
Sample records for thallium 179

  1. Extracorporeal treatment for thallium poisoning

    DEFF Research Database (Denmark)

    Ghannoum, Marc; Nolin, Thomas D; Goldfarb, David S


    The EXtracorporeal TReatments In Poisoning (EXTRIP) workgroup was formed to provide recommendations on the use of extracorporeal treatment (ECTR) in poisoning. To test and validate its methods, the workgroup reviewed data for thallium (Tl)....

  2. Usefulness of Thallium Scan for Differential Diagnosis of Breast Mass

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Sang Kyun; Yum, Ha Yong; Lee, Chung Han; Choi, Kyung Hyun [Kosin University College of Medicine, Pusan (Korea, Republic of)


    The purpose of this study is to evaluate thallium scanning as a potential test in differentiating malignant from benign lesions of breast. Thirty-one female patients underwent thallium scan of the breast. After intravenous injection of 74-111 MBq(2-3 mCi)of thallium-201, anterior and lateral images were obtained. We compared thallium scans with pathological results. Of 11 patients with breast cancers, 10 cases (90.9%) were detected using thallium scan. Thallium scan obtained in one patient who had breast cancer but received several cycles of chemotherapy did not show thallium uptake. The smallest detectable cancer was 1.5 cm in diameter. In contrast, there is no thallium accumulation in breasts of 17 of 20 patients with benign disease (85%), Three cases of 13 fibrocystic disease show thallium uptake in their breast. In conclusion, thallium scan is an effective test in differentiating benign from malignant lesion.

  3. Thallium contamination of water in Canada

    Energy Technology Data Exchange (ETDEWEB)

    Cheam, V. [National Water Research Institute Branch, Burlington, ON (Canada). Aquatic Ecosystems Protection Research Branch


    A highly sensitive instrument, a Laser-Excited Atomic Fluorescence Spectrometer, has been developed to study thallium contamination in some important Canadian ecosystems from the Arctic (containing very low thallium concentration) to coal-related industries across Canada and even to the study of thallium toxicity in an invertebrate, Hyalella azteca. Overall, the data indicate that the coal power plants and mines contain higher thallium concentrations than the other ecosystems studied, and the eastern region has the highest Tl concentrations compared to other regions. The range of thallium concentration in ng/L for the Arctic snow and ice was between not detected and 8.4, for the Great Lakes waters 0.9 to 48, for pore waters 0.1 to 213, for western coal power plants and mines 0.1 to 1326, for central coal power plants 1.2 to 175, for eastern coal power plants and mines 0.2 to 23605, and for miscellaneous sites across Canada not detected to 4390 ng/L. Some of these high concentrations and those high ones reported in industrial wastewaters exceeded the chronic toxicity endpoints for Hyalella azteca mortality, growth and reproduction, and thus can cause serious distress to the environment. All data were integrated into a map of thallium distribution, the first one in Canada. Natural background level of thallium for the Arctic was estimated to be 0.02 to 0.03 pg/g.

  4. IRIS Toxicological Review of Thallium and Compounds ... (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certain tumors. EPA's assessment of noncancer health effects and carcinogenic potential of thallium compounds was last prepared and added to the IRIS database between 1988 and 1990. The IRIS program is preparing an assessment that will incorporate current health effects information available for thallium and compounds, and current risk assessment methods. The IRIS assessment for thallium compounds will consist of a Toxicological Review and IRIS Summary. The Toxicological Review is a critical review of the physiochemical and toxicokinetic properties of a chemical, and its toxicity in humans and experimental systems. The assessment will present reference values for the noncancer effects of thallium compounds (RfD and Rfc), and a cancer assessment. The Toxicological Review and IRIS Summary have been subject to Agency review, Interagency review, and external scientific peer review. The final product will reflect the Agency opinion on the overall toxicity of thallium and compounds. EPA is undertaking an Integrated Risk Information System (IRIS) health assessment for thallium and compounds. IRIS is an EPA database containing Agency scientific positions on potential adverse human health effec

  5. Repeat thallium-201 SPECT in cerebral lymphoma. (United States)

    Borggreve, F; Dierckx, R A; Crols, R; Mathijs, R; Appel, B; Vandevivere, J; Mariën, P; Martin, J J; De Deyn, P P


    The authors report on the contribution of Thallium-201 brain SPECT in the diagnosis and follow-up of a non-immunosuppressed patient, presenting with primary cerebral lymphoma. The tumoral process was at first not diagnosed on CT-scan, but Thallium-201 SPECT suggested a tumoral invasion. During corticosteroid treatment the tumor volume on CT-scan decreased, while on Thallium-201 SPECT there was an enhancement of the accumulation and an increasing tumor to non-tumor ratio. These scintigraphical findings more closely reflected the clinical course and the postmortem results.

  6. Leg 179 summary

    Digital Repository Service at National Institute of Oceanography (India)

    Pettigrew, T.J.; Casey, J.F.; Miller, D.J.; Araki, E.; Boissonnas, R.; Busby, R.; Einaudi, F.; Gerdom, M.; Guo, Z.P.; Hopkins, H.; Myers, G.; Rao, D.G.; Shibata, T.; Thy, P.

    Pettigrew, T.L., Casey, J.F., Miller, D.J., et al., 1999 Proceedings of the Ocean Drilling Program, Initial Reports Volume 179 1. LEG 179 SUMMARY 1 Shipboard Scientific Party 2 ABSTRACT Ocean Drilling Program (ODP) Leg 179 set out with two primary objectives... a hole, then simultaneously deepen that hole and stabilize its walls with casing. This system is an adaptation of pneu- matically driven drilling systems that have successfully drilled in envi- ronments not unlike those that present our greatest...

  7. Thallium poisoning from maliciously contaminated food. (United States)

    Meggs, W J; Hoffman, R S; Shih, R D; Weisman, R S; Goldfrank, L R


    Four young adults presented two days after one of them had received marzipan balls packaged in a box from an expensive candy manufacturer. Two ate one candy ball, while two others shared a third. The next day, variable gastrointestinal symptoms developed. On the third day, two patients developed painful paresthesiae of the hands and feet, an early but nonspecific clinical marker of thallium poisoning. A tentative diagnosis of thallium poisoning was made based on symptoms, and treatment was initiated. The remaining candies were radiographed. Metallic densities in the candies supported the diagnosis, and atomic absorption spectroscopy was used to quantitate thallium content. Each candy contained a potentially fatal dose. Five to seven days later, hypertension and tachycardia developed in the two patients who had ingested an entire candy. All patients developed alopecia but recovered without overt neurologic or other sequelae. While the diagnosis of thallium poisoning is often delayed until alopecia develops, an early diagnosis favors an effective treatment strategy.

  8. Thallium in mineral resources extracted in Poland

    Directory of Open Access Journals (Sweden)

    Bojakowska I.


    Full Text Available Thallium concentrations in primary mineral commodities extracted in Poland and processed in high temperatures were determined by ICP-MS method. Samples of hard and brown coal, copper-silver and zinclead ores, argillaceous and calcareous rocks of different genesis and age were analyzed. The highest thallium concentrations occur in the zinc-lead ores, the average content being of 52.1 mg/kg. The copper ores contain in average 1.4 mg/kg of thallium. Hard coals from the Upper Silesian Coal Basin display higher thallium content than those exploited in the Lublin Coal Basin. Brown coals from Turow deposit distinguish by much higher values, 0.7 mg/kg Tl, than those from huge Bełchatów and smaller Konin-Turek region deposits. Average thallium concentrations in clays used for ceramic materials are lower than 1 mg/kg, except of Mio-Pliocene Slowiany deposit. The average content of thallium in the studied limestone and dolomite raw materials for cement, lime, and metallurgical flux, and refractories is very low in comparison to the average amounts in the world carbonate rocks.

  9. Examining of Thallium in Cigarette Smokers. (United States)

    Ghaderi, Amir; NasehGhafoori, Payam; Rasouli-Azad, Morad; Sehat, Mojtaba; Mehrzad, Fateme; Nekuei, Mina; Aaseth, Jan; Banafshe, Hamid Reza; Mehrpour, Omid


    Smoking is one of the sources of thallium which is considered as a toxic heavy metal. The aim of this study was to determine urinary thallium levels and related variables in smokers, compared to a control group. The study was conducted on 56 participants who had smoked continuously during the year before they were referred to Kashan Smoking Cessation Clinic. Fifty-three nonsmokers who were family members or friends of the smokers were selected as the control group. Urinary thallium was measured in both groups (n = 109) using atomic absorption spectrophotometry. The mean value (with SD) for urinary thallium in the smokers (10.16 ± 1.82 μg/L) was significantly higher than in the control group (2.39 ± 0.63 μg/L). There was a significant relationship between smoking duration and urinary thallium levels (P = 0.003). In a subgroup of smokers who was addicted to opium and opium residues (n = 9), the mean level of thallium (37.5 ± 13.09 μg/L) was significantly higher than in the other smokers (4.93 ± 4.45; P = 0.001). Multiple regression analysis showed opioid abuse, insomnia, and chronic obstructive pulmonary disease (COPD), together were strong predictors of urinary thallium levels in smokers. There was no significant difference in thallium level in hookah smokers (P = 0.299) or in those with COPD compared to other smokers (P = 0.375). Urinary thallium levels of smokers with clinical signs of depression, sleep disorders, memory loss, and sweating were higher than those of smokers without these signs. Since thallium, as other toxic metals is accumulated in the body, and cigarette smoking also involves carcinogenic exposures and health hazards for passively exposed people, the need for cigarette control policies is emphasized.

  10. Thallium-201 scintigraphy in unstable angina pectoris

    Energy Technology Data Exchange (ETDEWEB)

    Wackers, F.J.T.; Lie, K.I.; Liem, K.L.; Sokole, E.B.; Samson, G.; Van Der Schoot, J.B.; Durrer, D.


    Thallium-201 scintigraphy was performed during the pain free period in 98 patients with unstable angina. Scintiscans were positive in 39 patients, questionable in 27 patients and normal in 32 patients. Eighty-one patients responded favorably to treatment (group I). Seventeen patients had complicated courses (group II) and despite maximal treatment with propranolol either developed infarction (six patients) or continued to have angina necessitating coronary surgery (11 patients). In group I during the pain free period 26 of 81 patients had positive thallium-201 scans, whereas 20 patients had an abnormal ECG at that time; during angina 18 patients had transient ECG changes. In group II during the pain free period 13 of 17 patients had positive scans, whereas two patients had abnormal ECG at that time; during angina 12 patients showed transient ECG changes. The sensitivity to recognize group II was 76% for thallium-201 scintigraphy, 11% for ECG during the pain free period; 70% for ECG during angina; 94% for the combination of either positive scans or abnormal ECG. Thus, positive thallium-201 scans occur in patients with unstable angina, positive scans can be obtained during the pain free period, thallium-201 scans are more frequently positive in patients with complicated course.

  11. Thallium-201 uptake in a benign thymoma

    Energy Technology Data Exchange (ETDEWEB)

    Campeau, R.J.; Ey, E.H.; Varma, D.G.


    A 68-year-old woman was admitted with atypical angina. A chest radiograph showed an anterior mediastinal mass that was confirmed on CT. The mass was relatively avascular and separate from the heart and great vessels. She underwent stress thallium testing that demonstrated no exercise-induced ischemia; however, an abnormal focus of thallium activity was present in the anterior mediastinum on stress and redistribution images. Cardiac catheterization demonstrated a normal left ventriculogram, coronary arteries and thoracic aorta. Subsequent surgery and pathologic examination revealed the mass to be a benign thymoma arising in the right lobe of the thymus gland.

  12. Endogenous thiols enhance thallium toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Montes, Sergio; Rios, Camilo [Instituto Nacional de Neurologia y Neurocirugia, ' ' Manuel Velasco Suarez' ' , Departamento de Neuroquimica, Mexico, D.F (Mexico); Soriano, Luz; Monroy-Noyola, Antonio [Universidad Autonoma del Estado de Morelos, Laboratorio de Neuroproteccion, Facultad de Farmacia, Cuernavaca, Morelos (Mexico)


    Either L-methionine (L-met) or L-cysteine (L-cys), given alone and in combination with Prussian blue (PB) was characterized as treatment against acute thallium (Tl) toxicity in rats. Animals were intoxicated with 32 mg/kg Tl acetate corresponding to rat LD{sub 50}. Antidotal treatments were administered during 4 days, as follows: (1) vehicle, (2) L-met 100 mg/kg i.p. twice a day, (3) L-cys 100 mg/kg i.p. twice a day, (4) PB 50 mg/kg oral, twice a day, (5) L-met + PB and (6) L-cys + PB. Mortality was as follows: control 50%; L-met 80%; L-cys 80%; PB 20%; L-met + PB 90% and L-cys + PB 100%. In a different experiment, using 16 mg/kg of Tl, tissue levels of this metal were analyzed. PB treatment statistically diminished Tl content in body organs and brain regions (P < 0.01). Whereas, separate treatments of L-met and L-cys failed to decrease Tl content in organs and brain regions; while its administration in combination with PB (L-met + PB and L-cys + PB groups) lowered Tl levels in body organs in the same extent as PB group. Results indicate that L-met and L-cys administered alone or in combination with PB should not be considered suitable treatments against acute Tl toxic effects because this strategy failed to prevent mortality and Tl accumulation in brain. (orig.)

  13. Thallium in fractions of soil formed on floodplain terraces. (United States)

    Jakubowska, Monika; Pasieczna, Anna; Zembrzuski, Wlodzimierz; Swit, Zbigniew; Lukaszewski, Zenon


    Two soils formed on the floodplain terrace of a rivulet flowing through the zinc-lead ore exploration area polluted with thallium and one soil from a floodplain terrace of the reference area were investigated in terms of thallium distribution between soil fractions. Such type of soil is formed on river floodplain terraces next to the main river channel and its composition records the history of river pollution. A sequential extraction of soil according to the BCR protocol was performed with an additional initial stage of extraction with water. Apart from labile thallium, thallium entrapped in the residual parent matter was also determined. Thallium was determined by flow-injection differential-pulse anodic stripping voltammetry. In all three cases, the major fraction is thallium entrapped in parent matter. Top soil from the polluted area contains 49.3% thallium entrapped in the residual parent matter, the bottom soil contains 41% while the reference soil contains 80% in this fraction. The major part of labile thallium is located in the reducible fraction (27.7% of total thallium in the top soil, 27% in the bottom soil and 12.4% of the reference soil). Second in terms of significance is the fraction of oxidizable thallium. The top soil contains 12% of total thallium concentration, the bottom soil contains 19% of total concentration, while the reference soil contains 4.1% of total concentration. The acid soluble/exchangeable fraction of thallium has almost the same significance as the oxidizable fraction. The top soil contains 10.4% of the total concentration, while the bottom soil contains 12% of the total concentration. Water soluble thallium concentration is very small. Comparison of the top and the bottom soil show that thallium has not been transported from the river channel onto the floodplain terrace over a long period.

  14. Characteristics of photoconductivity in thallium monosulfide single ...

    Indian Academy of Sciences (India)

    journal of. March 2007 physics pp. 467–479. Characteristics of photoconductivity in thallium monosulfide single crystals. I M ASHRAF, H A ELSHAIKH and A M BADR. Physics Department ... pendencies of carrier lifetime on light intensity, applied voltage and temperature are also ..... 14, 797 (1935) (in Japanese). [10] A T ...

  15. Extraction separation of thallium (III) from thallium (I) with n-octylaniline. (United States)

    Shilimkar, Tulshidas N; Anuse, Mansing A; Patil, Kesharsingh J


    A novel method is developed for the extraction separation of thallium(III) from salicylate medium with n-octylaniline dissolved in toluene as an extractant. The optimum conditions have been determined by making a critical study of weak acid concentration, extractant concentration, period of equilibration and effect of solvent on the equilibria. The thallium (III) from the pregnant organic phase is stripped with acetate buffer solution (pH 4.7) and determined complexometrically with EDTA. The method affords the sequential separation of thallium(III) from thallium(I) and also commonly associated metal ions such as Al(III), Ga(III), In(III), Fe(III), Bi(III), Sb(III) and Pb(II). It is used for analysis of synthetic mixtures of associated metal ions and alloys. The method is highly selective, simple and reproducible. The reaction takes place at room temperature and requires 15-20 min for extraction and determination of thallium(III).

  16. Thallium bromide iodide crystal acoustic anisotropy examination. (United States)

    Mantsevich, S N


    Thallium bromide iodide crystal also known as KRS-5 is the well known material used in far infrared radiation applications for optical windows and lenses fabrication. The main advantage of this material is the transparency in wide band of wavelengths from 0.53 to 50μm. Despite such advantages as transparency and large acousto-optic figure of merit values, KRS-5 is rarely used in acousto-optics. Nevertheless this material seems to be promising for far infrared acousto-optic applications. The acoustic and acousto-optic properties of KRS-5 needed for the full use in optoelectronics are not well understood to date. In this paper the detailed examination of thallium bromide iodide crystal acoustic properties is presented. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Thallium and its contents in Remata carbonate rocks

    Directory of Open Access Journals (Sweden)

    Kondelová Marcela


    Full Text Available The article presents at first the list of thallium own minerals and its isomorphic content in other minerals, especially in Slovakian ore deposits. This trace element was found in numerous dolomite-rock samples from Remata massif near Handlová. An interesting level of Tl content was analyzed in nonsilicified rocks; the highest content of Tl (and Ag are along the E – W line of disturbance. The presence of thallium in some limonitic aggregates in close Kremnica-gold deposit indicate any continuous relation. Some similarities to type gold deposits Carlin ( USA are discussed, even if no gold and discrete thallium phases were in Remata determined yet.

  18. Tracing thallium contamination in soils using isotopes (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Teper, Leslaw; Cabala, Jerzy; Rohovec, Jan; Penížek, Vít; Zádorová, Tereza; Pavlů, Lenka; Holubík, Ondřej; Drábek, Ondřej; Němeček, Karel; Houška, Jakub; Ash, Christopher


    We report the thallium (Tl) isotope record in moderately contaminated soils, which have been historically affected by emissions from coal-fired power plants. Our findings clearly demonstrate that Tl of anthropogenic (high-temperature) origin with light isotope composition was deposited onto the studied soils, where heavier Tl (ɛ205Tl -1) naturally occurs. The results show a positive linear relationship (R2 = 0.71) between 1/Tl and the isotope record, as determined for all the soils and bedrocks, also indicative of binary Tl mixing between two dominant reservoirs. We also identified significant Tl isotope variations within the products from coal combustion and thermo-desorption experiments with local Tl-rich coal pyrite. Bottom ash exhibited the heaviest Tl isotope composition (ɛ205Tl 0), followed by fly ash (ɛ205Tl between -2.5 and -2.8) and volatile Tl fractions (ɛ205Tl between -6.2 and -10.3), suggesting partial Tl isotope fractionations. Despite the evident role of soil processes in the isotope redistribution, we demonstrate that Tl contamination can be traced in soils, and propose that the isotope data represent a possible tool to aid our understanding of post-depositional Tl dynamics in surface environments for the future. This research was supported by the Czech Science Foundation (grant no. 14-01866S and 17-03211S).

  19. 49 CFR 179.100-9 - Welding. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.100-9 Section 179.100-9... Specifications for Pressure Tank Car Tanks (Classes DOT-105, 109, 112, 114 and 120) § 179.100-9 Welding. (a) All..., appendix W (IBR, see § 171.7 of this subchapter). Welding procedures, welders and fabricators shall be...

  20. 49 CFR 179.220-10 - Welding. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.220-10 Section 179.220-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-10 Welding. (a) All joints... of this subchapter). Welding procedures, welders, and fabricators shall be approved. (b) Radioscopy...

  1. 49 CFR 179.300-9 - Welding. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.300-9 Section 179.300-9... Specifications for Multi-Unit Tank Car Tanks (Classes DOT-106A and 110AW) § 179.300-9 Welding. (a) Longitudinal... fusion welded on class DOT-110A tanks. Welding procedures, welders and fabricators must be approved in...

  2. 49 CFR 179.400-11 - Welding. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.400-11 Section 179.400-11...-11 Welding. (a) Except for closure of openings and a maximum of two circumferential closing joints in... subchapter). (d) Each welding procedure, welder, and fabricator must be approved. [Amdt. 179-32, 48 FR 27708...

  3. 49 CFR 179.200-10 - Welding. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding. 179.200-10 Section 179.200-10... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.200-10 Welding. (a) All joints... W (IBR, see § 171.7 of this subchapter). Welding procedures, welders and fabricators shall be...

  4. 40 CFR 179.45 - Appearance. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Appearance. 179.45 Section 179.45 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS FORMAL EVIDENTIARY PUBLIC HEARING Participation and Appearance; Conduct § 179.45 Appearance. (a) A party to a hearing may...

  5. 5 CFR 179.208 - Certification. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Certification. 179.208 Section 179.208... Salary Offset § 179.208 Certification. (a) OPM salary offset coordinator shall provide a certification to... certification must be in writing and must state: (1) That the employee owes the debt; (2) The amount and basis...

  6. 40 CFR 179.125 - Judicial review. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Judicial review. 179.125 Section 179... EVIDENTIARY PUBLIC HEARING Judicial Review § 179.125 Judicial review. (a) The Administrator's final decision... judicial review within the period ending on the 60th day after the date of the publication of the order...

  7. 49 CFR 179.102-2 - Chlorine. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Chlorine. 179.102-2 Section 179.102-2... Specifications for Pressure Tank Car Tanks (Classes DOT-105, 109, 112, 114 and 120) § 179.102-2 Chlorine. (a) Each tank car used to transport chlorine must comply with all of the following: (1) Tanks must be...

  8. 49 CFR 179.11 - Welding certification. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Welding certification. 179.11 Section 179.11 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY... Design Requirements § 179.11 Welding certification. (a) Welding procedures, welders and fabricators shall...

  9. 5 CFR 179.307 - Administrative offset. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Administrative offset. 179.307 Section 179.307 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.307 Administrative offset. (a) If the debtor does not...

  10. 5 CFR 179.308 - Accelerated procedures. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Accelerated procedures. 179.308 Section 179.308 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.308 Accelerated procedures. OPM may make an administrative...

  11. 5 CFR 179.302 - Definitions. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Definitions. 179.302 Section 179.302 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.302 Definitions. Administrative offset, as defined in 31 U.S.C. 3701(a)(1), means...

  12. 5 CFR 179.304 - Notification procedures. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Notification procedures. 179.304 Section 179.304 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.304 Notification procedures. Before collecting any debt...

  13. 5 CFR 179.303 - General. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false General. 179.303 Section 179.303 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.303 General. (a) The Director or his or her designee, after attempting to collect a...

  14. 5 CFR 179.305 - Agency review. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Agency review. 179.305 Section 179.305 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.305 Agency review. (a) A debtor may dispute the existence of the debt, the amount of...

  15. Catalytic properties of Thallium-containing mesoporous silicas

    Directory of Open Access Journals (Sweden)

    A. Baradji


    Full Text Available The benzylation of benzene by benzyl chloride over a series of Thallium-containing mesoporous silicas with different Tl contents has been investigated. These materials (Tl-HMS-n have been characterized by chemical analysis, N2 adsorption/desorption isotherm and X-ray diffraction (XRD. The mesoporous Thallium-containing materials showed both high activity and high selectivity for the benzylation of benzene. More interesting is the observation that these catalysts are always active and selective for large molecules like naphthenic compounds such as methoxynaphthalene.

  16. A comparison of the clinical relevance of thallium201 and ...

    African Journals Online (AJOL)

    Thallium-201 is at present the radiotracer of choice for the clinical evaluation of myocardial blood flow. Although different technetium-99m-isonitrile agents have been synthesised recently, only 99mTc-melhoxyisobutyl-isonitrile (99mTc_MIBI) has proved to hold promise for clinical implementation. The myocardial distribution ...

  17. Een bepalingsmethode voor thallium in regenwater met behulp van voltammetrie

    NARCIS (Netherlands)

    Struijs; J.; Wolfs; P.M.; Esseveld; F.G.van


    In dit rapport wordt een bepalingmethode beschreven voor thallium in het nanogram/liter-gebied, waarbij gebruik wordt gemaakt van differentiele pulse-anodic stripping voltammetry (DPASV) aan de dunne kwikfilm. Met deze techniek blijkt het mogelijk om de concentratie van dit element rechtstreeks

  18. IRIS Toxicological Review of Thallium and Compounds (External Review Draft) (United States)

    Thallium compounds are used in the semiconductor industry, the manufacture of optic lenses and low-melting glass, low-temperature thermometers, alloys, electronic devices, mercury lamps, fireworks, and imitation germs, and clinically as an imaging agent in the diagnosis of certai...

  19. Band-Structure of Thallium by the LMTO Method

    DEFF Research Database (Denmark)

    Holtham, P. M.; Jan, J. P.; Skriver, Hans Lomholt


    The relativistic band structure of thallium has been calculated using the linear muffin-tin orbital (LMTO) method. The positions and extents of the bands were found to follow the Wigner-Seitz rule approximately, and the origin of the dispersion of the bands was established from the canonical s...

  20. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)

    A simple, rapid and selective complexometric method is proposed for the determination of thallium(III), using mercaptoethane(EtSH) as demasking agent. The sample solution containing Tl(III) is first complexed with excess EDTA and the surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using ...

  1. Selective Thallium (I Ion Sensor Based on Functionalised ZnO Nanorods

    Directory of Open Access Journals (Sweden)

    Z. H. Ibupoto


    Full Text Available Well controlled in length and highly aligned ZnO nanorods were grown on the gold-coated glass substrate by hydrothermal growth method. ZnO nanorods were functionalised with selective thallium (I ion ionophore dibenzyldiaza-18-crown-6 (DBzDA18C6. The thallium ion sensor showed wide linear potentiometric response to thallium (I ion concentrations ( M to  M with high sensitivity of 36.87 ± 1.49 mV/decade. Moreover, thallium (I ion demonstrated fast response time of less than 5 s, high selectivity, reproducibility, storage stability, and negligible response to common interferents. The proposed thallium (I ion-sensor electrode was also used as an indicator electrode in the potentiometric titration, and it has shown good stoichiometric response for the determination of thallium (I ion.

  2. Dicty_cDB: VHP179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP179 (Link to dictyBase) - - - Contig-U16441-1 VHP179P (Link to Original site) VHP...179F 666 VHP179Z 631 VHP179P 1277 - - Show VHP179 Library VH (Link to library) Clone ID VHP...e URL Representative seq. ID VHP...179P (Link to Original site) Representative DNA sequence >VHP179 (VHP179Q) /CSM/VH/VHP1-D/VHP...mylinkeilfmvmqdiikemiilwl*ishlmekpkf qyqmmqvkhfqpqqffhiklyqfhhi*ilrv**lhvpiisf*lvkilv*hgtmhhpmvmf yshqvvqafq

  3. 49 CFR 179.100-7 - Materials. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Materials. 179.100-7 Section 179.100-7 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS...

  4. 49 CFR 179.220-7 - Materials. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Materials. 179.220-7 Section 179.220-7 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS...

  5. 49 CFR 179.300-7 - Materials. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Materials. 179.300-7 Section 179.300-7 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS...

  6. 49 CFR 179.200-7 - Materials. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Materials. 179.200-7 Section 179.200-7 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS...

  7. 49 CFR 179.400-5 - Materials. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Materials. 179.400-5 Section 179.400-5 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS...

  8. 5 CFR 179.207 - Hearing. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Hearing. 179.207 Section 179.207 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS... copies of such records to the employee. (e) Hearing official. The Office may request an administrative...

  9. 5 CFR 179.215 - Refunds. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Refunds. 179.215 Section 179.215 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS... (unless expressly prohibited by statute or regulation); or (2) An administrative or judicial order directs...

  10. A Simple and Rapid Complexometric Determination of Thallium(III ...

    African Journals Online (AJOL)



    Oct 8, 2005 ... surplus EDTA is removed by titration at pH 5–6 with zinc sulphate solution using xylenol orange as indicator. ... Reproducible and accurate results are obtained in the concentration range 4–80 mg of thallium with a relative error ≤ ±0.6% .... soluble and stable 1:1 complex with Tl(I) so formed.22 This was.

  11. Thallium in the hydrosphere of south west England

    Energy Technology Data Exchange (ETDEWEB)

    Law, Sin [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom); Turner, Andrew, E-mail: [School of Geography, Earth and Environmental Sciences, University of Plymouth, Drake Circus, Plymouth PL4 8AA (United Kingdom)


    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L{sup -1}) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L{sup -1} were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration ({approx}1400 ng L{sup -1}) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. - Highlights: > Thallium concentrations have been measured in natural and waste waters from south west England. > Dissolved concentrations spanned three orders of magnitude and were highest in water from an abandoned mine. > Inputs associated with historical metal mine workings are the most important to the regional hydrosphere. - Concentrations of dissolved thallium in waters of south west England span two orders of magnitude and are greatest in water from an abandoned mine.

  12. 46 CFR 179.210 - Collision bulkhead. (United States)


    ...) SUBDIVISION, DAMAGE STABILITY, AND WATERTIGHT INTEGRITY Subdivision and Damage Stability Requirements § 179... wood on or after March 11, 2001, and operates in cold water. (c) A double-ended ferry required to have...

  13. Nuclear Data Sheets for 179Ir (United States)

    Baglin, Coral M.


    Nuclear structure data pertaining to 179Ir have been compiled and evaluated, and incorporated into the ENSDF data file. This evaluation of 179Ir supersedes the previous publication (C. Baglin, Nuclear Data Sheets 72,617 (1994) (literature cutoff date September 1994)), and includes literature available by 8 October 1998. The newly incorporated references are: 96Ji04 (which supersedes 93JiZW), 95Au04, 95Bi01 and 94Mu18.

  14. Sodium dithionite as a selective demasking agent for the complexometric determination of thallium

    Directory of Open Access Journals (Sweden)



    Full Text Available Sodium dithionite is proposed as a new demasking agent for the rapid and selective complexometric determination of thallium(III. In the presence of diverse metal ions, thallium (III was first complexed with excess EDTA and the surplus EDTAwas then titrated with a standard zinc sulphate solution at pH 5–6 (hexamine buffer using Xylenol Orange as the indicator. The EDTAequivalent to thallium was then released selectively with sodium dithionite and back titrated with a standard zinc sulphate solution as before. Reproducible and accurate results were obtained in the range 4–100 mg of thallium with a relative error of ±27 % and a coefficient of variation (n = 6 of not more than 0.30 %. The effects of various diverse ions were studied. The method was applied to the determination of thallium in its complexes and in alloys.

  15. Dicty_cDB: CFF179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFF179 (Link to dictyBase) - - - Contig-U14022-1 CFF179Z (Link to Original site) -...(Link to library) Clone ID CFF179 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig...Contig-U14022-1 Original site URL Representative...Representative seq. ID CFF179Z (Link to Original site) Representative DNA sequence >CFF179 (CFF179Q) /CSM/CF/CFF1-D/CFF179Q...XXXXXXXXXXTAAAAAGAAGAATGAGTCATCAAAAGGTGTAACAAAAACTCATAAAGTTG ATGATCCAAAAGTATTATCAACAAAATCTTCAACTTTGGCAGCTACTTCCACAAGTAGAC

  16. [Efficiency of hemoperfusion on clearing thallium based on atomic absorption spectrometry]. (United States)

    Tian, Tian; Wang, Yongan; Nie, Zhiyong; Wang, Jiao; Peng, Xiaobo; Yuan, Ye; Li, Wanhua; Qiu, Zewu; Xue, Yanping; Xiong, Yiru


    To determine thallium in whole blood by atomic absorption detection method, and to investigate the eliminating effect of hemoperfusion (HP) for thallium in blood. The blood of Beagle dogs which had not exposed to thallium before were obtained for preparation of thallium nitrate ( TlNO3 )-containing solution in three concentrations according to the conversion formula based on animal weight and volume of blood. HP was performed in the simulated in vivo environment. The content of TlNO3 in blood of the next group was determined on the amount of TlNO3 for the last HP of the former dose group. Thallium quantity in different samples was measured with atomic absorption spectrometer blood samples before and after HP. Finally, the thallium concentration in blood was analyzed statistically. Thallium concentrations showed a good linear relationship in the range of 0-200 μg/L (r = 0.998 4). The intra-day precision (RSD) was lower than 4.913%, the intra-day recovery rate was 96.2%-111.9%; the inter-day precision (RSD) was lower than 7.502%, the inter-day recovery rate was 89.6%-105.2%. The concentration of thallium in blood was significantly reduced after HP per time in high, middle, and low dose groups [(453.43 ± 27.80) mg/L to (56.09 ± 14.44) mg/L in high dose group, F = 8.820, P = 0.003; (64.51 ± 13.60) mg/L to (3.19 ± 0.23) mg/L in middle dose group, F = 36.312, P = 0.000; (5.40 ± 0.98) mg/L to (0.38 ± 0.25) mg/L in low dose group, F = 46.240, P = 0.000 ]. The adsorption rate of four times of HP in high, middle and low dose group were (87.63 ± 2.48 )%, (95.06 ± 1.54 )% and (92.76 ± 4.87)%, respectively, without significant difference (F = 4.231, P = 0.070). The method for measuring thallium was established, and it shows a very stable, simple, sensitive for determination of thallium. HP can effectively remove thallium from blood. Thallium concentration can be reduced by 90% after four times of HP. HP is also effective even when thallium concentration is not high.

  17. S179D prolactin: antagonistic agony! (United States)

    Walker, Ameae M


    The aims of this review are three-fold: first, to collate what is known about the production and activities of phosphorylated prolactin (PRL), the latter largely, but not exclusively, as illustrated through the use of the molecular mimic, S179D PRL; second, to apply this and related knowledge to produce an updated model of prolactin-receptor interactions that may apply to other members of this cytokine super-family; and third, to promote a shift in the current paradigm for the development of clinically important growth antagonists. This third aim explains the title since, based on results with S179D PRL, it is proposed that agents which signal to antagonistic ends may be better therapeutics than pure antagonists-hence antagonistic agony. Since S179D PRL is not a pure antagonist, we have proposed the term selective prolactin receptor modulator (SPeRM) for this and like molecules.

  18. Left ventricular dilatation and pulmonary thallium uptake after single-photon emission computer tomography using thallium-201 during adenosine-induced coronary hyperemia

    Energy Technology Data Exchange (ETDEWEB)

    Iskandrian, A.S.; Heo, J.; Nguyen, T.; Lyons, E.; Paugh, E. (Philadelphia Heart Institute, PA (USA))


    This study examined the implications of left ventricular (LV) dilatation and increased pulmonary thallium uptake during adenosine-induced coronary hyperemia. The lung-to-heart thallium ratio in the initial images was significantly higher in patients with coronary artery disease (CAD) than normal subjects; 0.48 +/- 0.16 in 3-vessel disease (n = 16), 0.43 +/- 0.10 in 2-vessel disease (n = 20), 0.43 +/- 0.08 in 1-vessel disease (n = 16) and 0.36 +/- 0.05 in normal subjects (n = 7) (p less than 0.001, 0.09 and 0.06, respectively). There was a significant correlation between the severity and the extent of the perfusion abnormality (determined from the polar maps) and the lung-to-heart thallium ratio (r = 0.51 and 0.52, respectively, p less than 0.0002). There was also a significant correlation between lung thallium washout and lung-to-heart thallium ratio (r = 0.42, p = 0.0009) and peak heart rate (r = -0.49, p less than 0.0001). The LV dilatation was mostly due to an increase in cavity dimension (30% increase) and to a lesser extent (6% increase) due to increase in LV size. (The cavity dimensions were measured from the short-axis slices at the midventricular level in the initial and delayed images). The dilation was seen in patients with CAD but not in the normal subjects. These changes correlated with the extent and severity of the thallium perfusion abnormality. Thus, adenosine-induced coronary hyperemia may cause LV dilation and increased lung thallium uptake on the basis of subendocardial ischemia.

  19. 49 CFR 179.500-5 - Material. (United States)


    ... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS Specification for Cryogenic Liquid Tank Car Tanks and Seamless Steel Tanks (Classes DOT-113 and 107A) § 179.500-5 Material. (a) Tanks shall be made from open-hearth or electric steel of uniform quality. Material...

  20. Reference: 179 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 179 Vincent Patrick...ogy Allen Nina|Bankaitis Vytas A|Bibikova Tatiana N|Chua Michael|Fairbrother Ashley|Gilroy Simon|Mekeel Hal|Nogue Fabien|Vincent Patrick|Xu Yue

  1. Early detection of restenosis after successful percutaneous transluminal coronary angioplasty by exercise-redistribution Thallium scintigraphy

    NARCIS (Netherlands)

    W. Wijns (William); P.W.J.C. Serruys (Patrick); J.H.C. Reiber (Johan); P.J. de Feyter (Pim); M.J.B.M. van den Brand (Marcel); M.L. Simoons (Maarten); P.G. Hugenholtz (Paul)


    textabstractThe value of exercise testing and thallium scintigraphy in predicting recurrence of angina pectoris and restenosis after a primary successful transluminal coronary angioplasty (PTCA) was prospectively evaluated. In 89 patients, a symptom-limited exercise electrocardiogram (ECG) and

  2. Dicty_cDB: VFG179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFG179 (Link to dictyBase) - - - Contig-U12091-1 VFG179P (Link to Original site) VFG179F...(Link to library) Clone ID VFG179 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig...Contig-U12091-1 Original site URL Representative...Representative seq. ID VFG179P (Link to Original site) Representative DNA sequence >VFG179 (VFG179Q) /CSM/VF/VFG1-D/VFG179Q...d/ AATTTAAAAAACAATTATAAAAACAACAAATACAAAAATGATTAAGAATAGAAAATTAGA TATTACTTCAACTAATGTTGCTGGTATTGGAACAGAT

  3. Oral zinc sulphate in treatment of patients with thallium poisoning: A clinical therapeutic trial

    Directory of Open Access Journals (Sweden)

    Ahmed A. Al-Mohammadi


    Full Text Available Thallium poisoning is usually associated with typical dermatological features simulating that of zinc deficiency. The aim of this study was to evaluate the role of oral zinc sulphate in the treatment of patients with thallium poisoning.Materials and methods: This clinical therapeutic trial study was conducted in Departments of Dermatology of Baghdad and Basrah Teaching Hospitals from February 2008 - February 2010, where a total of 37 patients with thallium poisoning were enrolled.A detailed history was taken from all patients and complete clinical examination was performed. All patients received zinc sulphate in a dose of 5 mg/kg three times a day few days before confirming the diagnosis of thallium poisoning. Thallium in urine had been measured using the colorimetric method and was positive in all patients. After confirming the diagnosis of thallium poisoning, thallium antidotes Prussian blue was given to 32 patients.Results: Age range of 37 patients was 5-33 (24±5.3 years. The dermatological findings were mainly: anagen hair loss affected the scalp and limbs. Also, dusky ecchymotic red dermatitis like rash was observed on the face and dorsum of hands and legs, while neurological manifestations were mainly of peripheral neuropathy, were reported in 21 (55% patients. All patients but two responded promptly to a trial of zinc sulphate within few days.Conclusion: Oral Zinc sulphate appears to be an effective and safe treatment for thallium poisoning particularly for skin and hair features and in reducing its lethal progression and complications. J Clin Exp Invest 2011;2(2:133-7

  4. Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices (United States)


    THALLIUM(I) IN REVERSE OSMOSIS AND CHLORINATED WATER MATRICES ECBC-TR-1127 Approved for public release; distribution is unlimited...3. DATES COVERED (From - To) Apr 2010 - Dec 2011 4. TITLE AND SUBTITLE Fate of Thallium(I) in Reverse Osmosis and Chlorinated Water Matrices... osmosis (RO) and RO water with added chlorine (RO-Cl) was measured using inductively coupled plasma optical emission spectroscopy (ICP-OES) for a period of

  5. Thallium in the hydrosphere of south west England. (United States)

    Law, Sin; Turner, Andrew


    Thallium is a highly toxic metal whose environmental concentrations, distributions and behaviour are not well understood. In the present study we measure the concentrations of Tl in filtered and unfiltered samples of rain, tap, river, estuarine and waste waters collected from south west England. Dissolved Tl was lowest (<20 ng L(-1)) in tap water, rain water, treated sewage and landfill effluents, estuarine waters, and rivers draining catchments of sandstones and shales. Concentrations up to about 450 ng L(-1) were observed in rivers whose catchments are partly mineralized and where metal mining was historically important, and the highest concentration (~1400 ng L(-1)) was measured in water abstracted directly from an abandoned mine. Compared with other trace metals measured (e.g. As, Cd, Co, Cr, Cu, Ni, Pb, Zn), Tl has a low affinity for suspended particles and undergoes little removal by conventional (hydroxide precipitation) treatment of mine water. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Qualitative evaluation of coronary flow during anesthetic induction using thallium-201 perfusion scans

    Energy Technology Data Exchange (ETDEWEB)

    Kleinman, B.; Henkin, R.E.; Glisson, S.N.; el-Etr, A.A.; Bakhos, M.; Sullivan, H.J.; Montoya, A.; Pifarre, R.


    Qualitative distribution of coronary flow using thallium-201 perfusion scans immediately postintubation was studied in 22 patients scheduled for elective coronary artery bypass surgery. Ten patients received a thiopental (4 mg/kg) and halothane induction. Twelve patients received a fentanyl (100 micrograms/kg) induction. Baseline thallium-201 perfusion scans were performed 24 h prior to surgery. These scans were compared with the scans performed postintubation. A thallium-positive scan was accepted as evidence of relative hypoperfusion. Baseline hemodynamic and ECG data were obtained prior to induction of anesthesia. These data were compared with the data obtained postintubation. Ten patients developed postintubation thallium-perfusion scan defects (thallium-positive scan), even though there was no statistical difference between their baseline hemodynamics and hemodynamics at the time of intubation. There was no difference in the incidence of thallium-positive scans between those patients anesthetized by fentanyl and those patients anesthetized with thiopental-halothane. The authors conclude that relative hypoperfusion, and possibly ischemia, occurred in 45% of patients studied, despite stable hemodynamics, and that the incidence of these events was the same with two different anesthetic techniques.

  7. 49 CFR 179.103-2 - Manway cover. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Manway cover. 179.103-2 Section 179.103-2... Specifications for Pressure Tank Car Tanks (Classes DOT-105, 109, 112, 114 and 120) § 179.103-2 Manway cover. (a) The manway cover must be an approved design. (b) If no valves or measuring and sampling devices are...

  8. Dicty_cDB: VFI179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available s*ysfkik*nnsf*sisfkmsw Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VSE471 (VSE471...Q) /CSM/VS/VSE4-C/VSE471Q.Seq.d/ 930 0.0 VFI179 (VFI179Q) /CSM/VF/VFI1-D/VFI179Q.Seq.d/ 930 0

  9. 49 CFR 179.12 - Interior heater systems. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Interior heater systems. 179.12 Section 179.12... Design Requirements § 179.12 Interior heater systems. (a) Interior heater systems shall be of approved... each compartment. (b) Each interior heater system shall be hydrostatically tested at not less than 13...

  10. 29 CFR 4.179 - Identification of contract work. (United States)


    ... 29 Labor 1 2010-07-01 2010-07-01 true Identification of contract work. 4.179 Section 4.179 Labor... Compliance with Compensation Standards § 4.179 Identification of contract work. Contractors and... workweek are engaged in performing work on such contracts. If such a contractor during any workweek is not...

  11. 5 CFR 179.306 - Written agreement for repayment. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Written agreement for repayment. 179.306 Section 179.306 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.306 Written agreement for repayment. A debtor who admits...

  12. 5 CFR 179.301 - Scope of regulations. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Scope of regulations. 179.301 Section 179.301 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.301 Scope of regulations. These regulations apply to the...

  13. 5 CFR 179.214 - Interest, penalties and administrative costs. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Interest, penalties and administrative costs. 179.214 Section 179.214 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Salary Offset § 179.214 Interest, penalties and administrative costs...

  14. 5 CFR 179.218 - Additional administrative collection action. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Additional administrative collection action. 179.218 Section 179.218 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Salary Offset § 179.218 Additional administrative collection action...

  15. 5 CFR 179.309 - Additional administrative procedures. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Additional administrative procedures. 179.309 Section 179.309 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS CLAIMS COLLECTION STANDARDS Administrative Offset § 179.309 Additional administrative procedures. Nothing...

  16. Comparison of thallium deposition with segmental perfusion in pigs with chronic hibernating myocardium. (United States)

    Baldwa, Sunil; Rana, Muzamil; Canty, John M; Fallavollita, James A


    Viable, chronically dysfunctional myocardium with reduced resting flow (or hibernating myocardium) is an important prognostic factor in ischemic heart disease. Although thallium-201 imaging is frequently used to assess myocardial viability in patients with ischemic cardiomyopathy, there are limited data regarding its deposition in hibernating myocardium, and this data suggest that thallium retention may be supernormal compared with control myocardium. Accordingly, pigs (n=7) were chronically instrumented with a 1.5 mm Delrin stenosis on the proximal left anterior descending coronary artery (LAD) to produce hibernating myocardium. Four months later, severe anteroapical hypokinesis was documented with contrast ventriculography (wall motion score, 0.7+/-0.8; normal=3), and microsphere measurements confirmed reduced resting flow (LAD subendocardium, 0.78+/-0.34 vs. 0.96+/-0.24 ml.min(-1).g(-1) in remote; P<0.001). Absolute deposition of thallium-201 and insulin-stimulated [18F]-2 fluoro-2-deoxyglucose (FDG) were assessed over 1 h and compared with resting flow (n=704 samples). Thallium-201 deposition was only weakly correlated with perfusion (r2=0.20; P<0.001) and was more homogeneously distributed (relative dispersion, 0.12+/-0.03 vs. 0.29+/-0.10 for microsphere flow; P<0.01). Thus after 1 h relative thallium-201 (subendocardium LAD/remote, 0.96+/-0.16) overestimated relative perfusion (0.78+/-0.32; P<0.0001) and underestimated the relative reduction in flow. Viability was confirmed by both histology and preserved FDG uptake. We conclude that under resting conditions, thallium-201 redistribution in hibernating myocardium is nearly complete within 1 h, with similar deposition to remote myocardium despite regional differences in flow. These data suggest that in this time frame thallium-201 deposition may not discriminate hibernating myocardium from dysfunction myocardium with normal resting flow. Since hibernating myocardium has been associated with a worse prognosis

  17. Thallium uptake and biological behaviour in childhood brain tumours

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, E.J.; Howman-Giles, R.; Kellie, S.; Uren, R.F. [Royal Alexandra Hospital for Children, Sydney, NSW (Australia)


    Full text: The histopathological grade and radiological appearance of the diverse cerebral neoplasms in childhood frequently poorly reflect their biological behaviour. We examined thallium accumulation prior to treatment (and in several cases, at intervals there after) in 13 children to determine its usefulness as a tumour marker. 23 SPECT studies were acquired 20 minutes after the injection of 1-3 mCi of {sup 201}TI. Thallium index (TI), the ratio of counts in tumour/normal brain, was calculated. No uptake was seen in two patients (pts) with a Grade 1 cerebellar astrocytomas (disease free at 4/12 f/u). Three pts with medulloblastomas were studied. One pt showed intense uptake (Tl =12). His tumour (proliferative antigen stain Ki67 = 50%) recurred early after debulking surgery (Tl +ve prior to CT or MRI changes). The second pt was imaged at relapse (Ki67 = 60%) and showed intense uptake, Tl = 17. The third pt showed lower level uptake (Tl = 2), Ki67 = 5%, and is disease-free at 5/12 (as per {sup 201}TI and MRI). One pt with a Grade 1 brainstem glioma showed Tl = 5 and has progressed rapidly despite low grade histology. Four pts with chiasmatic-hypothalamic gliomas have been studied. Although these neoplasms are usually low grade histologically, their growth properties vary greatly. Two pts with Tl<2.5 have been conservatively managed because of slow tumour growth. The other two pts have Tl>3.5 and have required aggressive treatment for rapid disease progression. One pt with a large pilocytic astrocytoma of the optic chiasm showed Tl = 9.5. Active treatment was not undertaken. One pt with a pineal germ cell tumour showed avid {sup 201}TI uptake (Tl not performed) and has had two normal studies, and is clinically well, since BMT. Avid {sup 201}TI uptake also seen in one pt with cerebral neuroblastoma. (Died at 8/12 after Dx.) Thus, {sup 201}TI accumulates in histologically diverse paediatric neoplasms. The Tl appears to reflect biological behaviour in the limited

  18. Evaluation of muscular lesions in connective tissue diseases: thallium 201 muscular scans

    Energy Technology Data Exchange (ETDEWEB)

    Guillet, G.; Guillet, J.; Sanciaume, C.; Maleville, J.; Geniaux, M.; Morin, P.


    We performed thallium 201 muscle scans to assess muscular involvement in 40 patients with different connective tissue diseases (7 with dermatomyositis, 7 with systemic lupus erythematosus, 12 with progressive systemic scleroderma, 2 with calcinosis, Raynaud's phenomenon, esophageal involvement, sclerodactyly, and telangiectasia (CREST) syndrome, 3 with monomelic scleroderma, 6 with morphea, and 3 with Raynaud's disease). Only 12 of these patients complained of fatigability and/or myalgia. Electromyography was performed and serum levels of muscle enzymes were measured in all patients. Comparison of thallium 201 exercise recording with the other tests revealed that scan sensitivity is greater than electromyographic and serum muscle enzymes levels. Thallium 201 scans showed abnormal findings in 32 patients and revealed subclinical lesions in 18 patients, while electromyography findings were abnormal in 25 of these 32 patients. Serum enzyme levels were raised in only 8 patients. Thallium 201 scanning proved to be a useful guide for modifying therapy when laboratory data were conflicting. It was useful to evaluate treatment efficacy. Because our data indicate a 100% positive predictive value, we believe that thallium 201 scanning should be advised for severe systemic connective tissue diseases with discordant test results.

  19. Exercise-induced thallium-201 myocardial perfusion defects in angina pectoris without significant coronary artery stenosis

    Energy Technology Data Exchange (ETDEWEB)

    Nakazato, Masayasu; Maruoka, Yuji; Sunagawa, Osahiko; Kinjo, Kunihiko; Tomori, Masayuki; Fukiyama, Koshiro (Ryukyu Univ., Nishihara, Okinawa (Japan). School of Medicine)


    We performed exercise thallium-201 myocardial scintigraphy in 32 patients with angina pectoris to study the incidence of perfusion defects, who had no significant organic stenosis on coronary angiography. None of them had myocardial infarction or cardiomyopathy. Thallium-201 myocardial scintigraphy and 12-lead ECG recording were performed during supine bicycle ergometer exercise. Perfusion defects in thallium-201 scintigrams in SPECT images were assessed during visual analysis by two observers. In the coronary angiograms obtained during intravenous infusion of nitroglycerin, the luminal diameter of 75% stenosis or less in the AHA classification was regarded as an insignificant organic stenosis. Myocardial perfusion defects in the thallium-201 scintigrams were detected in eight (25%) of the 32 patients. Six of these eight patients had variant angina documented during spontaneous attacks with ST elevations in standard 12-lead ECGs. Perfusion defects were demonstrated at the inferior or infero-posterior regions in six patients, one of whom had concomitant anteroseptal defect. The defects were not always accompanied by chest pain. All but one patient demonstrating inferior or inferoposterior defects showed ST depression in leads II, III and aV{sub F} on their ECGs, corresponding to inferior wall ischemia. The exception was a case with right bundle branch block. Thus, 25% of the patients with angina pectoris, who had no evidence of significant organic stenosis on their coronary angiograms, exhibited exercise-induced perfusion defects in their thallium-201 scintigrams. Coronary spasms might have caused myocardial ischemia in these patients. (author).

  20. Advanced crystal growth techniques for thallium bromide semiconductor radiation detectors (United States)

    Datta, Amlan; Becla, Piotr; Guguschev, Christo; Motakef, Shariar


    Thallium Bromide (TlBr) is a promising room-temperature radiation detector candidate with excellent charge transport properties. Currently, Travelling Molten Zone (TMZ) technique is widely used for growth of semiconductor-grade TlBr crystals. However, there are several challenges associated with this type of crystal growth process including lower yield, high thermal stress, and low crystal uniformity. To overcome these shortcomings of the current technique, several different crystal growth techniques have been implemented in this study. These include: Vertical Bridgman (VB), Physical Vapor Transport (PVT), Edge-defined Film-fed Growth (EFG), and Czochralski Growth (Cz). Techniques based on melt pulling (EFG and Cz) were demonstrated for the first time for semiconductor grade TlBr material. The viability of each process along with the associated challenges for TlBr growth has been discussed. The purity of the TlBr crystals along with its crystalline and electronic properties were analyzed and correlated with the growth techniques. Uncorrected 662 keV energy resolutions around 2% were obtained from 5 mm x 5 mm x 10 mm TlBr devices with virtual Frisch-grid configuration.

  1. Thallium distribution in sediments from the Pearl river basin, China

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Juan [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Jin; Chen, Yongheng [Guangzhou University, Key Laboratory of Waters Safety and Protection in the Pearl River Delta, Ministry of Education, Guangzhou (China); Qi, Jianying [Department of Environmental Science and Engineering, Guangzhou University, Guangzhou (China); Lippold, Holger [Forschungszentrum Dresden-Rossendorf (FZD), Institute of Radiochemistry, Research Site Leipzig, Leipzig (Germany); Wang, Chunlin [Guangdong Provincial Academy of Environmental Science, Guangzhou (China)


    Thallium (Tl) is a rare element of high toxicity. Sediments sampled in three representative locations near industries utilizing Tl-containing raw materials from the Pearl River Basin, China were analyzed for their total Tl contents and the Tl contents in four sequentially extracted fractions (i.e., weak acid exchangeable, reducible, oxidizable, and residual fraction). The results reveal that the total Tl contents (1.25-19.1 {mu}g/g) in the studied sediments were slightly high to quite high compared with those in the Chinese background sediments. This indicates the apparent Tl contamination of the investigated sediments. However, with respect to the chemical fractions, Tl is mainly associated with the residual fraction (>60%) of the sediments, especially of those from the mining area of Tl-bearing pyrite minerals, indicating the relatively low mobility, and low bioavailability of Tl in these sediments. This obviously contrasts with the previous findings that Tl is mainly entrapped in the first three labile fractions of the contaminated samples. Possible reasons were given for the dominating association of Tl with the residual fraction (>95%) of the mining area sediments. The significant role of certain K-containing silicates or minerals of these sediments on retaining Tl in the residual fraction, discovered by this study, provides a special field of research opportunity for the Tl-containing wastewater treatment. (Copyright copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  2. Nuclear Data Sheets for A = 179 (United States)

    Baglin, Coral M.


    Nuclear structure data pertaining to all nuclei with mass number A = 179 (Yb, Lu, Hf, Ta, W, Re, Os, Ir, Pt, Au, Hg, Tl) have been compiled and evaluated, and incorporated into the ENSDF database. This evaluation for A = 179, which considers data available by 15 November 2008, supersedes the previous complete publication (E. Browne, Nuclear Data Sheets55, 483 (1988), cutoff September 1987) and the update-mode publication (C. Baglin, Nuclear Data Sheets72, 617 (1994), cutoff date September 1994), as well as the subsequent evaluations of Ta, Ir and Tl by C. Baglin (literature cutoff dates January 2000, October 1998 and February 2001, respectively). The newly evaluated literature provides new Coulomb excitation data for Hf, transfer reaction data for Hf and Ta, new information on Au and Hg from α decay and significant (HI,xnγ) reaction data for Hf, Ta, Re, Au and Hg. At the time of the 1994 evaluation, no γ-ray information was available for Au or Hg; that situation has now changed dramatically, although additional work on details of the low-lying structure of Au could be instructive.

  3. [Graphite furnace atomic absorption spectrometry for determination of thallium in blood]. (United States)

    Zhang, Q L; Gao, G


    Colloidal palladium was used as chemical modifier in the determination of blood thallium by graphite furnace atomic absorption spectrometry. Blood samples were precipitated with 5% (V/V)nitric acid, and then determined by GFAAS with colloidal palladium used as a chemical modifier. 0.2% (W/V)sodium chloride was added in the standard series to improve the matrix matching between standard solution and sample. The detection limit was 0.2 μg/L. The correlation coefficient was 0.9991. The recoveries were between 93.9% to 101.5%.The relative standard deviations were between 1.8% to 2.7%.The certified reference material of whole blood thallium was determined and the result was within the reference range Conclusion: The method is accurate, simple and sensitive, and it can meet the needs of detection thallium in blood entirely.

  4. Myocardial perfusion defect on thallium-201 imaging in patients with chronic obstructive pulmonary disease

    Energy Technology Data Exchange (ETDEWEB)

    Mehrotra, P.P.; Weaver, Y.J.; Higginbotham, E.A.


    Six patients with angina pectoris had reversible perfusion defects on stress and redistribution thallium imaging. Three patients had a positive electrocardiographic response to exercise. No significant coronary artery lesions were seen on coronary arteriography in any of the six patients. All had mild to moderate hypoxemia at rest and physiologic evidence of chronic obstructive pulmonary disease as defined by the decrease in the ratio of forced expiratory volume at 1 second to forced vital capacity (FEV1/FVC X 100) or decrease in the forced midexpiratory flow rate (FEF25-75), or both. None had clinical findings suggestive of any of the reported causes of positive thallium scans in patients with normal coronary arteriograms. Cellular dysfunction produced by hypoxemia affecting the uptake of thallium seems to be the most likely mechanism of this abnormality.

