549 cells. In addition, Runx2 was a putative target of miR-196b, and Runx2 silence remarkably increased cell apoptosis and abolished the promotive effects of miR-196b suppression on cell viability, migration and invasion. Finally, miR-196b also mediated its action by inactivation of PI3K/AKT/GSK3β, Smad, and JNK pathways by down-regulation of Runx2. MiR-196b functions as a tumor suppressor that inhibited cell growth and metastasis of lung cancer cells by targeting Runx2. These findings provided further evidences for treatment of lung cancer. The Author(s). Published by S. Karger AG, Basel.

  11. Liquid Nitrogen (-196°C effect under pollen of some cultured or ornamental species

    Directory of Open Access Journals (Sweden)

    Sabina GLIGOR

    2006-05-01

    Full Text Available The criopreservation involve the stock of the vegetal material at low temperatures (-196°C in liquid nitrogen, in thermal conditions in which the division of cells and metabolic processes slow down, thus that the samplings may be conserved for long periods without suffering any genetic modifications. This stock technique is applied till present only on 80 vegetal species, keeping their seeds and vitrocultures preponderantly; researches were made regarding the maintenance of pollen in liquid nitrogen.The mature pollen, able to resist a higher degree of desiccation, may be conserved at low temperatures, without criopreservation. It was made researches on criopreservation of rise, maize, wheat, roses, sun flower and soy pollen. Our study purpose was to follow the impact of liquid nitrogen (-196°C about on viability of some cultured and ornamental species. The designed time of criopreservation it was 30 minutes and 7 days, using the TTC (tripheniltetrazole chloride method which allows testing the viability of vegetal material based on dehydrogenase activity.It was observed at Petunia hybrida species, that the pollen viability was low - in relevance with the witness represented from the pollen which was not resigned to the nitrogen liquid treatment - between percentage limits of 3.5-8%, in the case when the vegetal material was submersed 30 minutes in liquid nitrogen and 7.5-14.5% 7 days at (-196°C. The submersing of Nicotiana alata var. grandiflora species at 7 days, determined a low viability with 11.53%. The following two studied species Cucurbita and Hosta were proved to be the most resistant at submersing and maintenance in liquid nitrogen. The most affected pollen was Campsis radicans species. At Datura stramonium species was observed 2.59% a low viability of pollen, after 30 minutes of liquid nitrogen treatment, was 19.56%, after 7 days of submersing, the most pollen granules losing completely their viability.

  12. Effects of Potassium-Channel Opener on Thallium-201 Kinetics: In-vitro Study in Rat Myocyte Preparations and In-vivo Mice Biodistribution Study

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jae Tae; Kim, Eun Ji; Ahn, Byeong Cheol; Son, Kang Kyun; Lee, Kyu Bo [Kyungpook National University School of Medicine, Taegu (Korea, Republic of); Ha, Jeoung Hee [Youngnam University Medical School, Taegu (Korea, Republic of); Kim, Chun Ki [Mt. Sinai School of Medicine, New York (United States)

    1996-10-15

    Potassium channel opener (K-opener) opens ATP-sensitive K{sup +}-channel located at membrane and induces potassium efflux from cytosol, resulting in intracellular hyperpolarization. Newly synthesized K-opener is currently examined for pharmacologic potency by means of rubidium release test from smooth muscle strip preincubated with Rb-86. Since in-vive behavior of thallium is similar to that of rubidium, we hypothesized that K-opener can alter T1-201 kinetics in vivo. This study was prepared to investigate the effects of pinacidil (one of potent K-openers) on the T1-201 uptake and clearance in cultured myocyte, and in-vivo biodistribution in mice. Spontaneous contracting myocytes were prepared to imitate in-vivo condition from 20 hearts of 3-5 days old Sprague-Dawley rat and cultured for 3-5 days before use (5 X 105 cells/ml). Pinacidil was dissolved in 10% DMSO solution at a final concentration of 100nM or 10uM and was co-incubated with T1-201 in HBSS buffer for 20-min to evaluate its effect on cellular T1-uptake, or challenged to cell preparation pre-incubated with T1-201 for washout study. Two, 40 or 100 mg of pinacidil was injected intravenously into ICR mice at 10 min after 5 muCi T1-201 injection, and organ uptake and whole body retention rate were measured at different time points. Co-incubation of pinacidil with T1-201 resulted in a decrease in T1-201 uptake into cultured myocyte by 1.6 to 2.5 times, depending on pinacidil concentration and activity of T1-201 used. Pinacidil enhanced T1-201 washout by 1.6-3.1 times from myocyte preparations pre-incubated with T1-201. Pinacidil treatment appears to be resulted in mild decreases in blood and liver activity in normal mice, in contrast, renal and cardiac uptake were mildly decreased in a dose dependent manner. Whole body retention ratios of T1-201 were lower at 24 hour after injection with 100 mg of pinacidil than control. These results suggest that treatment with K-opener may affect the interpretation of T1

  13. Probing the O(6) character of {sup 196}Pt with inelastic electron scattering

    Energy Technology Data Exchange (ETDEWEB)

    Aslanidou, Simela; Bassauer, Sergej; Hufnagel, Alexander; Kremer, Christoph; Krugmann, Andreas; Neumann-Cosel, Peter von; Pietralla, Norbert; Singer, Maxim [Institut fuer Kernphysik, Technische Universitaet Darmstadt (Germany)

    2015-07-01

    The Interacting-Boson-Model provides an elegant tool to classify low-lying collective states in medium and heavy mass even-even nuclei. One of its dynamical symmetries is O(6) and a crucial test of this theory is to investigate the monopole transition to the band head of the K=0, σ=N-2 band. A powerful tool to investigate monopole transitions is inelastic electron scattering. An experiment on {sup 196}Pt -claimed to be a perfect O(6) nucleus - has been performed at the superconducting electron linear accelerator S-DALINAC at Darmstadt using the high resolution LINTOTT spectrometer. The experiment and analysis results are presented.

  14. Determination of particle mass deposition according to Bergerhoff; Performance characteristics of the measurement of particle mass deposition and its portions of lead, cadmium, zinc and thallium. Bestimmung des Staubniederschlags nach Bergerhoff; Verfahrenskenngroessen fuer die Messung des Staubniederschlags und seiner Anteile an Blei, Cadmium, Zink und Thallium

    Energy Technology Data Exchange (ETDEWEB)

    Gehrig, R. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Faesi, C. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Hofer, P. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe)

    1993-05-01

    The requirements concerning quality assurance have increased considerably in the field of immission control. Well founded values for detection limits and confidence limits have to be given. Based on the statistical analysis of long term data series of deposition measurements of particle mass (Berghoff method), lead, cadmium, zinc and thallium performance characteristics were established for very differently polluted sites. The resulting detection limits as well as confidence limits are low enough for a reliable control of the respective immission limit values. It is further shown that the use of plastic buckets instead of the glass buckets required by the VDI guideline or the addition of a protecting agent to avoid freezing does not affect the measurements significantly. (orig.)

  15. Roman Policies towards Antiochus III and the Greeks from Winter 197/196 B.C. to Autumn 196 B.C.

    Directory of Open Access Journals (Sweden)

    Deutschmann, Eike Hellmut

    2012-01-01

    Full Text Available In the Second Macedonian War (200-196 B.C., the res publica reduced the strength of the enemy King Philip V apparently to establish a new political order in Southern Balkans: Assumedly a pro-Roman balance of forces should prevail there, untainted by influence of another major power. A particular senatorial policy towards the Greeks probably did not exist before the fighting in Hellas came to an end in summer 197 B.C. In the same year, the Seleucid king Antiochus III brought large parts of the west coast of Asia Minor under control and set about crossing the Hellespont. Rome subsequently stylized itself as the guardian of freedom for the Greeks living in Hellas and Asia Minor. The statesmen of the res publica could have perceived Antiochus’ expansion as a threat to the mentioned new order. Therefore, the Roman Policy of Freedom was possibly applied primarily to take action against the Seleucid king. Die res publica verminderte im Zweiten Makedonischen Krieg (200-196 a.c. die Macht des gegnerischen Königs Philipp V - anscheinend um eine neue politische Ordnung im südlichen Balkanraum zu etablieren: Vermutlich sollte dort ein romfreundliches Kräftegleichgewicht vorherrschen, auf das keine andere Großmacht Einfluß hat. Eine speziell an die Griechen gerichtete Politik seitens des römischen Senats gab es wahrscheinlich nicht vor Ende der Kampfhandlungen in Hellas im Sommer 197 a.c. In dem Jahr erweiterte der seleukidische König Antiochos III. seinen Einflussbereich auf große Teile der kleinasiatischen Westküste und schickte sich an, den Hellespont zu überqueren. Rom stilisierte sich in der Folgezeit zum Freiheitsgarant der in Hellas und Kleinasien lebenden Griechen. Antiochos Expansion könnte von den Staatsmännern der res publica als Bedrohung der genannten neuen Ordnung angesehen worden sein. Demzufolge wurde die römische Freiheitspolitik möglicherweise in erster Linie angewendet, um gegen den seleukidischen König vorzugehen.

  16. Conformational analysis of the hydrophobic peptide alphas1-casein(136-196).

    Science.gov (United States)

    Alaimo, M H; Farrell, H M; Germann, M W

    1999-05-18

    Hydrophobic interactions are important in the self-association of milk proteins, including alphas1-casein. The extent to which casein interaction sites are influenced by local secondary structure is not widely known. Both primary amino acid sequence and local secondary structure are shown to affect the self-association of the hydrophobic peptide alphas1-casein(136-196). The peptide is aggregated at low concentrations (7 microM and above), as determined by 1H nuclear magnetic resonance (NMR) measurements at pH 6.0 in phosphate buffer. Increase in temperature is shown to induce side chain mobility (melting) as indicated by both 1H NMR and near-UV circular dichroism (CD) measurements. As determined by far-UV CD, there is also a loss in the global amount of extended structure with increasing temperature, while beta-turn structures and some aromatic dichroism are conserved at temperatures as high as 70 degrees C. Similar retention of structure occurs at pH 2 and in 6 M guanidine HCl. The observed stability of beta-turns and some side chains in alphas1-casein(136-196) supports previous assumptions that hydrophobic, proline-based turns are important interaction sites in the self-association of alphas1-casein, and possibly in the formation of the calcium transport complexes, the casein micelles. It may be speculated that these areas of the peptide represent a 'molten globule-like', heat stable, core structure for alphas1-casein.

  17. Preparation, Characterization, and In Vivo Pharmacoscintigraphy Evaluation of an Intestinal Release Delivery System of Prussian Blue for Decorporation of Cesium and Thallium

    Directory of Open Access Journals (Sweden)

    Nidhi Sandal

    2017-01-01

    Full Text Available Background. Prussian blue (PB, ferric hexacyanoferrate is approved by US-FDA for internal decorporation of Cesium-137 (137Cs and Thallium-201 (201Tl. Aim. Since PB is a costly drug, pH-dependent oral delivery system of PB was developed using calcium alginate matrix system. Methods. Alginate (Alg beads containing PB were optimized by gelation of sodium alginate with calcium ions and effect of varying polymer concentration on encapsulation efficiency and release profile was investigated. Scanning electron microscopy (SEM was carried out to study surface morphology. Adsorption efficacy of Alg-PB beads for 201Tl was evaluated and compared with native PB. In vivo pH-dependent release of the formulation was studied in humans using gamma scintigraphy. Results. Encapsulation efficiencies of Alg-PB beads with 0.5, 1.0, 1.5, and 2.0% polymer solution were 99.9, 91, 92, and 93%, respectively. SEM and particle size analysis revealed differences between formulations in their appearance and size distribution. No drug release was seen in acidic media (pH of 1-2 while complete release was observed at pH of 6.8. Dissolution data was fitted to various mathematical models and beads were found to follow Hixson-Crowell mechanism of release. The pH-dependent release of beads was confirmed in vivo by pharmacoscintigraphy in humans.

  18. Replacement of a photomultiplier tube in a 2-inch thallium-doped sodium iodide gamma spectrometer with silicon photomultipliers and a light guide

    Directory of Open Access Journals (Sweden)

    Chankyu Kim

    2015-06-01

    Full Text Available The thallium-doped sodium iodide [NaI(Tl] scintillation detector is preferred as a gamma spectrometer in many fields because of its general advantages. A silicon photomultiplier (SiPM has recently been developed and its application area has been expanded as an alternative to photomultiplier tubes (PMTs. It has merits such as a low operating voltage, compact size, cheap production cost, and magnetic resonance compatibility. In this study, an array of SiPMs is used to develop an NaI(Tl gamma spectrometer. To maintain detection efficiency, a commercial NaI(Tl 2′ × 2′ scintillator is used, and a light guide is used for the transport and collection of generated photons from the scintillator to the SiPMs without loss. The test light guides were fabricated with polymethyl methacrylate and reflective materials. The gamma spectrometer systems were set up and included light guides. Through a series of measurements, the characteristics of the light guides and the proposed gamma spectrometer were evaluated. Simulation of the light collection was accomplished using the DETECT 97 code (A. Levin, E. Hoskinson, and C. Moison, University of Michigan, USA to analyze the measurement results. The system, which included SiPMs and the light guide, achieved 14.11% full width at half maximum energy resolution at 662 keV.

  19. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: a comparative dual-isotope study.

    Science.gov (United States)

    Zimmermann, R; Rauch, B; Kapp, M; Bubeck, B; Neumann, F J; Seitz, F; Stokstad, P; Mall, G; Tillmanns, H; Kübler, W

    1992-01-01

    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were administered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for 201Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r = 0.75, p or = 75% (IP-PA: 70.0%, 201Tl: 66.3%, P = NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P = 0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29% +/- 11% vs 44% +/- 11% in normal myocardium, P IPPA is essentially as sensitive as scintigraphy with 201Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability.

  20. Dynamic low dose I-123-iodophenylpentadecanoic acid metabolic cardiac imaging; Comparison to myocardial biopsy and reinjection SPECT thallium in ischemic cardiomyopathy and cardiac transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Murray, G.L.; Magill, H.L. [Baptist Memorial Hospital (United States); Schad, N.C.

    1993-12-01

    Recognition of stunned and hibernating myocardium is essential in this era of cardiac revascularization. Positron emission tomography (PET) accurately identifies viability but is costly and unavailable to most patients. Dynamic low dose I-123-iodophenylpentadecanoic acid (IPPA) metabolic cardiac imaging is a potentially cost-effective alternative to PET. Using transmural myocardial biopsies obtained during coronary bypass surgery as the viability gold standard, resting IPPA imaging agreed with 39/43 (91%) biopsies, with a sensitivity for viability of 33/36(92%) and a specificity of 6/7 (86%) in patients with severe ischemic cardiomyopathy. Eighty percent of IPPA viable, infarcted segments improved wall motion postoperatively. Furthermore, when compared to reinjection thallium (SPECT-Tl) scans after myocardial infarction, there was IPPA-Tl concordance in 27/35 (77%)(Kappa=0.536, p=0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-Tl, 26/35 (74%) vs. 18/35 (51%)(p=0.047). Finally, when compared to transvenous endomyocardial biopsy for detecting rejection following cardiac transplantation, IPPA sensitivity for {>=}Grade II rejection was 100%, and IPPA screening assessment for the necessity of biopsy could result in a 31% cost-savings. Therefore, IPPA metabolic cardiac imaging is a safe, inexpensive technique with a promising future. (author).

  1. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: A comparative dual-isotope study

    Energy Technology Data Exchange (ETDEWEB)

    Zimmermann, R.; Rauch, B.; Kapp, M.; Neumann, F.J.; Seitz, F.; Kuebler, W. (Heidelberg Univ. (Germany). Dept. of Cardiology); Bubeck, B. (Heidelberg Univ. (Germany). Dept. of Nuclear Medicine); Mall, G. (Heidelberg Univ. (Germany). Dept. of Pathology); Tillmanns, H. (Giessen Univ. (Germany). Dept. of Cardiology); Stokstad, P.

    1992-11-01

    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were adminstered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for {sup 201}Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r=0.75, p<0.001). Both tracers also revealed a similar sensitivity for the identification of individual coronary artery stenoses {>=}75% (IPPA: 70%, {sup 201}Tl: 66.3%, P=NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P=0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29%{+-}11% vs 44%{+-}11% in normal myocardium, P<0.05). The data indicate that serial myocardial scintigraphy with IPPA is essentially as sensitive as scintigraphy with {sup 201}Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability. (orig.).

  2. Myocardial viability assessment with dynamic low-dose iodine-123-iodophenylpentadecanoic acid metabolic imaging: comparison with myocardial biopsy and reinjection SPECT thallium after myocardial infarction.

    Science.gov (United States)

    Murray, G L; Schad, N C; Magill, H L; Vander Zwaag, R

    1994-04-01

    Aggressive cardiac revascularization requires recognition of stunned and hibernating myocardium, and cost considerations may well govern the technique used. Dynamic low-dose (1 mCi) [123I]iodophenylpentadecanoic acid (IPPA) metabolic imaging is a potential alternative to PET using either 18FDG or 15O-water. Resting IPPA images were obtained from patients with severe ischemic cardiomyopathy, and transmural myocardial biopsies were obtained during coronary bypass surgery to confirm viability. Thirty-nine of 43 (91%) biopsies confirmed the results of the IPPA images with a sensitivity for viability of 33/36 (92%) and a specificity of 6/7 (86%). Postoperatively, wall motion improved in 80% of IPPA-viable, dysfunctional segments. Furthermore, when compared to reinjection thallium (SPECT-TI) scans after myocardial infarction, IPPA-SPECT-TI concordance occurred in 27/35 (77%) (K = 0.536, p = 0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-TI, 26/35 (74%) versus 18/35 (51%) (p = 0.047). Metabolic IPPA cardiac viability imaging is a safe, inexpensive technique that may be a useful alternative to PET.

  3. Identification and Decay Studies of New, Neutron-Rich Isotopes of Bismuth, Lead and Thallium by means of a Pulsed Release Element Selective Method

    CERN Multimedia

    Mills, A; Kugler, E; Van duppen, P L E; Lettry, J

    2002-01-01

    % IS354 \\\\ \\\\ It is proposed to produce, identify and investigate at ISOLDE new, neutron-rich isotopes of bismuth, lead and thallium at the mass numbers A=215 to A=218. A recently tested operation mode of the PS Booster-ISOLDE complex, taking an advantage of the unique pulsed proton beam structure, will be used together with a ThC target in order to increase the selectivity. The decay properties of new nuclides will be studied by means of $\\beta$-, $\\gamma$- and X- ray spectroscopy methods. The expected information on the $\\beta$-half-lives and excited states will be used for testing and developing the nuclear structure models ``south-east'' of $^{208}$Pb, and will provide input data for the description of the r-process path at very heavy nuclei. The proposed study of the yields and the decay properties of those heavy nuclei produced in the spallation of $^{232}$Th by a 1~GeV proton beam contributes also the data necessary for the simulations of a hybrid accelerator-reactor system.

  4. Thallium contamination in arable soils and vegetables around a steel plant-A newly-found significant source of Tl pollution in South China.

    Science.gov (United States)

    Liu, Juan; Luo, Xuwen; Wang, Jin; Xiao, Tangfu; Chen, Diyun; Sheng, Guodong; Yin, Meiling; Lippold, Holger; Wang, Chunlin; Chen, Yongheng

    2017-05-01

    Thallium (Tl) is a highly toxic rare element. Severe Tl poisoning can cause neurological brain damage or even death. The present study was designed to investigate contents of Tl and other associated heavy metals in arable soils and twelve common vegetables cultivated around a steel plant in South China, a newly-found initiator of Tl pollution. Potential health risks of these metals to exposed population via consumption of vegetables were examined by calculating hazard quotients (HQ). The soils showed a significant contamination with Tl at a mean concentration of 1.34 mg/kg. The Tl levels in most vegetables (such as leaf lettuce, chard and pak choy) surpassed the maximum permissible level (0.5 mg/kg) according to the environmental quality standards for food in Germany. Vegetables like leaf lettuce, chard, pak choy, romaine lettuce and Indian beans all exhibited bioconcentration factors (BCF) and transfer factors (TF) for Tl higher than 1, indicating a hyperaccumulation of Tl in these plants. Although the elevated Tl levels in the vegetables at present will not immediately pose significant non-carcinogenic health risks to residents, it highlights the necessity of a permanent monitoring of Tl contamination in the steel-making areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Thallium-201 is comparable to technetium-99m-sestamibi for estimating cardiac function in patients with abnormal myocardial perfusion imaging

    Directory of Open Access Journals (Sweden)

    Ming-Che Wu

    2015-11-01

    Full Text Available We analyzed the left-ventricular functional data obtained by cardiac-gated single-photon emission computed tomography myocardial perfusion imaging (MPI with thallium-201 (Tl-201 and technetium-99m-sestamibi (MIBI protocols in different groups of patients, and compared the data between Tl-201 and MIBI. Two hundred and seventy-two patients undergoing dipyridamole stress/redistribution Tl-201 MPI and 563 patients undergoing 1-day rest/dipyridamole stress MIBI MPI were included. Higher mean stress ejection fraction (EF, rest EF, and change in EF (ΔEF were noticed in the normal MPI groups by both Tl-201 and MIBI protocols. Higher mean EF was observed in the females with normal MPI results despite their higher mean age. Comparisons between the Tl-201 and MIBI groups suggested a significant difference in all functional parameters, except for the rest end diastolic volume/end systolic volume and ΔEF between groups with negative MPI results. For the positive MPI groups, there was no significant difference in all parameters, except for the change in end diastolic volume and change in end systolic volume after stress between both protocols. The Tl-201 provides comparable left-ventricular functional data to MIBI cardiac-gated single-photon emission computed tomography in patients with positive MPI results, and may therefore be undertaken routinely for incremental functional information that is especially valuable to this patient group.

  6. Usefulness of thallium-201 myocardial scintigraphy during hyperventilation and accelerated exercise test in patients with vasospastic angina and nearly normal coronary artery

    Energy Technology Data Exchange (ETDEWEB)

    Sueda, Shozo; Mineoi, Kazuaki; Kondou, Tadashi [Takanoko Hospital, Matsuyama, Ehime (Japan)] [and others

    1998-04-01

    The usefulness of thallium-201 ({sup 201}Tl) myocardial scintigraphy was studied in 109 patients with vasospastic angina who had nearly normal coronary arteries (degree of stenosis <50%). Coronary spasm was confirmed by pharmacologic agents in all 109 patients from January 1991 to June 1996. The appearance rate of visual redistribution on {sup 201}Tl myocardial scintigraphy was compared between four groups, 34 patients performing graded bicycle ergometer exercise starting at a work load of 50 W with increments of 25 W every 3 min (Ergo(3) group), 14 patients performing hyperventilation for 5 min (HV(5) group), 31 patients performing bicycle ergometer exercise with increments of 25 W every 1 min after 5 min hyperventilation (HV(5)+Ergo(1) group), and 30 patients at rest (Rest group). The value of the visual redistribution rate on {sup 201}Tl myocardial scintigrams in the HV(5)+Ergo(l) group (65%) was higher than that in the patients of other groups (Ergo(3) 41%, HV(5) 43%, Rest 33%). However, there were no significant differences between the four groups. Stress {sup 201}Tl imaging after hyperventilation and accelerated exercise is useful to disclose ischemic evidence in about two thirds of patients with vasospastic angina and nearly normal coronary arteries, whereas about 40% of patients had visual redistribution on {sup 201}Tl myocardial scintigrams by performing standard procedures. (author)

  7. On-line preconcentration of ultra-trace thallium(I in water samples with titanium dioxide nanoparticles and determination by graphite furnace atomic absorption spectrometry

    Directory of Open Access Journals (Sweden)

    Saeid Asadpour

    2016-11-01

    Full Text Available A new method has been developed for the determination of Tl(I based on simultaneous sorption and preconcentration with a microcolumn packed with TiO2 nanoparticle with a high specific surface area prepared by Sonochemical synthesis prior to its determination by graphite furnace atomic absorption spectrometry (GFAAS. The optimum experimental parameters for preconcentration of thallium, such as elution condition, pH, and sample volume and flow rate have been investigated. Tl(I can be quantitatively retained by TiO2 nanoparticles at pH 9.0, then eluted completely with 1.0 mol L−1 HCl. The adsorption capacity of TiO2 nanoparticles for Tl(I was found to be 25 mg g−1. Also detection limit, precision (RSD, n = 8 and enrichment factor for Tl(I were 87 ng L−1, 6.4% and 100, respectively. The method has been applied for the determination of trace amounts of Tl(I in some environmental water samples with satisfactory results.

  8. Thallium-201 single photon emission computed tomography (SPECT) in patients with Duchenne's progressive muscular dystrophy. A histopathologic correlation study

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, Toru; Yanagisawa, Atsuo; Sakata, Konomi; Shimoyama, Katsuya; Yoshino, Hideaki; Ishikawa, Kyozo [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine; Sakata, Hitomi; Ishihara, Tadayuki

    2001-02-01

    The pathomorphologic mechanism responsible for abnormal perfusion imaging during thallium-201 myocardial single photon emission computed tomography ({sup 201}Tl-SPECT) in patients with Duchenne's progressive muscular dystrophy (DMD) was investigated. Hearts from 7 patients with DMD were evaluated histopathologically at autopsy and the results correlated with findings on initial and delayed resting {sup 201}Tl-SPECT images. The location of segments with perfusion defects correlated with the histopathologically abnormal segments in the hearts. Both the extent and degree of myocardial fibrosis were severe, especially in the posterolateral segment of the left ventricle. Severe transmural fibrosis and severe fatty infiltration were common in segments with perfusion defects. In areas of redistribution, the degree of fibrosis appeared to be greater than in areas of normal perfusion; and intermuscular edema was prominent. Thus, the degree and extent of perfusion defects detected by {sup 201}Tl-SPECT were compatible with the histopathology. The presence of the redistribution phenomenon may indicate ongoing fibrosis. Initial and delayed resting {sup 201}Tl-SPECT images can predict the site and progress of myocardial degeneration in patients with DMD. (author)

  9. Aryl hydrocarbon receptor-dependent regulation of miR-196a expression controls lung fibroblast apoptosis but not proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Hecht, Emelia [Department of Medicine, McGill University, Montreal, Quebec (Canada); Zago, Michela [Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Sarill, Miles [Department of Medicine, McGill University, Montreal, Quebec (Canada); Rico de Souza, Angela [Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Gomez, Alvin; Matthews, Jason [Department of Pharmacology and Toxicology, University of Toronto, Toronto, ON (Canada); Hamid, Qutayba; Eidelman, David H. [Department of Medicine, McGill University, Montreal, Quebec (Canada); Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Baglole, Carolyn J., E-mail: Carolyn.baglole@McGill.ca [Department of Medicine, McGill University, Montreal, Quebec (Canada); Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada)

    2014-11-01

    The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor implicated in the regulation of apoptosis and proliferation. Although activation of the AhR by xenobiotics such as dioxin inhibits the cell cycle and control apoptosis, paradoxically, AhR expression also promotes cell proliferation and survival independent of exogenous ligands. The microRNA (miRNA) miR-196a has also emerged as a regulator of proliferation and apoptosis but a relationship between the AhR and miR-196a is not known. Therefore, we hypothesized that AhR-dependent regulation of endogenous miR-196a expression would promote cell survival and proliferation. Utilizing lung fibroblasts from AhR deficient (AhR{sup −/−}) and wild-type (AhR{sup +/+}) mice, we show that there is ligand-independent regulation of miRNA, including low miR-196a in AhR{sup −/−} cells. Validation by qRT-PCR revealed a significant decrease in basal expression of miR-196a in AhR{sup −/−} compared to AhR{sup +/+} cells. Exposure to AhR agonists benzo[a]pyrene (B[a]P) and FICZ as well as AhR antagonist CH-223191 decreased miR-196a expression in AhR{sup +/+} fibroblasts concomitant with decreased AhR protein levels. There was increased proliferation only in AhR{sup +/+} lung fibroblasts in response to serum, corresponding to a decrease in p27{sup KIP1} protein, a cyclin-dependent kinase inhibitor. Increasing the cellular levels of miR-196a had no effect on proliferation or expression of p27{sup KIP1} in AhR{sup −/−} fibroblasts but attenuated cigarette smoke-induced apoptosis. This study provides the first evidence that AhR expression is essential for the physiological regulation of cellular miRNA levels- including miR-196a. Future experiments designed to elucidate the functional relationship between the AhR and miR-196a may delineate additional novel ligand-independent roles for the AhR. - Highlights: • The AhR controls proliferation and apoptosis in lung cells. • The AhR regulates the

  10. Insights into the evolution of sorbitol metabolism: phylogenetic analysis of SDR196C family

    Directory of Open Access Journals (Sweden)

    Sola Carvajal Agustín

    2012-08-01

    Full Text Available Abstract Background Short chain dehydrogenases/reductases (SDR are NAD(P(H-dependent oxidoreductases with a highly conserved 3D structure and of an early origin, which has allowed them to diverge into several families and enzymatic activities. The SDR196C family (http://www.sdr-enzymes.org groups bacterial sorbitol dehydrogenases (SDH, which are of great industrial interest. In this study, we examine the phylogenetic relationship between the members of this family, and based on the findings and some sequence conserved blocks, a new and a more accurate classification is proposed. Results The distribution of the 66 bacterial SDH species analyzed was limited to Gram-negative bacteria. Six different bacterial families were found, encompassing α-, β- and γ-proteobacteria. This broad distribution in terms of bacteria and niches agrees with that of SDR, which are found in all forms of life. A cluster analysis of sorbitol dehydrogenase revealed different types of gene organization, although with a common pattern in which the SDH gene is surrounded by sugar ABC transporter proteins, another SDR, a kinase, and several gene regulators. According to the obtained trees, six different lineages and three sublineages can be discerned. The phylogenetic analysis also suggested two different origins for SDH in β-proteobacteria and four origins for γ-proteobacteria. Finally, this subdivision was further confirmed by the differences observed in the sequence of the conserved blocks described for SDR and some specific blocks of SDH, and by a functional divergence analysis, which made it possible to establish new consensus sequences and specific fingerprints for the lineages and sub lineages. Conclusion SDH distribution agrees with that observed for SDR, indicating the importance of the polyol metabolism, as an alternative source of carbon and energy. The phylogenetic analysis pointed to six clearly defined lineages and three sub lineages, and great variability in

  11. Study of dimuon pair production in e+ e- collisions from 196 - 202 GeV

    CERN Document Server

    Flacher, Henning

    2000-01-01

    In this thesis the electroweak process $e^{+} e^{-}$ --> $μ^{+} μ^{-}$ was studied and an inclusive and exclusive cross section were measured. Furthermore the forward-backward asymmetry Afb was determined from the exclusive event sample. The investigated data was recorded·with the detector ALEPH at centre-of-mass energies of 196, 200 and 202 GeV resulting in a total integrated luminosity of 208.1 pb-1. All the measured results are in good agreement with the Standard Model. From the measurements of total cross sections and angular distributions for all the two fermion processes at energies from 130 - 202 GeV limits on processes beyond the Standard Model were derived. For Contact Interactions they were found to be of the order of 10 TeV while for TeV-Scale Quantum Gravity a limit for the ultra-violet cut-off parameter of A::1 TeV could be derived.