  5. Early and delayed thallium-201 scintigraphy in thyroid nodules: the relationship between early thallium-201 uptake and perfusion

    Energy Technology Data Exchange (ETDEWEB)

    Derebek, E. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Biberoglu, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Kut, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yesil, S. [Dept. of Internal Medicine, Div. of Endocrinology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Saydam, S. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yilmaz, M. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Yenici, O. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Igci, E. [Dept. of Radiology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Gokce, O. [Dept. of Surgery, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Canda, S. [Dept. of Pathology, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Bueyuekgebiz, A. [Dept. of Pediatrics, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Dogan, A.S. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey); Durak, H. [Dept. of Nuclear Medicine, Dokuz Eylul Univ., School of Medicine, Izmir (Turkey)


    Seventy-six patients with tyroid nodules were studied. Initially, 75 MBq of thallium-201 was injected. The thyroid gland was imaged 15 min (early) and 3 h (delayed) after the injection. Thereafter, 185 MBq technetium-99m pertechnetate was injected. Immediately after the injection, a 1-min perfusion image was acquired, followed by an image at 20 min. Increased early and delayed {sup 201}Tl uptake compared with the contralateral thyroid tissue was adopted as the criterion for malignancy. Sensitivity, specificity and negative predictive values were found to be 85%, 64% and 78%, respectively, in operated patients, but these values were 86%, 87% and 95%, respectively, in the whole group, including patients followed with fine-needle aspiration biopsy. With the purpose of investigating the relationship between perfusion and early {sup 201}Tl uptake, bot perfusion and early images were graded comparing nodular activity with contralateral thyroid activity. There was a poor correlation between perfusion and {sup 201}Tl uptake. The correlation was even worse in hyperactive nodules. It is concluded that early and delayed {sup 201}Tl imaging should not be used in the differential diagnosis of cold nodules and that early {sup 201}Tl uptake seems to be more closely related to factors other than perfusion. (orig.)

  6. Overlapping toxic effect of long term thallium exposure on white mustard (Sinapis alba L.) photosynthetic activity. (United States)

    Mazur, Radosław; Sadowska, Monika; Kowalewska, Łucja; Abratowska, Agnieszka; Kalaji, Hazem M; Mostowska, Agnieszka; Garstka, Maciej; Krasnodębska-Ostręga, Beata


    Heavy metal exposure affect plant productivity by interfering, directly and indirectly, with photosynthetic reactions. The toxic effect of heavy metals on photosynthetic reactions has been reported in wide-ranging studies, however there is paucity of data in the literature concerning thallium (Tl) toxicity. Thallium is ubiquitous natural trace element and is considered the most toxic of heavy metals; however, some plant species, such as white mustard (Sinapis alba L.) are able to accumulate thallium at very high concentrations. In this study we identified the main sites of the photosynthetic process inhibited either directly or indirectly by thallium, and elucidated possible detoxification mechanisms in S. alba. We studied the toxicity of thallium in white mustard (S. alba) growing plants and demonstrated that tolerance of plants to thallium (the root test) decreased with the increasing Tl(I) ions concentration in culture media. The root growth of plants exposed to Tl at 100 μg L(-1) for 4 weeks was similar to that in control plants, while in plants grown with Tl at 1,000 μg L(-1) root growth was strongly inhibited. In leaves, toxic effect became gradually visible in response to increasing concentration of Tl (100 - 1,000 μg L(-1)) with discoloration spreading around main vascular bundles of the leaf blade; whereas leaf margins remained green. Subsequent structural analyses using chlorophyll fluorescence, microscopy, and pigment and protein analysis have revealed different effects of varying Tl concentrations on leaf tissue. At lower concentration partial rearrangement of the photosynthetic complexes was observed without significant changes in the chloroplast structure and the pigment and protein levels. At higher concentrations, the decrease of PSI and PSII quantum yields and massive oxidation of pigments was observed in discolored leaf areas, which contained high amount of Tl. Substantial decline of the photosystem core proteins and disorder of the

  7. Stable room-temperature thallium bromide semiconductor radiation detectors (United States)

    Datta, A.; Fiala, J.; Becla, P.; Motakef, Shariar


    Thallium bromide (TlBr) is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br- species, with an estimated electro-diffusion velocity of 10-8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br- ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation) for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  8. Thallium pollution in China: A geo-environmental perspective. (United States)

    Xiao, Tangfu; Yang, Fei; Li, Shehong; Zheng, Baoshan; Ning, Zengping


    It is well known that thallium (Tl) is a non-essential and toxic metal to human health, but less is known about the geo-environmentally-induced Tl pollution and its associated health impacts. High concentrations of Tl that are primarily associated with the epithermal metallogenesis of sulfide minerals have the potential of producing Tl pollution in the environment, which has been recognized as an emerging pollutant in China. This paper aims to review the research progress in China on Tl pollution in terms of the source, mobility, transportation pathway, and health exposure of Tl and to address the environmental concerns on Tl pollution in a geo-environmental perspective. Tl associated with the epithermal metallogenesis of sulfide minerals has been documented to disperse readily and accumulate through the geo-environmental processes of soil enrichment, water transportation and food crop growth beyond a mineralized zone. The enrichments of Tl in local soil, water, and crops may result in Tl pollution and consequent adverse health effects, e.g. chronic Tl poisoning. Investigation of the baseline Tl in the geo-environment, proper land use and health-related environmental planning and regulation are critical to prevent the Tl pollution. Examination of the human urinary Tl concentration is a quick approach to identify exposure of Tl pollution to humans. The experiences of Tl pollution in China can provide important lessons for many other regions in the world with similar geo-environmental contexts because of the high mobility and toxicity of Tl. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Stable room-temperature thallium bromide semiconductor radiation detectors

    Directory of Open Access Journals (Sweden)

    A. Datta


    Full Text Available Thallium bromide (TlBr is a highly efficient ionic semiconductor with excellent radiation detection properties. However, at room temperature, TlBr devices polarize under an applied electric field. This phenomenon not only degrades the charge collection efficiency of the detectors but also promotes chemical reaction of the metal electrodes with bromine, resulting in an unstable electric field and premature failure of the device. This drawback has been crippling the TlBr semiconductor radiation detector technology over the past few decades. In this exhaustive study, this polarization phenomenon has been counteracted using innovative bias polarity switching schemes. Here the highly mobile Br− species, with an estimated electro-diffusion velocity of 10−8 cm/s, face opposing electro-migration forces during every polarity switch. This minimizes the device polarization and availability of Br− ions near the metal electrode. Our results indicate that it is possible to achieve longer device lifetimes spanning more than 17 000 h (five years of 8 × 7 operation for planar and pixelated radiation detectors using this technique. On the other hand, at constant bias, 2500 h is the longest reported lifetime with most devices less than 1000 h. After testing several biasing switching schemes, it is concluded that the critical bias switching frequency at an applied bias of 1000 V/cm is about 17 μHz. Using this groundbreaking result, it will now be possible to deploy this highly efficient room temperature semiconductor material for field applications in homeland security, medical imaging, and physics research.

  10. Medical geology of arsenic, selenium and thallium in China. (United States)

    Li, Shehong; Xiao, Tangfu; Zheng, Baoshan


    Arsenic (As), selenium (Se) and thallium (Tl) are three trace metals (metalloids) of high concern in China because deficiency or excess expose can cause a range of endemic diseases, such as endemic arsenism, selenosis, Keshan disease (KD), Kashin-Beck disease (KBD) and thallotoxicosis. These specific endemic diseases were attributable for overabundance or deficiency (mainly referring to selenium) of these three elements in the local environment as a result of natural geochemical processes and/or anthropologic activities. The geochemistry and human health impacts of these three trace elements have been intensively studied since the 1970s in China, in terms of geochemical sources, distribution, transportation, health impact pathways, and prevention/remediation measures. Endemic arsenism in China are induced from the exposures of high As in either drinking water or domestic combustion of As-rich coals. Both endemic selenium deficiency and selenosis occurred in China. The KD and KBD were related to the deficiency of Se in the low-Se geological belt with Se contents in soil less than 0.125mg/kg stretching from northeast to southwest of China. Endemic selenosis occurred in areas with high Se concentrations in soils derived from the Se-enriched black carbonaceous siliceous rocks, carbonaceous shale and slate. Endemic Tl poisoning occurred in southwestern China due to Tl contamination in local drinking water and vegetables surrounding the Tl-rich sulfide mineralized areas. Some measures have been taken to control and remedy the endemic diseases with significant effects in reducing health risk and damage of As, Se and Tl. However, the states of the endemic diseases of As, Se and Tl in China are still serious in some areas, and substantial research efforts regarding the health impacts of these elements are further required. This paper reviews the progress of medical geology of As, Se and Tl in China, and provides with some outlooks for future research directions. Copyright

  11. New CZT cardiac cameras and myocardial perfusion imaging with thallium 201; Nouvelles cameras cardiaques a semi-conducteur cadmium -zinc- telluride (CZT) et scintigraphies myocardiques au thallium 201

    Energy Technology Data Exchange (ETDEWEB)

    Songy, B. [Service de medecine et imagerie nucleaire, centre cardiologique du Nord (CCN), 93 - Saint-Denis (France)


    Myocardial perfusion imaging is widely used for management of coronary artery disease. However, it suffers from technical limitations. New cardiac cameras using CZT detectors are now available and increase spatial (x2) and energy (x2) resolutions and photons sensitivity (x5). We describe here the General Electric Discovery NM 530c new camera and summarize the validation studies with technetium agents and with thallium 201, protocols to reduce doses, ultrafast protocols and perspectives offered with this new technology. (author)

  12. Genotoxic and mutagenic effects of the diagnostic use of thallium-201 in nuclear medicine

    Energy Technology Data Exchange (ETDEWEB)

    Kelsey, K.T. (Harvard School of Public Health, Boston, MA (United States)); Donohoe, K.J. (Beth Israel Hospital, Boston, MA (United States). Div. of Nuclear Medicine); Baxter, Barbara; Memisoglu, Asli; Little, J.B.; Caggana, Michele; Liber, H.L. (Harvard School of Public Health, Boston, MA (United States))


    In order to investigate possible mutagenetic effects of in vivo exposure to low levels of ionizing radiation used in nuclear medicine, the authors examined hypoxanthine guanine phosphoribosyl transferase (hprt) mutant fraction (MF) and chromosome aberration (CA) frequency in 24 nuclear medicine patients before and after injection of thallium-201. The mean MF of the thallium-201-exposed cohort was 5.2{+-}4.4 x 10{sup -6} before injection exposure. No significant difference in MF was observed 24 h later. In 11 patients who were studied on a 3rd occasion, 30 days after thallium-201 exposure, there was again no significant difference in post-exposure as compared with the pre-exposure MF. The frequency of CA in peripheral blood lymphocytes was not significantly different, comparing pre- and 24h to 1 month post-radionuclide exposure . Thus, thallium-201 exposure was not associated with significant elevations in MF or CA frequency in lymphocytes of exposed individuals. (author). 40 refs.; 3 tabs.

  13. Systematics of c-axis Phonons in the Thallium- and Bismuth-Based Cuprate Superconductors

    NARCIS (Netherlands)

    Tsvetkov, A. A; Dulic, D.; Marel, D. van der; Damascelli, A.; Kaljushnaia, G. A.; Gorina, J. I.; Senturina, N. N.; Kolesnikov, N. N.; Ren, Z. F.; Wang, J. H.; Menovsky, A. A.; Palstra, T. T. M.


    Published in: Phys. Rev. B 60 (1999) 13196 Citing articles (CrossRef) citations recorded in [Science Citation Index] Abstract: We present grazing incidence reflectivity measurements in the far infrared region at temperatures above and below Tc for a series of thallium (Tl2Ba2CuO6, Tl2Ba2CaCu2O8) and

  14. Dipyridamole-thallium-201 tomography documenting improved myocardial perfusion with therapy in Kawasaki disease

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Spielmann, R.P.; Hausdorf, G.


    Thallium-201 tomographic perfusion studies after pharmacologic vasodilation were performed in seven children (aged 2 years 8 months to 8 years 7 months), 3 to 20 months after the acute stage of the disease. In all patients coronary aneurysms were seen on cross-sectional echocardiograms. The scintigrams of six children showed no significant regional reduction of myocardial thallium-201 uptake. These children had remained asymptomatic in the follow-up period after the acute inflammatory stage of Kawasaki disease. Persistent and transient thallium defects were present in one child with acute posterolateral myocardial infarction; obstruction of two coronary vessels supplying the defect zones was confirmed by contrast angiography. After 8 months of treatment a follow-up nuclear scan showed marked reduction in the size of the defect and almost complete abolishment of the ischemic reaction. Thus tomographic thallium-201 perfusion scintigraphy in conjunction with vasodilation stress is useful to assess myocardial perfusion in children with Kawasaki disease and demonstrates marked improvement in regional perfusion after adequate medical therapy.

  15. Complexometric determination of thallium(III using ethanethiol as a selective masking agent

    Directory of Open Access Journals (Sweden)

    Karthikeyan J.


    Full Text Available A simple and selective complexometric method for the determination of thallium in presence of other metal ions is proposed based on the selective masking ability of ethanethiol towards thallium(III. Thallium present in a given sample solution is first complexed with a known excess of EDTA and the surplus EDTA is titrated with standard zinc sulphate solution at pH 5-6(hexamine using xylenol orange as the indicator. A 0.3% aqueous solution of ethanethiol is then added to displace EDTA from the Tl(III-EDTA complex. The released EDTA is titrated with standard zinc sulphate solution as before. Reproducible and accurate results are obtained for 3.70 mg to 74.07 mg of Tl (III with relative error less than ? 0.44% and coefficient of variation not more than 0.27%. The interference of various ions was studied and the method was used for the analysis of thallium in its synthetic alloy mixtures and also in complexes.

  16. Thallium-201: Autoradiography in pigmented mice and melanin-binding in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Tjaelve, H.; Nilsson, M.; Larsson, B. (Uppsala Univ. (Sweden))


    Autoradiography with /sup 201/Tl/sup +/ in C57Bl mice showed a strong labelling of the eye melanin and of pigmented hair follicles. An analysis of the affinity of thallium for pigment from cow eyes indicated a binding to three groups of sites and showed a marked sensitivity to the addition of H/sup +/-ions. The results are consistent with the conception that a binding of thallium occurs to the free carboxyl groups of the melanin and that the structure of the polymer has a marked influence on the affinity. Similar results have previously been obtained with other cations. There was no indication that the strong in vivo affinity of thallium to melanin is due to a more firm binding than for other cations which do not localize on melanin in vivo. Instead, the ability of cations to pass the melanocyte membranes and reach the melanin granules is probably decisive for whether a melanin-binding will take place in vivo. Toxic effects on the eye and epilation are symptoms of thallium intoxication which may be related to its melanin-binding. The fate of /sup 201/Tl/sup +/ in some other tissues is also described and discussed.

  17. Laser-assisted decay and optical spectroscopy studies of neutron-deficient thallium isotopes

    CERN Document Server

    Van Beveren, Céline; Huyse, Mark

    The neutron-deficient thallium isotopes with one proton less than the Z = 82 shell closure, are situated in an interesting region of the nuclear chart, notorious for intruder states and shape coexistence. Shape coexistence is the remarkable phenomenon in which two or more distinct types of deformation occur at low energy in the same atomic nucleus. Shape coexistence has been studied intensively, experimentally as well as theoretically in different nuclei in the light-lead region and the isomerism in the thallium isotopes was among the first indications of this phenomenon. Different shapes, whose structure has been linked to specific proton orbitals above and below the Z = 82 shell closure, are present at low energy in the neutron-deficient odd-mass thallium nuclei. In the odd-odd nuclei, the coupling of an unpaired proton and unpaired neutron gives rise to multiplets of low-lying states from which some can be isomeric. Since thallium has one proton missing in the major proton shell, and when approaching neutr...

  18. Clinical features and applications of thallium-201. With reference to scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tadashige


    Thallium-201 is not only used widely in myocardial imaging but also has a great potential in other various nuclear medicine imaging studies. This paper presents clinical features and applications of thallium-201, focusing on clinical trials with thallium-201 at the Shinshu University School of Medicine. Thallium-201 myocardial scintigraphy offers information on (1) ventricular position and morphology, (2) hypertrophy or dilatation of the left ventricle, (3) hypertrophy or dilatation of the right ventricle, (4) site and extent of myocardial ischemia and infarct, (5) myocardial blood flow, (6) pulmonary congestion or interstitial pulmonary edema, and (7) pericardial effusion. It can be used in the following evaluation or diagnosis: (1) acute or old myocardial infarction, (2) angina pectoris, (3) treatment strategy or prognosis of ischemic heart disease, (4) treatment strategy or observation of bypass graft or drug therapy, (5) hypertrophic or dilated idiopathic cardiomyopathy, (6) myocardial lesions induced by sarcoidosis, collagen disease, and neuro-muscular disease, (7) ventricular hypertrophy and pulmonary edema, and (9) pericarditis, pericardial effusion, and systolic pericarditis associated with underlying disease. The significance of tumor, liver, bone marrow scintigraphies is also referred to. (Namekawa, K) 69 refs.

  19. Optimised thallium precipitation in a waste water treatment system of the flue gas desulphurisation; Optimierte Thalliumabscheidung einer RAA

    Energy Technology Data Exchange (ETDEWEB)

    Ritzerfeld, Guenter [RWE Power AG, Bergheim (Germany); Birngruber, Ingolf [RWE Power AG, Hamm (Germany); Muelder, Thomas [RWE Power AG, Ibbenbueren (Germany)


    When co-combusting substitute fuels in power plants, the element Thallium should be checked in the drain of the waste water treatment system of flue gas desulphurisation. In 2005 Thallium-concentrations exceeding the limit value were determined for the first time as a consequence of the modified analysis of the supervisory authority. The previous lower Thallium concentrations with graphite tube-atomic absorption spectrometry were caused by the high chloride concentration in RAA waste water. The RAA operating mode was checked and changed. Equipment-related weak spots were detected and corrected. (orig.)

  20. 21 CFR 133.179 - Pasteurized process cheese spread. (United States)


    ... than 250 parts per million nisin in the food. (g) The name of the food is “pasteurized process cheese... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Pasteurized process cheese spread. 133.179 Section 133.179 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES...

  1. 49 CFR 179.500-6 - Heat treatment. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Heat treatment. 179.500-6 Section 179.500-6...-6 Heat treatment. (a) Each necked-down tank shall be uniformly heat treated. Heat treatment shall... treatment of alternate steels shall be approved. All scale shall be removed from outside of tank to an...

  2. 20 CFR 220.179 - Exceptions to medical improvement. (United States)


    ... disability decision was in error. The Board will apply the exception to medical improvement based on error if... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Exceptions to medical improvement. 220.179... Medical Improvement § 220.179 Exceptions to medical improvement. (a) First group of exceptions to medical...

  3. 49 CFR 179.18 - Thermal protection systems. (United States)


    ..., underframes, metal jackets, insulation, and thermal protection. A complete record of each analysis shall be...) Systems that no longer require test verification. The Department maintains a list of thermal protection... 49 Transportation 2 2010-10-01 2010-10-01 false Thermal protection systems. 179.18 Section 179.18...

  4. 21 CFR 179.25 - General provisions for food irradiation. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true General provisions for food irradiation. 179.25... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) IRRADIATION IN THE PRODUCTION, PROCESSING AND HANDLING OF FOOD Radiation and Radiation Sources § 179.25 General provisions for food irradiation. For the purposes...

  5. 49 CFR 179.102-17 - Hydrogen chloride, refrigerated liquid. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Hydrogen chloride, refrigerated liquid. 179.102-17...) § 179.102-17 Hydrogen chloride, refrigerated liquid. Each tank car used to transport hydrogen chloride, refrigerated liquid must comply with the following special requirements: (a) The tank car must comply with...

  6. 49 CFR 179.102-1 - Carbon dioxide, refrigerated liquid. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Carbon dioxide, refrigerated liquid. 179.102-1...) § 179.102-1 Carbon dioxide, refrigerated liquid. (a) Tank cars used to transport carbon dioxide, refrigerated liquid must comply with the following special requirements: (1) All plates for tank, manway nozzle...

  7. 49 CFR 179.14 - Coupler vertical restraint system. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Coupler vertical restraint system. 179.14 Section... TANK CARS General Design Requirements § 179.14 Coupler vertical restraint system. (a) Performance... not be equipped with couplers having this vertical restraint capability. (b) Test verification. Except...

  8. 5 CFR 179.206 - Notice requirements before offset. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Notice requirements before offset. 179.206 Section 179.206 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS... administrative costs including a statement that such assessments must be made unless excused in accordance with...

  9. Comparison of Polythionates as Precursors for the Formation of Thallium Sulfide Layers

    Directory of Open Access Journals (Sweden)

    Vitalijus JANICKIS


    Full Text Available The processes of obtaining layers of thallium, sulfides, TlxSy, by the sorption-diffusion method on polyamide 6 using solutions of lower polythionates - sodium trithionate and tetrathionate, Na2S3O6, Na2S4O6, potassium pentathionate, K2S5O6, and of dodecathionic acid, H2S12O6, as precursors of sulfur are compared. The concentration of sorbed sulfur increases with increasing the duration of treatment, the concentration and temperature of precursor solution. It rather significantly also depends on the nature - sulfurity of polythionate, i. e. on the number of sulfur atoms in the polythionate anion: effectiveness of sulfurization using solutions of dodecathionic acid is significantly higher than that of lower polythionates. Thallium sulfide layers are formed on the surface of polyamide after the treatment of sulfurized polymer with Tl(I salt solution. The concentration of thallium in the layer increases with the increase of initial sulfurization duration and in case of H2S12O6 solution used - on the temperature of this process. The results of X-ray diffraction analysis confirmed the formation of thallium sulfide layers in the surface of polyamide 6. The phase composition of layer changes depending on the conditions of initial treatment in a H2S12O6 solution. Five thallium sulfide phases, two forms of TlS, Tl2S2, Tl4S3 and Tl2S5 were identified in the composition of the layers treated for different time with a solution of dodecathionic acid at the temperature of 20 °C and 30 °C and then with Tl(I salt solution by X-ray diffraction but the maxima of TlS and Tl2S5 phases predominate in the diffractograms.

  10. Thermodynamic Study of Tl6SBr4 Compound and Some Regularities in Thermodynamic Properties of Thallium Chalcohalides

    Directory of Open Access Journals (Sweden)

    Dunya Mahammad Babanly


    Full Text Available The solid-phase diagram of the Tl-TlBr-S system was clarified and the fundamental thermodynamic properties of Tl6SBr4 compound were studied on the basis of electromotive force (EMF measurements of concentration cells relative to a thallium electrode. The EMF results were used to calculate the relative partial thermodynamic functions of thallium in alloys and the standard integral thermodynamic functions (-ΔfG0, -ΔfH0, and S0298 of Tl6SBr4 compound. All data regarding thermodynamic properties of thallium chalcogen-halides are generalized and comparatively analyzed. Consequently, certain regularities between thermodynamic functions of thallium chalcogen-halides and their binary constituents as well as degree of ionization (DI of chemical bonding were revealed.

  11. A calixarene-based ion-selective electrode for thallium(I) detection

    Energy Technology Data Exchange (ETDEWEB)

    Chester, Ryan [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Sohail, Manzar [Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia); Ogden, Mark I.; Mocerino, Mauro [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Pretsch, Ernö [ETH Zürich, Institute of Biogeochemistry and Pollutant Dynamics (IBP), Universitätstrasse 16, CH-8092, Zürich (Switzerland); De Marco, Roland, E-mail: [Nanochemistry Research Institute, Department of Chemistry, Curtin University, GPO Box U1987, Perth, Western Australia 6845 (Australia); Faculty of Science, Health, Education and Engineering, University of the Sunshine Coast, Locked Bag 4, Maroochydore DC, Queensland 4556 (Australia)


    Highlights: • Tuning of metal binding cavities in thallium(I) calixarene ionophores. • Novel calixarene-based ionophores with improved selectivity for thallium(I). • Sandwich membrane characterization of thallium(I) binding in novel calixarenes. • Improved selectivity and sensitivity with novel thallium(I) calixarene ionophores. • Solid contact ion-selective electrodes for novel thallium(I) calixarene ionophores. - Abstract: Three new calixarene Tl{sup +} ionophores have been utilized in Tl{sup +} ion-selective electrodes (ISEs) yielding Nernstian response in the concentration range of 10{sup −2}–10{sup −6} M TlNO{sub 3} with a non-optimized filling solution in a conventional liquid contact ISE configuration. The complex formation constants (log β{sub IL}) for two of the calixarene derivatives with thallium(I) (i.e. 6.44 and 5.85) were measured using the sandwich membrane technique, with the other ionophore immeasurable due to eventual precipitation of the ionophore during these long-term experiments. Furthermore, the unbiased selectivity coefficients for these ionophores displayed excellent selectivity against Zn{sup 2+}, Ca{sup 2+}, Ba{sup 2+}, Cu{sup 2+}, Cd{sup 2+} and Al{sup 3+} with moderate selectivity against Pb{sup 2+}, Li{sup +}, Na{sup +}, H{sup +}, K{sup +}, NH{sub 4}{sup +} and Cs{sup +}, noting that silver was the only significant interferent with these calixarene-based ionophores. When optimizing the filling solution in a liquid contact ISE, it was possible to achieve a lower limit of detection of approximately 8 nM according to the IUPAC definition. Last, the new ionophores were also evaluated in four solid-contact (SC) designs leading to Nernstian response, with the best response noted with a SC electrode utilizing a gold substrate, a poly(3-octylthiophene) (POT) ion-to-electron transducer and a poly(methyl methacrylate)–poly(decyl methacrylate) (PMMA–PDMA) co-polymer membrane. This electrode exhibited a slope of 58.4 mV decade

  12. 49 CFR 179.300-15 - Pressure relief devices. (United States)


    ... percent of the tank test pressure. When relief devices of the fusible plug type are used, the required... exceeding that specified in § 179.301. (d) Fusible plugs shall function at a temperature not exceeding 175...

  13. Thallium Flux Assay for Measuring the Activity of Monovalent Cation Channels and Transporters. (United States)

    Weaver, C David


    Monovalent cation channels are critically important for physiological processes ranging from the control of neuronal excitability to the maintenance of solute balance. Mutations in these channels are associated with a multiplicity of diseases and monovalent cation channel-modulating drugs are used as therapeutics. Techniques that allow the measurement of the activity of these ion channels are useful for exploring their many biological roles as well as enabling the discovery and characterization of ion channel modulators for the purposes of drug discovery. Although there are numerous techniques for measuring the activity of monovalent cation channels, the thallium flux assay technique is a widely used fluorescence-based approach. Described herein is a method for using the thallium-flux technique for detecting and quantifying the activity of small-molecule potassium channel modulators in 384-well plates.

  14. Comparative studies on right ventricular pressure and volume overloading by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Owada, K.; Tsukahara, Y.; Kijima, M.; Miyazaki, Y.; Ono, K. (Fukushima Medical Coll. (Japan))


    Thallium-201 myocardial scintigraphy was performed in 44 patients with various heart diseases including mitral stenosis, atrial septal defect, primary pulmonary hypertension, and left atrial myxoma. The morphological findings of right ventricular (RV) free wall on the scintigram and RV/IVS (interventricular septum) uptake ratio of the images obtained from the left anterior oblique projection were studied in the patients with RV pressure or volume overloading.

  15. Study of {sup 179}Hf{sup m2} excitation

    Energy Technology Data Exchange (ETDEWEB)

    Vishnevsky, I. N.; Zheltonozhsky, V. A., E-mail:; Savrasov, A. N. [National Academy of Sciences of Ukraine, Institute for Nuclear Research (Ukraine); Mazur, V. M. [National Academy of Sciences of Ukraine, Institute of Electronic Physics (Ukraine)


    Isomeric ratios of {sup 179}Hf{sup m2,g} yields in the (γ, n) reaction and the cross section for the {sup 179}Hf{sup m2} population in the (α, p) reaction are measured for the first time at the end-point energies of 15.1 and 17.5 MeV for bremsstrahlung photons and 26 MeV for alpha particles. The results are σ = (1.1 ± 0.11) × 10{sup −27} cm{sup 2} for the {sup 176}Lu(α, p){sup 179}Hf{sup m2} reaction and Y{sub m2}/Y{sub g} = (6.1 ± 0.3) × 10{sup −6} and (3.7 ± 0.2) × 10{sup −6} for the {sup 180}Hf(γ, n){sup 179}Hf{sup m22} reaction at E{sub ep} =15.1 and 17.5 MeV, respectively. The experimental data on the relative {sup 179}Hf{sup m2} yield indicate a single-humped shape of the excitation function for the {sup 180}Hf(γ, n){sup 179}Hf{sup m2} reaction. Simulation is performed using the TALYS-1.4 and EMPIRE-3.2 codes.

  16. Tunable frequency-stabilization of UV laser using a Hallow-Cathode Lamp of atomic thallium

    CERN Document Server

    Chen, Tzu-Ling; Shy, Jow-Tsong; Liu, Yi-Wei


    A frequency-stabilized ultraviolet laser system, locked to the thallium resonant transition of 377.5 nm, was demonstrated using a novel bichromatic spectroscopy technique for tuning the zero-crossing laser-lock point. The atomic thallium system is a promising candidate in atomic parity violation and permanent electric dipole moment experiments, and its 377.5 nm 6P1/2->7S1/2 transition is important for thallium laser cooling and trapping experiment. The pressure shift, owing to the high pressure bu?er gas of the hollow-cathode lamp, was observed using an atomic beam resonance as reference. Such a shift was corrected by adjusting the peak ratio of the two Doppler-free saturation pro?les resulted from two pumping beams with a 130 MHz frequency di?erence. The resulted frequency stability of the ultraviolet laser is ?0.5 MHz at 0.1 sec integration time. This scheme is compact and versatile for stabilizing UV laser systems, which acquire a sub-MHz stability and frequency tunability.

  17. Detection of human collateral circulation by vasodilation-thallium-201 tomography

    Energy Technology Data Exchange (ETDEWEB)

    Nienaber, C.A.; Salge, D.; Spielmann, R.P.; Montz, R.; Bleifeld, W. (University Hospital Eppendorf, Hamburg (Germany, F.R.))


    Coronary arteriolar vasodilation may provoke redistribution of flow to collateral-dependent jeopardized myocardium. To assess the physiologic significance of collaterals, 80 consecutive post-infarction patients (age 58 +/- 8 years) underwent vasodilation-redistribution thallium-201 tomographic imaging after administration of 0.56 mg of intravenous dipyridamole/kg body weight. Circumferential profile analysis of thallium-201 uptake and redistribution in representative left ventricular tomograms provided quantitative assessment of transient and fixed defects and separation between periinfarctional and distant inducible hypoperfusion. Tomographic perfusion data were correlated to wall motion and collateral circulation between distinct anatomic perfusion territories. Patients were grouped according to presence (59%) or absence (41%) of angiographically visible collateral channels to jeopardized myocardium. In the presence of collaterals, distant reversible defects were larger than in absence of collaterals (p less than 0.05); the extent of combined periinfarctional and distant redistribution was also larger in collateralized patients (p less than 0.025), whereas the size of the persistent perfusion defect was similar in both groups. By prospective analysis the tomographic perfusion pattern of combined periinfarctional and distant redistribution revealed a sensitivity of 85% and a specificity of 78% for the detection of significant collateral circulation in this group of patients. Thus, using the exhausted flow reserve as a diagnostic tool, vasodilation-thallium-201 tomography has the potential to identify and quantitate collateralized myocardium in post-infarction patients and may guide diagnostic and therapeutic decision-making.

  18. [Characterization of kale (Brassica oberacea var acephala) under thallium stress by in situ attenuated total reflection FTIR]. (United States)

    Yao, Yan; Zhang, Ping; Wang, Zhen-Chun; Chen, Yong-Heng


    The experiment was designed based on consumption of carbon dioxide through the photosynthesis of Brassica oberacea var acephala leaf, and the photosynthesis of kale leaf under thallium stress was investigated by in situ attenuated total reflection FTIR (in situ ATR-FTIR). The ATR-FTIR showed that the absorption peaks of leaves had no obvious difference between plants growing in thallium stress soil and plants growing in non-thallium pollution soil, and the strong peaks at 3,380 cm(-1) could be assigned to the absorption of water, carbohydrate, protein or amide; the strong peaks at 2,916 and 2,850 cm(-1) assigned to the absorption of carbohydrate or aliphatic compound; the peaks at 1,640 cm(-1) assigned to the absorption of water. However, as detected by the in situ ATR-FTIR, the double peaks (negative peaks) at 2,360 and 2,340 cm(-1) that are assigned to the absorption of CO2 appeared and became high gradually. It was showed that kale was carrying photosynthesis. At the same time, the carbon dioxide consumption speed of leaf under thallium stress was obviously larger than that of the blank It was expressed that photosynthesis under thallium stress was stronger than the blank All these represented that kale had certain tolerance to the heavy metal thallium. Meanwhile, the carbon dioxide consumption of grown-up leaf was more than that of young leaf whether or not under thallium stress. It was also indicated that the intensity of photosynthesis in grown-up leaf is higher than that in young leaf.

  19. Thallium and manganese complexes involved in the luminescence emission of potassium-bearing aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, Miguel A., E-mail: [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garcia-Guinea, Javier, E-mail: [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Garrido, Fernando, E-mail: [Museo Nacional de Ciencias Naturales, CSIC, Jose Gutierrez Abascal 2, Madrid E-28006 (Spain); Townsend, Peter D., E-mail: [School of Science and Technology, University of Sussex, Brighton BN1 9QH (United Kingdom); Marco, Jose-Francisco, E-mail: [Instituto de Química-Física Rocasolano, CSIC, Calle Serrano 119, Madrid E-28006 (Spain)


    The luminescence emission at 285 nm in natural K-feldspar has been studied by Russian groups and associated with thallium ions in structural positions of K{sup +} sites as artificially thallium-doped feldspars display the same emission band. Here attention is focussed on spectra of CL emission bands centered near 285 and 560 nm from paragenetic adularia, moscovite and quartz micro-inclusions. With accesorial thallium they show clear resemblances to each other. Associated sedimentary and hydrothermal aluminosilicate samples collected from Guadalix (Madrid, Spain) were analyzed with a wide range of experimental techniques including Environmental Scanning Electron Microscopy (ESEM) with an attached X-Ray Energy-Dispersive Spectrometer (EDS) and a cathodoluminescence probe (CL) and Electron Probe Microanalysis (EPMA), X-Ray Fluorescence Spectrometry (XRF), Inductively Coupled Plasma-Optical Emission Spectrometry (ICP-OES), Differential and Thermogravimetric Analyses (DTA-TG), radioluminescence (RL), Mössbauer spectroscopy and X-Ray Photoelectron Spectrometry (XPS). The luminescence emission bands at 285 and 560 nm seem to be associated with hydrous thallium–manganese complexes bonded to potassium-bearing aluminosilicates since various minerals such as K-feldspar, moscovite and quartz micro-inclusions display similar CL spectra, accesorial thallium and hydroxyl groups. The presence of iron introduces a brown color which is attributed to submicroscopic iron oxides detectable in the optical and chemical microanalysis, but this does not contribute to the luminescence emission. The XPS Mn 2p spectrum of the adularia sample at room temperature is composed of a spin–orbit doublet plus clear shake-up satellite structure ∼4 eV above the main photoemision lines and is consistent with Mn{sup 2+} in good agreement with the observed luminescence emission at 560 nm for aluminosilicates produced by a {sup 4}T1({sup 4}G)→{sup 6}A1({sup 6}S) transition in tetrahedrally

  20. Diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic and thallium 201 perfusion imaging in stable coronary artery disease. (United States)

    Walamies, M; Turjanmaa, V; Koskinen, M; Uusitalo, A


    The diagnostic value of 123I-phenylpentadecanoic acid (IPPA) metabolic cardiac imaging was studied in a group (n = 29) of patients with angiographically confirmed CAD using single photon emission computed tomography (SPECT). A symptom-limited exercise test was first done with IPPA, and 2 days later with thallium. Medications were not withheld during testing. Fourteen healthy control subjects participated in parallel IPPA and 15 in thallium tests. Data acquisition and output were comparable in the two imaging modalities. By testing various relatively simple criteria for abnormality we found that the semiquantitative interpretation was more accurate than the visual readings. The best compromise of accuracy with the scored criteria consisted of a sensitivity of 86% and a specificity of 86%, obtained with IPPA polar tomograms (mild exercise defect) and a sensitivity of 86% and a specificity of 80% obtained with thallium (regionally decreased washout). With visual interpretation alone, a sensitivity of 83% and a specificity of 71% was detected with IPPA (mild exercise defect) and 72% and 73%, respectively, with thallium (partial reversibility). The sensitivity of the exercise ECG alone was 62%. The results of this study imply that IPPA imaging could be a rational, uncomplicated clinical method for non-invasive diagnosis of CAD. The diagnostic ability of IPPA is at least as good as that of thallium, and it is possible to use them in succession.

  1. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging: A new marker of triple-vessel disease

    Energy Technology Data Exchange (ETDEWEB)

    Takeishi, Y.; Tono-oka, I.; Ikeda, K.; Komatani, A.; Tsuiki, K.; Yasui, S. (Yamagata Univ. School of Medicine (Japan))


    To investigate the significance and mechanism of dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging, we performed both dipyridamole thallium-201 imaging and dipyridamole radionuclide angiography on 83 patients with known angiograms. The dipyridamole/delayed ratio of the left ventricular dimension from the thallium-201 image was defined as the left ventricular dilatation ratio (LVDR). An LVDR greater than the mean + two standard deviations in patients without coronary artery disease was defined as abnormal. Twenty-two of 83 patients showed an abnormal LVDR, and 18 of the 22 patients (82%) had triple-vessel disease. By defect and washout analysis, the sensitivity and specificity for correctly identifying the patients as having triple-vessel disease was 72% and 76%, respectively, whereas LVDR had a sensitivity of 72% and a specificity of 93%. When LVDR was used in combination with the defect and washout criteria, sensitivity increased to 84% without a loss of specificity. In those 22 patients with abnormal LVDRs, end-diastolic volume measured by radionuclide angiography did not change after dipyridamole infusion. Dilatation of the left ventricular cavity on dipyridamole thallium-201 imaging reflected relative subendocardial hypoperfusion induced by dipyridamole rather than actual chamber enlargement. The LVDR was moderately sensitive and highly specific for triple-vessel disease and provided complementary information to dipyridamole thallium-201 imaging.

  2. A preliminary investigation and evaluation of the thallium environmental impacts of the unmined Xiangquan thallium-only deposit in Hexian, China (United States)

    Zhou, Taofa; Fan, Yu; Yuan, Feng; Cooke, David; Zhang, Xin; Li, Liangjun


    The Xiangquan Thallium-only deposit in Hexian, east China is a newly found near-surface and unmined shallow-seated thallium deposit. The 250t Tl deposit is hosted in Lower Ordovician Lunshan Group as lenticular and confined by northeast F1, F2 faults. The metallic minerals are dominated by pyrite, more than 95% Tl occurs in pyrite as tiny individual grains or as ‘‘invisible thallium”. Tl and other trace elements pollution in ecosystems such as soils, surface and ground waters and water sediments, plants and crops, and animal and human beings in Xiangquan near the Tl ore deposit have been investigated and evaluated. Results show that Tl as well as As and Sb in ecosystems in Xiangquan around the deposit have enriched, they came from Tl-pyrite in the ore bodies and in the parent rocks of weathered soils on top of the ore bodies and went into the nearby ecosystems through weathering, leaching and dissolving. In 2 km2 around the Xiaolongwang Mountain where the Tl ore deposit seated, soils, vegetables, crops have been polluted or heavily polluted by Tl, As and Sb. Farmlands near the ore body are not fit to grow vegetables and crops. Thermal Spring water in Xiangquan town and pond water close to the Tl deposit are not potable. Tl also enriches in human hair and urinate of villagers who live close to the Tl deposit. Even through the Tl-only deposit has put clear environmental impacts on the local environment and ecosystems around it, no serious consequences of Tl pollution have so far taken place due to unmining of the Tl deposit as well as the screen effect of the silicficious breccia cap on top of it. All this work adds new knowledge to understand Tl behavior in unmined Tl deposit, and also benefit to the local environmental protection and the future mineral resources exploration.

  3. {sup 201}Thallium SPECT, accuracy in astrocytoma diagnosis and treatment evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Kaellen, K


    The aims of the studies included in this thesis were: - to investigate the reliability of {sup 201}Thallium single photon emission computed tomography. Tl SPECT for preoperative diagnosis and histological staging of malignant astrocytomas in comparison with CT; - to develop a method for quantification of cerebral thallium uptake, and to evaluate the quantitative measurement in comparison with CT, for astrocytoma treatment follow-up purposes; - to compare quantitative Tl SPECT and proton magnetic resonance spectroscopy (H-MRS) with conventional MR imagingfor astrocytoma monitoring, and to evaluate associations between change of morphological tumour characteristics during treatment and changes of cerebral thallium uptake and metabolic ratios. Results and conclusions: - High TI-index, calculated as a ratio comparing tumour uptake to uptake in the contralateral hemisphere, is an indicator of highly malignant astrocytoma. Differentiation between the high-grade astrocytomas, the low-grade astrocytomas, and infectious lesions is only partial, with an overlap of Tl-indexes between these groups. High-grade astrocytomas that do not show contrast enhancement on CT, and astrocytomas with central necrosis and moderate ring-enhancement, tend to be underestimated when evaluated by Tl-index calculation. Tl SPECT is not a reliable method for non-invasive tumour staging among the group of highly malignant astrocytomas. - Quantification of cerebral TI-uptake, defining the volume of viable tumour tissue, is a new method for astrocytoma chemotherapy monitoring. Results suggest that the method provides prognostic information, and information of treatment efficacy, at an earlier stage than CT. - We did not find a higher accuracy of quantitative Tl SPECT than of MR for monitoring purposes and our results indicated that treatment induced MR changes were interrelated with TI-uptake variations. - Multi-voxel H-MRS was difficult to apply for astrocytoma treatment monitoring, due to the

  4. A Novel Ion - selective Polymeric Membrane Sensor for Determining Thallium(I) With High Selectivity (United States)

    Kassim, Anuar; Rezayi, Majid; Ahmadzadeh, Saeid; Rounaghi, Gholamhossein; Mohajeri, Masoomeh; Azah Yusof, Noor; Tee, Tan Wee; Yook Heng, Lee; Halim Abdullah, Abd


    Thallium is a toxic metal that introduced into the environment mainly as a waste from the production of zinc, cadmium, and lead and by combustion of coal. Thallium causes gastrointestinal irritation and nerve damage when people are exposed to it for relatively short period of time. For long term, thallium has the potential to cause the following effects: change in blood chemistry, damage to liver, kidney, intestinal and testicular tissue, and hair loss. In this work a membrane was prepared by use of 4'-nitrobenzo -18-crown-6 (4'NB18C6) as an ion carrier, polyvinylchloride (PVC) as a matrix, and diocthylphetalate (DOP) as a plasticizer for making an ion selective electrode for measurement of Tl+ cation in solutions. The amount of 4'-nitrobenzo-18C6 and polyvinylchloride were optimized in the preparation of the membrane. The response of the electrode was Nernstian within the concentration range 1.0 × 10-8 to 1.0 × 10-1M. This sensor displays a drift in Nernstian response for this cation with increasing the amount of ionophore and decreasing the amount of polyvinylchloride.The results of potentiometric measurements showed that, this electrode also responses to Cu2+ Ni2+ and Pb2+ cations, but the electrode has a wider dynamic range and a lower detection limit to Tl+ cation. The effects of various parameters such as pH, different cations interferences, effect of the amount of ionophore and polyvinylchloride and time on response of the coated ion selective electrode were investigated. Finally the constructed electrode was used in complexometric and precipitation titrations of Tl+ cation with EDTA and KBr, respectively. The response of the fabricated electrode at concentration range from 1.0 × 10-8 to 1.0 × 10-1M is linear with a Nernstian slope of 57.27 mV.

  5. Oxidative stress and DNA damage in broad bean (Vicia faba L.) seedlings induced by thallium. (United States)

    Radić, Sandra; Cvjetko, Petra; Glavas, Katarina; Roje, Vibor; Pevalek-Kozlina, Branka; Pavlica, Mirjana


    Thallium (Tl) is a metal of great toxicological concern because it is highly toxic to all living organisms through mechanisms that are yet poorly understood. Since Tl is accumulated by important crops, the present study aimed to analyze the biological effects induced by bioaccumulation of Tl in broad bean (Vicia faba L.) as well as the plant's antioxidative defense mechanisms usually activated by heavy metals. Thallium toxicity was related to production of reactive oxygen species in leaves and roots of broad bean seedlings following short-term (72 h) exposure to thallium (I) acetate (0, 0.5, 1, 5, and 10 mg/L) by evaluating DNA damage and oxidative stress parameters as well as antioxidative response. The possible antagonistic effect of potassium (K) was tested by combined treatment with 5 mg/L of Tl (Tl+) and 10 mg/L of potassium (K+) acetate. Accumulation of Tl+ in roots was 50 to 250 times higher than in broad bean shoots and was accompanied by increase in dry weight and proline. Despite responsive antioxidative defense (increased activities of superoxide dismutase, ascorbate peroxidase, and pyrogallol peroxidase), Tl+ caused oxidative damage to lipids and proteins as evaluated by malondialdehyde and carbonyl group levels, and induced DNA strand breaks. Combined treatment caused no oxidative alternations to lipids and proteins though it induced DNA damage. The difference in Tl-induced genotoxicity following both acellular and cellular exposure implies indirect DNA damage. Results obtained indicate that oxidative stress is involved in the mechanism of Tl toxicity and that the tolerance of broad bean to Tl is achieved, at least in part, through the increased activity of antioxidant enzymes.

  6. Thallium Intoxication Treated with Long-Term Hemodialysis, Forced Diuresis and Prussian Blue

    DEFF Research Database (Denmark)

    Larsen, Elfinn; Solgaard, Per Bent; Freund, L. Gade


    A 56 yr old woman, who ingested 2 g of thallium sulfate, was successfully treated with long-term hemodialysis for 200 h during 10 days, combined with forced diuresis and Prussian blue. The effect of the artificial kidney dialysis was determined by repeated analysis of the Tl concentration...... in the dialysis bath and in blood samples. During the 1st 120 h of hemodialysis, 143 mg of Tl was eliminated via the artificial kidney and 110 mg via the urinary tract. The present case of acute Tl intoxication is the 1st in which long-term hemodialysis has been used in the acute phase...

  7. Experimental excitation functions of deuteron induced reactions on natural thallium up to 50 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Adam Rebeles, R., E-mail: [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Van den Winkel, P.; Hermanne, A. [Cyclotron Laboratory, Vrije Universiteit Brussel, B-1090 Brussels (Belgium); Tarkanyi, F.; Takacs, S. [Institute of Nuclear Research of the Hungarian Academy of Sciences, Debrecen H-4026 (Hungary)


    Excitation functions of deuteron induced reactions on natural thallium leading to the formation of {sup 204m,203m2+m1+g,202m,201m+g,200}Pb and {sup 202,201m+g,200m+g}Tl isotopes were determined up to 50 MeV. The cross sections were measured by an activation technique using stacked foil irradiation. The excitation functions of the investigated reactions are compared with data reported in literature and also with the theoretical results of TALYS nuclear reaction code. From the measured cross section data, the thick target yield for the medical interesting {sup 203}Pb isotope is calculated.

  8. 49 CFR 179.220-11 - Postweld heat treatment. (United States)


    ... treated before welding to shell if postweld heat treatment is not practicable due to assembly procedures... SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-11...

  9. Phenotype abnormality: 179 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 179 decreased length... in organ named portion of meristem tissue ... portion of meristem tissue ... decreased length ...

  10. 49 CFR 179.400-19 - Valves and gages. (United States)


    ... Specification for Cryogenic Liquid Tank Car Tanks and Seamless Steel Tanks (Classes DOT-113 and 107A) § 179.400... satisfactory properties at the lading temperature. (1) Liquid control valves must be of extended stem design... materials that will effectively seal the valve stem without causing difficulty of operation. (3) Each...

  11. 49 CFR 179.220-18 - Bottom outlets. (United States)


    ... Specifications for Non-Pressure Tank Car Tanks (Classes DOT-111AW and 115AW) § 179.220-18 Bottom outlets. (a) The... or stem projection below the “V” groove or its equivalent. The valve and seat must be readily...

  12. Image collection: 179 [Togo Picture Gallery[Archive

    Lifescience Database Archive (English)

    Full Text Available 179 Gorilla_beringei_NL.png マウンテンゴリラ Mountain gorilla Gorilla beringei 499232 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱,霊長目

  13. Application of Hyphenated Techniques in Speciation Analysis of Arsenic, Antimony, and Thallium (United States)

    Michalski, Rajmund; Szopa, Sebastian; Jabłońska, Magdalena; Łyko, Aleksandra


    Due to the fact that metals and metalloids have a strong impact on the environment, the methods of their determination and speciation have received special attention in recent years. Arsenic, antimony, and thallium are important examples of such toxic elements. Their speciation is especially important in the environmental and biomedical fields because of their toxicity, bioavailability, and reactivity. Recently, speciation analytics has been playing a unique role in the studies of biogeochemical cycles of chemical compounds, determination of toxicity and ecotoxicity of selected elements, quality control of food products, control of medicines and pharmaceutical products, technological process control, research on the impact of technological installation on the environment, examination of occupational exposure, and clinical analysis. Conventional methods are usually labor intensive, time consuming, and susceptible to interferences. The hyphenated techniques, in which separation method is coupled with multidimensional detectors, have become useful alternatives. The main advantages of those techniques consist in extremely low detection and quantification limits, insignificant interference, influence as well as high precision and repeatability of the determinations. In view of their importance, the present work overviews and discusses different hyphenated techniques used for arsenic, antimony, and thallium species analysis, in different clinical, environmental and food matrices. PMID:22654649

  14. Evaluation of myocardial abnormalities in collagen diseases by thallium-201 myocardial scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru; Kagoshima, Tadashi; Sugihara, Kiyotaka (Nara Medical Univ., Kashihara (Japan)) (and others)


    This study was performed to evaluate myocardial abnormalities in patients with collagen diseases by exercise and rest thallium-201 myocardial scintigrams. A total of 65 patients without ischemic ECG changes, consisting of 18 with systemic lupus erythematosus (SLE), 18 with polymyositis (PM), 8 with progressive systemic sclerosis (PSS), and 21 with Sjoegren's syndrome (SjS), was enrolled in this study. Reversible exercise-induced defects scintigraphically suggesting myocardial ischemia were noted in 8 cases of SLE, 4 cases of PM, 4 cases of PSS, and 3 cases of SjS. Nineteen patients had exercise-induced defects and underwent cardiac catheterization, 8 of whom had normal coronary angiograms. Fixed hypoperfusion areas were observed in one case of SLE, 6 cases of PM and 3 cases of SjS. Rest thallium-201 myocardial scintigram disclosed hypoperfusion areas which were not induced by exercise in 2 cases of SLE, 3 cases of PM, one case of PSS and 5 cases of SjS. Echocardiogram showed no significant differences in ejection fraction and % fractional shortening between the disease groups and healthy control group. These findings suggest that patients with collagen diseases have abnormalities of coronary circulation at the level of the intramural vasculature before cardiac function impairment, myocardial fibrosis and functional abnormalities at the cell membrane. (author).

  15. Follow-up Thallium-201 scintigraphy after mantle field radiotherapy for Hodgkin's disease

    Energy Technology Data Exchange (ETDEWEB)

    Pierga, J.Y.; Girinski, T.; Henry-Amar, M. (Institut Gustave Roussy, Villejuif (France)); Maunoury, C.; Valette, H.; Tchernia, G.; Desgrez, A. (Centre Hospitalier de Bicetre, Le Kremlin-Bicetre (France)); Socie, G. (Institut Gustave Roussy, Villejuif (France) Hopital St Louis, Paris (France)); Cosset, J.M. (Institut Gustave Roussy, Villejuif (France) Institut Curie, Paris (France))


    Assessment of the long-term cardiac effects of mediastinal radiotherapy for Hodgkin's disease, by Thallium scintigraphy. 32 patients (14 males and 18 females) who underwent mantle field radiotherapy for Hodgkin's disease were included in this study. Twenty patients received 4 fractions of 2.5 Gy per week and 12, five fraction of 2 Gy per week, delivered on alternate days. All the patients, except three, performed exercise testing electrocardiogram and Thallium-201 tomoscintigraphy. The average time interval from completion of treatment to the study was 7 years (range 3--13 years). No patients had clinical symptoms of cardiac disease. Mean age at the time of the study was 35 years (range 23--48 years). Two electrocardiograms revealed left bundle branch block and the patients were excluded from the study. Only one out of 27 exercise electrocardiograms was abnormal in a patient with mitral valve prolapse, who was also excluded from the study. Twenty-six scintigraphies were evaluable. Twenty-two (85%) were clearly abnormal with partial or complete redistribution on delayed images. The anterior region was affected in 19 of these cases (86%). Four explorations were undoubtedly normal. Coronary angiography was not performed for ethical reasons in these asymptomatic patients. Despite possible false positive tests, the high rate of abnormality (85%) in this small series is striking. These preliminary data justify larger studies and a close long-term follow-up of these patients. 24 refs., 1 fig., 2 tabs.

  16. Thallium occurrence and partitioning in soils and sediments affected by mining activities in Madrid province (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-Gonzalez, M.A.; Garcia-Guinea, J. [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain); Laborda, F. [Group of Analytical Spectroscopy and Sensors Group, Institute of Environmental Sciences, University of Zaragoza, Pedro Cerbuna 12, 50009 Zaragoza (Spain); Garrido, F., E-mail: [National Museum of Natural Sciences, CSIC, Jose Gutierrez Abascal 2, 28006 Madrid (Spain)


    Thallium (Tl) and its compounds are toxic to biota even at low concentrations but little is known about Tl concentration and speciation in soils. An understanding of the source, mobility, and dispersion of Tl is necessary to evaluate the environmental impact of Tl pollution cases. In this paper, we examine the Tl source and dispersion in two areas affected by abandoned mine facilities whose residues remain dumped on-site affecting to soils and sediments of natural water courses near Madrid city (Spain). Total Tl contents and partitioning in soil solid phases as determined by means of a sequential extraction procedure were also examined in soils along the riverbeds of an ephemeral and a permanent streams collecting water runoff and drainage from the mines wastes. Lastly, electronic microscopy and cathodoluminescence probe are used as a suitable technique for Tl elemental detection on thallium-bearing phases. Tl was found mainly bound to quartz and alumino-phyllosilicates in both rocks and examined soils. Besides, Tl was also frequently found associated to organic particles and diatom frustules in all samples from both mine scenarios. These biogenic silicates may regulate the transfer of Tl into the soil-water system. - Highlights: • Abandoned mine residues are Tl sources in soils of Madrid catchment area. • Tl was associated to quartz and aluminosilicates in both rocks and soils. • Tl was frequently found associated to organic particles and diatom frustules. • Cathodoluminescence is a suitable technique for Tl detection on soils and rocks.

  17. [Detecting Thallium in Water Samples using Dispersive Liquid Phase Microextraction-Graphite Furnace Atomic Absorption Spectroscopy]. (United States)

    Zhu, Jing; Li, Yan; Zheng, Bo; Tang, Wei; Chen, Xiao; Zou, Xiao-li


    To develope a method of solvent demulsification dispersive liquid phase microextraction (SD-DLPME) based on ion association reaction coupled with graphite furnace atomic absorption spectroscopy (GFAAS) for detecting thallium in water samples. Methods Thallium ion in water samples was oxidized to Tl(III) with bromine water, which reacted with Cl- to form TlCl4-. The ionic associated compound with trioctylamine was obtained and extracted. DLPME was completed with ethanol as dispersive solvent. The separation of aqueous and organic phase was achieved by injecting into demulsification solvent without centrifugation. The extractant was collected and injected into GFAAS for analysis. With palladium colloid as matrix modifier, a two step drying and ashing temperature programming process was applied for high precision and sensitivity. The linear range was 0.05-2.0 microg/L, with a detection limit of 0.011 microg/L. The relative standard derivation (RSD) for detecting Tl in spiked water sample was 9.9%. The spiked recoveries of water samples ranged from 94.0% to 103.0%. The method is simple, sensitive and suitable for batch analysis of Tl in water samples.

  18. The learning machine in quantitative chemical analysis : Part I. Anodic Stripping Voltammetry of Cadmium, Lead and Thallium

    NARCIS (Netherlands)

    Bos, M.; Jasink, G.


    The linear learning machine method was applied to the determination of cadmium, lead and thallium down to 10-8 M by anodic stripping voltammetry at a hanging mercury drop electrode. With a total of three trained multicategory classifiers, concentrations of Cd, Pb and Tl could be predicted with an

  19. Thallium chloride 201Tl combined with single photon emission computed tomography (SPECT) in the evaluation of vestibular schwannoma growth

    DEFF Research Database (Denmark)

    Charabi, Samih Ahmed; Lassen, N A; Thomsen, J


    Thallium chloride 201Tl combined with SPECT was performed in a series of 29 patients with neuroradiological evidence of vestibular schwannoma (VS). The relative tumor uptake (U) and relative tumor concentration (C) of the radiotracer 201Tl was determined, and the cerebellum served as a reference...

  20. 21 CFR 179.30 - Radiofrequency radiation for the heating of food, including microwave frequencies. (United States)


    ... PRODUCTION, PROCESSING AND HANDLING OF FOOD Radiation and Radiation Sources § 179.30 Radiofrequency radiation... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Radiofrequency radiation for the heating of food, including microwave frequencies. 179.30 Section 179.30 Food and Drugs FOOD AND DRUG ADMINISTRATION...

  1. 21 CFR 179.41 - Pulsed light for the treatment of food. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Pulsed light for the treatment of food. 179.41 Section 179.41 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... FOOD Radiation and Radiation Sources § 179.41 Pulsed light for the treatment of food. Pulsed light may...

  2. 49 CFR 38.179 - Trams, and similar vehicles, and systems (United States)


    ... 49 Transportation 1 2010-10-01 2010-10-01 false Trams, and similar vehicles, and systems 38.179 Section 38.179 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Other Vehicles and Systems § 38.179...