  12. Charged Hadron Distributions In 19.6-gev Gold+gold Collisions

    CERN Document Server

    Picha, R

    2005-01-01

    Experimental results from a low-energy heavy ion run in year 2001 at the Relativistic Heavy Ion Collider (RHIC) using the Solenoidal Tracker at RHIC (STAR) detector are presented. From the collisions of gold ions at sNN = 19.6 GeV, six species of particles (π±, K±, p, and p¯) are identified via energy loss mechanism and their transverse mass spectra are analyzed at midrapidity (|y| < 0.5) and m T − m0 < 1.0 GeV/c 2. Rapidity distributions, particle ratios, and hadronic freeze-out conditions are discussed. This study provides a low energy measurement at RHIC which is very close to that at the SPS for cross comparison between collider experiments and fixed target experiments. The analysis provides a good reference to study excitation functions of strangeness production, net baryon, and collective flow inside heavy ion collisions.

  13. Iodine-123 phenylpentadecanoic acid and single photon emission computed tomography in identifying left ventricular regional metabolic abnormalities in patients with coronary heart disease: comparison with thallium-201 myocardial tomography.

    Science.gov (United States)

    Hansen, C L; Corbett, J R; Pippin, J J; Jansen, D E; Kulkarni, P V; Ugolini, V; Henderson, E; Akers, M; Buja, L M; Parkey, R W

    1988-07-01

    Iodine-123 phenylpentadecanoic acid (IPPA) is a synthetic long chain fatty acid with myocardial kinetics similar to palmitate. Two hypotheses were tested in this study. The first hypothesis was that IPPA imaging with single photon emission computed tomography (SPECT) is useful in the identification of patients with coronary artery disease. Fourteen normal volunteers (aged 27 +/- 2 years) and 33 patients (aged 54 +/- 11 years) with stable symptomatic coronary artery disease and at least one major coronary artery with luminal diameter narrowing greater than or equal to 70% were studied with symptom-limited maximal exercise testing. The IPPA (6 to 8 mCi) was injected 1 min before the termination of exercise, and tomographic imaging was performed beginning at 9 min and repeated at 40 min after the injection of IPPA. Nine of the normal volunteers and 13 of the patients had a second examination performed at rest on another day. Using the limits of normal as 2 SD from the normal mean values, 27 of the 33 patients with coronary artery disease demonstrated abnormalities in either the initial distribution or the clearance of IPPA, or both. Nineteen of the 33 patients had a maximal variation of activity distribution of greater than or equal to 25% on the 9 min IPPA images. Twenty-two of the 33 patients had a maximal variation in IPPA washout greater than 17% and 17 had a washout rate less than or equal to 2%. There was good agreement between the location of significant coronary artery stenoses and abnormalities in the initial distribution and clearance of IPPA. The second hypothesis tested was that IPPA imaging is as or more sensitive and, therefore, complementary to thallium-201 imaging in the identification of exercise-induced ischemia in patients. Twenty-five of the 33 patients underwent both thallium-201 and IPPA tomographic imaging after symptom-limited maximal exercise testing. The amount of exercise performed by each patient during both studies was similar. Twenty

  14. Luminescent one- and two-dimensional extended structures and a loosely associated dimer based on platinum(II)-thallium(I) backbones.

    Science.gov (United States)

    Forniés, Juan; García, Ana; Lalinde, Elena; Moreno, M Teresa

    2008-05-05

    Neutralization reactions between (NBu4)2[ trans-Pt(C 6F5)2(CN)2] 1 and (NBu4)2[cis-Pt(C6F5)2(CN)2] 2 with TlPF 6 have been carried out, and the resulting structures of [trans,trans,trans-Tl2{Pt(C6F5)2(CN)2}.(CH3COCH3) ] n [4.(CH3COCH3)2] n and {Tl[Tl{cis-Pt(C6F5)2(CN)2}].(H2O)} n [5.(H2O)] n have been determined by X-ray crystallography. Remarkably, the change from trans to cis geometry on the platinum substrate causes a significant decrease in the Pt(II)...Tl(I) metallophilic interaction. Thus, the platinum center in the trans fragment easily connects with two Tl(I) ions forming a distorted pseudo-octahedron PtTl2, which generates a final two-dimensional layered structure by secondary additional intermolecular Tl(I)...N(CN) interactions. However, the [cis-Pt(C6F5)2(CN)2] (2-) fragment interacts strongly with just one Tl center leading to an extended helical [-Pt-Tl-Pt-Tl-] n(n-) chain. In this case, the second thallium center neutralizes the anionic chain mainly through Tl...N(CN) ( intra) and Tl...F(C 6F 5) (intra and inter)actions. The reaction of TlPF 6 with the monoanionic fragment (NBu4)[cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)] 3 yields the discrete associated dimer [Tl{cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)}] 2 [ 6] 2. Dimer [ 6] 2 could be described as two square pyramids with the thallium atoms in the apical positions, connected through Tl...N(cyano) interactions. The final heteropolynuclear Pt-Tl complexes, except 4 at room temperature, show bright emission in the solid state when irradiated with UV-vis radiation, in contrast to the precursors 1 and 3, which are not luminescent. This difference indicates that the emissions in 4- 6 are presumably related to the interaction between the metal centers. The Pt-Tl bonding interactions and, consequently, the emissive properties are lost in solution at room temperature, as shown by the conductivity and NMR measurements. However, variable-concentration luminescence measurements in glassy acetonitrile solutions

  15. Simultaneous dual myocardial imaging with iodine-123-[beta]-methyl iodophenyl-pentadecanoic acid (BMIPP) and thallium-201 in patients with coronary heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Tawarahara, Kei; Kurata, Chinori; Taguchi, Takahisa; Aoshima, Shigeyuki; Okayama, Kenichi; Kobayashi, Akira; Yamazaki, Noboru; Kaneko, Masao (Hamamatsu Univ. School of Medicine, Shizuoka (Japan))

    1994-02-01

    To assess the clinical value of simultaneous dual myocardial imaging with iodine-123-[beta]-methyl-iodophenyl-pentadecanoic acid ([sup 123]I-BMIPP) and thallium-201 ([sup 201]TL), myocardial imaging was performed at rest and during execise in seven patients with coronary heart disease. When [sup 123]I-BMIPP and [sup 201]Tl images were compared, the initial exercise and resting images agreed 87% and 64%, respectively. In the initial resting images, the regional uptake of [sup 123]I-BMIPP was frequently less than that of [sup 201]Tl. The incidence of exercise-induced reversible defects by [sup 201]Tl in the Tl>BMIPP regions was significantly higher than that in the Tl=BMIPP regions (57% vs 4%, p<0.01) and the incidence of coronary narrowing of more than 90% in the Tl>BMIPP regions was also significantly higher than that in the Tl=BMIPP regions (91% vs 38%, p<0.01). In addition, this disparity (Tl>BMIPP) was found more frequently in regions with abnormal wall motion than in regions with normal wall motion (hypokinetic regions; 68%, severe hypokinetic or akinetic regions; 50%, vs normokinetic regions; 4%, p<0.01). In contrast, the uptake of [sup 123]I-BMIPP correlated closely with that of [sup 201]Tl in normal myocardium and the uptake of both [sup 123]I-BMIPP and [sup 201]Tl was severely reduced in myocardium with severe ischemia during exercise and prior infarction. These results indicate that dual myocardial imaging with [sup 123]I-BMIPP and [sup 201]Tl may provide a unique means of identifying patients with metabolically disturbed myocardium, such as hibernating and stunned myocardium. (author).

  16. Imaging of brain tumors in AIDS patients by means of dual-isotope thallium-201 and technetium-99m sestamibi single-photon emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    De La Pena, R.C.; Ketonen, L.; Villanueva-Meyer, J. [Dept. of Radiology, Univ. of Texas, Galveston (United States)

    1998-10-01

    Our aim was to evaluate the use of dual-isotope thallium-201 (Tl) and technetium-99m sestamibi (sestamibi) simultaneous acquisition in brain single-photon emission tomography (SPET) for the differentiation between brain lymphoma and benign central nervous system (CNS) lesions in AIDS patients. Thirty-six consecutive patients with enhancing mass lesions on magnetic resonance (MR) imaging were included in the study. SPET of the brain was performed to obtain simultaneous Tl and sestamibi images. Regions-of-interest were drawn around the lesion and on the contralateral side to calculate uptake ratios. The final diagnosis was reached by pathologic findings in 17 patients and clinical and/or MR follow-up in 19 patients. Of the 36 patients, 11 had brain lymphoma, 1 glioblastoma multiforme, 15 toxoplasmosis and 9 other benign CNS lesions. Correlation between SPET and the final diagnosis revealed in 10 true-positive, 23 true-negative, 1 false-positive and 2 false-negative studies. All patients with toxoplasmosis had negative scans. A patient with a purulent infection had positive scans. Tl and sestamibi scans were concordant in every lesion. The same lesions that took up Tl were also visualized with sestamibi. However, sestamibi scans showed higher lesion-to-normal tissue uptake ratios (3.7{+-}1.8) compared with those of Tl (2.3{+-}0.8, P<0.002). Simultaneous acquisition of Tl and sestamibi can help differentiate CNS lymphoma from benign brain lesions in AIDS patients. (orig.) With 2 figs., 2 tabs., 34 refs.

  17. Technetium-99m pyrophosphate/thallium-201 dual-isotope SPECT imaging predicts reperfusion injury in patients with acute myocardial infarction after reperfusion

    Energy Technology Data Exchange (ETDEWEB)

    Akutsu, Yasushi; Kaneko, Kyouichi; Kodama, Yusuke; Li, Hui-Ling; Nishimura, Hideki; Hamazaki, Yuji; Kobayashi, Youichi [Showa University School of Medicine, Division of Cardiology, Department of Medicine, Tokyo (Japan); Suyama, Jumpei; Shinozuka, Akira; Gokan, Takehiko [Showa University School of Medicine, Department of Radiology, Tokyo (Japan)

    2009-02-15

    Microcirculatory failure after reperfusion is clinically indicated to cause reperfusion injury whereas excessive intracellular calcium ion overload is experimentally proved as a key mechanism of reperfusion injury. We hypothesized that technetium-99m ({sup 99m}Tc) pyrophosphate (Tc-PYP) uptake in injured but viable infarct-related myocardium with preserved myocardial perfusion after reperfusion estimated by thallium-201 ({sup 201}Tl) uptake would be associated with final functional recovery. Dual-isotope Tc-PYP/{sup 201}Tl single-photon emission computed tomography (SPECT) was performed 2 days after successful reperfusion therapy in patients with first acute myocardial infarction, and 50 patients (63 {+-} 13 years old, female 22%) with preserved {sup 201}Tl uptakes of {>=}50% in reperfused myocardium was followed for 1 month. Tc-PYP uptake was assessed as the heart-to-sternum (H/S) ratio. Two-dimensional echocardiography was also performed 2 days and 1 month after reperfusion to evaluate functional recovery. High Tc-PYP uptake, defined as the H/S ratio {>=}0.81, was predictive of chronic phase no functional recovery (73.7% in 14 of 19 patients with high uptake vs 16.1% in five of 31 patients without those, p < 0.0001). After adjustment for potential confounding variables, including electrocardiographic persistent ST segment elevation at 1 h after reperfusion, high Tc-PYP uptake remained independently predictive of no functional recovery with odds ratio of 8.7 (95% confidential interval = 2 to 38.7; p = 0.005). High Tc-PYP uptake in reperfused but viable infarct-related myocardium was a powerful predictor of no functional recovery, which may reflect excessive intracellular calcium ion overload caused by reperfusion injury. Tc-PYP/{sup 201}Tl dual-isotope SPECT imaging can provide prognostic information after reperfusion. (orig.)

  18. BaHg2Tl2. An unusual polar intermetallic phase with strong differentiation between the neighboring elements mercury and thallium.

    Science.gov (United States)

    Dai, Jing-Cao; Gupta, Shalabh; Gourdon, Olivier; Kim, Hyun-Jeong; Corbett, John D

    2009-06-24

    High yields of the novel BaHg(2)Tl(2) are achieved from reactions of the appropriate cast alloys at approximately 400 degrees C. (Isotypic SrHg(2)Tl(2) also exists.) The tetragonal barium structure (P4(2)/mnm, a = 10.606 A, c = 5.159 A) was refined from both single-crystal X-ray and neutron powder diffraction data in order to ensure the atom site assignments although distances and calculated atom site population also support the results. The Hg and Tl network atoms are distinctive in their functions and bonding. Parallel chains of Hg hexagons and of Tl tetrahedra along c are constructed from polyhedra that share opposed like edges, and these are in turn interconnected by Hg-Tl bonds. Overall, the number of Tl-Tl bonds per cell exceeds the Hg-Hg type by 20:12, but these are approximately 1:2 each in bonding according to their average -ICOHP values (related to overlap populations). Barium is bound within a close 15-atom polyhedron, 12 atoms of which are the more electronegative Hg. LMTO-ASA calculations show that scalar relativistic effects are particularly important for Hg 5d-6s mixing in Hg-Hg and Hg-Tl bonding, whereas relatively separate Tl 6s and 6p states are more important in Tl-Tl interactions. The 6p states of Hg and Tl and 5d of Ba define a dominant conduction band around E(F), and the phase is metallic and Pauli-like paramagnetic. The thallium characteristics here are close to those in numerous alkali-metal-Tl cluster systems. Other active metal-mercury phases that have been studied theoretically are all distinctly electron-richer and more reduced, and without appreciable net 5d, 6s contributions to Hg-Hg bonding.

  19. The nonoxidative conversion of nitroethane to ethylnitronate in Neurospora crassa 2-nitropropane dioxygenase is catalyzed by histidine 196.

    Science.gov (United States)

    Francis, Kevin; Gadda, Giovanni

    2008-09-02

    The deprotonation of nitroethane catalyzed by Neurospora crassa 2-nitropropane dioxygenase was investigated by measuring the formation and release of ethylnitronate formed in turnover as a function of pH and through mutagenesis studies. Progress curves for the enzymatic reaction obtained by following the increase in absorbance at 228 nm over time were visibly nonlinear, requiring a logarithmic approximation of the initial reaction rates for the determination of the kinetic parameters of the enzyme. The pH dependence of the second-order rate constant k cat/ K m with nitroethane as substrate implicates the presence of a group with a p K a of 8.1 +/- 0.1 that must be unprotonated for nitronate formation. Mutagenesis studies suggest that this group is histidine 196 as evident from the inability of a H196N variant form of the enzyme to catalyze the formation of ethylnitronate from nitroethane. Replacement of histidine 196 with asparagine resulted in an approximately 15-fold increase in the k cat/ K m with ethylnitronate as compared to the wild-type, which results from the inability of the mutant enzyme to undergo nonoxidative turnover. The results presented herein are consistent with a branched catalytic mechanism for the enzyme in which the ethylnitronate intermediate formed from the H196-catalyzed deprotonation of nitroethane partitions between release from the active site and oxidative denitrification to yield acetaldehyde and nitrite.

  20. 15 CFR 19.6 - When will Commerce entities allow a debtor to pay a Commerce debt in installments instead of one...

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false When will Commerce entities allow a debtor to pay a Commerce debt in installments instead of one lump sum? 19.6 Section 19.6 Commerce and Foreign Trade Office of the Secretary of Commerce COMMERCE DEBT COLLECTION Procedures To Collect Commerce...

  1. Fracture toughness testing of V-4Cr-4Ti at 25{degrees}C and -196{degrees}C

    Energy Technology Data Exchange (ETDEWEB)

    Li, H.X.; Kurtz, R.J. [Pacific Northwest National Lab., Richland, WA (United States)

    1996-10-01

    Measurements of the fracture toughness of the production-scale heat (832665) of V-4Cr-4Ti have been performed at 25{degrees}C and {minus}196{degrees}C using compact tension (CT) specimens. Test specimens were vacuum annealed at either 1000{degrees}C for 1 hour (HT1) or 1050{degrees}C for two hours (HT2). Specimens given the HT1 treatment were annealed after final machining, whereas the HT2 specimens received the 1050{degrees}C anneal at Teledyne Wah Chang prior to final machining. Following machining HT2 specimens were then vacuum annealed at 180{degrees}C for two hours to remove hydrogen. Specimens treated using HT1 had a partially recrystallized microstructure and those treated using HT2 had a fully recrystallized microstructure. The fracture toughness at 25{degrees}C was determined by J-integral tests and at {minus}196{degrees}C by ASTM E 399 type tests. Toughness values obtained at {minus}196{degrees}C were converted to J-integral values for comparison to the 25{degrees}C data. The 25{degrees}C fracture toughness was very high with none of the specimens giving valid results per ASTM criteria. Specimens fractured by microvoid coalescence. The fracture toughness at {minus}196{degrees}C was much lower than that at 25{degrees}C and the fracture surface showed predominantly cleavage features. The present results show a transition from ductile to brittle behavior with decreasing test temperature which is not observed from one-third scale Charpy impact tests. The fracture toughness at {minus}196{degrees}C was still quite high, however, at about 75 kJ/m{sup 2}. Delaminations in planes normal to the thickness direction were seen at both test temperatures. Fracture surfaces inside the delaminations exhibited nearly 100% cleavage facets. The cause of the brittle delaminations was not determined, but will be a subject for further investigation.

  2. s196wo.m77t and s196wo.h77t: MGD77T data and header file for single-beam bathymetry for field activity S-1-96-WO in Cascadia, Washington from 04/14/1996 to 06/06/1996

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Single-beam bathymetry data along with GPS navigation data was collected as part of the U.S. Geological Survey cruise S-1-96-WO. The cruise was conducted in...

  3. Search for excited electrons in p pmacr collisions at s=1.96TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P. A.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Luna, R.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.; Obrant, G.; Ochando, C.; Onoprienko, D.; Oshima, N.; Osta, J.; Otec, R.

    2008-05-01

    We present the results of a search for the production of an excited state of the electron, e*, in proton-antiproton collisions at s=1.96TeV. The data were collected with the D0 experiment at the Fermilab Tevatron Collider and correspond to an integrated luminosity of approximately 1fb-1. We search for e* in the process p pmacr →e*e, with the e* subsequently decaying to an electron plus photon. No excess above the standard model background is observed. Interpreting our data in the context of a model that describes e* production by four-fermion contact interactions and e* decay via electroweak processes, we set 95% C.L. upper limits on the production cross section ranging from 8.9 to 27 fb, depending on the mass of the excited electron. Choosing the scale for contact interactions to be Λ=1TeV, excited electron masses below 756 GeV are excluded at the 95% C.L.

  4. Search For Electroweak Single Top Quark Production In 1.96 Tev Proton-antiproton Collisions

    CERN Document Server

    Stelzer, B

    2005-01-01

    This thesis describes the first search for electroweak single top quark production in proton-antiproton collisions at a center of mass energy of 1.96 TeV. The data sample used for this analysis corresponds to 162 pb -1 recorded by the upgraded Collider Detector at Fermilab. The search is performed by doing a classic maximum likelihood fit to the H T distribution in data. The kinematic variable H T is the scalar sum of transverse energies of all final state particles in the event. This variable has the advantage that its distribution looks very similar for both contributing (s- channel and t-channel) single top processes, but is different for background processes. The combination of both channels to one signal improves the sensitivity of the search. No significant evidence for electroweak single top quark production is found and we set an upper limit at the 95% confidence level on the combined single top quark production cross section of 17.8 pb.

  5. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma.

    Science.gov (United States)

    Lin, J D; Kao, P F; Weng, H F; Lu, W T; Huang, M J

    1998-07-01

    Radioactive iodine (131I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. 201Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative 131I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of 201Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of 131I and 201Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative 201Tl and 131I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. 201Tl imaging was performed before the 131I studies. Of the 62 patients who underwent 201Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the 201Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic 131I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by 201Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative 201Tl scans, 11 had positive findings on 131I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on 131I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative 201Tl and 131I scans, 15 had elevated serum Tg levels. Among these, local recurrence followed by lung metastases was manifested in

  6. MRI and thallium features of pigmented villonodular synovitis and giant cell tumours of tendon sheaths: a retrospective single centre study of imaging and literature review.

    Science.gov (United States)

    Lynskey, Samuel J; Pianta, Marcus J

    2015-01-01

    The purpose of this study was to characterize the MRI and thallium-201 ((201)TI) scintigraphy attributes of pigmented villonodular synovitis (PVNS) and giant cell tumours of tendon sheaths (GCTTS). The epidemiology of these uncommon lesions was also assessed and less commonly encountered pathology reported on including multifocality, necrosis and concurrent malignancy. A retrospective single centre review of MRI and (201)TI scintigraphy findings for 83 surgically proven or biopsy-proven consecutive cases of PVNS was undertaken. Radiological findings including lesion size, (201)TI uptake (as a marker of metabolic activity), location, extent and patient demographics were correlated with biopsy and surgical specimen histology. Typical appearances are described, as well as less common imaging manifestations. The study period encompassed all patients presenting or referred to a tertiary bone and soft-tissue tumour referral centre with PVNS or GCTTS between 1 January 2007 and the 1 December 2013. Lesions occur most commonly around the knee joint in the fourth decade of life, with younger patients showing a tendency to occur in the hip. Features of PVNS and GTTS include bone erosion, ligamentous and cartilage replacement, muscle infiltration and multifocality. MR signal characteristics were variable but post-contrast enhancement was near-universal. 14 of 83 cases showed no uptake of (201)TI and revealed a statistically significant smaller average axial dimension of 19.8 mm than lesions displaying active (201)TI uptake of 36.4 mm, p = 0.016. Four lesions demonstrated central necrosis on gross histology, two of each from both the (201)TI-avid and (201)TI-non-avid groups. MR is the imaging modality of choice when considering the diagnosis of these uncommon tumours. (201)TI scintigraphy as a marker of metabolic activity further adds minimal value although small lesions can appear to lack (201)TI avidity. This article depicts typical imaging findings of PVNS/GCTTS and

  7. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Lin Jen-Der; Weng Hsiao-Fen; Lu Wen-Tsoung [Division of Endocrinology and Metabolism, Chang Gung Memorial Hospital (Taiwan, Province of China); Kao Pan-Fu; Huang Miau-Ju [Department of Nuclear Medicine, Chang Gung Memorial Hospital, Taiwan (Taiwan, Province of China)

    1998-07-01

    Radioactive iodine ({sup 131}I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. {sup 201}Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative {sup 131}I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of {sup 201}Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of {sup 131}I and {sup 201}Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative {sup 201}Tl and {sup 131}I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. {sup 201}Tl imaging was performed before the {sup 131}I studies. Of the 62 patients who underwent {sup 201}Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the {sup 201}Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic {sup 131}I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by {sup 201}Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative {sup 201}Tl scans, 11 had positive findings on {sup 131}I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on {sup 131}I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative {sup 201}Tl and {sup 131}I

  8. Effects of adenosine and a selective A2A adenosine receptor agonist on hemodynamic and thallium-201 and technetium-99m-sestaMIBI biodistribution and kinetics.

    Science.gov (United States)

    Mekkaoui, Choukri; Jadbabaie, Farid; Dione, Donald P; Meoli, David F; Purushothaman, Kailasnath; Belardinelli, Luiz; Sinusas, Albert J

    2009-10-01

    The purpose of this study was to compare a selective A(2A) adenosine receptor agonist (regadenoson) with adenosine in clinically relevant canine models with regard to effects on hemodynamics and thallium-201 ((201)Tl) and technetium-99m ((99m)Tc)-sestaMIBI biodistribution and kinetics. The clinical application of vasodilator stress for perfusion imaging requires consideration of the effects of these vasodilating agents on systemic hemodynamics, coronary flow, and radiotracer uptake and clearance kinetics. Sequential imaging and arterial blood sampling was performed on control, anesthetized closed-chest canines (n = 7) to evaluate radiotracer biodistribution and kinetics after either a bolus administration of regadenoson (2.5 microg/kg) or 4.5-min infusion of adenosine (280 microg/kg). The effects of regadenoson on coronary flow and myocardial radiotracer uptake were then evaluated in an open-chest canine model of a critical stenosis (n = 7). Results from ex vivo single-photon emission computed tomography were compared with tissue well-counting. The use of regadenoson compared favorably with adenosine in regard to the duration and magnitude of the hemodynamic effects and the effect on (201)Tl and (99m)Tc-sestaMIBI biodistribution and kinetics. The arterial blood clearance half-time was significantly faster for (99m)Tc-sestaMIBI (regadenoson: 1.4 +/- 0.03 min; adenosine: 1.5 +/- 0.08 min) than for (201)Tl (regadenoson: 2.5 +/- 0.16 min, p adenosine: 2.7 +/- 0.04 min, p regadenoson stress was significantly greater than the relative perfusion defect with (99m)Tc-sestaMIBI (0.69 +/- 0.03%, p regadenoson produced a hyperemic response comparable to a standard infusion of adenosine. The biodistribution and clearance of both (201)Tl and (99m)Tc-sestaMIBI during regadenoson were similar to adenosine vasodilation. Ex vivo perfusion images under the most ideal conditions permitted detection of a critical stenosis, although (201)Tl offered significant advantages over (99m

  9. Comparison of 8-frame and 16-frame thallium-201 gated myocardial perfusion SPECT for determining left ventricular systolic and diastolic parameters.

    Science.gov (United States)

    Kurisu, Satoshi; Sumimoto, Yoji; Ikenaga, Hiroki; Watanabe, Noriaki; Ishibashi, Ken; Dohi, Yoshihiro; Fukuda, Yukihiro; Kihara, Yasuki

    2017-07-01

    The myocardial perfusion single photon emission computed tomography synchronized with the electrocardiogram (gated SPECT) has been widely used for the assessment of left ventricular (LV) systolic and diastolic functions using Quantitative gated SPECT. The aim of this study was to compare the effects of 8-frame and 16-frame thallium-201 (Tl-201) gated SPECT for determining LV systolic and diastolic parameters. The study population included 42 patients with suspected coronary artery disease who underwent gated SPECT by clinical indication. LV systolic and diastolic parameters were assessed on 8-frame and 16-frame gated SPECT. There were good correlations in end-diastolic volume (r = 0.99, p < 0.001), end-systolic volume (ESV) (r = 0.97, p < 0.001) and ejection fraction (EF) (r = 0.95, p < 0.001) between 8-frame and 16-frame gated SPECT. Bland-Altman plot showed a significant negative slope of -0.08 in EDV indicating a larger difference for larger EDV. Eight-frame gated SPECT overestimated ESV by 2.3 ml, and underestimated EF by -4.2% than 16-frame gated SPECT. There were good correlations in peak filling rate (PFR) (r = 0.87, p < 0.001), one third mean filling rate (r = 0.87, p < 0.001) and time to PFR (r = 0.61, p < 0.001) between 8-frame and 16-frame gated SPECT. Eight-frame gated SPECT underestimated PFR by -0.22 than 16-frame gated SPECT. Eight-frame gated SPECT estimated as much MFR/3 and TPFR as 16-frame gated SPECT. According to the data, the study suggested that 8-frame Tl-201 gated SPECT could underestimate systolic and/or diastolic parameter when compared with 16-frame gated SPECT.

  10. Low expression of miR-196b enhances the expression of BCR-ABL1 and HOXA9 oncogenes in chronic myeloid leukemogenesis.

    Directory of Open Access Journals (Sweden)

    Yue Liu

    Full Text Available MicroRNAs (miRNAs can function as tumor suppressors or oncogene promoters during tumor development. In this study, low levels of expression of miR-196b were detected in patients with chronic myeloid leukemia. Bisulfite genomic sequencing PCR and methylation-specific PCR were used to examine the methylation status of the CpG islands in the miR-196b promoter in K562 cells, patients with leukemia and healthy individuals. The CpG islands showed more methylation in patients with chronic myeloid leukemia compared with healthy individuals (P<0.05, which indicated that low expression of miR-196b may be associated with an increase in the methylation of CpG islands. The dual-luciferase reporter assay system demonstrated that BCR-ABL1 and HOXA9 are the target genes of miR-196b, which was consistent with predictions from bioinformatics software analyses. Further examination of cell function indicated that miR-196b acts to reduce BCR-ABL1 and HOXA9 protein levels, decrease cell proliferation rate and retard the cell cycle. A low level of expression of miR-196b can cause up-regulation of BCR-ABL1 and HOXA9 expression, which leads to the development of chronic myeloid leukemia. MiR-196b may represent an effective target for chronic myeloid leukemia therapy.