  3. Bis(2-mercapto-1-R-imidazolyl)hydroborato complexes of aluminium, gallium, indium and thallium: compounds possessing gallium-gallium bonds and a trivalent thallium alkyl. (United States)

    Yurkerwich, Kevin; Coleman, Fergal; Parkin, Gerard


    The reactions of bis(mercaptoimidazolyl)hydroborato derivatives [Bm(R)]M' (R = Me, Bu(t); M' = Li, Na, Tl) with MX(3) trihalides of aluminium, gallium and indium yield both 1:1 and 2:1 complexes of the types [Bm(R)]MX(2) and [Bm(R)](2)MX, respectively. Structurally characterized examples of the [Bm(R)]MX(2) series include [Bm(Me)]AlCl(2), [Bm(Me)]GaI(2), [Bm(Me)]InI(2), [Bm(Bu(t))]AlCl(2) and [Bm(Bu(t))]GaX(2) (X = Cl, Br, I), while structurally characterized examples of the [Bm(R)](2)MX series include [Bm(Bu(t))](2)InX (X = Cl, Br, I). In addition to the halide complexes, the trivalent dimethyl thallium complex [Bm(Bu(t))]TlMe(2) has been synthesized via the reaction of [Bm(Bu(t))]Tl with Me(2)TlCl. The reactions of [Bm(R)]M' with the monovalent halides, "GaI", InCl and InI, result in disproportionation. In the case of indium, the mononuclear complexes [Bm(Bu(t))](2)InI and [Bm(Bu(t))]InCl(kappa(2)-mim(Bu(t))) are obtained, whereas for gallium, dinuclear compounds that feature Ga-Ga bonds, namely [Bm(R)](GaI)(GaI)[Bm(R)] (R = Me, Bu(t)) have been isolated.

  4. Thallium stress testing does not predict cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Holley, J.L.; Fenton, R.A.; Arthur, R.S. (Univ. of Pittsburgh, PA (USA))


    This study assessed the usefulness of thallium stress testing as a predictor of perioperative cardiovascular risk in diabetic patients with end-stage renal disease undergoing cadaveric renal transplantation. Demographic factors influencing the exercise performance in these patients were also examined. The medical records of 189 consecutive patients with diabetic nephropathy who were evaluated for cadaveric renal transplantation were reviewed. Thallium stress testing was the initial examination of cardiovascular status in 141 patients. An adequate examination was one in which at least 70% of maximum heart rate was achieved. A thallium stress test was normal if there were no ST segment depressions on the electrocardiogram and no perfusion abnormalities on the thallium scan. Forty-four patients underwent cardiac catheterization as the initial evaluation (Group C) and four patients underwent transplantation without a formal cardiovascular evaluation (Group D). Sixty-four of the 141 patients undergoing thallium stress testing had an adequate and normal examination (Group A). The incidence of perioperative cardiac events in this group was 2%. Seventy-seven patients (Group B) had an abnormal (n = 41) or an inadequate (n = 36) thallium stress test and most (n = 61) then underwent coronary angiography. The use of beta-blockers was the only predictor of an abnormal or inadequate thallium stress test. Forty-three percent of patients with inadequate or abnormal thallium stress tests had significant coronary artery disease on cardiac catheterization. The perioperative risk of cardiac events was not different in Group A versus Groups B, C, and D combined. Survival of Group A and B patients was not different but was significantly longer than that of Group C patients.

  5. Evaluation of thallium-201 scanning for detection of latent coronary artery disease (United States)

    Johnson, P. C.; Leblanc, A.; Deboer, L.; Jhingran, S.


    The use of thallium imaging as a noninvasive method to accurately screen shuttle passengers for latent coronary artery disease was investigated. All radionuclide procedures were performed using an Anger type camera with a high resolution collimator. A minimum of 200,000 counts were collected for each image using a 20% window centered on the 69-83 keV X-rays. For the images obtained following injection with the patient at rest, the testing was begun 10 minutes after injection. Injections of TT during exercise were made at a point near the termination of the treadmill procedure as determined by either the appearance of ST segment changes on the electrocardiogram consistant with subendocardial ischemia, the appearance of angina-like chest pain in the patient or fatigue in the patient which required cessation of the test. The severity of heart disease was based on the medical history, physical exam, exercise electrocardiograms, chest X-rays and the coronary arteriogram.

  6. Thallium Analysis in Environmental Samples by Inductively Coupled Plasma Mass Spectrometry; Analisis de Talio en Muestras Ambientales por Espectrometria de Masas con Fuente de Plasma de Acoplamiento Inductivo

    Energy Technology Data Exchange (ETDEWEB)

    Higueras, I.; Fernandez, M.; Conde, E.; Gajate, A.


    Due to its high toxicity, thallium has been considered by the US Environmental Protection Agency as one of the priority pollutants to be controlled. While being a highly toxic element, thallium has been studied to a much lesser degree than other toxic elements, mainly because thallium is often undetected by classical analytical methods. Thallium is a rare and dispersed element that occurs mainly in sulfur-containing ores. Thus, it is a potential pollutant to surrounding environment, if Tl-rich mineral and/or their industrial wastes are not properly disposed. In this work an Inductively Coupled Plasma Mass Spectrometry analytical procedure has been developed in order to determine thallium in environmental solid samples and its application to the study of this element as a potential pollutant associated with natural and anthropogenic activities. The analytical procedure has been validated by the use of appropriate reference materials, and through the isotope dilution technique as a primary method of measurement. Finally, the developed procedure has been applied to several samples from a mining area, as one of the scenarios where thallium it is likely to occur. (Author) 87 refs.

  7. A Case-Control Study of Prenatal Thallium Exposure and Low Birth Weight in China. (United States)

    Xia, Wei; Du, Xiaofu; Zheng, Tongzhang; Zhang, Bin; Li, Yuanyuan; Bassig, Bryan A; Zhou, Aifen; Wang, Youjie; Xiong, Chao; Li, Zhengkuan; Yao, Yuanxiang; Hu, Jie; Zhou, Yanqiu; Liu, Juan; Xue, Weiyan; Ma, Yue; Pan, Xinyun; Peng, Yang; Xu, Shunqing


    Thallium (Tl) is a highly toxic heavy metal widely present in the environment. Case reports have suggested that maternal exposure to high levels of Tl during pregnancy is associated with low birth weight (LBW), but epidemiological data are limited. This study was designed to evaluate whether prenatal Tl exposure is associated with an increased risk of LBW. This case-control study involving 816 study participants (204 LBW cases and 612 matched controls) was conducted in Hubei Province, China, in 2012-2014. Tl concentrations were measured in maternal urine collected at delivery, and associations with LBW were evaluated using conditional logistic regression. Higher maternal urinary Tl levels were significantly associated with increased risk of LBW [crude odds ratio (OR) = 1.52; 95% CI: 1.00, 2.30 for the highest vs. lowest tertile], and the association was similarly elevated after adjustment for potential confounders (adjusted OR = 1.90; 95% CI: 1.01, 3.58 for the highest vs. lowest tertile). Stratified analyses showed slightly higher risk estimates for LBW associated with higher Tl levels for mothers case-control study to investigate the association between prenatal Tl exposure and LBW. The results suggest that prenatal exposure to high levels of Tl may be associated with an increased risk of LBW. Xia W, Du X, Zheng T, Zhang B, Li Y, Bassig BA, Zhou A, Wang Y, Xiong C, Li Z, Yao Y, Hu J, Zhou Y, Liu J, Xue W, Ma Y, Pan X, Peng Y, Xu S. 2016. A case-control study of prenatal thallium exposure and low birth weight in China. Environ Health Perspect 124:164-169;

  8. Evaluation of myocardial abnormalities in patients with collagen diseases by thallium-201 myocardial scintigram

    Energy Technology Data Exchange (ETDEWEB)

    Yamano, Shigeru (Nara Medical Univ., Kashihara (Japan))


    This study was performed to evaluate myocardial lesions in patients with collagen diseases by rest and exercise thallium-201 myocardial scintigraphies. A total of 76 patients without ischemic ECG changes, consisting of 27 cases of systemic lupus erythematosus (SLE), 17 cases of polymyositis or dermatomyositis (PM[center dot]DM), 11 cases of progressive systemic sclerosis (PSS), and 21 cases of Sjoegren's syndrome (SjS), were enrolled in this study. Reversible exercise-induced defects suggesting myocardial ischemia were noted in 12 cases of SLE, 5 cases of PM[center dot]DM, 3 cases of PSS, and 3 cases of SjS. Of the 23 patients who had exercise-induced defects, 9 patients showed normal coronary angiograms by cardiac catheterization. Fixed hypoperfusion areas were observed in 5 cases of SLE, 6 cases of PM[center dot]DM, 4 cases of PSS and 3 cases of SjS. Rest thallium-201 myocardial scintigraphy disclosed hypoperfusion areas, which were not induced by exercise, in 1 case of SLE, 4 cases of PM[center dot]DM, 1 case of PSS and 5 cases of SjS. Endomyocardial biopsy was performed on 20 patients. Myocardial lesions in PM[center dot]DM and PSS were more severe and wide spread than in SLE. Ejection fraction and fractional shortening evaluated by echocardiography had no significant differences between each disease group and the healthy control group. These findings suggest that patients with collagen diseases show the presence of abnormalities of coronary circulation at the level of the intramyocardial vasculature in the stage before impairment of cardiac function, myocardial fibrosis and functional abnormalities of the cell membrane level that were not dependent on myocardial ischemia. (author).

  9. Development and Applications of Thallium isotopes: a new proxy tracking the extent of manganese oxide burial (United States)

    Owens, J. D.; Nielsen, S.; Ostrander, C.; Peterson, L. C.; Anbar, A. D.


    Thallium (Tl) isotopes are a new and potential powerful paleoredox proxy with the possibility to track bottom water oxygen conditions based on the burial flux of manganese oxides. Thallium has a residence time of ~20 thousand years, which is long enough to render modern oxic seawater conservative with respect to concentration and isotopes. The isotopic signature of Tl in the global ocean is driven mainly by two outputs (1) adsorption onto manganese oxides and (2) low temperature oceanic crust alteration. Importantly, the isotopic inputs of Tl are all nearly the same value; thus, the isotopic composition and flux of the outputs almost exclusively set the seawater signature. For relatively short term redox events it is reasonable to assume that the dominant isotope fractionation process is associated with manganese oxide precipitation because low temperature alteration is controlled by long-term average ocean crust production rates. We present a broad range of modern samples that span several open ocean profiles combined with water column and sediment profiles from the permanently anoxic basins of the Black Sea and Cariaco Basins. The open ocean shows no variation in depth profiles that encompass most of the major water masses in the Atlantic and Southern Oceans. The anoxic basins, however, reveal Tl isotope signatures closer to their inputs, which is likely due to basinal restriction. The authigenic fraction of organic-rich sediments from the Black Sea and Cariaco Basin capture the Tl isotope value of the overlying water column, which shows that Tl isotopes could be applied as a faithful deep time redox proxy. For the first time, we will present new data showing that Tl isotopes is tracking bottom water ocean oxygenation. We are applying this isotope system to ancient samples, testing the spatial and temporal variability of ocean oxygenation coinciding with major biogeochemical events.

  10. Thallium myocardial tomoscintigraphy: detection of ischemia during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease. Tomoscintigraphie myocardique au thallium: detection de l'ischemie provoquee par le sevrage de la ventilation assistee chez le bronchiteux chronique

    Energy Technology Data Exchange (ETDEWEB)

    Andre, L.; Valette, H.; Obama, S.; Archambaud, F.; Richard, C.; Teboul, J.L.; Hebert, J.L.; Auzepy, P.; Desgrez, A. (Hopital de Bicetre, 94 - Le Kremlin-Bicetre (FR))


    In order to evidence myocardial ischemia-leading to ventricular dysfunction-during weaning from mechanical ventilation in patients with chronic obstructive pulmonary disease, thallium myocardial tomography and gated blood pool studies were performed in 9 patients during mechanical ventilation and during weaning from mechanical ventilation. During the latter, results of gated blood pool studies showed a diffuse homogeneous left ventricular dysfunction. A fixed lower thallium uptake in the septum than in the lateral wall was found with the quantitative analysis of myocardial tomograms. Partial volume effect is likely the cause of this septal defect. The hypothesis of a diffuse ischemia cannot be excluded; but, without the absolute quantification of tomographic data, it cannot be proven.

  11. Studies of photon spectra from a thallium-204 foil source as an aid to dosimetry and shielding

    CERN Document Server

    Francis, T M


    Beta ray foil sources incorporating nuclides such as thallium-204, promethium-147 and strontium-90 plus yttrium-90 ar increasingly used in industrial devices such as thickness gauges. These sources are so constructed that they give rise to complex photon spectra containing low energy Bremsstrahlung and X-rays characteristic of the constructional materials. The energy response of practical monitoring instruments is such that they are likely to underestimate the dose due to such spectra unless they are calibrated using appropriate spectra. This report describes a series of measurements carried out on a commercially available thallium-204 foil source and five commonly used shielding materials. The measurements made with a NaI(T1) spectrometer have been corrected for instrumental distortions to obtain the photon spectra in air. These spectra are presented and have been used to compute dose in air with the help of published data on mass energy-absorption coefficients. Also included in the report are data derived f...

  12. Septal myocardial perfusion imaging with thallium-201 in the diagnosis of proximal left anterior descending coronary artery disease

    Energy Technology Data Exchange (ETDEWEB)

    Pichard, A.D.; Wiener, I.; Martinez, E.; Horowitz, S.; Patterson, R.; Meller, J.; Goldsmith, S.J.; Gorlin, R.; Herman, M.V.


    The use of myocardial perfusion imaging (MPI) to identify obstructive coronary disease of the left anterior descending coronary artery proximal to the first septal perforator (prox LAD) was studied in 60 patients. Perfusion of the septum and anteroapical areas with thallium-201 injected during exercise was compared to results of coronary arteriography. Septal MPI defect was found in 92.3% of patients with obstruction of the proximal LAD, 27.7% of patients with obstruction of LAD distal to first septal perforator, 0% in patients with obstructions involving right or circumflex arteries, and in 10.5% of patients without coronary disease. Anteroapical MPI defects were found with similar frequency in the three groups with obstructive coronary disease. Septal MPI defect had a sensitivity of 92.3% and specificity of 85.4% in the diagnosis of proximal LAD disease. Normal septal perfusion with thallium-201 virtually excluded proximal LAD disease.

  13. Usefulness of rest-redistribution thallium scan for the indication of PTCA in an interesting case with acute myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chiba, Hiroshi; Nishimura, Tsunehiko; Mitani, Isao; Matsuo, Takeshi; Uehara, Toshiisa; Hayashida, Kohei; Sumiyoshi, Tetsuya; Haze, Kazuo


    A 72-year-old woman with acute myocardial infarction was received coronary thrombolytic therapy. After percutaneous transluminal coronary recanalization (PTCR), the stenosis of LAD became from 99 % to 90 %. Left ventriculogram showed dyskinesis of anterior wall in acute phase. After PTCR, she complained of postinfarctional angina. Thus, in order to evaluate the viability of anterior wall, serial thallium scintigraphy was performed at rest, which showed perfusion defect and redistribution of anterior wall. After percutaneous transluminal coronary angioplasty (PTCA), anterior wall motion became almost normal. The perfusion defect of anterior wall was also gradually disappeared. The serial thallium scintigraphy at rest is an useful method not only to evaluate the viability of myocardium in acute myocardial infarction, but also to follow the effect of PTCA.

  14. Rearrangement of beta,gamma-unsaturated esters with thallium trinitrate: synthesis of indans bearing a beta-keto ester moiety

    Directory of Open Access Journals (Sweden)

    Silva Jr. Luiz F.


    Full Text Available The rearrangement of beta,gamma-unsaturated esters, such as 2-(3,4-dihydronaphthalen-1-yl-propionic acid ethyl ester, with thallium trinitrate (TTN in acetic acid leads to 3-indan-1-yl-2-methyl-3-oxo-propionic acid ethyl ester in good yield, through a ring contraction reaction. The new indans thus obtained feature a beta-keto ester moiety, which would be useful for further functionalization.

  15. Formic acid electrooxidation on thallium-decorated shape-controlled platinum nanoparticles: an improvement in electrocatalytic activity


    Busó-Rogero, Carlos; Perales-Rondón, Juan V.; Farias, Manuel J.S.; Vidal-Iglesias, Francisco J.; Solla-Gullón, José; Herrero, Enrique; Feliu, Juan M.


    Thallium modified shape-controlled Pt nanoparticles were prepared and their electrocatalytic activity towards formic acid electrooxidation was evaluated in 0.5 M sulfuric acid. The electrochemical and in situ FTIR spectroscopic results show a remarkable improvement in the electrocatalytic activity, especially in the low potential region (around 0.1–0.2 V vs. RHE). Cubic Pt nanoparticles modified with Tl were found to be more active than the octahedral Pt ones in the entire range of Tl coverag...

  16. Usefulness and limitations of thallium-201 myocardial scintigraphy in delineating location and size of prior myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Niess, G.S.; Logic, J.R.; Russell, R.O. Jr.; Rackley, C.E.; Rogers, W.J.


    Thirty-two patients were evaluated at a mean of 7 +- 2 months after infarction with a 12-lead ECG, resting /sup 201/Tl myocardial scintigram, biplane left ventriculogram, and coronary angiograms. From the left ventriculogram, asynergy was quantified as percent abnormally contracting segment (% ACS), the percent of end-diastolic circumference which was either akinetic or dyskinetic. Using a computerized planimetry system, we expressed /sup 201/Tl perfusion defects as a percentage of total potential thallium uptake. Of 21 patients with ECG evidence of prior transmural infarction, a /sup 201/Tl defect was present in 20, and angiographic asynergy was present in all 21. The site of prior infarction by ECG agreed with the /sup 201/T1 defect location in 24 of 32 patients and with site of angiographic asynergy in 23 of 32 patients. Scintigraphic defects were present in only four of 10 patients with ACS less than or equal to 6%, but scintigraphic defects were found in 20 of 22 patients with ACS > 6%. Thallium defect size correlated marginally with angiographic left ventricular ejection fraction but correlated closely with angiographic % ACS. Thallium defect size was similar among patients with one-, two-, or three-vessel coronary artery disease (greater than or equal to 70% stenosis), but thallium defect size was larger in patients with electrocardiographic evidence of transmural infarction or pulmonary capillary wedge pressure > 12 mm Hg. Thus, resting /sup 201/T1 myocardial scintigraphy is useful in localizing and quantifying the extent of prior myocardial infarction, but is insensitive to small infarcts (ACS < 6%).

  17. Determination of thallium at ultra-trace levels in water and biological samples using solid phase spectrophotometry. (United States)

    Amin, Alaa S; El-Sharjawy, Abdel-Azeem M; Kassem, Mohammed A


    A new simple, very sensitive, selective and accurate procedure for the determination of trace amounts of thallium(III) by solid-phase spectrophotometry (SPS) has been developed. The procedure is based on fixation of Tl(III) as quinalizarin ion associate on a styrene-divinylbenzene anion-exchange resin. The absorbance of resin sorbed Tl(III) ion associate is measured directly at 636 and 830 nm. Thallium(I) was determined by difference measurements after oxidation of Tl(I) to Tl(III) with bromine. Calibration is linear over the range 0.5-12.0 μg L(-1) of Tl(III) with relative standard deviation (RSD) of 1.40% (n=10). The detection and quantification limits are 150 and 495 ng L(-1) using 0.6 g of the exchanger. The molar absorptivity and Sandell sensitivity are also calculated and found to be 1.31×10(7) L mol(-1)cm(-1) and 0.00156 ng cm(-2), respectively. The proposed procedure has been successfully applied to determine thallium in water, urine and serum samples. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. The efficient removal of thallium from sintering flue gas desulfurization wastewater in ferrous metallurgy using emulsion liquid membrane. (United States)

    Yang, Li; Xiao, Jiangping; Shen, Yi; Liu, Xian; Li, Wensong; Wang, Weiyan; Yang, Yunquan


    The removal of thallium ions in flue gas desulfurization wastewater from ferrous metallurgic industry was studied by emulsion liquid membrane (ELM) method using 2-ethylhexyl phosphoric acid-2-ethylhexyl ester (P507) as carrier, aviation kerosene (AK) as organic solvent, polyisobutylene succinimide (T154) as surfactant, polyisobutylene (PIB) as additive, and sulfuric acid as internal reagent. Some important influence parameters such as concentrations of carrier, surfactant and stripping agent, agitation speed, extraction time, volume ratios of feed solution to emulsion phase and internal phase to membrane phase, and their effects on the removal efficiency of Tl in the ELM process were investigated and optimized. Under the optimum operating conditions of 2% of carrier, 5% of surfactant, 0.5 M of stripping agent, 350 rpm of agitation speed, 12.5:1 of volume ratio of feed solution to emulsion phase, and 3:1 volume ratio of membrane to internal phase, the maximum extraction efficiency of thallium reached 99.76% within 15-min reaction time. The ICP-MS analysis indicated that the thallium concentration in treated wastewater was below 5 μg/L and could meet the emission standard demand for industrial wastewater enacted by the local government of Hunan province of China. Meanwhile, the extraction of impurity ions calcium and magnesium in the ELM system was investigated. The result showed that an acidic environment would be in favor of the removal of Tl from calcium and magnesium contained in wastewater. Graphical abstract ᅟ.

  19. Thallium isotopes in metallurgical wastes/contaminated soils: A novel tool to trace metal source and behavior. (United States)

    Vaněk, Aleš; Grösslová, Zuzana; Mihaljevič, Martin; Ettler, Vojtěch; Trubač, Jakub; Chrastný, Vladislav; Penížek, Vít; Teper, Leslaw; Cabala, Jerzy; Voegelin, Andreas; Zádorová, Tereza; Oborná, Vendula; Drábek, Ondřej; Holubík, Ondřej; Houška, Jakub; Pavlů, Lenka; Ash, Christopher


    Thallium (Tl) concentration and isotope data have been recorded for contaminated soils and a set of industrial wastes that were produced within different stages of Zn ore mining and metallurgical processing of Zn-rich materials. Despite large differences in Tl levels of the waste materials (1-500mgkg-1), generally small changes in ε205Tl values have been observed. However, isotopically lighter Tl was recorded in fly ash (ε205Tl∼-4.1) than in slag (ε205Tl∼-3.3), implying partial isotope fractionation during material processing. Thallium isotope compositions in the studied soils reflected the Tl contamination (ε205Tl∼-3.8), despite the fact that the major pollution period ended more than 30 years ago. Therefore, we assume that former industrial Tl inputs into soils, if significant, can potentially be traced using the isotope tracing method. We also suggest that the isotope redistributions occurred in some soil (subsurface) horizons, with Tl being isotopically heavier than the pollution source, due to specific sorption and/or precipitation processes, which complicates the discrimination of primary Tl. Thallium isotope analysis proved to be a promising tool to aid our understanding of Tl behavior within the smelting process, as well as its post-depositional dynamics in the environmental systems (soils). Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Thallium-isotopic compositions of euxinic sediments as a proxy for global manganese-oxide burial (United States)

    Owens, Jeremy D.; Nielsen, Sune G.; Horner, Tristan J.; Ostrander, Chadlin M.; Peterson, Larry C.


    Thallium (Tl) isotopes are a new and potentially powerful paleoredox proxy that may track bottom water oxygen conditions based on the global burial flux of manganese oxides. Thallium has a residence time of ∼20 thousand years, which is longer than the ocean mixing time, and it has been inferred that modern oxic seawater is conservative with respect to both concentration and isotopes. Marine sources of Tl have nearly identical isotopic values. Therefore, the Tl sinks, adsorption onto manganese oxides and low temperature oceanic crust alteration (the dominant seawater output), are the primary controls of the seawater isotopic composition. For relatively short-term, ∼million years, redox events it is reasonable to assume that the dominant mechanism that alters the Tl isotopic composition of seawater is associated with manganese oxide burial because large variability in low temperature ocean crust alteration is controlled by long-term, multi-million years, average ocean crust production rates. This study presents new Tl isotope data for an open ocean transect in the South Atlantic, and depth transects for two euxinic basins (anoxic and free sulfide in the water column), the Cariaco Basin and Black Sea. The Tl isotopic signature of open ocean seawater in the South Atlantic was found to be homogeneous with ε205Tl = -6.0 ± 0.3 (±2 SD, n = 41) while oxic waters from Cariaco and the Black Sea are -5.6 and -2.2, respectively. Combined with existing data from the Pacific and Arctic Oceans, our Atlantic data establish the conservatism of Tl isotopes in the global ocean. In contrast, partially- and predominantly-restricted basins reveal Tl isotope differences that vary between open-ocean (-6) and continental material (-2) ε205Tl, scaling with the degree of restriction. Regardless of the differences between basins, Tl is quantitatively removed from their euxinic waters below the chemocline. The burial of Tl in euxinic sediments is estimated to be an order of magnitude

  1. Thallium isotopes as a potential tracer for the origin of cratonic eclogites (United States)

    Nielsen, Sune G.; Williams, Helen M.; Griffin, William L.; O'Reilly, Suzanne Y.; Pearson, Norman; Viljoen, Fanus


    Cratonic eclogites are inferred to originate either from subducted ocean crust or mantle melts accreted onto the roots of continents. These models have different implications for the growth of continents, but it is currently difficult to determine the origin of individual eclogite suites. Upper ocean crust altered at low temperatures and marine sediments both display high thallium (Tl) concentrations and strongly fractionated Tl isotope signatures relative to the ambient upper mantle. In this study we carry out the first examination of the suitability of Tl isotopes as a tracer for an ocean-crust origin of cratonic eclogites. We have analysed the Tl isotope composition of clinopyroxene and garnet in six eclogites from the Kaalvallei and Bellsbank kimberlite pipes in South Africa. Minerals were pre-cleaned with an HCl leaching technique and the leachates display variably light Tl isotope ratios. These most likely reflect low-temperature hydrothermal alteration occurring after eruption of the kimberlite that carried the eclogites to the surface. The leached mineral pairs all display identical Tl isotope ratios, strongly suggesting that the source of the analysed Tl is identical for each mineral pair. It is, however, not possible to exclude the possibility that the analysed Tl originates from kimberlitic material that was not removed by the cleaning procedure. Only one of the six samples exhibits a Tl isotope composition different from ambient mantle. Assuming that the Tl isotope signatures indeed represent the eclogite minerals and not any form of contamination, the Tl isotope composition in this sample is consistent with containing a minor component (low temperatures. Thallium isotopes may become one of the most sensitive indicators for the presence of low-T altered ocean crust because of the stark contrast in Tl concentration and isotopic composition between the mantle and altered ocean crust. In fact, no other chemical or isotopic tracer could have provided an

  2. Thallium-201 SPECT in the diagnosis of head and neck cancer. (United States)

    Valdés Olmos, R A; Balm, A J; Hilgers, F J; Koops, W; Loftus, B M; Tan, I B; Muller, S H; Hoefnagel, C A; Gregor, R T


    The accuracy of SPECT with 201Tl-chloride for the diagnosis of primary tumors, lymph node metastases and recurrences in head and neck cancer was evaluated for clinical applicability. SPECT images, obtained 60 min after administration of 150 MBq 201Tl-chloride, were compared with clinical, CT and/or MRI and histology results. In addition, whole-body images were obtained to detect distant metastases. In 79 patients studied for primary tumors (principally larynix, hypopharynx, oropharynx, nasopharynx and oral cavity), 201Tl SPECT correctly identified 69 of 73 (95% versus 88% for CT/MRI) histologically confirmed malignancies including 63 squamous-cell carcinomas. The method localized four occult naso- and oropharynx carcinomas not seen on CT/MRI and was correctly negative in two patients without tumor and in three of four patients with no confirmed primary tumor in the head and neck. With respect to regional spread, only patients who had cervical lymph node dissection were evaluated, and the findings were recorded per side of the neck. Thallium-201 SPECT correctly identified metastases in 31 of 36 neck dissections with proven lymph node involvement (86%), was correctly negative in nine and false-positive in one. Although the sensitivity of CT/MRI was clearly higher (97%), considerably more false-positive cases affected its accuracy (81% versus 87% for SPECT). In 30 patients investigated for recurrences, 201Tl SPECT correctly identified 27 of 29 microscopically confirmed tumor sites (93%) and was correctly negative in seven. Sensitivity of CT/MRI was lower (76%), and a greater number of false-positives (seven versus three for SPECT) further decreased its accuracy (64% versus 87% for SPECT). Distant metastases were detected in five patients. Thallium-201 SPECT appears to be an accurate method for the diagnosis of head and neck cancer. The method is particularly useful for detection of occult head and neck tumors and for assessing recurrences. It also may be of

  3. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland. (United States)

    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata


    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50% of the spawn samples, levels exceeded 20 mgTl/kg d.w. The issue of maternal transfer of thallium from females to oocytes is discussed. Due to a significant accumulation of thallium, spawn analysis can be used as a sensitive indicator of the presence of this element in the environment and may replace more invasive methods that involve the killing of adult animals. In those regions that are abundant in Zn-Pb ores, the spawn of amphibians may be a very important source of thallium contamination for predators. From among all tissues of the Bukowno adult toads, the livers have shown the highest accumulation of thallium (mean 3.98 mg/kg d.w. and maximum value--18.63). For as many as 96.5% of livers, concentrations exceeded 1.0 mgTl/kg d.w. which is treated as indicative of poisoning.

  4. In-situ pre-concentration through repeated sampling and pyrolysis for ultrasensitive determination of thallium in drinking water by electrothermal atomic absorption spectrometry. (United States)

    Liu, Liwei; Zheng, Huaili; Xu, Bincheng; Xiao, Lang; Chigan, Yong; Zhangluo, Yilan


    In this paper, a procedure for in-situ pre-concentration in graphite furnace by repeated sampling and pyrolysis is proposed for the determination of ultra-trace thallium in drinking water by graphite furnace atomic absorption spectrometry (GF-AAS). Without any other laborious enrichment processes that routinely result in analyte loss and contamination, thallium was directly concentrated in the graphite furnace automatically and subsequently subject to analysis. The effects of several key factors, such as the temperature for pyrolysis and atomization, the chemical modifier, and the repeated sampling times were investigated. Under the optimized conditions, a limit of detection of 0.01µgL -1 was obtained, which fulfilled thallium determination in drinking water by GB 5749-2006 regulated by China. Successful analysis of thallium in certified water samples and drinking water samples was demonstrated, with analytical results in good agreement with the certified values and those by inductively coupled plasma mass spectrometry (ICP-MS), respectively. Routine spike-recovery tests with randomly selected drinking water samples showed satisfactory results of 80-96%. The proposed method is simple and sensitive for screening of ultra-trace thallium in drinking water samples. Copyright © 2017. Published by Elsevier B.V.

  5. The ECG component of Thallium-201 exercise testing impacts on cardiac intervention rates

    Energy Technology Data Exchange (ETDEWEB)

    Deague, J.; Salehi, N.; Grigg, L.; Lichtenstein, M.; Better, N. [Royal Melbourne Hospital, Parkville, VIC (Australia). Departments of Nuclear Medicine and Cardiology


    Full text: Thallium exercise testing (Tlex) offers superior sensitivity and specificity to exercise electrocardiography (ECG), but the value of the ECG data in Tlex remains poorly studied. While a normal Tlex is associated with an excellent prognosis, patients with a positive Tlex have a higher cardiac event rate. We aimed to see if a negative ECG Component of the Tlex (ECGTl) was associated with an improved outcome compared with a positive ECGTl, in those patients with a reversible Tlex defect. We followed 100 consecutive patients retrospectively with a reversible defect on Tlex (50 with negative and 50 with positive ECGTI) for 12 months. The ECG was reviewed as positive (1mm ST depression 0.08 seconds after J point or >2mm if on digoxin or prior ECG changes), negative, equivocal or uninterpretable. We excluded patients with pharmacological testing, and those with equivocal or uninterpretable ECGs. End-points included angiography, cardiac interventions and cardiac event rate (CER) incorporating unstable angina, acute myocardial infarction, and cardiac death. In conclusion 24% of patients with reversible defects on Tlex who had a negative ECGTI still proceeded to PTCA or CABG. Those with a positive ECGTI had a higher incidence of angiography and cardiac revascularisation, but this difference was only evident in patients with mild to moderate reversibility

  6. Redox-controlled release dynamics of thallium in periodically flooded arable soil. (United States)

    Antić-Mladenović, Svetlana; Frohne, Tina; Kresović, Mirjana; Stärk, Hans-Joachim; Savić, Dubravka; Ličina, Vlado; Rinklebe, Jörg


    To our knowledge, this is the first work to mechanistically study the impact of the redox potential (E H ) and principal factors, such as pH, iron (Fe), manganese (Mn), dissolved organic carbon (DOC), dissolved inorganic carbon (DIC), chlorides (Cl - ) and sulfates (SO 4 2- ), on the release dynamics of thallium (Tl) in periodically flooded soil. We simulated flooding using an automated biogeochemical microcosm system that allows for systematical control of pre-defined redox windows. The E H value was increased mechanistically at intervals of approximately 100 mV from reducing (-211 mV) to oxidizing (475 mV) conditions. Soluble Tl levels (0.02-0.28 μg L -1 ) increased significantly with increases in E H (r = 0.80, p soils along with a determination of the Tl species and monitoring of the Tl content in plants to achieve more detailed insight into soluble Tl behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.


    Directory of Open Access Journals (Sweden)

    Arif Gökhan BAŞARAN


    Full Text Available Determination of larval growth rate of and forensic analysis of the age of Calliphoridae larvae on a corpse are useful evidence in legal investigations for the estimation of exact death time and time duration after death; post mortem interval. However many factors, such as temperature, tissue type and contamination of drugs and toxins, effect larval development of blow fly larvae and consequently theestimation of post mortem interval. The present study examined the larval growth rate of a forensically important blow fly species, Lucilia sericata Meigen 1826 in different concentrations (0,12; 0,25; 0,50; 1 and 2 μg/g of toxic heavy metal Thallium under controlled laboratory conditions. Body length and weight, death ratio of larvae and pupa between experimental and control groups were compared. Results demonstrated that the development rate of larvae between uncontaminated and contaminated diets varies significantly. In short, they molted later, reached maximum length more slowly and sometimesproduced significantly smaller pupae in contaminated food source. These results emphasized that the importance of determining the contamination rate of toxins in tissue for the forensic entomologist,while using development rates from standard curves based on larvae fed non-contaminated mediums.

  8. Value of transient dilation of the left ventricular cavity on stress thallium scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Sugihara, Hiroki; Shiga, Kouji; Umamoto, Ikuo (Kyoto Prefectural Univ. of Medicine (Japan)) (and others)


    This study was undertaken to evaluate the value of transient dilation of the left ventricular cavity on stress thallium scintigraphy in 80 patients with ischemic heart disease (IHD) and 50 with hypertrophic cardiomyopathy (HCM). Twenty persons without either coronary artery stenosis or heart disease were served as controls. Areas surrounded by maximum count points on the line of each 10deg on the short axis slice through the mid-cavity of the left ventricle were obtained at 10 minutes and at 3 hours after exercise. Transient dilation index (TDI) was obtained by dividing the area on early image by that on delayed image. TDI was significantly higher in patients with two or three vessel disease in the IHD group than the control group. High TDI was observed in 8% for one vessel disease, 40% for two vessel disease, and 80% for three vessel disease, contributing to the detection of multivessel IHD. In the HCM group of 80 patients, 24 (48%) had high TDI which was frequently associated with a history of chest pain and positive ECG findings at exercise. When these 24 HCM patients underwent exercise blood pool scintiscanning, left ventricular enddiastolic volume was similar before and at 10 minutes after exercise. These findings suggest that transient dilation of the left ventricular cavity after exercise may reflect subendocardial ischemia in both IHD and HCM. TDI would become a useful indicator for transient dilation of the left ventricular cavity. (N.K.).

  9. Clinicopathologic correlation study of thallium-201 myocardial scintigraphy in diagnosis of myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Chida, Kouji; Sugiura, Masaya; Ohkawa, Shin-ichiro


    In a series of 1,000 consecutive autopsy cases, we evaluated the clinical utility of thallium-201 (Tl-201) myocardial scintigraphy and electrocardiography (ECG) in 101 patients who had been studied while alive. Fifty-five cases had myocardial infarctions (MI) at autopsy. The Tl-201 scintigram and ECG in diagnosis of MI showed sensitivities of 68 % and 60 %, specificities of 87 % and 83 %, and diagnostic accuracies of 76 % and 70 %, respectively. The sensitivity of the Tl-201 scintigram was 70 % in anterior MI, 80 % in postero-inferior MI, 25 % in lateral and subendocardial infarction. The sensitivity was 88 % for large massive MI, but was low in scattered (50 %) or middle-sized MI (17 %). The diagnostic limit of the resolution of Tl-201 scintigrams was 4.5 cm in long diameter. All 8 cases with MI of less than 4 cm could not be diagnosed with the technique. There were 48 cases of large MI (more than 5 cm), but 8 cases could not be diagnosed by scintigraphy because of non-transmural or scattered MI. A comparison of the Tl-201 scintigram and ECG showed that 27 cases out of 60 cases were diagnosed by both methods, 14 only by the Tl-201 scintigram, 9 only by ECG and 10 by neither method.

  10. Evaluation of myocardial damage in Duchenne's muscular dystrophy with thallium-201 myocardial SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Tamura, Takuhisa; Shibuya, Noritoshi (Kawatana National Hospital, Nagasaki (Japan)); Hashiba, Kunitake; Oku, Yasuhiko; Mori, Hideki; Yano, Katsusuke


    Myocardial damage and cardiopulmonary functions in patients with Duchenne's muscular dystrophy (DMD) were assessed using thallium-201 myocardial single-photon emission computed tomography (SPECT) and technetium-99m multigated radionuclide angiography. Twenty-five patients with DMD were divided into 4 groups according to percent of perfusion defect (%PD) calculated by the bull's-eye method and age. PD was detected in 24 (96.0%) of 25 patients with DMD, and it spread from the left ventricular lateral wall to the anterior wall and/or interventricular septum. PD was detected even in a 6-year-old DMD boy. Patients in Group I (%PD[>=]10% and age<15 years old) were shown to have a higher risk of left-sided heart failure without respiratory failure. Patients in Group II (%PD[>=]10 and age[>=]15) showed decreased pulmonary function and worsened arterial blood gas values as compared with Group IV (%PD<10 and age[>=]15). There was no significant difference in cardiac function among the 4 groups. It is postulated that myocardial damage in Group II patients is dependent primarily on a deficiency of dystrophin and on chronic respiratory failure, and that some of them are at risk of cardiopulmonary failure. It is concluded that myocardial SPECT is useful for the early diagnosis of myocardial damage and evaluation of cardiopulmonary function in DMD patients. (author).

  11. Role of relativity in high-pressure phase transitions of thallium. (United States)

    Kotmool, Komsilp; Chakraborty, Sudip; Bovornratanaraks, Thiti; Ahuja, Rajeev


    We demonstrate the relativistic effects in high-pressure phase transitions of heavy element thallium. The known first phase transition from h.c.p. to f.c.c. is initially investigated by various relativistic levels and exchange-correlation functionals as implemented in FPLO method, as well as scalar relativistic scheme within PAW formalism. The electronic structure calculations are interpreted from the perspective of energetic stability and electronic density of states. The full relativistic scheme (FR) within L(S)DA performs to be the scheme that resembles mostly with experimental results with a transition pressure of 3 GPa. The s-p hybridization and the valence-core overlapping of 6s and 5d states are the primary reasons behind the f.c.c. phase occurrence. A recent proposed phase, i.e., a body-centered tetragonal (b.c.t.) phase, is confirmed with a small distortion from the f.c.c. phase. We have also predicted a reversible b.c.t. → f.c.c. phase transition at 800 GPa. This finding has been suggested that almost all the III-A elements (Ga, In and Tl) exhibit the b.c.t. → f.c.c. phase transition at extremely high pressure.

  12. High thallium concentrations in soils from sites of historical Ag, Pb, and Zn mining in western Małopolska (S Poland

    Directory of Open Access Journals (Sweden)

    Woch M. W.


    Full Text Available The aim of this study was to assess thallium concentration in topsoil originating from sites of historical mining of Ag, Pb and Zn in western Małopolska (S Poland. Soil samples were collected from 63 sites, sieved, ground and digested in hot HClO4. Thallium concentration was measured with an atomic absorption spectrometer. Thallium concentrations averaged 20.84 mg kg-1 and varied from 4.42 to 49.82 mg kg-1. In all studied soils they exceeded values typical for uncontaminated soils (0.02 to 2.8 mg Tl kg-1. This indicates that Tl contamination may threaten the environment and public health. Routine monitoring of Tl contamination in southern Poland is required.

  13. Preconcentration of thallium(III) with 2,6-bis( N-phenyl carbamoyl) pyridine on microcrystalline naphthalene prior to its trace determination in human serum spectrophotometrically (United States)

    Rezaei, B.; Meghdadi, S.; Majidi, N.


    A novel, simple, sensitive and effective method has been developed for preconcentration of thallium on 2,6-bis( N-phenyl carbamoyl)pyridine-naphthalene adsorbent in the pH range 5.0-10.0, prior to its spectrophotometric determination, based on the oxidation of bromopyrogallol red at λ = 518 nm. This method makes it possible to quantitize thallium in the range of 3.0 × 10 -9 to 1.0 × 10 -5 M, with a detection limit (S/N = 3) of 1.2 × 10 -9 M. This procedure has been successfully applied to determine the ultra trace levels of thallium in the environmental and biological samples, free from the interference of some diverse ions. The precision, expressed as relative standard deviation of three measurements is better than 4.17%.

  14. 40 CFR 179.91 - Burden of going forward; burden of persuasion. (United States)


    ... persuasion. 179.91 Section 179.91 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED...; burden of persuasion. (a) The party whose request for an evidentiary hearing was granted has the burden... FFDCA has the burden of persuasion in the hearing on that issue, whether the proceeding concerns the...

  15. 26 CFR 1.179-5 - Time and manner of making election. (United States)


    ...,000, decreasing the depreciation allowable in 2003 for the milling machine, and making any other... of depreciation allowed or allowable in that taxable year for the item of section 179 property to... depreciation in that taxable year for the item of section 179 property to which the revocation pertains). Such...

  16. 32 CFR Appendix A to Part 179 - Tables of the Munitions Response Site Prioritization Protocol (United States)


    ... 32 National Defense 1 2010-07-01 2010-07-01 false Tables of the Munitions Response Site... OF DEFENSE CLOSURES AND REALIGNMENT MUNITIONS RESPONSE SITE PRIORITIZATION PROTOCOL (MRSPP) Pt. 179, App. A Appendix A to Part 179—Tables of the Munitions Response Site Prioritization Protocol The tables...

  17. Biphasic thallium 201 SPECT-imaging for the noninvasive diagnosis of myocardial perfusion abnormalities in a child with Kawasaki disease--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Hausdorf, G.; Nienaber, C.A.; Spielman, R.P.


    The mucocutaneous lymph node syndrome (Kawasaki disease) is of increasing importance for the pediatric cardiologist, for coronary aneurysms with the potential of thrombosis and subsequent stenosis can develop in the course of the disease. The authors report a 2 1/2-year-old female child in whom, fourteen months after the acute phase of Kawasaki disease, myocardial infarction occurred. Biphasic thallium 201 SPECT-imaging using dipyridamole depicted anterior wall ischemia and inferolateral infarction. This case demonstrates that noninvasive vasodilation-redistribution thallium 201 SPECT-imaging has the potential to predict reversible myocardial perfusion defects and myocardial necrosis, even in small infants with Kawasaki disease.

  18. Influence of the Dirac-Hartree-Fock starting potential on the parity-nonconserving electric-dipole-transition amplitudes in cesium and thallium (United States)

    Perger, W. F.; Das, B. P.


    The parity-nonconserving electric-dipole-transition amplitudes for the 6s1/2-7s1/2 transition in cesium and the 6p1/2-7p1/2 transition in thallium have been calculated by the Dirac-Hartree-Fock method. The effects of using different Dirac-Hartree-Fock atomic core potentials are examined and the transition amplitudes for both the length and velocity gauges are given. It is found that the parity-nonconserving transition amplitudes exhibit a greater dependence on the starting potential for thallium than for cesium.

  19. Assessment of myocardial viability by dynamic tomographic iodine 123 iodophenylpentadecanoic acid imaging: comparison with rest-redistribution thallium 201 imaging. (United States)

    Iskandrian, A S; Powers, J; Cave, V; Wasserleben, V; Cassell, D; Heo, J


    This study examined the ability of dynamic 123I-labeled iodophenylpentadecanoic acid (IPPA) imaging to detect myocardial viability in patients with left ventricular (LV) dysfunction caused by coronary artery disease. Serial 180-degree single-photon emission computed tomographic (SPECT) images (five sets, 8 minutes each) were obtained starting 4 minutes after injection of 2 to 6 mCi 123I at rest in 21 patients with LV dysfunction (ejection fraction [EF] 34% +/- 11%). The segmental uptake was compared with that of rest-redistribution 201Tl images (20 segments/study). The number of perfusion defects (reversible and fixed) was similar by IPPA and thallium (11 +/- 5 vs 10 +/- 5 segments/patient; difference not significant). There was agreement between IPPA and thallium for presence or absence (kappa = 0.78 +/- 0.03) and nature (reversible, mild fixed, or severe fixed) of perfusion defects (kappa = 0.54 +/- 0.04). However, there were more reversible IPPA defects than reversible thallium defects (7 +/- 4 vs 3 +/- 4 segments/patient; p = 0.001). In 14 patients the EF (by gated pool imaging) improved after coronary revascularization from 33% +/- 11% to 39% +/- 12% (p = 0.002). The number of reversible IPPA defects was greater in the seven patients who had improvement in EF than in the patients without such improvement (10 +/- 4 vs 5 +/- 4 segments/patient; p = 0.075). 123I-labeled IPPA SPECT imaging is a promising new technique for assessment of viability. Reversible defects predict recovery of LV dysfunction after coronary revascularization.

  20. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) of the thallium superconducting phases (United States)

    Bayya, S. S.; Snyder, R. L.


    This paper explores the speed of reaction as a parameter to minimizing thallium loss. Self-propagating high-temperature synthesis (SHS) and microwave-assisted combustion synthesis (MACS) were developed for the synthesis of Tl-2212 and Tl-2223 superconductors using Cu metal powder as a fuel. A kitchen microwave oven was used to carry out MACS reactions. The samples were reacted for few seconds and led to the formation of the superconducting phases. Further explorations and modifications in the processing could lead to the formation of single phases by MACS.

  1. Tracking along-arc sediment inputs to the Aleutian arc using thallium isotopes (United States)

    Nielsen, Sune G.; Yogodzinski, Gene; Prytulak, Julie; Plank, Terry; Kay, Suzanne M.; Kay, Robert W.; Blusztajn, Jerzy; Owens, Jeremy D.; Auro, Maureen; Kading, Tristan


    Sediment transport from the subducted slab to the mantle wedge is an important process in understanding the chemical and physical conditions of arc magma generation. The Aleutian arc offers an excellent opportunity to study sediment transport processes because the subducted sediment flux varies systematically along strike (Kelemen et al., 2003) and many lavas exhibit unambiguous signatures of sediment addition to the sub-arc mantle (Morris et al., 1990). However, the exact sediment contribution to Aleutian lavas and how these sediments are transported from the slab to the surface are still debated. Thallium (Tl) isotope ratios have great potential to distinguish sediment fluxes in subduction zones because pelagic sediments and low-temperature altered oceanic crust are highly enriched in Tl and display heavy and light Tl isotope compositions, respectively, compared with the upper mantle and continental crust. Here, we investigate the Tl isotope composition of lavas covering almost the entire Aleutian arc a well as sediments outboard of both the eastern (DSDP Sites 178 and 183) and central (ODP Hole 886C) portions of the arc. Sediment Tl isotope compositions change systematically from lighter in the Eastern to heavier in the Central Aleutians reflecting a larger proportion of pelagic sediments when distal from the North American continent. Lavas in the Eastern and Central Aleutians mirror this systematic change to heavier Tl isotope compositions to the west, which shows that the subducted sediment composition is directly translated to the arc east of Kanaga Island. Moreover, quantitative mixing models of Tl and Pb, Sr and Nd isotopes reveal that bulk sediment transfer of ∼0.6-1.0% by weight in the Eastern Aleutians and ∼0.2-0.6% by weight in the Central Aleutians can account for all four isotope systems. Bulk mixing models, however, require that fractionation of trace element ratios like Ce/Pb, Cs/Tl, and Sr/Nd in the Central and Eastern Aleutians occurs after

  2. Controls on thallium uptake during hydrothermal alteration of the upper ocean crust (United States)

    Coggon, Rosalind M.; Rehkämper, Mark; Atteck, Charlotte; Teagle, Damon A. H.; Alt, Jeffrey C.; Cooper, Matthew J.


    Hydrothermal circulation is a fundamental component of global biogeochemical cycles. However, the magnitude of the high temperature axial hydrothermal fluid flux remains disputed, and the lower temperature ridge flank fluid flux is difficult to quantify. Thallium (Tl) isotopes behave differently in axial compared to ridge flank systems, with Tl near-quantitatively stripped from the intrusive crust by high temperature hydrothermal reactions, but added to the lavas during low temperature reaction with seawater. This contrasting behavior provides a unique approach to determine the fluid fluxes associated with axial and ridge flank environments. Unfortunately, our understanding of the Tl isotopic mass balance is hindered by poor knowledge of the mineralogical, physical and chemical controls on Tl-uptake by the ocean crust. Here we use analyses of basaltic volcanic upper crust from Integrated Ocean Drilling Program Hole U1301B on the Juan de Fuca Ridge flank, combined with published analyses of dredged seafloor basalts and upper crustal basalts from Holes 504B and 896A, to investigate the controls on Tl-uptake by mid-ocean ridge basalts and evaluate when in the evolution of the ridge flank hydrothermal system Tl-uptake occurs. Seafloor basalts indicate an association between basaltic uptake of Tl from cold seawater and uptake of Cs and Rb, which are known to partition into K-rich phases. Although there is no clear relationship between Tl and K contents of seafloor basalts, the data do not rule out the incorporation of at least some Tl into the same minerals as the alkali elements. In contrast, we find no relationship between the Tl content and either the abundance of secondary phyllosilicate minerals, or the K, Cs or Rb contents in upper crustal basalts. We conclude that the uptake of Tl and alkali elements during hydrothermal alteration of the upper crust involves different processes and/or mineral phases compared to those that govern seafloor weathering. Furthermore

  3. Chemistry and phase evolution during roasting of toxic thallium-bearing pyrite. (United States)

    Lopez-Arce, Paula; Garcia-Guinea, Javier; Garrido, Fernando


    In the frame of a research project on microscopic distribution and speciation of geogenic thallium (Tl) from contaminated mine soils, Tl-bearing pyrite ore samples from Riotinto mining district (Huelva, SW Spain) were experimentally fired to simulate a roasting process. Concentration and volatility behavior of Tl and other toxic heavy metals was determined by quantitative ICP-MS, whereas semi-quantitative mineral phase transitions were identified by in situ thermo X-Ray Diffraction (HT-XRD) and Scanning Electron Microscopy with Energy Dispersive Spectroscopy (SEM-EDS) analyses after each firing temperature. Sample with initial highest amount of quartz (higher Si content), lowest quantity of pyrite and traces of jarosite (lower S content) developed hematite and concentrated Tl (from 10 up to 72 mg kg-1) after roasting at 900 °C in an oxidizing atmosphere. However, samples with lower or absent quartz content and higher pyrite amount mainly developed magnetite, accumulating Tl between 400 and 500 °C and releasing Tl from 700 up to 900 °C (from 10-29 mg kg-1 down to 4-1 mg kg-1). These results show the varied accumulative, or volatile, behaviors of one of the most toxic elements for life and environment, in which oxidation of Tl-bearing Fe sulfides produce Fe oxides wastes with or without Tl. The initial chemistry and mineralogy of pyrite ores should be taken into account in coal-fired power stations, cement or sulfuric acid production industry involving pyrite roasting processes, and steel, brick or paint industries, which use iron ore from roasted pyrite ash, where large amounts of Tl entail significant environmental pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Measurement of the parity nonconserving neutral weak interaction in atomic thallium

    Energy Technology Data Exchange (ETDEWEB)

    Bucksbaum, P.H.


    This thesis describes an experiment to measure parity nonconservation in atomic thallium. A frequency doubled, flashlamp pumped tunable dye laser is used to excite the 6P/sub 1/2/(F = 0) ..-->.. 7P/sub 1/2/(F = 1) transition at 292.7 nm, with circularly polarized light. An electrostatic field E of 100 to 300 V/cm causes this transition to occur via Stark induced electric dipole. Two field free transitions may also occur: a highly forbidden magnetic dipole M, and a parity nonconserving electric dipole epsilon/sub P/. The latter is presumed to be due to the presence of a weak neutral current interaction between the 6p valence electron and the nucleus, as predicted by gauge theories which unite the electromagnetic and weak interactions. Both M and epsilon/sub P/ interfere with the Stark amplitude ..beta..E to produce a polarization of the 7P/sub 1/2/ state. This is measured with a circularly polarized infrared laser beam probe, tuned to the 7P/sub 1/2/ ..-->.. 8S/sub 1/2/ transition. This selectively excites m/sub F/ = +1 or -1 components of the 7P/sub 1/2/ state, and the polarization is seen as an asymmetry in 8S ..-->.. 6P/sub 3/2/ fluorescence when the probe helicity is reversed. The polarization due to M is M/ = -2M/(BETAE). It is used to calibrate the analyzing efficiency. The polarization due to epsilon/sub P/ is P/ = 2i epsilon/sub P//(..beta..E), and can be distinguished from M/ by its properties under reversal of the 292.7 nm photon helicity and reversal of the laser direction. A preliminary measurement yielded a parity violation in agreement with the gauge theory of Weinberg and Salam.

  5. MRI and thallium-201 SPECT in the prediction of survival in glioma

    Energy Technology Data Exchange (ETDEWEB)

    Vos, Maaike J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Medical Center Haaglanden, Department of Neurology, PO Box 432, The Hague (Netherlands); Berkhof, Johannes [VU University Medical Center, Department of Epidemiology and Biostatistics, Amsterdam (Netherlands); Hoekstra, Otto S. [VU University Medical Center, Department of Nuclear Medicine and PET Research, Amsterdam (Netherlands); Bosma, Ingeborg; Sizoo, Eefje M.; Heimans, Jan J.; Reijneveld, Jaap C.; Postma, Tjeerd J. [VU University Medical Center, Department of Neurology, Amsterdam (Netherlands); Sanchez, Esther [VU University Medical Center, Department of Radiology, Amsterdam (Netherlands); Lagerwaard, Frank J. [VU University Medical Center, Department of Radiation Oncology, Amsterdam (Netherlands); Buter, Jan [VU University Medical Center, Department of Medical Oncology, Amsterdam (Netherlands); Noske, David P. [VU University Medical Center, Department of Neurosurgery and Neuro-Oncology Research Group, Amsterdam (Netherlands)


    This paper aims to study the value of MRI and Thallium 201 ({sup 201}Tl) single-photon emission computed tomography (SPECT) in the prediction of overall survival (OS) in glioma patients treated with temozolomide (TMZ) and to evaluate timing of radiological follow-up. We included patients treated with TMZ chemoradiotherapy for newly diagnosed glioblastoma multiforme (GBM) and with TMZ for recurrent glioma. MRIs and {sup 201}Tl SPECTs were obtained at regular intervals. The value of both imaging modalities in predicting OS was examined using Cox regression analyses. Altogether, 138 MRIs and 113 {sup 201}Tl SPECTs in 46 patients were performed. Both imaging modalities were strongly related to OS (P {<=} 0.02). In newly diagnosed GBM patients, the last follow-up MRI (i.e., after six adjuvant TMZ courses) and SPECT (i.e., after three adjuvant TMZ courses) were the strongest predictors of OS (P = 0.01). In recurrent glioma patients, baseline measurements appeared to be the most predictive of OS (P < 0.01). The addition of one imaging modality to the other did not contribute to the prediction of OS. Both MRI and {sup 201}Tl SPECT are valuable in the prediction of OS. It is adequate to restrict to one of both modalities in the radiological follow-up during treatment. In the primary GBM setting, MRI after six adjuvant TMZ courses contributes significantly to the prediction of survival. In the recurrent glioma setting, baseline MRI appears to be a powerful predictor of survival, whereas follow-up MRIs during TMZ seem to be of little additional value. (orig.)

  6. Synthesis, calorimetric, structural and conductivity studies in a new thallium selenate tellurate adduct compound

    Energy Technology Data Exchange (ETDEWEB)

    Ktari, L. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Abdelhedi, M. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France); Bouhlel, N. [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Dammak, M., E-mail: [Laboratoire de l' Etat Solide (LES), Faculte des Sciences de Sfax, 3000 Sfax (Tunisia); Cousson, A. [Laboratoire Leon Brouillon LLB, CEA Saclay, 91191 Gif-Sur-Yvette Cedex (France)


    The crystal structure of the thallium selenate tellurate Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} (TlSeTe) was determined by X-ray diffraction method. The title compound crystallizes in the monoclinic system with P2{sub 1}/c space group. The following parameters are: a = 12.358(3) A; b = 7.231(1) A; c = 11.986(2) A; {beta} = 111.092(2){sup o}; Z = 4. The structure can be regarded as being built of isolated TeO{sub 6} octahedra and SeO{sub 4} tetrahedra. The Tl{sup +} cations are intercalated between these kinds of polyhedra. The main feature of this structure is the coexistence of two different and independent anions (SeO{sub 4}{sup 2-} and TeO{sub 6}{sup 6-}) in the same unit cell. The structure is stable due to O-H...O hydrogen bonds which link tetrahedral and octahedral groups. Crystals of Tl{sub 2}SeO{sub 4}.Te(OH){sub 6} undergo three endothermal transitions at 373, 395 and 437 K. These transitions are detected by DSC and analyzed by dielectric measurements with impedance spectroscopy. The evolution of conductivity versus temperature showed the presence of a protonic conduction phase transition at 437 K. The phase transition at 373 K can be related to a structural phase transition, whereas the one at 395 K is ascribed as likely due to a ferroelectric-paraelectric phase transition.

  7. Electrochemical properties of modified copper-thallium hexacyanoferrate electrode in the presence of different univalent cations

    Energy Technology Data Exchange (ETDEWEB)

    Rutkowska, Iwona A.; Stroka, Jadwiga [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland); Galus, Zbigniew [Department of Chemistry, University of Warsaw, Pasteura 1, PL-02-093 Warsaw (Poland)], E-mail:


    The preparation of copper(II) hexacyanoferrate (CuHCF) films on the surface of gold electrodes as well as their characterization in solutions of various alkali metal and NH{sub 4}{sup +} cations and in the presence of thallium(I) are described. The electrochemical quartz crystal microbalance and cyclic voltammetric techniques were used. In 0.50 M lithium nitrate, even at submillimolar concentration of Tl(I), the formal potential of CuHCF was shifted to more positive values. At higher Tl(I) concentrations, the formal potential of the CuHCF redox reaction changed linearly with the logarithm of Tl(I) concentration (in the 0.50 M solution of lithium or another alkali metal nitrate). From such dependencies, selectivity coefficients K{sub Tl/M} were calculated, and they show that the CuHCF film on the gold electrode interacts preferentially with Tl(I). High affinity of Tl(I) to copper hexacyanoferrate, that was observed in the presence of alkali metal cations, was explained by relatively strong donor-acceptor interactions of Tl(I) ions with nitrogen in CN groups of the CuHCF film. It was also shown for simple M{sub 4}[Fe(CN){sub 6}] metal ferrocyanate salts (where M = Li{sup +}, Na{sup +}, K{sup +}, Rb{sup +}, Cs{sup +} and Tl{sup +}) that there is a preferential interaction of Tl{sup +} with CN group consistent with formation of a Tl-NC-Fe bridge.

  8. Quantitative evaluation of thallium-201 myocardial scintigram in coronary artery diseases

    Energy Technology Data Exchange (ETDEWEB)

    Mikada, Ken-etsu (Akita Univ. (Japan). School of Medicine)


    Quantitative indices from circumferential profile curves of thallium-201 ([sup 201]Tl) myocardial scintigram were evaluated for diagnostic utility in coronary artery diseases (CAD). Myocardial [sup 201]Tl scintigrams with single photon emission computed tomography (SPECT) were obtained 5 minutes (early) and 4 hours (delayed) after exercise in 20 normal subjects and 66 cases of CAD, of which 20 were angina pectoris without myocardial infarction (AP), 14 were subendocardial infarction (non-QMI) and 32 were Q-wave infarction (QMI). Tl counts, %Tl uptake and washout ratio (WR) were measured in 81 segments (9 apical segments of the slice from the longitudinal axis and all 72 segments of two slices from the short axis). A mean early defect (MED), a mean delayed defect (MDD), a mean delta washout rate (MDR), and a [Sigma] delayed defect ([Sigma]DD) were calculated from the areas which were below the two standard deviations of the mean %Tl uptake in normal subjects. A mean filling-in (MFI) was calculated from the difference of the %Tl uptake between early and delayed curves in each patient. In patients with CAD, the MED and MFI were higher, but MDW was lower with a more severe coronary stenosis, indicating that these indices were useful to detect myocardial hypo-perfuion. In severely stenotic regions, the MDD was higher in QMI than in AP and non-QMI, indicating that the ratio of infarct to the myocardium in the region was higher in QMI. In QMI, [Sigma]DD correlated well (r=0.723) with Total Wall Motion Scores with two-dimentional echocardiography which was directly related with infarct size. Further, MED, MFI and MDW were improved after aortocoronary bypass only in patients with patent graft. It is concluded that this quantitative evaluation with [sup 201]Tl-SPECT can provide an objective and quantitative estimate of regional myocardial ischemia and infarct. (author).

  9. Thallium-201 for cardiac stress tests: residual radioactivity worries patients and security. (United States)

    Geraci, Matthew J; Brown, Norman; Murray, David


    A 47-year-old man presented to the Emergency Department (ED) in duress and stated he was "highly radioactive." There were no reports of nuclear disasters, spills, or mishaps in the local area. This report discusses the potential for thallium-201 (Tl-201) patients to activate passive radiation alarms days to weeks after nuclear stress tests, even while shielded inside industrial vehicles away from sensors. Characteristics of Tl-201, as used for medical imaging, are described. This patient was twice detained by Homeland Security Agents and searched after he activated radiation detectors at a seaport security checkpoint. Security agents deemed him not to be a threat, but they expressed concern regarding his health and level of personal radioactivity. The patient was subsequently barred from his job and sent to the hospital. Tl-201 is a widely used radioisotope for medical imaging. The radioactive half-life of Tl-201 is 73.1h, however, reported periods of extended personal radiation have been seen as far out as 61 days post-administration. This case describes an anxious, but otherwise asymptomatic patient presenting to the ED with detection of low-level personal radiation. Documentation should be provided to and carried by individuals receiving radionuclides for a minimum of five to six half-lives of the longest-lasting isotope provided. Patients receiving Tl-201 should understand the potential for security issues; reducing probable tense moments, confusion, and anxiety to themselves, their employers, security officials, and ED staff. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Usefulness of thallium-201 SPECT in the evaluation of tumor natures in intracranial meningiomas

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, Tetsuji; Nakano, Takahiro; Asano, Kenichiroh; Shimamura, Norihito; Ohkuma, Hiroki [Hirosaki University Graduate School of Medicine, Department of Neurosurgery, Hirosaki (Japan)


    Although intracranial meningiomas are regarded as benign tumors, some of them behave clinically as malignant tumors. Past reports suggest that MIB 1 and vascular endothelial growth factor (VEGF) in postoperative tumor specimens correlate with the aggressive nature of tumors, but preoperative prediction of such a nature is more useful for therapeutic planning for the tumor. The purpose of this study was to assess the usefulness of preoperative thallium-201 chloride single-photon emission computed tomography (Tl SPECT) to evaluate biological behavior in intracranial meningiomas. Tl SPECT was performed on 39 patients with intracranial meningioma and Tl uptake indices were calculated. The difference in the Tl uptake index between atypical meningiomas and other pathological types of meningioma was evaluated. Moreover, correlation of Tl uptake indices with the MIB1 labeling index was estimated. Tl uptake indices were also compared between VEGF strongly positive and weakly positive meningiomas. The delayed index of atypical meningioma was significantly higher than that of the other pathological types (p = 0.036). Significant correlation was found between the Tl uptake index in the delayed image and MIB1 labeling index (p < 0.0001, R{sup 2} = 0.36). Moreover, VEGF strongly positive meningiomas exhibited a significantly higher Tl uptake index compared to VEGF weakly positive meningiomas in both the early image and the delayed image (p = 0.029, 0.023, respectively). Tl uptake index may be a possible preoperative surrogate marker of MIB1 and VEGF that is useful in detecting aggressive natures in intracranial meningiomas. (orig.)

  11. Effective removal of trace thallium from surface water by nanosized manganese dioxide enhanced quartz sand filtration. (United States)

    Huangfu, Xiaoliu; Ma, Chengxue; Ma, Jun; He, Qiang; Yang, Chun; Zhou, Jian; Jiang, Jin; Wang, Yaan


    Thallium (Tl) has drawn wide concern due to its high toxicity even at extremely low concentrations, as well as its tendency for significant accumulation in the human body and other organisms. The need to develop effective strategies for trace Tl removal from drinking water is urgent. In this study, the removal of trace Tl (0.5 μg L -1 ) by conventional quartz sand filtration enhanced by nanosized manganese dioxide (nMnO 2 ) has been investigated using typical surface water obtained from northeast China. The results indicate that nMnO 2 enhanced quartz sand filtration could remove trace Tl(I) and Tl(III) efficiently through the adsorption of Tl onto nMnO 2 added to a water matrix and onto nMnO 2 attached on quartz sand surfaces. Tl(III)-HA complexes might be responsible for higher residual Tl(III) in the effluent compared to residual Tl(I). Competitive Ca 2+ cations inhibit Tl removal to a certain extent because the Ca 2+ ions will occupy the Tl adsorption site on nMnO 2 . Moreover, high concentrations of HA (10 mgTOC L -1 ), which notably complexes with and dissolves nMnO 2 (more than 78%), resulted in higher residual Tl(I) and Tl(III). Tl(III)-HA complexes might also enhance Tl(III) penetration to a certain extent. Additionally, a higher pH level could enhance the removal of trace Tl from surface water. Finally, a slight increase of residual Tl was observed after backwash, followed by the reduction of the Tl concentration in the effluent to a "steady" state again. The knowledge obtained here may provide a potential strategy for drinking water treatment plants threatened by trace Tl. Copyright © 2017. Published by Elsevier Ltd.

  12. Reduced left ventricular cavitary activity ("black hole sign") in thallium-201 SPECT perfusion images of anteroapical transmural myocardial infarction. (United States)

    Civelek, A C; Shafique, I; Brinker, J A; Durski, K; Weiss, J L; Links, J M; Natarajan, T K; Ozguven, M A; Wagner, H N


    Apparently reduced left ventricular (LV) cavitary thallium activity in both planar and tomographic perfusion images has been previously observed by these and other investigators. With single-photon emission computerized tomography, we have clinically noted that this "black hole sign" was associated with an aneurysm in the setting of a transmural anterior or anteroapical perfusion defect. We have now prospectively studied the etiology and predictive value of this sign in 84 consecutive patients with an anterior, anteroapical transmural perfusion defect. Of the 84 patients, 49 had both LV aneurysm (confirmed by contrast ventriculography, echocardiography or gated blood pool studies) and a black hole sign. Only 1 patient with an aneurysm did not have the black hole sign, and 2 without aneurysm did. Thus, it is concluded that this sign is highly accurate in diagnosing LV aneurysm. Because thallium-201 single-photon emission computerized tomography imaging is often performed as one of the first diagnostic tests soon after myocardial infarction, this has important clinical management implications.

  13. The analysis of thallium in geological materials by radiochemical neutron activation and x-ray fluorescence spectrometry: a comparison

    Energy Technology Data Exchange (ETDEWEB)

    McGoldrick, P.J.; Robinson, P. [Tasmania Univ., Sandy Bay, TAS (Australia)


    Carrier-based radiochemical neutron activation (RNAA) is a precise and accurate technique for the analysis of Tl in geological materials. For about a decade, until the mid-80s, a procedure modified from Keays et al. (1974) was used at the University of Melbourne to analyse for Tl in a wide variety of geological materials. Samples of powdered rock weighing several hundred milligrams each were irradiated in HIFAR for between 12 hours and 1 week, and subsequently fused with a sodium hydroxide - sodium peroxide mixture and several milligrams of inactive Tl carrier. Following acid digestion of the fusion mixture anion exchange resin was used to separate Tl from the major radioactive rock constituents. The Tl was then stripped from the resin and purified as thallium iodide and a yield measured gravimetrically. Activity from {sup 204}Tl (a {beta}-emitter with a 3 8 year half-life) was measured and Tl determined by reference to pure chemical standards irradiated and processed along with the unkowns. Detection limits for the longer irradiations were about one part per billion. Precision was monitored by repeat analyses of `internal standard` rocks and was estimated to be about five to ten percent (one standard deviation). On the other hand, X-ray fluorescence spectrometry (XRF) was seen as an excellent cost-effective alternative for thallium analysis in geological samples, down to 1 ppm. 6 refs. 1 tab., 1 fig.

  14. Pentoxifylline (Trental) does not inhibit dipyridamole-induced coronary hyperemia: Implications for dipyridamole-thallium-201 myocardial imaging

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Slinker, B.K. (Univ. of Vermont College of Medicine, Burlington (USA))


    Dipyridamole-thallium-201 imaging is often performed in patients unable to exercise because of peripheral vascular disease. Many of these patients are taking pentoxifylline (Trental), a methylxanthine derivative which may improve intermittent claudication. Whether pentoxifylline inhibits dipyridamole-induced coronary hyperemia like other methylxanthines such as theophylline and should be stopped prior to dipyridamole-thallium-201 imaging is unknown. Therefore, we studied the hyperemic response to dipyridamole in seven open-chest anesthetized dogs after pretreatment with either pentoxifylline (0, 7.5, or 15 mg/kg i.v.) or theophylline (3 mg/kg i.v.). Baseline circumflex coronary blood flows did not differ significantly among treatment groups. Dipyridamole significantly increased coronary blood flow before and after 7.5 or 15 mm/kg i.v. pentoxifylline (p less than 0.002). Neither dose of pentoxifylline significantly decreased the dipyridamole-induced hyperemia, while peak coronary blood flow was significantly lower after theophylline (p less than 0.01). We conclude that pentoxyifylline does not inhibit dipyridamole-induced coronary hyperemia even at high doses.

  15. Thallium-201 scintigraphy after dipyridamole infusion with low-level exercise. III Clinical significance and additional diagnostic value of ST segment depression and angina pectoris during the test

    NARCIS (Netherlands)

    G-J. Laarman (GertJan); P.W.J.C. Serruys (Patrick); J.F. Verzijlbergen (Fred); C.A.P.L. Ascoop (Carl); J. Azar


    textabstractIntravenous dipyridamole thallium testing is a useful alternative procedure for assessing coronary artery disease (CAD) in patients who are unable to perform maximal exercise tests. Ischaemic ST segment depression and angina pectoris are frequently observed during the test, in particular

  16. Indium-111 antimyosin antibody imaging and thallium-201 imaging. A comparative myocardial scintigraphic study using single-photon emission computed tomography in patients with myocarditis and dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Takehiko; Matsumori, Akira; Nohara, Ryuji; Konishi, Junji; Sasayama, Shigetake [Kyoto Univ. (Japan). Faculty of Medicine; Tamaki, Nagara


    Indium-111 antimyosin antibody imaging (a tracer of myocardial necrosis) and thallium-201 imaging (a tracer of myocardial perfusion) were compared in patients with myocarditis and dilated cardiomyopathy. The distribution of each tracer and antimyosin/thallium-201 overlapping were evaluated with single-photon emission computed tomography (SPECT). Scintigraphic data were classified into 5 patterns according to the distribution of both images and were compared with histologic findings of endomyocardial biopsy: AM-D, intense and diffuse antimyosin uptake and no perfusion abnormality (active myocarditis); AM-L, localized antimyosin uptake and no perfusion abnormality (active myocarditis); HM, no antimyosin uptake with or without perfusion abnormality (healed myocarditis); DCM-NH, diffuse antimyosin uptake and inhomogeneous thallium-201 uptake (dilated cardiomyopathy); DCM-PD, diffuse or localized antimyosin uptake and myocardial perfusion defect(s) (dilated cardiomyopathy). Patients with dilated-phase hypertrophic cardiomyopathy were frequently found in the DCM-PD group. Taken together, comparative antimyosin/thallium-201 SPECT images are useful for evaluating the activity of myocarditis and ongoing myocardial damage even in areas with no perfusion in patients with dilated cardiomyopathy. (author)

  17. Thallium-201 myocardial scintigraphy in patients with normal coronary arteries and normal left ventriculogram. Comparison with hemodynamic, metabolic and morphologic findings

    Energy Technology Data Exchange (ETDEWEB)

    Loesse, B.; Kuhn, H.; Rafflenbeul, D.; Kroenert, H.; Hort, W.; Feinendegen, L.E.; Loogen, F.


    36 consecutive patients with chest pain and/or severe ventricular dysrhythmias, but normal coronary arteries and normal left ventriculogram, underwent thallium-201 myocardial imaging at rest and during exercise. The myocardial scintigram was abnormal in 27 patients (group A) and normal in only 9 patients (group B).

  18. Preconcentration of thallium (I) by single drop microextraction with electrothermal atomic absorption spectroscopy detection using dicyclohexano-18-crown-6 as extractant system. (United States)

    Chamsaz, Mahmoud; Arbab-Zavar, Mohammad Hossien; Darroudi, Abolfazl; Salehi, Thiery


    A simple single drop liquid-phase microextraction (SDME) technique, combined with electrothermal atomic absorption spectroscopy (ETAAS) is developed both to preconcentrate and determine thallium (I) ions in aqueous solutions. The ions were transferred from 10.0 ml of aqueous sample (donor phase) containing 0.5 ml of 1% picric acid as the ion-pair agent into a 3 microl microdrop of nitrobenzene (acceptor phase) containing dicyclohexano-18-crown-6 as the complexing agent. The latter will help to improve the extraction efficiency of the analyte. After the ions have been extracted, the acceptor drop was directly injected into a graphite furnace for thallium (I) determination. Several parameters such as the extracting solvent, extraction time, temperature, concentration of picric acid and crown ether, drop volume and stirring rate were examined. Under the optimized experimental conditions, the detection limit (L.O.D.) was 0.7 ng ml(-1). The relative standard deviation for five replicate analysis of 10 ng ml(-1) of thallium (I) was 5.1%. The calibration curve was linear in the range of 3-22 ng ml(-1). The results for determination of thallium in reference material, spiked tap water and seawater demonstrated the accuracy, recovery and applicability of the presented method. The enrichment factor was 50.

  19. 49 CFR 179.300 - General specifications applicable to multi-unit tank car tanks designed to be removed from car... (United States)


    ... 110AW). 179.300 Section 179.300 Transportation Other Regulations Relating to Transportation PIPELINE AND... SPECIFICATIONS FOR TANK CARS Specifications for Multi-Unit Tank Car Tanks (Classes DOT-106A and 110AW) § 179.300...

  20. Synthesis and application of a novel nanostructured ion-imprinted polymer for the preconcentration and determination of thallium(I) ions in water samples

    Energy Technology Data Exchange (ETDEWEB)

    Fayazi, M., E-mail: [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, M. [Young Researchers and Elite Club, Kerman Branch, Islamic Azad University, Kerman (Iran, Islamic Republic of); Taher, M.A. [Department of Chemistry, Faculty of Sciences, Shahid Bahonar University of Kerman, Kerman (Iran, Islamic Republic of); Ghanei-Motlagh, R. [Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of); Salavati, M.R. [Department of Chemistry, Faculty of Science, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of)


    Highlights: • A novel nanostructured thallium(I)-imprinted polymer was evaluated for trace detection of Tl(I). • The prepared sorbent displayed rapid extraction rate, high sensitivity and good reproducibility. • The proposed methodology was applied for quantification of Tl(I) in different water samples. - Abstract: A novel synthesized nanostructured ion-imprinted polymer (IIP) was investigated for the determination of trace amount of thallium(I). For this purpose, the thallium(I) IIP particles were synthesized using methacrylic acid (MAA) as the functional monomer, ethylene glycol dimethacrylate (EGDMA) as the cross-linker, methyl-2-[2-(2-2-[2-(methoxycarbonyl) phenoxy] ethoxyethoxy) ethoxy] benzoate as the chelating agent and 2,2-azobisisobutyronitrile (AIBN) as the initiator. The prepared IIP particles were characterized by field emission scanning electron microscopy (FE-SEM), Fourier transform infrared spectroscopy (FT-IR) and thermo gravimetric analysis (TGA). Various experimental factors such as pH, the amount of IIP particles, sorption and desorption time, sample volume, elution condition, and potentially interfering ions systematically examined. Under the optimum conditions, a sensitive response to Tl(I) within a wide concentration range (0.05–18 μg L{sup −1}) was achieved. The limit of detection (LOD, 3S{sub b}/m) was 6.3 ng L{sup −1}. The maximum adsorption capacity of the novel imprinted adsorbent for Tl(I) was calculated to be 18.3 mg g{sup −1}. The relative standard deviation (RSD) for eight replicate detections of 0.1 μg L{sup −1} of thallium(I) was found to be 4.0%. An enrichment factor (EF) of 100 was obtained by this method. The proposed technique was successfully applied to monitoring thallium in different water samples and the certified reference material.

  1. L-Tyrosine immobilized on multiwalled carbon nanotubes: A new substrate for thallium separation and speciation using stabilized temperature platform furnace-electrothermal atomic absorption spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Pacheco, Pablo H.; Gil, Raul A. [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina); Smichowski, Patricia, E-mail: [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Rivadavia 1917, CP C1033 AAJ, Ciudad de Buenos Aires (Argentina); Comision Nacional de Energia Atomica, Gerencia Quimica, Av. Gral. Paz 1499, B1650KNA San Martin (Argentina); Polla, Griselda [Comision Nacional de Energia Atomica, Gerencia de Investigacion y Aplicaciones, Av.Gral. Paz 1499, B1650KNA San Martin (Argentina); Martinez, Luis D., E-mail: [Departamento de Quimica Analitica, Facultad de Quimica, Bioquimica y Farmacia, Universidad Nacional de San Luis, Chacabuco y Pedernera, P.O. Box 375, 5700 San Luis (Argentina); Instituto de Quimica de San Luis (INQUISAL-CONICET), Chacabuco y Pedernera, CP 5700, San Luis (Argentina)


    An approach for the separation and determination of inorganic thallium species is described. A new sorbent, L-tyrosine-carbon nanotubes (L-tyr-CNTs), was used and applied to the analysis of tap water samples. At pH 5.0, L-tyr was selective only towards Tl(III), while total thallium was determined directly by stabilized temperature platform furnace-electrothermal atomic absorption spectrometry (STPF-ETAAS). The Tl(III) specie, which was retained by L-tyrosine, was quantitatively eluted from the column with 10% of nitric acid. An on-line breakthrough curve was used to determine the column capacity, which resulted to be 9.00 {mu}mol of Tl(III) g{sup -1} of L-tyr-CNTs with a molar ratio of 0.14 (moles of Tl bound to moles of L-tyr at pH 5). Transient peak areas revealed that Tl stripping from the column occurred instantaneously. Effects of sample flow rate, concentration and flow rate of the eluent, and interfering ions on the recovery of the analyte were systematically investigated. The detection limit for the determination of total thallium (3{sigma}) by STPF-ETAAS was 150 ng L{sup -1}. The detection limit (3{sigma}) for Tl(III) employing the separation system was 3 ng L{sup -1}, with an enrichment factor of 40. The precision of the method expressed as the relative standard deviation (RSD) resulted to be 3.4%. The proposed method was applied to the speciation and determination of inorganic thallium in tap water samples. The found concentrations were in the range of 0.88-0.91 {mu}g L{sup -1} of Tl(III), and 3.69-3.91 {mu}g L{sup -1} of total thallium.

  2. Tracing subducted sediment inputs to the Ryukyu arc-Okinawa Trough system: Evidence from thallium isotopes (United States)

    Shu, Yunchao; Nielsen, Sune G.; Zeng, Zhigang; Shinjo, Ryuichi; Blusztajn, Jerzy; Wang, Xiaoyuan; Chen, Shuai


    Sediments are actively subducted in virtually every arc worldwide. However, quantifying their contributions to arc lavas and thereby establishing budgets of how sediments participate in slab-mantle interaction is challenging. In this contribution we use thallium (Tl) abundances and isotopic compositions of lavas from the Ryukyu arc (including south Kyushu) and its back-arc basin, Okinawa Trough, to investigate the influence of sediments from arc to back-arc. We also present extensive geochemical data for sediments and altered oceanic crust (AOC) outboard of the northern (DSDP Sites 296, 442B, 443 and 444) and central (DSDP Sites 294 and 295) part of the Ryukyu arc. The Tl isotopic compositions of sediments change systematically from lighter outboard of northern Ryukyu arc to heavier outboard of central Ryukyu arc. The feature reflects the dominance of terrigenous material and pelagic sedimentation outboard of the northern and central Ryukyu arc, respectively. Central and northern sections of Ryukyu arc and Okinawa Trough display larger range of Tl isotopic variation than southern section, which is consistent with more pelagic provenance for sediments outboard of central and northern Ryukyu arcs than that of expected sediments outboard of southern Ryukyu arc. Identical Tl, Sr, Nd and Pb isotope variations are found when comparing arc and back arc lavas, which indicates that sediments fluxes also account for the Tl isotopic variations in the Okinawa Trough lavas. Two-end-member mixing models of Tl with Pb, Sr and Nd isotopes require sediment inputs ofsediment end members predict very similar sediment fluxes when using Tl, Sr, Nd and Pb isotopes, which indicates that fractionation of these elements must have happened after mixing between mantle and sediments. This conclusion is corroborated by model calculations of mixing between sediment melts with fractionated Sr/Nd ratios and mantle wedge, which show that no arc lava plot on such mixing lines. Thus bulk sediment

  3. Comparison of arbutamine stress and treadmill exercise thallium-201 SPECT: Hemodynamics, safety profile and diagnostic accuracy

    Energy Technology Data Exchange (ETDEWEB)

    Kiat, H.; Berman, D.S. [Cedars-Sinai Medical Centre, Los Angeles, California, LA (United States)


    Full text: Arbutamine (ARB), a new pharmacologic stress agent with enhanced chronotropic property compared to dobutamine, was compared with treadmill (TM) exercise testing (Ex) in a multicenter study using thallium-201 (Tl) SPECT. Of the total of 184 patients who underwent ARB, 69 also had TM stress and quantitative coronary angiography. Fifty-eight patients with a low pretest likelihood of CAD also underwent ARB study for evaluation of test specificity (normalcy rate). Tl scans were scored by a central laboratory using a 20 segment (seg)/scan visual analysis (5 point system: 0=normal, 4-absent uptake). Maximum heart rate (HR) by ARB and Ex was 122 vs 141 bpm (p<0.05). Mean %HR change from baseline was similar (79% vs 82%, respectively, p=ns). Maximum systolic BP for ARB and Ex was 173 vs 175 mmHg, and mean % change from baseline was 24% vs 28% (p=ns). Sensitivity for detecting CAD (270% stenosis) by ARB Tl was 94% and 97% by Ex Tl (p=ns). Stress Tl SPECT segmental agreement for presence of defect between ARB and Ex was 92% (kappa=0.8, p<0.001). Exact segmental stress Tl score (0-4 grading) agreement was 83 % (kappa=0.7, p<0.001). Among 346 segs with stress defects by both ARB and Ex defect reversibility agreement was 86% (kappa=0.7, p<0.001). The normalcy rate for ARB TI-SPECT among patients with a low likelihood of CAD was 90%. Adverse events were mostly mild (tremor: 23%, flushing: 10%, headache: 10%, paraesthesia: 8%, dizziness: 8%, hot flushes: 4%). Arrhythimia of clinical concern occurred in 8% (10/122) of ARB patients who had cardiac catheterisation and in 1.4% (1/69) of patients who had stress Tl. Of all 184 patients with ARB stress, ARB was discontinued due to arrhythmia in 7(5%) and 1 patient had IV Metoprolol for frequent ventricular couplets. Sustained arrhythmias were not observed

  4. Thallium Isotopes Tracking Mn-Oxide Burial - A Proxy for Deoxygenation During Oceanic Anoxic Event 2 (United States)

    Ostrander, C.; Owens, J. D.; Nielsen, S.


    Thallium (Tl) is proving to be a useful paleoredox proxy given that the Tl isotope composition of seawater is highly dependent on the magnitude of manganese (Mn) oxide burial in the ocean. In turn, Mn oxides require oxygen at the sediment-water interface to precipitate, linking the Tl isotope cycle to ocean oxygenation. Currently, the marine residence time of Tl is ~20kyrs and the Tl isotope composition of seawater is invariant, which suggests Tl isotopes could be a global tracer of marine Mn-oxide burial. Importantly, recent research suggests sediments deposited under a euxinic water column faithfully record the Tl isotope value of the overlying oxic water column (e.g. Black Sea and Cariaco Basin). Therefore, analysis of organic-rich black shales may prove useful in evaluating the seawater Tl isotope composition of past oceans and, hence, large-scale burial of Mn-oxides and the extent of bottom water ocean oxygenation. A logical test for this proxy is during the well-studied Cenomanian-Turonian boundary event termed Oceanic Anoxic Event 2 (OAE-2) at ~94 Ma. It is known that the global extent of anoxia and euxinia increased during this event, however, to what extent global bottom water deoxygenation occured is unconstrained. If deep water deoxygenation occurred, it would be hypothesized that Mn-oxide precipitation would decrease, resulting in a positive Tl isotope excursion during OAE-2. We have analyzed the Tl isotope composition of organic-rich black shales from Site 1258 of the Ocean Drilling Program (ODP) spanning the period before, during, and after OAE-2. Based on Fe redox proxies, the entire section is euxinic and thus no Mn-oxides are present (i.e. no local redox changes). Before the event, Tl isotope compositions are similar or slightly heavier than modern seawater values. Just prior to the onset of OAE-2, a positive shift occurs and is maintained until recovery, slightly before the termination of the event. The shift to heavier values and subsequent

  5. Geochemical translocation of thallium in the sediments from the North River, China (United States)

    Liu, J.


    Thallium (Tl) is a highly toxic rare heavy metal. As a sulphophile element, it usually occurs in numerous sulphide minerals (such as pyrite, galena, sphlerite). Guangdong north region, known as the hometown of nonferrous metals, has abundant containing Tl mineral resources. Numerous industrial activities, such as mining, smelting, and electroplating are also flourishing. In 2010, a serious Tl pollution in the North River (a major river in the Northern Guangdong Province) shocked the society. The Tl pollution in water appeared to be under control after that incident. But in fact, even if the wastewater discharge of pollution sources has been controlled, the potential risk of heavy metal pollution in the sediments of the North River still exists, for the metals are easy to precipitate and accumulate into sediment from water. So far, Tl pollution in sediments has been studied to a very limited extent. In this paper, we investigated the content and vertical distribution characteristics of Tl and some other related heavy metals in a typical sediment profile from the North River by using inductively coupled plasma mass spectrometry (ICP-MS). Then the Pb isotopic compositions in the sediments were measured by using multi-inductively coupled plasma mass spectrometry (MC-ICP-MS). Several sediments from typical layers were also subjected to sequential extraction procedure for investigating the geochemical fractions of Tl. The risk of Tl and other metal pollution was finally assessed by calculating geo-accumulation indexes (Igeo) and potential ecological risk. The results showed that: (1) Tl concentrations range 1.03 mg/kg to 3.13 mg/kg with a mean of 1.89 mg/kg, three times higher than that in local background soil; (2) Tl content generally increased with depth with some fluctuations and significant correlations were found between Tl and Pb, Zn, Cd, Cu, and Ni; (3) About 46 % to 70 % in sediment cores were resided in the residual fraction; (4) Igeo showed that the studied

  6. 49 CFR 179.16 - Tank-head puncture-resistance systems. (United States)


    ... FOR TANK CARS General Design Requirements § 179.16 Tank-head puncture-resistance systems. (a... weight of at least 217,724 kg (480,000 pounds) and the hand brake is applied on the last “backup” car... 49 Transportation 2 2010-10-01 2010-10-01 false Tank-head puncture-resistance systems. 179.16...

  7. Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact (United States)

    Hu, Ningjing; Liu, Jihua; Shi, Xuefa


    Source and distribution of sedimentary thallium in the Bohai Sea: Implications for hydrodynamic forces and anthropogenic impact Hu Ningjing, Liu Jihua, Shi Xuefa First Institute of Oceanography, State Oceanic Administration, Qingdao 266061, China Thallium (Tl), a non-essential and highly toxic trace metal, is listed as priority toxic pollutant by the United States Environmental Protection Agency (USEPA) (Keith and Telliard, 1979). However, its geochemical cycling in aquatic environment has received far less attention than that of many other trace metals. This has been attributed to relatively little commercial interest in Tl and, until recently, problems inherent in its detection at environmental concentrations (Meeravali and Jiang, 2008). In this study, we investigated the sources, distribution and fate of Tl in surface sediments of the Bohai Sea (BS), China, based on the datasets of total Tl and chemical speciation of Tl of 408 surface sediment samples in the total entire BS. The enrichment factors and chemical speciation of Tl indicated that Tl in BS was dominated by natural Tl, although anthropogenic Tl contamination was observed in the Liuguhe River mouth; the mud deposits are the sinks of Tl and the regional currents and tide systems play a key role on the accumulation of Tl in BS. The distribution of Tl consistent with that of MnO and Fe2O3 as well as the level of Fe-Mn fraction is relatively high, indicating MnO and Fe2O3 influence the geochemical behaviors of Tl in the BS. Although the positive correlation between Tl and TOC is observed for the samples in the BS, however, level of Tl in oxidizable faction could be neglected, suggesting TOC might not be a major factor affecting the concentration of Tl in BS. The low proportion of Tl in the non-residual fraction dominated by the Fe-Mn oxides suggested that the labile Tl was controlled by the Fe-Mn oxides and Tl has a low bioavailability and a minor potential threat to biota in BS. Acknowledgements: this work

  8. Fractionation and Mobility of Thallium in Volcanic Ashes after Eruption of Eyjafjallajökull (2010) in Iceland. (United States)

    Karbowska, Bozena; Zembrzuski, Wlodzimierz


    Volcanic ash contains thallium (Tl), which is highly toxic to the biosphere. The aim of this study was to determine the Tl concentration in fractions of volcanic ash samples originating from the Eyjafjallajökull volcano. A sequential extraction scheme allowed for a study of element migration in the environment. Differential pulse anodic stripping voltammetry using a flow measuring system was selected as the analytical method to determine Tl content. The highest average content of Tl in volcanic ash was determined in the fraction entrapped in the aluminosilicate matrix (0.329 µg g(-1)), followed by the oxidizable fraction (0.173 µg g(-1)). The lowest content of Tl was found in the water soluble fraction (0.001 µg g(-1)); however, this fraction is important due to the fact that Tl redistribution among all the fractions occurs through the aqueous phase.

  9. Determination of gold, indium, tellurium and thallium in the same sample digest of geological materials by atomic-absorption spectroscopy and two-step solvent extraction (United States)

    Hubert, A.E.; Chao, T.T.


    A rock, soil, or stream-sediment sample is decomposed with hydrofluoric acid, aqua regia, and hydrobromic acid-bromine solution. Gold, thallium, indium and tellurium are separated and concentrated from the sample digest by a two-step MIBK extraction at two concentrations of hydrobromic add. Gold and thallium are first extracted from 0.1M hydrobromic acid medium, then indium and tellurium are extracted from 3M hydrobromic acid in the presence of ascorbic acid to eliminate iron interference. The elements are then determined by flame atomic-absorption spectrophotometry. The two-step solvent extraction can also be used in conjunction with electrothermal atomic-absorption methods to lower the detection limits for all four metals in geological materials. ?? 1985.

  10. Cloning and phylogenetic analysis of a fatty acid elongase gene from Nannochloropsis oculata CS179 (United States)

    Pan, Kehou; Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Yang, Guanpin


    Nannochloropsis oculata CS179, a unicellular marine microalga, is rich in long-chain polyunsaturated fatty acids (LCPUFAs). Elongase and desaturase play a key role in the biosynthesis of PUFAs. A new elongase gene, which encodes 322 amino acids, was identified via RT-PCR and 5' and 3' RACE. The sequence of the elongase gene was blast-searched in the NCBI GenBank and showed a similarity to those of the cryptosporidium. But the NJ-tree revealed that the N. oculata CS179 elongase clustered with those of the microalgae Phaeodactylum tricornutum, Ostreococcus tauri and Thalassiosira pseudonana.

  11. Intrinsic gK factors of odd-mass 167− 179Lu isotopes

    Indian Academy of Sciences (India)

    In this paper, g K -factors of the intrinsic magnetic moments and effective spin gyromagnetic factors ( g s eff ) of the 167−179Lu isotopes have been studied within the Tamm–Dancoff approximation (TDA) (Kuliev et al, Sov. J. Nucl. Phys. 9, 185 (1969)) by using a realistic potential such as Woods–Saxon potential for the first ...

  12. 14 CFR 121.179 - Airplanes: Reciprocating engine-powered: En route limitations: All engines operating. (United States)


    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Airplanes: Reciprocating engine-powered: En...: CERTIFICATION AND OPERATIONS OPERATING REQUIREMENTS: DOMESTIC, FLAG, AND SUPPLEMENTAL OPERATIONS Airplane Performance Operating Limitations § 121.179 Airplanes: Reciprocating engine-powered: En route limitations: All...

  13. 78 FR 34675 - National Council on the Arts 179th Meeting (United States)


    ... ARTS AND THE HUMANITIES National Council on the Arts 179th Meeting AGENCY: National Endowment for the Arts, National Foundation on the Arts and Humanities. ACTION: Notice of meeting. SUMMARY: Pursuant to... given that a meeting of the National Council on the Arts will be held at the Nancy Hanks Center, 1100...

  14. 49 CFR 179.201-5 - Postweld heat treatment and corrosion resistance. (United States)


    ... 49 Transportation 2 2010-10-01 2010-10-01 false Postweld heat treatment and corrosion resistance....201-5 Postweld heat treatment and corrosion resistance. (a) Tanks and attachments welded directly... tested to demonstrate that they possess the corrosion resistance specified in § 179.200-7(d), Footnote 2...

  15. Comparison of glucose-insulin-thallium-201 infusion single photon emission computed tomography (SPECT), stress-redistribution-reinjection thallium-201 SPECT and low dose dobutamine echocardiography for prediction of reversible dysfunction

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, Hiroki; Kondo, Makoto; Motohiro, Masayuki; Usami, Satoru [Shimada Municipal Hospital, Shizuoka (Japan)


    The usefulness of glucose-insulin-thallium-201 (GI-Tl) infusion single photon emission computed tomography (SPECT) in predicting reversible dysfunction has not been evaluated, so the present study recruited 20 patients with regional ischemic dysfunction for investigation. All patients underwent GI-Tl SPECT, post-stress Tl reinjection imaging and low dose dobutamine echocardiography. The diagnostic accuracy of these 3 techniques in predicting functional recovery was evaluated by receiver operating characteristic (ROC) analysis. In segments with functional recovery, regional Tl activities of GI-Tl SPECT were significantly higher than those of reinjection imaging (p<0.05), although there were no significant differences in segments without recovery. The area under the ROC curve for GI-Tl SPECT (0.75{+-}0.06) was greater than that for reinjection imaging (0.68{+-}0.07). The optimal cutoff values to identify viable myocardium were considered to be 55% of peak activity for GI-Tl SPECT and 50% for reinjection imaging. At this cutoff point, the sensitivity and specificity for detection of functional recovery were, respectively, 85% and 61% for GI-Tl SPECT, and 73% and 61% for reinjection imaging. Dobutamine echocardiography had the same sensitivity (85%), but lower specificity (48%) than GI-Tl SPECT. Continuous infusion of GI-Tl solution enhances regional Tl uptake compared with conventional post-stress reinjection imaging. This study suggests that GI-Tl SPECT is superior to reinjection imaging and dobutamine echocardiography in predicting functional recovery after ischemic left ventricular dysfunction. (author)

  16. 42 CFR 137.179 - May a Self-Governance Tribe make agreements with the Federal Records Centers regarding disclosure... (United States)


    ... 42 Public Health 1 2010-10-01 2010-10-01 false May a Self-Governance Tribe make agreements with... § 137.178? 137.179 Section 137.179 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES TRIBAL SELF-GOVERNANCE...

  17. 21 CFR 179.21 - Sources of radiation used for inspection of food, for inspection of packaged food, and for... (United States)


    ... CONSUMPTION (CONTINUED) IRRADIATION IN THE PRODUCTION, PROCESSING AND HANDLING OF FOOD Radiation and Radiation... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sources of radiation used for inspection of food, for inspection of packaged food, and for controlling food processing. 179.21 Section 179.21 Food and...

  18. 42 CFR 416.179 - Payment and coinsurance reduction for devices replaced without cost or when full or partial... (United States)


    ... replaced without cost or when full or partial credit is received. 416.179 Section 416.179 Public Health... devices replaced without cost or when full or partial credit is received. (a) General rule. CMS reduces... replaced without cost to the ASC or the beneficiary; (2) The ASC receives full credit for the cost of a...

  19. Detection and dosimetry of gamma ray emitted from thallium-201 and technetium-99m based on chemiluminescence technique

    Energy Technology Data Exchange (ETDEWEB)

    Shourian, Mostafa [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Tavakoli, Hassan, E-mail: [Faculty of Medicine, Department of Physiology and Biophysics, Faculty of Medicine, Baqiyatollah University of Medical Sciences, P.O. Box 19395-6558, Tehran (Iran, Islamic Republic of); Ghourchian, Hedayatollah, E-mail: [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of); Rafiee-Pour, Hossain-Ali [Laboratory of Microanalysis, Institute of Biochemistry and Biophysics, University of Tehran, P.O. Box 13145-1384, Tehran (Iran, Islamic Republic of)


    This report describes the detection and dosimetry of gamma ray emitted from Thallium-201 ({sup 201}Tl) and Technetium-99m ({sup 99m}Tc) based on chemiluminescence technique. H{sub 2}O{sub 2} produced by two gamma emitter radioisotopes of {sup 201}Tl and {sup 99m}Tc were quantitatively measured by chemiluminescence method. Upon producing H{sub 2}O{sub 2} in a luminol alkaline solution, in the presence of diperiodatocuprate, as catalyst a chemical reaction was accrued and consequently the emitted light was measured. The determined H{sub 2}O{sub 2} concentration was correlated with the gamma ray detection and dosimetry. The sensitivity of chemiluminescence technique for {sup 201}Tl and {sup 99m}Tc dosimetry was determined to be 0.20 and 0.08 MBq/l (Mega Becquerel per liter) respectively (R.S.D. = %5, N = 3). The plotted calibration curves showed detection limits of 3.24 and 1.76 MBq/l for {sup 201}Tl and {sup 99m}Tc, respectively.

  20. Myocardial infarction diagnosis with body surface potential mapping, electrocardiography, vectorcardiography and thallium-201 scintigraphy: a correlative study with left ventriculography. (United States)

    Ackaoui, A; Nadeau, R; Sestier, F; Savard, P; Primeau, R; Lemieux, R; Descary, M C


    In 35 subjects with typical or atypical angina and/or documented myocardial infarction (MI), body surface potential maps (BSPMs), ECG, VCG and rest Thallium-201 (T1-201) have been compared to left ventriculography (LVG). BSPMs were recorded with 26 ECGs, and BSPM abnormalities for MI cases were considered to be areas of normally positive potentials that have become negative. Subjects with MI were classified according to the segmental localization and degree of asynergy on LVG. Moderate anterolateral and apical asynergy were found to correlate with BSPM diagnosis of anterolateral MI and ischemia, severe anterolateral and apical asynergy with BSPM diagnosis of anterolateral MI and ischemia, and moderate diaphragmatic and/or posterobasal asynergy with BSPM diagnosis of posterior MI. Simultaneous anterior and posterior asynergy were found for BSPM diagnosis of anterior with posterior MI. Subjects with no LVG asynergy had normal BSPMs. BSPM diagnosis had the highest correlation coefficient with the LVG diagnosis (r = 0.88). ECG and VCG showed similar results with r = 0.65 and 0.71 respectively, while T1-201 had r = 0.55. The examination of our BSPMs, as well as the ECG, VCG and T1-201, did not permit to detect apical damage in presence of anterior MI, and posterobasal damage in the presence of inferoposterior MI. It is concluded that BSPMs are slightly superior to ECG and VCG for diagnosis of MI.

  1. Thallium release from acid mine drainages: Speciation in river and tap water from Valdicastello mining district (northwest Tuscany). (United States)

    Campanella, Beatrice; Casiot, Corinne; Onor, Massimo; Perotti, Martina; Petrini, Riccardo; Bramanti, Emilia


    In this work we present an advantageous method for the simultaneous separation and detection of Tl(I) and Tl(III) species through ion chromatography coupled with on-line inductively coupled plasma - mass spectrometry. Chromatographic separation between Tl(III) and Tl(I) was achieved in less than two minutes. The method was validated by recovery experiments on real samples, and by comparing the sum of the concentrations of individual Tl species with total thallium values obtained from continuous flow ICP-MS. The experimental procedure offers an accurate, sensitive and interference-free method for Tl speciation at trace levels in environmental samples. This allowed us to investigate the Tl speciation in acid mine drainages (AMD), surface waters and springs in a mining catchment in Valdicastello Carducci (Tuscany, Italy), where severe Tl contamination ad been evidenced previously. This study shows for the first time that Tl(III), in addition to Tl(I), is present in considerable amounts in water samples affected by acid mining outflow, raising the question of the origin of this thermodynamically unstable species. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Specificity protein 1-zinc finger protein 179 pathway is involved in the attenuation of oxidative stress following brain injury

    Directory of Open Access Journals (Sweden)

    Jian-Ying Chuang


    Full Text Available After sudden traumatic brain injuries, secondary injuries may occur during the following days or weeks, which leads to the accumulation of reactive oxygen species (ROS. Since ROS exacerbate brain damage, it is important to protect neurons against their activity. Zinc finger protein 179 (Znf179 was shown to act as a neuroprotective factor, but the regulation of gene expression under oxidative stress remains unknown. In this study, we demonstrated an increase in Znf179 protein levels in both in vitro model of hydrogen peroxide (H2O2-induced ROS accumulation and animal models of traumatic brain injury. Additionally, we examined the sub-cellular localization of Znf179, and demonstrated that oxidative stress increases Znf179 nuclear shuttling and its interaction with specificity protein 1 (Sp1. Subsequently, the positive autoregulation of Znf179 expression, which is Sp1-dependent, was further demonstrated using luciferase reporter assay and green fluorescent protein (GFP-Znf179-expressing cells and transgenic mice. The upregulation of Sp1 transcriptional activity induced by the treatment with nerve growth factor (NGF led to an increase in Znf179 levels, which further protected cells against H2O2-induced damage. However, Sp1 inhibitor, mithramycin A, was shown to inhibit NGF effects, leading to a decrease in Znf179 expression and lower cellular protection. In conclusion, the results obtained in this study show that Znf179 autoregulation through Sp1-dependent mechanism plays an important role in neuroprotection, and NGF-induced Sp1 signaling may help attenuate more extensive (ROS-induced damage following brain injury.

  3. Page | 179

    African Journals Online (AJOL)

    Fr. Ikenga

    This is so because as the economy of a nation advances, so the creative industry grows; and so also does the need for access to the .... foreign political and economic forces. By this, reference is ...... Identifying the Public Domain,” (White Paper Prepared in Furtherance of the Digital Musical Literary Project,. National Science ...

  4. Thallium in spawn, juveniles, and adult common toads (Bufo bufo) living in the vicinity of a zinc-mining complex, Poland


    Dmowski, Krzysztof; Rossa, Monika; Kowalska, Joanna; Krasnodębska-Ostręga, Beata


    A breeding population of the common toad Bufo bufo living in the vicinity of a Zn-Pb smelting works in Bukowno, Poland was studied for the presence of thallium. Tl concentration was measured in the bottom sediments of the spawning pond, in the laid eggs, in juveniles after metamorphosis, and in the selected tissues of the adult individuals. A very high concentration of Tl was detected in the spawn (13.97 ± 8.90 mg/kg d.w.). In 50 % of the spawn samples, levels exceeded 20 mgTl/kg d.w. The iss...

  5. Effects of potassium channel opener on the kinetics of thallium-201 in in-vitro and in-vivo

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.; Kim, E. J.; Ahn, B. C.; Chae, S. C.; Lee, K. B. [College of Medicine, Kyungpook National Univ., Taegu (Korea, Republic of); Kim, C. K. [Mt. Sinai Medical School, New York (United States)


    Potassium channel opener (K-opener) opens membrane ATP-sensitive K{sup +}-channel and induces and increase in potassium efflux from cells. K-openers are powerful smooth muscle relaxants and currently used as antihypertensive, antianginal drugs or bronchodilators in clinic. Pharmacologic potency of newly synthesized K-opener is being evaluated with efflux capacity of preincubated Rb-83 from the isolated aortic vascular tissue preparation. Thallium has similar characteristics to those of rubidium and potassium in vivo. To evaluate the effect of pinacidil (a potent K-opener) on Tl-201 biokinetics, we have performed uptake/washout studies in cultured myocytes, and mice biodistribution study. Primary culture of spontaneous contracting myocytes was undertake from hearts of newborn Sprague-Dawley rat. Different concentration of pinacidil (100nM or 10uM) was co-incubated with Tl-201 in HBSS buffer to evaluate its effect on cellular uptake, or challenged to myocyte preparations pre-incubated with Tl-201 for washout study. Pinacidil was injected into mice simultaneous or 10-min after Tl-201 injection, and organ uptake and whole body retention ratio was measured using gamma counter or dose calibrator. Co-incubation of pinacidil with Tl-201 resulted in a decrease in Tl uptake into myocytes by 1.6 - 2.5 times, and an increase in washout by 1.6 - 3.1 times. Pinacidil injection resulted in mild decrease in blood, heart and liver uptake in mice, bur renal uptake was markedly decreased in a dose dependent manner. These results suggest that the pinacidil Tl-201 kinetics and may potentially affect the interpretation of Tl-201 myocardial imaging.

  6. Functional Significance of Angiographic Collaterals in Patients with Totally Occluded Right Coronary Artery: Intracoronary Thallium-201 Scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Do Yun; Lee, Jong Doo; Cho, Seung Yun; Shim, Won Heum; Ha, Jong Won; Kim, Han Soo; Kwon, Hyuk Moon; Jang, Yang Soo; Chung, Nam Sik; Kim, Sung Soon [Yonsei University College of Medicine, Seoul (Korea, Republic of); Park, Chang Yun; Kim, Young Soo [Inje University College of Medicine, Seoul (Korea, Republic of)


    To compare the myocardial viability in patients suffering from total occlusion of the right coronary artery (RCA) with the angiographic collaterals, intracoronary injection of Thallium-201 (T1-201) was done to 14 coronary artery disease (CAD) patients (pts) with total occlusion of RCA and into four normal subjects for control. All 14 CAD pts had Grade 2 or 3 collateral circulations. There were 14 male and 4 females, and their ages ranged from 31 to 70 years. In nine pts, T1-201 was injected into left main coronary artery (LCA) (300 approx 350 mu Ci) to evaluate the myocardial viability of RCA territory through collateral circulations. The remaining five pts received T1-201 into RCA (200-250 mu Ci) because two had intraarterial bridging collaterals and three had previous successful PTCA. Planar and SPECT myocardial perfusion images were obtained 30 minutes, and four to five hours after T1-201 reinjection. Intravenous T1-201 reinjection (six pts) or {sup 99m}Tc-MIBI (two pts) were also performed in eight CAD pts. Intracoronary myocardial perfusion images were compared with intravenous T1-201(IV T1-201) images, EGG, and ventriculography. Intracoronary TI-201 images proved to be superior to that of IV T1-201 due to better myocardial to background uptake ratio and more effective in the detection of viable tissue. We also found that perfusion defects were smaller on intracoronary T1-201 images than those on the IV T1-201. All of the 14 CAD pts had either mostly viable myocardium (seven pts) or large area of T1-201 perfusion (seven pts) in RCA territory, however ventriculographic wall motion and ECG did not correlate well with intracoronary myocardial perfusion images. In conclusion, total RCA occlusion patients with well developed collateral circulation had large area of viable myocardial in the corresponding territory.

  7. Disease stage classification in hypertrophic cardiomyopathy by dual analysis of iodine-123-labeled metaiodobenzylguanidine and thallium-201 myocardial scintigraphies

    Energy Technology Data Exchange (ETDEWEB)

    Hiasa, Go [Ehime Univ., Matsuyama (Japan). School of Medicine


    Many patients with hypertrophic cardiomyopathy (HCM) gradually changes from typical myocardial hypertrophy to dilated cardiomyopathy-like features. However, it is difficult to estimate the disease stage in HCM. To determine the disease stage, dual analysis of iodine-123-labeled metaiodobenzylguanidine ({sup 123}I-MIBG) and thallium-201 ({sup 201}Tl) myocardial scintigraphies were performed in 108 HCM patients. According to the scintigraphic distribution patterns, patients were divided into three groups. Group A (n=15): normal distributions of both {sup 123}I-MIBG and {sup 201}Tl, group B (n=71): normal {sup 201}Tl and low {sup 123}I-MIBG patterns, group C (n=22): low distributions of both scintigraphies. The decrease in {sup 201}Tl uptake was observed in only group C. Concerning {sup 123}I-MIBG, heart-to-mediastinum ratio (H/M) and washout rate (WOR) had good correlations with left ventricular systolic functions. H/M was decreased and WOR was increased in order of C, B and A groups. Left ventricular diastolic function reflected by isovolumic relaxation time was longer in group B than in group A. Attenuated left ventricular hypertrophy, enlarged left ventricular volumes, impaired left ventricular functions and serious clinical symptoms were observed in only group C. Myocardial sympathetic abnormalities in group B may be mainly due to myocardial hypertrophy, and those in group C may be due to myocardial injury. Dual analysis of {sup 123}I-MIBG and {sup 201}Tl scintigraphies may be useful to classify disease stages of HCM. (author)

  8. New quaternary thallium indium germanium selenide TlInGe2Se6: Crystal and electronic structure (United States)

    Khyzhun, O. Y.; Parasyuk, O. V.; Tsisar, O. V.; Piskach, L. V.; Myronchuk, G. L.; Levytskyy, V. O.; Babizhetskyy, V. S.


    Crystal structure of a novel quaternary thallium indium germanium selenide TlInGe2Se6 was investigated by means of powder X-ray diffraction method. It was determined that the compound crystallizes in the trigonal space group R3 with the unit cell parameters a = 10.1798(2) Å, c = 9.2872(3) Å. The relationship with similar structures was discussed. The as-synthesized TlInGe2Se6 ingot was tested with X-ray photoelectron spectroscopy (XPS) and X-ray emission spectroscopy (XES). In particular, the XPS valence-band and core-level spectra were recorded for initial and Ar+ ion-bombarded surfaces of the sample under consideration. The XPS data allow for statement that the TlInGe2Se6 surface is rigid with respect to Ar+ ion-bombardment. Particularly, Ar+ ion-bombardment (3.0 keV, 5 min duration, ion current density fixed at 14 μA/cm2) did not cause substantial modifications of stoichiometry in topmost surface layers. Furthermore, comparison on a common energy scale of the XES Se Kβ2 and Ge Kβ2 bands and the XPS valence-band spectrum reveals that the principal contributions of the Se 4p and Ge 4p states occur in the upper and central portions of the valence band of TlInGe2Se6, respectively, with also their substantial contributions in other portions of the band. The bandgap energy of TlInGe2Se6 at the level of αg=103 cm-1 is equal to 2.38 eV at room temperature.

  9. Synthesis, Characterization and Antibacterial Studies of N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide and Its Neodymium(III and Thallium(III Complexes

    Directory of Open Access Journals (Sweden)

    Lawrence Nnamdi Obasi


    Full Text Available N-(Benzothiazol-2-yl-4-chlorobenzenesulphonamide (NBTCS was synthesized by condensation reaction of 4-chlorobenzenesulphonyl chloride and 2-aminobenzothiazole in acetone under reflux. Neodymium(III and thallium(III complexes of the ligand were also synthesized. Both ligand and metal complexes were characterized using UV-Vis, IR, 1H- and 13C-NMR spectroscopies, elemental analysis and molar conductance measurement. IR studies revealed that the ligand is tridentate and coordinates to the metal ions through nitrogen and oxygen atoms of the sulphonamide group and nitrogen atom attached to benzothiazole ring. The neodymium(III complex displays a coordination number of eight while thallium(III complex displays a coordination number of six. The ligand and its complexes were screened in vitro for their antibacterial activities against Escherichia coli strains (E. coli 6 and E. coli 13, Proteus species, Staphylococcus aureus and Pseudomonas aeruginosa using the agar well diffusion technique. The synthesized compounds were found to be more active against the microorganisms screened relative to ciprofloxacin, gentamicin and co-trimoxazole.

  10. Comparative study of body surface isopotential map, left ventriculogram and thallium-201 myocardial scintigram in patients with old lateral myocardial infarction

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Naoyuki


    In 16 patients with old lateral myocardial infarction, body surface isopotential maps and 12 lead electrocardiograms were compared with left ventriculographic findings. In addition 8 of these subjects were performed thallium-201 myocardial scintigraphy in order to determine the location and extent of myocardial necrosis. Common 12 lead electrocardiographic findings of the subjects were initial Q waves more than 30 msec and inverted T waves in only aVL lead. The patients were classified into 4 groups according to the location and extent of ventricular wall motion abnormalities group I (6 cases) showed hypokinesis in the anterior segment, group II (5 cases): akinesis in the anterior segment and hypokinesis in the seg. 6, group III (4 cases): hypokinesis in the anterior segment and seg. 7, group IV (1 case): hypokinesis in the anterior segment and seg. 4, 7. And each of the 4 groups demonstrated characteristic findings of surface isopotential maps. Group II with coexisting hypokinesis in the seg. 6 showed surface isopotential maps additional pattern of anterior myocardial infarction, and group III with coexisting hypokinesis in the seg. 7 showed additional patterns of posterior myocardial infarction. The classification according to the abnormality of ventricular wall motion was also conformed with the thallium-201 myocardial scintigraphic findings except one case. These results suggest that body surface isopotential map is more useful than the 12 lead electrocardiogram in detecting the location and extent of left ventricular wall motion abnormality in patients with old lateral myocardial infarction. (author) 53 refs.

  11. Serial thallium-201 imaging at rest in patients with unstable and stable angina pectoris: relationship of myocardial perfusion at rest to presenting clinical syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.A.; Okada, R.D.; Boucher, C.A.; Phillips, H.R.; Strauss, H.W.; Pohost, G.M.


    In order to determine whether there are differences in myocardial perfusion at rest among patients with various unstable and stable angina syndromes, serial thallium-201 imaging was performed at rest in 19 patients presenting with rapidly worsening exertional angina (unstable angina, group A), 12 patients with rest angina alone without exertional symptoms (unstable angina, group B), and 34 patients with chronic stable angina. No patient had an episode of angina within 4 hours of study. Nineteen of 19 (100%) patients in group A demonstrated transient defects compared to only 3 of 12 (25%) patients in group B (p less than 0.0001) and 4 of 34 (12%) stable angina patients (p less than 0.0001). The majority of zones demonstrating transient defects in group A were associated with hypokinesis of the corresponding left ventriculogram segment without associated ECG evidence of previous infarction. There were no significant differences in the frequency of persistent thallium defects, severity of angiographic coronary artery disease, or frequency of regional wall motion abnormalities of myocardial segments supplied by stenotic coronary arteries among the three groups of patients. Transient defects have been shown to reflect reduction in regional coronary blood flow to viable myocardium. Therefore, we conclude that regional resting hypoperfusion of viable myocardium is far more common in patients with exertional unstable angina symptoms than in patients with rest angina alone or chronic stable angina.