  11. MicroRNA Profiling Identifies miR-196a as Differentially Expressed in Childhood Adrenoleukodystrophy and Adult Adrenomyeloneuropathy.

    Science.gov (United States)

    Shah, Navjot; Singh, Inderjit

    2017-03-01

    X-linked adrenoleukodystrophy (X-ALD) is a peroxisomal disorder caused by mutations in the ABCD1 gene, leading to a defect in the peroxisomal adrenoleukodystrophy protein (ALDP), which inhibits the β-oxidation of very long chain fatty acids (VLCFAs). It is a complex disease where the same mutation in the peroxisomal ABCD1 can lead to clinically diverse phenotypes ranging from the fatal disorder of cerebral ALD (cALD) to mild adult disorder of adrenomyeloneuropathy (AMN). This suggests a role of epigenetic factors/modifier genes in disease progression of X-ALD which is not understood at present. To examine the possible role of microRNA (miRNA) in X-ALD disease mechanisms for differences in cALD and AMN phenotype, we profiled 1008 known miRNA in cALD, AMN, and normal human skin fibroblasts using miScript miRNA PCR array (Qiagen) and selected miRNAs which had differential expression in cALD and AMN fibroblasts. Eleven miRNA which were differentially regulated in cALD and AMN fibroblasts were identified. miR-196a showed a significant differential expression between cALD and AMN and is further characterized for target gene regulation. The predicted role of miR-196a in inhibition of inflammatory signaling factors (IKKα and IKKβ) and ELOVL1 expression suggests the pathological role of altered expression of miR-196a. This study indicates that miR-196a participated in differential regulation of ELOVL1 and inflammatory response between cALD as compared to AMN and may be a possible biomarker to differentiate between cALD and AMN.

  12. A Fully Reconfigurable Low-Noise Biopotential Sensing Amplifier With 1.96 Noise Efficiency Factor.

    Science.gov (United States)

    Tzu-Yun Wang; Min-Rui Lai; Twigg, Christopher M; Sheng-Yu Peng

    2014-06-01

    A fully reconfigurable biopotential sensing amplifier utilizing floating-gate transistors is presented in this paper. By using the complementary differential pairs along with the current reuse technique, the theoretical limit for the noise efficiency factor of the proposed amplifier is below 1.5. Without consuming any extra power, floating-gate transistors are employed to program the low-frequency cutoff corner of the amplifier and to implement the common-mode feedback. A concept proving prototype chip was designed and fabricated in a 0.35 μm CMOS process occupying 0.17 mm (2) silicon area. With a supply voltage of 2.5 V, the measured midband gain is 40.7 dB and the measured input-referred noise is 2.8 μVrms. The chip was tested under several configurations with the amplifier bandwidth being programmed to 100 Hz, 1 kHz , and 10 kHz. The measured noise efficiency factors in these bandwidth settings are 1.96, 2.01, and 2.25, respectively, which are among the best numbers reported to date. The measured common-mode rejection and the supply rejection are above 70 dB . When the bandwidth is configured to be 10 kHz, the dynamic range measured at 1 kHz is 60 dB with total harmonic distortion less than 0.1%. The proposed amplifier is also demonstrated by recording electromyography (EMG), electrocardiography (ECG), electrooculography (EOG), and electroencephalography (EEG) signals from human bodies.

  13. The role of substrate binding pocket residues phenylalanine 176 and phenylalanine 196 on Pseudomonas sp. OX1 toluene o-xylene monooxygenase activity and regiospecificity.

    Science.gov (United States)

    Sönmez, Burcu; Yanık-Yıldırım, K Cansu; Wood, Thomas K; Vardar-Schara, Gönül

    2014-08-01

    Saturation mutagenesis was used to generate eleven substitutions of toluene-o-xylene monooxygenase (ToMO) at alpha subunit (TouA) positions F176 and F196 among which nine were novel: F176H, F176N, F176S, F176T, F196A, F196L, F196T, F196Y, F196H, F196I, and F196V. By testing the substrates phenol, toluene, and naphthalene, these positions were found to influence ToMO oxidation activity and regiospecificity. Specifically, TouA variant F176H was identified that had 4.7-, 4.3-, and 1.8-fold faster hydroxylation activity towards phenol, toluene, and naphthalene, respectively, compared to native ToMO. The F176H variant also produced the novel product hydroquinone (61%) from phenol, made twofold more 2-naphthol from naphthalene (34% vs. 16% by the wild-type ToMO), and had the regiospecificity of toluene changed from 51% to 73% p-cresol. The TouA F176N variant had the most para-hydroxylation capability, forming p-cresol (92%) from toluene and hydroquinone (82%) from phenol as the major product, whereas native ToMO formed 30% o-cresol, 19% m-cresol, and 51% of p-cresol from toluene and 100% catechol from phenol. For naphthalene oxidation, TouA variant F176S exhibited the largest shift in the product distribution by producing threefold more 2-naphthol. Among the other F196 variants, F196L produced catechol from phenol two times faster than the wild-type enzyme. The TouA F196I variant produced twofold less o-cresol and 19% more p-cresol from toluene, and the TouA F196A variant produced 62% more 2-naphthol from naphthalene compared to wild-type ToMO. Both of these positions have never been studied through the saturation mutagenesis and some of the best substitutions uncovered here have never been predicted and characterized for aromatics hydroxylation. © 2014 Wiley Periodicals, Inc.

  14. MiR-196a exerts its oncogenic effect in glioblastoma multiforme by inhibition of IκBα both in vitro and in vivo

    KAUST Repository

    Yang, Guang

    2014-01-23

    BackgroundRecent studies have revealed that miR-196a is upregulated in glioblastoma multiforme (GBM) and that it correlates with the clinical outcome of patients with GBM. However, its potential regulatory mechanisms in GBM have never been reported.MethodsWe used quantitative real-time PCR to assess miR-196a expression levels in 132 GBM specimens in a single institution. Oncogenic capability of miR-196a was detected by apoptosis and proliferation assays in U87MG and T98G cells. Immunohistochemistry was used to determine the expression of IκBα in GBM tissues, and a luciferase reporter assay was carried out to confirm whether IκBα is a direct target of miR-196a. In vivo, xenograft tumors were examined for an antiglioma effect of miR-196a inhibitors.ResultsWe present for the first time evidence that miR-196a could directly interact with IκBα 3′-UTR to suppress IκBα expression and subsequently promote activation of NF-κB, consequently promoting proliferation of and suppressing apoptosis in GBM cells both in vitro and in vivo. Our study confirmed that miR-196a was upregulated in GBM specimens and that high levels of miR-196a were significantly correlated with poor outcome in a large cohort of GBM patients. Our data from human tumor xenografts in nude mice treated with miR-196 inhibitors demonstrated that inhibition of miR-196a could ameliorate tumor growth in vivo.ConclusionsMiR-196a exerts its oncogenic effect in GBM by inhibiting IκBα both in vitro and in vivo. Our findings provide new insights into the pathogenesis of GBM and indicate that miR-196a may predict clinical outcome of GBM patients and serve as a new therapeutic target for GBM. © 2014 © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Yield and excitation function measurements of some nuclear reactions on natural thallium induced by protons leading to the production of medical radioisotopes {sup 201}Tl and {sup 203}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Al-Saleh, F.S.; Al-Harbi, A.A. [Girls College of Education, Riyadh (Saudi Arabia). Physics Dept.; Azzam, A. [Nuclear Research Center, Cairo (Egypt). Nuclear Physics Dept.

    2007-07-01

    Excitation functions for {sup 201}Pb, {sup 202m}Pb, {sup 203}Pb and {sup 204m}Pb radionuclides which are formed via proton induced reactions with natural thallium target have been measured from their respective threshold (E{sub thr}) to 27.5 MeV using activation technique. Natural copper foils were used to monitor the cyclotron beam. The integral yields (MBq/{mu}A h) of the produced radionuclides were calculated from the measured excitation functions. The optimum proton energy range for the production of {sup 203}Pb with low amount of impurities is (16-10 MeV) after 5 h of EOB. The experimental cross-sections for {sup nat}Tl(p,xn) reactions were compared with the cross-sections recommended by the IAEA and with earlier published data when it was possible. (orig.)

  16. ["Running amok"--content analytic study of 196 news presentations from industrialized countries].

    Science.gov (United States)

    Adler, L; Lehmann, K; Räder, K; Schünemann, K F

    1993-12-01

    We performed a content analysis study based on 196 reports in the German press published during the last decade on acts of violence designated as "going berserk" or "running amok (amuck)" and meeting defined criteria. With less than one person per one million men per year running berserk or amok, this is a very rare act of violence, albeit a very dangerous one involving 1.3 deaths and 1.7 injuries per case. Offenders differ from the normal population in regards to the small percentage of women (5%) and high unemployment (40%), and from other violent offenders in that they are normally occupationally well-qualified. Severe psychiatric disorders are overrepresented. A total of 108 cases were classified according to specific syndromes either by specialists or experts on the spot, or on the basis of a description of the signs and symptoms. Of the syndrome-related acts, the most dangerous offences were committed by 10 delusionally ill and 2 psychopathic individuals. 30 less dangerous offenders suffered from paranoid-hallucinatory syndromes. 28 crimes committed in a state of intoxication and 11 "crimes of passion" were the least dangerous. Another 25 persons with an extensive incidence of suicide in the family, without any apparent pre-existing psychiatric disorder, may have gone berserk in the course of a depressive syndrome. Although psychotically ill individuals tend to overreact more often following a minimal slight, under delusions or with no apparent reason at all, on the whole the causes for both the psychotic and other offenders are of a serious nature. Object loss and private disputes on the one hand and social conflicts on the other were of approximately equal significance. The relationship between the offender and his victim is more essential for the course of the occurrence than motives or the type of the psychopathological syndrome. If only family members are attacked, the offenders have usually been inconspicuous, elderly individuals, two thirds of whom can

  17. miR-196b targets c-myc and Bcl-2 expression, inhibits proliferation and induces apoptosis in endometriotic stromal cells.

    Science.gov (United States)

    Abe, Wakana; Nasu, Kaei; Nakada, Chisato; Kawano, Yukie; Moriyama, Masatsugu; Narahara, Hisashi

    2013-03-01

    What is the global expression pattern of microRNAs (miRNAs) in endometriotic stromal cells and is miR-196b involved in the pathogenesis of endometriosis? Several miRNAs are aberrantly expressed in endometriotic cyst stromal cells (ECSCs), including miR-196b whose expression is repressed in endometriotic stromal cells. Although, histologically, endometriotic tissues and normal proliferative endometrium are similar, a number of distinct molecular differences have been reported to date. The anti-apoptotic and excessive proliferative properties of endometriotic cells are considered to be involved in the development and progression of endometriosis. ECSCs and normal endometrial stromal cells (NESCs) were isolated from ovarian endometriotic tissues and eutopic endometrial tissues, respectively and compared. Aberrantly expressed miRNAs in ECSCs were identified by a global miRNA microarray technique. The roles of miR-196b in ECSC proliferation, apoptosis, and c-myc and B-cell lymphoma/leukemia (Bcl)-2 mRNA expression were investigated with precursor hsa-miR-196b transfection. The methylation status of the miR-196b gene in ECSCs and the effect of a DNA demethylating agent on miR-196b expression were also examined. miRNA microarray analysis identified eight down-regulated miRNAs (including miR-196b) and four up-regulated miRNAs in ECSCs. Compulsory expression of miR-196b directed the inhibition of proliferation and the induction of apoptosis in ECSCs. miR-196b was found to suppress c-myc and Bcl-2 mRNA expression in ECSCs, and there was a significant correlation between miR-196b and HOXA10 expression in ECSCs and NESCs. The miR-196b gene was hypermethylated in ECSCs when compared with NESCs, and the treatment with a DNA demethylating agent restored the expression of miR-196b in ECSCs. miRNA expression profiles were investigated only in the stromal component of ectopic and eutopic endometrium samples. In addition to miR-196b, the roles of other miRNAs aberrantly expressed in

  18. Observation of Exclusive Gamma Gamma Production in p pbar Collisions at sqrt{s}=1.96 TeV

    CERN Document Server

    Aaltonen, T.; Alvarez Gonzalez, B.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calamba, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chung, W.H.; Chung, Y.S.; Ciocci, M.A.; Clark, A.; Clarke, C.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Dell'Orso, M.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, S.; Ershaidat, N.; Eusebi, R.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kim, Y.J.; Kimura, N.; Kirby, M.; Klimenko, S.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Mastrandrea, P.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagan Griso, S.; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Sorin, V.; Song, H.; Squillacioti, P.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2012-01-01

    We have observed exclusive \\gamma\\gamma production in proton-antiproton collisions at \\sqrt{s}=1.96 TeV, using data from 1.11 \\pm 0.07 fb^{-1} integrated luminosity taken by the Run II Collider Detector at Fermilab. We selected events with two electromagnetic showers, each with transverse energy E_T > 2.5 GeV and pseudorapidity |\\eta| 2.5$ GeV is 2.48^{+0.40}_{-0.35}(stat)^{+0.40}_{-0.51}(syst) pb.

  19. Search for third-generation scalar leptoquarks in pp at square root s=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguilo, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A-F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Boehnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M-C; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Davies, G; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lam, D; Lammers, S; Landsberg, G; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Otero Y Garzón, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safonov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schleiphake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smirnov, D; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; van Eijk, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, G; Weber, M; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-08-10

    We report on a search for charge-1/3 third-generation leptoquarks (LQ) produced in pp collisions at square root s =1.96 TeV using the D0 detector at Fermilab. Third-generation leptoquarks are assumed to be produced in pairs and to decay to a tau neutrino and a b quark with branching fraction B. We place upper limits on sigma(pp --> LQLQ)B2 as a function of the leptoquark mass M(LQ). Assuming B=1, we exclude at the 95% confidence level third-generation scalar leptoquarks with M(LQ)<229 GeV.

  20. Measurement of dijet azimuthal decorrelations at central rapidities in pp collisions at sqrt s =1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, D L; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahmed, S N; Ahn, S H; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Atramentov, O; Autermann, C; Avila, C; Babukhadia, L; Bacon, T C; Badaud, F; Baden, A; Baffioni, S; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Beaudette, F; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Besson, A; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Bhattacharjee, M; Binder, M; Bischoff, A; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Bonamy, P; Borcherding, F; Borissov, G; Bos, K; Bose, T; Boswell, C; Brandt, A; Briskin, G; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Canelli, F; Carvalho, W; Casey, B C K; Casey, D; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevalier, L; Cho, D K; Choi, S; Chopra, S; Christiansen, T; Christofek, L; Claes, D; Clark, A R; Clément, B; Clément, C; Coadou, Y; Colling, D J; Coney, L; Connolly, B; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Coss, J; Cothenet, A; Cousinou, M-C; Crépé-Renaudin, S; Cristetiu, M; Cummings, M A C; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; Martins, C De Oliveira; Dean, S; Del Signore, K; Déliot, F; Delsart, P A; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Eltzroth, J T; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Fein, D; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleuret, F; Fortner, M; Fox, H; Freeman, W; Fu, S; Fuess, S; Galea, C F; Gallas, E; Galyaev, E; Gao, M; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Geurkov, G; Ginther, G; Goldmann, K; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Graham, G; Grannis, P D; Greder, S; Green, J A; Greenlee, H; Greenwood, Z D; Gregores, E M; Grinstein, S; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gu, W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haggerty, H; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Hanlet, P; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, C; Hays, J; Hebbeker, T; Hebert, C; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Hou, S; Houben, P; Hu, Y; Huang, J; Huang, Y; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Jiang, Y; Johns, K; Johnson, M; Johnson, P; Jonckheere, A; Jonsson, P; Jöstlein, H; Juste, A; Kado, M M; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Ke, Z; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, K H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Kotwal, A V; Koubarovsky, A; Kouznetsov, O; Kozelov, A V; Kozminski, J; Krane, J; Krishnaswamy, M R; Krzywdzinski, S; Kubantsev, M; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kurca, T; Kuznetsov, V E; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, S W; Lee, W M; Leflat, A; Leggett, C; Lehner, F; Leonidopoulos, C; Lewis, P; Li, J; Li, Q Z; Li, X; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Lu, J; Lubatti, H J; Lucotte, A; Lueking, L; Luo, C; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magerkurth, A; Magnan, A-M; Maity, M; Makovec, N; Mal, P K; Malik, S; Malyshev, V L; Manankov, V; Mao, H S; Maravin, Y; Marshall, T; Martens, M; Martin, M I; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; McMahon, T; Meder, D; Melanson, H L; Melnitchouk, A; Meng, X; Merkin, M; Merritt, K W; Meyer, A; Miao, C; Miettinen, H; Mihalcea, D; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Montgomery, H E; Moore, R W; Mostafa, M; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Nang, F; Narain, M; Narasimham, V S; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Olivier, B; Oshima, N; Otero y Garzón, G J; Padley, P; Papageorgiou, K; Parashar, N; Park, J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Peters, O; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Popkov, E; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Przybycien, M B; Qian, J; Quadt, A; Quinn, B; Rani, K J; Rapidis, P A; Ratoff, P N; Reay, N W; Renardy, J-F; Reucroft, S; Rha, J; Ridel, M; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Royon, C; Rubinov, P; Ruchti, R; Sabirov, B M; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schukin, A A; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shary, V; Shephard, W D; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skow, D; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Song, Y; Sonnenschein, L; Sopczak, A; Sorín, V; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Steinbrück, G; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tentindo-Repond, S; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Trippe, T G; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wallace, N; Wang, Z-M; Warchol, J; Warsinsky, M; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Whiteson, D; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wlodek, T; Wobisch, M; Womersley, J; Wood, D R; Wu, Z; Wyatt, T R; Xu, Q; Xuan, N; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, B; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zheng, H; Zhou, B; Zhou, Z; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G; Zylberstejn, A

    2005-06-10

    Correlations in the azimuthal angle between the two largest transverse momentum jets have been measured using the D0 detector in p (-)p collisions at a center-of-mass energy sqrt[s]=1.96 TeV. The analysis is based on an inclusive dijet event sample in the central rapidity region corresponding to an integrated luminosity of 150 pb(-1). Azimuthal correlations are stronger at larger transverse momenta. These are well described in perturbative QCD at next-to-leading order in the strong coupling constant, except at large azimuthal differences where contributions with low transverse momentum are significant.

  1. New results on the superdeformed {sup 196}Pb nucleus: The decay of the excited bands to the yrast band

    Energy Technology Data Exchange (ETDEWEB)

    Bouneau, S.; Azaiez, F.; Duprat, J. [IPN, Orsay (France)] [and others

    1996-12-31

    The study of the superdeformed (SD) {sup 196}Pb nucleus has been revisited using the EUROGAM phase 2 spectrometer. In addition to the known yrast and two lowest excited SD bands, a third excited SD band has been seen. All of the three excited bands were found to decay to the yrast SD band through, presumably, E1 transitions, allowing relative spin and excitation energy assignments. Comparisons with calculations using the random-phase approximation suggest that all three excited bands can be interpreted as octupole vibrational structures.

  2. MicroRNA-196a & microRNA-101 expression in Barrett's oesophagus in patients with medically and surgically treated gastro-oesophageal reflux

    Directory of Open Access Journals (Sweden)

    Bright Tim

    2011-02-01

    Full Text Available Abstract Background Proton pump inhibitor (PPI medication and surgical fundoplication are used for the control of gastro-oesophageal reflux in patients with Barrett's oesophagus, but differ in their effectiveness for both acid and bile reflux. This might impact on the inflammatory processes that are associated with progression of Barrett's oesophagus to cancer, and this may be evident in the gene expression profile and microRNA expression pattern in Barrett's oesophagus mucosa. We hypothesised that two miRNAs with inflammatory and oncogenic roles, miR-101 and miR-196a, are differentially expressed in Barrett's oesophagus epithelium in patients with reflux treated medically vs. surgically. Findings Mucosal tissue was obtained at endoscopy from patients with Barrett's oesophagus whose reflux was controlled by proton pump inhibitor (PPI therapy (n = 20 or by fundoplication (n = 19. RNA was extracted and the expression of miR-101 and miR-196a was measured using real-time reverse transcription - polymerase chain reaction. There were no significant differences in miR-101 and miR-196a expression in Barrett's oesophagus epithelium in patients treated by PPI vs. fundoplication (p = 0.768 and 0.211 respectively. Secondary analysis showed a correlation between miR-196a expression and Barrett's oesophagus segment length (p = 0.014. Conclusion The method of reflux treatment did not influence the expression of miR-101 and miR-196a in Barrett's oesophagus. This data does not provide support to the hypothesis that surgical treatment of reflux better prevents cancer development in Barrett's oesophagus. The association between miR-196a expression and Barrett's oesophagus length is consistent with a tumour promoting role for miR-196a in Barrett's oesophagus.

  3. Cathepsin activities and membrane integrity of zebrafish (Danio rerio) oocytes after freezing to -196 degrees C using controlled slow cooling.

    Science.gov (United States)

    Zhang, T; Rawson, D M; Tosti, L; Carnevali, O

    2008-04-01

    This study investigated enzymatic activity of cathepsins and the membrane integrity of zebrafish (Danio rerio) oocytes after freezing to -196 degrees C using controlled slow cooling. Stage III oocytes (>0.5mm), obtained through dissection of anaesthetised female fish and desegregation of ovarian cumulus, were exposed to 2M methanol or 2M DMSO (both prepared in Hank's medium) for 30min at 22 degrees C before being loaded into 0.5ml plastic straws and placed into a programmable cooler. After controlled slow freezing, samples were plunged into liquid nitrogen (LN) and held for at least 10min, and thawed by immersing straws into a 27 degrees C water bath for 10s. Thawed oocytes were washed twice in Hank's medium. Cathepsin activity and membrane integrity of oocytes were assessed both after cryoprotectant treatment at 22 degrees C and after freezing in LN. Cathepsin B and L colorimetric analyses were performed using substrates Z-Arg-ArgNNap and Z-Phe-Arg-4MbetaNA-HCl, respectively, and 2-naphthylamine and 4-methoxy-2-naphthylamine were used as standards. Cathepsin D activity was performed by analysing the level of hydrolytic action on haemoglobin. Oocytes membrane integrity was assessed using 0.2% Trypan blue staining for 5min. Analysis of cathepsin activities showed that whilst the activity of cathepsin B and D was not affected by 2M DMSO treatment, their activity was lowered when treated with 2M methanol. Following freezing to -196 degrees C, the activity of all cathepsins (B, D and L) was significantly decreased in both 2M DMSO and 2M methanol. Trypan blue staining showed that 63.0+/-11.3% and 72.7+/-5.2% oocytes membrane stayed intact after DMSO and methanol treatment for 30min at 22 degrees C, respectively, whilst 14.9+/-2.6% and 1.4+/-0.8% stayed intact after freezing in DMSO and methanol to -196 degrees C. The results indicate that cryoprotectant treatment and freezing modified the activities of lysosomal enzymes involved in oocyte maturation and yolk

  4. Measurement of the t{bar t} cross section at {radical}s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Victor Abazov et al.

    2003-07-29

    A measurement of the t{bar t} cross section at {radical}s = 1.96 TeV is carried out on data samples of {approx}40 pb{sup -1} in dilepton channels (e{mu}, ee and {mu}{mu}) and lepton+jets channels using two complementary approaches: a fully topological analysis and a soft-muon-tag. Overall, 17 events are observed with an expected background of 6.5 {+-} 0.6. This excess corresponds to an observation probability of three standard deviations and the measured t{bar t} cross section is: {sigma}{sub p}{bar p}{yields} t{bar t} = 8.5{sub -3.6}{sup +4.5} (stat) {sub -3.5}{sup +6.3} (sys) {+-} 0.8 (lumi) pb.

  5. Production of psi(2S) Mesons in p anti-p Collisions at 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-05-01

    The authors have measured the differential cross section for the inclusive production of {psi}(2S) mesons decaying to {mu}{sup +}{mu}{sup -} that were produced in prompt or B-decay processes from p{bar p} collisions at 1.96 TeV. These measurements have been made using a data set from an integrated luminosity of 1.1 fb{sup -1} collected by the CDF II detector at Fermilab. For events with transverse momentum p{sub T}({psi}(2S)) > 2 GeV/c and rapidity |y({psi}(2S))| < 0.6 we measure the integrated inclusive cross section {sigma}(p{bar p} {yields} {psi}(2S)X) {center_dot} Br({psi}(2S) {yields} {mu}{sup +}{mu}{sup -}) to be 3.29 {+-} 0.04(stat.) {+-} 0.32(syst.) nb.

  6. Search for chargino-neutralino production in ppbar collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Aaltonen, T; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Cilijak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Da Ronco, S; Datta, M; D'Auria, S; Davies, T; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Dorr, C; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; García, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraan, A C; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shalhout, S Z; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakian, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuno, S; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Vallecorsa, S; Van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veramendi, G; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Vollrath, I; Volobuev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

    2007-01-01

    We present the results of a search for associated production of the chargino and neutralino supersymmetric particles using up to 1.1 fb-1 of integrated luminosity collected by the CDF II experiment at the Tevatron ppbar collider at a center-of-mass energy of 1.96 TeV. The search is conducted by analyzing events with a large transverse momentum imbalance and either three charged leptons or two charged leptons of the same electric charge. The numbers of observed events are found to be consistent with standard model expectations. Upper limits on the production cross section are derived in different theoretical models. In one of these models a lower limit on the mass of the chargino is set at 129 GeV/c^2 at the 95% confidence level.

  7. Double parton interactions in photon+3 jet events in ppbar collisions sqrt{s}=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Simon Fraser U. /York U., Canada; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan State U.; Alverson, G.; /Northeastern U. /Rio de Janeiro, CBPF

    2009-12-01

    We have used a sample of photon+3 jets events collected by the D0 experiment with an integrated luminosity of about 1 fb{sup -1} to determine the fraction of events with double parton scattering (f{sub DP}) in a single ppbar collision at {radical}s = 1.96 TeV. The DP fraction and effective cross section (sigma{sub eff}), a process-independent scale parameter related to the parton density inside the nucleon, are measured in three intervals of the second (ordered in p{sub T}) jet transverse momentum pT{sub jet2} within the range 15 < pT{sub jet2} < 30 GeV. In this range, f{sub DP} varies between 0.23 < f{sub DP} < 0.47, while sigma{sub eff} has the average value sigma{sub effave} = 16.4 {+-} 0.3(stat) {+-} 2.3(syst) mb.

  8. Auger electron spectroscopy study of initial stages of oxidation in a copper - 19.6-atomic-percent-aluminum alloy

    Science.gov (United States)

    Ferrante, J.

    1973-01-01

    Auger electron spectroscopy was used to examine the initial stages of oxidation of a polycrystalline copper - 19.6 a/o-aluminum alloy. The growth of the 55-eV aluminum oxide peak and the decay of the 59-, 62-, and 937-eV copper peaks were examined as functions of temperature, exposure, and pressure. Pressures ranged from 1x10 to the minus 7th power to 0.0005 torr of O2. Temperatures ranged from room temperature to 700 C. A completely aluminum oxide surface layer was obtained in all cases. Complete disappearance of the underlying 937-eV copper peak was obtained by heating at 700 C in O2 at 0.0005 torr for 1 hr. Temperature studies indicated that thermally activated diffusion was important to the oxidation studies. The initial stages of oxidation followed a logarithmic growth curve.

  9. Search for Wbb and WH production in pp collisions at square root [s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevalier, L; Cho, D K; Choi, S; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Coss, J; Cothenet, A; Cousinou, M-C; Crépé-Renaudin, S; Cristetiu, M; Cummings, M A C; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Déliot, F; Delsart, P A; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Eltzroth, J T; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Freeman, W; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Jöstlein, H; Juste, A; Kado, M M; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, K H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kurca, T; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, S W; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Merkin, M; Merritt, K W; Meyer, A; Miettinen, H; Mihalcea, D; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Montgomery, H E; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'dell, V; O'neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero Y Garzón, G J; Padley, P; Parashar, N; Park, J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Peters, O; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Przybycien, M B; Qian, J; Quadt, A; Quinn, B; Rani, K J; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schukin, A A; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shephard, W D; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Song, Y; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Steinbrück, G; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tentindo-Repond, S; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Warsinsky, M; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Whiteson, D; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G; Zylberstejn, A

    2005-03-11

    We present a search for Wbb production in pp collisions at sqrt[s]=1.96 TeV in events containing one electron, an imbalance in transverse momentum, and two b-tagged jets. Using 174 pb(-1) of integrated luminosity accumulated by the D0 experiment at the Fermilab Tevatron collider, and the standard-model description of such events, we set a 95% C.L. upper limit on Wbb production of 6.6 pb for b quarks with transverse momenta p(b)(T)>20 GeV and bb separation in pseudorapidity-azimuth space DeltaR(bb)>0.75. Restricting the search to optimized bb mass intervals provides upper limits on WH production of 9.0-12.2 pb for Higgs-boson masses of 105-135 GeV.

  10. Measurement of inclusive differential cross sections for pp collisions at (square root)s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Cho, D K; Choi, S; Choudhary, B; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cothenet, A; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cristetiu, M; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Mendes, A; Merkin, M; Merritt, K W; Meyer, A; Michaut, M; Miettinen, H; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero y Garzón, G J; Padley, P; Parashar, N; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Silva, W L Prado da; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu, Anh T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G

    2005-06-17

    We present measurements of the inclusive production cross sections of the Gamma(1S) bottomonium state in pp collisions at (square root)s = 1.96 TeV. Using the Gamma(1S) --> mu(+)mu(-) decay mode for a data sample of 159 +/- 10 pb(-1) collected by the D0 detector at the Fermilab Tevatron collider, we determine the differential cross sections as a function of the Gamma(1S) transverse momentum for three ranges of the Gamma(1S) rapidity: 0 < y(Gamma) < or = 0.6, 0.6 < y(Gamma) < or = 1.2, and 1.2 < y(Gamma) < or = 1.8.