  12. The sigma-1 receptor-zinc finger protein 179 pathway protects against hydrogen peroxide-induced cell injury. (United States)

    Su, Tzu-Chieh; Lin, Shu-Hui; Lee, Pin-Tse; Yeh, Shiu-Hwa; Hsieh, Tsung-Hsun; Chou, Szu-Yi; Su, Tsung-Ping; Hung, Jan-Jong; Chang, Wen-Chang; Lee, Yi-Chao; Chuang, Jian-Ying


    The accumulation of reactive oxygen species (ROS) have implicated the pathogenesis of several human diseases including neurodegenerative disorders, stroke, and traumatic brain injury, hence protecting neurons against ROS is very important. In this study, we focused on sigma-1 receptor (Sig-1R), a chaperone at endoplasmic reticulum, and investigated its protective functions. Using hydrogen peroxide (H2O2)-induced ROS accumulation model, we verified that apoptosis-signaling pathways were elicited by H2O2 treatment. However, the Sig-1R agonists, dehydroepiandrosterone (DHEA) and DHEA sulfate (DHEAS), reduced the activation of apoptotic pathways significantly. By performing protein-protein interaction assays and shRNA knockdown of Sig-1R, we identified the brain Zinc finger protein 179 (Znf179) as a downstream target of Sig-1R regulation. The neuroprotective effect of Znf179 overexpression was similar to that of DHEAS treatment, and likely mediated by affecting the levels of antioxidant enzymes. We also quantified the levels of peroxiredoxin 3 (Prx3) and superoxide dismutase 2 (SOD2) in the hippocampi of wild-type and Znf179 knockout mice, and found both enzymes to be reduced in the knockout versus the wild-type mice. In summary, these results reveal that Znf179 plays a novel role in neuroprotection, and Sig-1R agonists may be therapeutic candidates to prevent ROS-induced damage in neurodegenerative and neurotraumatic diseases. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Syndrome of diminished vasodilator reserve of the coronary microcirculation (microvascular angina or syndrome X): Diagnosis by combined atrial pacing and thallium 201 imaging--a case report

    Energy Technology Data Exchange (ETDEWEB)

    Magarian, G.J.; Palac, R.; Reinhart, S. (Veterans Administration Medical Center, Portland, OR (USA))


    Patients with angina-like chest pain without evidence of epicardial coronary artery disease or coronary arterial vasospasm are becoming increasingly recognized. These are often related to noncardiac causes including esophageal, musculoskeletal, and hyperventilatory or panic states. However, recently a subgroup of such patients are being recognized as having true myocardial ischemia and chest pain on the basis of diminished coronary microvascular vasodilatory reserve (microvascular ischemia or Syndrome X). The authors describe such a patient who was found to have replication of anginal pain associated with a reversible ischemic defect on thallium 201 imaging during atrial pacing, suggesting ischemia in this myocardial segment. Resolution of angina and ST segment electrocardiographic changes of ischemia occurred with cessation of pacing. We believe this is the first report of a patient with this form of myocardial ischemia diagnosed by this method and should be considered in patients with anginal chest pain after significant coronary artery disease and coronary vasospasm have been excluded.

  14. Determination of perfusion defect area in experimental myocardial infarction. A comparison between 201-thallium and sup 99m Tc methoxy-isobutyl-isonitril (MIBI)

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, K.D.; Rohmann, S.; Bahavar, H.; Grebe, S.F.; Schaper, W.; Schlepper, M. (Kerckhoff-Klinik, Bad Nauheim (Germany))


    To assess the accuracy of two myocardial perfusion markers in quantifying defect size, the left anterior descending coronary artery (LAD) was occluded in 13 porcine hearts. Fourty minutes later 55 MBq {sup 201}TI and 370 MBq {sup 99m}Tc-MIBI were simultaneously injected i.v. in 10 animals. After injection and in vivo double nuclide SPECT acquisition, the risk area was demarcated with fluorescein (FI) dye in 5 animals. The in vitro defect area determined by {sup 201}TI was significant larger (15.8 {+-} 27%) than those of {sup 99m}Tc-MIBI, while FI compared to Tc showed no statistical difference. Thus, in a pig model Tc-MIBI was more accurate with ex vivo imaging. With SPECT thallium imaging defect size was overestimated. In vivo there was a distinct trend with Tc-MIBI studies to underestimate the defect size up to 16%. (orig.).

  15. High thallium content in rocks associated with Au-As-Hg-Tl and coal mineralization and its adverse environmental potential in SW Guizhou, China

    Energy Technology Data Exchange (ETDEWEB)

    Xiao, T.F.; Guha, J.; Boyle, D. [Chinese Academy of Science, Guiyang (China)


    This study is focused on high concentrations of Tl in rocks in SW Guizhou, China, that are related to several widely scattered disseminated gold-mercury-arsenic and coal deposits, and a primary Tl deposit within an Au-As-Hg-Tl metallogenic belt of the Huijiabao anticline. The Tl, Hg and As in the Lanmuchang Hg-Tl deposit area are associated with the abundant occurrence of sulfide minerals such as lorandite, realgar, orpiment and cinnabar. Concentrations of Tl range from 100 to 35 000 ppm in sulfide ores, and 39-490 ppm in host rocks. The enrichment of Au, Tl, Hg, As, and Sb in the Yanshang gold mineralized area reflects the occurrence of Au mineralization and its mineral assemblage of Tl-Hg-As-Sb sulfides. Thallium ranges from 0.22 to 16 ppm in Au ores and host rocks. Thallium in coals is enriched up to 46 ppm within the Au-As-Hg-TI metallogenic belt, and is derived from the regional Au-As-Hg-Tl mineralization. Mercury and As show a similar distribution to Tl with high concentrations in sulfide ores, coals and host rocks. Human populations living near and downstream of Tl deposits and Tl-bearing ore deposits are susceptible to Tl contamination because of its high toxicity and high uptake rate by crops. The dispersion of Tl, Hg and As associated with the primary mineralization of Au-As-Hg-TI can be traced through physical erosion and chemical weathering, producing secondary dispersion into sods, groundwater and surface water and crops. Mining activities compound the natural processes, readily dispersing Tl into the surface environment.

  16. Functional significance of myocardial perfusion defects induced by dipyridamole using thallium-201 single-photon emission computed tomography and two-dimensional echocardiography

    Energy Technology Data Exchange (ETDEWEB)

    Jain, A.; Suarez, J.; Mahmarian, J.J.; Zoghbi, W.A.; Quinones, M.A.; Verani, M.S. (Baylor College of Medicine, Houston, TX (USA))


    The mechanisms responsible for inhomogeneous myocardial blood flow after oral administration of a large dose (300 mg) of dipyridamole were assessed in 27 patients with serial thallium-201 single-photon emission computed tomography (SPECT) and simultaneous 2-dimensional echocardiograms. Myocardial tomographic images were obtained 50 minutes and 3 to 4 hours after administration of dipyridamole. Two-dimensional echocardiograms were recorded at baseline and then every 15 minutes for 60 minutes. Dipyridamole caused only a mild reduction in blood pressure (from 129 +/- 18 to 126 +/- 16 mm Hg) and a mild increase in heart rate (from 69 +/- 15 to 73 +/- 4 beats/min). Sixteen patients had perfusion defects after dipyridamole by SPECT, which underwent partial or total filling-in. Fourteen of these patients (87.5%) had either a new abnormality or further deterioration of a preexisting wall motion abnormality by 2-dimensional echocardiography, and thus were considered to have developed transient ischemia during dipyridamole administration. Ten of 11 patients (91%) with normal perfusion or fixed defects by SPECT had no further deterioration in wall motion after oral dipyridamole, and were thus considered to have no evidence of myocardial ischemia. In conclusion, most patients with transient thallium-201 defects after dipyridamole develop transient worsening of resting wall motion by 2-dimensional echocardiography, suggestive of true myocardial ischemia. Because myocardial oxygen demand, as indicated by the heart rate-blood pressure product, did not change significantly, the mechanism of myocardial ischemia in these patients is likely to be diminished regional blood flow related to a subendocardial steal induced by dipyridamole.


    DEFF Research Database (Denmark)

    Breinbjerg, Anders; Kamperis, Konstantinos; Frøkjær, Jørgen

    ultrasound (2 with bilateral hydronephrosis, 3 with unilateral hydronephrosis). Conclusions: Renal DMSA/MAG3 scans are important tools when assessing differential renal function and renal parenchymal defects following a pyelonephritis.Whether to perform these investigations already after the first......Introduction: Controversy exists regarding follow-up investigations in children diagnosed with their first pyelonephritis. In our centre children with upper urinary tract infections are subjected to a DMSA or MAG3 scan to assess renal parenchymal damage app. 6 months following the UTI. We aimed...... to analyse follow-up data on 179 consecutive Danish children after their first pyelonephritis. Material and methods:We examined the records of children diagnosed with their first upper UTI confirmed by urine culture during the years 2011-2013.We collected data on the clinical course of the pyelonephritis...

  18. Predictive value of clinical history compared with urodynamic study in 1,179 women

    Directory of Open Access Journals (Sweden)

    Jorge Milhem Haddad


    Full Text Available SUMMARY Objective: to determine the positive predictive value of clinical history in comparison with urodynamic study for the diagnosis of urinary incontinence. Methods: retrospective analysis comparing clinical history and urodynamic evaluation of 1,179 women with urinary incontinence. The urodynamic study was considered the gold standard, whereas the clinical history was the new test to be assessed. This was established after analyzing each method as the gold standard through the difference between their positive predictive values. Results: the positive predictive values of clinical history compared with urodynamic study for diagnosis of stress urinary incontinence, overactive bladder and mixed urinary incontinence were, respectively, 37% (95% CI 31-44, 40% (95% CI 33-47 and 16% (95% CI 14-19. Conclusion: we concluded that the positive predictive value of clinical history was low compared with urodynamic study for urinary incontinence diagnosis. The positive predictive value was low even among women with pure stress urinary incontinence.

  19. Presence of the Gpr179(nob5) allele in a C3H-derived transgenic mouse. (United States)

    Balmer, Jasmin; Ji, Rui; Ray, Thomas A; Selber, Fabia; Gassmann, Max; Peachey, Neal S; Gregg, Ronald G; Enzmann, Volker


    To identify the mutation responsible for an abnormal electroretinogram (ERG) in a transgenic mouse line (tg21) overexpressing erythropoietin (Epo). The tg21 line was generated on a mixed (C3H; C57BL/6) background and lacked the b-wave component of the ERG. This no-b-wave (nob) ERG is seen in other mouse models with depolarizing bipolar cell (DBC) dysfunction and in patients with the complete form of congenital stationary night blindness (cCSNB). We determined the basis for the nob ERG phenotype and screened C3H mice for the mutation to evaluate whether this finding is important for the vision research community. ERGs were used to examine retinal function. The retinal structure of the transgenic mice was investigated using histology and immunohistochemistry. Inverse PCR was performed to identify the insertion site of the Epo transgene in the mouse genome. Affected mice were backcrossed to follow the inheritance pattern of the nob ERG phenotype. Quantitative real-time PCR (qRT PCR), Sanger sequencing, and immunohistochemistry were used to identify the mutation causing the defect. Additional C3H sublines were screened for the detected mutation. Retinal histology and blood vessel structure were not disturbed, and no loss of DBCs was observed in the tg21 nob mice. The mutation causing the nob ERG phenotype is inherited independently of the tg21 transgene. The qRT PCR experiments revealed that the nob ERG phenotype reflected a mutation in Gpr179, a gene involved in DBC signal transduction. PCR analysis confirmed the presence of the Gpr179(nob5) insertional mutation in intron 1 of Gpr179. Screening for mutations in other C3H-derived lines revealed that C3H.Pde6b(+) mice carry the Gpr179 (nob5) allele whereas C3H/HeH mice do not. We identified the presence of the Gpr179(nob5) mutation causing DBC dysfunction in a C3H-derived transgenic mouse line. The nob phenotype is not related to the presence of the transgene. The Gpr179(nob5) allele can be added to the list of

  20. k179ar.m77t - MGD77 data file for Geophysical data from field activity K-1-79-AR in Prudhoe Bay, Alaska, Arctic Ocean from 07/23/1979 to 08/20/1979 (United States)

    U.S. Geological Survey, Department of the Interior — Single-beam bathymetry data along with DGPS navigation data was collected as part of field activity K-1-79-AR in Prudhoe Bay, Alaska, Arctic Ocean from 07/23/1979 to...

  1. 31 CFR 363.179 - Does Public Debt make any reservations as to the conversion of an eligible savings bond? (United States)


    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Does Public Debt make any... BUREAU OF THE PUBLIC DEBT REGULATIONS GOVERNING SECURITIES HELD IN TREASURYDIRECT Conversion of a Definitive Savings Bond § 363.179 Does Public Debt make any reservations as to the conversion of an eligible...

  2. 27 CFR 53.179 - Supporting evidence required in case of manufacturers tax involving exportations, uses, sales, or... (United States)


    ... Administrative Provisions of Special Application to Manufacturers Taxes § 53.179 Supporting evidence required in... exportations, uses, sales, or resales on which the claim is based and which give rise to a right of credit or refund under section 6416(b)(2) of the Code and § 53.177, (2) Identifying the article, both as to nature...

  3. 26 CFR 1.179B-1T - Deduction for capital costs incurred in complying with Environmental Protection Agency sulfur... (United States)


    ... lesser of— (A) The total amount of crude oil input (in barrels) to the refinery's domestic processing...). (a) Scope and definitions—(1) Scope. This section provides the rules for determining the amount of...) Definitions. For purposes of section 179B and this section, the following definitions apply: (i) The...

  4. Cost-effectiveness of female human papillomavirus vaccination in 179 countries: a PRIME modelling study. (United States)

    Jit, Mark; Brisson, Marc; Portnoy, Allison; Hutubessy, Raymond


    Introduction of human papillomavirus (HPV) vaccination in settings with the highest burden of HPV is not universal, partly because of the absence of quantitative estimates of country-specific effects on health and economic costs. We aimed to develop and validate a simple generic model of such effects that could be used and understood in a range of settings with little external support. We developed the Papillomavirus Rapid Interface for Modelling and Economics (PRIME) model to assess cost-effectiveness and health effects of vaccination of girls against HPV before sexual debut in terms of burden of cervical cancer and mortality. PRIME models incidence according to proposed vaccine efficacy against HPV 16/18, vaccine coverage, cervical cancer incidence and mortality, and HPV type distribution. It assumes lifelong vaccine protection and no changes to other screening programmes or vaccine uptake. We validated PRIME against existing reports of HPV vaccination cost-effectiveness, projected outcomes for 179 countries (assuming full vaccination of 12-year-old girls), and outcomes for 71 phase 2 GAVI-eligible countries (using vaccine uptake data from the GAVI Alliance). We assessed differences between countries in terms of cost-effectiveness and health effects. In validation, PRIME reproduced cost-effectiveness conclusions for 24 of 26 countries from 17 published studies, and for all 72 countries in a published study of GAVI-eligible countries. Vaccination of a cohort of 58 million 12-year-old girls in 179 countries prevented 690,000 cases of cervical cancer and 420,000 deaths during their lifetime (mostly in low-income or middle-income countries), at a net cost of US$4 billion. HPV vaccination was very cost effective (with every disability-adjusted life-year averted costing less than the gross domestic product per head) in 156 (87%) of 179 countries. Introduction of the vaccine in countries without national HPV vaccination at present would prevent substantially more cases

  5. Stereoselective synthesis of an active metabolite of the potent PI3 kinase inhibitor PKI-179. (United States)

    Chen, Zecheng; Venkatesan, Aranapakam M; Dos Santos, Osvaldo; Delos Santos, Efren; Dehnhardt, Christoph M; Ayral-Kaloustian, Semiramis; Ashcroft, Joseph; McDonald, Leonard A; Mansour, Tarek S


    The synthesis and stereochemical determination of 1-(4-(4-((1R,5R,6R)-6-hydroxy-3-oxa-8-azabicyclo[3.2.1]octan-8-yl)-6-morpholino-1,3,5-triazin-2-yl)phenyl)-3-(pyridin-4-yl)urea (2), an active metabolite of the potent PI3 kinase inhibitor PKI-179 (1), is described. Stereospecific hydroboration of the double bond of 2,5-dihydro-1H-pyrrole 8 gave the 2,3-trans alcohol 9 exclusively. The configuration of the 3-hydroxyl group in 9 was inverted by an oxidation and stereoselective reduction sequence to give the corresponding 2,3-cis isomer 23. Both exo (21) and endo (27) isomers of the metabolite 2 were prepared via a practical synthetic route from 9 and 23, respectively, and the stereochemistry of 2 was determined to be endo. The endo isomer (27) was separated into two enantiomers 28 and 29 by chiral HPLC. Compound 2 was found to be enantiomerically pure and identical to the enantiomer 28. The absolute stereochemistry of the enantiomer 28 was determined by Mosher's method, thus establishing the stereochemistry of the active metabolite 2.

  6. Effects of Potassium-Channel Opener on Thallium-201 Kinetics: In-vitro Study in Rat Myocyte Preparations and In-vivo Mice Biodistribution Study

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jae Tae; Kim, Eun Ji; Ahn, Byeong Cheol; Son, Kang Kyun; Lee, Kyu Bo [Kyungpook National University School of Medicine, Taegu (Korea, Republic of); Ha, Jeoung Hee [Youngnam University Medical School, Taegu (Korea, Republic of); Kim, Chun Ki [Mt. Sinai School of Medicine, New York (United States)


    Potassium channel opener (K-opener) opens ATP-sensitive K{sup +}-channel located at membrane and induces potassium efflux from cytosol, resulting in intracellular hyperpolarization. Newly synthesized K-opener is currently examined for pharmacologic potency by means of rubidium release test from smooth muscle strip preincubated with Rb-86. Since in-vive behavior of thallium is similar to that of rubidium, we hypothesized that K-opener can alter T1-201 kinetics in vivo. This study was prepared to investigate the effects of pinacidil (one of potent K-openers) on the T1-201 uptake and clearance in cultured myocyte, and in-vivo biodistribution in mice. Spontaneous contracting myocytes were prepared to imitate in-vivo condition from 20 hearts of 3-5 days old Sprague-Dawley rat and cultured for 3-5 days before use (5 X 105 cells/ml). Pinacidil was dissolved in 10% DMSO solution at a final concentration of 100nM or 10uM and was co-incubated with T1-201 in HBSS buffer for 20-min to evaluate its effect on cellular T1-uptake, or challenged to cell preparation pre-incubated with T1-201 for washout study. Two, 40 or 100 mg of pinacidil was injected intravenously into ICR mice at 10 min after 5 muCi T1-201 injection, and organ uptake and whole body retention rate were measured at different time points. Co-incubation of pinacidil with T1-201 resulted in a decrease in T1-201 uptake into cultured myocyte by 1.6 to 2.5 times, depending on pinacidil concentration and activity of T1-201 used. Pinacidil enhanced T1-201 washout by 1.6-3.1 times from myocyte preparations pre-incubated with T1-201. Pinacidil treatment appears to be resulted in mild decreases in blood and liver activity in normal mice, in contrast, renal and cardiac uptake were mildly decreased in a dose dependent manner. Whole body retention ratios of T1-201 were lower at 24 hour after injection with 100 mg of pinacidil than control. These results suggest that treatment with K-opener may affect the interpretation of T1

  7. Inhibition of human airway sensitization by a novel monoclonal anti-IgE antibody, 17-9. (United States)

    Rabe, K F; Watson, N; Dent, G; Morton, B E; Wagner, K; Magnussen, H; Heusser, C H


    We investigated the effect of a novel mouse IgG2b nonanaphylactogenic anti-human IgE antibody, 17-9, on allergen and histamine responses in passively sensitized human airways in vitro to determine the specific contribution of IgE to the sensitization process. Bronchial rings were sensitized with serum containing high levels of allergen-specific IgE (Dermatophagoides farinae), or with a hapten-specific chimeric humanized IgE (JW8). There was a concentration-dependent contraction of serum-sensitized bronchial rings to D. farinae (517 +/- 188 mg tension at 10 U/ml, n = 8) that was not observed in nonsensitized controls. This response was practically abolished when tissues were sensitized in the presence of 100 microg/ml anti-IgE antibody 17-9 (54 +/- 20 mg). In tissues sensitized with the anti-NIP IgE, JW8, there was a concentration-dependent contraction to the specific antigen NIP-BSA (560 +/- 154 mg at 0.3 microg/ml, n = 5) that was not observed in nonsensitized control subjects and that was substantially inhibited when 17-9 was present in the sensitization buffer (124 +/- 109 mg). The inhibition with 17-9 was specific, as pretreatment with a non-IgE-specific IgG2b antibody did not affect allergen responses. Potency and maximal contractions to histamine in serum-sensitized tissues were significantly elevated compared with nonsensitized controls; this was not affected by the presence of 17-9 during sensitization (pEC50 = 5.1 +/- 0.2 versus 5.0 +/- 0.3 in tissues sensitized in the absence of 17-9). In tissues sensitized with JW8 there was no significant increase in responsiveness to histamine. We conclude that allergen responses in sensitized human airways are dependent on IgE levels in the sensitizing serum while nonspecific (hyper)responsiveness depends on serum factors other than IgE. Nonanaphylactogenic anti-human IgE antibodies effectively inhibit allergen responses of human airways in vitro but may not affect other factors inducing hyperresponsiveness.

  8. Determination of particle mass deposition according to Bergerhoff; Performance characteristics of the measurement of particle mass deposition and its portions of lead, cadmium, zinc and thallium. Bestimmung des Staubniederschlags nach Bergerhoff; Verfahrenskenngroessen fuer die Messung des Staubniederschlags und seiner Anteile an Blei, Cadmium, Zink und Thallium

    Energy Technology Data Exchange (ETDEWEB)

    Gehrig, R. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Faesi, C. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe); Hofer, P. (Eidgenoessische Materialpruefungs- und Forschungsanstalt, Duebendorf (Switzerland). Abt. fuer Luftfremdstoffe)


    The requirements concerning quality assurance have increased considerably in the field of immission control. Well founded values for detection limits and confidence limits have to be given. Based on the statistical analysis of long term data series of deposition measurements of particle mass (Berghoff method), lead, cadmium, zinc and thallium performance characteristics were established for very differently polluted sites. The resulting detection limits as well as confidence limits are low enough for a reliable control of the respective immission limit values. It is further shown that the use of plastic buckets instead of the glass buckets required by the VDI guideline or the addition of a protecting agent to avoid freezing does not affect the measurements significantly. (orig.)

  9. Pain intensity on the first day after surgery: a prospective cohort study comparing 179 surgical procedures. (United States)

    Gerbershagen, Hans J; Aduckathil, Sanjay; van Wijck, Albert J M; Peelen, Linda M; Kalkman, Cor J; Meissner, Winfried


    Severe pain after surgery remains a major problem, occurring in 20-40% of patients. Despite numerous published studies, the degree of pain following many types of surgery in everyday clinical practice is unknown. To improve postoperative pain therapy and develop procedure-specific, optimized pain-treatment protocols, types of surgery that may result in severe postoperative pain in everyday practice must first be identified. This study considered 115,775 patients from 578 surgical wards in 105 German hospitals. A total of 70,764 patients met the inclusion criteria. On the first postoperative day, patients were asked to rate their worst pain intensity since surgery (numeric rating scale, 0-10). All surgical procedures were assigned to 529 well-defined groups. When a group contained fewer than 20 patients, the data were excluded from analysis. Finally, 50,523 patients from 179 surgical groups were compared. The 40 procedures with the highest pain scores (median numeric rating scale, 6-7) included 22 orthopedic/trauma procedures on the extremities. Patients reported high pain scores after many "minor" surgical procedures, including appendectomy, cholecystectomy, hemorrhoidectomy, and tonsillectomy, which ranked among the 25 procedures with highest pain intensities. A number of "major" abdominal surgeries resulted in comparatively low pain scores, often because of sufficient epidural analgesia. Several common minor- to medium-level surgical procedures, including some with laparoscopic approaches, resulted in unexpectedly high levels of postoperative pain. To reduce the number of patients suffering from severe pain, patients undergoing so-called minor surgery should be monitored more closely, and postsurgical pain treatment needs to comply with existing procedure-specific pain-treatment recommendations.

  10. Preparation, Characterization, and In Vivo Pharmacoscintigraphy Evaluation of an Intestinal Release Delivery System of Prussian Blue for Decorporation of Cesium and Thallium

    Directory of Open Access Journals (Sweden)

    Nidhi Sandal


    Full Text Available Background. Prussian blue (PB, ferric hexacyanoferrate is approved by US-FDA for internal decorporation of Cesium-137 (137Cs and Thallium-201 (201Tl. Aim. Since PB is a costly drug, pH-dependent oral delivery system of PB was developed using calcium alginate matrix system. Methods. Alginate (Alg beads containing PB were optimized by gelation of sodium alginate with calcium ions and effect of varying polymer concentration on encapsulation efficiency and release profile was investigated. Scanning electron microscopy (SEM was carried out to study surface morphology. Adsorption efficacy of Alg-PB beads for 201Tl was evaluated and compared with native PB. In vivo pH-dependent release of the formulation was studied in humans using gamma scintigraphy. Results. Encapsulation efficiencies of Alg-PB beads with 0.5, 1.0, 1.5, and 2.0% polymer solution were 99.9, 91, 92, and 93%, respectively. SEM and particle size analysis revealed differences between formulations in their appearance and size distribution. No drug release was seen in acidic media (pH of 1-2 while complete release was observed at pH of 6.8. Dissolution data was fitted to various mathematical models and beads were found to follow Hixson-Crowell mechanism of release. The pH-dependent release of beads was confirmed in vivo by pharmacoscintigraphy in humans.

  11. Replacement of a photomultiplier tube in a 2-inch thallium-doped sodium iodide gamma spectrometer with silicon photomultipliers and a light guide

    Directory of Open Access Journals (Sweden)

    Chankyu Kim


    Full Text Available The thallium-doped sodium iodide [NaI(Tl] scintillation detector is preferred as a gamma spectrometer in many fields because of its general advantages. A silicon photomultiplier (SiPM has recently been developed and its application area has been expanded as an alternative to photomultiplier tubes (PMTs. It has merits such as a low operating voltage, compact size, cheap production cost, and magnetic resonance compatibility. In this study, an array of SiPMs is used to develop an NaI(Tl gamma spectrometer. To maintain detection efficiency, a commercial NaI(Tl 2′ × 2′ scintillator is used, and a light guide is used for the transport and collection of generated photons from the scintillator to the SiPMs without loss. The test light guides were fabricated with polymethyl methacrylate and reflective materials. The gamma spectrometer systems were set up and included light guides. Through a series of measurements, the characteristics of the light guides and the proposed gamma spectrometer were evaluated. Simulation of the light collection was accomplished using the DETECT 97 code (A. Levin, E. Hoskinson, and C. Moison, University of Michigan, USA to analyze the measurement results. The system, which included SiPMs and the light guide, achieved 14.11% full width at half maximum energy resolution at 662 keV.

  12. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: a comparative dual-isotope study. (United States)

    Zimmermann, R; Rauch, B; Kapp, M; Bubeck, B; Neumann, F J; Seitz, F; Stokstad, P; Mall, G; Tillmanns, H; Kübler, W


    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were administered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for 201Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r = 0.75, p or = 75% (IP-PA: 70.0%, 201Tl: 66.3%, P = NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P = 0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29% +/- 11% vs 44% +/- 11% in normal myocardium, P IPPA is essentially as sensitive as scintigraphy with 201Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability.

  13. Dynamic low dose I-123-iodophenylpentadecanoic acid metabolic cardiac imaging; Comparison to myocardial biopsy and reinjection SPECT thallium in ischemic cardiomyopathy and cardiac transplantation

    Energy Technology Data Exchange (ETDEWEB)

    Murray, G.L.; Magill, H.L. [Baptist Memorial Hospital (United States); Schad, N.C.


    Recognition of stunned and hibernating myocardium is essential in this era of cardiac revascularization. Positron emission tomography (PET) accurately identifies viability but is costly and unavailable to most patients. Dynamic low dose I-123-iodophenylpentadecanoic acid (IPPA) metabolic cardiac imaging is a potentially cost-effective alternative to PET. Using transmural myocardial biopsies obtained during coronary bypass surgery as the viability gold standard, resting IPPA imaging agreed with 39/43 (91%) biopsies, with a sensitivity for viability of 33/36(92%) and a specificity of 6/7 (86%) in patients with severe ischemic cardiomyopathy. Eighty percent of IPPA viable, infarcted segments improved wall motion postoperatively. Furthermore, when compared to reinjection thallium (SPECT-Tl) scans after myocardial infarction, there was IPPA-Tl concordance in 27/35 (77%)(Kappa=0.536, p=0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-Tl, 26/35 (74%) vs. 18/35 (51%)(p=0.047). Finally, when compared to transvenous endomyocardial biopsy for detecting rejection following cardiac transplantation, IPPA sensitivity for {>=}Grade II rejection was 100%, and IPPA screening assessment for the necessity of biopsy could result in a 31% cost-savings. Therefore, IPPA metabolic cardiac imaging is a safe, inexpensive technique with a promising future. (author).

  14. Myocardial scintigraphy with iodine-123 phenylpentadecanoic acid and thallium-201 in patients with coronary artery disease: A comparative dual-isotope study

    Energy Technology Data Exchange (ETDEWEB)

    Zimmermann, R.; Rauch, B.; Kapp, M.; Neumann, F.J.; Seitz, F.; Kuebler, W. (Heidelberg Univ. (Germany). Dept. of Cardiology); Bubeck, B. (Heidelberg Univ. (Germany). Dept. of Nuclear Medicine); Mall, G. (Heidelberg Univ. (Germany). Dept. of Pathology); Tillmanns, H. (Giessen Univ. (Germany). Dept. of Cardiology); Stokstad, P.


    To characterise the clinical usefulness of serial myocardial scintigraphy with iodine-123 phenylpentadecanoic acid (IPPA) in comparison with thallium-201, dual-isotope investigations were performed in 41 patients with angiographically documented coronary artery disease. Both tracers were adminstered simultaneously during symptom-limited ergometry. Planar scintigrams were acquired immediately after stress, and delayed imaging was performed after 1 h for IPPA and 4 h for {sup 201}Tl. Scintigrams were evaluated both qualitatively and quantitatively using a newly developed algorithm for automated image superposition. Initial myocardial uptake of both tracers was closely correlated (r=0.75, p<0.001). Both tracers also revealed a similar sensitivity for the identification of individual coronary artery stenoses {>=}75% (IPPA: 70%, {sup 201}Tl: 66.3%, P=NS) with identical specificity (69.8%). The number of persistent defects, however, was significantly higher with IPPA (P=0.021), suggesting that visual analysis of serial IPPA scintigrams may overestimate the presence of myocardial scar tissue. On the other hand, previous Q wave myocardial infarction was associated with a decreased regional IPPA clearance (29%{+-}11% vs 44%{+-}11% in normal myocardium, P<0.05). The data indicate that serial myocardial scintigraphy with IPPA is essentially as sensitive as scintigraphy with {sup 201}Tl for the detection of stress-induced perfusion abnormalities. Quantitative analysis of myocardial IPPA kinetics, however, is required for the evaluation of tissue viability. (orig.).

  15. Myocardial viability assessment with dynamic low-dose iodine-123-iodophenylpentadecanoic acid metabolic imaging: comparison with myocardial biopsy and reinjection SPECT thallium after myocardial infarction. (United States)

    Murray, G L; Schad, N C; Magill, H L; Vander Zwaag, R


    Aggressive cardiac revascularization requires recognition of stunned and hibernating myocardium, and cost considerations may well govern the technique used. Dynamic low-dose (1 mCi) [123I]iodophenylpentadecanoic acid (IPPA) metabolic imaging is a potential alternative to PET using either 18FDG or 15O-water. Resting IPPA images were obtained from patients with severe ischemic cardiomyopathy, and transmural myocardial biopsies were obtained during coronary bypass surgery to confirm viability. Thirty-nine of 43 (91%) biopsies confirmed the results of the IPPA images with a sensitivity for viability of 33/36 (92%) and a specificity of 6/7 (86%). Postoperatively, wall motion improved in 80% of IPPA-viable, dysfunctional segments. Furthermore, when compared to reinjection thallium (SPECT-TI) scans after myocardial infarction, IPPA-SPECT-TI concordance occurred in 27/35 (77%) (K = 0.536, p = 0.0003). Similar to PET, IPPA demonstrated more viability than SPECT-TI, 26/35 (74%) versus 18/35 (51%) (p = 0.047). Metabolic IPPA cardiac viability imaging is a safe, inexpensive technique that may be a useful alternative to PET.

  16. Identification and Decay Studies of New, Neutron-Rich Isotopes of Bismuth, Lead and Thallium by means of a Pulsed Release Element Selective Method

    CERN Multimedia

    Mills, A; Kugler, E; Van duppen, P L E; Lettry, J


    % IS354 \\\\ \\\\ It is proposed to produce, identify and investigate at ISOLDE new, neutron-rich isotopes of bismuth, lead and thallium at the mass numbers A=215 to A=218. A recently tested operation mode of the PS Booster-ISOLDE complex, taking an advantage of the unique pulsed proton beam structure, will be used together with a ThC target in order to increase the selectivity. The decay properties of new nuclides will be studied by means of $\\beta$-, $\\gamma$- and X- ray spectroscopy methods. The expected information on the $\\beta$-half-lives and excited states will be used for testing and developing the nuclear structure models ``south-east'' of $^{208}$Pb, and will provide input data for the description of the r-process path at very heavy nuclei. The proposed study of the yields and the decay properties of those heavy nuclei produced in the spallation of $^{232}$Th by a 1~GeV proton beam contributes also the data necessary for the simulations of a hybrid accelerator-reactor system.

  17. Thallium contamination in arable soils and vegetables around a steel plant-A newly-found significant source of Tl pollution in South China. (United States)

    Liu, Juan; Luo, Xuwen; Wang, Jin; Xiao, Tangfu; Chen, Diyun; Sheng, Guodong; Yin, Meiling; Lippold, Holger; Wang, Chunlin; Chen, Yongheng


    Thallium (Tl) is a highly toxic rare element. Severe Tl poisoning can cause neurological brain damage or even death. The present study was designed to investigate contents of Tl and other associated heavy metals in arable soils and twelve common vegetables cultivated around a steel plant in South China, a newly-found initiator of Tl pollution. Potential health risks of these metals to exposed population via consumption of vegetables were examined by calculating hazard quotients (HQ). The soils showed a significant contamination with Tl at a mean concentration of 1.34 mg/kg. The Tl levels in most vegetables (such as leaf lettuce, chard and pak choy) surpassed the maximum permissible level (0.5 mg/kg) according to the environmental quality standards for food in Germany. Vegetables like leaf lettuce, chard, pak choy, romaine lettuce and Indian beans all exhibited bioconcentration factors (BCF) and transfer factors (TF) for Tl higher than 1, indicating a hyperaccumulation of Tl in these plants. Although the elevated Tl levels in the vegetables at present will not immediately pose significant non-carcinogenic health risks to residents, it highlights the necessity of a permanent monitoring of Tl contamination in the steel-making areas. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Thallium-201 is comparable to technetium-99m-sestamibi for estimating cardiac function in patients with abnormal myocardial perfusion imaging

    Directory of Open Access Journals (Sweden)

    Ming-Che Wu


    Full Text Available We analyzed the left-ventricular functional data obtained by cardiac-gated single-photon emission computed tomography myocardial perfusion imaging (MPI with thallium-201 (Tl-201 and technetium-99m-sestamibi (MIBI protocols in different groups of patients, and compared the data between Tl-201 and MIBI. Two hundred and seventy-two patients undergoing dipyridamole stress/redistribution Tl-201 MPI and 563 patients undergoing 1-day rest/dipyridamole stress MIBI MPI were included. Higher mean stress ejection fraction (EF, rest EF, and change in EF (ΔEF were noticed in the normal MPI groups by both Tl-201 and MIBI protocols. Higher mean EF was observed in the females with normal MPI results despite their higher mean age. Comparisons between the Tl-201 and MIBI groups suggested a significant difference in all functional parameters, except for the rest end diastolic volume/end systolic volume and ΔEF between groups with negative MPI results. For the positive MPI groups, there was no significant difference in all parameters, except for the change in end diastolic volume and change in end systolic volume after stress between both protocols. The Tl-201 provides comparable left-ventricular functional data to MIBI cardiac-gated single-photon emission computed tomography in patients with positive MPI results, and may therefore be undertaken routinely for incremental functional information that is especially valuable to this patient group.

  19. Usefulness of thallium-201 myocardial scintigraphy during hyperventilation and accelerated exercise test in patients with vasospastic angina and nearly normal coronary artery

    Energy Technology Data Exchange (ETDEWEB)

    Sueda, Shozo; Mineoi, Kazuaki; Kondou, Tadashi [Takanoko Hospital, Matsuyama, Ehime (Japan)] [and others


    The usefulness of thallium-201 ({sup 201}Tl) myocardial scintigraphy was studied in 109 patients with vasospastic angina who had nearly normal coronary arteries (degree of stenosis <50%). Coronary spasm was confirmed by pharmacologic agents in all 109 patients from January 1991 to June 1996. The appearance rate of visual redistribution on {sup 201}Tl myocardial scintigraphy was compared between four groups, 34 patients performing graded bicycle ergometer exercise starting at a work load of 50 W with increments of 25 W every 3 min (Ergo(3) group), 14 patients performing hyperventilation for 5 min (HV(5) group), 31 patients performing bicycle ergometer exercise with increments of 25 W every 1 min after 5 min hyperventilation (HV(5)+Ergo(1) group), and 30 patients at rest (Rest group). The value of the visual redistribution rate on {sup 201}Tl myocardial scintigrams in the HV(5)+Ergo(l) group (65%) was higher than that in the patients of other groups (Ergo(3) 41%, HV(5) 43%, Rest 33%). However, there were no significant differences between the four groups. Stress {sup 201}Tl imaging after hyperventilation and accelerated exercise is useful to disclose ischemic evidence in about two thirds of patients with vasospastic angina and nearly normal coronary arteries, whereas about 40% of patients had visual redistribution on {sup 201}Tl myocardial scintigrams by performing standard procedures. (author)

  20. On-line preconcentration of ultra-trace thallium(I in water samples with titanium dioxide nanoparticles and determination by graphite furnace atomic absorption spectrometry

    Directory of Open Access Journals (Sweden)

    Saeid Asadpour


    Full Text Available A new method has been developed for the determination of Tl(I based on simultaneous sorption and preconcentration with a microcolumn packed with TiO2 nanoparticle with a high specific surface area prepared by Sonochemical synthesis prior to its determination by graphite furnace atomic absorption spectrometry (GFAAS. The optimum experimental parameters for preconcentration of thallium, such as elution condition, pH, and sample volume and flow rate have been investigated. Tl(I can be quantitatively retained by TiO2 nanoparticles at pH 9.0, then eluted completely with 1.0 mol L−1 HCl. The adsorption capacity of TiO2 nanoparticles for Tl(I was found to be 25 mg g−1. Also detection limit, precision (RSD, n = 8 and enrichment factor for Tl(I were 87 ng L−1, 6.4% and 100, respectively. The method has been applied for the determination of trace amounts of Tl(I in some environmental water samples with satisfactory results.

  1. Thallium-201 single photon emission computed tomography (SPECT) in patients with Duchenne's progressive muscular dystrophy. A histopathologic correlation study

    Energy Technology Data Exchange (ETDEWEB)

    Nishimura, Toru; Yanagisawa, Atsuo; Sakata, Konomi; Shimoyama, Katsuya; Yoshino, Hideaki; Ishikawa, Kyozo [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine; Sakata, Hitomi; Ishihara, Tadayuki


    The pathomorphologic mechanism responsible for abnormal perfusion imaging during thallium-201 myocardial single photon emission computed tomography ({sup 201}Tl-SPECT) in patients with Duchenne's progressive muscular dystrophy (DMD) was investigated. Hearts from 7 patients with DMD were evaluated histopathologically at autopsy and the results correlated with findings on initial and delayed resting {sup 201}Tl-SPECT images. The location of segments with perfusion defects correlated with the histopathologically abnormal segments in the hearts. Both the extent and degree of myocardial fibrosis were severe, especially in the posterolateral segment of the left ventricle. Severe transmural fibrosis and severe fatty infiltration were common in segments with perfusion defects. In areas of redistribution, the degree of fibrosis appeared to be greater than in areas of normal perfusion; and intermuscular edema was prominent. Thus, the degree and extent of perfusion defects detected by {sup 201}Tl-SPECT were compatible with the histopathology. The presence of the redistribution phenomenon may indicate ongoing fibrosis. Initial and delayed resting {sup 201}Tl-SPECT images can predict the site and progress of myocardial degeneration in patients with DMD. (author)

  2. Endobronchial ultrasound-guided transbronchial needle aspiration for lung cancer diagnosis and staging in 179 patients

    Directory of Open Access Journals (Sweden)

    Antonio Bugalho


    Full Text Available Background: Linear endobronchial ultrasound-guided transbronchial needle aspiration (eBUStBNA is an important minimally invasive procedure for non-small cell lung cancer (NScLc staging. It is also a valid method for diagnosing extraluminal lesions adjacent to the tracheobronchial tree. Aim: to evaluate our eBUS-tBNA performance regarding diagnostic yield, safety and learning curve for lung cancer diagnosis and staging. Material and methods: All patients undergoing eBUS-tBNA for lung cancer diagnosis or staging were included. they were divided into three different groups: paratracheal and parabronchial masses sent for diagnosis (Group 1; peripheral lung lesions with abnormal mediastinal lymph nodes sent for diagnosis and staging (Group 2; NScLc patients sent for mediastinal staging (Group 3. the learning curve was assessed for yield, accuracy, procedure time, size and number of lesions punctured per patient Results: A total of 179 patients were included and 372 lesions were punctured. the overall yield and accuracy were 88% and 92.7%, respectively. In Group 1, eBUS-tBNA was performed in 48 patients and sensitivity was 86.1% and accuracy was 87.5%. For the 87 patients included in Group 2, yield was 86.7%, accuracy was 93.1% and cancer prevalence was 51.7%. the diagnostic yield and accuracy in Group 3 was 95% and 97.7% respectively. eBUS-tBNA practice led to an increase number of sites punctured per patient in a shorter time, without complications. Conclusion: eBUS-tBNA is an effective method for diagnosing and staging lung cancer patients. the procedure is clearly safe. Handling and performance improves with the number of procedures executed. Resumo: Introdução: A punção aspirativa transbrônquica guiada por ecoendoscopia brônquica linear (eBUS-tBNA é um importante procedimento minimamente invasivo para o estadiamento do cancro do pulmão de não pequenas células (cPNPc. É, também, um método válido para o diagnóstico de les

  3. Iodine-123 phenylpentadecanoic acid and single photon emission computed tomography in identifying left ventricular regional metabolic abnormalities in patients with coronary heart disease: comparison with thallium-201 myocardial tomography. (United States)

    Hansen, C L; Corbett, J R; Pippin, J J; Jansen, D E; Kulkarni, P V; Ugolini, V; Henderson, E; Akers, M; Buja, L M; Parkey, R W


    Iodine-123 phenylpentadecanoic acid (IPPA) is a synthetic long chain fatty acid with myocardial kinetics similar to palmitate. Two hypotheses were tested in this study. The first hypothesis was that IPPA imaging with single photon emission computed tomography (SPECT) is useful in the identification of patients with coronary artery disease. Fourteen normal volunteers (aged 27 +/- 2 years) and 33 patients (aged 54 +/- 11 years) with stable symptomatic coronary artery disease and at least one major coronary artery with luminal diameter narrowing greater than or equal to 70% were studied with symptom-limited maximal exercise testing. The IPPA (6 to 8 mCi) was injected 1 min before the termination of exercise, and tomographic imaging was performed beginning at 9 min and repeated at 40 min after the injection of IPPA. Nine of the normal volunteers and 13 of the patients had a second examination performed at rest on another day. Using the limits of normal as 2 SD from the normal mean values, 27 of the 33 patients with coronary artery disease demonstrated abnormalities in either the initial distribution or the clearance of IPPA, or both. Nineteen of the 33 patients had a maximal variation of activity distribution of greater than or equal to 25% on the 9 min IPPA images. Twenty-two of the 33 patients had a maximal variation in IPPA washout greater than 17% and 17 had a washout rate less than or equal to 2%. There was good agreement between the location of significant coronary artery stenoses and abnormalities in the initial distribution and clearance of IPPA. The second hypothesis tested was that IPPA imaging is as or more sensitive and, therefore, complementary to thallium-201 imaging in the identification of exercise-induced ischemia in patients. Twenty-five of the 33 patients underwent both thallium-201 and IPPA tomographic imaging after symptom-limited maximal exercise testing. The amount of exercise performed by each patient during both studies was similar. Twenty

  4. Luminescent one- and two-dimensional extended structures and a loosely associated dimer based on platinum(II)-thallium(I) backbones. (United States)

    Forniés, Juan; García, Ana; Lalinde, Elena; Moreno, M Teresa


    Neutralization reactions between (NBu4)2[ trans-Pt(C 6F5)2(CN)2] 1 and (NBu4)2[cis-Pt(C6F5)2(CN)2] 2 with TlPF 6 have been carried out, and the resulting structures of [trans,trans,trans-Tl2{Pt(C6F5)2(CN)2}.(CH3COCH3) ] n [4.(CH3COCH3)2] n and {Tl[Tl{cis-Pt(C6F5)2(CN)2}].(H2O)} n [5.(H2O)] n have been determined by X-ray crystallography. Remarkably, the change from trans to cis geometry on the platinum substrate causes a significant decrease in the Pt(II)...Tl(I) metallophilic interaction. Thus, the platinum center in the trans fragment easily connects with two Tl(I) ions forming a distorted pseudo-octahedron PtTl2, which generates a final two-dimensional layered structure by secondary additional intermolecular Tl(I)...N(CN) interactions. However, the [cis-Pt(C6F5)2(CN)2] (2-) fragment interacts strongly with just one Tl center leading to an extended helical [-Pt-Tl-Pt-Tl-] n(n-) chain. In this case, the second thallium center neutralizes the anionic chain mainly through Tl...N(CN) ( intra) and Tl...F(C 6F 5) (intra and inter)actions. The reaction of TlPF 6 with the monoanionic fragment (NBu4)[cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)] 3 yields the discrete associated dimer [Tl{cis-Pt(C6F5)2(CN)(PPh2C[triple bond]CPh)}] 2 [ 6] 2. Dimer [ 6] 2 could be described as two square pyramids with the thallium atoms in the apical positions, connected through Tl...N(cyano) interactions. The final heteropolynuclear Pt-Tl complexes, except 4 at room temperature, show bright emission in the solid state when irradiated with UV-vis radiation, in contrast to the precursors 1 and 3, which are not luminescent. This difference indicates that the emissions in 4- 6 are presumably related to the interaction between the metal centers. The Pt-Tl bonding interactions and, consequently, the emissive properties are lost in solution at room temperature, as shown by the conductivity and NMR measurements. However, variable-concentration luminescence measurements in glassy acetonitrile solutions

  5. Simultaneous dual myocardial imaging with iodine-123-[beta]-methyl iodophenyl-pentadecanoic acid (BMIPP) and thallium-201 in patients with coronary heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Tawarahara, Kei; Kurata, Chinori; Taguchi, Takahisa; Aoshima, Shigeyuki; Okayama, Kenichi; Kobayashi, Akira; Yamazaki, Noboru; Kaneko, Masao (Hamamatsu Univ. School of Medicine, Shizuoka (Japan))


    To assess the clinical value of simultaneous dual myocardial imaging with iodine-123-[beta]-methyl-iodophenyl-pentadecanoic acid ([sup 123]I-BMIPP) and thallium-201 ([sup 201]TL), myocardial imaging was performed at rest and during execise in seven patients with coronary heart disease. When [sup 123]I-BMIPP and [sup 201]Tl images were compared, the initial exercise and resting images agreed 87% and 64%, respectively. In the initial resting images, the regional uptake of [sup 123]I-BMIPP was frequently less than that of [sup 201]Tl. The incidence of exercise-induced reversible defects by [sup 201]Tl in the Tl>BMIPP regions was significantly higher than that in the Tl=BMIPP regions (57% vs 4%, p<0.01) and the incidence of coronary narrowing of more than 90% in the Tl>BMIPP regions was also significantly higher than that in the Tl=BMIPP regions (91% vs 38%, p<0.01). In addition, this disparity (Tl>BMIPP) was found more frequently in regions with abnormal wall motion than in regions with normal wall motion (hypokinetic regions; 68%, severe hypokinetic or akinetic regions; 50%, vs normokinetic regions; 4%, p<0.01). In contrast, the uptake of [sup 123]I-BMIPP correlated closely with that of [sup 201]Tl in normal myocardium and the uptake of both [sup 123]I-BMIPP and [sup 201]Tl was severely reduced in myocardium with severe ischemia during exercise and prior infarction. These results indicate that dual myocardial imaging with [sup 123]I-BMIPP and [sup 201]Tl may provide a unique means of identifying patients with metabolically disturbed myocardium, such as hibernating and stunned myocardium. (author).

  6. Imaging of brain tumors in AIDS patients by means of dual-isotope thallium-201 and technetium-99m sestamibi single-photon emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    De La Pena, R.C.; Ketonen, L.; Villanueva-Meyer, J. [Dept. of Radiology, Univ. of Texas, Galveston (United States)


    Our aim was to evaluate the use of dual-isotope thallium-201 (Tl) and technetium-99m sestamibi (sestamibi) simultaneous acquisition in brain single-photon emission tomography (SPET) for the differentiation between brain lymphoma and benign central nervous system (CNS) lesions in AIDS patients. Thirty-six consecutive patients with enhancing mass lesions on magnetic resonance (MR) imaging were included in the study. SPET of the brain was performed to obtain simultaneous Tl and sestamibi images. Regions-of-interest were drawn around the lesion and on the contralateral side to calculate uptake ratios. The final diagnosis was reached by pathologic findings in 17 patients and clinical and/or MR follow-up in 19 patients. Of the 36 patients, 11 had brain lymphoma, 1 glioblastoma multiforme, 15 toxoplasmosis and 9 other benign CNS lesions. Correlation between SPET and the final diagnosis revealed in 10 true-positive, 23 true-negative, 1 false-positive and 2 false-negative studies. All patients with toxoplasmosis had negative scans. A patient with a purulent infection had positive scans. Tl and sestamibi scans were concordant in every lesion. The same lesions that took up Tl were also visualized with sestamibi. However, sestamibi scans showed higher lesion-to-normal tissue uptake ratios (3.7{+-}1.8) compared with those of Tl (2.3{+-}0.8, P<0.002). Simultaneous acquisition of Tl and sestamibi can help differentiate CNS lymphoma from benign brain lesions in AIDS patients. (orig.) With 2 figs., 2 tabs., 34 refs.

  7. Technetium-99m pyrophosphate/thallium-201 dual-isotope SPECT imaging predicts reperfusion injury in patients with acute myocardial infarction after reperfusion

    Energy Technology Data Exchange (ETDEWEB)

    Akutsu, Yasushi; Kaneko, Kyouichi; Kodama, Yusuke; Li, Hui-Ling; Nishimura, Hideki; Hamazaki, Yuji; Kobayashi, Youichi [Showa University School of Medicine, Division of Cardiology, Department of Medicine, Tokyo (Japan); Suyama, Jumpei; Shinozuka, Akira; Gokan, Takehiko [Showa University School of Medicine, Department of Radiology, Tokyo (Japan)


    Microcirculatory failure after reperfusion is clinically indicated to cause reperfusion injury whereas excessive intracellular calcium ion overload is experimentally proved as a key mechanism of reperfusion injury. We hypothesized that technetium-99m ({sup 99m}Tc) pyrophosphate (Tc-PYP) uptake in injured but viable infarct-related myocardium with preserved myocardial perfusion after reperfusion estimated by thallium-201 ({sup 201}Tl) uptake would be associated with final functional recovery. Dual-isotope Tc-PYP/{sup 201}Tl single-photon emission computed tomography (SPECT) was performed 2 days after successful reperfusion therapy in patients with first acute myocardial infarction, and 50 patients (63 {+-} 13 years old, female 22%) with preserved {sup 201}Tl uptakes of {>=}50% in reperfused myocardium was followed for 1 month. Tc-PYP uptake was assessed as the heart-to-sternum (H/S) ratio. Two-dimensional echocardiography was also performed 2 days and 1 month after reperfusion to evaluate functional recovery. High Tc-PYP uptake, defined as the H/S ratio {>=}0.81, was predictive of chronic phase no functional recovery (73.7% in 14 of 19 patients with high uptake vs 16.1% in five of 31 patients without those, p < 0.0001). After adjustment for potential confounding variables, including electrocardiographic persistent ST segment elevation at 1 h after reperfusion, high Tc-PYP uptake remained independently predictive of no functional recovery with odds ratio of 8.7 (95% confidential interval = 2 to 38.7; p = 0.005). High Tc-PYP uptake in reperfused but viable infarct-related myocardium was a powerful predictor of no functional recovery, which may reflect excessive intracellular calcium ion overload caused by reperfusion injury. Tc-PYP/{sup 201}Tl dual-isotope SPECT imaging can provide prognostic information after reperfusion. (orig.)

  8. BaHg2Tl2. An unusual polar intermetallic phase with strong differentiation between the neighboring elements mercury and thallium. (United States)

    Dai, Jing-Cao; Gupta, Shalabh; Gourdon, Olivier; Kim, Hyun-Jeong; Corbett, John D


    High yields of the novel BaHg(2)Tl(2) are achieved from reactions of the appropriate cast alloys at approximately 400 degrees C. (Isotypic SrHg(2)Tl(2) also exists.) The tetragonal barium structure (P4(2)/mnm, a = 10.606 A, c = 5.159 A) was refined from both single-crystal X-ray and neutron powder diffraction data in order to ensure the atom site assignments although distances and calculated atom site population also support the results. The Hg and Tl network atoms are distinctive in their functions and bonding. Parallel chains of Hg hexagons and of Tl tetrahedra along c are constructed from polyhedra that share opposed like edges, and these are in turn interconnected by Hg-Tl bonds. Overall, the number of Tl-Tl bonds per cell exceeds the Hg-Hg type by 20:12, but these are approximately 1:2 each in bonding according to their average -ICOHP values (related to overlap populations). Barium is bound within a close 15-atom polyhedron, 12 atoms of which are the more electronegative Hg. LMTO-ASA calculations show that scalar relativistic effects are particularly important for Hg 5d-6s mixing in Hg-Hg and Hg-Tl bonding, whereas relatively separate Tl 6s and 6p states are more important in Tl-Tl interactions. The 6p states of Hg and Tl and 5d of Ba define a dominant conduction band around E(F), and the phase is metallic and Pauli-like paramagnetic. The thallium characteristics here are close to those in numerous alkali-metal-Tl cluster systems. Other active metal-mercury phases that have been studied theoretically are all distinctly electron-richer and more reduced, and without appreciable net 5d, 6s contributions to Hg-Hg bonding.

  9. Roles of Asp179 and Glu270 in ADP-Ribosylation of Actin by Clostridium perfringens Iota Toxin.

    Directory of Open Access Journals (Sweden)

    Alexander Belyy

    Full Text Available Clostridium perfringens iota toxin is a binary toxin composed of the enzymatically active component Ia and receptor binding component Ib. Ia is an ADP-ribosyltransferase, which modifies Arg177 of actin. The previously determined crystal structure of the actin-Ia complex suggested involvement of Asp179 of actin in the ADP-ribosylation reaction. To gain more insights into the structural requirements of actin to serve as a substrate for toxin-catalyzed ADP-ribosylation, we engineered Saccharomyces cerevisiae strains, in which wild type actin was replaced by actin variants with substitutions in residues located on the Ia-actin interface. Expression of the actin mutant Arg177Lys resulted in complete resistance towards Ia. Actin mutation of Asp179 did not change Ia-induced ADP-ribosylation and growth inhibition of S. cerevisiae. By contrast, substitution of Glu270 of actin inhibited the toxic action of Ia and the ADP-ribosylation of actin. In vitro transcribed/translated human β-actin confirmed the crucial role of Glu270 in ADP-ribosylation of actin by Ia.

  10. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma. (United States)

    Lin, J D; Kao, P F; Weng, H F; Lu, W T; Huang, M J


    Radioactive iodine (131I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. 201Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative 131I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of 201Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of 131I and 201Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative 201Tl and 131I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. 201Tl imaging was performed before the 131I studies. Of the 62 patients who underwent 201Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the 201Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic 131I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by 201Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative 201Tl scans, 11 had positive findings on 131I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on 131I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative 201Tl and 131I scans, 15 had elevated serum Tg levels. Among these, local recurrence followed by lung metastases was manifested in

  11. MRI and thallium features of pigmented villonodular synovitis and giant cell tumours of tendon sheaths: a retrospective single centre study of imaging and literature review. (United States)

    Lynskey, Samuel J; Pianta, Marcus J


    The purpose of this study was to characterize the MRI and thallium-201 ((201)TI) scintigraphy attributes of pigmented villonodular synovitis (PVNS) and giant cell tumours of tendon sheaths (GCTTS). The epidemiology of these uncommon lesions was also assessed and less commonly encountered pathology reported on including multifocality, necrosis and concurrent malignancy. A retrospective single centre review of MRI and (201)TI scintigraphy findings for 83 surgically proven or biopsy-proven consecutive cases of PVNS was undertaken. Radiological findings including lesion size, (201)TI uptake (as a marker of metabolic activity), location, extent and patient demographics were correlated with biopsy and surgical specimen histology. Typical appearances are described, as well as less common imaging manifestations. The study period encompassed all patients presenting or referred to a tertiary bone and soft-tissue tumour referral centre with PVNS or GCTTS between 1 January 2007 and the 1 December 2013. Lesions occur most commonly around the knee joint in the fourth decade of life, with younger patients showing a tendency to occur in the hip. Features of PVNS and GTTS include bone erosion, ligamentous and cartilage replacement, muscle infiltration and multifocality. MR signal characteristics were variable but post-contrast enhancement was near-universal. 14 of 83 cases showed no uptake of (201)TI and revealed a statistically significant smaller average axial dimension of 19.8 mm than lesions displaying active (201)TI uptake of 36.4 mm, p = 0.016. Four lesions demonstrated central necrosis on gross histology, two of each from both the (201)TI-avid and (201)TI-non-avid groups. MR is the imaging modality of choice when considering the diagnosis of these uncommon tumours. (201)TI scintigraphy as a marker of metabolic activity further adds minimal value although small lesions can appear to lack (201)TI avidity. This article depicts typical imaging findings of PVNS/GCTTS and

  12. Relative value of thallium-201 and iodine-131 scans in the detection of recurrence or distant metastasis of well differentiated thyroid carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Lin Jen-Der; Weng Hsiao-Fen; Lu Wen-Tsoung [Division of Endocrinology and Metabolism, Chang Gung Memorial Hospital (Taiwan, Province of China); Kao Pan-Fu; Huang Miau-Ju [Department of Nuclear Medicine, Chang Gung Memorial Hospital, Taiwan (Taiwan, Province of China)


    Radioactive iodine ({sup 131}I) has been found to be more sensitive and more specific than thallium-201 for the detection of distant metastases and thyroid remnants in the neck in cases of well-differentiated thyroid carcinoma. {sup 201}Tl has been deemed particularly useful in localizing metastases or recurrence in patients with a negative {sup 131}I scan and abnormal levels of serum thyroglobulin (Tg). This study aimed to: (1) determine the value of {sup 201}Tl imaging in localizing metastases or recurrence in patients with well-differentiated thyroid carcinoma, and (2) evaluate the false-positive and false-negative results of {sup 131}I and {sup 201}Tl scintigraphy. Sixty-two thyroid remnant ablated patients who underwent simultaneous postoperative {sup 201}Tl and {sup 131}I scans and and serum Tg determinations were evaluated. Fifty patients had papillary thyroid carcinomas and 12 had follicular thyroid carcinomas. {sup 201}Tl imaging was performed before the {sup 131}I studies. Of the 62 patients who underwent {sup 201}Tl imaging studies, 24 were found to have positive results, with local recurrence or distant metastases. Patients with positive results in the {sup 201}Tl imaging studies tended to be older, were mor often male, had higher Tg levels and had a higher recurrence rate. Of these 24 patients, ten had negative diagnostic or therapeutic {sup 131}I scans. Concurrently, serum Tg levels were less than 5 ng/ml in five of these ten patients. Three patients were deemed false positive by {sup 201}Tl scans; one had a parotid tumour, one a periodontal abscess and one lung metastasis. Among the 38 patients with negative {sup 201}Tl scans, 11 had positive findings on {sup 131}I scans. Three had distant metastases: two with lung metastases and one with bone metastases. Patients with false-positive results on {sup 131}I scans included those with biliary tract stones, ovarian cysts, and breast secretion. Of the 27 patients with negative {sup 201}Tl and {sup 131}I

  13. Effects of adenosine and a selective A2A adenosine receptor agonist on hemodynamic and thallium-201 and technetium-99m-sestaMIBI biodistribution and kinetics. (United States)

    Mekkaoui, Choukri; Jadbabaie, Farid; Dione, Donald P; Meoli, David F; Purushothaman, Kailasnath; Belardinelli, Luiz; Sinusas, Albert J


    The purpose of this study was to compare a selective A(2A) adenosine receptor agonist (regadenoson) with adenosine in clinically relevant canine models with regard to effects on hemodynamics and thallium-201 ((201)Tl) and technetium-99m ((99m)Tc)-sestaMIBI biodistribution and kinetics. The clinical application of vasodilator stress for perfusion imaging requires consideration of the effects of these vasodilating agents on systemic hemodynamics, coronary flow, and radiotracer uptake and clearance kinetics. Sequential imaging and arterial blood sampling was performed on control, anesthetized closed-chest canines (n = 7) to evaluate radiotracer biodistribution and kinetics after either a bolus administration of regadenoson (2.5 microg/kg) or 4.5-min infusion of adenosine (280 microg/kg). The effects of regadenoson on coronary flow and myocardial radiotracer uptake were then evaluated in an open-chest canine model of a critical stenosis (n = 7). Results from ex vivo single-photon emission computed tomography were compared with tissue well-counting. The use of regadenoson compared favorably with adenosine in regard to the duration and magnitude of the hemodynamic effects and the effect on (201)Tl and (99m)Tc-sestaMIBI biodistribution and kinetics. The arterial blood clearance half-time was significantly faster for (99m)Tc-sestaMIBI (regadenoson: 1.4 +/- 0.03 min; adenosine: 1.5 +/- 0.08 min) than for (201)Tl (regadenoson: 2.5 +/- 0.16 min, p adenosine: 2.7 +/- 0.04 min, p regadenoson stress was significantly greater than the relative perfusion defect with (99m)Tc-sestaMIBI (0.69 +/- 0.03%, p regadenoson produced a hyperemic response comparable to a standard infusion of adenosine. The biodistribution and clearance of both (201)Tl and (99m)Tc-sestaMIBI during regadenoson were similar to adenosine vasodilation. Ex vivo perfusion images under the most ideal conditions permitted detection of a critical stenosis, although (201)Tl offered significant advantages over (99m

  14. Comparison of 8-frame and 16-frame thallium-201 gated myocardial perfusion SPECT for determining left ventricular systolic and diastolic parameters. (United States)

    Kurisu, Satoshi; Sumimoto, Yoji; Ikenaga, Hiroki; Watanabe, Noriaki; Ishibashi, Ken; Dohi, Yoshihiro; Fukuda, Yukihiro; Kihara, Yasuki


    The myocardial perfusion single photon emission computed tomography synchronized with the electrocardiogram (gated SPECT) has been widely used for the assessment of left ventricular (LV) systolic and diastolic functions using Quantitative gated SPECT. The aim of this study was to compare the effects of 8-frame and 16-frame thallium-201 (Tl-201) gated SPECT for determining LV systolic and diastolic parameters. The study population included 42 patients with suspected coronary artery disease who underwent gated SPECT by clinical indication. LV systolic and diastolic parameters were assessed on 8-frame and 16-frame gated SPECT. There were good correlations in end-diastolic volume (r = 0.99, p < 0.001), end-systolic volume (ESV) (r = 0.97, p < 0.001) and ejection fraction (EF) (r = 0.95, p < 0.001) between 8-frame and 16-frame gated SPECT. Bland-Altman plot showed a significant negative slope of -0.08 in EDV indicating a larger difference for larger EDV. Eight-frame gated SPECT overestimated ESV by 2.3 ml, and underestimated EF by -4.2% than 16-frame gated SPECT. There were good correlations in peak filling rate (PFR) (r = 0.87, p < 0.001), one third mean filling rate (r = 0.87, p < 0.001) and time to PFR (r = 0.61, p < 0.001) between 8-frame and 16-frame gated SPECT. Eight-frame gated SPECT underestimated PFR by -0.22 than 16-frame gated SPECT. Eight-frame gated SPECT estimated as much MFR/3 and TPFR as 16-frame gated SPECT. According to the data, the study suggested that 8-frame Tl-201 gated SPECT could underestimate systolic and/or diastolic parameter when compared with 16-frame gated SPECT.

  15. Complications and Morbidities of Mini-open Anterior Retroperitoneal Lumbar Interbody Fusion: Oblique Lumbar Interbody Fusion in 179 Patients. (United States)

    Silvestre, Clément; Mac-Thiong, Jean-Marc; Hilmi, Radwan; Roussouly, Pierre


    A retrospective study including 179 patients who underwent oblique lumbar interbody fusion (OLIF) at one institution. To report the complications associated with a minimally invasive technique of a retroperitoneal anterolateral approach to the lumbar spine. Different approaches to the lumbar spine have been proposed, but they are associated with an increased risk of complications and a longer operation. A total of 179 patients with previous posterior instrumented fusion undergoing OLIF were included. The technique is described in terms of: the number of levels fused, operative time and blood loss. Persurgical and postsurgical complications were noted. Patients were age 54.1 ± 10.6 with a BMI of 24.8 ± 4.1 kg/m(2). The procedure was performed in the lumbar spine at L1-L2 in 4, L2-L3 in 54, L3-L4 in 120, L4-L5 in 134, and L5-S1 in 6 patients. It was done at 1 level in 56, 2 levels in 107, and 3 levels in 16 patients. Surgery time and blood loss were, respectively, 32.5 ± 13.2 minutes and 57 ± 131 ml per level fused. There were 19 patients with a single complication and one with two complications, including two patients with postoperative radiculopathy after L3-5 OLIF. There was no abdominal weakness or herniation. Minimally invasive OLIF can be performed easily and safely in the lumbar spine from L2 to L5, and at L1-2 for selected cases. Up to 3 levels can be addressed through a 'sliding window'. It is associated with minimal blood loss and short operations, and with decreased risk of abdominal wall weakness or herniation.

  16. Yield and excitation function measurements of some nuclear reactions on natural thallium induced by protons leading to the production of medical radioisotopes {sup 201}Tl and {sup 203}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Al-Saleh, F.S.; Al-Harbi, A.A. [Girls College of Education, Riyadh (Saudi Arabia). Physics Dept.; Azzam, A. [Nuclear Research Center, Cairo (Egypt). Nuclear Physics Dept.


    Excitation functions for {sup 201}Pb, {sup 202m}Pb, {sup 203}Pb and {sup 204m}Pb radionuclides which are formed via proton induced reactions with natural thallium target have been measured from their respective threshold (E{sub thr}) to 27.5 MeV using activation technique. Natural copper foils were used to monitor the cyclotron beam. The integral yields (MBq/{mu}A h) of the produced radionuclides were calculated from the measured excitation functions. The optimum proton energy range for the production of {sup 203}Pb with low amount of impurities is (16-10 MeV) after 5 h of EOB. The experimental cross-sections for {sup nat}Tl(p,xn) reactions were compared with the cross-sections recommended by the IAEA and with earlier published data when it was possible. (orig.)


    Directory of Open Access Journals (Sweden)

    N. Fahriza Fuadiah


    Full Text Available The aims of the research is to produce the set of oriented realistic mathematical education (RME approach material that is valid and practical for teaching in elementary school student of the fifth grade  and have a good potencial effect. PMRI is one of learning approach which dribbles students in understanding mathematics concept by selfcontruction through prior knowledge which is related to daily activity, finding the concept by themselves so that the learning becomes meaningful. The research is a development research and method used in two stages, that are preliminary study (analysis and model development stage and formative study (evaluation and revision stage. The samples were students of fifth grade at SD Negeri 179 Palembang. In technique collecting the data, the writer used interview with the experts, observation by using prototype. The data was analyzed by using descriptive method. The result of data analyses concludes that the development of geometry and measurement prototype for the fifth grade students is valid based on content, construction, and language. It can be conclude from the documentary data that the use of student’s book has been a practical use. The try out tested on students has given potential effect which is the students like to study using realistic mathematical education approach with student activity level of 6.47 in a very high criteria and the average of final mark of  87,17 in a very good criteria. Key words: development research, RME, the set of teaching and learning

  18. Quality assurance for image-guided radiation therapy utilizing CT-based technologies: A report of the AAPM TG-179

    Energy Technology Data Exchange (ETDEWEB)

    Bissonnette, Jean-Pierre; Balter, Peter A.; Dong Lei; Langen, Katja M.; Lovelock, D. Michael; Miften, Moyed; Moseley, Douglas J.; Pouliot, Jean; Sonke, Jan-Jakob; Yoo, Sua [Task Group 179, Department of Radiation Physics, Princess Margaret Hospital, University of Toronto, Toronto, Ontario, M5G 2M9 (Canada); Department of Radiation Physics, University of Texas M.D. Anderson Cancer Center, Houston, Texas 77030 (United States); Department of Radiation Oncology, M. D. Anderson Cancer Center Orlando, Orlando, Florida 32806 (United States); Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York 10021 (United States); Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado 80045 (United States); Department of Radiation Physics, Princess Margaret Hospital, University of Toronto, Toronto, Ontario, M5G 2M9 (Canada); Department of Radiation Oncology, UCSF Comprehensive Cancer Center, 1600 Divisadero St., Suite H 1031, San Francisco, California 94143-1708 (United States); Department of Radiation Oncology, Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital, Plesmanlaan 121, 1066 CX Amsterdam (Netherlands); Department of Radiation Oncology, Duke University, Durham, North Carolina 27710 (United States)


    Purpose: Commercial CT-based image-guided radiotherapy (IGRT) systems allow widespread management of geometric variations in patient setup and internal organ motion. This document provides consensus recommendations for quality assurance protocols that ensure patient safety and patient treatment fidelity for such systems. Methods: The AAPM TG-179 reviews clinical implementation and quality assurance aspects for commercially available CT-based IGRT, each with their unique capabilities and underlying physics. The systems described are kilovolt and megavolt cone-beam CT, fan-beam MVCT, and CT-on-rails. A summary of the literature describing current clinical usage is also provided. Results: This report proposes a generic quality assurance program for CT-based IGRT systems in an effort to provide a vendor-independent program for clinical users. Published data from long-term, repeated quality control tests form the basis of the proposed test frequencies and tolerances.Conclusion: A program for quality control of CT-based image-guidance systems has been produced, with focus on geometry, image quality, image dose, system operation, and safety. Agreement and clarification with respect to reports from the AAPM TG-101, TG-104, TG-142, and TG-148 has been addressed.

  19. Upper Wenlock δ13C chemostratigraphy, conodont biostratigraphy and palaeoecological dynamics in the Ledai-179 drill core (Eastern Lithuania

    Directory of Open Access Journals (Sweden)

    Sigitas Radzevičius


    Full Text Available Based on the integrated chemostratigraphic and lithostratigraphic studies, as well as biostratigraphic and palaeo­ecological analyses of conodonts in the Ledai-179 core, we present a combined model of change in the upper Wenlock and lowermost Ludlow strata of the inner shelf settings in the eastern part of the Baltic Basin. The comparison of the δ13C trend, and conodont and lithological successions confirms previous suggestions that the Birštonas and Nevėžis formations correspond to the Homerian. This is quite unexpected, however, that the chronostratigraphic position of the Širvinta Formation changed from the Gorstian to the upper part of the Homerian. The numerical biostratigraphic changepoint analyses of local conodont richness, per capita immigration and also per capita extirpation rates revealed several episodes of permanent change. These episodes of dynamic states either preceded or postdated the Mulde extinction interval at the beginning of the late Homerian δ13C excursion, which points to possible transient effects of this extinction event on conodonts.

  20. A structural insight into the inhibitory mechanism of an orally active PI3K/mTOR dual inhibitor, PKI-179 using computational approaches. (United States)

    Rehan, Mohd


    The PI3K/AKT/mTOR signaling pathway has been identified as an important target for cancer therapy. Attempts are increasingly made to design the inhibitors against the key proteins of this pathway for anti-cancer therapy. The PI3K/mTOR dual inhibitors have proved more effective than the inhibitors against only single protein targets. Recently discovered PKI-179, an orally effective compound, is one such dual inhibitor targeting both PI3K and mTOR. This anti-cancer compound is efficacious both in vitro and in vivo. However, the binding mechanisms and the molecular interactions of PKI-179 with PI3K and mTOR are not yet available. The current study investigated the exact binding mode and the molecular interactions of PKI-179 with PI3Kγ and mTOR using molecular docking and (un)binding simulation analyses. The study identified PKI-179 interacting residues of both the proteins and their importance in binding was ranked by the loss in accessible surface area, number of molecular interactions of the residue, and consistent appearance of the residue in (un)binding simulation analysis. The key residues involved in binding of PKI-179 were Ala-805 in PI3Kγ and Ile-2163 in mTOR as they have lost maximum accessible surface area due to binding. In addition, the residues which played a role in binding of the drug but were away from the catalytic site were also identified using (un)binding simulation analyses. Finally, comparison of the interacting residues in the respective catalytic sites was done for the difference in the binding of the drug to the two proteins. Thus, the pairs of the residues falling at the similar location with respect to the docked drug were identified. The striking similarity in the interacting residues of the catalytic site explains the concomitant inhibition of both proteins by a number of inhibitors. In conclusion, the docking and (un)binding simulation analyses of dual inhibitor PKI-179 with PI3K and mTOR will provide a suitable multi-target model for


    African Journals Online (AJOL)


    obtenus des CD4 + cellules T et CD8 + cellules T. Lymphocytes T CD4 + et CD8 + ont diminué de manière significative tandis que le rapport CD4/CD8 a augmenté de manière significative chez les sujets atteints de cancer de la prostate par rapport aux sujets témoins. Les cellules T CD4 + et CD8+ supprimés comptent chez ...


    African Journals Online (AJOL)


    determine the T lymphocyte subsets (CD4 + T cells, CD8 + T cells and CD4/CD8 ratio) in the prostate cancer subjects and control subjects. CD4 + T ..... lymphocytes Infiltrating Breast Cancer: A Promising New. Prognostic Marker? 2012; 1 (3): 364 – 365. 16. Davidsson, S., Ohlson, A.L., Andersson, S.O., Fall, K.,. Meisner, A.

  3. Clinical and radiographical results of 179 thrust plate hip prostheses: 5-14 years follow-up study. (United States)

    Yasunaga, Yuji; Yamasaki, Takuma; Matsuo, Toshihiko; Yoshida, Tomokazu; Oshima, Seigo; Hori, Junji; Yamasaki, Keiichiro; Ochi, Mitsuo


    The thrust plate hip prosthesis (TPP) is a bone-reserving prosthesis for cementless fixation at the metaphysis of the proximal femur. We retrospectively evaluated the results of 162 patients (179 hips) who underwent hip arthroplasty using TPP. Eighty-three patients (87 hips) suffered from osteoarthritis of the hip joint (OA group), 79 patients (92 hips) from osteonecrosis of the femoral head (ON group). The mean age at surgery was 55 years in the OA group and 47.4 years in the ON group. The mean follow-up period was 97 months in the OA group and 104 months in the ON group. For these patients, we evaluated the results clinically and radiographically. The mean Merle d'Aubigne's score improved from 8.2 to 16.9 in the OA group and from 9.1 to 16.6 in the ON group at the final follow-up. Early mechanical loosening of TPP was observed in two hips of OA and one hip of ON. In one patient of ON, bilateral TPPs had to be removed 5 years postoperatively because of infection. Two female patients with ON suffered from a spontaneous femoral fracture below the tip of the lateral plate. Kaplan-Meier survivorship using TPP removed for any reason as the end point was 97.7% in the OA group and 90.3% in the ON group after 13 years. The middle-term results of the TPP were satisfactory if the indication for the TPP and the operative procedure were appropriate. The TPP is a useful and safe prosthesis for relatively young patients with not only osteoarthritis of the hip but also osteonecrosis of the femoral head.

  4. Low-temperature affected LC-PUFA conversion and associated gene transcript level in Nannochloropsis oculata CS-179 (United States)

    Ma, Xiaolei; Zhang, Lin; Zhu, Baohua; Pan, Kehou; Li, Si; Yang, Guanpin


    Nannochloropsis oculata CS-179, a marine eukaryotic unicellular microalga, is rich in long-chain polyunsaturated fatty acids (LC-PUFAs). Culture temperature affected cell growth and the composition of LC-PUFAs. At an initial cell density of 1.5 × 106 cell mL-1, the highest growth was observed at 25°C and the cell density reached 3 × 107 cell mL-1 at the beginning of logarithmic phase. The content of LC-PUFAs varied with culture temperature. The highest content of LC-PUFAs (43.96%) and EPA (36.6%) was gained at 20°C. Real-time PCR showed that the abundance of Δ6-desaturase gene transcripts was significantly different among 5 culture temperatures and the highest transcript level (15°C) of Nanoc-D6D took off at cycle 21.45. The gene transcript of C20-elongase gene was higher at lower temperatures (10, 15, and 20°C), and the highest transcript level (20°C) of Nanoc-E took off at cycle 21.18. The highest conversion rate (39.3%) of Δ6-desaturase was also gained at 20°C. But the conversion rate of Nanoc-E was not detected. The higher content of LC-PUFAs was a result of higher gene transcript level and higher enzyme activity. Compared with C20-elongase gene, Δ6-desaturase gene transcript and enzyme activity varied significantly with temperature. It will be useful to study the mechanism of how the content of LC-PUFAs is affected by temperature.

  5. Analysis of mutant quantity and quality in human-hamster hybrid AL and AL-179 cells exposed to 137Cs-gamma or HZE-Fe ions (United States)

    Waldren, C.; Vannais, D.; Drabek, R.; Gustafson, D.; Kraemer, S.; Lenarczyk, M.; Kronenberg, A.; Hei, T.; Ueno, A.; Chatterjee, A. (Principal Investigator)


    We measured the number of mutants and the kinds of mutations induced by 137Cs-gamma and by HZE-Fe (56Fe [600 MeV/amu, LET = 190 KeV/micrometer) in standard AL human hamster hybrid cells and in a new variant hybrid, AL-179. We found that HZE-Fe was more mutagenic than 137Cs-gamma per unit dose (about 1.6 fold), but was slightly less mutagenic per mean lethal dose, DO, at both the S1 and hprt- loci of AL cells. On the other hand, HZE-Fe induced about nine fold more complex S1- mutants than 137Cs-gamma rays, 28% vs 3%. 137Cs-gamma rays induced about twice as many S1- mutants and hprt-mutants in AL-179 as in AL cells, and about nine times more of the former were complex, and potentially unstable kinds of mutations.

  6. Phosphorylated human prolactin (S179D-hPRL) is a potent anti-angiogenic hormone in vitro and in vivo; Prolactina humana pseudofosforilada (S179D-hPRL) e um potente fator anti-angiogenico in vitro e in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Ueda, Eric Kinnosuke Martins


    S179D-prolactin (hPRL) is an experimentally useful mimic of naturally phosphorylated human prolactin. S179D-hPRL, but not unmodified PRL, was found to be anti-angiogenic in both the chorioallantoic membrane and corneal assays. Further investigation using human endothelial in vitro models showed reduced cell number, reduced tubule formation in Matrigel, and reduced migration and invasion, as a function of treatment with S179D-hPRL. Analysis of growth factors in human endothelial cells in response to S179D-hPRL showed a decreased expression or release of endogenous PRL, heme-oxygenase-1, basic fibroblast growth factor (bFGF), angio genin, epidermal growth factor and vascular endothelial growth factor and an increased expression of inhibitors of matrix metallo proteases. S179D-hPRL also blocked signaling from bFGF in these cells. We conclude that this molecular mimic of a pituitary hormone is a potent anti-angiogenic protein, partly as a result of its ability to reduce utilization of several well-established endothelial autocrine growth loops, partly by its ability to block signaling from bFGF and partly because of its ability to decrease endothelial migration. We also examined the influence of S179D-hPRL on apoptosis in human endothelial cells, using procaspase-8 as a marker of the extrinsic pathway, and cytochrome C release as a marker of the intrinsic pathway. Both pathways converge at caspase-3, which cleaves DNA fragmentation factor (DFF45). A 3-day incubation with 50 ng/ml S179D-hPRL quadrupled the early apoptotic cells; this effect was doubled at 100 ng/ml and maximal at 500 ng/ml. DFF45 and pro-caspase 8 cleavage were detectable at 100 ng/ml. Cytochrome C, however, was unaffected until 500 ng/ml. p21 increased at 100 ng/ml, whereas a change in p53 activity required both triple the time and 500 ng/ml. p21 promoter activity was maximal at 50 ng/ml, whereas 500 ng/ml were required to see a significant change in the Bax promoter (a measure of p53 activity). As

  7. Key Residues and Phosphate Release Routes in the Saccharomyces cerevisiae Pho84 Transceptor: THE ROLE OF TYR179 IN FUNCTIONAL REGULATION. (United States)

    Samyn, Dieter R; Van der Veken, Jeroen; Van Zeebroeck, Griet; Persson, Bengt L; Karlsson, Björn C G


    Pho84, a major facilitator superfamily (MFS) protein, is the main high-affinity Pi transceptor in Saccharomyces cerevisiae Although transport mechanisms have been suggested for other MFS members, the key residues and molecular events driving transport by Pi:H+ symporters are unclear. The current Pho84 transport model is based on the inward-facing occluded crystal structure of the Pho84 homologue PiPT in the fungus Piriformospora indica However, this model is limited by the lack of experimental data on the regulatory residues for each stage of the transport cycle. In this study, an open, inward-facing conformation of Pho84 was used to study the release of Pi A comparison of this conformation with the model for Pi release in PiPT revealed that Tyr179 in Pho84 (Tyr150 in PiPT) is not part of the Pi binding site. This difference may be due to a lack of detailed information on the Pi release step in PiPT. Molecular dynamics simulations of Pho84 in which a residue adjacent to Tyr179, Asp178, is protonated revealed a conformational change in Pho84 from an open, inward-facing state to an occluded state. Tyr179 then became part of the binding site as was observed in the PiPT crystal structure. The importance of Tyr179 in regulating Pi release was supported by site-directed mutagenesis and transport assays. Using trehalase activity measurements, we demonstrated that the release of Pi is a critical step for transceptor signaling. Our results add to previous studies on PiPT, creating a more complete picture of the proton-coupled Pi transport cycle of a transceptor. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Comparison of 14 MeV isomer production of Hf-178m1 and Hf-179m2 using Feshbach-Kerman-Koonin and exciton preequilibrium models (United States)

    Chadwick, M. B.; Young, P. G.

    The Hf-178m2(16+) isomeric state has a 31-yr half life and could pose serious radioactive problems in nuclear fusion reactors if its production in 14 MeV neutron-induced reactions is significant. We present statistical/pre-equilibrium model calculations for the production of this isomer in the Hf-179(n, 2n) Hf-178m2 reaction, as well as the 25-days 12.5(-) isomer in the Hf-179(n,n')Hf-179m2 reaction, using two different preequilibrium models: the exciton model and the Feshbach-Kerman-Koonin (FKK) theory. Our calculations which use the exciton model agree well with measurements, but those with the FKK theory underestimate measurements. Our calculations are the first to probe angular momentum transfer effects in the FKK theory and suggest that, as it is presently applied, high spin-transfer reactions are underestimated. We suggest modifications to the FKK statistical averaging procedure which may result in an improved agreement with experiment.

  9. Significance of exercise-induced ST segment depression in patients with myocardial infarction involving the left circumflex artery. Evaluation by exercise thallium-201 myocardial single photon emission computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Koitabashi, Norimichi; Toyama, Takuji; Hoshizaki, Hiroshi [Gunma Prefectural Cardiovascular Center, Maebashi (Japan)] [and others


    The significance of exercise-induced ST segment depression in patients with left circumflex artery involvement was investigated by comparing exercise electrocardiography with exercise thallium-201 single photon emission computed tomography (Tl-SPECT) and the wall motion estimated by left ventriculography. Tl-SPECT and exercise electrocardiography were simultaneously performed in 51 patients with left circumflex artery involvement (angina pectoris 30, myocardial infarction 21). In patients with myocardial infarction, exercise-induced ST depression was frequently found in the V{sub 2}, V{sub 3} and V{sub 4} leads. In patients with angina pectoris, ST depression was frequently found in the II, III, aV{sub F}, V{sub 5} and V{sub 6} leads. There was no obvious difference in the leads of ST depression in patients with myocardial infarction with ischemia and without ischemia on Tl-SPECT images. In patients with myocardial infarction, the lateral wall motion of the infarcted area evaluated by left ventriculography was more significantly impaired in the patients with ST depression than without ST depression (p<0.01). Exercise-induced ST depression in the precordial leads possibly reflects wall motion abnormality rather than ischemia in the lateral infarcted myocardium. (author)

  10. PKI-179: an orally efficacious dual phosphatidylinositol-3-kinase (PI3K)/mammalian target of rapamycin (mTOR) inhibitor. (United States)

    Venkatesan, Aranapakam M; Chen, Zecheng; dos Santos, Osvaldo; Dehnhardt, Christoph; Santos, Efren Delos; Ayral-Kaloustian, Semiramis; Mallon, Robert; Hollander, Irwin; Feldberg, Larry; Lucas, Judy; Yu, Ker; Chaudhary, Inder; Mansour, Tarek S


    A series of mono-morpholino 1,3,5-triazine derivatives (8a-8q) bearing a 3-oxa-8-azabicyclo[3.2.1]octane were prepared and evaluated for PI3-kinase/mTOR activity. Replacement of one of the bis-morpholines in lead compound 1 (PKI-587) with 3-oxa-8-azabicyclo[3.2.1]octane and reduction of the molecular weight yielded 8m (PKI-179), an orally efficacious dual PI3-kinase/mTOR inhibitor. The in vitro activity, in vivo efficacy, and PK properties of 8m are discussed. Copyright © 2010. Published by Elsevier Ltd.

  11. Paleoceanographic changes of surface and deep water based on oxygen and carbon isotope records during the last 130 kyr identified in MD179 cores, off Joetsu, Japan Sea (United States)

    Ishihama, Saeko; Oi, Takeshi; Hasegawa, Shiro; Matsumoto, Ryo


    We reconstructed the paleoenvironmental history of surface and deep water over the last 130 kyr from oxygen and carbon isotope ratios of planktonic and benthic foraminifera in two cores (MD179-3312 and MD179-3304) from the Joetsu Basin, eastern margin of the Japan Sea. Our data showed that paleoceanographic changes such as influx of surface currents and vertical circulation were associated with global glacial-interglacial sea level change. Surface water conditions were influenced by the influx of Tsushima Current, East China Sea coastal or off-shore waters through the Tsushima Strait during interglacial or interstadial stages, and strongly affected by freshwater input during the glacial maximum. During interglacial maximums such as Marine Isotope Stages 1 and 5e, development of well-oxygenated bottom water was indicated. A density-stratified ocean with weak ventilation was inferred from the isotopic records of benthic foraminifera during the Last Glacial Maximum. Local negative excursions in carbon isotopes during deglacial or interglacial periods may suggest the dissolution of gas hydrates or methane seep activities.

  12. Diagnostic value of thallium-201 myocardial perfusion IQ-SPECT without and with computed tomography-based attenuation correction to predict clinically significant and insignificant fractional flow reserve: A single-center prospective study. (United States)

    Tanaka, Haruki; Takahashi, Teruyuki; Ohashi, Norihiko; Tanaka, Koichi; Okada, Takenori; Kihara, Yasuki


    The aim of this study was to clarify the predictive value of fractional flow reserve (FFR) determined by myocardial perfusion imaging (MPI) using thallium (Tl)-201 IQ-SPECT without and with computed tomography-based attenuation correction (CT-AC) for patients with stable coronary artery disease (CAD).We assessed 212 angiographically identified diseased vessels using adenosine-stress Tl-201 MPI-IQ-SPECT/CT in 84 consecutive, prospectively identified patients with stable CAD. We compared the FFR in 136 of the 212 diseased vessels using visual semiquantitative interpretations of corresponding territories on MPI-IQ-SPECT images without and with CT-AC.FFR inversely correlated most accurately with regional summed difference scores (rSDS) in images without and with CT-AC (r = -0.584 and r = -0.568, respectively, both P < .001). Receiver-operating characteristics analyses using rSDS revealed an optimal FFR cut-off of <0.80 without and with CT-AC. Although the diagnostic accuracy of FFR <0.80 did not significantly differ, FFR ≥0.82 was significantly more accurate with, than without CT-AC. Regions with rSDS ≥2 without or with CT-AC predicted FFR <0.80, and those with rSDS ≤1 without and with CT-AC predicted FFR ≥0.81, with 73% and 83% sensitivity, 84% and 67% specificity, and 79% and 75% accuracy, respectively.Although limited by the sample size and the single-center design, these findings showed that the IQ-SPECT system can predict FFR at an optimal cut-off of <0.80, and we propose a novel application of CT-AC to MPI-IQ-SPECT for predicting clinically significant and insignificant FFR even in nonobese patients. Copyright © 2017 The Authors. Published by Wolters Kluwer Health, Inc. All rights reserved.

  13. Dual myocardial single photon emission computed tomography (SPECT) using thallium-201 and I-123-{beta}-methyl-i-pentadecanoic acid in patients with Duchenne's progressive muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Shimoyama, Katsuya [Kyorin Univ., Mitaka, Tokyo (Japan). School of Medicine


    Dual single photon emission computed tomography (SPECT) was performed in 31 patients with Duchenne's progressive muscular dystrophy (DMD) using {sup 123}I-{beta}-methyl pentadecanoic acid (BMIPP) for myocardial fatty acid metabolism and {sup 201}thallium (Tl)-chloride for myocardial perfusion. The left ventricle was divided into 9 segments, and accumulation of the radiotracers was assessed visually for each segment to calculate defect score for each tracer. There was some degree of decrease in myocardial accumulation of both tracers in all DMD patients. Reduced accumulation was most common at the apex (BMIPP: 67%, Tl: 63%), followed by the posterior wall, lateral wall, and anterior wall. On the other hand, reduced accumulation was less common at the septum. BMIPP showed a higher accumulation than Tl in all segments but the septum. When BMIPP defect score was larger than Tl defect score, BMIPP defect score tended to increase during 4 years follow-up (p<0.042). However, when Tl defect score was larger than BMIPP defect score, an increase in Tl defect score was slight. A significant negative correlation was found between the sum of the BMIPP and Tl defect scores and the left ventricular ejection fraction (LVEF) (r=0.66, p<0.0001). According to the histo-pathological study of two autopsied hearts, severe myocardial fibrosis was seen in segments with fixed perfusion defect. In addition, the mismatched segments of BMIPP defect score > Tl defect score revealed a slight fibrosis or normal myocardium. It can be concluded that the dual SPECT myocardial scintigraphy using BMIPP and Tl provides accurate information about disease progression of the heart in patients with DMD by detecting abnormalities of the myocardial metabolism of each substance, thereby enabling the assessment of left ventricular function. (author)

  14. Evaluation of myocardial flow reserve using pharmacological stress thallium-201 single-photon emission computed tomography: is there a difference between total arterial off-pump coronary artery bypass grafting and conventional coronary artery bypass grafting? (United States)

    Lee, Jae Won; Ryu, Sang Wan; Song, Hyun; Kim, Kyung Sun; Yang, Yu Jung; Moon, Dae Hyeuk


    The advantage of total arterial off-pump coronary bypass grafting (OPCAB) over conventional onpump coronary artery bypass grafting with 1 internal thoracic artery and veins (CCAB) in terms of myocardial flow reserve has not been studied. We studied these procedures using thallium- 201 perfusion single-photon emission computed tomography (Tl-201 perfusion SPECT). Between 1997 and 2001, 152 patients were recruited from our database (OPCAB, n = 100; CCAB, n = 52). All patients underwent pharmacological stress Tl-201 perfusion SPECT 3 to 12 months after bypass surgery. Myocardial perfusion was analyzed semiquantitatively with a 5-point scoring system in a 20-segment model (0, normal, to 4, absence of uptake). Summed stress (SSS), rest (SRS), and difference score (SDS) of the entire myocardium as well as average scores (ASS, ARS, ADS) of individual walls (anterior, septal, lateral, and inferior) were compared by Student t test as well as by repeated-measures analysis of variance with Bonferroni correction. The SSS, SRS, and SDS of OPCAB versus those of CCAB were 6.86 +/- 0.72 versus 7.17 +/- 0.92, 3.95 +/- 0.57 versus 3.75 +/- 0.73, and 2.91 +/- 0.47 versus 3.42 +/- 0.74 (P > .05). However, the lateral wall showed lower scores in OPCAB (ASS, 0.18 versus 0.41, P = .015; ARS, 0.12 versus 0.20, P = .168; ADS, 0.06 versus 0.21, P = .031). The septal wall had higher scores in OPCAB (ASS, 0.33 versus 0.12, P = .003; ARS, 0.18 versus 0.07, P = .037; ADS, 0.14 versus 0.04, P = .030). The anterior and inferior walls were not different between the 2 groups. OPCAB led to results similar to those of CCAB. The better results in the lateral wall have been the effect of grafting radial artery rather than vein. The similarity in myocardial reserve in the inferior wall between the 2 groups needs further study. There was no deleterious effect of off-pump as opposed to on-pump CAB.

  15. Klebsiella pneumoniae Carbapenemase-2 (KPC-2, Substitutions at Ambler Position Asp179, and Resistance to Ceftazidime-Avibactam: Unique Antibiotic-Resistant Phenotypes Emerge from β-Lactamase Protein Engineering

    Directory of Open Access Journals (Sweden)

    Melissa D. Barnes


    Full Text Available The emergence of Klebsiella pneumoniae carbapenemases (KPCs, β-lactamases that inactivate “last-line” antibiotics such as imipenem, represents a major challenge to contemporary antibiotic therapies. The combination of ceftazidime (CAZ and avibactam (AVI, a potent β-lactamase inhibitor, represents an attempt to overcome this formidable threat and to restore the efficacy of the antibiotic against Gram-negative bacteria bearing KPCs. CAZ-AVI-resistant clinical strains expressing KPC variants with substitutions in the Ω-loop are emerging. We engineered 19 KPC-2 variants bearing targeted mutations at amino acid residue Ambler position 179 in Escherichia coli and identified a unique antibiotic resistance phenotype. We focus particularly on the CAZ-AVI resistance of the clinically relevant Asp179Asn variant. Although this variant demonstrated less hydrolytic activity, we demonstrated that there was a prolonged period during which an acyl-enzyme intermediate was present. Using mass spectrometry and transient kinetic analysis, we demonstrated that Asp179Asn “traps” β-lactams, preferentially binding β-lactams longer than AVI owing to a decreased rate of deacylation. Molecular dynamics simulations predict that (i the Asp179Asn variant confers more flexibility to the Ω-loop and expands the active site significantly; (ii the catalytic nucleophile, S70, is shifted more than 1.5 Å and rotated more than 90°, altering the hydrogen bond networks; and (iii E166 is displaced by 2 ÅÅ when complexed with ceftazidime. These analyses explain the increased hydrolytic profile of KPC-2 and suggest that the Asp179Asn substitution results in an alternative complex mechanism leading to CAZ-AVI resistance. The future design of novel β-lactams and β-lactamase inhibitors must consider the mechanistic basis of resistance of this and other threatening carbapenemases.

  16. Galangin enhances TGF-β1-mediated growth inhibition by suppressing phosphorylation of threonine 179 residue in Smad3 linker region. (United States)

    Kwak, Mi-Kyung; Yang, Kyung-Min; Park, Jinah; Lee, Siyoung; Park, Yuna; Hong, Eunji; Sun, Eun Jin; An, Haein; Park, Sujin; Pang, Kyoungwha; Lee, Jihee; Kang, Jin Muk; Kim, Pyunggang; Ooshima, Akira; Kim, Seong-Jin


    Smad3 linker phosphorylation is a candidate target for several kinases that play important roles in cancer cell initiation, proliferation and progression. Also, Smad3 is an essential intracellular mediator of TGF-β1-induced transcriptional responses during carcinogenesis. Therefore, it is highly advantageous to identify and develop inhibitors targeting Smad3 linker phosphorylation for the treatment of cancers. Galangin (3,5,7-trihydroxyflavone) has been known to be an active flavonoid showing a cytotoxic effect on several cancer cells. However, the mechanism of action of galangin in various cancers remains unclear, and there has been no report concerning regulation of Smad3 phosphorylation by galangin. In the present study, we show that galangin significantly induced apoptosis and inhibited cell proliferation in the presence of TGF-β1 in both human prostate and pancreatic cancer cell lines. Particularly, galangin effectively inhibits phosphorylation of the Thr-179 site at Smad3 linker region through suppression of CDK4 phosphorylation. Thus, galangin can be a promising candidate as a selective inhibitor to suppress phosphorylation of Smad3 linker region. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. 175 - 179_Bello and Uba,

    African Journals Online (AJOL)


    chromosomal and plasmid-mediated types are and may be ... of Gram positive and Gram negative bacteria. ... AMASE PRODUCTION BY BACTERIA ISOLATED FROM TH. STINAL ..... sexual activity, contraception, pregancy, urinary tract.


    African Journals Online (AJOL)



    Jun 1, 2013 ... permeability, swellability in organic liquids and organic liquid separation potentials. The ... currently employed to deal with some of these wastes, ... a waste. This is because the wood has poor mechanical strength and cannot be used as structural support in most buildings. Although used as fuel(fire wood) ...

  19. Characteristics of photoconductivity in thallium monosulfide single ...

    Indian Academy of Sciences (India)

    Pramana – Journal of Physics. Current Issue : Vol. 90, Issue 1 · Current Issue Volume 90 | Issue 1. January 2018. Home · Volumes & Issues · Special Issues · Forthcoming Articles · Search · Editorial Board · Information for Authors · Subscription ...

  20. DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia. (United States)

    Tan, Jin Ai Mary Anne; Kho, Siew Leng; Ngim, Chin Fang; Chua, Kek Heng; Goh, Ai Sim; Yeoh, Seoh Leng; George, Elizabeth


    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.

  1. Symptom burden and quality of life in end-stage renal disease: a study of 179 patients on dialysis and palliative care. (United States)

    Yong, D S P; Kwok, A O L; Wong, D M L; Suen, M H P; Chen, W T; Tse, D M W


    Palliative care for end-stage renal disease (ESRD) is developing in Hong Kong. This is the first local study to explore the symptom burden and quality of life (QOL) of ESRD patients on chronic dialysis and palliative care. This was a prospective cross-sectional study conducted on ESRD patients in a hospital in Hong Kong from January 2006 to April 2007. Data collected included demographics, socioeconomic status, modified Charlson Comorbidity Index (CCI), prevalence and intensity of 23 ESRD-related symptoms as rated by numerical rating scale (0-10), Brief Pain Inventory and QOL by MOS SF-36. A total of 179 ESRD patients completed the study; 45 patients (25.1%) were in the palliative care group and 134 patients (74.9%) in the dialysis group. The palliative care group were older (73.1 +/- 7.1 vs 58.2 +/- 11.4 years, P diabetics (62.2 vs 35.8%, P < 0.001) and were of poorer socioeconomic status than the dialysis group. The mean number of symptoms was 8.2 +/- 3.9 and 9.3 +/- 4.7 in the palliative care and the dialysis group, respectively (P = NS). Fatigue, cold aversion, pruritus, lower torso weakness and difficulty sleeping were the five most prevalent symptoms in both groups, and were also among the most intense symptoms. QOL was significantly impaired in both groups. Scores of all QOL domains correlated negatively with the number of symptoms (P < 0.001). Our ESRD patients under palliative care and dialysis had overlapping symptom prevalence and intensity, significant symptom burden and impaired QOL.

  2. Comparison of surgical site infection rates in clean and clean-contaminated wounds in dogs and cats after minimally invasive versus open surgery: 179 cases (2007-2008). (United States)

    Mayhew, Philipp D; Freeman, Lynetta; Kwan, Toni; Brown, Dorothy C


    To report and compare the surgical site infection (SSI) rates for clean and clean-contaminated procedures performed by either a minimally invasive surgical or open surgical approach in a large population of dogs and cats. Prospective case series. 179 patients (dogs and cats) undergoing minimally invasive abdominal or thoracic surgery. Case information from all animals that underwent minimally invasive abdominal or thoracic surgery was prospectively collected and compared with an existing database of the same information collected from 379 patients undergoing laparotomy or thoracotomy via an open surgical approach. For both groups, an SSI was defined as any surgical wound in which purulent discharge was observed within 14 days after the procedure. Follow-up for all patients was obtained by direct examination or telephone interviews. Overall SSI rate in the minimally invasive surgery (MIS) group was 1.7% and in the open surgery (OS) group was 5.5%. On univariate analysis, there was a significantly lower SSI rate in the MIS group, compared with the SSI rate for the OS group. On multivariable logistic regression analysis, this difference appeared to be a result of the fact that surgery times were longer (median, 105 vs 75 minutes) and hair was clipped ≥ 4 hours prior to surgery for more animals (23% vs 11 %) in the OS group, compared with the MIS group. MIS may be associated with a lower SSI rate, compared with OS, but confounding factors such as differences in surgery time and preoperative preparation contributed in part to this finding. As such, surgical approach cannot be categorized as an independent risk factor for SSIs in small animals until further studies are performed.

  3. Construct validity and test–retest reliability of the International Fitness Scale (IFIS in Colombian children and adolescents aged 9–17.9 years: the FUPRECOL study

    Directory of Open Access Journals (Sweden)

    Robinson Ramírez-Vélez


    Full Text Available Background There is a lack of instruments and studies written in Spanish evaluating physical fitness, impeding the determination of the current status of this important health indicator in the Latin population, especially in Colombia. The aim of the study was two-fold: to examine the validity of the International Fitness Scale (IFIS with a population-based sample of schoolchildren from Bogota, Colombia and to examine the reliability of the IFIS with children and adolescents from Engativa, Colombia. Methods The sample comprised 1,873 Colombian youths (54.5% girls aged 9–17.9 years. We measured their adiposity markers (waist-to-height ratio, skinfold thickness, percentage of body fat and body mass index, blood pressure, lipids profile, fasting glucose, and physical fitness level (self-reported and measured. A validated cardiometabolic risk index score was also used. An age- and sex-matched subsample of 229 schoolchildren who were not originally included in the sample completed the IFIS twice for reliability purposes. Results Our data suggest that both measured and self-reported overall physical fitness levels were inversely associated with percentage of body fat indicators and the cardiometabolic risk index score. Overall, schoolchildren who self-reported “good” or “very good” fitness had better measured fitness levels than those who reported “very poor/poor” fitness (all p < 0.001. The test-retest reliability of the IFIS items was also good, with an average weighted kappa of 0.811. Discussion Our findings suggest that self-reported fitness, as assessed by the IFIS, is a valid, reliable, and health-related measure. Furthermore, it can be a good alternative for future use in large studies with Latin schoolchildren from Colombia.

  4. Construct validity and test–retest reliability of the International Fitness Scale (IFIS) in Colombian children and adolescents aged 9–17.9 years: the FUPRECOL study (United States)

    Correa-Bautista, Jorge E.; Izquierdo, Mikel


    Background There is a lack of instruments and studies written in Spanish evaluating physical fitness, impeding the determination of the current status of this important health indicator in the Latin population, especially in Colombia. The aim of the study was two-fold: to examine the validity of the International Fitness Scale (IFIS) with a population-based sample of schoolchildren from Bogota, Colombia and to examine the reliability of the IFIS with children and adolescents from Engativa, Colombia. Methods The sample comprised 1,873 Colombian youths (54.5% girls) aged 9–17.9 years. We measured their adiposity markers (waist-to-height ratio, skinfold thickness, percentage of body fat and body mass index), blood pressure, lipids profile, fasting glucose, and physical fitness level (self-reported and measured). A validated cardiometabolic risk index score was also used. An age- and sex-matched subsample of 229 schoolchildren who were not originally included in the sample completed the IFIS twice for reliability purposes. Results Our data suggest that both measured and self-reported overall physical fitness levels were inversely associated with percentage of body fat indicators and the cardiometabolic risk index score. Overall, schoolchildren who self-reported “good” or “very good” fitness had better measured fitness levels than those who reported “very poor/poor” fitness (all p < 0.001). The test-retest reliability of the IFIS items was also good, with an average weighted kappa of 0.811. Discussion Our findings suggest that self-reported fitness, as assessed by the IFIS, is a valid, reliable, and health-related measure. Furthermore, it can be a good alternative for future use in large studies with Latin schoolchildren from Colombia. PMID:28560104

  5. Modification of Cysteine 179 of IκBα Kinase by Nimbolide Leads to Down-regulation of NF-κB-regulated Cell Survival and Proliferative Proteins and Sensitization of Tumor Cells to Chemotherapeutic Agents* (United States)

    Gupta, Subash C.; Prasad, Sahdeo; Reuter, Simone; Kannappan, Ramaswamy; Yadav, Vivek R.; Ravindran, Jayaraj; Hema, Padmanabhan S.; Chaturvedi, Madan M.; Nair, Mangalam; Aggarwal, Bharat B.


    Reverse pharmacology, also called the “bedside to bench” approach, that deals with new uses for a well known molecular entity has been used extensively in cancer drug development to identify novel compounds and delineate their mechanisms of action. Here, we show that nimbolide, a triterpenoid isolated from Azadirachta indica, enhanced the apoptosis induced by inflammatory cytokines and chemotherapeutic agents in tumor cells. This limonoid abrogated the expression of proteins associated with cell survival (Bcl-2, Bcl-xL, IAP-1, and IAP-2), proliferation (cyclin D1), invasion (MMP-9), and angiogenesis (VEGF), all regulated by nuclear factor (NF)-κB. Nimbolide inhibited the activation of NF-κB induced by carcinogens and inflammatory stimuli. Constitutively active NF-κB found in most tumor cells was also inhibited. We found that suppression of NF-κB activation by nimbolide was caused by inhibition of IκB kinase (IKK), which led to suppression of IκBα phosphorylation and degradation, nuclear translocation, DNA binding, and gene transcription. Reducing agent reversed the action of the limonoid, suggesting the involvement of a cysteine residue. Replacement of Cys179 of IKK-β with alanine abolished the effect of nimbolide, suggesting that Cys179 plays a critical role in inhibiting the NF-κB activation. Overall, our results indicate that nimbolide can sensitize tumor cells to chemotherapeutic agents through interaction with IKK, leading to inhibition of NF-κB-regulated proteins. PMID:20829362

  6. Factors associated with grade 3 or 4 treatment-related toxicity in women with advanced or recurrent cervical cancer: an exploratory analysis of NRG Oncology/Gynecologic Oncology Group trials 179 and 204. (United States)

    Chase, Dana M; Kauderer, James; Wenzel, Lari; Ramondetta, Lois; Cella, David; Long, Harry J; Monk, Bradley J


    This study aimed to describe pretreatment patient characteristics and baseline quality-of-life scores as they relate to the development of grade 3 or 4 toxicity in patients receiving chemotherapy for advanced/recurrent cervical cancer. The study sample was drawn from Gynecologic Oncology Group protocols 179 and 204. Grade 3 or 4 toxicities were considered in 4 specified categories as follows: peripheral neuropathy, fatigue, hematological, and gastrointestinal (GI). The data variables explored included age, stage, pretreatment radiation, performance status (PS) at treatment initiation, and baseline Functional Assessment of Cancer Therapy-Cervix (FACT-Cx) score. A logistic regression model was developed with various adverse events as binary (0/1) outcomes. Six hundred seventy-three patient-reported questionnaires were used in the analyses. At baseline, pain was the most severe patient-reported symptom. Baseline line-item patient concerns did demonstrate specific correlations with the development of individual toxicities. In 401 patients who were enrolled on Gynecologic Oncology Group 204 (fatigue not measured on 179), a worse PS predicted the development of grade 3 or 4 fatigue (odds ratio, 2.78; 95% confidence interval, 1.66-4.68). Exposure to previous radiation, treatment regimen, and a worse FACT-Cx score were associated with the reporting of both grade 3 or 4 leukopenia (P < 0.05) and anemia (P < 0.0005). Performance status and treatment regimen (P < 0.05) were associated with the development of grade 3 or 4 thrombocytopenia. Age and treatment regimen (P < 0.05) were associated with the development of grade 3 or 4 neutropenia. The FACT-Cx score (P = 0.0016) predicted grade 3 or 4 GI toxicity. The development of fatigue, hematological, and GI toxicity might be predictable based on factors other than treatment assignment such as age, PS, and patient-reported quality-of-life measurement.

  7. Hydrothermal synthesis and crystal structure analysis of two new cadmium bismuthates, CdBi2O6 and Cd0.37Bi0.63O1.79

    Directory of Open Access Journals (Sweden)

    N. Kumada


    Full Text Available Two new cadmium bismuthates, CdBi2O6 and Cd0.37Bi0.63O1.79, were prepared by hydrothermal reaction using NaBiO3·nH2O as one of the starting compounds. The crystal structures of these compounds were refined by using synchrotron X-ray powder diffraction data. The former bismuthate has a MnSb2O6-type structure with a hexagonal cell (space group: P321; the cell parameters were a = 9.3641(7 and c = 4.9523(3 Å, and the final R-factors were Rwp = 4.59% and Rp = 3.04%. The latter bismuthate has a fluorite-type structure with a cubic cell (space group: Fm3¯m of a = 5.4110(4 Å, and the final R-factors were Rwp = 4.79% and Rp = 3.57%. These new bismuthates exhibit no photocatalytic activity under visible light.

  8. 26 CFR 1.179-4 - Definitions. (United States)


    ... 732(a)(1). (2) Property deemed to have been acquired by a new target corporation as a result of a... the taxpayer. For example, X Corporation purchases a new drill press costing $10,000 in November 1984...

  9. Publications | Page 179 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Woody and non-woody biomass utilisation for fuel and implications on plant nutrients availability in the Mukehantuta watershed in Ethiopia (open access). Scarcity of fuel wood has huge implications for agricultural productivity and food security. Due to the increasing scarcity of traditional fuel wood resources, rural ...

  10. 182 179 Comparative Study on the Proximate

    African Journals Online (AJOL)


    Dec 2, 2008 ... Key words: Annona squamosa, Fruits, Proximate, Minerals, nutrient density. INTRODUCTION. Sugar apple (Annona squamosa) also called. “Gwanda masar” in Hausa belong to the family. Annonacae. The most widely grown of all the species are A. muricata, A. cherimola, A reticulata, A. senegalensis and ...

  11. 27 CFR 24.179 - Sweetening. (United States)


    ... finished wine may not exceed 21 percent by weight. When liquid sugar or invert sugar syrup is used, the resulting volume may not exceed the volume which would result from the maximum use of pure dry sugar only... wine, sugar, juice or concentrated fruit juice of the same kind of fruit may be added after...

  12. Publications | Page 179 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Comparative characterization of MicroRNAs from the liver flukes Fasciola gigantica and F. hepatica (open access). MicroRNAs (miRNAs) are key regulators of gene expression at the post-transcription level. The present study specifically explored and compared the miRNA expression profiles of F. gigantica and F. hepatica ...

  13. 35_173 - 179_BIO 015 Akhilendra

    African Journals Online (AJOL)


    Globalization has their living environment es and facilities, health, dy attempts to find out ru town in Yobe State, tic random sampling for enting 10% of the total academicians, ... Drinking water, electricity, drainage, sewerage, sanitation, landscaping, housing, poverty and unemployment are most significa. Ulcer, Malaria and ...

  14. 32 CFR 179.3 - Definitions. (United States)


    ... munitions that contain a CA fill and any explosive component. Examples are M55 rockets with CA, the M23 VX..., including bulk explosives and chemical warfare agents; chemical munitions, rockets, guided and ballistic... primed, fuzed, armed, or otherwise prepared for action; (2) Have been fired, dropped, launched, projected...

  15. 9 CFR 381.179 - Registration. (United States)


    ... warehouseman storing any such articles in or for commerce, or engages in the business of buying, selling, or.... (a) Except as provided in paragraph (c) of this section, every person that engages in business, in or... business in commerce as a wholesaler of any carcasses, or parts or products of the carcasses, of any...

  16. 32 CFR 179.6 - Procedures. (United States)


    ... from 71 to 81. (iv) EHE Rating D is assigned to MRSs with an EHE module score from 60 to 70. (v) EHE... from 71 to 81. (iv) CHE Rating D is assigned to MRSs with a CHE score from 60 to 70. (v) CHE Rating E... to MRSs with a combination level of high for the CHF and RF and low for MPF (HHL), or high for CHF...

  17. GPCR Interaction: 179 [GRIPDB[Archive

    Lifescience Database Archive (English)

    Full Text Available 1 with itself, CCR9, CCR10, CXCR3, and CXCR4 was confirmed by co-immunoprecipitation experiments, whereas tr...R expression levels. 18823943 BRET, trFRET, coimmunoprecipitation YP_401711.1 ...

  18. 5 CFR 179.203 - Definitions. (United States)


    ...) Other independent establishments that are entities of the Federal Government. Certification means a...: Agency means: (1) An Executive Agency as defined by section 105 of title 5, United States Code; (2) A... the paying agency to offset the salary of an employee. Claim See debt. Creditor agency means an agency...

  19. 14 CFR 17.9 - Protective orders. (United States)


    ... a competitive advantage to one or more firms. (b) The terms of the Office of Dispute Resolution for... application shall establish that the applicant is not involved in competitive decisionmaking for any firm that could gain a competitive advantage from access to the protected information and that the applicant will...

  20. 32 CFR 179.7 - Sequencing. (United States)


    ... and social factors. (3) Economic factors, including economic considerations pertaining to environmental justice issues, economies of scale, evaluation of total life cycle costs, and estimated valuations...

  1. Thallium in the marine environment: first ecotoxicological assessments in the Guadalquivir estuary and its potential adverse effect on the donana european natural reserve after the Aznalcollar mining spill (SW Spain); Talio en el medio marino: primera valoracion ecotoxicologica en el estuario del Guadalquivir y su efecto potencial adverso en la reserva natural de donana despues del vertido minero de Aznalcollar (SW de Espana).

    Energy Technology Data Exchange (ETDEWEB)

    DelValls, T.A [Departamento de Quimica Fisica, Facultad de Ciencias del Mar, Universidad de Cadiz, Puerto Real, Cadiz (Spain); Saenz, V; Arias, A.M; Blasco, J [Instituto de Ciencias Marinas de Andalucia, CSIC, Puerto Real, Cadiz (Spain)


    Thallium (Tl) is an extremely toxic but little-studied element in the marine environment and practically no information has been reported on the levels of Tl in marine organisms. After the Aznalcollar mining Spill (April 1998), high levels of metals were put into the environment. This acud-contaminated medium was responsible for the initial pollution effects measured in the Guadiamar River, which is an affluent of the Guadalquivir River and very close to the biggest natural reserve in Europe (Donana). Four different species were used in the monitoring from April to September 1998 and a sediment field bioassay to check bioacumulation was performed. We present the first ecotoxicological evaluation of the mining spill in the Guadalquivir River, with reference to Tl, a little-known metal. Also, Pb and Cd data were compared to Tl during field sediment testing. Results show low levels of this metal in all of the organisms studied and they do not show any increase in the level of this metal, ranging from 40 to 90 ng g{sup -}1, 80 to 210 ng g{sup -}1, 15 to 98 ng g{sup -}1 and 75 to 125 whole body dry weight for Scrobicularia plana, Liza ramada (muscle), Crassostrea angulata and Uca Tangeri, respectively. These are the first field data of Tl concentration measured using estuarine organisms. Field sediment toxicity test results confirm those obtained during the monitoring: Tl is not bioaccumulated by the organisms (C. angulata) used in the test. The sequence in bioaccumulation of metals was Cd > Pb > Tl. Both studies, bioaccumulation and sediment toxicity, should be maintained during the next few years to really evaluate the potential effect of the mining spill on the ecosystem and society. [Spanish] El talio (Tl) es un elemento extremadamente toxico aunque poco estudiado en el medio marino y la informacion sobre niveles de Tl en organismos marinos con anterioridad al presente trabajo es practicamente nula. Despues del vertido minero de Aznalcollar (abril de 1998) se

  2. faas determination of thallium after preconcentration using nitroso-s ...