  11. PHENIX results on anisotropic flow in d+Au collisions from 19.6 to 200 GeV

    Science.gov (United States)

    Morrow, Sylvia; Phenix Collaboration

    2017-09-01

    Results on elliptic flow in p+p and p/d/3He+A have raised the question of how small a system can be while still exhibiting collective behavior. In 2016, RHIC operations included d+Au collisions at 200, 62.4, 39, and 19.6 GeV. In this talk we present results on elliptic and triangular flow at midrapidity as a function of transverse momentum and event multiplicity in d+Au collisions at various energies. We compare these results with several theoretical predictions in scenarios including pre-equilibrium flow, hydrodynamic flow, partonic scattering, and purely hadronic scattering in order to assess the role of each stage in the system evolution for producing collective effects in small systems.

  12. Comparing effects of freezing at -196 °C and -20 °C on the viability of mastitis pathogens

    Directory of Open Access Journals (Sweden)

    Inge-Marie Petzer

    2012-02-01

    Full Text Available The aim of this study was to compare the effects of cryopreservation at approximately -196 °C in liquid nitrogen (N and freezing at approximately -20 °C in a freezer, on the viability and survival of eight different mastitogenic bacteria inoculated in milk. Bacteria were frozen at approximately -20 °C in a freezer and cryopreserved at approximately -196 °C in liquid nitrogen. An effective preservation method was needed for follow-up samples from cows identified in the South African National Milk Recording Scheme (NMRS with somatic cell counts above 250 000 cells/mL milk. The organisation responsible for sample collection of the NMRS milk samples also provides producers with liquid nitrogen for their semen flasks at the collection sites. This existing mode of storage and transport could therefore be utilised.Ten samples of each organism were thawed and cultured bi-weekly until week 18 for both temperature treatments. An additional sampling was performed at week 30 for samples frozen at approximately -20 °C. Freezing and cryopreservation did not impair subsequent isolation of Streptococcus dysgalactiae, Streptococcus uberis, Enterococcus faecalis, Staphylococcus aureus (STH (phage type lytic group III or Sta. aureus (STA (phage typed, other than lytic group III. Survival was indicated by the isolation of bacteria from samples, and viability by the strength of growth of the bacteria isolated. The survival of Streptococcus agalactiae decreased after week 12 and Escherichia coli after week 16 of freezing, but both organisms survived under cryogenic preservation until week 18. Coagulase-negative staphylococci survived until week 18 for both freezing and cryogenic preservation.Both storage methods could thus contribute to the improvement of a pro-active approach towards udder health management in South African dairy herds.

  13. Clinical experience with Liraglutide in 196 patients with type 2 diabetes from a tertiary care center in India

    Directory of Open Access Journals (Sweden)

    Parjeet Kaur

    2014-01-01

    Full Text Available Context: GLP-1 receptor agonists (GLP-1 RA are unique antidiabetic agents that have the ability to lower blood glucose without causing hypoglycemia, while at the same time promoting weight loss. Information on the efficacy and safety of GLP-1 RA in the Indian diabetic population is limited. Aims: (1 To evaluate the effect of GLP-1 RA, Liraglutide on glycemic control, and weight in obese Indian patients with type 2 diabetes. (2 To study the adverse event profile of Liraglutide in these patients in real-world clinical setting. Settings and Design: Observational study conducted in a tertiary care hospital. Materials and Methods: Liraglutide was prescribed to 196 obese patients with type 2 diabetes who had poor glycemic control on oral medications ± insulin. The initial dose of Liraglutide was 0.6 mg, which was up-titrated to 1.2 mg after 1 week; further up-titration to 1.8 mg was done based on tolerance. Dipeptidyl peptidase-IV (DPP-IV inhibitors were discontinued and dose of other medications adjusted according to clinical judgment during the study period. Results: Mean age of patients was 49.9 ± 9.6 years. Three month data were available for 175 patients out of a total of 196. At 3 months, glycosylated hemoglobin (HbA1c was 7.6 ± 0.9% vs. 9.2 ± 1.9% at baseline (P = 0.007 and mean body weight was 96.0 ± 16.5 kg vs. 100.1 ± 17.5 kg at baseline (P < 0.001. Most common adverse events were nausea, burping, and eructation (10%. Conclusion: Liraglutide significantly improves glycemic control with low risk of hypoglycemia and is associated with significant weight loss in obese Indian patients with type 2 diabetes mellitus.

  14. Significance of exercise-induced ST segment depression in patients with myocardial infarction involving the left circumflex artery. Evaluation by exercise thallium-201 myocardial single photon emission computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Koitabashi, Norimichi; Toyama, Takuji; Hoshizaki, Hiroshi [Gunma Prefectural Cardiovascular Center, Maebashi (Japan)] [and others

    2000-04-01

    The significance of exercise-induced ST segment depression in patients with left circumflex artery involvement was investigated by comparing exercise electrocardiography with exercise thallium-201 single photon emission computed tomography (Tl-SPECT) and the wall motion estimated by left ventriculography. Tl-SPECT and exercise electrocardiography were simultaneously performed in 51 patients with left circumflex artery involvement (angina pectoris 30, myocardial infarction 21). In patients with myocardial infarction, exercise-induced ST depression was frequently found in the V{sub 2}, V{sub 3} and V{sub 4} leads. In patients with angina pectoris, ST depression was frequently found in the II, III, aV{sub F}, V{sub 5} and V{sub 6} leads. There was no obvious difference in the leads of ST depression in patients with myocardial infarction with ischemia and without ischemia on Tl-SPECT images. In patients with myocardial infarction, the lateral wall motion of the infarcted area evaluated by left ventriculography was more significantly impaired in the patients with ST depression than without ST depression (p<0.01). Exercise-induced ST depression in the precordial leads possibly reflects wall motion abnormality rather than ischemia in the lateral infarcted myocardium. (author)

  15. Hiljutine maksulahend Euroopa Kohtus - ettevõtja kasuks! : Cadbury Schweppes vs. Ühendkuningriigi maksuhaldur, C-196/04 / Hiie Marrandi

    Index Scriptorium Estoniae

    Marrandi, Hiie

    2006-01-01

    Euroopa Kohtu eelotsusetaotluse alusel tehtud lahendist (12. 09. 2006 C-196/04) Cadbury Schweppes´i ja Suurbritannia maksuhalduri vaidluse kohta, mis puudutas madala maksumääraga territooriumil asuva tütarühingu tulu omistamist Suurbritannia emaühingule

  16. Search for the lightest scalar top quark in events with two leptons in p$\\overline{\\p}$ collisions at $\\sqrt{s}$= 1.96 TeV

    CERN Document Server

    Abazov, V; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clement, B; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; de Jong, P; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kozelov, A V; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G L; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pompo, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simák, V; Sirotenko, V I; Skubic, P; Slattery, P; Smirnov, D; Snow, J; Snow, G R; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Strauss, E; Ströhmer, R; Strom, D; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, S; Uvarov, L; Uzunyan, S; Vachon, B; vanden Berg, P J; van Eijk, B; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vokac, P; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; SWang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weber, G; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, J; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2008-01-01

    Data collected by the D0 detector at a p-pbar center-of-mass energy of 1.96 TeV at the Fermilab Tevatron Collider have been used to search for pair production of the lightest supersymmetric partner of the top quark decaying into $b \\ell \\tilde{\

  17. Search for Wh Production Using High-PT Isolated Like-Sign Dilepton Events in 1.96-TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Wakisaka, Takayuki [Osaka City Univ. (Japan)

    2009-04-01

    The thesis describes search for the neutral Higgs production associated with the W boson using high-PT isolated like-sign (LS) dilepton events in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV.

  18. miR-196 is an essential early-stage regulator of tail regeneration, upstream of key spinal cord patterning events.

    Science.gov (United States)

    Sehm, Tina; Sachse, Christoph; Frenzel, Corina; Echeverri, Karen

    2009-10-15

    Salamanders have the remarkable ability to regenerate many body parts following catastrophic injuries, including a fully functional spinal cord following a tail amputation. The molecular basis for how this process is so exquisitely well-regulated, assuring a faithful replication of missing structures every time, remains poorly understood. Therefore a study of microRNA expression and function during regeneration in the axolotl, Ambystoma mexicanum, was undertaken. Using microarray-based profiling, it was found that 78 highly conserved microRNAs display significant changes in expression levels during the early stages of tail regeneration, as compared to mature tissue. The role of miR-196, which was highly upregulated in the early tail blastema and spinal cord, was then further analyzed. Inhibition of miR-196 expression in this context resulted in a defect in regeneration, yielding abnormally shortened tails with spinal cord defects in formation of the terminal vesicle. A more detailed characterization of this phenotype revealed downstream components of the miR-196 pathway to include key effectors/regulators of tissue patterning within the spinal cord, including BMP4 and Pax7. As such, our dataset establishes miR-196 as an essential regulator of tail regeneration, acting upstream of key BMP4 and Pax7-based patterning events within the spinal cord.

  19. miR-196a-2 rs11614913 polymorphism is associated with vitiligo by affecting heterodimeric molecular complexes of Tyr and Tyrp1.

    Science.gov (United States)

    Cui, T-T; Yi, X-L; Zhang, W-G; Wei, C; Zhou, F-B; Jian, Z; Wang, G; Gao, T-W; Li, C-Y; Li, K

    2015-10-01

    Tyrosinase and tyrosinase-related protein 1 (Tyr-Tyrp1) complex plays a critical role in the synthesis of melanin intermediates, which involves the production of reactive oxygen species (ROS) and contributes to the development of vitiligo. Based on our previous observation that rs11614913 single nucleotide polymorphism (SNP) in miR-196a-2 could affect the risk of vitiligo by influencing Tyrp1, we hypothesized that the same SNP could also regulate the level of Tyr in vitiligo. The aim of this study was to evaluate the potential association between rs11614913 SNP in miR-196a-2 and serum Tyr level in vitiligo and the regulatory role of miR-196a-2 in the expression of Tyr in melanocytes. The serum Tyr level was detected in 116 patients with vitiligo and 116 controls by ELISA plate assay. The expression level of Tyrp1 and Tyr in PIG1(normal melanocyte cell lines) cells was analyzed by western blotting. The ROS level and apoptosis rate in PIG1 cells transfected with si-Tyr or control siRNA were tested by flow cytometry. The results show that the individuals with TT+TC genotypes in miR-196a-2 and higher Tyr level in serum had an increased risk of vitiligo compared with those who had the CC genotype and lower Tyr level (P vitiligo.

  20. Discovery of porcine miRNA-196a/b may influence porcine adipogenesis in longissimus dorsi muscle by miRNA sequencing.

    Science.gov (United States)

    Liu, Linqing; Qian, Kun; Wang, Chonglong

    2017-04-01

    Intramuscular fat (IMF) is one of the fat traits that has economic importance in the pork industry. Longissimus dorsi muscle contains IMF and is suitable for studying adipogenesis. To discover further potential regulatory miRNAs that may influence adipogenesis, we analyzed miRNA in the longissimus dorsi muscle of Yorkshire (YY, lean-type) and Chinese Wannanhua (WH, fatty) pigs using miRNA sequencing (miRNA-seq). From this dataset, we identified 598 unique miRNAs comprising 325 pre-miRNAs and 273 novel pre-miRNAs through comparison with known miRNAs in miRBase version 21. We found 42 miRNAs including nine up- and 33 down-regulated between the YY and WH pigs. Moreover, we found two miRNAs, miR-196a/b (miR-196a, miR-196b-5p), that had the highest level of expression in WH pigs, and miR-196a/b may influence porcine adipogenesis in longissimus dorsi muscle through an adipocytokine signaling pathway. © 2016 Stichting International Foundation for Animal Genetics.

  1. Erratum to “Neutron–19C scattering: Emergence of universal properties in a finite range potential” [Phys. Lett. B 764 (2017 196

    Directory of Open Access Journals (Sweden)

    M.A. Shalchi

    2017-08-01

    Full Text Available Numerical results for the function (1−EK/E0kcot⁡δ0R, as given in Phys. Lett. B 764 (2017 196, are revised. Fig. 2 and Tables 2 and 3 should be replaced by the following corresponding figure and tables. The conclusions of the original paper remain unchanged.

  2. Biosafety Recommendations for Work with Influenza Viruses Containing a Hemagglutinin from the A/goose/Guangdong/1/96 Lineage.

    Science.gov (United States)

    Gangadharan, Denise; Smith, Jacinta; Weyant, Robbin

    2013-06-28

    The CDC and National Institutes of Health (NIH) Biosafety in Microbiological and Biomedical Laboratories (BMBL) manual describes biosafety recommendations for work involving highly pathogenic avian influenza (HPAI) (US Department of Health and Human Services [HHS], CDC. Biosafety in microbiological and biomedical laboratories, 5th ed. Atlanta, GA: CDC; 2009. HHS publication no. [CDC] 21-1112. Available at http://www.cdc.gov/biosafety/publications/bmbl5). The U.S. Department of Agriculture Guidelines for Avian Influenza Viruses builds on the BMBL manual and provides additional biosafety and biocontainment guidelines for laboratories working with HPAI (US Department of Agriculture, Animal and Plant Health Inspection Service, Agricultural Select Agent Program. Guidelines for avian influenza viruses. Washington, DC: US Department of Agriculture; 2011. Available at http://www.selectagents.gov/Guidelines_for_Avian_Influenza_Viruses.html). The recommendations in this report, which are intended for laboratories in the United States, outline the essential baseline biosafety measures for working with the subset of influenza viruses that contain a hemagglutinin (HA) from the HPAI influenza A/goose/Guangdong/1/96 lineage, including reassortant influenza viruses created in a laboratory setting. All H5N1 influenza virus clades known to infect humans to date have been derived from this lineage (WHO/OIE/FAO H5N1 Evolution Working Group. Continued evolution of highly pathogenic avian influenza A [H5N1]: updated nomenclature. Influenza Other Respir Viruses 2012;6:1-5). In 2009, the NIH Guidelines for Research Involving Recombinant or Synthetic Nucleic Acid Molecules were amended to include specific biosafety and biocontainment recommendations for laboratories working with Recombinant Risk Group 3 influenza viruses, including HPAI H5N1 influenza viruses within the Goose/Guangdong/1/96-like H5 lineage. In February 2013, the NIH guidelines were further revised to provide additional

  3. A combined search for the standard model Higgs boson at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.

    2008-05-01

    We present new results of the search for WH→ℓνbb¯ production in pp¯ collisions at a center-of-mass energy of s=1.96 TeV, based on a dataset with integrated luminosity of 0.44 fb. We combine these new results with previously published searches by the D0 collaboration, for WH and ZH production analyzed in the E̸bb¯ final state, for ZH (→ℓℓbb¯) production, for WH (→WWW) production, and for H (→WW) direct production. No signal-like excess is observed either in the WH analysis or in the combination of all D0 Higgs boson analyses. We set 95% C.L. (expected) upper limits on σ(pp¯→WH)×B(H→bb¯) ranging from 1.6 (2.2) pb to 1.9 (3.3) pb for Higgs boson masses between 105 and 145 GeV, to be compared to the theoretical prediction of 0.13 pb for a Standard Model (SM) Higgs boson with mass m=115 GeV. After combination with the other D0 Higgs boson searches, we obtain for m=115 GeV an observed (expected) limit 8.5 (12.1) times higher than the SM predicted Higgs boson production cross section. For m=160 GeV, the corresponding observed (expected) ratio is 10.2 (9.0).

  4. A combined search for the standard model Higgs boson at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.; Obrant, G.

    2008-05-01

    We present new results of the search for WH → ℓνbbbar production in ppbar collisions at a center-of-mass energy of √{ s} = 1.96 TeV, based on a dataset with integrated luminosity of 0.44 fb-1. We combine these new results with previously published searches by the D0 collaboration, for WH and ZH production analyzed in the E̸T bbbar final state, for ZH (→ℓ+ℓ- bbbar) production, for WH (→ WWW) production, and for H (→ WW) direct production. No signal-like excess is observed either in the WH analysis or in the combination of all D0 Higgs boson analyses. We set 95% C.L. (expected) upper limits on σ (ppbar → WH) × B (H → bbbar) ranging from 1.6 (2.2) pb to 1.9 (3.3) pb for Higgs boson masses between 105 and 145 GeV, to be compared to the theoretical prediction of 0.13 pb for a Standard Model (SM) Higgs boson with mass mH = 115 GeV. After combination with the other D0 Higgs boson searches, we obtain for mH = 115 GeV an observed (expected) limit 8.5 (12.1) times higher than the SM predicted Higgs boson production cross section. For mH = 160 GeV, the corresponding observed (expected) ratio is 10.2 (9.0).

  5. Identification and decay of /sup 190/W, /sup 196/Os, /sup 230/Ra, and /sup 230/Ac. [Half-life

    Energy Technology Data Exchange (ETDEWEB)

    Katcoff, S.; Gilat, J.; Haustein, P.E.; Franz, E.M.; Morcos, N.A.; Ward, T.E.; Smith, H.A. Jr.; Hill, J.C.; Petry, R.F.

    1976-05-19

    Several new or poorly characterized neutron-rich nuclides were produced and studied at the Brookhaven Medium Energy Intense Neutron facility, MEIN. /sup 190/W decays with T/sub 1/2/ = 30.0 +- 1.5 min, E/sub beta/ = 0.93 +- 0.07 MeV, and ..gamma..'s of 157.6 and 162.1 keV. /sup 196/Os decays with T/sub 1/2/ = 35.0 +- 0.4 min and ..gamma..'s at 126.1, 200.7, 207.0, 257.0, 315.3, 407.6, 522.2, and 628.9 keV. /sup 230/Ra decays with T/sub 1/2/ = 93 +- 2 min to 122 +- 3 sec /sup 230/Ac; ..gamma..-ray energies and intensities are tabulated. A decay scheme is proposed for /sup 190/W, and many of the transitions following the decay of /sup 230/Ac are between known levels in /sup 230/Th.

  6. Frequency of and risk factors associated with lingual lesions in dogs: 1,196 cases (1995-2004).

    Science.gov (United States)

    Dennis, Michelle M; Ehrhart, Nicole; Duncan, Colleen G; Barnes, Ashley B; Ehrhart, E J

    2006-05-15

    To categorize histologic lesions affecting the tongue, determine the frequency with which they develop, and identify risk factors associated with their development in dogs. Retrospective case series. 1,196 dogs. Diagnostic reports of lingual biopsy specimens from dogs evaluated from January 1995 to October 2004 were reviewed. Neoplasia comprised 54% of lingual lesions. Malignant tumors accounted for 64% of lingual neoplasms and included melanoma, squamous cell carcinoma, hemangiosarcoma, and fibrosarcoma. Large-breed dogs, especially Chow Chows and Chinese Shar-Peis, were at increased risk for melanoma. Females of all breeds and Poodles, Labrador Retrievers, and Samoyeds were more likely to have squamous cell carcinomas. Hemangiosarcomas and fibrosarcomas were commonly diagnosed in Border Collies and Golden Retrievers, respectively. Benign neoplasms included squamous papilloma, plasma cell tumor, and granular cell tumor. Small-breed dogs, especially Cocker Spaniels, were at increased risk for plasma cell tumors. Glossitis accounted for 33% of diagnoses; in most cases, the inciting cause was not apparent. Whereas large-breed dogs were more likely to have lingual neoplasia, small-breed dogs were more likely to have glossitis. Calcinosis circumscripta accounted for 4% of lingual lesions and predominately affected young large-breed dogs. The remaining submissions consisted mostly of various degenerative or wound-associated lesions. The frequency of lingual lesions was not evenly distributed across breeds, sexes, or size classes of dogs. Veterinarians should be aware of the commonly reported lingual lesions in dogs so that prompt diagnosis and appropriate management can be initiated.

  7. Search for New Physics in Dielectron Events in 1.96-TeV Proton - Anti-proton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Ikado, Koji [Waseda Univ., Shinjuku (Japan)

    2004-03-01

    The authors have searched for new physics beyond the Standard Model of elementary particle physics in dielectron decay mode at the CDF (Collider Detector at Fermilab) experiment in {bar p}p collisions at √s = 1.96 TeV. The data were collected during the 2002-2003 runs corresponding to an integrated luminosity of 200 pb-1. Many extensions of the Standard Model have been proposed. Grand Unified Theories (GUT) assumes a larger gauge symmetry group and predict new gauge bosons. GUT has hierarchy problem in it and there have been many attempts to solve the hierarchy problem. Solutions for the hierarchy problem are supersymmetry, technicolor, large extra dimensions, warped extra dimensions and little Higgs models. The authors analyze the differential distribution of dielectron events in terms of their invariant mass and no significant excess is found in very high mass region. They present a 95% confidence level limit on the production cross section times branching ratio for new resonant particles decaying into an electron pair as a function of invariant mass. New resonant particles include new neutral gauge boson Z', Randall-Sundrum graviton, R-parity violating sneutrino, and technicolor particles. They also present limits on the effective Planck scale of large extra dimensions.

  8. Event Shapes in $p\\bar p$ Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Atkins, Scott [Louisiana Tech Univ., Ruston, LA (United States)

    2012-08-01

    This dissertation presents the analysis of nine different event shapes measured in high energy p$\\bar{p}$ collisions. An event shape can be defined as an event-based quantity that measures how the final energies are distributed in the final event. This analysis will test strong interactions as described by Quantum Chromodynamics (QCD), through their implementation in different Monte Carlo-based models. Each of the event shapes provides information about the flow of energy in QCD events and about the hadronic final states that occur in p$\\bar{p}$ particle collisions, thus allowing the study of the dynamics of QCD multijet events. Any deviation of an event shape from zero will be indicative of higher-order effects, meaning that more than the two jets were produced in the event. For each of the event shapes, both normalized differential distributions ( 1/σ dσ/dX) and average event shapes ($\\bar{X}$σ) were measured, where X is the event shape and σ is the cross section. This analysis uses 0.7 fb-1 of data taken between 2004 and 2006 by the DØ detector located at the Fermi National Accelerator Lab (Fermilab) in Batavia, IL, using p$\\bar{p}$ collisions at a center-of-mass energy of √s = 1.96 TeV.

  9. Search for stopped gluinos from pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguilo, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A-F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Boehnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M-C; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Davies, G; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lam, D; Lammers, S; Landsberg, G; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'dell, V; O'neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Y Garzón, G J Otero; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; da Silva, W L Prado; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smirnov, D; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; van Eijk, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, G; Weber, M; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-09-28

    Long-lived, heavy particles are predicted in a number of models beyond the standard model of particle physics. We present the first direct search for such particles' decays, occurring up to 100 h after their production and not synchronized with an accelerator bunch crossing. We apply the analysis to the gluino (g), predicted in split supersymmetry, which after hadronization can become charged and lose enough momentum through ionization to come to rest in dense particle detectors. Approximately 410 pb(-1) of pp collisions at square root(s) = 1.96 TeV collected with the D0 detector during Run II of the Fermilab Tevatron collider are analyzed in search of such "stopped gluinos" decaying into a gluon and a neutralino (chi(1)(0)). Limits are placed on the (gluino cross section) x (probability to stop) x [BR(g --> g chi(1)(0))] as a function of the gluino and chi(1)(0) masses, for gluino lifetimes from 30 micros-100 h.

  10. Measurement of trilinear gauge boson couplings from at {\\boldmath$\\sqrt{s}=1.96$} TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Abolins, Maris A.; /Michigan State U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Aguilo, Ernest; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, Mahsana; /Kansas State U.; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls /Northeastern U.

    2009-07-01

    We present a direct measurement of trilinear gauge boson couplings at gammaWW and ZWW vertices in WW and WZ events produced in p{bar p} collisions at {radical}s = 1.96 TeV. We consider events with one electron or muon, missing transverse energy, and at least two jets. The data were collected using the D0 detector and correspond to 1.1 fb{sup -1} of integrated luminosity. Considering two different relations between the couplings at the gammaWW and ZWW vertices, we measure these couplings at 68% C.L. to be kappa{sub gamma} = 1.07{sub -0.29}{sup +0.26}, lambda = 0.00{sub -0.06}{sup +0.06}, and g{sub 1}{sup Z} = 1.04{sup -0.09}{sup +0.09} in a scenario respecting SU(2){sub L}[direct-product]U(1){sub Y} gauge symmetry and kappa = 1.04{sub -0.11}{sup +0.11} and lambda=0.00{sub -0.06}{sup +0.06} in an 'equal couplings' scenario.

  11. Fragmentation of Jets Produced in Proton-Antiproton Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Jindariani, Sergo R. [Univ. of Florida, Gainesville, FL (United States)

    2007-01-01

    We present the first measurement of two-particle momentum correlations in jets produced in p$\\bar{p}$ collisions at center of mass energy of 1.96 TeV. A comparison of the experimental data to theoretical predictions obtained for partons within the framework of resummed perturbative QCD (Next-to-Leading Log Approximation) shows that the predicted parton momentum correlations survive the hadronization stage of jet fragmentation and are present at the hadron level. We also present the measurement of the intrinsic transverse momenta of particles with respect to jet axis (kT ). Experimental data is compared to the theoretical predictions obtained for partons within the framework of Modified Leading Log Approximation and Next-to-Modified Leading Log Approximation, and shows good agreement in the range of validity of the theoretical predictions. The results of both measurements indicate that the perturbative stage of the jet formation must be dominant and give further support to the hypothesis of Local Parton-Hadron Duality.

  12. Diagnostic value of thallium-201 myocardial perfusion IQ-SPECT without and with computed tomography-based attenuation correction to predict clinically significant and insignificant fractional flow reserve: A single-center prospective study.

    Science.gov (United States)

    Tanaka, Haruki; Takahashi, Teruyuki; Ohashi, Norihiko; Tanaka, Koichi; Okada, Takenori; Kihara, Yasuki

    2017-12-01

    The aim of this study was to clarify the predictive value of fractional flow reserve (FFR) determined by myocardial perfusion imaging (MPI) using thallium (Tl)-201 IQ-SPECT without and with computed tomography-based attenuation correction (CT-AC) for patients with stable coronary artery disease (CAD).We assessed 212 angiographically identified diseased vessels using adenosine-stress Tl-201 MPI-IQ-SPECT/CT in 84 consecutive, prospectively identified patients with stable CAD. We compared the FFR in 136 of the 212 diseased vessels using visual semiquantitative interpretations of corresponding territories on MPI-IQ-SPECT images without and with CT-AC.FFR inversely correlated most accurately with regional summed difference scores (rSDS) in images without and with CT-AC (r = -0.584 and r = -0.568, respectively, both P < .001). Receiver-operating characteristics analyses using rSDS revealed an optimal FFR cut-off of <0.80 without and with CT-AC. Although the diagnostic accuracy of FFR <0.80 did not significantly differ, FFR ≥0.82 was significantly more accurate with, than without CT-AC. Regions with rSDS ≥2 without or with CT-AC predicted FFR <0.80, and those with rSDS ≤1 without and with CT-AC predicted FFR ≥0.81, with 73% and 83% sensitivity, 84% and 67% specificity, and 79% and 75% accuracy, respectively.Although limited by the sample size and the single-center design, these findings showed that the IQ-SPECT system can predict FFR at an optimal cut-off of <0.80, and we propose a novel application of CT-AC to MPI-IQ-SPECT for predicting clinically significant and insignificant FFR even in nonobese patients. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  13. Dual myocardial single photon emission computed tomography (SPECT) using thallium-201 and I-123-{beta}-methyl-i-pentadecanoic acid in patients with Duchenne's progressive muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Shimoyama, Katsuya [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine

    1999-10-01

    Dual single photon emission computed tomography (SPECT) was performed in 31 patients with Duchenne's progressive muscular dystrophy (DMD) using {sup 123}I-{beta}-methyl pentadecanoic acid (BMIPP) for myocardial fatty acid metabolism and {sup 201}thallium (Tl)-chloride for myocardial perfusion. The left ventricle was divided into 9 segments, and accumulation of the radiotracers was assessed visually for each segment to calculate defect score for each tracer. There was some degree of decrease in myocardial accumulation of both tracers in all DMD patients. Reduced accumulation was most common at the apex (BMIPP: 67%, Tl: 63%), followed by the posterior wall, lateral wall, and anterior wall. On the other hand, reduced accumulation was less common at the septum. BMIPP showed a higher accumulation than Tl in all segments but the septum. When BMIPP defect score was larger than Tl defect score, BMIPP defect score tended to increase during 4 years follow-up (p<0.042). However, when Tl defect score was larger than BMIPP defect score, an increase in Tl defect score was slight. A significant negative correlation was found between the sum of the BMIPP and Tl defect scores and the left ventricular ejection fraction (LVEF) (r=0.66, p<0.0001). According to the histo-pathological study of two autopsied hearts, severe myocardial fibrosis was seen in segments with fixed perfusion defect. In addition, the mismatched segments of BMIPP defect score > Tl defect score revealed a slight fibrosis or normal myocardium. It can be concluded that the dual SPECT myocardial scintigraphy using BMIPP and Tl provides accurate information about disease progression of the heart in patients with DMD by detecting abnormalities of the myocardial metabolism of each substance, thereby enabling the assessment of left ventricular function. (author)

  14. Measurement of the Top Quark Mass by Dynamical Likelihood Method using the Lepton plus Jets Events in 1.96 Tev Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Yorita, Kohei [Waseda Univ., Shinjuku (Japan)

    2005-03-01

    We have measured the top quark mass with the dynamical likelihood method (DLM) using the CDF II detector at the Fermilab Tevatron. The Tevatron produces top and anti-top pairs in pp collisions at a center of mass energy of 1.96 TeV. The data sample used in this paper was accumulated from March 2002 through August 2003 which corresponds to an integrated luminosity of 162 pb-1.

  15. Measurement of top quark mass in the all hadronic channel in √s = 1.96 TeF, p$\\bar{p}$ collisions at D0

    Energy Technology Data Exchange (ETDEWEB)

    Lam, David Wai Kui [Univ. of Notre Dame, IN (United States)

    2008-04-01

    A measurement of the top quark mass in proton-antiproton collisions at √s = 1.96 TeV using 1040fb-1 of data collected in D detector at Fermilab is presented. This analysis focuses on the all-hadronic decay mode of the top quark and therefore only events with six or more calorimeter jets in the final state are considered.

  16. Clinical need for a Baha trial in patients with single-sided sensorineural deafness. Analysis of a Baha database of 196 patients.

    Science.gov (United States)

    Desmet, Jolien; Bouzegta, Rajae; Hofkens, Anouk; De Backer, Annemarie; Lambrechts, Peggy; Wouters, Kristien; Claes, Jozef; De Bodt, Marc; Van de Heyning, Paul

    2012-03-01

    A bone-anchored hearing aid (Baha) is used in patients with single-sided sensorineural deafness (SSD) to overcome the head shadow effect. Of all the patients with SSD, treated at our hospital, 196 patients used a Baha on trial between November 2001 and April 2010. The objective of this study is to evaluate what factors determine the decision of a SSD patient whether or not to opt for a Baha device following a Baha trial period. 196 patients with SSD were enrolled for a trial period of 2 weeks at the Antwerp University Hospital, a tertiary referral centre. 93% of these patients suffered from an acquired hearing loss. 44% of all the patients (87/196) chose to wear a Baha device after the trail period, either on an abutment or on a headband. The collected data were analysed to determine correlations between the decision of a patient following a Baha trial period on the one hand, and Fletcher Index ipsi- and contralaterally, bone conduction hearing thresholds at the better hearing ear, aetiology, age at the start of the trial period, duration of hearing loss at the start of the trial period and the type of device used during the trial period, on the other hand. Although 66% of all the patients (109/196) declined the Baha after a trial, reasons not to choose a Baha were diverse and no crucial factors could be found that determine the success of a Baha trial period. Lack of improvement concerning speech understanding in noise was the most important reason mentioned by patients who declined the Baha. The authors advocate that all patients, suffering from SSD, should be offered the opportunity to try a Baha device as no factors could be found that determine the decision of a patient following the trial period.

  17. Measurement of electroweak single top quark production in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Peter Joseph [Univ. of California, Los Angeles, CA (United States)

    2008-01-01

    The top quark is an extremely massive fundamental particle that is predominantly produced in pairs at particle collider experiments. The Standard Model of particle physics predicts that top quarks can also be produced singly by the electroweak force; however, this process is more difficult to detect because it occurs at a smaller rate and is more difficult to distinguish from background processes. The cross section of this process is related to the Cabbibo-Kobayashi-Maskawa matrix element |V tb|, and measurement of the single top quark production cross section is currently the only method to directly measure this quantity without assuming the number of generations of fermions. This thesis describes a measurement of the cross section of electroweak single top quark production in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV. This analysis uses 2.2 fb-1 of integrated luminosity recorded by the Collider Detector at Fermilab. The search is performed using a matrix element method which calculates the differential cross section for each event for several signal and background hypotheses. These numbers are combined into a single discriminant and used to construct templates from Monte Carlo simulation. A maximum likelihood fit to the data distribution gives a measurement of the cross section. This analysis measures a value of 2.2$+0.8\\atop{-0.7}$ pb, which corresponds to a value of |V tb| = 0.88$+0.16\\atop{-0.14}$experimental±0.7(theoretical). The probability that this result originates from a background fluctuation in the absence of single top production (p-value) is 0.0003, which is equivalent to 3.4 standard deviations in Gaussian statistics. The expected (median) p-value as estimated from pseudo-experiments for this analysis is 0.000003, which corresponds to 4.5 standard deviations in Gaussian statistics.

  18. Relationships between consumption of alcoholic beverages and healthy foods: the French supermarket cohort of 196,000 subjects.

    Science.gov (United States)

    Hansel, Boris; Roussel, Ronan; Diguet, Vincent; Deplaude, Amandine; Chapman, M John; Bruckert, Eric

    2015-02-01

    Moderate alcohol consumption is associated with reduced risk of cardiovascular disease. Related dietary habits and lifestyle may bias assessment of the relationship between alcohol intake and health status. We examined the relationship between key features relating to the consumption of alcoholic beverages and individual profiles of objective food purchases. Data were collected on regular clients of a large supermarket chain implanted across France (n = 196,604). Food items purchased were classified into three categories: (1) healthy foods; (2) unhealthy foods; and (3) others. Wine consumers favoured purchase of healthy foods more often than others, whereas the lowest level of healthy food purchasers was associated with consumption of beer and aniseed-based beverages. Bordeaux wine purchasers spent less in their average budget than the whole population for nine out of the 11 unhealthy food categories. Conversely, the budget was markedly higher in non-alcohol purchasers as compared to the whole population for seven out of the 11 unhealthy foods. The ratio of the budget for healthy to that for unhealthy foods was also distinct between the groups, being highest for wine and lowest for beer. In the subgroup of non-alcohol consumers, this ratio was intermediate but significantly lower relative to values in the five subcategories of wine purchasers. Marked differences in the profile of the purchase of healthy versus unhealthy food products as a function of the subcategory of alcoholic beverage consumed were documented, revealing a critical unidentified confounding feature in analyses of the potential relationship between alcohol consumption and protection against cardiovascular disease. © The European Society of Cardiology 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  19. Diffractive Dijet Production in $\\bar{p}p$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Albrow, M.; /Fermilab; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U. /Fermilab; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Arisawa, T.; /Waseda U. /Dubna, JINR

    2012-06-01

    We report on a study of diffractive dijet production in {bar p}p collisions at {radical}s = 1.96 TeV using the CDF II detector at the Fermilab Tevatron {bar p}p collider. A data sample from 310 pb{sup -1} of integrated luminosity collected by triggering on a high transverse energy jet, E{sub T}{sup jet}, in coincidence with a recoil antiproton detected in a Roman pot spectrometer is used to measure the ratio of single-diffractive to inclusive-dijet event rates as a function of x{sup {bar p}} of the interacting parton in the antiproton, the Bjorken-x, x{sub Bj}{sup {bar p}}, and a Q{sup 2} {approx} (E{sub T}{sup jet}){sup 2} in the ranges 10{sup -3} < x{sub Bj}{sup {bar p}} < 10{sup -1} and 10{sup 2} < Q{sup 2} < 10{sup 4} GeV{sup 2}, respectively. Results are presented for the region of {bar p}-momentum-loss fraction 0.03 < {zeta}{sub {bar p}} < 0.09 and a four-momentum transfer squared t{sub {bar p}} > -4 GeV{sup 2}. The t{sub {bar p}} dependence is measured as a function of Q{sup 2} and x{sub Bj}{sup {bar p}} and compared with that of inclusive single diffraction dissociation. We find weak x{sub Bj}{sup bar p}} and Q{sup 2} dependencies in the ratio of single diffractive to inclusive event rates, and no significant Q{sup 2} dependence in the diffractive t{sub {bar p}} distributions.

  20. Perioperative Outcomes, Complications, and Efficacy of Robotic-Assisted Prolapse Repair: A Single Institution Study of 196 Patients.

    Science.gov (United States)

    Gupta, Priyanka; Ehlert, Michael; Bartley, Jamie; Gilleran, Jason; Killinger, Kim A; Boura, Judith A; Nagaraju, Pradeep; Fischer, Melissa

    2017-09-15

    Abdominal pelvic organ prolapse repair is efficacious for uterovaginal and apical prolapse. We describe the safety and efficacy of robotic prolapse repair in a large teaching institution. Consecutive robotic-assisted prolapse repairs at a single institution between 2006 and 2014 were retrospectively reviewed for patient characteristics, operative information, and outcomes. A total of 196 women (mean age, 61 ± 9 years) underwent robotic prolapse repair (189 sacrocolpopexy, 6 sacrohysteropexy, 1 enterocele repair). Concomitant procedures included hysterectomy (88), midurethral sling (84), and/or Burch colposuspension (7). Mean odds ratio time was 242 ± 69.9 minutes, and median length of stay was 1 day. Intraoperative complications were as follows: cystotomy (4), vaginotomy (4), conversion to open (2), bowel injury/aborted (1), adhesions/aborted (1), and ureteral injury (1). Women with complications had greater blood loss than those without complications (P = 0.0015). Immediate (neuropraxia (3). At median follow-up of 9 months (range, 0-85 months), 14 women had recurrent grade 3 prolapse, and 4 had grade 2 apical prolapse. Nine of 14 women had additional prolapse repair at a mean of 9.5 ± 6.3 months. Vaginal mesh exposure was detected in 12 (6.3%) of 192 women. There were 6 procedures for mesh exposure and 2 procedures for exposed sutures. One mesh erosion into the bladder required open excision. In this large series of robotic prolapse repair, complications are infrequent. Short-term apical outcomes are excellent. Few women required additional compartment repairs within 1 year with 6% rate of mesh exposure.

  1. Study on the top quark pair production mechanism in 1.96 TeV proton-antiproton collisions

    Energy Technology Data Exchange (ETDEWEB)

    Naganoma, Junji [Waseda Univ., Shinjuku (Japan)

    2008-03-01

    The study of the top quark pair production mechanism in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV is described. The main subjects are the measurements of the top quark pair production cross section, the top quark mass and a search for a new particle decaying to the top quark pair. The analyses are based on 1.9 fb-1 of data collected by the Collider Detector at Fermilab (CDF) Run II experiment between March 2002 and May 2007, using the lepton+jets events. The measured top quark pair production cross section is 8.2 ± 0.5 (stat.) ± 0.8 (syst.) ± 0.5 (lum.) pb, which is slightly higher than the standard model prediction at the top mass of 175 GeV/c2. The top quark mass is an important parameter in the standard model, and also in the experimental studies. The measured top quark mass if 171.6 ± 2.0 (stat.) ± 1.3(syst.) GeV/c2. Finally, they report on a search for a new gauge boson decaying to t$\\bar{t}$, which interferes with the standard model gluon in the q$\\bar{q}$ → t$\\bar{t}$ production process. They call such a hypothetical particle a 'Massive Gluon'. The observed t$\\bar{t}$ invariant mass distribution is consistent with the standard model expectations, and also the measured massive gluon coupling strength with quarks is consistent within a statistical fluctuation of the standard model expectation in the wide range of the massive gluon masses and widths. They set the upper and lower limits on the coupling strength of the massive gluon.

  2. A genetic variant in miR-196a2 increased digestive system cancer risks: a meta-analysis of 15 case-control studies.

    Directory of Open Access Journals (Sweden)

    Jing Guo

    Full Text Available BACKGROUND: MicroRNAs (miRNAs negatively regulate the gene expression and act as tumor suppressors or oncogenes in oncogenesis. The association between single nucleotide polymorphism (SNP in miR-196a2 rs11614913 and the susceptibility of digestive system cancers was inconsistent in previous studies. METHODOLOGY/PRINCIPAL FINDINGS: An updated meta-analysis based on 15 independent case-control studies consisting of 4999 cancer patients and 7606 controls was performed to address this association. It was found that miR-196a2 polymorphism significantly elevated the risks of digestive system cancers (CT vs. TT, OR = 1.25, 95% CI = 1.07-1.45; CC vs. TT, OR = 1.38, 95% CI = 1.13-1.67; CC/CT vs. TT, OR = 1.29, 95% CI = 1.10-1.50; CC vs. CT/TT, OR = 1.14, 95% CI = 1.01-1.30; C vs. T, OR = 1.15, 95% CI = 1.05-1.26. We also found that variant in miR-196a2 increased the susceptibility of colorectal cancer (CRC (CT vs. TT, OR = 1.23, 95% CI = 1.04-1.44; CC vs. TT, OR = 1.32, 95% CI = 1.08-1.61; CC/CT vs. TT, OR = 1.25, 95% CI = 1.07-1.46; C vs. T, OR = 1.15, 95% CI = 1.05-1.28, while the association in recessive model (CC vs. CT/TT, OR = 1.16, 95% CI = 0.98-1.38 showed a marginal significance. Additionally, significant association between miR-196a2 polymorphism and increased risk of hepatocellular cancer (HCC was detected. By stratifying tumors on the basis of site of origin, source of controls, ethnicity and allele frequency in controls, elevated cancer risks were observed. CONCLUSION/SIGNIFICANCE: Our findings suggest the significant association between miR-196a2 polymorphism and increased susceptibility of digestive system cancers, especially of CRC, HCC and Asians. Besides, C allele may contribute to increased digestive cancer risks.

  3. Physical and underway data collected aboard the KNORR during cruise KN196-01 in the Davis Strait, Gulf of St. Lawrence and others from 2009-09-17 to 2009-10-02 (NODC Accession 0104280)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104280 includes physical and underway data collected aboard the KNORR during cruise KN196-01 in the Davis Strait, Gulf of St. Lawrence and others...

  4. Measurement of the single top production cross section in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Tanasijczuk, Andres Jorge [Univ. of Buenos Aires (Argentina)

    2010-03-25

    This thesis describes a search for singly produced top quarks via an electroweak vertex in head-on proton-antiproton collisions at a center of mass energy of √s = 1.96 TeV. The analysis uses a total of 2.3 fb-1 of data collected with the D0 detector at Fermilab, corresponding to two different run periods of the Tevatron collider. Two channels contribute to single top quark production at the Tevatron, the s-channel and the t-channel. In the s-channel, a virtual W boson is produced from the aniquilation of a quark and an antiquark and a top and a bottom quarks are produced from the W decay. The top quark decays almost exclusively into a W boson and a bottom quark. Final states are considered in which the W boson decays leptonically into an electron or a muon plus a neutrino. Thus, at the detector level, the final state characterizing the s-channel contains one lepton, missing energy accounting for the neutrino, and two jets from the two bottom quarks. In the t-channel, the final state has an additional jet coming from a light quark. Clearly, a precise reconstruction of the events requires a precise measurement of the energy of the jets. A multivariate technique, Bayesian neural networks, is used to extract the single top signal from the overwhelming background still left after event selection. A Bayesian likelihood probability is then computed to measure the single top cross section. Assuming the observed excess is due to single top events, the measured single top quark production cross section is σ(p$\\bar{p}$ → tb + X, tqb + X) = 4.70+1.18-0.93 pb. The observed excess is associated with a p-value of (3.2 ± 2.3) x 10-8, assuming the background-only hypothesis. This p-value corresponds to an excess over background of 5.4 standard deviations for a Gaussian density. The p-value computed using the standard model signal cross section of 3.46 pb is (22.7 ± 0.6) x 10-6, corresponding to an expected significance

  5. Measurement of the Single Top Quark Production Cross Section in 1.96-TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Koji [Univ. of Tsukuba (Japan)

    2009-02-01

    Top quarks are predominantly produced in pairs via the strong interaction in $\\bar{p}$p collisions at √s = 1.96 TeV . The top quark has a weak isospin 1/2, composing a weak isospin doublet with the bottom quark. This characteristic predicts not only top quark pair production via strong interaction but also single production together with a bottom quark via weak interaction. However, finding single top quark production is challenging since it is rarely produced (σ singletop = 2.9 pb) against background processes with the same final state like W+jets and t$\\bar{t}$. A measurement of electroweak single top production probes the W-t-b vertex, which provides a direct determination of the Cabbibo-Kobayashi-Maskawa (CKM) matrix element |Vtb|. The sample offers a source of almost 100% polarized top quarks. This thesis describes an optimized search for s-channel single top quark production and a measurement of the single top production cross section using 2.7 fb-1 of data accumulated with the CDF detector. We are using events with one high-pT lepton, large missing ET and two identified b-quark jets where one jet is identified using a secondary vertex tagger, called SecVtx, and the other jet is identified using SecVtx or a jet probability tagger, called JetProb. In this analysis we have developed a kinematics fitter and a likelihood-based separator between signal and background. As a result, we found that the probability (p-value) that the candidate events originate from a background fluctuation in the absence of single top s-channel production is 0.003, which is equivalent to 2.7 σ deviations in Gaussian statistics, and this excess corresponds to the single top s-channel cross section of 2.38-0.84+1.01 pb. An observed value of |Vtb| is 1.43-0.26+0.38(experimental) ± 0.11(theory). We also set the 95% CL. upper limit of σs = 4.15 pb for the s

  6. Evaluation of myocardial flow reserve using pharmacological stress thallium-201 single-photon emission computed tomography: is there a difference between total arterial off-pump coronary artery bypass grafting and conventional coronary artery bypass grafting?

    Science.gov (United States)

    Lee, Jae Won; Ryu, Sang Wan; Song, Hyun; Kim, Kyung Sun; Yang, Yu Jung; Moon, Dae Hyeuk

    2004-01-01

    The advantage of total arterial off-pump coronary bypass grafting (OPCAB) over conventional onpump coronary artery bypass grafting with 1 internal thoracic artery and veins (CCAB) in terms of myocardial flow reserve has not been studied. We studied these procedures using thallium- 201 perfusion single-photon emission computed tomography (Tl-201 perfusion SPECT). Between 1997 and 2001, 152 patients were recruited from our database (OPCAB, n = 100; CCAB, n = 52). All patients underwent pharmacological stress Tl-201 perfusion SPECT 3 to 12 months after bypass surgery. Myocardial perfusion was analyzed semiquantitatively with a 5-point scoring system in a 20-segment model (0, normal, to 4, absence of uptake). Summed stress (SSS), rest (SRS), and difference score (SDS) of the entire myocardium as well as average scores (ASS, ARS, ADS) of individual walls (anterior, septal, lateral, and inferior) were compared by Student t test as well as by repeated-measures analysis of variance with Bonferroni correction. The SSS, SRS, and SDS of OPCAB versus those of CCAB were 6.86 +/- 0.72 versus 7.17 +/- 0.92, 3.95 +/- 0.57 versus 3.75 +/- 0.73, and 2.91 +/- 0.47 versus 3.42 +/- 0.74 (P > .05). However, the lateral wall showed lower scores in OPCAB (ASS, 0.18 versus 0.41, P = .015; ARS, 0.12 versus 0.20, P = .168; ADS, 0.06 versus 0.21, P = .031). The septal wall had higher scores in OPCAB (ASS, 0.33 versus 0.12, P = .003; ARS, 0.18 versus 0.07, P = .037; ADS, 0.14 versus 0.04, P = .030). The anterior and inferior walls were not different between the 2 groups. OPCAB led to results similar to those of CCAB. The better results in the lateral wall have been the effect of grafting radial artery rather than vein. The similarity in myocardial reserve in the inferior wall between the 2 groups needs further study. There was no deleterious effect of off-pump as opposed to on-pump CAB.

  7. MIR196A2 rs11614913 C > T polymorphism correlates with an increased risk of hepatopulmonary syndrome in liver cirrhosis: a case-control study in China.

    Science.gov (United States)

    Chen, Hai-Yong; Chen, Yao-Min; Wu, Jian; Yang, Fu-Chun; Lv, Zhen; Xu, Xiao-Feng; Zheng, Shu-Sen; Liao, Sang-Sang; Luo, Yi-Hui

    2017-07-01

    This case-control study is designed to explore the relationship between microRNA-196a2 (MIR196A2) rs11614913 C > T polymorphism and the risk of hepatopulmonary syndrome (HPS) in liver cirrhosis. From January 2013 to January 2015, 163 liver cirrhosis patients with HPS (case group), 264 liver cirrhosis patients without HPS (control group), and 195 healthy people (normal group) were selected. A DNA extraction kit was used to extract plasma DNA from peripheral blood. Polymerase chain reaction-restriction fragment length polymorphism was used to detect the allele and genotype frequencies of MIR196A2 C > T polymorphism. Real-time quantitative polymerase chain reaction was adopted to detect the relative expression of MIR196A. The frequencies of C allele in the case group were higher than those in the control and normal groups (all P  T polymorphism was closely associated with an increased risk of HPS in patients with liver cirrhosis. Compared with the normal group, the relative expression of MIR196A in the case group was significantly increased (P  0.05). In the case group, compared with patients carrying the TT genotype, the relative expression of MIR196A of patients carrying the C allele (CT + CC) evidently increased (P  T polymorphism may contribute to an increased risk of HPS in liver cirrhosis patients. © 2016 The Japan Society of Hepatology.

  8. MAGIC detection of very high energy γ-ray emission from the low-luminosity blazar 1ES 1741+196

    Science.gov (United States)

    Ahnen, M. L.; Ansoldi, S.; Antonelli, L. A.; Antoranz, P.; Arcaro, C.; Babic, A.; Banerjee, B.; Bangale, P.; Barres de Almeida, U.; Barrio, J. A.; Bednarek, W.; Bernardini, E.; Berti, A.; Biasuzzi, B.; Biland, A.; Blanch, O.; Bonnefoy, S.; Bonnoli, G.; Borracci, F.; Bretz, T.; Buson, S.; Carosi, A.; Chatterjee, A.; Clavero, R.; Colin, P.; Colombo, E.; Contreras, J. L.; Cortina, J.; Covino, S.; Da Vela, P.; Dazzi, F.; De Angelis, A.; De Lotto, B.; de Oña Wilhelmi, E.; Di Pierro, F.; Doert, M.; Domínguez, A.; Dominis Prester, D.; Dorner, D.; Doro, M.; Einecke, S.; Eisenacher Glawion, D.; Elsaesser, D.; Engelkemeier, M.; Fallah Ramazani, V.; Fernández-Barral, A.; Fidalgo, D.; Fonseca, M. V.; Font, L.; Frantzen, K.; Fruck, C.; Galindo, D.; García López, R. J.; Garczarczyk, M.; Garrido Terrats, D.; Gaug, M.; Giammaria, P.; Godinović, N.; Gora, D.; Guberman, D.; Hadasch, D.; Hahn, A.; Hayashida, M.; Herrera, J.; Hose, J.; Hrupec, D.; Hughes, G.; Idec, W.; Kodani, K.; Konno, Y.; Kubo, H.; Kushida, J.; La Barbera, A.; Lelas, D.; Lindfors, E.; Lombardi, S.; Longo, F.; López, M.; López-Coto, R.; Majumdar, P.; Makariev, M.; Mallot, K.; Maneva, G.; Manganaro, M.; Mankuzhiyil, N.; Mannheim, K.; Maraschi, L.; Marcote, B.; Mariotti, M.; Martínez, M.; Mazin, D.; Menzel, U.; Miranda, J. M.; Mirzoyan, R.; Moralejo, A.; Moretti, E.; Nakajima, D.; Neustroev, V.; Niedzwiecki, A.; Nievas Rosillo, M.; Nilsson, K.; Nishijima, K.; Noda, K.; Nogués, L.; Paiano, S.; Palacio, J.; Palatiello, M.; Paneque, D.; Paoletti, R.; Paredes, J. M.; Paredes-Fortuny, X.; Pedaletti, G.; Peresano, M.; Perri, L.; Persic, M.; Poutanen, J.; Prada Moroni, P. G.; Prandini, E.; Puljak, I.; Garcia, J. R.; Reichardt, I.; Rhode, W.; Ribó, M.; Rico, J.; Saito, T.; Satalecka, K.; Schroeder, S.; Schweizer, T.; Shore, S. N.; Sillanpää, A.; Sitarek, J.; Snidaric, I.; Sobczynska, D.; Stamerra, A.; Strzys, M.; Surić, T.; Takalo, L.; Takami, H.; Tavecchio, F.; Temnikov, P.; Terzić, T.; Tescaro, D.; Teshima, M.; Torres, D. F.; Toyama, T.; Treves, A.; Vanzo, G.; Verguilov, V.; Vovk, I.; Ward, J. E.; Will, M.; Wu, M. H.; Zanin, R.; Becerra González, J.; Rani, B.; Krauss, F.; Perri, M.; Verrecchia, F.; Reinthal, R.

    2017-06-01

    We present the first detection of the nearby (z = 0.084) low-luminosity BL Lac object 1ES 1741+196 in the very high energy (E > 100 GeV) band. This object lies in a triplet of interacting galaxies. Early predictions had suggested 1ES 1741+196 to be, along with several other high-frequency BL Lac sources, within the reach of MAGIC detectability. Its detection by MAGIC, later confirmed by VERITAS, helps to expand the small population of known TeV BL Lacs. The source was observed with the MAGIC telescopes between 2010 April and 2011 May, collecting 46 h of good quality data. These observations led to the detection of the source at 6.0 σ confidence level, with a steady flux F(>100 GeV) = (6.4 ± 1.7stat ± 2.6syst) × 10-12 ph cm-2s-1 and a differential spectral photon index Γ = 2.4 ± 0.2stat ± 0.2syst in the range of ˜80 GeV-3 TeV. To study the broad-band spectral energy distribution (SED) simultaneous with MAGIC observations, we use KVA, Swift/UVOT and XRT and Fermi/LAT data. One-zone synchrotron-self-Compton (SSC) modelling of the SED of 1ES 1741+196 suggests values for the SSC parameters that are quite common among known TeV BL Lacs except for a relatively low Doppler factor and slope of electron energy distribution. A thermal feature seen in the SED is well matched by a giant elliptical's template. This appears to be the signature of thermal emission from the host galaxy, which is clearly resolved in optical observations.

  9. Search for Randall-Sundrum gravitons with 1 fb-1 of data from ppbar collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, S; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kozelov, A V; Krop, D; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Rominsky, M; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Siccardi, V; Simák, V; Sirotenko, V; Skubic, P; Slattery, P; Smirnov, D; Snow, J; Snow, G R; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Strauss, E; Ströhmer, R; Strom, D; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, S; Uvarov, L; Uzunyan, S; Vachon, B; vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vokac, P; Von Törne, E; Voutilainen, M; Wagner, R; Wahl, H D; Wang, L; SWang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weber, G; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, J; Zatserklyaniy, A; Zeitnitz, C; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-01-01

    Using 1 fb-1 of data from ppbar collisions at $\\sqrt{s}$=1.96 TeV at the Fermilab Tevatron collider collected by the D0 detector, we search for decays of Kaluza-Klein excitations of the graviton in the Randall-Sundrum model of extra dimensions to $e^+e^-$ and diphotons. We set 95% confidence level upper limits on the production cross section times branching fraction which translate into lower limits on the mass of the lightest excitation between 300 and 900 GeV for values of the coupling k/M(Planck) between 0.01 and 0.1.

  10. Search for Randall-Sundrum Gravitons with 1fb-1 of Data from pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, S.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.

    2008-03-01

    We search for decays of Kaluza-Klein excitations of the graviton in the Randall-Sundrum model of extra dimensions to e+e- and γγ in 1fb-1 of pp¯ collisions at s=1.96TeV collected by the D0 detector at the Fermilab Tevatron. We set 95% confidence level upper limits on the production cross section times branching fraction, which translate into lower limits on the mass of the lightest excitation between 300 and 900 GeV for values of the coupling k/M¯Pl between 0.01 and 0.1.

  11. Search for the lightest scalar top quark in events with two leptons in ppbar collisions at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Clément, B.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; de Jong, P.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Michaut, M.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.

    2008-01-01

    Data collected by the D0 detector at a ppbar center-of-mass energy of 1.96 TeV at the Fermilab Tevatron Collider have been used to search for pair production of the lightest supersymmetric partner of the top quark decaying into bℓν˜. The search is performed in the ℓℓ‧ = eμ and μμ final states. No evidence for this process has been found in data samples of approximately 400 pb-1. The domain in the [ M (t˜1) , M (ν˜)] plane excluded at the 95% C.L. is substantially extended by this search.

  12. Search for particles decaying into a Z boson and a photon in pp¯ collisions at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borcherding, F.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; de, K.; de Jong, P.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Gounder, K.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Kryemadhi, A.; Krzywdzinski, S.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; McCroskey, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.

    2006-10-01

    We present the results of a search for a new particle X produced in pp¯ collisions at s=1.96 TeV and subsequently decaying to Zγ. The search uses 0.3 fb-1 of data collected with the DØ detector at the Fermilab Tevatron Collider. We set limits on the production cross section times the branching fraction σ(pp¯→X)×B(X→Zγ) that range from 0.4 to 3.5 pb at the 95% C.L. for X with invariant masses between 100 and 1000 GeV/c, over a wide range of X decay widths.

  13. Search for particles decaying into a Z boson and a photon in ppbar collisions at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borcherding, F.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; De, K.; de Jong, P.; de Jong, S. J.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Gounder, K.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Kryemadhi, A.; Krzywdzinski, S.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; McCroskey, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.

    2006-10-01

    We present the results of a search for a new particle X produced in ppbar collisions at √{ s} = 1.96 TeV and subsequently decaying to Zγ. The search uses 0.3 fb-1 of data collected with the DØ detector at the Fermilab Tevatron Collider. We set limits on the production cross section times the branching fraction σ (ppbar → X) × B (X → Zγ) that range from 0.4 to 3.5 pb at the 95% C.L. for X with invariant masses between 100 and 1000 GeV /c2, over a wide range of X decay widths.

  14. Search for scalar leptoquarks in the acoplanar jet topology in pp¯ collisions at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; de, K.; de Jong, P.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.; Meyer, A.; Meyer, J.; Michaut, M.

    2006-09-01

    A search for leptoquarks has been performed in 310 pb-1 of data from pp¯ collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron Collider. The topology analyzed consists of acoplanar jets with missing transverse energy. The data show good agreement with standard model expectations, and a lower mass limit of 136 GeV has been set at the 95% C.L. for a scalar leptoquark decaying exclusively into a quark and a neutrino.