    African Journals Online (AJOL)

    EXPERIMENTAL. Apparatus. A Shimadzu AA-670 flame atomic absorption spectrophotometer was used in the following conditions: wavelength: 276.8 nm, lamp ... hydrogen phosphate and 0.1 M sodium dihydrogen phosphate and 0.5 M aqueous ammonia and ... The residue was dried at the room temperature in the folds.

  3. Thallium-201 accumulation in cerebral candidiasis: Unexpected finding on SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Tonami, N.; Matsuda, H.; Ooba, H.; Yokoyama, K.; Hisada, K.; Ikeda, K.; Yamashita, J. (Kanazawa Univ. (Japan))


    The authors present an unexpected finding of Tl-201 uptake in the intracerebral lesions due to candidiasis. SPECT demonstrated the extent of the lesions and a high target-to-background ratio. The regions where abnormal Tl-201 accumulation was seen were nearly consistent with CT scans of those enhanced by a contrast agent. After treatment, most of the abnormal Tl-201 accumulation disappeared.

  4. Thallium Toxicity: The Problem; An Analytical Approach; An Antidotal Study (United States)


    Nixon CE: The 1932 thallotoxi- cosis outbreak in California. JAMA 100:1315-1319, 1933. 21. Aoyama H, Yoshida M, Yamamura Y: Acute poisoning by...lower extremities); ataxia; muscle/joint pain; aptosis; strabismis; facial palsy; mydriasis; psychotic signs (permanent neurological and psychiatric

  5. Sequential thallium-201 myocardial scintigraphy after acute infarction in man

    Energy Technology Data Exchange (ETDEWEB)

    Fletcher, J.W.; Mueller, H.S.; Rao, P.S.


    Three sequential Tl-201 myocardial perfusion studies were performed in 21 patients (18 men, 3 women) with first acute transmural myocardia infarction. The Tl-201 image defect size was determined with a semiquantitative visual scoring method and temporal changes in image defect size were compared to CK-MB infarct size and enzymatic evidence of progressive myocardial necrosis and infarct extension. Progressive decreases in Tl-201 image defect size were observed and the visual score in all 21 patients decreased significantly from 6.5 +- 3.7 (mean +- SD) on day 1 to 4.9 +- 3.5 on day 12. Eleven patients without evidence of infarct extension had significantly lower infarct size, a significant decrease in visual score by the 12th day and had significantly smaller Tl-201 defects at all three study times compared to 10 patients with infarct extension. Seven of 10 (70%) with extension had an initial visual score greater than or equal to 7 compared to only 2/11 (18%) without extension. The temporal behavior of Tl-201 image defects is related to the size of the infarction and presence or absence of extension. Sequential studies comparing early initial and subsequent defect size may assist in evaluating the behavior of ischemic and infarcted myocardium in the postinfarction period.

  6. A comparison of the clinical relevance of thallium- 201 and ...

    African Journals Online (AJOL)


    Sep 1, 1990 ... group of 20 patients, who underwent both 201TI single photon emission computed tomography and 99mTc_MIBI study as well as coronary angiography. The sensitivity for predicting a lesion ranged from 25% to 88% in different areas of the heart and was comparable for the two radiophannaceuticals. The.

  7. Thallium isotope variations in anthropogenically-affected soils (United States)

    Vanek, Ales; Chrastny, Vladislav; Penizek, Vit; Mihaljevic, Martin; Komarek, Michael; Cabala, Jerzy


    Our preliminary data from soils impacted by long-term Tl deposition in the vicinity of a primary/secondary Zn smelter at Olkusz (Poland) indicate apparent variability of ɛ205Tl within soil profiles. The identified ɛ205Tl values presented for the forest soil profile reached -1.7 in the surface/organic horizon, +1.9 in the organo-mineral horizon (Ap), and +1.0 in the mineral horizon (C). This finding suggests both the enrichment of 203Tl isotope in the topsoil, as well as its preferential release during smelting operations, as "lighter" Tl tends to enter the emissions during a high-temperature process. The maximum ɛ205Tl value in the subsurface horizon Ap is in accordance with the concentration peak of oxalate-extractable Mn, indicating the presence of amorphous/poorly-crystalline Mn oxides with a potential to isotopically fractionate Tl toward the "heavier" fraction. The Tl isotope signature in the bottom horizon probably reflects the composition of a local geochemical anomaly of Tl. However, a portion of mobile (anthropogenic) Tl with negative ɛ205Tl moving downwards in the soil profile cannot be neglected. In general, there is no detailed information about the biogeochemical cycling and variations of Tl isotopes in areas affected by significant anthropogenic inputs of the metal (e.g., coal burning and primary metallurgy); the questions of the degree to which the factors such as soil (and sediment) chemistry, mineralogy, local biota, and pollution source control Tl isotope fractionation remain unresolved. Therefore, further research on the topic is needed before any principal conclusions will be made.

  8. Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C]. (United States)

    Kutlar, Ferdane; Ameri, Afshin; Patel, Niren H; Zhuang, Lina; Johnson, Lee E; Cheng, Michael L; Kutlar, Abdullah


    The total number of hemoglobin (Hb) variants so far reported to the HbVar database is 1598 (April 9 2014) and 130 of them are fetal Hb variants. Fetal Hb are categorized as two different subunits, (G)γ- and (A)γ-globin chains, and γ chain variants can be observed in both subunits. There are 72 (G)γ- and 58 (A)γ-globin chain variants. Most of them are clinically silent and detected during newborn screening programs in the USA and outside the USA. In this report, we discuss the molecular characteristics and diagnostic difficulties of two new γ-globin chain variants found in an African American baby with no clinical symptoms. One is a new (G)γ-globin chain variant, Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and the other one is Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

  9. Dicty_cDB: VHE179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Method and nucleic acids for the improved treatment of breast cell proliferative disorders. 46 1.3 1 DD20925...lytica Sheared DNA Entamoeba histolytica genomic, DNA sequence. 34 1.2 3 DD391900 |DD391900.1 Method and nucleic acids for the improv...ed treatment of breast cell proliferative disorders. 46 1.3 1 DD391626 |DD391626.1

  10. 49 CFR 179.500-18 - Inspection and reports. (United States)


    ... inspection of inside surface of tanks before necking-down, to insure that no seams, cracks, laminations, or...; and report minimum thickness of tank wall, maximum inside diameter, and calculated value of D, for... after closing in ends; all material accepted was found free from seams, cracks, laminations, and other...

  11. Sound Recordings and the Library. Occasional Papers Number 179. (United States)

    Almquist, Sharon G.

    The basic concept that sound waves could be traced or recorded on a solid object was developed separately by Leon Scott, Charles Cros, and Thomas Alva Edison between 1857 and 1877 and, by 1890, the foundation of the present-day commercial record industry was established. Although cylinders were the first sound recordings to be sold commercially,…

  12. 49 CFR 179.100-8 - Tank heads. (United States)


    ... hot formed at a temperature exceeding 1700 °F., must be normalized after forming by heating to a temperature between 1550° and 1700 °F., by holding at that temperature for at least 1 hour per inch of... and tempering, the treatment specified in that specification must be used instead of the one specified...

  13. Adventures in Rocket Science. EG-2007-12-179-MSFC (United States)

    Huegele, Vince; Hill, Kristy; Terry, Brenda


    This guide was prepared as a tool useful for informal education venues (4-H, Boys and Girls Clubs, Boy Scouts, Girl Scouts, etc.), science clubs and related programs, and can be adopted for formal education settings. An exciting and productive study in rocket science can be implemented using the selected activities for the above-mentioned…

  14. 49 CFR 179.200-17 - Bottom outlets. (United States)


    ... bottom of the tank or mounted on a pad or nozzle with a tongue and groove or male and female flange... tank or mounted with a tongue and groove or male and female flange attachment on a pad attached to the... and the valve body of exterior valves, must be of cast, fabricated, or forged metal. If welded to tank...

  15. 179--14 Dec 2009 [Final version].indd

    African Journals Online (AJOL)

    14 Des 2009 ... discovered a time-honored concept – the concept of a universe that is made up neither of just vibrating strings, nor of separate particles and atoms, but instead constituted in the embrace of continuous fields and forces that carry information as well as energy.' Dié eeue oue konsep staan volgens Laszlo ...

  16. 49 CFR 179.400-16 - Access to inner tank. (United States)


    ... TANK CARS Specification for Cryogenic Liquid Tank Car Tanks and Seamless Steel Tanks (Classes DOT-113... design. (b) If a welded closure is used, it must be designed to allow it to be reopened by grinding or...

  17. 49 CFR 179.7 - Quality assurance program. (United States)


    ... responsibility for those persons in charge of the quality assurance program. (2) An organizational chart showing... control of processes and product characteristics during production. (7) Procedures for correction of... only personnel qualified for each non-destructive inspection and test perform that particular operation...

  18. 179 The Impact of Photography in a Developing Economy

    African Journals Online (AJOL)

    Nekky Umera

    creative art. In consequence, both professionals and amateurs are encouraged to take to photography not only as a recreative venture but as an employment generation medium for sustainable growth in a developing economy. Keywords: Communication, optical image, daguerreotype, digital, automatic recording, light.

  19. 49 CFR 192.179 - Transmission line valves. (United States)


    ... atmosphere without hazard and, if the transmission line is adjacent to an overhead electric line, so that the gas is directed away from the electrical conductors. (d) Offshore segments of transmission lines must...

  20. 46 CFR 179.212 - Watertight bulkheads for subdivision. (United States)


    ... (UNDER 100 GROSS TONS) SUBDIVISION, DAMAGE STABILITY, AND WATERTIGHT INTEGRITY Subdivision and Damage... passengers; or (2) Is constructed of wood on or after March 11, 2001, and operates in cold water. As an...

  1. All projects related to | Page 179 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Program: Maternal and Child Health. Total Funding: CA$ 256,600.00. Africa Centre for Systematic Reviews and Knowledge Translation. Project. There is increasing global recognition of the need to link research evidence to policy decisions and practice. Topic: HEALTH POLICY, POLICY MAKING, INSTITUTION BUILDING, ...

  2. 179--14 Dec 2009 [Final version].indd

    African Journals Online (AJOL)

    14 Des 2009 ... Steve McIntosh, an integral philosopher, takes Wilber's ideas further, and even criticises him on a few points. ... wat vir hierdie artikel belangrik is, is dié van Jim Marion (2000), Andre Marquis (2008) en Steve McIntosh. (2007). ...... fisikus Stephan Hawking wat blykbaar gesê het dat mistisisme vir diegene is ...

  3. 179-IJBCS-Article-Dr C C Onyenekwe

    African Journals Online (AJOL)


    5 Department of Immunology, College of Health Sciences, Nnamdi Azikiwe University, Nnewi Campus, PMB. 5001 Nnewi, Anambra State, Nigeria. 7 VCT Unit, Nnamdi Azikiwe University ... reduced anti-BCG titre in HIV and malaria co- infected or HIV infected subjects (Onyenekwe et al., 2008b). However, could this.

  4. 29 CFR 1910.179 - Overhead and gantry cranes. (United States)


    ... mechanism provided for lifting the maximum rated load. (49) A man trolley is a trolley having an operator's... shall be taken: (a) The crane to be repaired shall be run to a location where it will cause the least...

  5. 179 Nigerian Pidgin: A Means of Human Development Charles ...

    African Journals Online (AJOL)

    of arbitrary vocal symbol based on social cooperation; the totality of meaningful utterance in a given society (Yule 15). Language is a system of conventional or written symbols by means of which humans as members of a social group and participants in its culture communicates (Encyclopedia Britannica, 2002). Language.

  6. 179 The Impact of Photography in a Developing Economy

    African Journals Online (AJOL)

    Nekky Umera

    Abstract. Photography as an image–making process is not quite appreciated by budding artists and professionals as an art form. This study is thus aimed at advancing photography as a versatile creative medium of expression and a veritable tool for research and skill acquisition for employment generation irrespective of ...

  7. Dicty_cDB: SHH179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 929066.7 Mouse DNA sequence from clone RP23-68E1 on chromosome 2. 32 6.6 4 BW572424 |BW572424.1 Ciona savi...gnyi cDNA, clone:csef009l24, 5'end, single read. 42 7.6 1 AC183074 |AC183074.1 Bos

  8. 75 FR 179 - Petition for Waiver of Compliance (United States)


    ... instance of vandalism in 25 years of its operations. ACJR further states that the expense of retrofitting... Federal holidays. Communications received within 45 days of the date of this notice will be considered by FRA before final action is taken. Comments received after that date will be considered as far as...

  9. People’s Republic of China Scientific Abstracts No. 179 (United States)


    No 2, April 1977 7 CHIH-WU HSUEH-PAO [ACTA BOTANICA SINICA] No 2, June 1977 22 I-CH’UAN HSUEH-PAO [ACTA GENETICA SINICA] No 1...sources with fluorescent dyes and applications in forensic medicine. 10 ATITHOR: WU Min [O702 4t ] ORG: Institute of Oncology...photorespirators. 8650 C50J 4009 29 ACTA GENETICA SINICA AUTHOR: WU An-chiu [0702 1344 0036] ORG: Technique Staff of San-t’ai Commune Fu County

  10. Dicty_cDB: SLB179 [Dicty_cDB

    Lifescience Database Archive (English)


  11. The pubertal transition in 179 healthy Danish children

    DEFF Research Database (Denmark)

    Mouritsen, Annette; Aksglæde, Lise; Sørensen, Kaspar


    Pubertal onset is usually defined by breast development in girls and testicular growth in boys. Pubarche is defined as the attainment of pubic hair and is considered as a sign of pubertal transition. Pubarche is preceded by a gradual increase in production of adrenal androgens, DHEA and Δ4...

  12. 49 CFR 179.5 - Certificate of construction. (United States)


    ... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS REGULATIONS SPECIFICATIONS FOR TANK CARS... to the owner and the Executive Director—Tank Car Safety, AAR, certifying that the tank, equipment... each series when submitted to the Executive Director—Tank Car Safety, AAR. (c) If the owner elects to...

  13. Dicty_cDB: AFF179 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 8e-20 2 BU044708 |BU044708.1 PP_LEa0020E04f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0020E04f...2e-11 2 BU040616 |BU040616.1 PP_LEa0006L02f Peach developing fruit mesocarp Prunus persica cDNA clone PP_LEa0006L02f

  14. Publications | Page 179 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Voilà, si on se fie aux résultats de deux dialogues nationaux tenus au Brésil et au Canada, les principaux enjeux d'actualité aux yeux des jeunes, quel que soit ... dans la gouvernance d'Internet partout dans le monde, le CRDI appuie une nouvelle initiative d'envergure sur les répercussions de la censure d'Internet en Asie.

  15. Glass Walls in North America. Technical Paper No. 179. (United States)

    Hutcheon, N. B.

    Solar heat gains (radiation) and its effects on the building environment are discussed, in conjunction with the proper and improper use of large glass areas in the exterior walls of buildings in North America. The difficulties of solar heat gain and of controlling natural light and glare are outlined and said to influence building comfort and air…

  16. Investigation of thallium fluxes from subaerial volcanism-Implications for the present and past mass balance of thallium in the oceans (United States)

    Baker, R.G.A.; Rehkamper, M.; Hinkley, T.K.; Nielsen, S.G.; Toutain, J.P.


    A suite of 34 volcanic gas condensates and particulates from Kilauea (Hawaii), Mt. Etna and Vulcano (Italy), Mt. Merapi (Indonesia), White Island and Mt. Nguaruhoe (New Zealand) were analysed for both Tl isotope compositions and Tl/Pb ratios. When considered together with published Tl-Pb abundance data, the measurements provide globally representative best estimates of Tl/Pb = 0.46 ?? 0.25 and ??205Tl = -1.7 ?? 2.0 for the emissions of subaerial volcanism to the atmosphere and oceans (??205Tl is the deviation of the 205Tl/203Tl isotope ratio from NIST SRM 997 isotope standard in parts per 10,000). Compared to igneous rocks of the crust and mantle, volcanic gases were found to have (i) Tl/Pb ratios that are typically about an order of magnitude higher, and (ii) significantly more variable Tl isotope compositions but a mean ??205Tl value that is indistinguishable from estimates for the Earth's mantle and continental crust. The first observation can be explained by the more volatile nature of Tl compared to Pb during the production of volcanic gases, whilst the second reflects the contrasting and approximately balanced isotope fractionation effects that are generated by partial evaporation of Tl during magma degassing and partial Tl condensation as a result of the cooling and differentiation of volcanic gases. Mass balance calculations, based on results from this and other recent Tl isotope studies, were carried out to investigate whether temporal changes in the volcanic Tl fluxes could be responsible for the dramatic shift in the ??205Tl value of the oceans at ???55 Ma, which has been inferred from Tl isotope time series data for ferromanganese crusts. The calculations demonstrate that even large changes in the marine Tl input fluxes from volcanism and other sources are unable to significantly alter the Tl isotope composition of the oceans. Based on modelling, it is shown that the large inferred change in the ??205Tl value of seawater is best explained if the oceans of the early Cenozoic featured significantly larger Tl output fluxes to oxic pelagic sediments, whilst the sink fluxes to altered ocean crust remained approximately constant. ?? 2009 Elsevier Ltd.

  17. Two new examples of very short thallium-transition metal contacts

    DEFF Research Database (Denmark)

    Karanovic, Ljiljana; Poleti, Dejan; Balic Zunic, Tonci


    Two new sulphosalts Tl3Ag3Sb2S6, (1) and Tl(3)Ag(3)AS(2)S(6), (2) were prepared in reaction of synthetic binary sulfides: argentite (Ag2S), carlinite (Tl2S) and orpiment (As2O3) or stibnite (Sb2S3), and their crystal structures have been determined using single-crystal data. The compounds are iso....... It is also pointed out that if only valence shell electrons are considered (Tl-Ag)(2+) group is isoelectronic with the (Hg-Hg)(2+) ion, therefore new examples of short Tl-Ag contacts could be expected. (C) 2007 Elsevier B.V. All rights reserved....

  18. Observation of electric quadrupole X-ray transitions in muonic thallium, lead and bismuth

    CERN Document Server

    Schneuwly, H; Engfer, R; Jahnke, U; Kankeleit, E; Lindenberger, K H; Pearce, R M; Petitjean, C; Schellenberg, L; Schröder, W U; Walter, H K; Zehnder, A


    Electric quadrupole X-ray transitions (5g to 3d, 4f to 2p, and 3d to 1s) have been observed in muonic Tl, Pb and Bi. From the 3 to 1 transitions, energy splittings of the n=3 levels were deduced. From a comparison of the relative intensities of E1 and E2 transitions the population ratios 5g/5f, 4f/4d, and 3d/3p were deduced. These ratios are well reproduced by a cascade calculation assuming a statistical initial population at n=20, including K, L and M shell conversion. In the case of /sup 205/Tl discrepancies between the experimental and the calculated 3d-1s/3p-is intensity ratio can be explained by nuclear excitation. From the 3p/sub 3/2/ to 1s/sub 1/2/ intensity in /sup 209 /Bi one can deduce the ratio of the radiationless to the X-ray transition width and give limits for prompt neutron emission from the 3d level. (23 refs).

  19. Coronary blood flow and thallium 201 uptake in rejecting rat heart transplantations

    Energy Technology Data Exchange (ETDEWEB)

    Bergsland, J.; Hwang, K.; Driscoll, R.; Carr, E.A.; Wright, J.R.; Curran-Everett, D.C.; Carroll, M.; Krasney, E.; Krasney, J.A. (Veterans Administration Medical Center, Buffalo, NY (USA))


    The effects of rejection on coronary flow (CAF) in heart allografts are unclear, although previous evidence with cardiac imaging agents indicates impaired flow during advanced rejection. The purpose of this study was to measure CAF in heterotopically placed heart grafts. Lewis rats (LEW) received grafts from either syngeneic Lewis rats (LEW/LEW group) or allogeneic ACI rats (ACI/LEW group). CAF was measured in both the transplanted and native hearts with radiolabeled microspheres. Rejection was measured histologically (grades 0 (absent) to 4+ (severe)). In addition systemic blood pressure and cardiac outputs of the native hearts were determined with microspheres. Different animals were studied during relatively early (4 days) and late (6 days) rejection. Among the 4-day animals a cyclosporine-treated group was included (ACI/LEW CyA). In 6-day rats CAF in allografts was lower (0.56 +/- .06 ml/gm/min) compared with syngeneic grafts (1.72 +/- 0.4 ml/gm/min) (p less than 0.05). The CAF in the native hearts did not differ significantly but was higher than in the grafts in both groups. Heart rates were reduced in allografts (p less than 0.05). It is interesting that arterial pressure and cardiac output were significantly lower in animals bearing allogeneic than syngeneic grafts. In rats studied at 4 days graft CAF was lower than in the native heart in both the LEW/LEW and ACI/LEW groups, but there was no significant difference in behavior between groups. The same was true for a cyclosporine-treated group. Graft heart rates were similar in all 4-day rats.

  20. Comparison of planar and tomographic thallium scintigraphy in patients with coronary artery disease

    Energy Technology Data Exchange (ETDEWEB)

    Stone, D.L.; Weiss, A.T.; Snyder, S.H.; Yaffe, S.; Gotsman, M.S.; Atlan, H.


    Planar and tomographic scans from 57 patients are compared and related to coronary arteriographic results. Tomography identified inferior and septal defects not seen on planar imaging. Planar imaging better identified apical defects. Lesions of the left circumflex were poorly defined by both techniques.

  1. Relationship between thallium-201 myocardial SPECT and findings of endomyocardial biopsy specimens in dilated cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, Motohiro; Gotoh, Kohshi; Nagashima, Kenshi [Gifu Univ. (Japan). School of Medicine] (and others)


    The purpose of this study was to clarify which myocardial histological findings associated with dilated cardiomyopathy (DCM) are reflected in quantitative {sup 201}Tl myocardial SPECT. We obtained studied SPECT images from 21 patients with DCM 10 minutes and 2 hours after they received an injection of 111 MBq {sup 201}Tl at rest. We calculated the percent coefficient of variation of myocardial {sup 201}Tl counts [%CV(Tl)], the washout rate (WR), standard deviation of WR [SD(WR)], extent score (ES) and severity score (SS). We used image analysis to measure % fibrosis, % myocytes, the ratio of fibrous tissue to myocyte tissue (F/My), myocyte size and standard deviation of myocyte size [SD(My)] in left ventricular endomyocardial biopsy specimens. The %CV(Tl) was correlated with % fibrosis and F/My. The ES and SS also correlated with F/My. The correlation between SD(WR) and SD(My) was significant. The present findings suggest that %CV(Tl), ES and SS of rest {sup 201}Tl SPECT reflect myocardial fibrosis and that the standard deviation of washout reflects the distribution of myocyte size. (author)

  2. Thallium dynamics in contrasting light sandy soils--soil vulnerability assessment to anthropogenic contamination. (United States)

    Vanek, Ales; Chrastný, Vladislav; Komárek, Michael; Galusková, Ivana; Drahota, Petr; Grygar, Tomás; Tejnecký, Václav; Drábek, Ondrej


    The influence of different soil conditions and the presence of LMWOA (Low Molecular Weight Organic Acids) on anthropogenic Tl dynamics were discussed in this study. A shift from the "labile" to the residual fraction during the ageing was identified, indicating Tl incorporation into stable phases (e.g., illite and/or amorphous silicates). The increased water-soluble Tl concentration (1.8-fold, in maximum) after the split application of LMWOA (simulating root exudation) was observed in all soils; partial dissolution of relatively "insoluble" Tl-bearing phases (silicates and eventually oxides) in the presence of LMWOA is suggested. Thermodynamic modeling showed that Tl mobilization in the presence of citric and oxalic acids was indirect and could be attributed to complexation of major elements (Ca, Mg, Al) originating from the dissolution of various soil phases. On the contrary, H(+)-promoted dissolution by acetic acid was assumed as the predominant mechanism of Tl mobilization. Manganese(III,IV) oxides, illite and probably amorphous silicates were evaluated as the dominant phases responsible for Tl retention in the soils. In carbonate-rich soils, Tl coprecipitation with the newly formed carbonates seems to be an important factor influencing Tl release. Therefore, we suggest data on CEC, pH(ZPC) and soil mineralogy to be critical for assessment of Tl behavior in soil systems.

  3. Electron and ligand transfer reactions between cyclometallated platinum(II) compounds and thallium(III) carboxylates

    NARCIS (Netherlands)

    Koten, G. van; Ploeg, A.F.M.J. van der; Vrieze, K.


    Reaction of trans-[(2-Me{2}NCH{2}C{6}H{4}{2}Pt}I{}I{] with Tl}I{}I{}I{(O{2}CR){3} (R = Me, i-Pr) gave direct elimination of Tl}I{(O{2}CR) and formation of the oxidative addition product [(2-Me{2}NCH{2}C{6}H{4}){2}Pt}I{}V{ (O{2}CR){2}], in two isomeric forms. A structure with the carbon ligands in

  4. Induced phosphorescence of some aza- and thio-stilbenes embedded in thallium-exchanged zeolites

    Energy Technology Data Exchange (ETDEWEB)

    Ciorba, S. [Department of Chemistry, University of Perugia, 06123 Perugia (Italy); Clennan, Edward L. [Department of Chemistry, University of Wyoming, Laramie, WY 82071 (United States); Mazzucato, U. [Department of Chemistry, University of Perugia, 06123 Perugia (Italy); Spalletti, A., E-mail: faby@unipg.i [Department of Chemistry, University of Perugia, 06123 Perugia (Italy)


    The emission properties of some aza-stilbenes (2-, 3- and 4-styrylpyridine) and thio-stilbenes [2- and 3-styrylthiophene and 1,2-di-(3-thienyl)ethene]have been investigated after inclusion in commercial (NaY) and cation-exchanged (TlY) faujasite zeolites to get information on the triplet properties through population of the T{sub 1} state induced by the heavy atom effect. The fluorescence properties in NaY and TlY were compared with those reported in solution. The phosphorescence spectra, observed in TlY at liquid nitrogen temperature, allowed the energy levels of the T{sub 1} states to be obtained. Phosphorescence lifetimes were also measured. Their comparison with the lifetime known for stilbene showed that the radiative decay is little affected by the heteroatoms. - Research highlights: {yields} The exchange of Na{sup +} with heavy Tl{sup +} cations in faujasite zeolites allowed the triplet properties of some hetero-stilbenes to be obtained. {yields} The absorption and fluorescence spectra in NaY and TlY were measured and compared with those in fluid solutions. {yields} The triplet energy levels and lifetimes of three aza-stilbenes and three thio-stilbenes in TlY were determined by measuring their phosphorescence emission at liquid nitrogen temperature.

  5. Predictive value of early maximal exercise test and thallium scintigraphy after successful percutaneous transluminal coronary angioplasty

    NARCIS (Netherlands)

    W. Wijns (William); P.W.J.C. Serruys (Patrick); M.L. Simoons (Maarten); M.J.B.M. van den Brand (Marcel); P.J. de Feyter (Pim); J.H.C. Reiber (Johan); P.G. Hugenholtz (Paul)


    textabstractRestenosis of the dilated vessel after percutaneous transluminal coronary angioplasty can be detected by non-invasive procedures but their ability to predict later restenosis soon after a successful angioplasty as well as recurrence of angina has not been assessed. A maximal exercise

  6. Effect of procainamide, lidocaine and diphenylhydantoin on thallium-201 chloride uptake

    Energy Technology Data Exchange (ETDEWEB)

    Schachner, E.R.; Oster, Z.H.; Sacker, D.F.; Som, P.; Atkins, H.L.


    The effect of procainamide, lidocaine and diphenylhydantoin on the organ distribution (particularly the heart) of /sup 201/Tl chloride in rats was studied. The results show that diphenylhydantoin significantly decreases the uptake of /sup 201/Tl chloride in several organs of rats previously treated with this drug. No statistically significant effects were noted with procainamide and lidocaine.

  7. Interaction of the univalent thallium cation with antamanide: Experimental and theoretical study (United States)

    Makrlík, Emanuel; Böhm, Stanislav; Vaňura, Petr; Ruzza, Paolo


    On the basis of extraction experiments and γ-activity measurements, the extraction constant corresponding to the equilibrium Tl+(aq) + 1·Na+(nb) ⇔ 1·Tl+ (nb) + Na+(aq) occurring in the two-phase water-nitrobenzene system (1 = antamanide; aq = aqueous phase, nb = nitrobenzene phase) was determined as log Kex (Tl+, 1·Na+) = 0.7 ± 0.1. Further, the stability constant of the 1·Tl+ complex in nitrobenzene saturated with water was calculated for a temperature of 25 °C: log βnb (1·Tl+) = 4.5 ± 0.2. Finally, by using quantum mechanical DFT calculations, the most probable structure of the cationic complex species 1·Tl+ was derived. In the resulting complex, the "central" cation Tl+ is bound by four bond interactions to the corresponding four carbonyl oxygen atoms of the parent ligand 1. Besides, the whole 1·Tl+ complex structure is stabilized by two intramolecular hydrogen bonds. The interaction energy of the considered 1·Tl+ complex was found to be -359.0 kJ/mol, confirming also the formation of this cationic species.

  8. Sequential dual-isotope SPECT imaging with thallium-201 and technetium-99m-sestamibi. (United States)

    Heo, J; Wolmer, I; Kegel, J; Iskandrian, A S


    This study examined the results of sequential SPECT dual-isotope imaging with 201Tl and 99mTc-sestamibi in 148 patients, 114 of whom also had coronary angiography and 34 had exercise testing or adenosine infusion at a rate of 140 micrograms/kg/min for 6 min. The study was completed within 2 hr. The stress and rest images were normal in 11 of 17 patients (65%) with no CAD by angiography and in 33 of 34 patients with a low pretest probability of CAD (normalcy rate = 97%). The images were abnormal in 75 patients with CAD (77%). The perfusion pattern was compared to wall motion in 485 segments (97 patients) assessed by contrast ventriculography. There were no or reversible perfusion defects in 357 of 386 segments (92%) with no wall motion abnormality. Sequential dual-isotope imaging is feasible and can be completed in a short period of time and may therefore enhance laboratory throughput and patient convenience.

  9. The Plastic Deformation of Thallium Halides in Relation to Crystal Orientation (United States)


    und Chem. I_2., 443 (1867). 6. J. Tanmann and A. Mueller, Zs.f. Metallkunde 18, 69 (1926). 3 -• a a-- - . .. Fig. 1. Press patterns on Cu-crystal...metry. Actually, under the proper lighting conditions, there can 7. J. Tammann and A. Mueller, Zs.f. Metallkunde 18, 69 (1926). 7 -41ZI 4, 4, 0 %4 ~4- 0

  10. Nuclear volume effects in equilibrium stable isotope fractionations of mercury, thallium and lead (United States)

    Yang, Sha; Liu, Yun


    The nuclear volume effects (NVEs) of Hg, Tl and Pb isotope systems are investigated with careful evaluation on quantum relativistic effects via the Dirac’s formalism of full-electron wave function. Equilibrium 202Hg/198Hg, 205Tl/203Tl, 207Pb/206Pb and 208Pb/206Pb isotope fractionations are found can be up to 3.61‰, 2.54‰, 1.48‰ and 3.72‰ at room temperature, respectively, larger than fractionations predicted by classical mass-dependent isotope fractionations theory. Moreover, the NVE can cause mass-independent fractionations (MIF) for odd-mass isotopes and even-mass isotopes. The plot of vs. for Hg-bearing species falls into a straight line with the slope of 1.66, which is close to previous experimental results. For the first time, Pb4+-bearing species are found can enrich heavier Pb isotopes than Pb2+-bearing species to a surprising extent, e.g., the enrichment can be up to 4.34‰ in terms of 208Pb/206Pb at room temperature, due to their NVEs are in opposite directions. In contrast, fractionations among Pb2+-bearing species are trivial. Therefore, the large Pb fractionation changes provide a potential new tracer for redox conditions in young and closed geologic systems. The magnitudes of NVE-driven even-mass MIFs of Pb isotopes (i.e., ) and odd-mass MIFs (i.e., ) are almost the same but with opposite signs. PMID:26224248

  11. Nondestructive method for quantifying thallium dopant concentrations in CsI:Tl crystals. (United States)

    Miller, Stuart R; Ovechkina, Elena E; Bennett, Paul; Brecher, Charles


    We report a quantitative method for using X-ray fluorescence (XRF) to nondestructively measure the true content of Tl dopant in CsI:Tl scintillator crystals. The instrument is the handheld LeadTracer™, originally developed at RMD Instruments for measuring Pb concentration in electronic components. We describe both the measurement technique and specific findings on how changes in crystal size and growth parameters affect Tl concentration. This method is also applicable to numerous other activator ions important to scintillators, such as Ce(3+) and Eu(2+). © 2013 Elsevier Ltd. All rights reserved.

  12. KN179L03: WHOI cruise 179 leg 03 aboard the R/V Knorr from 2004-08-27 - 2004-09-11 (NODC Accession 0050808) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Post-cruise download of raw data from shipboard computer(s) as furnished by the Woods Hole Oceanographic Institution Shipboard Scientific Support Group and archived...

  13. Thallium 2223 high Tc superconductor in a silver matrix and its magnetic shielding, hermal cycle and time aging properties

    Energy Technology Data Exchange (ETDEWEB)

    Fei, X.; He, W.S.; Havenhill, A. [and others


    Superconducting Tl{sub 2}Ba{sub 2}Ca{sub 2}Cu{sub 3}O{sub 10} (Tl2223) was ground to powder. Mixture with silver powder (0--80% weight) and press to desired shape. After proper annealing, one can get good silver-content Tl2223 bulk superconductor. It is time-stable and has good superconducting property as same as pure Tl2223. It also has better mechanical property and far better thermal cycle property than pure Tl2223.

  14. Kinetic analysis of 18F-fluorodihydrorotenone as a deposited myocardial flow tracer: Comparison to thallium-201.

    Energy Technology Data Exchange (ETDEWEB)

    Marshall, Robert C.; Powers-Risius, Patricia; Reutter, Bryan W.; O' Neil, James P.; La Belle, Michael; Huesman, Ronald H.; VanBrocklin, Henry F.


    The goal of this investigation was to assess the accuracy of 18F-fluorodihydrorotenone (18F-FDHR) as a new deposited myocardial flow tracer and compare the results to those for 201Tl. Methods. The kinetics of these flow tracers were evaluated in 22 isolated, erythrocyte- and albumin-perfused rabbit hearts over a flow range encountered in patients. The two flow tracers plus a vascular reference tracer (131I-albumin) were introduced as a bolus through a port just above the aortic cannula. Myocardial extraction, retention, washout, and uptake parameters were computed from the venous outflow curves using the multiple indicator dilution technique and spectral analysis. Results. The mean initial extraction fractions of 18F-FDHR (0.85 +- 0.07) and 201Tl (0.87 +- 0.05) were not significantly different, although the initial extraction fraction for 18F-FDHR declined with flow (P < 0.0001), whereas the initial extraction fraction of 201Tl did not. Washout of 201Tl was faster (P < 0.001) and more affected by flow (P < 0.05) than 18F-FDHR washout. Except for initial extraction fraction, 18F-FDHR retention was greater (P < 0.001) and less affected by flow (P < 0.05) than 201Tl retention. Reflecting its superior retention, net uptake of 18F-FDHR was better correlated with flow than 201Tl uptake at both one and fifteen minutes after tracer introduction (P < 0.0001 for both comparisons). Conclusion. The superior correlation of 18F-FDHR uptake with flow indicates that it is a better flow tracer than 201Tl in the isolated rabbit heart. Compared to the other currently available positron-emitting flow tracers (82Rb, 13N-ammonia, and 15O-water), 18F-FDHR has the potential of providing excellent image resolution without the need for an on-site cyclotron.

  15. Quantitative angiography of the left anterior descending coronary artery: correlations with pressure gradient and results of exercise thallium scintigraphy

    NARCIS (Netherlands)

    W. Wijns (William); P.W.J.C. Serruys (Patrick); J.H.C. Reiber (Johan); M.J.B.M. van den Brand (Marcel); M.L. Simoons (Maarten); C.J. Kooijman; K. Balakumaran (Kulasekaram); P.G. Hugenholtz (Paul)


    textabstractTo evaluate, during cardiac catheterization, what constitutes a physiologically significant obstruction to blood flow in the human coronary system, computer-based quantitative analysis of coronary angiograms was performed on the angiograms of 31 patients with isolated disease of the

  16. Comparison of I-123 IPPA and thallium-201 for the prediction of functional improvement after myocardial revascularization

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, C.L.; Van Decker, W.; Iskandrian, A.S. [Temple Univ. Hospital, Allegheny Univ. of the Health Sciences, Philadelphia, PA (United States)


    Sixteen patients in the phase I/II study of IPPA had RRT prior to MR. Patients were injected with 2-6 mCi of IPPA; sequential SPECT imaging was begun at 4 minutes. Radionuclide ventriculography was performed before and 8 weeks after MR. The ability of IPPA and RRT to identify patients with a 5% increase in EF after MR were compared using receiver operating characteristic (ROC) curve analysis. The IPPA images were analyzed using two techniques: The first method looked at the fraction of the myocardium (FM) demonstrating abnormal metabolism and the second at the FM demonstrating descreased initial perfusion and abnormal metabolism. RRT images were analyzed three different ways: Thresholded uptake on the initial images, thresholded uptake on the delayed images and relative improvement between the initial and delayed images. The parameters giving the highest ROC areas were identified for both IPPA and RRT and then compared. Five patients underwent PTCA and 11 underwent coronary artery bypass grafting. The mean EF increased from 36{+-}12% to 41{+-}14% after MR (p=0.012). The amount of myocardium (AM) showing intermediate metabolism (IM) of IPPA from 0.001 to 0.013 In counts/min was a strong predictor of FI after MR (area=0.92{+-}0.05). The AM that was hypoperfused and had IM (activity<90% of maximum uptake and metabolism from 0.002-0.013 In counts/min) was a stronger predictor (area=0.97 0.03). Using RRT, the best predictor was the AM with greater than 55% of maximal activity on the initial images (area=0.83{+-}0.10); the AM>45% of maximal activity on the delayed images was slightly lower (area=0.81{+-}0.10); improvement between the initial and delayed images was comparatively weak (0.56{+-}0.13). The difference between the areas between IPPA and RRT, however, was not statistically significant. (orig./MG) [Deutsch] Sechzehn Patienten der Phase-I/II-IPPA-Studie wurden einer RRT vor MR unterzogen. Es wurden 75-220 MBq IPPA injiziert und 4 min p.i. eine sequentielle SPECT-Akquisition gestartet. Eine Radionuklid-Ventrikulographie wurde vor und acht Wochen nach MR durchgefuehrt. Die Moeglichkeit von IPPA und RRT, solche Patienten zu erkennen, die eine Zunahme der EF>5% nach der MR aufwiesen, wurde mit der Receiver-Operating-Characteristic-(ROC)-Kurvenanalyse evaluiert. Die IPPA-Bilder wurden ueber zwei Methoden analysiert: Die erste erfasste Anteile des Myokards (AM), die einen abnormen Metabolismus aufwiesen, und die zweite AM mit einer initial verringerten Durchblutung und einem abnormen Metabolismus. Die RRT-Bilder wurden auf drei Weisen analysiert: Die schwellenabhaengige Aufnahme im fruehen Bild, die schwellenabhaengige Aufnahme im spaeten Bild und eine relative Verbesserung zwischen beiden. Fuer IPPA und RRT wurden diejenigen Schwellenwerte, die die groesste Flaeche unter den ROC-Kurven ergaben, ermittelt und miteinander verglichen. Fuenf Patienten wurden einer PTCA unterzogen und 11 einer koronaren Bypass-Operation. Die mittlere EF stieg von 36{+-}12% auf 41{+-}14% nach der MR (p=0,012). Der AM, der einen mittelgradigen Stoffwechsel (MS) des IPPA von 0,001-0,013 In Counts/min aufwies, war stark praediktiv fuer die KV nach MR (Flaeche=0,92{+-}0,05). Der AM, der eine initial verringerte Durchblutung und einen MS (Aktivitaet <90% der maximalen Aufnahme und Stoffwechsel von 0,002-0,013 In Counts/Minute) zeigte, war sogar staerker praediktiv (Flaeche=0,97{+-}0,03). Bei Verwendung von RRT war der beste Praediktor derjenige AM, der eine Aufnahme >55% des Maximums in den fruehen Bildern zeigte (Flaeche=0,83{+-}0,1); der AM, der ueber einen Uptake>45% der maximalen Aktivitaet in den spaeten Aufnahmen verfuegte, war geringfuegig schlechter (Flaeche=0,81{+-}0,1); eine Verbesserung zwischen dem fruehen und spaeten Bild war vergleichsweise schwach (Flaeche=0,56{+-}0,13). Der Unterschied zwischen IPPA und RRT war statistisch nicht signifikant (IPPA=0,97{+-}0,03 vs. RRT=0,83{+-}0,1; p=0,13). (orig./MG)

  17. Exercise-induced U-wave changes in patients with coronary artery disease. Correlation with tomographic thallium-201 myocardial imaging

    Energy Technology Data Exchange (ETDEWEB)

    Miyakoda, Hiroyuki; Endo, Akihiro; Kato, Masahiko; Kato, Tatsuo; Omodani, Hiroki; Osaki, Shuichi; Kinugawa, Toru; Hoshio, Akira [Tottori Univ., Yonago (Japan). School of Medicine; Mashiba, Hiroto


    We studied the relation between exercise-induced U-wave changes and the site of a reversible defect in tomographic {sup 201}Tl myocardial imaging. Coronary artery disease and control groups consisted of 116 and 42 patients, respectively. In the anteroapical-ischemia group (n=37), the sensitivity of U-wave inversion in the anterior precordial leads for ischemia was 62% (23/37) and that of prominent U-waves without an increase in the height of the T-wave in the inferior limb leads was 57% (21/37). In this group, 18 patients (49%) met both criteria (18 =78%= of 23 patients with the former; 18 =86%= of 21 patients with the latter). In the posterior-ischemia group (n=59), the sensitivity of prominent U-waves with a decrease in the height of the T-wave in the anterior precordial leads for ischemia was 63% (37/59) and that of U-wave inversion in the inferior limb leads was 20% (12/59). In this group, 12 patients (20%) met both criteria (12 =32%= of 37 patients with the former; all 12 patients with the latter). The specificity of U-wave criteria was 100%. In the anteroapical and posterior-ischemia group (n=20), the sensitivity of U-wave criteria for anteroapical and posterior ischemia was 85% (17/20) and 40% (8/20), respectively. In conclusion, U-wave criteria are not only specific but also sensitive for myocardial ischemia determined by {sup 201}Tl imaging. (author)

  18. Structural, dielectric and vibrational studies of the new mixed solid solution of thallium potassium sulfate selenate tellurate

    Energy Technology Data Exchange (ETDEWEB)

    Elferjani, A.; Abdelhedi, M.; Dammak, M.; Kolsi, A.W. [University of Sfax, Laboratory of Inorganic Chemistry, UR 11ES73, B. P. 1171, Sfax (Tunisia)


    The new mixed compound Tl{sub 1.89}K{sub 0.11}(SO{sub 4}){sub 0.9}(SeO{sub 4}){sub 0.1}Te(OH){sub 6} which is crystallized in the monoclinic system with space group P2{sub 1}/c was analyzed at room temperature using X-ray diffractometer data. The unit cell parameters are a = 12.3308(7), b = 7.2011(4), c = 12.0298(8) Aa, β = 110.755(4) , V = 998.87(11) Aa{sup 3} and Z = 4. The final refinement led to R = 0.035 and Rw = 0.038. The main feature of these atomic arrangements is the coexistence of three and different anions (SO{sub 4} {sup 2-}, SeO{sub 4} {sup 2-} and TeO{sub 6} {sup 6-} groups) in the unit cell, connected by hydrogen bonds (O-H..O) which make the building of the crystal. The Tl{sup +} and K{sup +} cations, occupying the same positions, are located between these polyhedral. The crystals of Tl{sub 1.89}K{sub 0.11}(SO{sub 4}){sub 0.9}(SeO{sub 4}){sub 0.1}Te(OH){sub 6} underwent three endothermic peaks at 377, 466 and 472 K. These transitions were detected by DSC and analyzed by dielectric measurements using the impedance and modulus spectroscopy techniques. The IR and Raman spectra recorded at room temperature in the frequency ranges (50-1200) and (400-4000) cm{sup -1}, respectively, have confirmed the presence of TeO{sub 6} {sup 6-}, SO{sub 4} {sup 2-} and SeO{sub 4} {sup 2-} groups in the crystal. (orig.)

  19. Studies on the adsorption of caesium, thallium, strontium and cobalt radionuclides on activated carbons from aqueous solutions

    Energy Technology Data Exchange (ETDEWEB)

    Rivera-Utrilla, J.; Ferro-Garcia, M.A.; Mata-Arjona, A.; Gonzalez-Gomez, C. (Granada Univ. (Spain). Dept. of Inorganic Chemistry)


    Individual adsorption studies of Cs/sup +/, Tl/sup +/, Sr/sup 2 +/ and Co/sup 2 +/ on activated carbons from aqueous solutions are reported. The carbon samples were characterised using different techniques. The surface area and the micro-, meso- and macropore volumes of all samples have been calculated. The chemical nature of the surface of the activated carbons was also studied. Optimal conditions for the adsorption of the metal ions have been identified. The adsorption of these cations by the carbon samples was also determined in the presence of a number of different anions. The data suggest the possible use of activated carbons for the preconcentration and separation of some cations.

  20. One-dimensional phosphinite platinum chains based on hydrogen bonding interactions and phosphinite tetranuclear platinum(II)-thallium(I) complexes. (United States)

    Díez, Alvaro; Forniés, Juan; Gómez, Julio; Lalinde, Elena; Martín, Antonio; Moreno, M Teresa; Sánchez, Sergio


    The mononuclear pentafluorophenyl platinum complex containing the chelated diphenylphosphinous acid/diphenylphosphinite system [Pt(C(6)F(5)){(PPh(2)O)(2)H}(PPh(2)OH)] 1 has been prepared and characterised. 1 and the related alkynyl complex [Pt(C[triple bond, length as m-dash]CBu(t)){(PPh(2)O)(2)H}(PPh(2)OH)] 2 form infinite one-dimensional chains in the solid state based on intermolecular O-H[dot dot dot]O hydrogen bonding interactions. Deprotonation reactions of [PtL{(PPh(2)O)(2)H}(PPh(2)OH)] (L = C(6)F(5), C[triple bond, length as m-dash]CBu(t), C[triple bond, length as m-dash]CPh 3) with [Tl(acac)] yields tetranuclear Pt(2)Tl(2) complexes [PtL{(PPh(2)O)(2)H}(PPh(2)O)Tl](2) (L = C(6)F(5) 4, C[triple bond, length as m-dash]CBu(t), C[triple bond, length as m-dash]CPh ). The structure of the tert-butylalkynyl derivative , established by X-ray diffraction, shows two anionic discrete units [Pt(C[triple bond, length as m-dash]CBu(t)){(PPh(2)O)(2)H}(PPh(2)O)](-) joined by two Tl(i) centres via Tl-O and Pt-Tl bonds. Despite the existence of Pt-Tl interactions, they do not show luminescence.

  1. Dual-tracer autoradiography with thallium-201 and iodine-125 MIBG in BIO 14. 6 cardiomyopathic Syrian hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Taguchi, Takahisa; Kobayashi, Akira; Kurata, Chinori; Tawarahara, Kei; Yamazaki, Noboru (Hamamatsu Univ. School of Medicine, Shizuoka (Japan))


    Dual-tracer imaging of the heart with [sup 125]I-metaiodobenzylguanidine (MIBG) and [sup 201]Tl can simultaneously demonstrate the distribution of sympathetic nerve endings and the underlying myocardial perfusion. A quantitative dual-tracer autoradiographic study with [sup 201]Tl and [sup 125]I-MIBG was performed to investigate changes in the distribution of cardiac sympathetic innervation with the progression of cardiomyopathy in BIO 14.6 hamsters. The distribution of [sup 201]Tl was uniform in control hamsters and BIO 14.6 hamsters at all stages of cardiomyopathy. In contrast, a reduction in MIBG accumulation occurred in the endocardial region of the left ventricular free wall and the left ventricular aspect of the interventricular septum in BIO 14.6 hamsters at 3 and 8 months of age. Thus, there was an uncoupling of the left ventricular distribution of [sup 201]Tl and [sup 125]I-MIBG in BIO 14.6 hamsters. In addition, interstitial fibrosis was increased in the interventricular septum, the subendocardial region of the left ventricular free wall, and the right ventricular wall, which were the sites of reduced MIBG accumulation. This study shows that dual myocardial imaging with MIBG and [sup 201]Tl may be useful for investigating patients with cardiomyopathy. (author).

  2. Assessment of transient dilation of the left ventricular cavity in patients with hypertrophic cardiomyopathy by exercise thallium-201 scintigraphy

    Energy Technology Data Exchange (ETDEWEB)

    Sugihara, Hiroki; Shiga, Kouji; Umamoto, Ikuo (Kyoto Prefectural Univ. of Medicine (Japan)) (and others)


    Exercise Tl scintigraphy (EX-Tl) provides a noninvasive means of identifying myocardial perfusion abnormalities in patients (pts) with hypertrophic cardiomyopathy (HCM). We have noted that some pts with HCM have a pattern of transient dilation of the left ventricle (LV) on the immediate post exercise images as compared with 3 hour redistribution images. We presumed that left ventricular dilation was caused by subendocardial hypoperfusion. So we studied transient dilation of the LV in 50 pts with HCM and 20 controls (C). Initial and delayed conventional short tomographic images were obtained after reconstruction of 30 projections acquired over 180 degrees. Thirty six radii every 10 degrees were generated from the center of the middle myocardial images of the short axis. An area surrounded by the thirty six points of maximal count on each radius was calculated in initial and delayed images. Transient dilation index (TDI) as an index of dilation was determined by dividing an area in initial image by an area in delayed image. TDI in pts with HCM was larger than that in C. Pts with HCM were classified into the two groups, Group A: TDI>1.11 (mean+2 SD in C), 24 pts, Group B: TDI>1.11, 26 pts. Frequency of pts with history of chest pain in Group A was higher than that in Group B, and frequency of pts with positive exercise ECG in Group A was higher than that in Group B. End diastolic volume in Group B did not change 10 minutes after exercise by radionuclide ventriculography. In conclusion, transient dilation of the LV in pts with HCM by Ex-Tl is in appearance, and may reflect subendocardial ischemia. (author).

  3. Vestibularis-schwannomers diagnostik og vaekst bedømt ved SPECT kombineret med TL-201 Thallium

    DEFF Research Database (Denmark)

    Charabi, S; Lassen, N A; Jacobsen, G K


    The value of SPECT scanning in diagnosis and growth potential of vestibular schwannoma (VS) was investigated in a series of 29 patients. SPECT demonstrated all tumours > 0.8 cm3, but had limitations as a diagnostic modality of small intracanalicular tumours, when compared to gadolinium DTPA...

  4. Assessment of myocardial viability by exercise stress-redistribution myocardial scintigraphy with thallium-201; The usefulness of C-map

    Energy Technology Data Exchange (ETDEWEB)

    Narita, Michihiro; Kurihara, Tadashi; Murano, Kenichi; Usami, Masahisa (Sumitomo Hospital, Osaka (Japan))


    This study was intended to clarify whether Tl-201 washout rate abnormality after exercise stress can detect myocardial viability in the myocardium with perfusion defect on redistribution (RD) images. The subjects were 29 patients with ischemic heart disease in whom perfusion defect was seen on delayed (3 hr) RD images and had percutaneous transluminal coronary angioplasty (PTCA). A combined map (C-map) was prepared by adding the location of washout rate abnormality ([<=]30%) to perfusion defect on RD images before PTCA. The C-map and myocardial images after PTCA (Post-map) were compared. The left ventriculogram was divided into 17 segments. C-map and Post-map were qualitatively concordant with each other in 27 of 29 patients (93%). In the other 2 patients, only one segment showed discordance of findings between the two maps. Out of 152 segments with perfusion defect on RD images, 75 segments (50%) showed normal perfusion in both the C-map and the Post-map. In segmental analysis, the C-map and the Post-map were found consistent in 80% of the cases. In 12 patients with fixed defect before PTCA, the agreement between the C-map and the Post-map was also excellent (86%). The present C-map was useful for not only qualitative but also quantitative analyses of myocardial viability in myocardial segments which show perfusion defect on standard RD images. (N.K.).

  5. Oyedeji et al., Afr J Tradit Complement Altern Med. (2016) 13(6):179 ...

    African Journals Online (AJOL)


    Apr 10, 2015 ... Corrosion inhibition by Justicia gendarussa plant extract in hydrochloric acid solution. Corrosion Science. 51: 2848-2856. 29. Sofowora, A. (2005). Medicinal plants and traditional medicine in Africa. Spectrum Books Ltd: Ibadan. Nigeria. 289. 30. Steenkamp. V.J. (2003). Traditional herbal remedies used by ...

  6. 26 CFR 1.179-1 - Election to expense certain depreciable assets. (United States)


    ... residential rental property as an investment. A and others form ABC partnership whose function is to rent and... 1991, ABC partnership purchases and places in service office furniture costing $20,000 to be used in the active conduct of ABC's business. Although the office furniture is used with respect to an...

  7. Statistical Abstract of Higher Education in North Carolina, 1978-79. Research Report 1-79. (United States)

    Balfour, Linda, Comp.

    A statistical abstract covering the breadth of higher education in the state of North Carolina is presented. Extensive data on current enrollment, enrollment trends, undergraduate transfers, degrees conferred, faculty, library resources, costs to students, admissions, student financial aid, and student housing are provided. The data, collected and…

  8. 21 CFR 179.26 - Ionizing radiation for the treatment of food. (United States)


    ... as ingredients in small amounts solely for flavoring or aroma: culinary herbs, seeds, spices.... Turmeric and paprika may also be irradiated when they are to be used as color additives. The blends may... exceed 30 kGy (3 Mrad). 6. For control of food-borne pathogens in fresh or frozen, uncooked poultry...

  9. Oyedeji et al., Afr J Tradit Complement Altern Med. (2016) 13(6):179 ...

    African Journals Online (AJOL)


    Apr 10, 2015 ... 31. Viana, F.M.P., Kobory, R.F., Bettiol, W., Athayde, S.C. (2000). Control of damping-off in bean plant caused by Sclerotinia sclerotiorum by the incorporation of organic matter in the substrate. Summa Phytopathologica. 26: 94–97. 32. Yerima, M., Magaji, M.G., Yaro, A.H., Tanko Y., Mohammed, M.M. (2009).

  10. Intrinsic gK factors of odd-mass 167−179Lu isotopes

    Indian Academy of Sciences (India)

    Phys. J. A3, 225 (1998)) using the spin matrix elements. The theoretical predictions for the gK factors exhibit good agreement with the experimental gK factors with increasing mass number A of the lutetium isotopes. The strongest influence of the neutron–proton spin interaction occurs at q = −1. Sufficient agreement between.

  11. Vinyl Monomers Double as UV Stabilizers: 179th ACS Meeting Houston. (United States)

    Chemical and Engineering News, 1980


    Synthesis and polymerization of vinyl monomers that double as stabilizers against degradation of plastics by ultraviolet light has been accomplished. Potential applications include protection of photovoltaic cells in solar power plants. (Author/RE)

  12. : tous les projets | Page 179 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Les programmes nationaux de prévention du VIH en Tanzanie, en Zambie et au Botswana doivent s'attaquer de manière efficace au taux d'infection des femmes durant la grossesse et la période post-partum. Date de début : 20 mars 2012. End Date: 15 décembre 2014. Sujet: HIV, MATERNAL AND CHILD HEALTH, ...

  13. 49 CFR Appendix A to Part 179 - Procedures for Tank-Head Puncture-Resistance Test (United States)


    ..., and duplicate the condition of a conventional draft sill including the draft yoke and draft gear. The...-minus 2.5 cm (1 inch), above the top of the sill; the other test must be conducted with the coupler height at 79 cm (31 inches), plus-or-minus 2.5 cm (1 inch), above the top of the sill. If the combined...

  14. 179 Extraction of Coal-tar Pitch by Supercritical Carbon Dioxide ...

    African Journals Online (AJOL)


    performed with Saturn 2000, Version 5. 3. Results and Discussion. 3.1. Optimal conditions for supercritical fluid extractions experiments. The first phase was the determination of optimal conditions for SFE experiments. For this purpose the dependence of extraction yield on temperature (T) and pressure (P) was investigated.

  15. 21 CFR 179.39 - Ultraviolet radiation for the processing and treatment of food. (United States)


    ...; intensity of radiation, 1 W (of 2,537 A. radiation) per 5 to 10 ft.2 Surface microorganism control. Potable.... Sterilization of water used in food production. Juice products Turbulent flow through tubes with a minimum Reynolds number of 2,200. Reduction of human pathogens and other microorganisms. [42 FR 14635, Mar. 15...

  16. C14ORF179 encoding IFT43 is mutated in Sensenbrenner syndrome

    NARCIS (Netherlands)

    Arts, H.H.; Bongers, M.H.F.; Mans, D.A.; Beersum, S.E.C. van; Oud, M.M.; Bolat, E.; Spruijt, L.; Cornelissen, E.A.M.; Schuurs-Hoeijmakers, J.H.M.; Leeuw, N. de; Cormier-Daire, V.; Brunner, H.G.; Knoers, N.V.A.M.; Roepman, R.