  15. Search for scalar leptoquarks in the acoplanar jet topology in ppbar collisions at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; De, K.; de Jong, P.; de Jong, S. J.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.; Meyer, A.; Meyer, J.; Michaut, M.; Miettinen, H.; Millet, T.

    2006-09-01

    A search for leptoquarks has been performed in 310 pb-1 of data from ppbar collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron Collider. The topology analyzed consists of acoplanar jets with missing transverse energy. The data show good agreement with standard model expectations, and a lower mass limit of 136 GeV has been set at the 95% C.L. for a scalar leptoquark decaying exclusively into a quark and a neutrino.

  16. Search for the lightest scalar top quark in events with two leptons in pp¯ collisions at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Clément, B.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de Jong, P.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Michaut, M.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.

    2008-01-01

    Data collected by the D0 detector at a pp¯ center-of-mass energy of 1.96 TeV at the Fermilab Tevatron Collider have been used to search for pair production of the lightest supersymmetric partner of the top quark decaying into bℓν˜. The search is performed in the ℓℓ=eμ and μμ final states. No evidence for this process has been found in data samples of approximately 400 pb-1. The domain in the [M(t),M(ν˜)] plane excluded at the 95% C.L. is substantially extended by this search.

  17. Search for scalar leptoquarks in the acoplanar jet topology in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; /Buenos Aires U. /Rio de

    2006-07-01

    A search for leptoquarks has been performed in 310 pb{sup -1} of data from p{bar p} collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron Collider. The topology analyzed consists of acoplanar jets with missing transverse energy. The data show good agreement with standard model expectations, and a lower mass limit of 136 GeV has been set at the 95% C.L. for a scalar leptoquark decaying exclusively into a quark and a neutrino.

  18. Search for Large Extra Dimensions via Single Photons Plus Missing Energy Final States at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Carrera, Edgar Fernando [Florida State Univ., Tallahassee, FL (United States)

    2008-12-01

    This dissertation presents a search for large extra dimensions in the single photon plus missing transverse energy final states. We use a data sample of approximately 2.7 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV (recorded with the D- detector) to investigate direct Kaluza Klein graviton production and set limits, at the 95% C.L., on the fundamental mass scale MD from 970 GeV to 816 GeV for two to eight extra dimensions.

  19. Search for Large Extra Dimensions in the Production of Jets and Missing Transverse Energy in ppbar Collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst.

    2006-04-01

    The authors present the results of a search for new physics in the jets plus missing transverse energy data sample collected from 368 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV recorded by the Collider Detector at Fermilab. They compare the number of events observed in the data with a data-based estimate of the standard model backgrounds contributing to this signature. They observe no significant excess of events, and they interpret this null result in terms of lower limits on the fundamental Planck scale for a large extra dimensions scenario.

  20. Measurement of the W + γ Production in Proton - Anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kirby, Michael H. [Duke Univ., Durham, NC (United States)

    2004-01-01

    The authors present a measurement of the $\\bar{p}$p → Wγ + X → evγ + X production cross section using data form the Collider Detector at Fermilab. The p$\\bar{p}$ collisions were provided by the Tevatron Collider at a center of mass energy of 1.96 TeV. Electroweak theory includes the trilinear vector boson coupling, WWγ, which contributes to the evγ final state. The electron decay channel of the W provides a clean sample to study the production of diboson pairs. The measurement of the production cross section tests the structure of the non-Abelian character of Electroweak theory.

  1. Inclusive high-p$\\perp$ b$\\bar{b}$cross section measurement at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Galyaev, Eugene N. [Univ. of Notre Dame, IN (United States)

    2006-11-01

    The Run II physics program at the Tevatron started in the spring of 2001 with protons and antiprotons colliding at an energy of √s = 1.96 TeV, and is continuing with about 1.2 fb-1 of data currently collected by the CDF and D0 experiments. A measurement of the b-jet cross section as function of jet transverse momentum p$\\perp$ has been performed using 312 pb-1 of D0 data. The results for this measurement were obtained and are presented herein. A neural network algorithm was used to identify b jets.

  2. Search for Higgs boson production in proton-antiproton collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kusakabe, Yoshiaki [Waseda Univ., Shinjuku (Japan)

    2006-12-01

    We performed a search for Standard Model Higgs boson production in association with W boson (p$\\bar{p}$ → W±H → ℓvb$\\bar{b}$) in p$\\bar{p}$ collisions at √s = 1.96 TeV. The search uses the data collected between February 2002 and February 2006 at Collider Detector at Fermilab (CDF), which corresponds to an integrated luminosity of about 1 fb-1. The experimental final state of WH → ℓvb$\\bar{b}$ process is lepton (e±±), missing transverse energy and two jets. The largest background in lepton+jets events is W+light flavor process, therefore the identification of jets as b-jets reduces this kind of background significantly. We used displaced SECondary VerTeX b-tagging (SECVTX) technique, which utilizes the signature that b-jets have secondary vertex displaced away from primary vertex because of the long life time of B-mesons. However, there is still much contamination in SECVTX b-tagged jets. Finite resolution of secondary vertex tracking measurements results in false tags, and c-jets are also identified as b-jets due to the long life time of D-mesons frequently. For the purpose of increasing the purity of the SECVTX b-tagged jets, we applied Neural Network to SECVTX tagged jets for the first time by using secondary vertex variables and some variables independent of it. Neural Network filter rejects 65% of light flavor jets and 50% of c-jets from the SECVTX tagged jets. We improved the sensitivity of the Higgs boson signal search by 10% with Neural Network b-tagging technique. Events with one high pT electron or muon, large missing transverse energy and either single SECVTX b-tagged jet which passes the Neural Network filter or at least two SECVTX b-tagged jets are selected. The number of selected events and dijet mass distributions are consistent with the Standard Model background expectations. Therefore we set an upper limit on σ(p$\\bar{p}$ → WH) • Br(H → b$\\bar{b}$) as 3.9 to 1

  3. Tungsten Inert Gas and Friction Stir Welding Characteristics of 4-mm-Thick 2219-T87 Plates at Room Temperature and -196 °C

    Science.gov (United States)

    Lei, Xuefeng; Deng, Ying; Yin, Zhimin; Xu, Guofu

    2014-06-01

    2219-T87 aluminum alloy is widely used for fabricating liquid rocket propellant storage tank, due to its admirable cryogenic property. Welding is the dominant joining method in the manufacturing process of aerospace components. In this study, the tungsten inert gas welding and friction stir welding (FSW) characteristics of 4-mm-thick 2219-T87 alloy plate at room temperature (25 °C) and deep cryogenic temperature (-196 °C) were investigated by property measurements and microscopy methods. The studied 2219 base alloy exhibits a low strength plane anisotropy and excellent room temperature and cryogenic mechanical properties. The ultimate tensile strength values of TIG and FSW welding joints can reach 265 and 353 MPa at room temperature, and 342 and 438 MPa at -196 °C, respectively. The base metal consists of elongated deformed grains and many nano-scaled θ (Al2Cu) aging precipitates. Fusion zone and heat-affected zone (HAZ) of the TIG joint are characterized by coarsening dendritic grains and equiaxed recrystallized grains, respectively. The FSW-welded joint consists of the weld nugget zone, thermo-mechanically affected zone (TMAZ), and HAZ. In the weld nugget zone, a micro-scaled sub-grain structure is the main microstructure characteristic. The TMAZ and HAZ are both characterized by coarsened aging precipitates and elongated deformed grains. The excellent FSW welding properties are attributed to the preservation of the working structures and homogenous chemical compositions.

  4. Hysteresis and Instability in Some IPRT Sensors Within Temperature Ranges Extending from -196 ^{circ }\\hbox {C} to 150 ^{circ }\\hbox {C}

    Science.gov (United States)

    Rusby, R. L.; Machin, D.

    2017-08-01

    Industrial platinum resistance thermometer (IPRT) sensors or probes suffer from some instability on cycling over significant ranges of temperature and, specifically, from hysteresis in which the resistance tends to follow different paths for increasing temperatures compared with decreasing temperatures. The effect is well known, and cases of quite large hysteresis have been reported in the literature. Therefore, in establishing calibration and measurement capabilities for IPRT calibrations it is important to include an assessment of the performance which can be expected of a `typical good' IPRT and to include this in the overall uncertainty which the laboratory can expect to achieve in such calibrations, even though the effect itself is outside the laboratory's control. This paper presents results which have been obtained in cycling IPRT probes from four sources within various temperature ranges of current interest at NPL, between -196 ^{circ }\\hbox {C} and 150 ^{circ }\\hbox {C}, to see what levels of hysteresis may be expected. The cycles were carried out quite quickly in order to detect the hysteresis before it was mitigated by relaxation effects, but the time dependence was not itself studied. In most cases, hysteresis was {<}0.0025 ^{circ }\\hbox {C} between 0 ^{circ }\\hbox {C} and 100 ^{circ }\\hbox {C}, and {<}0.0035 ^{circ }\\hbox {C} when the range extended down to -80 ^{circ }\\hbox {C} or up to 150 ^{circ }\\hbox {C}. Greater instability occurred when the sensors were cooled to -196 ^{circ }\\hbox {C}.

  5. Measurement of the Top Quark Pair Production Cross Section in p anti-p collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Otero y Garzon, Gustavo J. [Univ. of Illinois, Chicago, IL (United States)

    2006-03-01

    The subject of this thesis is the measurement of the rate at which a top-antitop quark pair is produced in pp collisions at a center of mass energy of ps = 1:96 TeV. The data are collected with the D detector, a multi-purpose detector operating at the Fermilab Tevatron collider during Run II. A measurement of the top quark pair (t$\\bar{t}$) production cross section ( σt$\\bar{t}$) in p$\\bar{p}$ collisions at a center of mass energy of 1.96 TeV is presented. The measurement is based on data recorded by the D0 Detector at the Fermilab Tevatron Collider, and preselected in the e+jets (366 pb-1) and μ+jets (363 pb-1) channels. The cross section is extracted by applying a lifetime-tagging technique to the data, and yields σt$\\bar{t}$ = 6.96$+1.07\\atop{-0.98}$(stat + syst) ± 0.45(lumi) pb; for a top quark mass mt =175 GeV, in good agreement with the Standard Model prediction.

  6. Characteristics of photoconductivity in thallium monosulfide single ...

    Indian Academy of Sciences (India)

    Pramana – Journal of Physics. Current Issue : Vol. 90, Issue 1 · Current Issue Volume 90 | Issue 1. January 2018. Home · Volumes & Issues · Special Issues · Forthcoming Articles · Search · Editorial Board · Information for Authors · Subscription ...

  7. Search for a fourth generation b'-quark at LEP-II at sqrt{s}=196-209 GeV

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J.E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K-H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Berntzon, L.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P.S.L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chudoba, J.; Chliapnikov, P.; Chudoba, J.; Chung, S.U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M.J.; Crennell, D.; Cuevas, J.; D'Hondt, J.; Dalmau, J.; da Silva, T.; Da Silva, W.; Della Ricca, G.; De Angelis, A.; De Boer, W.; De Clercq, C.; De Lotto, B.; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Santo, M.C.Espirito; Fanourakis, G.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, E.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S-O.; Holt, P.J.; Houlden, M.A.; Jackson, John Neil; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Johansson, P.D.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, F.; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; Nulty, R.Mc; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Oliveira, O.; Oblakowska-Mucha, A.; Obraztsov, V.; Oliveira, O.; Oliveira, S.M.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, H.; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Rames, J.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Roudeau, P.; Sadovsky, A.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Santos, R.; Savoy-Navarro, A.; Schwickerath, U.; Sekulin, R.; Siebel, M.; Sopczak, A.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Taffard, A.C.; Tegenfeldt, F.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Valenti, G.; Turluer, M-L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; Van Dam, Piet; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Zalewska, A.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimine, N.I.; Zintchenko, A.

    2007-01-01

    A search for the pair production of fourth generation b'-quarks was performed using data taken by the DELPHI detector at LEP-II. The analysed data were collected at centre-of-mass energies ranging from 196 to 209 GeV, corresponding to an integrated luminosity of 420 pb^{-1}. No evidence for a signal was found. Upper limits on BR(b' -> bZ) and BR(b' -> cW) were obtained for b' masses ranging from 96 to 103 GeV/c^2. These limits, together with the theoretical branching ratios predicted by a sequential four generations model, were used to constrain the value of R_{CKM}=|V_{cb'}/V_{tb'}V_{tb}|, where V_{cb'}, V_{tb'} and V_{tb} are elements of the extended CKM matrix.

  8. Studies of high-transverse momentum jet substructure and top quarks produced in 1.96 TeV proton-antiproton collisions

    Science.gov (United States)

    Aaltonen, T.; Alon, R.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Duchovni, E.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Perez, G.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2015-02-01

    Results of a study of the substructure of the highest transverse momentum (pT) jets observed by the CDF Collaboration are presented. Events containing at least one jet with pT>400 GeV /c in a sample corresponding to an integrated luminosity of 5.95 fb-1 , collected in 1.96 TeV proton-antiproton collisions at the Fermilab Tevatron collider, are selected. A study of the jet mass, angularity, and planar-flow distributions is presented, and the measurements are compared with predictions of perturbative quantum chromodynamics. A search for boosted top-quark production is also described, leading to a 95% confidence level upper limit of 38 fb on the production cross section of top quarks with pT>400 GeV /c .

  9. Studies of high-transverse momentum jet substructure and top quarks produced in 1.96 TeV proton-antiproton collisions

    CERN Document Server

    Aaltonen, Timo Antero; Amerio, Silvia; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cavalli-Sforza, Matteo; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Duchovni, Ehud; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grinstein, Sebastian; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi; Margaroli, Fabrizio; Marino, Christopher Phillip; Martínez-Perez, Mario; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Perez, Gilad; Phillips, Thomas J; Piacentino, Giovanni M; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sinervo, Pekka; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2015-02-19

    Results of a study of the substructure of the highest transverse momentum (pT) jets observed by the CDF collaboration are presented. Events containing at least one jet with pT > 400 GeV/c in a sample corresponding to an integrated luminosity of 5.95 inverse fb, collected in 1.96 TeV proton-antiproton collisions at the Fermilab Tevatron collider, are selected. A study of the jet mass, angularity, and planar-flow distributions is presented, and the measurements are compared with predictions of perturbative quantum chromodynamics. A search for boosted top-quark production is also described, leading to a 95% confidence level upper limit of 38 fb on the production cross section of top quarks with pT > 400 GeV/c.

  10. Mass and lifetime measurements of bottom and charm baryons in $p\\bar p$ collisions at $\\sqrt{s}= 1.96 TeV

    CERN Document Server

    Aaltonen, Timo Antero; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cavalli-Sforza, Matteo; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Giurgiu, Gavril A; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grinstein, Sebastian; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi; Margaroli, Fabrizio; Marino, Christopher Phillip; Martínez-Perez, Mario; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Phillips, Thomas J; Piacentino, Giovanni M; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Ranjan, Niharika; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2014-04-22

    We report on mass and lifetime measurements of several ground state charmed and bottom baryons, using a data sample corresponding to 9.6 $\\textrm{fb}^{-1}$ from $p\\bar p$ collisions at $\\sqrt{s}=1.96$ TeV, and recorded with the Collider Detector at Fermilab. Baryon candidates are reconstructed from data collected with an online event selection designed for the collection of long-lifetime heavy-flavor decay products and a second event selection designed to collect $J/\\psi \\rightarrow \\mu^+ \\, \\mu^-$ candidates. First evidence for the process $\\Omega_b^- \\rightarrow \\Omega_c^0 \\, \\pi^-$ is presented with a significance of $3.3\\sigma$. We measure the following baryon masses: \\begin{eqnarray} M(\\Xi_c^{0}) = 2470.85\\pm0.24(stat)\\pm0.55(syst) \\, MeV/c^2, \

  11. Search for dark matter in events with one jet and missing transverse energy in pp¯ collisions at √s=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Bai, Y; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'Orso, M; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Fox, P J; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harnik, R; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lecompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Sorin, V; Song, H; Squillacioti, P; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Varganov, A; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

    2012-05-25

    We present the results of a search for dark matter production in the monojet signature. We analyze a sample of Tevatron pp[over ¯] collisions at √s=1.96 TeV corresponding to an integrated luminosity of 6.7 fb(-1) recorded by the CDF II detector. In events with large missing transverse energy and one energetic jet, we find good agreement between the standard model prediction and the observed data. We set 90% confidence level upper limits on the dark matter production rate. The limits are translated into bounds on nucleon-dark matter scattering rates which are competitive with current direct detection bounds on spin-independent interaction below a dark matter candidate mass of 5 GeV/c(2), and on spin-dependent interactions up to masses of 200 GeV/c(2).

  12. Search for chargino-neutralino production in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    We present the results of a search for associated production of the chargino and neutralino supersymmetric particles using up to 1.1 fb{sup -1} of integrated luminosity collected by the CDF II experiment at the Tevatron p{bar p} collider at a center-of-mass energy of 1.96 TeV. The search is conducted by analyzing events with a large transverse momentum imbalance and either three charged leptons or two charged leptons of the same electric charge. The numbers of observed events are found to be consistent with standard model expectations. Upper limits on the production cross section are derived in different theoretical models. In one of these models a lower limit on the mass of the chargino is set at 129 GeV/c{sup 2} at the 95% confidence level.

  13. Measurement of the ttbar production cross section in ppbar collisions at sqrt{s} = 1.96 TeV using kinematic characteristics of lepton + jets events

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clément, C; Clement, B; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; de Jong, P; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G L; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perea, P M; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pompo, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smirnov, D; Smith, R P; Snow, J; Snow, G R; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Strauss, E; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, S; Uvarov, L; Uzunyan, S; Vachon, B; Van den Berg, P J; van Eijk, B; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Vokac, P; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weber, G; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yu, C; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-01-01

    We present a measurement of the top quark pair production cross section in ppbar collisions at sqrt(s)=1.96 TeV utilizing 425 pb-1 of data collected with the D0 detector at the Fermilab Tevatron Collider. We consider the final state of the top quark pair containing one high-pT electron or muon and at least four jets. We exploit specific kinematic features of ttbar events to extract the cross section. For a top quark mass of 175 GeV, we measure sigma_ttbar = 6.4 +1.3-1.2(stat} +/- 0.7(syst)+/- 0.4(lum) pb in good agreement with the standard model prediction.

  14. Search for Neutral Higgs Bosons Decaying to Tau Pairs in pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borcherding, F.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; de, K.; de Jong, P.; de Jong, S. J.; Cruz-Burelo, E. De La; Martins, C. De Oliveira; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Gounder, K.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Kryemadhi, A.; Krzywdzinski, S.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; McCroskey, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.

    2006-09-01

    A search for the production of neutral Higgs bosons Φ decaying into τ+τ- final states in pp¯ collisions at a center-of-mass energy of 1.96 TeV is presented. The data, corresponding to an integrated luminosity of approximately 325pb-1, were collected by the D0 experiment at the Fermilab Tevatron Collider. Since no excess compared to the expectation from standard model processes is found, limits on the production cross section times branching ratio are set. The results are combined with those obtained from the D0 search for Φb(b¯)→bb¯b(b¯) and are interpreted in the minimal supersymmetric standard model.

  15. Search for squark production in events with jets, hadronically decaying tau leptons and missing transverse energy at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, M.; /Kansas State U.; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan U. /Northeastern U.

    2009-05-01

    A search for supersymmetric partners of quarks is performed in the topology of multijet events accompanied by at least one tau lepton decaying hadronically and large missing transverse energy. Approximately 1 fb-1 of ppbar collision data from the Fermilab Tevatron Collider at a center of mass energy of 1.96 TeV recorded by the D0 detector is analyzed. Results are combined with the previously published D0 inclusive search for squarks and gluinos. No evidence of physics beyond the standard model is found and lower limits on the squark mass up to 410 GeV are derived in the framework of minimal supergravity with tan(beta)=15, A{sub 0}=-2m{sub 0} and mu<0, in the region where decays to tau leptons dominate. Gaugino masses m{sub 1/2} are excluded up to 172 GeV.

  16. Search for excited and exotic electrons in the egamma decay channel in pp collisions at sqrt[s] = 1.96 TeV.

    Science.gov (United States)

    Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J-F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chu, M L; Chuang, S; Chung, J Y; Chung, W-H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; de Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernandez, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Frisch, H; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Guenther, M; da Costa, J Guimaraes; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T; Kamon, T; Kang, J; Karagoz Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; Lecompte, T; Lee, J; Lee, J; Lee, S W; Lefevre, R; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A-S; Nigmanov, T; Nodulman, L; Norniella, O; Oesterberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Palmonari, F; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; St Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sanchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sisakyan, A; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stefanini, A; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, S; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tönnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A; Varganov, A; Vataga, E; Vejcik, S; Velev, G; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobouev, I; von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

    2005-03-18

    We present a search for excited and exotic electrons (e(*)) decaying to an electron and a photon, both with high transverse momentum. We use 202 pb(-1) of data collected in pp collisions at sqrt[s] = 1.96 TeV with the Collider Detector at Fermilab II detector. No signal above standard model expectation is seen for associated ee(*) production. We discuss the e(*) sensitivity in the parameter space of the excited electron mass M(e(*)) and the compositeness energy scale Lambda. In the contact interaction model, we exclude 132 GeV/c(2)

  17. Search for first-generation scalar leptoquarks in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Acosta, D; Adelman, J; Affolder, T

    2005-06-01

    We report on a search for pair production of first-generation scalar leptoquarks (LQ) in pp collisions at {radical}(s)=1.96 TeV using an integrated luminosity of 203 pb{sup -1} collected at the Fermilab Tevatron collider by the CDF experiment. We observe no evidence for LQ production in the topologies arising from LQLQ{yields}eqeq and LQLQ{yields}eq{nu}q, and derive 95% C.L. upper limits on the LQ production cross section. The results are combined with those obtained from a separately reported CDF search in the topology arising from LQLQ{yields}{nu}q{nu}q and 95% C.L. lower limits on the LQ mass as a function of {beta}=BR(LQ{yields}eq) are derived. The limits are 236, 205 and 145 GeV/c{sup 2} for {beta}=1, {beta}=0.5 and {beta}=0.1, respectively.

  18. Search for heavy metastable particles decaying to jet pairs in pp collisions at sqrt{s} = 1.96 TeV

    CERN Document Server

    Aaltonen, T.

    2012-01-01

    A search is performed for heavy metastable particles that decay into jet pairs with a macroscopic lifetime (ctau ~ 1 cm) in \\ppbar\\ collisions at sqrt{s} = 1.96 TeV using data from the CDF II detector at Fermilab corresponding to an integrated luminosity of 3.2 fb^-1. To estimate the standard model background a data-driven approach is used. Probability density functions are constructed to model secondary vertices from known processes. No statistically significant excess is observed above the background. Limits on the production cross section in a hidden valley benchmark phenomenology are set for various Higgs boson masses as well as metastable particle masses and lifetimes.

  19. Search for Anomalous Kinematics of Top Dilepton Events in Proton - Anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, Andrew Gennadievich [Univ. of Rochester, NY (United States)

    2004-01-01

    The author presents a search for anomalous kinematics of t$\\bar{t}$ dilepton events in p$\\bar{p}$ collisions at √s = 1.96 TeV using 193 pb-1 of data collected with the CDF II detector. They developed a new a priori technique designed to silate the subset in a data sample revealing the largest deviation from Standard Model expectations and to quantify the significance of this departure. In the four-variable space considered, no particular subset shows a significant discrepancy and they find that the probability to obtain a data sample less consistent with the Standard Model than what is observed is 1.0-4.5%.

  20. Search for Scalar Top Quark Production in $p\\bar{p}$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U. /Fermilab; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Arisawa, T.; /Waseda U.; Artikov, A.; /Dubna, JINR /Texas A-M

    2012-03-01

    We report on a search for the supersymmetric partner of the top quark (scalar top) decaying into a charm quark and a neutralino in p{bar p} collisions at {radical}s = 1.96 TeV. The data sample, collected by the CDF II detector at the Fermilab Tevatron, corresponds to an integrated luminosity of 2.6 fb{sup -1}. Candidate events are selected by requiring two or more jets and a large imbalance in the transverse momentum. To enhance the analysis sensitivity, at least one of the jets is required to be identified as originating from a charm quark using an algorithm specifically designed for this analysis. The selected events are in good agreement with standard model predictions. In the case of large mass splitting between the scalar top quark and the neutralino we exclude a scalar top quark mass below 180 GeV/c{sup 2} at 95% confidence level.

  1. Search for squark production in events with jets, hadronically decaying tau leptons and missing transverse energy at {radical}(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Abbott, B. [University of Oklahoma, Norman, OK 73019 (United States); Abolins, M. [Michigan State University, East Lansing, MI 48824 (United States); Acharya, B.S. [Tata Institute of Fundamental Research, Mumbai (India); Adams, M. [University of Illinois at Chicago, Chicago, IL 60607 (United States); Adams, T. [Florida State University, Tallahassee, FL 32306 (United States); Aguilo, E. [University of Alberta, Edmonton, Alberta, and Simon Fraser University, Burnaby, British Columbia, and York University, Toronto, Ontario, and McGill University, Montreal, Quebec (Canada); Ahsan, M. [Kansas State University, Manhattan, KS 66506 (United States); Alexeev, G.D. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Alkhazov, G. [Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation); Alton, A. [University of Michigan, Ann Arbor, MI 48109 (United States); Alverson, G. [Northeastern University, Boston, MA 02115 (United States); Alves, G.A. [LAFEX, Centro Brasileiro de Pesquisas Fisicas, Rio de Janeiro (Brazil); Ancu, L.S. [Radboud University Nijmegen/NIKHEF, Nijmegen (Netherlands); Andeen, T.; Anzelc, M.S. [Northwestern University, Evanston, IL 60208 (United States); Aoki, M. [Fermi National Accelerator Laboratory, Batavia, IL 60510 (United States); Arnoud, Y. [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble (France); Arov, M. [Louisiana Tech University, Ruston, LA 71272 (United States); Arthaud, M. [CEA, Irfu, SPP, Saclay (France)] (and others)

    2009-09-14

    A search for supersymmetric partners of quarks is performed in the topology of multijet events accompanied by at least one tau lepton decaying hadronically and large missing transverse energy. Approximately 1 fb{sup -1} of pp-bar collision data from the Fermilab Tevatron Collider at a center of mass energy of 1.96 TeV recorded by the DO detector is analyzed. Results are combined with the previously published DO inclusive search for squarks and gluinos. No evidence of physics beyond the Standard Model is found and lower limits on the squark mass up to 410 GeV are derived in the framework of minimal supergravity with tan{beta}=15, A{sub 0}=-2m{sub 0} and {mu}<0, in the region where decays to tau leptons dominate. Gaugino masses m{sub 1/2} are excluded up to 172 GeV.

  2. Structural and preliminary molecular dynamics studies of the Rhodobacter sphaeroides reaction center and its mutant form L(M196)H + H(M202)L

    Science.gov (United States)

    Klyashtorny, V. G.; Fufina, T. Yu.; Vasilieva, L. G.; Shuvalov, V. A.; Gabdulkhakov, A. G.

    2014-07-01

    Pigment-protein interactions are responsible for the high efficiency of the light-energy transfer and conversion in photosynthesis. The reaction center (RC) from the purple bacterium Rhodobacter sphaeroides is the most convenient model for studying the mechanisms of primary processes of photosynthesis. Site-directed mutagenesis can be used to study the effect of the protein environment of electron-transfer cofactors on the optical properties, stability, pigment composition, and functional activity of RC. The preliminary analysis of RC was performed by computer simulation of the amino acid substitutions L(M196)H + H(M202)L at the pigment-protein interface and by estimating the stability of the threedimensional structure of the mutant RC by the molecular dynamics method. The doubly mutated reaction center was overexpressed, purified, and crystallized. The three-dimensional structure of this mutant was determined by X-ray crystallography and compared with the molecular dynamics model.

  3. Determination of the strong coupling constant from the inclusive jet cross section in ppbar collisions at sqrt(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, M.; /Kansas State U.; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan U. /Northeastern U.

    2009-11-01

    We determine the strong coupling constant {alpha}{sub s} and its energy dependence from the p{sub T} dependence of the inclusive jet cross section in p{bar p} collisions at {radical}s = 1.96 TeV. The strong coupling constant is determined over the transverse momentum range 50 < p{sub T} < 145 GeV. Using perturbative QCD calculations to order {Omicron}({alpha}{sub s}{sup 3}) combined with {Omicron}({alpha}{sub s}{sup 4}) contributions from threshold corrections, we obtain {alpha}{sub s}(M{sub Z}) = 0.1173{sub -0.0049}{sup +0.0041}. This is the most precise result obtained at a hadron-hadron collider.

  4. Search for Gluino-Mediated Sbottom Production in p anti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-03-01

    We report on a search for the supersymmetric partner of the bottom quark produced from gluino decays in data from 2.5 fb{sup -1} of integrated luminosity collected by the Collider Detector at Fermilab at {radical}s = 1.96 TeV. Candidate events are selected requiring two or more jets and large missing transverse energy. At least two of the jets are required to be tagged as originating from a b quark to enhance the sensitivity. The results are in good agreement with the prediction of the standard model processes, giving no evidence for gluino decay to sbottom quarks. This result constrains the gluino-pair-production cross section to be less than 40 fb at 95% credibility level for a gluino mass of 350 GeV/c{sup 2}.

  5. Top quark pair production cross section measurements in p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera, S.; /Valencia U., IFIC

    2006-07-01

    The CDF and D0 experiments have measured the t{bar t} production cross section in p{bar p} collisions at {radical}s = 1.96 TeV from different final states using a wide variety of techniques. CDF has combined 6 measurements using data samples with integrated luminosities up to 760 pb{sup -1}: {sigma}{sub t{bar t}} = 7.3 {+-} 0.5(stat) {+-} 0.6(syst) {+-} 0.4(lum) pb in good agreement with the theoretical calculations: 6.7 {+-} 0.8 pb for a top mass of 175 GeV/c{sup 2}. The experimental precision of the current CDF combined result is comparable for the first time to the accuracy of the QCD NLO theory: {approx} 12%.

  6. First observation of dijet events with an antiproton tag at √s = 1.96 TeV using the D0 Forward Proton Detector

    Energy Technology Data Exchange (ETDEWEB)

    Strang, Michael Allen [Univ. of Texas, Arlington, TX (United States)

    2005-08-01

    The Forward Proton Detector (FPD) is a new sub-system of the D0 detector, a 5000 ton particle physics detector located at the Fermilab Tevatron proton-antiproton collider. The FPD was implemented for the Tevatron Run II and gives access to a wide range of diffractive scattering processes, where one or both of the beam particles remain intact. The analysis described in this thesis makes use of the dipole spectrometer of the FPD to tag outgoing antiprotons in events that have a dijet signature in the central D0 calorimeter. Properties of jets with a diffractive tag signature are compared to jets without such a signature yielding the first observation of tagged diffractive dijets at a 1.96 TeV center-of-mass energy.

  7. Search for the Higgs boson in H --> WW(*) decays in pp collisions at square root of 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Arnoud, Y; Arov, M; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Balm, P W; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begalli, M; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Cho, D K; Choi, S; Choudhary, B; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cothenet, A; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; da Motta, H; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Golling, T; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, H; Kim, T J; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kulik, Y; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'dell, V; O'neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero Y Garzón, G J; Padley, P; Parashar, N; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Pétroff, P; Petteni, M; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Titov, M; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; White, V; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xu, Q; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G

    2006-01-13

    We present a search for the standard model Higgs boson in H --> WW(*) decays with e+e-, e+/-mu-/+, and mu+mu- final states in pp collisions at a center-of-mass energy of square root of s = 1.96 TeV. The data, collected from April 2002 to June 2004 with the D0 detector, correspond to an integrated luminosity of 300-325 pb(-1), depending on the final state. The number of events observed is consistent with the expectation from backgrounds. Limits from the combination of all three channels on the Higgs boson production cross section times branching ratio sigma x BR(H --> WW(*) are presented.

  8. Measurement of the WW production cross section in pp collisions at square root[s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevalier, L; Cho, D K; Choi, S; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Coss, J; Cothenet, A; Cousinou, M-C; Crépé-Renaudin, S; Cristetiu, M; Cummings, M A C; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveria Martins, C; Dean, S; Déliot, F; Delsart, P A; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Eltzroth, J T; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Freeman, W; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Jöstlein, H; Juste, A; Kado, M M; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, K H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kurca, T; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, S W; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Merkin, M; Merritt, K W; Meyer, A; Miettinen, H; Mihalcea, D; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Montgomery, H E; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero y Garzón, G J; Padley, P; Parashar, N; Park, J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Peters, O; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Przybycien, M B; Qian, J; Quadt, A; Quinn, B; Rani, K J; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schukin, A A; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shephard, W D; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Song, Y; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Steinbrück, G; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tentindo-Repond, S; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Warsinsky, M; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Whiteson, D; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G; Zylberstejn, A

    2005-04-22

    We present a measurement of the W boson pair-production cross section in pp collisions at a center-of-mass energy of sqrt[s]=1.96 TeV. The data, collected with the Run II D0 detector at Fermilab, correspond to an integrated luminosity of 224-252 pb(-1) depending on the final state (ee, emu, or mumu). We observe 25 candidates with a background expectation of 8.1+/-0.6(stat)+/-0.6(syst)+/-0.5(lum) events. The probability for an upward fluctuation of the background to produce the observed signal is 2.3x10(-7), equivalent to 5.2 standard deviations. The measurement yields a cross section of 13.8(+4.3)(-3.8)(stat)+1.2-0.9(syst)+/-0.9(lum) pb, in agreement with predictions from the standard model.

  9. Search for neutral, long-lived particles decaying into two muons in pp[over] collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakraborty, D; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; Cruz-Burelo, E De La; Martins, C De Oliveira; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lammers, S; Landsberg, G; Lazoflores, J; Bihan, A-C Le; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'dell, V; O'neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Y Garzón, G J Otero; Owen, M; Padley, P; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Peters, K; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; da Silva, W L Prado; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Kooten, R Van; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Vlimant, J-R; Toerne, E Von; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-10-20

    We present a search for a neutral particle, pair produced in pp[over] collisions at sqrt[s]=1.96 TeV, which decays into two muons and lives long enough to travel at least 5 cm before decaying. The analysis uses approximately 380 pb(-1) of data recorded with the D0 detector. The background is estimated to be about one event. No candidates are observed, and limits are set on the pair-production cross section times branching fraction into dimuons + X for such particles. For a mass of 10 GeV and lifetime of 4x10(-11) s, we exclude values greater than 0.14 pb (95% C.L.). These results are used to limit the interpretation of NuTeV's excess of dimuon events.

  10. Study of Zgamma events and limits on anomalous ZZgamma and Zgammagamma couplings in pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Cho, D K; Choi, S; Choudhary, B; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cothenet, A; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cristetiu, M; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Mendes, A; Merkin, M; Merritt, K W; Meyer, A; Michaut, M; Miettinen, H; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero Y Garzón, G J; Padley, P; Parashar, N; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G

    2005-07-29

    We present a measurement of the Zgamma production cross section and limits on anomalous ZZgamma and Zgammagamma couplings for form-factor scales of lambda = 750 and 1000 GeV. The measurement is based on 138 (152) candidates in the eegamma (mumugamma) final state using 320(290) pb(-1) of pp(-1) collisions at square root of s = 1.96 TeV. The 95% C.L. limits on real and imaginary parts of individual anomalous couplings are /h(10,30)Z/ < 0.23, /h(20,40)Z/ < 0.020, /h(10,30)gamma/ < 0.23, and /h(20,40)gamma/ < 0.019 for lambda = 1000 GeV.

  11. Search for pair production of scalar bottom quarks in pp collisions at square root of s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakraborty, D; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lammers, S; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Y Garzón, G J Otero; Owen, M; Padley, P; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Peters, K; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Vlimant, J-R; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-10-27

    A search for direct production of scalar bottom quarks (b) is performed with 310 pb(-1) of data collected by the D0 experiment in pp collisions at square root s = 1.96 TeV at the Fermilab Tevatron Collider. The topology analyzed consists of two b jets and an imbalance in transverse momentum due to undetected neutralinos (chi(1)0), with chi(1)0 assumed to be the lightest supersymmetric particle. We find the data consistent with standard model expectations, and set a 95% C.L. exclusion domain in the (m(b), m(chi(1)0)) mass plane, improving significantly upon the results from run I of the Tevatron.

  12. Search for neutral Higgs bosons decaying to tau pairs in pp[over ] collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Otero y Garzón, G J; Owen, M; Padley, P; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Peters, K; Pétroff, P; Petteni, M; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Kooten, R Van; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Vlimant, J-R; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-09-22

    A search for the production of neutral Higgs bosons Phi decaying into tau(+)tau(-) final states in pp[over ] collisions at a center-of-mass energy of 1.96 TeV is presented. The data, corresponding to an integrated luminosity of approximately 325 pb(-1), were collected by the D0 experiment at the Fermilab Tevatron Collider. Since no excess compared to the expectation from standard model processes is found, limits on the production cross section times branching ratio are set. The results are combined with those obtained from the D0 search for Phib(b[over ])-->bb[over ]b(b[over ]) and are interpreted in the minimal supersymmetric standard model.

  13. Search for V+A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst. Phys.

    2006-08-01

    The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} wb {yields} {ell}vb (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

  14. Search for V + A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; Antos, J.; Aoki, M.; Apollinari, G.; Arguin, J.-F.; Arisawa, T.; Artikov, A.; Ashmanskas, W.; Attal, A.; Azfar, F.; Azzi-Bacchetta, P.

    2006-09-01

    The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} Wb {yields} {ell}{nu}b (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

  15. Measurement of the Three-jet Mass Cross Section in $p\\bar{p}$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Hubacek, Zdenek [Czech Technical Univ., Prague (Czech Republic)

    2010-06-01

    This thesis describes the measurement of the inclusive three-jet cross section in proton-antiproton collisions at √s = 1.96 TeV measured at the D0 experiment at the Fermilab Tevatron Collider in the Fermi National Accelerator Laboratory, Batavia, Illinois, USA. The cross section as a function of three-jet invariant mass is provided in three regions of the third jet transverse momentum and three regions of jet rapidities. It utilizes a data sample collected in the so called Run IIa data taking period (2002-2006) corresponding to the integrated luminosity of about 0.7 fb-1. The results are used to test the next-to-leading order predictions of Quantum chromodynamics computed using the latest parton distribution functions.

  16. Search for associated production of z and Higgs bosons in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    BackusMayes, John Alexander [Univ. of Washington, Seattle, WA (United States)

    2010-01-01

    We present a search for associated production of Z and Higgs bosons in 4.2 fb-1 of $\\bar{p}$p collisions at √s = 1.96 TeV, produced in RunII of the Tevatron and recorded by the D0 detector. The search is performed in events containing at least two muons and at least two jets. The ZH signal is distinguished from the expected backgrounds by means of multivariate classifiers known as random forests. Binned random forest output distributions are used in comparing the data to background-only and signal+background hypotheses. No excess is observed in the data, so we set upper limits on ZH production with a 95% confidence level.

  17. Measurement of the $WZ$ Cross Section and Triple Gauge Couplings in $p \\bar p$ Collisions at $\\sqrt{s} = 1.96$ TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calamba, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chung, W.H.; Chung, Y.S.; Ciocci, M.A.; Clark, A.; Clarke, C.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Dell'Orso, M.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, S.; Ershaidat, N.; Eusebi, R.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kim, Y.J.; Kimura, N.; Kirby, M.; Klimenko, S.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Mastrandrea, P.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagan Griso, S.; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Sorin, V.; Song, H.; Squillacioti, P.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vanguri, R.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2012-01-01

    This Letter describes the current most precise measurement of the $WZ$ production cross section as well as limits on anomalous $WWZ$ couplings at a center-of-mass energy of 1.96 TeV in proton-antiproton collisions at the Collider Detector at Fermilab (CDF). The $WZ$ candidates are reconstructed from decays containing three charged leptons and missing energy from a neutrino, where the charged leptons are either electrons or muons. Using data collected by the CDF II detector (7.1 fb$^{-1}$ of integrated luminosity), 64 candidate events are observed with the expected background contributing $8 \\pm 1$ events. The measured total cross section $\\sigma (p \\bar p \\to WZ) = 3.93_{-0.53}^{+0.60}(\\text{stat})_{-0.46}^{+0.59}(\\text{syst}) $ pb is in good agreement with the standard model prediction of $3.50\\pm 0.21$. The same sample is used to set limits on anomalous $WWZ$ couplings.

  18. Signature-based search for delayed photons in exclusive photon plus missing transverse energy events from pp¯ collisions with s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M. A.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; De Barbaro, P.; Demortier, L.; Deninno, M.; d'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. B.; Kim, S. H.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucà, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; Stancari, M.; Denis, R. St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Warburton, A.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-08-01

    We present the first signature-based search for delayed photons using an exclusive photon plus missing transverse energy final state. Events are reconstructed in a data sample from the CDF II detector corresponding to 6.3fb-1 of integrated luminosity from s=1.96TeV proton-antiproton collisions. Candidate events are selected if they contain a photon with an arrival time in the detector larger than expected from a promptly produced photon. The mean number of events from standard model sources predicted by the data-driven background model based on the photon timing distribution is 286±24. A total of 322 events are observed. A p value of 12% is obtained, showing consistency of the data with standard model predictions.

  19. Search for Pair Production of Strongly Interacting Particles Decaying to Pairs of Jets in pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Albin, E.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M. A.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; De Barbaro, P.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. B.; Kim, S. H.; Kim, Y. K.; Kim, Y. J.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Sorin, V.; Song, H.; Stancari, M.; Denis, R. St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Warburton, A.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-07-01

    We present a search for the pair production of a narrow nonstandard-model strongly interacting particle that decays to a pair of quarks or gluons, leading to a final state with four hadronic jets. We consider both nonresonant production via an intermediate gluon as well as resonant production via a distinct nonstandard-model intermediate strongly interacting particle. We use data collected by the CDF experiment in proton-antiproton collisions at s=1.96TeV corresponding to an integrated luminosity of 6.6fb-1. We find the data to be consistent with nonresonant production. We report limits on σ(pp¯→jjjj) as a function of the masses of the hypothetical intermediate particles. Upper limits on the production cross sections for nonstandard-model particles in several resonant and nonresonant processes are also derived.

  20. Search for Higgs bosons decaying to tau(+)tau(-) pairs in p(p)over-bar collisions at root s=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abazov, V. M.; Abbott, B.; Achary, B. S.; Adams, M.; Adams, T.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Aoki, M.; Arov, M.; Askew, A.; Asman, B.; Atramentov, O.; Avila, C.; BackusMayes, J.; Badaud, F.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Barberis, E.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bazterra, V.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besancon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Blazey, G.; Blessing, S.; Bloom, K.; Boehnlein, A.; Boline, D.; Boos, E. E.; Borissov, G.; Bose, T.; Brandt, A.; Brandt, O.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Brown, J.; Bu, X. B.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burnett, T. H.; Buszello, C. P.; Calpas, B.; Camacho-Perez, E.; Carrasco-Lizarraga, M. A.; Casey, B. C. K.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chen, G.; Chevalier-Thery, S.; Cho, D. K.; Cho, S. W.; Choi, S.; Choudhary, B.; Cihangir, S.; Claes, D.; Clutter, J.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M. -C.; Croc, A.; Cutts, D.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; De La Cruz-Burelo, E.; Deliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Deterre, C.; DeVaughan, K.; Diehl, H. T.; Diesburg, M.; Ding, P. F.; Dominguez, A.; Dorland, T.; Dubey, A.; Dudko, L. V.; Duggan, D.; Duperrin, A.; Dutt, S.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Facini, G.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fortner, M.; Fox, H.; Fuess, S.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geng, W.; Gerbaudo, D.; Gerber, C. E.; Gershtein, Y.; Ginther, G.; Golovanov, G.; Goussiou, A.; Grannis, P. D.; Greder, S.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J. -F.; Grohsjea, A.; Gruenendahl, S.; Gruenewald, M. W.; Guillemin, T.; Guo, F.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hagopia, S.; Haley, J.; Hang, L.; Harder, K.; Harein, A.; Hauptman, J. M.; Hays, J.; Head, T.; Hebbeker, T.; Hedin, D.; Hegab, H.; Heinson, A. P.; Heintz, U.; Hensel, C.; Heredia-De La Cruz, I.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hoangau, T.; Hobbs, J. D.; Hoeneisen, B.; Hohlfeld, M.; Hubacek, Z.; Huske, N.; Hynek, V.; Lashvili, I.; Ilchenko, Y.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffre, M.; Jamin, D.; Jayasinghe, A.; Jesik, R.; Johns, K.; Johnson, M.; Johnston, D.; Jonckheere, A.; Jonsson, P.; Joshi, J.; Jung, A. W.; Juste, A.; Kaadze, K.; Kajfasz, E.; Karmanov, D.; Kasper, P. A.; Katsanos, I. I.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. N.; Kirby, M. H.; Kohli, J. M.; Kozelov, A. V.; Kraus, J.; Kulikov, S.; Kumar, A.; Kupco, A.; Kurca, T.; Kuzmin, V. A.; Kvita, J.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, H. S.; Lee, S. W.; Lee, W. M.; Lellouch, J.; Li, L.; Li, Q. Z.; Lietti, S. M.; Lim, J. K.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobodenko, A.; Lokajicek, M.; de Sa, R. Lopes; Lubatti, H. J.; Luna-Garcia, R.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madar, R.; Magana-Villalba, R.; Malik, S.; Malyshev, V. L.; Maravin, Y.; Martinez-Ortega, J.; McCarthy, R.; McGivern, C. L.; Meijer, M. M.; Melnitchouk, A.; Menezes, D.; Mercadante, P. G.; Merkin, M.; Meyer, A.; Meyer, J.; et al.

    2012-02-01

    We present a search for the production of neutral Higgs bosons decaying into {tau}{sup +}{tau}{sup -} pairs in p{bar p} collisions at a center-of-mass energy of 1.96 TeV. The data, corresponding to an integrated luminosity of 5.4 fb{sup -1}, were collected by the D0 experiment at the Fermilab Tevatron Collider. We set upper limits at the 95% C.L. on the product of production cross section and branching ratio for a scalar resonance decaying into {tau}{sup +}{tau}{sup -} pairs, and we interpret these limits as limits on the production of Higgs bosons in the minimal supersymmetric standard model (MSSM) and as constraints in the MSSM parameter space.

  1. Search for a Heavy Top-Like Quark in $p\\bar{p}$ Collisions at $\\sqrt{s} = 1.96$ TeV at the Tevatron

    Energy Technology Data Exchange (ETDEWEB)

    Cox, David J. [Univ. of California, Davis, CA (United States)

    2012-01-01

    We present the results of a search for pair production of a heavy top-like (t') quark decaying to Wq final states using data corresponding to an integrated luminosity of 5.6 fb-1 collected by the CDF II detector in pp collisions at $\\sqrt{s} = 1.96$ TeV center of mass energy. A search for t' → Wb in events containing a lepton and four or more jets is conducted. By performing a fit to the two-dimensional distribution of total transverse energy versus reconstructed t' quark mass, we set upper limits on the t't' pair production cross section and exclude a standard model fourth-generation t' quark decaying to Wb with mass below 358 GeV/c2 at 95% CL.

  2. Measurement of the differential cross section d\\sigma/dt in elastic $p\\bar{p}$ scattering at sqrt(s)=1.96 TeV

    CERN Document Server

    Abazov, V M; Acharya, B S; Adams, M; Adams, T; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Aoki, M; Askew, A; Atkins, S; Augsten, K; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Barberis, E; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bazterra, V; Bean, A; Begalli, M; Bellantoni, L; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatia, S; Bhatnagar, V; Blazey, G; Blessing, S; Bloom, K; Boehnlein, A; Boline, D; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brandt, O; Brock, R; Brooijmans, G; Bross, A; Brown, D; Brown, J; Bu, X B; Buehler, M; Buescher, V; Bunichev, V; Burdin, S; Buszello, C P; Camacho-Pérez, E; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Caughron, S; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapon, E; Chen, G; Chevalier-Théry, S; Cho, D K; Cho, S W; Choi, S; Choudhary, B; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M -C; Croc, A; Cutts, D; Das, A; Davies, G; de Jong, S J; De La Cruz-Burelo, E; Martins, C De Oliveira; Déliot, F; Demina, R; Denisov, D; Denisov, S P; Desai, S; Deterre, C; DeVaughan, K; Diehl, H T; Diesburg, M; Ding, P F; Dominguez, A; Dubey, A; Dudko, L V; Duggan, D; Duperrin, A; Dutt, S; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Evans, H; Evdokimov, A; Evdokimov, V N; Facini, G; Feng, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fuess, S; Garcia-Bellido, A; García-González, J A; García-Guerra, G A; Gavrilov, V; Gay, P; Geng, W; Gerbaudo, D; Gerber, C E; Gershtein, Y; Ginther, G; Golovanov, G; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J -F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guillemin, T; Gutierrez, G; Gutierrez, P; Haas, A; Hagopian, S; Haley, J; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Head, T; Hebbeker, T; Hedin, D; Hegab, H; Heinson, A P; Heintz, U; Hensel, C; La Cruz, I Heredia-De; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hoang, T; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Howley, I; Hubacek, Z; Hynek, V; Iashvili, I; Ilchenko, Y; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jayasinghe, A; Jesik, R; Johns, K; Johnson, E; Johnson, M; Jonckheere, A; Jonsson, P; Joshi, J; Jung, A W; Juste, A; Kaadze, K; Kajfasz, E; Karmanov, D; Kasper, P A; Katsanos, I; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y N; Kiselevich, I; Kohli, J M; Kozelov, A V; Kraus, J; Kulikov, S; Kumar, A; Kupco, A; Kurča, T; Kuzmin, V A; Lammers, S; Landsberg, G; Lebrun, P; Lee, H S; Lee, S W; Lee, W M; Lellouch, J; Li, H; Li, L; Li, Q Z; Lim, J K; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, H; Liu, Y; Lobodenko, A; Lokajicek, M; de Sa, R Lopes; Lubatti, H J; Luna-Garcia, R; Lyon, A L; Maciel, A K A; Madar, R; Magaña-Villalba, R; Malik, S; Malyshev, V L; Maravin, Y; Martínez-Ortega, J; McCarthy, R; McGivern, C L; Meijer, M M; Melnitchouk, A; Mendoza, L; Menezes, D; Mercadante, P G; Merkin, M; Meyer, A; Meyer, J; Miconi, F; Molina, J; Mondal, N K; da Motta, H; Mulhearn, M; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Nayyar, R; Neal, H A; Negret, J P; Neustroev, P; Novaes, S F; Nunnemann, T; Obrant, G; Oguri, V; Orduna, J; Osman, N; Osta, J; Padilla, M; Pal, A; Parashar, N; Parihar, V; Park, S K; Partridge, R; Parua, N; Patwa, A; Penning, B; Perfilov, M; Peters, Y; Petridis, K; Petrillo, G; Pétroff, P; Pleier, M -A; Podesta-Lerma, P L M; Podstavkov, V M; Pol, M -E; Popov, A V; da Silva, W L Prado; Prewitt, M; Price, D; Prokopenko, N; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Ranjan, K; Ratoff, P N; Razumov, I; Renkel, P; Ripp-Baudot, I; Rizatdinova, F; Rominsky, M; Ross, A; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Salcido, P; Sánchez-Hernández, A; Sanders, M P; Sanghi, B; Santoro, A; Santos, A S; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Scheglov, Y; Schellman, H; Schlobohm, S; Schwanenberger, C; Schwienhorst, R; Sekaric, J; Severini, H; Shabalina, E; Shary, V; Shaw, S; Shchukin, A A; Shivpuri, R K; Simak, V; Skubic, P; Slattery, P; Smirnov, D; Smith, K J; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Soustruznik, K; Stark, J; Stoyanova, D A; Strang, M A; Strauss, M; Stutte, L; Suter, L; Svoisky, P; Takahashi, M; Titov, M; Tokmenin, V V; Tsai, Y -T; Tschann-Grimm, K; Tsybychev, D; Tuchming, B; Tully, C; Uvarov, L; Uvarov, S; Uzunyan, S; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Verdier, P; Verkheev, A Y; Vertogradov, L S; Verzocchi, M; Vesterinen, M; Vilanova, D; Vokac, P; Wahl, H D; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weichert, J; Welty-Rieger, L; White, A; Wicke, D; Williams, M R J; Wilson, G W; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yamada, R; Yang, W -C; Yasuda, T; Yatsunenko, Y A; Ye, W; Ye, Z; Yin, H; Yip, K; Youn, S W; Zennamo, J; Zhao, T; Zhao, T G; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zivkovic, L

    2012-01-01

    We present a measurement of the elastic differential cross section $d\\sigma(p\\bar{p}\\rightarrow p\\bar{p})/dt$ as a function of the four-momentum-transfer squared t. The data sample corresponds to an integrated luminosity of $\\approx 31 nb^{-1}$ collected with the D0 detector using dedicated Tevatron $p\\bar{p} $ Collider operating conditions at sqrt(s) = 1.96 TeV and covers the range $0.26 <|t|< 1.2 GeV^2$. For $|t|<0.6 GeV^2$, d\\sigma/dt is described by an exponential function of the form $Ae^{-b|t|}$ with a slope parameter $ b = 16.86 \\pm 0.10(stat) \\pm 0.20(syst) GeV^{-2}$. A change in slope is observed at $|t| \\approx 0.6 GeV^2$, followed by a more gradual |t| dependence with increasing values of |t|.

  3. Generation of an isogenic, gene-corrected control cell line of the spinocerebellar ataxia type 2 patient-derived iPSC line H196.

    Science.gov (United States)

    Marthaler, Adele G; Schmid, Benjamin; Tubsuwan, Alisa; Poulsen, Ulla B; Engelbrecht, Alexander F; Mau-Holzmann, Ulrike A; Hyttel, Poul; Nielsen, Jørgen E; Nielsen, Troels T; Holst, Bjørn

    2016-01-01

    Spinocerebellar ataxia type 2 (SCA2) is a neurodegenerative disease primarily affecting the cerebellum. Very little is known about the molecular mechanisms underlying the disease and, to date, no cure or treatment is available. We have successfully generated bona fide induced pluripotent stem cell (iPSC) lines of SCA2 patients in order to study a disease-specific phenotype. Here, we demonstrate the gene correction of the iPSC line H196 clone 7 where we have exchanged the expanded CAG repeat of the ATXN2 gene with the normal length found in healthy alleles. This gene corrected cell line will provide the ideal control to model SCA2 by iPSC technology. Copyright © 2015. Published by Elsevier B.V.

  4. Search for chargino-neutralino production in p anti-p collisions at 1.96-TeV with high-p(T) leptons

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Albrow, M.G.; /Fermilab; Alvarez Gonzalez, B.; /Cantabria U., Santander; Amerio, S.; /Padua U.; Amidei, D.; /Michigan U.; Anastassov, A.; /Rutgers U., Piscataway; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Aoki, M.; /Illinois U., Urbana /Fermilab

    2007-11-01

    The authors present a search for the associated production of charginos and neutralinos in p{bar p} collisions at {radical}s = 1.96 TeV. The data were collected at the Collider Detector at Fermilab (CDF II) and correspond to integrated luminosities between 0.7 and 1.0 fb{sup -1}. They look for final states with one high-p{sub T} electron or muon, and two additional leptons. The results are consistent with the standard model expectations, and they set limits on the cross section as a function of the chargino mass in three different supersymmetric scenarios. For a specific MSSM scenario with no slepton mixing they set a 95% C.L. limit at 151 GeV/c{sup 2}.

  5. Search for a neutral Higgs boson decaying to a W boson pair in p antip collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Illinois U.,

    2006-05-01

    The authors present the results of a search for standard model Higgs boson production with decay to WW*, identified through the leptonic final states e{sup +}e{sup -} {bar {nu}}{nu}, e{sup {+-}}{mu}{sup {-+}} {bar {nu}}{nu} and {mu}{sup +} {mu}{sup -} {bar {nu}}{nu}. This search uses 360 pb{sup -1} of data collected from p{bar p} collisions at {radical}s = 1.96 TeV by the upgraded Collider Detector at Fermilab (CDF II). They observe no signal excess and set 95% confidence level upper limits on the production cross section times branching ratio for the Higgs boson to WW* or any new scalar particle with similar decay products. These upper limits range from 5.5 to 3.2 pb for Higgs boson masses between 120 and 200 GeV/c{sup 2}.

  6. Measurement of the $WZ$ Cross Section and Triple Gauge Couplings in $p \\bar p$ Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U. /Fermilab; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Arisawa, T.; /Waseda U.; Artikov, A.; /Dubna, JINR /Texas A-M

    2012-02-01

    This Letter describes the current most precise measurement of the WZ production cross section as well as limits on anomalous WWZ couplings at a center-of-mass energy of 1.96 TeV in proton-antiproton collisions. The WZ candidates are reconstructed from decays containing three charged leptons and missing energy from a neutrino, where the charged leptons are either electrons or muons. Using data collected by the CDF II detector (7.1 fb{sup -1} of integrated luminosity), 64 candidate events are observed with the expected background contributing 8 {+-} 1 events. The measured total cross section {sigma}(p{bar p} {yields} WZ) = 3.93{sub -0.53}{sup +0.60}(stat){sub -0.46}{sup +0.59}(syst) pb is in good agreement with the standard model prediction of 3.50 {+-} 0.21. The same sample is used to set limits on anomalous WWZ couplings.

  7. Search for Scalar Top Quark Production in p-pbar Collisions at sqrt(s)=1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calamba, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chung, W.H.; Chung, Y.S.; Ciocci, M.A.; Clark, A.; Clarke, C.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Dell'Orso, M.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, S.; Ershaidat, N.; Eusebi, R.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kim, Y.J.; Kimura, N.; Kirby, M.; Klimenko, S.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Mastrandrea, P.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagan Griso, S.; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Sorin, V.; Song, H.; Squillacioti, P.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2012-01-01

    We report on a search for the supersymmetric partner of the top quark (scalar top) decaying into a charm quark and a neutralino in p-pbar collisions at sqrt(s)=1.96 TeV. The data sample, collected by the CDFII detector at the Fermilab Tevatron, corresponds to an integrated luminosity of 2.6 fb-1. Candidate events are selected by requiring two or more jets and a large imbalance in the transverse momentum. To enhance the analysis sensitivity, at least one of the jets is required to be identified as originating from a charm quark using an algorithm specifically designed for this analysis. The selected events are in good agreement with standard model predictions. In the case of large mass splitting between the scalar top quark and the neutralino we exclude a scalar top quark mass below 180 GeV at 95% confidence level.

  8. Measurement of spin correlation between top and antitop quarks produced in $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96$ TeV

    CERN Document Server

    Abazov, Victor Mukhamedovich; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Agnew, James P; Alexeev, Guennadi D; Alkhazov, Georgiy D; Alton, Andrew K; Askew, Andrew Warren; Atkins, Scott; Augsten, Kamil; Aushev, Volodymyr; Aushev, Yegor; Avila, Carlos A; Badaud, Frederique; Bagby, Linda F; Baldin, Boris; Bandurin, Dmitry V; Banerjee, Sunanda; Barberis, Emanuela; Baringer, Philip S; Bartlett, JFrederick; Bassler, Ursula Rita; Bazterra, Victor; Bean, Alice L; Begalli, Marcia; Bellantoni, Leo; Beri, Suman B; Bernardi, Gregorio; Bernhard, Ralf Patrick; Bertram, Iain A; Besancon, Marc; Beuselinck, Raymond; Bhat, Pushpalatha C; Bhatia, Sudeep; Bhatnagar, Vipin; Blazey, Gerald Charles; Blessing, Susan K; Bloom, Kenneth A; Boehnlein, Amber S; Boline, Daniel Dooley; Boos, Edward E; Borissov, Guennadi; Borysova, Maryna; Brandt, Andrew; Brandt, Oleg; Brock, Raymond L; Bross, Alan D; Brown, Duncan Paul; Bu, Xue-Bing; Buehler, Marc; Buescher, Volker; Bunichev, Viacheslav Yevgenyevich; Burdin, Sergey; Buszello, Claus Peter; Camacho-Perez, Enrique; Casey, Brendan Cameron Kieran; Castilla-Valdez, Heriberto; Caughron, Seth Aaron; Chakrabarti, Subhendu; Chan, Kwok Ming Leo; Chandra, Avdhesh; Chapon, Emilien; Chen, Guo; Cho, Sung-Woong; Choi, Suyong; Choudhary, Brajesh C; Cihangir, Selcuk; Claes, Daniel R; Clutter, Justace Randall; Cooke, Michael P; Cooper, William Edward; Corcoran, Marjorie D; Couderc, Fabrice; Cousinou, Marie-Claude; Cuth, Jakub; Cutts, David; Das, Amitabha; Davies, Gavin John; de Jong, Sijbrand Jan; De La Cruz-Burelo, Eduard; Deliot, Frederic; Demina, Regina; Denisov, Dmitri S; Denisov, Sergei P; Desai, Satish Vijay; Deterre, Cecile; DeVaughan, Kayle Otis; Diehl, HThomas; Diesburg, Michael; Ding, Pengfei; Dominguez, DAaron M; Dubey, Abhinav Kumar; Dudko, Lev V; Duperrin, Arnaud; Dutt, Suneel; Eads, Michael T; Edmunds, Daniel L; Ellison, John A; Elvira, VDaniel; Enari, Yuji; Evans, Harold G; Evdokimov, Anatoly V; Evdokimov, Valeri N; Faure, Alexandre; Feng, Lei; Ferbel, Thomas; Fiedler, Frank; Filthaut, Frank; Fisher, Wade Cameron; Fisk, HEugene; Fortner, Michael R; Fox, Harald; Franc, Jiri; Fuess, Stuart C; Garbincius, Peter H; Garcia-Bellido, Aran; Garcia-Gonzalez, Jose Andres; Gavrilov, Vladimir B; Geng, Weigang; Gerber, Cecilia Elena; Gershtein, Yuri S; Ginther, George E; Gogota, Olga; Golovanov, Georgy Anatolievich; Grannis, Paul D; Greder, Sebastien; Greenlee, Herbert B; Grenier, Gerald Jean; Gris, Phillipe Luc; Grivaz, Jean-Francois; Grohsjean, Alexander; Gruenendahl, Stefan; Gruenewald, Martin Werner; Guillemin, Thibault; Gutierrez, Gaston R; Gutierrez, Phillip; Haley, Joseph Glenn Biddle; Han, Liang; Harder, Kristian; Harel, Amnon; Hauptman, John Michael; Hays, Jonathan M; Head, Tim; Hebbeker, Thomas; Hedin, David R; Hegab, Hatim; Heinson, Ann; Heintz, Ulrich; Hensel, Carsten; Heredia-De La Cruz, Ivan; Herner, Kenneth Richard; Hesketh, Gavin G; Hildreth, Michael D; Hirosky, Robert James; Hoang, Trang; Hobbs, John D; Hoeneisen, Bruce; Hogan, Julie; Hohlfeld, Mark; Holzbauer, Jenny Lyn; Howley, Ian James; Hubacek, Zdenek; Hynek, Vlastislav; Iashvili, Ia; Ilchenko, Yuriy; Illingworth, Robert A; Ito, Albert S; Jabeen, Shabnam; Jaffre, Michel J; Jayasinghe, Ayesh; Jeong, Min-Soo; Jesik, Richard L; Jiang, Peng; Johns, Kenneth Arthur; Johnson, Emily; Johnson, Marvin E; Jonckheere, Alan M; Jonsson, Per Martin; Joshi, Jyoti; Jung, Andreas Werner; Juste, Aurelio; Kajfasz, Eric; Karacheban, Olena; Karmanov, Dmitriy Y; Katsanos, Ioannis; Kaur, Manbir; Kehoe, Robert Leo Patrick; Kermiche, Smain; Khalatyan, Norayr; Khanov, Alexander; Kharchilava, Avto; Kharzheev, Yuri N; Kiselevich, Ivan Lvovich; Kohli, Jatinder M; Kozelov, Alexander V; Kraus, James Alexander; Kumar, Ashish; Kupco, Alexander; Kurca, Tibor; Kuzmin, Valentin Alexandrovich; Lammers, Sabine Wedam; Lebrun, Patrice; Lee, Hyeon-Seung; Lee, Seh-Wook; Lee, William M; Lei, Xiaowen; Lellouch, Jeremie; Li, Dikai; Li, Hengne; Li, Liang; Li, Qi-Zhong; Lim, Jeong Ku; Lincoln, Donald W; Linnemann, James Thomas; Lipaev, Vladimir V; Lipton, Ronald J; Liu, Huanzhao; Liu, Yanwen; Lobodenko, Alexandre; Lokajicek, Milos; Lopes de Sa, Rafael; Luna-Garcia, Rene; Lyon, Adam Leonard; Maciel, Arthur KA; Madar, Romain; Magana-Villalba, Ricardo; Malik, Sudhir; Malyshev, Vladimir L; Mansour, Jason; Martinez-Ortega, Jorge; McCarthy, Robert L; Mcgivern, Carrie Lynne; Meijer, Melvin M; Melnitchouk, Alexander S; Menezes, Diego D; Mercadante, Pedro Galli; Merkin, Mikhail M; Meyer, Arnd; Meyer, Jorg Manfred; Miconi, Florian; Mondal, Naba K; Mulhearn, Michael James; Nagy, Elemer; Narain, Meenakshi; Nayyar, Ruchika; Neal, Homer A; Negret, Juan Pablo; Neustroev, Petr V; Nguyen, Huong Thi; Nunnemann, Thomas P; Hernandez Orduna, Jose de Jesus; Osman, Nicolas Ahmed; Osta, Jyotsna; Pal, Arnab; Parashar, Neeti; Parihar, Vivek; Park, Sung Keun; Partridge, Richard A; Parua, Nirmalya; Patwa, Abid; Penning, Bjoern; Perfilov, Maxim Anatolyevich; Peters, Reinhild Yvonne Fatima; Petridis, Konstantinos; Petrillo, Gianluca; Petroff, Pierre; Pleier, Marc-Andre; Podstavkov, Vladimir M; Popov, Alexey V; Prewitt, Michelle; Price, Darren; Prokopenko, Nikolay N; Qian, Jianming; Quadt, Arnulf; Quinn, Gene Breese; Ratoff, Peter N; Razumov, Ivan A; Ripp-Baudot, Isabelle; Rizatdinova, Flera; Rominsky, Mandy Kathleen; Ross, Anthony; Royon, Christophe; Rubinov, Paul Michael; Ruchti, Randal C; Sajot, Gerard; Sanchez-Hernandez, Alberto; Sanders, Michiel P; Santos, Angelo Souza; Savage, David G; Savitskyi, Mykola; Sawyer, HLee; Scanlon, Timothy P; Schamberger, RDean; Scheglov, Yury A; Schellman, Heidi M; Schott, Matthias; Schwanenberger, Christian; Schwienhorst, Reinhard H; Sekaric, Jadranka; Severini, Horst; Shabalina, Elizaveta K; Shary, Viacheslav V; Shaw, Savanna; Shchukin, Andrey A; Simak, Vladislav J; Skubic, Patrick Louis; Slattery, Paul F; Smirnov, Dmitri V; Snow, Gregory R; Snow, Joel Mark; Snyder, Scott Stuart; Soldner-Rembold, Stefan; Sonnenschein, Lars; Soustruznik, Karel; Stark, Jan; Stefaniuk, Nazar; Stoyanova, Dina A; Strauss, Michael G; Suter, Louise; Svoisky, Peter V; Titov, Maxim; Tokmenin, Valeriy V; Tsai, Yun-Tse; Tsybychev, Dmitri; Tuchming, Boris; Tully, Christopher George T; Uvarov, Lev; Uvarov, Sergey L; Uzunyan, Sergey A; Van Kooten, Richard J; van Leeuwen, Willem M; Varelas, Nikos; Varnes, Erich W; Vasilyev, Igor A; Verkheev, Alexander Yurievich; Vertogradov, Leonid S; Verzocchi, Marco; Vesterinen, Mika; Vilanova, Didier; Vokac, Petr; Wahl, Horst D; Wang, Michael HLS; Warchol, Jadwiga; Watts, Gordon Thomas; Wayne, Mitchell R; Weichert, Jonas; Welty-Rieger, Leah Christine; Williams, Mark Richard James; Wilson, Graham Wallace; Wobisch, Markus; Wood, Darien Robert; Wyatt, Terence R; Xie, Yunhe; Yamada, Ryuji; Yang, Siqi; Yasuda, Takahiro; Yatsunenko, Yuriy A; Ye, Wanyu; Ye, Zhenyu; Yin, Hang; Yip, Kin; Youn, Sungwoo; Yu, Jiaming; Zennamo, Joseph; Zhao, Tianqi Gilbert; Zhou, Bing; Zhu, Junjie; Zielinski, Marek; Zieminska, Daria; Zivkovic, Lidija

    2016-06-10

    We present a measurement of the correlation between the spins of t and tbar quarks produced in proton-antiproton collisions at the Tevatron Collider at a center-of-mass energy of 1.96 TeV. We apply a matrix element technique to dilepton and single-lepton+jets final states in data accumulated with the D0 detector that correspond to an integrated luminosity of 9.7 fb$^{-1}$. The measured value of the correlation coefficient in the off-diagonal basis, $O_{off} = 0.89 \\pm 0.22$ (stat + syst), is in agreement with the standard model prediction, and represents evidence for a top-antitop quark spin correlation difference from zero at a level of 4.2 standard deviations.

  9. Measurement of the Cross Section for Prompt Isolated Diphoton Production in p\\bar p Collisions at \\sqrt{s} = 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Apresyan, A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bauer, G.; Bedeschi, F.; Beecher, D.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Binkley, M.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brau, B.; Brigliadori, L.; Brisuda, A.; Bromberg, C.; Brucken, E.; Bucciantonio, M.; Budagov, J.; Budd, H.S.; Budd, S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Canepa, A.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chou, J.P.; Chung, W.H.; Chung, Y.S.; Ciobanu, C.I.; Ciocci, M.A.; Clark, A.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuenca Almenar, C.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; De Cecco, S.; De Lorenzo, G.; Dell'Orso, M.; Deluca, C.; Demortier, L.; Deng, J.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, D.; Errede, S.; Ershaidat, N.; Eusebi, R.; Fang, H.C.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Ferrazza, C.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Galyardt, J.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giunta, M.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Gresele, A.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Gunay-Unalan, Z.; Haber, C.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jha, M.K.; Jindariani, S.; Johnson, W.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, H.W.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kimura, N.; Kirby, M.; Klimenko, S.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Krumnack, N.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; Lazzizzera, I.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Lin, C.J.; Linacre, J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, Q.; Liu, T.; Lockwitz, S.; Lockyer, N.S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Makhoul, K.; Maksimovic, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Martinez-Ballarin, R.; Mastrandrea, P.; Mathis, M.; Mattson, M.E.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Menzione, A.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Norniella, O.; Nurse, E.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Griso, S.Pagan; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Potamianos, K.; Poukhov, O.; Prokoshin, F.; Pronko, A.; Ptohos, F.; Pueschel, E.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Rossi, M.; Rubbo, F.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sartori, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schmidt, M.P.; Schmitt, M.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Sedov, A.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Sfyrla, A.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shiraishi, S.; Shochet, M.; Shreyber, I.; Simonenko, A.; Sinervo, P.; Sissakian, A.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Somalwar, S.; Sorin, V.; Squillacioti, P.; Stancari, M.; Stanitzki, M.; Denis, R.St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Ttito-Guzman, P.; Tkaczyk, S.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Tu, Y.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Weinberger, M.; Wester, W.C., III; Whitehouse, B.; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamaoka, J.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zucchelli, S.

    2011-01-01

    This letter reports a measurement of the cross section of prompt isolated photon pair production in p\\bar p collisions at a total energy \\sqrt{s} = 1.96 TeV using data of 5.36/fb integrated luminosity collected with the CDF II detector at the Fermilab Tevatron. The measured cross section, differential in basic kinematic variables, is compared with three perturbative QCD predictions, a Leading Order (LO) parton shower calculation and two Next-to-Leading Order (NLO) calculations. The NLO calculations reproduce most aspects of the data. By including photon radiation from quarks before and after hard scattering, the parton shower prediction becomes competitive with the NLO predictions.

  10. Search for Gauge Mediated SUSY Breaking in Diphoton Events in proton anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Minsuk [Kyungpook National Univ., Daegu (Korea, Republic of)

    2004-12-01

    The authors present the results of a search for anomalous production of diphoton events with large missing transverse energy using the Collider Detector at Fermilab. In 202 pb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV they observe no candidate events, with an expected standard model background of 0.27 ± 0.07(stat) ± 0.10(syst) events. The results exclude a lightest chargino of mass less than 167 GeV/c2, and lightest neutralino of 93 GeV/c2 at 95% confidence level in a gauge-mediated supersymmetry-breaking model with a light gravitino.

  11. First measurement of sigma (p anti-p ---> Z) . Br (Z ---> tau tau) at s**(1/2) = 1.96- TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G.A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Arnoud, Y.; Askew, A.; /Buenos Aires U. /Rio de Janeiro, CBPF /Rio de Janeiro State U. /Sao

    2004-12-01

    The authors present a measurement of the cross section for Z production times the branching fraction to {tau} leptons, {sigma} {center_dot} Br(Z {yields} {tau}{sup +}{tau}{sup -}), in p{bar p} collisions at {radical}s = 1.96 TeV in the channel in which one {tau} decays into {mu}{nu}{sub {mu}}{nu}{sub {tau}}, and the other into hadrons + {nu}{sub {tau}} or e{nu}{sub e}{nu}{sub {tau}}. The data sample corresponds to an integrated luminosity of 226 pb{sup -1} collected with the D0 detector at the Fermilab Tevatron collider. The final sample contains 2008 candidate events with an estimated background of 55%. From this they obtain {sigma} {center_dot} Br(Z {yields} {tau}{sup +}{tau}{sup -}) = 237 {+-} 15(stat) {+-} 18(sys) {+-} 15(lum) pb, in agreement with the standard model prediction.

  12. Search for high-mass resonances decaying to e mu in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst.

    2006-03-01

    The authors describe a general search for resonances decaying to a neutral e{mu} final state in p{bar p} collisions at a center-of-mass energy of 1.96 TeV. Using a data sample representing 344 pb{sup -1} of integrated luminosity recorded by the CDF II experiment, they compare Standard Model predictions with the number of observed events for invariant masses between 50 and 800 GeV/c{sup 2}. Finding no significant excess (5 events observed vs. 7.7 {+-} 0.8 expected for M{sub e{mu}} > 100 GeV/c{sup 2}), they set limits on sneutrino and Z{prime} masses as functions of lepton family number violating couplings.

  13. Gold nanoparticles production using reactor and cyclotron based methods in assessment of (196,198)Au production yields by (197)Au neutron absorption for therapeutic purposes.

    Science.gov (United States)

    Khorshidi, Abdollah

    2016-11-01

    Medical nano-gold radioisotopes is produced regularly using high-flux nuclear reactors, and an accelerator-driven neutron activator can turn out higher yield of (197)Au(n,γ)(196,198)Au reactions. Here, nano-gold production via radiative/neutron capture was investigated using irradiated Tehran Research Reactor flux and also simulated proton beam of Karaj cyclotron in Iran. (197)Au nano-solution, including 20nm shaped spherical gold and water, was irradiated under Tehran reactor flux at 2.5E+13n/cm(2)/s for (196,198)Au activity and production yield estimations. Meanwhile, the yield was examined using 30MeV proton beam of Karaj cyclotron via simulated new neutron activator containing beryllium target, bismuth moderator around the target, and also PbF2 reflector enclosed the moderator region. Transmutation in (197)Au nano-solution samples were explored at 15 and 25cm distances from the target. The neutron flux behavior inside the water and bismuth moderators was investigated for nano-gold particles transmutation. The transport of fast neutrons inside bismuth material as heavy nuclei with a lesser lethargy can be contributed in enhanced nano-gold transmutation with long duration time than the water moderator in reactor-based method. Cyclotron-driven production of βeta-emitting radioisotopes for brachytherapy applications can complete the nano-gold production technology as a safer approach as compared to the reactor-based method. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Susceptibility to HIV-1 infection is influenced by toll like receptor-2 (-196 to -174) polymorphism in a north Indian population.

    Science.gov (United States)

    Vidyant, Sanjukta; Chatterjee, Animesh; Agarwal, Vikas; Dhole, Tapan N

    2017-08-01

    Toll like receptors (TLRs) are pattern recognition receptors that recognize molecular patterns of pathogens and play an important role in innate immunity. Recent studies have identified that a single nucleotide polymorphism (SNP) in the TLR gene impairs the response to TLR ligands in some individuals and is associated with susceptibility to various infectious diseases. The present study aimed to investigate the role of four SNPs in the TLR2 gene [-196 to -174 Ins/Del, 2258 G/A (Arg753Gln), 2029 C/T (Arg677Trp) and 1892 C/A (Pro631His)] with respect to susceptibility and progression to HIV-1 in North Indian individuals. The study population consisted of 160 HIV-1 seropositive patients stratified on the basis of disease severity (stages I, II and III) and 270 HIV-1 seronegative individuals. The subjects were genotyped for TLR2 gene polymorphism by polymerase chain reaction restriction fragment length polymorphism. In the present study, we found that the TLR2 Del mutant genotype [odds ratio (OR) = 2.138; p = 0.001] and allele (OR = 1.562; p = 0.002) was at a higher frequency in patients with HIV-1 infection compared to healthy controls and was significantly associated with the risk of HIV-1 infection and disease susceptibility. Furthermore, we also found that TLR2 Del homozygous genotype was at a lower frequency in stage III (19.35%) compared to stage I (50.87%; OR = 1.901) and stage II (43.05%; OR = 1.514) and was associated with a reduced risk of HIV-1 disease progression. The present study reports for the first time that the TLR2-196 to -174 Ins/Del polymorphism is a risk factor for HIV-1 transmission in HIV-1 infected North Indian individuals. Copyright © 2017 John Wiley & Sons, Ltd.

  15. Measurement of Z+ γ production and search for anomalous triple gauge couplings in proton-antiproton collisions at √S = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Jianrong [Duke Univ., Durham, NC (United States)

    2008-01-01

    The author presents a measurement of p$\\bar{p}$ → Zγ + X → e+e-γ + X production using proton-antiproton collisions data collected at the Collider Detector at Fermilab at a center of mass energy of 1.96 TeV. Zγ production provides a direct test of the triple neutral gauge couplings. A measurement of Zγ production cross section and search for anomalous ZZγ and Zγγ couplings are presented. The data presented are from 1.1 fb-1 of p$\\bar{p}$ integrated luminosity collected at the CDF Detector. Electrons from Z decays are selected with Et > 20 Gev. Photons (Et > 7 GeV) are required to be well-separated from the electrons. There are 390 eeγ candidate events found with 1.1 fb-1 of data, compared to the SM prediction of 375.3 ± 25.2 events. The Standard Model prediction for the cross section for p$\\bar{p}$ → e+e-γ + X production at √s = 1.96 TeV is 4.5 ± 0.4 pb. The measured cross section is 4.7 ± 0.6 pb. The cross section and kinematic distributions of the eeγ events are in good agreement with theoretical predictions. Limits on the ZZγ and Zγγ couplings are extracted using the photon Et distribution of eeγ events with meeγ > 100 GeV/c2. These are the first limits measured using CDF Run II data. These limits provide important test of the interaction of the photon and the Z boson.

  16. Evaluation of Plasma MicroRNAs as Diagnostic and Prognostic Biomarkers in Pancreatic Adenocarcinoma: miR-196a and miR-210 Could Be Negative and Positive Prognostic Markers, Respectively

    Directory of Open Access Journals (Sweden)

    Qi Yu

    2017-01-01

    Full Text Available Background. Identifying diagnostic and prognostic biomarkers that could be targeted in the therapy of pancreatic cancer is essential. Objective. Investigations were conducted with respect to plasma miRNA (miR-21, miR-210, miR-155, miR-196a, miR-20a, and miR-25 expression and clinicopathologic factors to evaluate the prognostic value of miRNAs in pancreatic ductal adenocarcinoma (PDAC. Methods. Plasma miRNAs were detected by real-time quantitative PCR, and the association with clinicopathologic factors was subsequently performed by univariate and multivariate analyses. Results. Six miRNAs expressed significantly higher in PDAC patients than in normal individuals were identified. Receiver operating characteristic (ROC curves were constructed. It was evident that miRNA expression associated with PDAC, lymph node metastasis, serosal infiltration, and comprehensive therapy reached significance for overall survival. High miR-196a expression was associated with poor survival (P=0.001, whereas high miR-210 expression was significantly associated with improved survival (P=0.003. Multivariate survival analysis indicated that the miR-210 and miR-196a expression signature, lymph node metastasis, and comprehensive therapy were independent factors affecting overall survival. Conclusions. MiRNA expression profile is distinctive in PDAC. Aberrant expression of certain miRNAs was remarkably involved in shaping the overall survival time, which include miR-196a overexpression and decreased miR-210 expression.

  17. Association study of tumor necrosis factor receptor type 2 M196R and toll-like receptor 2 Arg753Gln polymorphisms with acne vulgaris in a Chinese Han ethnic group.

    Science.gov (United States)

    Tian, Li-Ming; Xie, Hong-Fu; Yang, Ting; Hu, Yao-Hua; Li, Ji; Wang, Wei-Zhen

    2010-01-01

    Inflammatory cytokines such as tumor necrosis factor receptor 2 (TNFR2) and Toll-like receptor 2 (TLR2) are the main responsible mediators of inflammatory acne. Factors affecting their production may possibly influence the degree of inflammatory response and hence may account for the clinical severity of acne. However, the roles of TNFR2 and TLR2 in the pathophysiology of acne vulgaris are poorly understood. We therefore investigated the relationship between acne vulgaris susceptibility and the polymorphisms in the TNFR2 M196R as well as TLR2 Arg753Gln gene. A total of 93 acne vulgaris patients and 90 healthy subjects from the Chinese Han ethnic group were enrolled in the study. The polymerase chain reaction restriction fragment length polymorphism technique was adopted to analyze the single-nucleotide polymorphisms of the TNFR2 M196R and TLR2 Arg753Gln gene, and to examine the association between acne vulgaris and the polymorphisms in the TNFR2 M196R as well as TLR2 Arg753Gln gene. The relationship between different genotypes and the susceptibility to acne vulgaris was analyzed. There is a significant difference in the frequency of TNFR2 M196R genetic polymorphisms between the moderate-acne to severe-acne subgroups and the control group (p acne subgroup and control group (p acne vulgaris in Chinese Han patients, further supporting the contribution of inflammatory cytokines to the pathogenesis of acne.

  18. Physical and underway data collected aboard the KNORR during cruise KN196-02 in the Davis Strait from 2009-10-06 to 2009-10-29 (NODC Accession 0104281)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104281 includes physical and underway data collected aboard the KNORR during cruise KN196-02 in the Davis Strait from 2009-10-06 to 2009-10-29. These...

  19. The NRT2.5 and NRT2.6 genes are involved in growth promotion of Arabidopsis by the plant growth-promoting rhizobacterium (PGPR) strain Phyllobacterium brassicacearum STM196.

    Science.gov (United States)

    Kechid, Maya; Desbrosses, Guilhem; Rokhsi, Wafaa; Varoquaux, Fabrice; Djekoun, Abdelhamid; Touraine, Bruno

    2013-04-01

    The Phyllobacterium brassicacearum STM196 strain stimulates Arabidopsis thaliana growth and antagonizes high nitrate inhibition of lateral root development. A previous study identified two STM196-responsive genes, NRT2.5 and NRT2.6 (Mantelin et al., 2006, Planta 223: 591-603). We investigated the role of NRT2.5 and NRT2.6 in the plant response to STM196 using single and double Arabidopsis mutants. The single mutants were also crossed with an nrt2.1 mutant, lacking the major nitrate root transporter, to distinguish the effects of NRT2.5 and NRT2.6 from potential indirect effects of nitrate pools. The nrt2.5 and nrt2.6 mutations abolished the plant growth and root system architecture responses to STM196. The determination of nitrate content revealed that NRT2.5 and NRT2.6 do not play an important role in nitrate distribution between plant organs. Conversely, NRT2.5 and NRT2.6 appeared to play a role in the plant response independent of nitrate uptake. Using a nitrate reductase mutant, it was confirmed that the NRT2.5/NRT2.6-dependent plant signalling pathway is independent of nitrate-dependent regulation of root development. Our findings demonstrate that NRT2.5 and NRT2.6, which are preferentially expressed in leaves, play an essential role in plant growth promotion by the rhizospheric bacterium STM196. No claim to original US government works. New Phytologist © 2013 New Phytologist Trust.

  20. Measurement of vector boson plus D*(2010)+ meson production in p ¯p collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; Denis, R. St.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2016-03-01

    A measurement of vector boson (V ) production in conjunction with a D*(2010)+meson is presented. Using a data sample corresponding to 9.7 fb-1 of proton-antiproton collisions at center-of-mass energy √{s }=1.96 TeV produced by the Fermilab Tevatron, we reconstruct V +D*+ samples with the CDF II detector. The D*+ is fully reconstructed in the D*(2010)+→D0(→K-π+)π+ decay mode. This technique is sensitive to the associated production of vector boson plus charm or bottom mesons. We measure the ratio of production cross sections σ (W +D*)/σ (W )=[1.75 ±0.13 (stat ) ±0.09 (stat ) ]% and σ (Z +D*)/σ (Z )=[1.5 ±0.4 (stat ) ±0.2 (stat ) ]% and perform a differential measurement of d σ (W +D*)/d pT(D*). Event properties are utilized to determine the fraction of V +D*(2010)+ events originating from different production processes. The results are in agreement with the predictions obtained with the pythia program, limiting possible contribution from non-standard-model physics processes.

  1. Measurement of the Bc± production cross section in p p ¯ collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hartz, M.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2016-03-01

    We describe a measurement of the ratio of the cross sections times branching fractions of the Bc+ meson in the decay mode Bc+→J /ψ μ+ν to the B+ meson in the decay mode B+→J /ψ K+ in proton-antiproton collisions at center-of-mass energy √{s }=1.96 TeV . The measurement is based on the complete CDF Run II data set, which comes from an integrated luminosity of 8.7 fb-1. The ratio of the production cross sections times branching fractions for Bc+ and B+ mesons with momentum transverse to the beam greater than 6 GeV /c and rapidity magnitude smaller than 0.6 is 0.211 ±0.012 (stat)-0.020 +0.021(syst ) . Using the known B+→J /ψ K+ branching fraction, the known B+ production cross section, and a selection of the predicted Bc+→J /ψ μ+ν branching fractions, the range for the total Bc+ production cross section is estimated.

  2. Characterization of Vadose Zone Sediments Below the T Tank Farm: Boreholes C4104, C4105, 299-W10-196, and RCRA Borehole 299-W11-39

    Energy Technology Data Exchange (ETDEWEB)

    Serne, R. Jeffrey; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Schaef, Herbert T.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; Legore, Virginia L.; Geiszler, Keith N.; Baum, Steven R.; Valenta, Michelle M.; Kutnyakov, Igor V.; Vickerman, Tanya S.; Orr, Robert D.; Brown, Christopher F.

    2008-09-11

    This report was revised in September 2008 to remove acid-extractable sodium data from Tables 4.8, 4.28, and 4.52. The sodium data was removed due to potential contamination introduced during the acid extraction process. The rest of the text remains unchanged from the original report issued in September 2004. The overall goal of the Tank Farm Vadose Zone Project, led by CH2M HILL Hanford Group, Inc., is to define risks from past and future single-shell tank farm activities at Hanford. To meet this goal, CH2M HILL Hanford Group, Inc. tasked scientists from Pacific Northwest National Laboratory to perform detailed analyses on vadose zone sediments from within Waste Management Area (WMA) T-TX-TY. This report is the second of two reports written to present the results of these analyses. Specifically, this report contains all the geologic, geochemical, and selected physical characterization data collected on vadose zone sediment recovered from boreholes C4104 and C4105 in the T Tank Farm, and from borehole 299-W-11-39 installed northeast of the T Tank Farm. Finally, the measurements on sediments from borehole C4104 are compared with a nearby borehole drilled in 1993, 299- W10-196, through the tank T-106 leak plume.

  3. Study of vector boson plus $D^{*}(2010)^+$ meson production in $\\bar{p}p$ collisions at $\\sqrt{s}=1.96\\, {\\rm TeV}$

    CERN Document Server

    Aaltonen, Timo Antero; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Bruck