    BACKGROUND: Sensenbrenner syndrome is a heterogeneous ciliopathy that is characterised by skeletal and ectodermal anomalies, accompanied by chronic renal failure, heart defects, liver fibrosis and other features. OBJECTIVE: To identify an additional causative gene in Sensenbrenner syndrome. METHODS:

  17. Gene probes : principles and protocols [Methods in molecular biology, v. 179

    National Research Council Canada - National Science Library

    Rapley, Ralph; Aquino de Muro, Marilena


    .... The applications covered range from searching for specific genes in the human chromosome to the detection of microorganisms and their toxins in the environment and in food samples, as well as in the...

  18. 21 CFR 179.45 - Packaging materials for use during the irradiation of prepackaged foods. (United States)


    ... §§ 178.3740 and 181.22 through 181.30 of this chapter, sodium citrate, sodium lauryl sulfate, polyvinyl... citrate, sodium lauryl sulfate, polyvinyl chloride, and materials as listed in paragraph (d)(2)(i) of this...-vinyl chloride copolymer film prepared from vinylidene chloride-vinyl chloride basic copolymers...

  19. 179 Extraction of Coal-tar Pitch by Supercritical Carbon Dioxide ...

    African Journals Online (AJOL)


    methanol in vials that were cooled with a mixture of ice and sodium chloride to ... The first phase was the determination of optimal conditions for SFE experiments. .... diagram is that different compounds reach their maximum yields at different.

  20. 4.8 GHz Intra-Day Variability of FSRQ 0507+ 179

    Indian Academy of Sciences (India)


    Jan 27, 2016 ... Author Affiliations. Lang Cui1 2 Jun Liu1 2 Xiang Liu1 2. Xinjiang Astronomical Observatory, Chinese Academy of Sciences, 150 Science 1-Street, Urumqi 830011, China. Key Laboratory of Radio Astronomy, Chinese Academy of Sciences, Nanjing 210008, China.

  1. Gene probes : principles and protocols [Methods in molecular biology, v. 179

    National Research Council Canada - National Science Library

    Rapley, Ralph; Aquino de Muro, Marilena


    "Senior scientists Marilena Aquino de Muro and Ralph Rapley have brought together an outstanding collection of time-tested protocols for designing and using genes probes in a wide variety of applications...

  2. Page 1 Kamala Dye as an Anthelmintic 179 of rottlerin when ...

    Indian Academy of Sciences (India)

    the criterion of toxicity according to the original Suggestion of Krishna-. Swami and Seshadri.” Besides rottlerin, its methyl ether has also been tested, since in the case of hydroxy-flavones, the methyl ethers are much more toxic than the original hydroxy compounds. The results obtained are given below. An alcoholic solution ...

  3. Page 1 Bull. Mater. Sci., Vol. 17, No. 2, April 1994, pp. 171-179. C ...

    Indian Academy of Sciences (India)

    are called biomaterials. Bioactive glasses and glassceramics are being used increasingly for ossicular bone replacement prostheses, maxillofacial reconstruction, periodontal packing, middle ear and dental implants, etc. (Hulbert et al 1987). Glassceramics combine the advantages of both glasses and ceramics, They are.

  4. 76 FR 179 - GMPT Warren Transmission, GM Powertrain Division, a Subsidiary of General Motors Company... (United States)


    ... Employment and Training Administration TA-W-71,374 GMPT Warren Transmission, GM Powertrain Division, a..., applicable to workers of GMPT Warren Transmission, GM Powertrain Division, a subsidiary of General Motors... determined that these workers were sufficiently under the control of GMPT Warren Transmission, GM Powertrain...

  5. 76 FR 179 - Notice of Determinations Regarding Eligibility To Apply for Worker Adjustment Assistance (United States)


    ... Chicago, IL Group, Inc., Merchandise Mart. The investigation revealed that the criteria under paragraphs(a..., Formerly E-Z- Data, Inc. 74,640 Citigroup Management Irving, TX Corporation, CitiCorp, Inc.. 74,700 AT&T...

  6. Newly developed semi-empirical formulas for (p, α) at 17.9 MeV and ...

    Indian Academy of Sciences (India)

    Department of Physics, Faculty of Arts and Sciences, Gazi University, TR-06500 Ankara, Turkey; Faculty of Arts and Sciences, Kırıkkale University, 71450 Kırıkkale, Turkey; Faculty of Arts and Sciences, Süleyman Demirel University, 32260 Isparta, Turkey; Department of Physics Engineering, Faculty of Engineering, Ankara ...

  7. A Guide to Calculating District Expenditure-to-Performance Ratios Using Publicly Available Data. REL 2017-179 (United States)

    Ryan, Sarah; Lavigne, Heather J.; Zweig, Jacqueline S.; Buffington, Pamela J.


    Districts across the nation are seeking ways to increase efficiency by maintaining, if not improving, educational outcomes using fewer resources. One measure that is sometimes used as a proxy for school district efficiency is an expenditure-to-performance ratio, for example a ratio of per pupil expenditures to student academic performance. This…

  8. SU-E-T-179: Clinical Impact of IMRT Failure Modes at Or Near TG-142 Tolerance Criteria Levels

    Energy Technology Data Exchange (ETDEWEB)

    Faught, J Tonigan; Balter, P; Johnson, J; Kry, S; Court, L; Stingo, F; Followill, D [UT MD Anderson Cancer Center, Houston, TX (United States)


    Purpose: Quantitatively assess the clinical impact of 11 critical IMRT dose delivery failure modes. Methods: Eleven step-and-shoot IMRT failure modes (FMs) were introduced into twelve Pinnacle v9.8 treatment plans. One standard and one highly modulated plan on the IROC IMRT phantom and ten previous H&N patient treatment plans were used. FMs included physics components covered by basic QA near tolerance criteria levels (TG-142) such as beam energy, MLC positioning, and MLC modeling. Resultant DVHs were compared to those of failure-free plans and the severity of plan degradation was assessed considering PTV coverage and OAR and normal tissue tolerances and used for FMEA severity scoring. Six of these FMs were physically simulated and phantom irradiations performed. TLD and radiochromic film results are used for comparison to treatment planning studies. Results: Based on treatment planning studies, the largest clinical impact from the phantom cases was induced by 2 mm systematic MLC shift in one bank with the combination of a D95% target under dose near 16% and OAR overdose near 8%. Cord overdoses of 5%–11% occurred with gantry angle, collimator angle, couch angle, MLC leaf end modeling, and MLC transmission and leakage modeling FMs. PTV coverage and/or OAR sparing was compromised in all FMs introduced in phantom plans with the exception of CT number to electron density tables, MU linearity, and MLC tongue-and-groove modeling. Physical measurements did not entirely agree with treatment planning results. For example, symmetry errors resulted in the largest physically measured discrepancies of up to 3% in the PTVs while a maximum of 0.5% deviation was seen in the treatment planning studies. Patient treatment plan study results are under analysis. Conclusion: Even in the simplistic anatomy of the IROC phantom, some basic physics FMs, just outside of TG-142 tolerance criteria, appear to have the potential for large clinical implications.

  9. Newly developed semi-empirical formulas for (p, α) at 17.9 MeV and ...

    Indian Academy of Sciences (India)

    Turkey. 2Faculty of Arts and Sciences, Kırıkkale University, 71450 Kırıkkale, Turkey. 3Faculty of Arts and Sciences, Süleyman Demirel University, 32260 ... neutron source (capable of incinerating nuclear waste and of producing energy), high-energy proton-induced fission as an alternative for the isotope production etc. [1,2].

  10. 4.8 GHz Intra-Day Variability of FSRQ 0507+ 179 Lang Cui1,2 ...

    Indian Academy of Sciences (India)

    TER (Mobile Astronomical System of the Telescope-Robots), and the magnitude increased fast from 18.7 to 16.6, up to the brightest magnitude since January 2009. (Denisenko et al. 2012). The last IDV session in Table 1 was arranged after the opti- cal flare to study the possible difference of IDV characteristics compared to ...

  11. Biokinetics of radiolabeled Iodophenylpentadecanoic acid (I-123-IPPA) and thallium-201 in a rabbit model of chronic myocardial infarction measured using a series of thermoluminescent dosimeters (United States)

    Medich, David Christopher


    The biokinetics of Iodophenylpentadecanoic acid (123I-IPPA) during a chronic period of myocardial infarction were determined and compared to 201Tl. IPPA was assessed as a perfusion and metabolic tracer in the scintigraphic diagnosis of coronary artery disease. The myocardial clearance kinetics were measured by placing a series of thermoluminescent dosimeters (TLDs) on normal and infarcted tissue to measure the local myocardial activity content over time. The arterial blood pool activity was fit to a bi-exponential function for 201Tl and a tri-exponential function for 123I-IPPA to estimate the left ventricle contribution to TLD response. At equilibrium, the blood pool contribution was estimated experimentally to be less than 5% of the total TLD response. The method was unable to resolve the initial uptake of the imaging agent due in part to the 2 minute TLD response integration time and in part to the 30 second lag time for the first TLD placement. A noticeable disparity was observed between the tracer concentrations of IPPA in normal and ischemic tissue of approximately 2:1. The fitting parameters (representing the biokinetic eigenvalue rate constants) were related to the fundamental rate constants of a recycling biokinetic model. The myocardial IPPA content within normal tissue was elevated after approximately 130 minutes post injection. This phenomenon was observed in all but one (950215) of the IPPA TLD kinetics curves.

  12. Combined thallium-201 and dynamic iodine-123 iodophenylpentadecanoic acid single-photon emission computed tomography in patients after acute myocardial infarction with effective reperfusion. (United States)

    Richter, W S; Beckmann, S; Cordes, M; Schuppenhauer, T; Schartl, M; Munz, D L


    Considerable derangements of energy metabolism are to be expected during ischemia and reperfusion. In ischemic myocardium, the oxidative degradation of carbohydrates is shifted toward the anaerobic production of lactate and the oxidation of fatty acids is suppressed. The aim of this study was to examine the uptake and metabolism of iodine-123 (123I) iodophenylpentadecanoic acid (IPPA) in stunned myocardium. In 15 patients, SPECT with 201Tl and 123I IPPA as well as echocardiography with low-dose dobutamine stimulation were performed 12 +/- 5 days after myocardial infarction with reperfusion. Follow-up echocardiography was carried out 24 +/- 8 days later for documentation of functional improvement. Uptake of 201Tl and 123I IPPA were obtained in five left ventricular segments, and dynamic SPECT imaging was used for calculation of the fast and the slow components of the biexponential myocardial 123I IPPA clearance. Wall motion improved in 14 of 26 dysfunctional segments (54%). Stunned segments were characterized by a reduced 123I IPPA extraction, a shorter half-life of the fast, and a longer half-life of the slow clearance component. All parameters of the combined 201Tl/123I IPPA study predicted functional recovery with similar accuracies (area under the receiver operator characteristic curves between 0.68 and 0.76; p = NS). Analysis of 201Tl uptake alone could not predict functional recovery in this study. Stunned myocardium is characterized by a disturbance of fatty acid metabolism. For prediction of functional improvement, 123I IPPA imaging added significant diagnostic information.

  13. Thallium 2223 high T(sub c) superconductor in a silver matrix and its magnetic shielding, hermalcycle and time aging properties (United States)

    Fei, X.; He, W. S.; Havenhill, A.; Ying, Z. Q.; Xin, Y.; Alzayed, N.; Wong, K. K.; Guo, Y.; Reichle, D.; Lucas, M. S. P.


    Superconducting Tl2Ba2Ca2Cu3O10 (Tl2223) was ground to powder. Mixture with silver powder (0-80% weight) and press to desired shape. After proper annealing, one can get good silver-content Tl2223 bulk superconductor. It is time-stable and has good superconducting property as same as pure Tl2223. It also has better mechanical property and far better thermal cycle property than pure Tl2223.

  14. Identification of advanced coronary artery disease with exercise myocardial perfusion imaging: the clinical value of a novel approach for assessing lung thallium-201 uptake

    Energy Technology Data Exchange (ETDEWEB)

    Moralidis, Efstratios [Hippokration Hospital, Nuclear Medicine Department, Thessaloniki (Greece); Hippokration Medical Center, Larissa (Greece); Spyridonidis, Tryfon [Hippokration Medical Center, Larissa (Greece); Arsos, Georgios [Hippokration Hospital, Nuclear Medicine Department, Thessaloniki (Greece); Anagnostopoulos, Constantinos [Royal Brompton Hospital, Nuclear Medicine Department, London (United Kingdom)


    The precise clinical utility of lung{sup 201}Tl uptake in exercise SPECT myocardial perfusion imaging remains open to research. This study validates an optimal index for lung{sup 201}Tl uptake measurement and assesses its value in the prediction of higher-risk coronary artery disease (CAD). Three hundred and ninety-eight patients underwent exercise SPECT myocardial perfusion imaging. They were separated into derivation (n = 217) and validation (n = 186) groups, both including sub-populations of lower- and higher-risk CAD, according to coronary angiography. Another 56 individuals with a low probability of CAD comprised the control group. From a planar, anterior, post-exercise acquisition, the lung (L) to heart (H) maximal (L/H{sub max}), total (L/H{sub mean}) and background-subtracted total (L/H{sub net}) ratios were calculated. These were also adjusted for confounding variables, as assessed from the control group. ROC analysis was used to compare the L/H ratios and define thresholds of abnormality. The performance of the optimal index was assessed in the derivation group and was then tested in the validation population. Subsequently, it was compared with other scintigraphic, exercise electrocardiography and clinical variables. In the derivation group L/H{sub net} was a better discriminator for higher-risk CAD than both L/H{sub max} and L/H{sub mean}. Similarly, the adjusted L/H{sub net} was a better discriminator than both the adjusted L/H{sub max} and the adjusted L/H{sub mean}. No significant difference was attained between L/H{sub net} and the adjusted L/H{sub net}. At the upper defined threshold of abnormality, sensitivity and specificity of L/H{sub net} in the detection of higher-risk CAD in the derivation and the validation cohorts were 52% and 92% versus 47% and 94%, respectively (p = ns). The results were similar at other defined thresholds. Moreover, L/H{sub net} was found to be a significant predictor of higher-risk CAD, superior to myocardial perfusion images, transient ventricular dilation measurements, and clinical and exercise testing variables (ROC analysis and logistic regression). By raising the threshold of abnormality of L/H{sub net}, specificity and positive predictive value increased, whereas sensitivity and negative predictive value decreased. Lung{sup 201}Tl assessment assists substantially in the identification of higher-risk CAD in exercise SPECT myocardial perfusion imaging and this is best achieved by L/H{sub net}. This index is a significant predictor of higher-risk CAD, superior to myocardial perfusion images, and its value is associated with the probability of a disease state. (orig.)

  15. Subcutaneous injection of thallium-201 chloride and gallium-67 citrate at acupuncture point K-3; An animal experiment and human-being study

    Energy Technology Data Exchange (ETDEWEB)

    Johg, Shiang-Bin; Wu, Chung-Chieng; Chen, Ming-Feng; Wu, Sheng-Nan (Kaohsiung Medical Coll., Taiwan (China))


    Subcutaneous (SC) injection of [sup 99m]Tc pertechnetate ([sup 99m]Tc) at acupuncture points K-3 is a new method of lower-limb radionuclide venography. To investigate the mechanism of absorption of [sup 99m]Tc from SC injected sites into vascular system, various radioisotopes such as [sup 201]Tl chloride ([sup 201]Tl) and [sup 67]Ga citrate ([sup 67]Ga) were SC injected at K-3 points in animal and human-beings experiments. It was found that [sup 99m]Tc and [sup 201]Tl were absorbed rapidly from K-3 points through venous system and into whole body soft tissue. However, [sup 67]Ga with a larger effective ionic radius than [sup 201]Tl was not absorbed throughout the observation of 5 minutes. Furthermore, intravenous administration of digitalis, a Na[sup +]-K[sup +] pump blocker, did not inhibit the absorption of [sup 99m]Tc and [sup 201]Tl after SC injection at K-3 points. These results suggest that absorption of radionuclides on SC injection at K-3 points is mainly through the passive pathway of diffusion rather than the active transport, and the effective ionic radius may be a major factor influencing the absorption rate of the radionuclides. (author).

  16. Interaction of the thallium cation with 1,3-alternate-25,27-bis(1-octyloxy)calix[4]arene-crown-6: Experimental and theoretical study (United States)

    Makrlík, Emanuel; Dybal, Jiří; Vaňura, Petr


    From extraction experiments and γ-activity measurements, the extraction constant corresponding to the equilibrium Tl+ (aq) + 1·Cs+ (nb) ⇔ 1·Tl+ (nb) + Cs+ (aq) taking place in the two-phase water-nitrobenzene system (1 = 1,3-alternate-25,27-bis(1-octyloxy)calix[4]arene-crown-6; aq = aqueous phase, nb = nitrobenzene phase) was evaluated as log Kex (Tl+, 1·Cs+) = -2.1 ± 0.1. Further, the stability constant of the 1·Tl+ complex in nitrobenzene saturated with water was calculated for a temperature of 25 °C: log βnb(1·Tl+) = 11.6 ± 0.2. Finally, by using quantum mechanical DFT calculations, the most probable structures A and B of the cationic complex species 1·Tl+, which are obviously in a dynamic equilibrium, were indicated. In both of these structures of the resulting 1·Tl+ complex, the "central" cation Tl+ is bound by eight strong bond interactions to six oxygen atoms from the 18-crown-6 moiety and to two carbons of the respective two benzene rings of the parent ligand 1 via cation-π interaction.

  17. Calix[4]arene-(2,3-naphthylene-crown-6,crown-6) as an extraordinarily efficient macrocyclic receptor for the univalent thallium cation (United States)

    Makrlík, Emanuel; Böhm, Stanislav; Kvíčalová, Magdalena; Vaňura, Petr; Asfari, Zouhair


    On the basis of extraction experiments and γ-activity measurements, the extraction constant corresponding to the equilibrium Tl+ (aq) + 1.Cs+ (nb) ? 1.Tl+ (nb) + Cs+ (aq) taking place in the two-phase water-nitrobenzene system (1 = calix[4]arene-(2,3-naphthylene-crown-6,crown-6); aq = aqueous phase, nb = nitrobenzene phase) was determined as log Kex(Tl+,1.Cs+) = 0.3 ± 0.1. Further, the extremely high stability constant of the 1.Tl+ complex in nitrobenzene saturated with water was calculated for a temperature of 25 °C: log βnb(1.Tl+) = 10.0 ± 0.2. Finally, applying quantum mechanical calculations, the most probable structure of the cationic complex species 1.Tl+ was derived. In the resulting complex, the 'central' cation Tl+ is bound by eight strong bonds to six oxygen atoms of the crown-6 moiety and to two carbons from the respective two benzene rings of the parent ligand 1 via cation-π interaction. The interaction energy, E(int), of the considered 1.Tl+ complex was found to be -305.7 kJ/mol, also confirming the formation of this cationic species.

  18. A new method of detecting subendocardial ischemia in patients with aortic valvular stenosis without coronary artery disease using thallium-201 single photon emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    Umamoto, Ikuo; Sugihara, Hiroki; Harada, Yoshiaki (Kyoto Prefectural Univ. of Medicine (Japan)) (and others)


    The purpose of this study was to detect myocardial ischemia in aortic valvular stenosis (AVS) without coronary artery disease by using exercise Tl-201 SPECT. The subjects were 18 AVS patients. Twenty other patients were served as controls. Transient 'left ventricular subendocardial dilation and decreased wall thickness', obtained on early SPECT images, were quantitatively determined by transient dilation index (TDI). Washout rates (WR) were calculated from overlapping early and delayed images to obtain WR map. According to TDI, 18 AVS patients were classified as having TDI[<=]1.11 (Group A, n=9) and TDI>1.11 (Group B, n=9). WR map in Group B presented the direction from the pericardial toward the endocardial side, revealing a pattern of decreased WR and a decreased coronary flow reserve on the endocardial side. Both pressure gradient between the aorta and left ventricle and left ventricular wall thickness were significantly greater in Group B than Group A. In 3 patients in Group B, TDI returned to normal and WR map became homogeneous after aortic valve replacement. In addition, fibrosis was noted in the endocardial site on biopsy. In AVS associated with great pressure gradient, endocardial ischemia may occur on exercise, resulting from a decreased coronary flow reserve, and a decreased compliance due to fibrosis and hypertrophy. Exercise Tl-201 myocardial SPECT is capable of detecting distribution patterns of subendocardial ischemia and coronary flow reserve in AVS. (N.K.).

  19. Exercise {beta}-methyl iodophenyl pentadecanoic acid (BMIPP) and resting thallium delayed single photon emission computed tomography (SPECT) in the assessment of ischemia and viability

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Takao; Hayakawa, Masanori; Hattori, Kaoru; Awano, Koujirou; Masuda, Jun; Inatome, Tetsuya; Fukuzaki, Hisashi [Miki City Hospital, Hyogo (Japan)


    To clarify the significance of exercise BMIPP and resting Tl delayed SPECT in the assessment of ischemia and viability, we studied maximal exercise-loading BMIPP SPECT following rest-injected Tl 3h SPECT in 11 control subjects, 20 with effort angina and 38 with old myocardial infarction. BMIPP and Tl uptake were scored as 0=normal, 1=reduced, 2=severely reduced, or 3=absent. Discordance was defined as when segments with a reduced BMIPP uptake had a better resting Tl uptake. Significant coronary artery stenosis was defined as stenosis of 75% or greater on coronary arteriogram. Left ventricular wall motion was assessed as either normokinesis, hypokinesis, severe hypokinesis, akinesis or dyskinesis on left ventriculogram. When discordance was considered to be a marker of ischemia, the sensitivity and specificity in effort angina and control subjects were 95.2% and 84.6% for patients and 83.9% and 94.4% for disease vessels, respectively. There were no differences between the sensitivity and specificity in left anterior descending artery (LAD), left circumflex artery (LCx) and right coronary artery (RCA) lesions (83.3%, 95.5% in LAD, 83.3%, 95.5% in LCx, 85.7%, 92.6% in RCA, respectively). All of the patients with old myocardial infarction had reduced exercise BMIPP uptake in infarcted regions. In old myocardial infarction, 35 patients had segments with discordant uptake. Discordance was observed in 75 (91.5%) of 82 segments with hypokinesis, and in 24 (92.3%) of 26 segments with severe hypokinesis. Even among the 36 segments with akinesis or dyskinesis, 25 (69.0%) had discordant uptake. When discordance in the infarcted region was considered to be a marker of viability, regions with severe asynergy showed a high possibility of viability. Thus, discordant uptake on exercise BMIPP and resting Tl delayed SPECT may be a useful marker of ischemia in effort angina and of viability in old myocardial infarction. (author).

  20. Leg {sup 201}Tl-SPECT in chronic exertional compartment syndrome; Tomoscintigraphie des jambes au thallium 201 dans le diagnostic du syndrome de loge chronique

    Energy Technology Data Exchange (ETDEWEB)

    Elkadri, N.; Slim, I.; Blondet, C.; Choquet, Ph.; Constantinesco, A. [Hopital Hautepierre, Service de Biophysique et Medecine Nucleaire, 67 - Strasbourg (France); Lecocq, J. [Hopital Hautepierre, Service de Medecine Physique et Readaptation, 67 - Strasbourg (France)


    Leg {sup 201}Tl-SPECT in chronic exertional compartment syndrome Background: The chronic exertional compartment syndrome is one of the most frequent origins regarding leg pain due to sport training. The diagnosis can be established by invasive compartment pressure measurement. The aim of this study is to evaluate the role that could have {sup 201}Tl-SPECT for patients with suspicion of compartment syndrome. Patients and methods: 51 leg {sup 201}Tl-SPECT exams were performed (exercise - and rest without reinjection) in 49 patients; 28 had compartment syndrome confirmed by pressure measurement. About 100 MBq of {sup 201}Tl were injected during exercise, when pain appeared or at least after 25 minutes exercise. We studied mean percentages of level uptake for each compartment, referred to the maximal uptake of both legs. Results: 47 compartments were concerned by compartment syndrome and 361 compartments were not. Scintigraphic patterns in compartments are reversible ischaemia (45%), uptake stability (36%) or reverse redistribution (19%); these patterns are not linked to compartment syndrome. However, there is a significant difference of rest {sup 201}Tl level uptake between compartments with and without compartment syndrome and a significant correlation between muscular pressure measurement and rest level uptake. Conclusion: {sup 201}Tl-SPECT shows that only ischaemia does not explain compartment syndrome. Moreover, it allows to predict pressure variation during exercise but it does not offer any interest in order to select patients for muscular invasive pressure measurement. (author)

  1. Method of fabricating a (1223) Tl-Ba-Ca-Cu-O superconductor (United States)

    Tkaczyk, John Eric; Lay, Kenneth Wilbur; He, Qing


    A method is disclosed for fabricating a polycrystalline thallium-containing superconductor having high critical current at elevated temperatures and in the presence of a magnetic field. A powder precursor containing compounds other than thallium is compressed on a substrate. Thallium is incorporated in the densified powder precursor at a high temperature in the presence of a partial pressure of a thallium-containing vapor.

  2. Constrictive pericarditis causing a positive TI-201 SPECT stress test for myocardial ischemia

    Energy Technology Data Exchange (ETDEWEB)

    Matthews, R.J.; Lightfoote, J.; Grusd, R.S. (Diagnostic Imaging of Southern California Medical Group, Sherman Oaks (USA))


    A case of constritive pericarditis was demonstrated by a positive thallium SPECT stress test for myocardial ischemia. After pericardiectomy, the repeat thallium stress test was normal. The disappearance of the criteria for a positive test suggests that constrictive pericarditis can cause myocardial ischemia, which can be demonstrated by thallium SPECT stress testing.

  3. Isotopic and chemical evidence for three accretionary magmatic arcs ( 1.79 - 1.42 Ga) in the SW Amazon Craton, Mato Grosso State, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Geraldes, Mauro Cesar; Teixeira, Wilson [Sao Paulo Univ., SP (Brazil). Inst. de Geociencias; Schmus, William Randall van [Kansas Univ., Lawrence, KS (United States). Dept. of Geology


    Twenty-one U/Pb ages of granitoids in the SW Amazon craton define three crustal accretionary events during the Paleo-and Mesoproterozoic that represent significant portions of the Rio Negro-Juruena Province and the Rondonian/San Ignacio province. Two events refer to the Rio Negro-Juruena province: The Alto Jauru greenstone belt comprises acid volcanics and tonalite to granite gneisses with U/Pb ages from 1790 to 1750 Ma. Sm/Nd isotopic data (e{sub N}-d{sub (t)} from +2.6 to +2.2 and T{sub DM} from 2.0 to 1.80 Ga) indicate a volcanic arc with juvenile signatures for these units. The second event (Cachoeirinha arc) comprises granites to tonalites with U/Pb ages from 1580 to 1530 Ma. Sm/Nd results. (author)

  4. Multibeam collection for KN179L04: Multibeam data collected aboard Knorr from 2004-09-14 to 2004-09-18, Reykjavik, Iceland to Nuuk (Godthab), Greenland (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  5. Multibeam collection for KN179L03: Multibeam data collected aboard Knorr from 2004-08-29 to 2004-09-11, Bergen, Norway to Reykjavik, Iceland (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...

  6. Serum BDNF concentrations as peripheral manifestations of depression : evidence from a systematic review and meta-analyses on 179 associations (N=9484)

    NARCIS (Netherlands)

    Molendijk, M. L.; Spinhoven, P.; Polak, M.; Bus, B. A. A.; Penninx, B. W. J. H.; Elzinga, B. M.

    Meta-analyses, published in 2008-2010, have confirmed abnormally low serum brain-derived neurotrophic factor (BDNF) concentrations in depressed patients and normalization of this by antidepressant treatment. These findings are believed to reflect peripheral manifestations of the neurotrophin

  7. Readers as overhearers and texts as objects: joint attention in reading communities DOI - 10.5752/P.2358-3428.2014v18n34p179

    Directory of Open Access Journals (Sweden)

    Vera Tobin


    Full Text Available Models of language that emphasize the interactive dimension of meaning construction tend to talk about published texts such as the novel as an arena of language use in which writers and readers occupy the positions of speaker and addressee. This paper argues that readers of published texts function in many ways more like overhearers than addressees. It uses tools from Conversation Analysis and Mental Spaces Theory to examine several case study interactions, drawn from the Michigan Corpus of Spoken Academic English and videotaped data from gesture research, as well as illustrative examples from literary history. The overhearer model that emerges suggests that the interactions between different readers of the same text are a more important locus of collaboration in literary discourse than is typically assumed, and shows that joint activities between readers also often exclude authors in interesting and important ways.Keywords: Interaction. Literature. Overhearers. Addressees. Joint attention. Mental spaces

  8. A Sense of History: A Reference Guide to Alaska's Women 1896-1985. Alaska Historical Commission Studies in History No. 179. (United States)

    Graham, Roberta

    This reference guide catalogs over 700 citations of written material, films, recordings, and photographs about Alaska women from 1896 to 1985. Each entry contains author, title, periodical citation or source, and a brief description. Major subject areas include adventure, agriculture, anthropology, art and music, aviation, churches and missions,…

  9. Body mass index at adolescence and risk of noncardia gastric cancer in a cohort of 1.79 million men and women. (United States)

    Levi, Zohar; Kark, Jeremy D; Twig, Gilad; Katz, Lior; Leiba, Adi; Derazne, Estela; Tzur, Dorit; Liphshitz, Irena; Keinan-Boker, Lital; Afek, Arnon


    This study assessed adolescent predictors of noncardia gastric cancer (NCGC) with a focus on the body mass index (BMI) in late adolescence. This study analyzed a cohort of 1,087,358 Israeli Jewish males and 707,212 Israeli Jewish females who underwent a compulsory physical examination between the ages of 16 and 19 years from 1967 to 2002. By linkage to the national cancer registry, participants were followed for NCGC through December 31, 2012. With a median follow-up of 23 years, 515 NCGC cases occurred (379 men and 136 women), and the median age was 47.0 years (interquartile range, 39.3-53.4 years). Multivariate-adjusted Cox regression was used to estimate hazard ratios (HRs) for NCGC according to the US Centers for Disease Control and Prevention BMI percentiles at the baseline (normal weight, 5th to obesity, ≥95th percentile) as well as the country of birth, residential socioeconomic status (SES), and education. In comparison with normal weight, adolescent obesity, but not overweight, was associated in both men and women with the risk of subsequent NCGC (unadjusted HR, 1.95; 95% confidence interval [CI], 1.25-3.06; adjusted HR, 1.78; 95% CI, 1.12-2.83). Immigration from the former Soviet Union (FSU), a low education level, and a low residential SES were also associated with the risk for NCGC with adjusted HRs of 2.67 (95% CI, 1.86-3.83), 1.85 (95% CI, 1.53-2.25), and 1.48 (95% CI, 1.13-1.93), respectively. The findings suggest that adolescent obesity, but not overweight, is associated with an increased risk for NCGC. Immigration from the FSU, a low residential SES, and a low education level are also significantly associated with the risk for NCGC. Cancer 2017. © 2017 American Cancer Society. © 2017 American Cancer Society.

  10. Corrigendum to ;Dynamics of epidemic spreading with vaccination: Impact of social pressure and engagement; [Physica A 467 (2017) 167-179 (United States)

    Pires, Marcelo A.; Crokidakis, Nuno


    The authors regret to inform that there are two misprints in the axis of Fig. 3 of the paper. In Fig. 3(c), the correct identification of the x-axis is γ (gamma) instead of λ (lambda), and in Fig. 3(d), the correct identification of the y-axis is γ (gamma) instead of λ (lambda). These modifications do not affect the results of the paper, as well as the discussion made in the text.

  11. Sam Thompson, Stewart Parker, and the lineage of northern Irish dramaDOI:10.5007/2175-8026.2010n58p179

    Directory of Open Access Journals (Sweden)

    Marilynn Richtarik


    Full Text Available Northern Irish dramatist Stewart Parker (1941-1988 wrote plays typically valued for their wit, intellectual content, and formal experimentation. Nonetheless, he was profoundly influenced as a young man by a very different sort of playwright. Sam Thompson (1916-1965, who began his working life in the Belfast shipyards, squarely confronted Northern Irish sectarianism in his plays. His sense of the political potential of drama left an enduring mark on Parker, who organized and edited Thompson's manuscripts several years after his untimely death. Although their dramatic writings bear little resemblance to each other, the two writers should be regarded as united in a common Northern Irish dramatic tradition by virtue of their shared socialist outlook, belief in the importance of individual stands against conformity, and sense of theatre's social mission.

  12. Effect of long-term cholesterol-lowering treatment with HMG-CoA reductase inhibitor (Simvastatin) of myocardial perfusion evaluated by thallium-201 single photon emission computed tomography

    Energy Technology Data Exchange (ETDEWEB)

    Hosokawa, Ryohei; Nohara, Ryuji; Linxue, Li; Sasayama, Shigetake [Kyoto Univ. (Japan). Graduate School of Medicine; Tamaki, Shunichi; Hashimoto, Tetsuo; Tanaka, Masahiro; Miki, Shinji


    Fifteen patients with either angina pectoris or old myocardial infarction, who had positive {sup 201}Tl single photon emission computed tomography (SPECT) imaging and coronary sclerosis of more than 50%, were treated with an HMG-CoA reductase inhibitor (simvastatin) for more than 1 year. They were compared with an untreated control group (n=25). Total cholesterol decreased 22% and high-density lipoprotein (HDL) increased 9% with simvastatin; both changes were significantly different from those in controls. Long-term simvastatin induced improvement of myocardial perfusion on {sup 201}Tl SPECT images both during exercise and at rest, which was also significantly different from controls. In addition, the improvement of myocardial perfusion on {sup 201}Tl SPECT images was clearly related to the improvements in cholesterol values, especially nonHDL cholesterol. Thus, the greater the decrease in nonHDL cholesterol, the greater the improvement in myocardial perfusion at rest or during exercise with long-term treatment using an HMG-CoA reductase inhibitor. These findings indicate that the improvements in cholesterol values caused by HMG-CoA reductase inhibitor therapy are related to improvements of myocardial perfusion seen on {sup 201}Tl SPECT images. (author)

  13. Improvement of critical current density in thallium-based (Tl,Bi)Sr{sub 1.6}Ba{sub 0.4}Ca{sub 2}Cu{sub 3}O{sub x} superconductors

    Energy Technology Data Exchange (ETDEWEB)

    Ren, Z.F.; Wang, C.A.; Wang, J.H. [State Univ. of New York at Buffalo, Amherst, NY (United States)] [and others


    Epitaxial (Tl,Bi)Sr{sub 1.6}Ba{sub 0.4}Ca{sub 2}Cu{sub 3}O{sub x} (Tl,Bi)-1223 thin films on (100) single crystal LaAlO{sub 3} substrates were synthesized by a two-step procedure. Phase development, microstructure, and relationships between film and substrate were studied by X-ray diffraction (XRD), scanning electron microscopy (SEM), and transmission electron microscopy (TEM). Resistance versus temperature, zero-field-cooled and field-cooled magnetization, and transport critical current density (J{sub c}) were measured. The zero-resistance temperature was 105-111 K. J{sub c} at 77 K and zero field was > 2 x 10{sup 6} A/cm{sup 2}. The films exhibited good flux pinning properties.

  14. Calculation of parity violating effects in the 6/sup 2/P/sub 1/2/-7/sup 2/P/sub 1/2/ forbidden M1 transition in thallium. [E1 amplitude, circular dichroism, parity violation, hyperfine structure

    Energy Technology Data Exchange (ETDEWEB)

    Neuffer, D.B.


    Calculations are presented of the E1 amplitude expected in forbidden M1 transitions of Tl and Cs if parity is violated in the neutral weak e-N interaction, as proposed in a number of gauge models, including that of Weinberg and Salam. Valence electron wave functions are generated as numerical solutions to the Dirac equation in a modified Tietz central potential. These wave functions are used to calculate allowed E1 transition rates, hfs splittings, and Stark E1 transition ampitudes. These results are compared with experiment and the agreement is generally good. The relativistic Tl 6/sup 2/P/sub 1/2/-7/sup 2/P/sub 1/2/ M1 transition amplitude M is also calculated, and corrections due to interconfiguration interaction, Breit interaction, and hfs mixing are included. The parity violating E1 amplitude E/sub PV/ is calculated and a value for the circular dichroism in the Weinberg model delta = -2.6 x 10/sup -3/ is obtained. Parity violating effects in other Tl transitions are discussed. Contributions to the M1 amplitude for the forbidden Cs 6/sup 2/S/sub 1/2/-7/sup 2/S/sub 1/2/ and 6/sup 2/S/sub 1/2/-8/sup 2/S/sub 1/2/ transitions and to the Cs 6/sup 2/S/sub 1/2/ g-factor anomaly from relativistic effects, Breit interaction, interconfiguration interaction, and hfs mixing are calculated, and it is found that this current theoretical description is not entirely adequate. The parity violating E1 amplitude E/sub PV/ for the 6S/sub 1/2/-7/sup 2/S/sub 1/2/ and 6S/sub 1/2/-8/sup 2/S/sub 1/2/ transitions is evaluated. With a measured value M/sub expt/ and the Weinberg value Q/sub W/ = -99, a circular dichroism delta = 1.64 x 10/sup -4/ for the 6/sup 2/S/sub 1/2/-7/sup 2/S/sub 1/2/ transition is found.

  15. The crystal structure of Gabrielite, Tl2AgCu2As3S7, a new species of Thallium Sulfosalt from Lengenbach, Switzerland

    DEFF Research Database (Denmark)

    Balic-Zunic, Tonci; Makovicky, Emil; Karanovic, Ljiljana


    ), 2.520(60)(2 3), and 2.978(60)(324). Gabrielite is opaque with a grey to black color, metallic luster and blackish red streak. Individual crystals reach up to approximately 0.4 mm, and aggregates may exceed 1 mm across. Euhedral crystals are short prismatic to platy parallel to (001), with excellent......5.95(Ag2.56Cu6.46) 9.02(As8.23Sb0.48) 8.71S21, was derived. The simplified formula is Tl2AgCu2As3S7. The calculated density Dcalc is 5.38 g/cm3. In reflected light, gabrielite is white, has common red internal reflections, shows weak anisotropy and moderate reflectivity [%Rmax in air (COM...

  16. Contribution à l'étude du système quaternaire argent-mercure-thallium-tellure: Étude de la coupe AgTlTeHgTe (United States)

    Gardes, B.; Ayral-Marin, R. M.; Brun, G.; Tedenac, J. C.


    The AgTlTeHgTe system has been studied by DTA and X-ray diffraction techniques. The diagram is characterized by an intermediate phase Ag 3HgTl 3Te 4 (or Ag 0.27Hg 0.09Tl 0.27Te 0.36) with 25 mol% HgTe and a high-temperature phase for T > 597 K in the range from 30 to 60 mol% HgTe. Electric measurements have been carried out for Ag 3HgTl 3Te 4.

  17. Nuclear stress test (United States)

    ... Persantine stress test; Thallium stress test; Stress test - nuclear; Adenosine stress test; Regadenoson stress test; CAD - nuclear stress; Coronary artery disease - nuclear stress; Angina - nuclear ...

  18. Clinical usefulness of myocardial scintigraphy for diagnosis of ischemic heart disease

    Energy Technology Data Exchange (ETDEWEB)

    Tsuji, Sotoyuki; Murakami, Eiji; Takekoshi, Noboru (Kanazawa Medical Univ. (Japan))


    Methods for noninvasive diagnosis an evaluation of coronary artery disease have been dramatically advanced by the development of myocardial scintigraphy. In this paper, 225 patients with coronary artery disease were studied with the following results: (1) With the use of 99mTc-PYP acute myocardial infarction areas were successfully detected in 80 % of the patients. (2) In the detection of myocardial infarction coincidence of the location of scan site defined by electrocardiogram with that of thallium defect at rest was 72 %. Coincidence of the area of dyssynergy in left ventriculogram with the site of thallium defect was 79 %. (3) The sensitivity of thallium-201 myocardial scintigram was 54 % and the specificity was 82 % in detecting angina pectoris. In detecting myocardial infarction the sensitivity was 81 % and the specificity was 75 %. In LCX the sensitivity of thallium-201 decreased considerably. (4) The sensitivity and specificity of thallium-201 imaging in detection of coronary artery disease after exercise were 78 % and 63 %, respectively.

  19. 40 CFR Appendix IV to Part 266 - Reference Air Concentrations* (United States)


    ...-36-0 0.3 Barium 7440-39-3 50 Barium Cyanide 542-62-1 50 Bromomethane 74-83-9 0.8 Calcium Cyanide 592... Cyanide (free) 57-12-15 20 Cyanogen 460-19-5 30 Cyanogen Bromide 506-68-3 80 Di-n-butyl Phthalate 84-74-2...) Carbonate 6533-73-9 0.3 Thallium (I) Chloride 7791-12-0 0.3 Thallium (I) Nitrate 10102-45-1 0.5 Thallium...

  20. Translation as a teaching tool to bridge L1 and L2 for adult learners at elementary levels.DOI: 10.5007/2175-7968.2011v1n27p179

    Directory of Open Access Journals (Sweden)

    Natanael Ferreira França Rocha


    Full Text Available Abstract: This paper aims to investigate the extent to which translation is useful in Foreign Language Teaching for adult learners at elementary levels. Although the effectiveness of translation has been questioned, this study presents reasons why a language teacher should resort to this tool.  The research drew on data collected from written translation exercises of elementary learners at a language center in the city of Londrina, Brazil, in 2009. The exercises were analyzed by examining the occurrence and disappearance of errors lesson by lesson. The results demonstrated that the act of translating fosters learning. Keywords: translation, foreign language teaching, adult learners, elementary levels, errors.

  1. Multibeam collection for KN179L02: Multibeam data collected aboard Knorr from 2004-08-18 to 2004-08-26, departing from St. John's, Newfoundland and returning to Bergen, Norway (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set is part of a larger set of data called the Multibeam Bathymetry Database (MBBDB) where other similar data can be found at...


    Directory of Open Access Journals (Sweden)

    Marilu León-Andrade


    Full Text Available Recently some regions in Mexico have been incorporated into international migration dynamic; however, the main objective in this paper is determined if young people are interested in international migration or continue to study, in a region which has been reached by the international migration process. Due to, we apply techniques like the pool and direct and personal interviews on a sample of farming high school students and residents of Cuacnopalan locality, in Palmar de Bravo municipality, Puebla. The results show that the main expectation is continue to study, for the half of the sample, in the short term; nevertheless, migration represents the only one option for young people in this rural space, because study is out of their reach and the few jobs in this kind of places don’t permit make a way of living.



    Marilu León-Andrade; Alejandro Ortega-Hernández; Benito Ramírez-Valverde; Rocío Rosas-Vargas; Benito Rodríguez-Haros


    Recently some regions in Mexico have been incorporated into international migration dynamic; however, the main objective in this paper is determined if young people are interested in international migration or continue to study, in a region which has been reached by the international migration process. Due to, we apply techniques like the pool and direct and personal interviews on a sample of farming high school students and residents of Cuacnopalan locality, in Palmar de Bravo municipality, ...

  4. Detecting asymptomatic coronary artery disease using routine ...

    African Journals Online (AJOL)


    monitored stress testing may result in a greater sensitivity and specificity being achieved. A study was undertaken to determine whether the addition of thallium imaging to conventional exercise stress testing holds any benefits in ...

  5. Movement - uncoordinated (United States)

    ... sclerosis (MS) Stroke or transient ischemic attack (TIA) Poisoning or toxic effects caused by: Alcohol Certain medicines Heavy metals such as mercury, thallium, and lead Solvents such as toluene or ...

  6. Spin-rotor Interpretation of Identical Bands and Quantized Alignment in Superdeformed A $\\approx$ 190 Nuclei


    Cizewski, J. A.; Bijker, R.


    The ``identical'' bands in superdeformed mercury, thallium, and lead nuclei are interpreted as examples of orbital angular momentum rotors with the weak spin-orbit coupling of pseudo-$SU(3)$ symmetries and supersymmetries.

  7. Drug: D02402 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D02402 Drug Thallium (201Tl) chloride injection (JP16); Thallous chloride Tl 201 (U...rugs 4300 Radioactive drugs D02402 Thallium (201Tl) chloride injection (JP16); Thallous chloride Tl 201 (USP...iopharmaceuticals V09GX01 Thallium (201Tl) chloride D02402 Thallium (201Tl) chloride injection (JP16); Thallous chloride Tl 201 (USP) CAS: 55172-29-7 PubChem: 7849460 ATOM 2 1 Z Tl 23.7341 -17.9308 #+ 2 X Cl 26.1441 -17.9308 #- BOND 0 InChI=1S/ClH.Tl/h1H;/q;+1/p-1/i;1-3 ...

  8. Myocardial imaging artifacts caused by mitral valve annulus calcification

    Energy Technology Data Exchange (ETDEWEB)

    Wagoner, L.E.; Movahed, A.; Reeves, W.C. (East Carolina Univ. School of Medicine, Greenville, NC (USA))


    Knowledge of imaging artifact of myocardial perfusion studies with thallium-201 is critical for improving the diagnostic accuracy of coronary artery disease. Three patients are described who underwent exercise or pharmacologic stress thallium-201 imaging studies and had a moderate, fixed myocardial perfusion defect (scar) involving the posterolateral and inferoposterior walls of the left ventricle. This was an imaging artifact caused by a heavily calcified mitral valve annulus.

  9. A highly efficient luminescent Pt2Tl2 chain with a short Tl(I)-Tl(I) interaction. (United States)

    Jamali, Sirous; Ashtiani, Mona M; Jamshidi, Zahra; Lalinde, Elena; Moreno, M Teresa; Samouei, Hamidreza; Escudero-Adán, Eduardo; Benet-Buchholz, Jordi


    The preparation of an unsupported tetranuclear cluster with a linear Pt(0)-Tl(I)-Tl(I)-Pt(0) metal chain is described. The complex shows strong red emission in the solid state, having a quantum yield of 73%. Density functional theory (DFT) and time-dependent DFT calculations show that red emission originated from a platinum to thallium-thallium charge-transfer excited state.

  10. Radio-adaptive Response in Myocardial Perfusion Imaging Induced by Technetium-99m. (United States)

    Shirazi, Mohammad Mehdi; Shabestani-Monfared, Ali; Shahidi, Maryam; Amiri, Mehrangiz; Abedi, Seyed Mohammad; Borzoueisileh, Sajad; Gorji, Kourosh Ebrahim Nejad


    Low dose radiation will induce adaptation and following exposure to an adaptive dose, the cells are more resistance to following challenging doses. This phenomenon is known as radio-adaptive response. The aim of this study was to investigate the percentage of apoptotic cells in the peripheral blood samples of the patients which undergo myocardial perfusion imaging (MPI) with technetium-99m (Tc-99m) before thallium scan to assess the induction of radio-adaptive response. In this study, 97 samples from 74 patients, referred to nuclear medicine center of Mazandaran Heart Hospital for MPI, which had no history of diagnostic, therapeutic, occupational, and radioactive exposures during past 2 years, were provided. The participants were classified into four groups including control, patients which were scanned solely with technetium, the patients which examined by thallium and the last group were the patients that examined by technetium followed by thallium. Then 2 ml Peripheral blood samples were obtained, and after 24 h incubating, the samples were studied by neutral comet assay. Statistical analysis was carried out using Student's t-test along with one-way analysis of variance. The mean percentage of apoptotic cells in the exposed groups were higher than the control. Furthermore, among exposed groups, the apoptotic cells in thallium group were more than others and this index was significantly lower in the group which was undergone technetium administration before thallium scan. These findings suggest that exposure to Tc-99m could induce a radio-adaptive response against the exposure of thallium-201.

  11. Infarction and post-infarction; Infarctus et postinfarctus. Diagnostic precoce d`ischemie residuelle par tomoscintigraphie myocardique au thallium couplee a un test a l`adenosine dans l`infarctus du myocarde recent. Facteurs pronostiques apres infarctus du myocarde. Place de la tomoscintigraphie monophonique dans la detection de la viabilite myocardique postinfarctus. Revascularisation myocardique apres infarctus du myocarde

    Energy Technology Data Exchange (ETDEWEB)

    Cadiou, C.; Helias, J.; Trochu, J.N.; Godin, J.F.; Crochet, D. [Hopital Laennec, CHR, 44 - Nantes (France); Citron, B.; Lipiecki, J. [Centre Hospitalier Universitaire G-Montpied, 63 - Clermont-Ferrand (France); Danchin, N.; Angioi, M.; Py, M. [Centre Hospitalier Universitaire, 54 - Nancy (France)


    The poor prognosis of residual ischemia after myocardial necrosis is now well established B. Citron makes a review of factors influencing mortality and morbidity after myocardial necrosis is now well established. B. Citron makes a review of factors influencing mortality and morbidity after myocardial necrosis. C. Cadiou exposes the interest of adenosine stress testing in patients after myocardial necrosis. J. Liepecki details the interest of myocardial scintigraphy in the detection of viability after myocardial necrosis. N. Danchin highlights the prognostic value of myocardial scintigraphy in this condition. (authors). 61 refs.

  12. ORF Alignment: NC_004463 [GENIUS II[Archive

    Lifescience Database Archive (English)


  13. ORF Alignment: NC_006274 [GENIUS II[Archive

    Lifescience Database Archive (English)


  14. The perfusion pattern in coronary artery occlusion: comparison of exercise and adenosine.p6. (United States)

    Iskandrian, A S; Kegel, J; Heo, J; Ogilby, J D; Untereker, W J; Cave, V


    This study compared exercise to adenosine thallium-201 single photon emission computed tomography in detecting occlusion of left anterior descending or right coronary arteries in patients with no previous myocardial infarction. There were 41 patients who underwent adenosine thallium imaging (adenosine infusion at a rate of 140 micrograms/kg/min for 6 min), and 143 patients who underwent exercise thallium imaging. There were more patients with right coronary than left anterior descending coronary artery occlusion. Thus, in the adenosine group, there were 15 patients with left anterior descending artery occlusion, and 26 with right coronary artery occlusion, and in the exercise group, there were 46 patients with left anterior descending artery occlusion, and 97 patients with right coronary artery occlusion. In the adenosine group, the thallium images were abnormal in 41 patients (100%), while in the exercise group, the thallium images were abnormal in 125 patients (87%, P exercise group (P:NS). In patients with isolated single vessel occlusion, the size of the perfusion abnormality was 28 +/- 9% with adenosine, and 21 +/- 12% with exercise (P:NS). Thus, most patients with occlusion of the left anterior descending or right coronary artery have regional perfusion abnormality during stress; the different role of collaterals with each type of stress may explain the higher percentage of abnormal results with adenosine than exercise.

  15. Study of /sup 201/Tl uptake by bone and bone marrow on /sup 201/Tl scintigraphy. With special reference to bone marrow abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Tadashige; Tanaka, Masao; Hirose, Yoshiki; Hirayama, Jiro; Handa, Kenjiro; Nakanishi, Fumiko; Yano, Kesato; Ueda, Hitoshi


    Thallium-201 (Tl-201) uptake in the bone and bone marrow was examined in a total of 93 patients with various diseases. Sternal uptake of Tl-201 was observed when patients had bone marrow abnormality especially associated with hematopoietic disease. It was associated with proliferation of immature cells and of various types of bone marrow cells, especially erythroblastic and plasma cells. Whole-body Tl-201 scanning showed a high uptake (82%) in the sternum, chest, lumbar vertebrae, and pelvis. Thallium-201 was definitively taken up by the sternum in polycythemia (5/41), hemolytic anemia (2/2), iron deficiency anemia (2/2), and multiple myeloma (2/5). For leukemia, Tl-201 uptake was slight or negative. Thallium-201 scanning proved useful in visualizing bone marrow abnormality, although careful interpretation of bone and bone marrow uptake is required. (Namekawa, K).

  16. Myocardial perfusion abnormalities in asymptomatic patients with systemic lupus erythematosus

    Energy Technology Data Exchange (ETDEWEB)

    Hosenpud, J.D.; Montanaro, A.; Hart, M.V.; Haines, J.E.; Specht, H.D.; Bennett, R.M.; Kloster, F.E.


    Accelerated coronary artery disease and myocardial infarction in young patients with systemic lupus erythematosus is well documented; however, the prevalence of coronary involvement is unknown. Accordingly, 26 patients with systemic lupus were selected irrespective of previous cardiac history to undergo exercise thallium-201 cardiac scintigraphy. Segmental perfusion abnormalities were present in 10 of the 26 studies (38.5 percent). Five patients had reversible defects suggesting ischemia, four patients had persistent defects consistent with scar, and one patient had both reversible and persistent defects in two areas. There was no correlation between positive thallium results and duration of disease, amount of corticosteroid treatment, major organ system involvement or age. Only a history of pericarditis appeared to be associated with positive thallium-201 results (p less than 0.05). It is concluded that segmental myocardial perfusion abnormalities are common in patients with systemic lupus erythematosus. Whether this reflects large-vessel coronary disease or small-vessel abnormalities remains to be determined.

  17. Superconductivity Technology Program for electric power systems: Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Marriott, K.B.


    Twenty-seven presentations are included in viewgraph form for the wire development panel, applications development panel, and thallium workshop. Authors and affiliations are: (wire development panel) Kreoger/Christen (ORNL), Malozemoff (American Superconductor Corp.), Blaugher (National Renewable Energy Lab.), Haldar (Intermagnetics), Gray/Lanagan/Eror (ANL), Bickel/Voigt/Roth (Sandia), Tkaczyk (GE), Suenaga (BNL), Willis/Korzekwa/Maley (Los Alamos); (applications development panel) Peterson/Stewart (Los Alamos), Iwasa (BNL), Hull/Nieman (ANL), Murphy/DeGregoria (ORNL), Hazelton (Intermagnetics), Dykhuizen (Sandia); (thallium workshop) Goodrich (NIST), Blaugher (NREL), Roth (Sandia), Holstein (DuPont), Paranthaman (ORNL), and Willis (Los Alamos).

  18. {sup 203,205}Tl NMR Studies of Crystallographically Characterized Thallium Alkoxides. X-Ray Structures of [Tl(OCH{sub 2}CH{sub 3})]4 and [Tl(OAr)]{sub infinity} where OAr = OC{sub 6}H{sub 3}(Me){sub 2}-2,6 and OC{sub 6}H{sub 3}(Pr{sup i}){sub 2}-2,6

    Energy Technology Data Exchange (ETDEWEB)



    [Tl(OCH{sub 2}CH{sub 3})]{sub 4}, (1) was reacted with excess HOR to prepare a series of [Tl(OR)]{sub n} where OR= OCHMe{sub 2} (2, n = 4), OCMe{sub 3} (3, n = 4), OCH{sub 2}CMe{sub 3} (4, n = 4), OC{sub 6}H{sub 3}(Me){sub 2}-2,6 (5, n = {infinity}), and OC{sub 6}H{sub 3}(Pr{sup i}){sub 2}-2,6 (6, n = {infinity}). Single crystal X-ray diffraction was used to determine the structure of compounds ligated by more sterically demanding ligands. Compound 4 was found to adopt a cubane structure, while 5 and 6 formed linear polymeric structures. These compounds were additionally characterized by {sup 203,205}Tl solution and {sup 205}Tl solid state NMR. Compounds 1--4 were found to remain intact in solution while the polymeric species, 5 and 6, appeared to be fluxional. While variations in the solution and solid state structures for the tetrameric [Tl(OR)]{sub 4} and polymeric [Tl(OAr)]{sub {infinity}} may be influenced by the steric hindrance of their respective ligands, the covalency of the species is believed to be more an effect of the parent alcohol acidity.

  19. Corrigendum to "The vapor-phase multi-stage CMD test for characterizing contaminant mass discharge associated with VOC sources in the vadose zone: Application to three sites in different lifecycle stages of SVE operations" [J. Contam. Hydrol. 179 (2015) 55-64 (United States)

    Brusseau, M. L.; Mainhagu, J.; Morrison, C.; Carroll, K. C.


    We have recognized that there may be potential ambiguity in the presentation of the site conditions and discussion for one of the three sites used for the study reported in Brusseau et al. (2015). With this Erratum, we would like to clarify information presented for the Hassayampa Landfill (HASS) site. Please note that the original conclusions reported in the paper regarding the performance of the contaminant mass discharge (CMD) tests themselves are not affected.

  20. A enfermagem nas estratégias de enfrentamento implementadas a pacientes oncológicos em cuidados paliativos: uma revisão integrativa doi: 10.12662/2317-3076jhbs.v3i3.162.p172-179.2015

    Directory of Open Access Journals (Sweden)

    Silvio Eder Dias da Silva


    Full Text Available Introdução: O cuidado paliativo apresenta-se como uma abordagem assistencial que tem como objetivo promover uma melhoria na qualidade de vida dos pacientes e de seus familiares, por meio da prevenção e do alívio do sofrimento por meio de identificação precoce e tratamento da dor e outros agravos físicos e psicológicos. Objetivo: identificar como os estudos de enfermagem vem abordando as estratégias de coping ao paciente em cuidados paliativos oncológicos. Método: Trata-se de uma revisão integrativa. O material selecionado para análise foi extraído nas bases de dados National Library of Medicine (PubMed, Literatura Latino Americana e do Caribe em Ciências da Saúde (LILACS e Cumulative Index to Nursing and Alied Health Literature (CINAHL, segundo os seguintes critérios de inclusão: artigos publicados nos idiomas português, inglês ou espanhol, artigos completos que abordem a temática em questão. Ao final do processo de seleção, foram identificados 18 artigos. Resultados: As estratégias de enfrentamento encontradas foram: realizar mudanças no cotidiano; adotar uma nova rotina de acordo com a necessidade de cuidados; manter a esperança; buscar apoio espiritual; preservar uma boa relação do familiar com o profissional de saúde; reconhecer os aspectos positivos do cuidar; valorizar o tempo restante ao lado do ente querido; praticar constantemente a autorreflexão; aceitar as delimitações do cuidado e dividir os cuidados com a equipe. Conclusão: Coping na enfermagem é recente no Brasil; ela constitui uma ferramenta indispensável para a compreensão dos problemas enfrentados pela terminalidade do câncer entre os estudos aqui analisados.

  1. Aplicação da técnica de relacionamento de banco de dados para a melhoria de informações sobre óbitos maternos infantis no ceará, 2006 - doi:10.5020/18061230.2009.p179

    Directory of Open Access Journals (Sweden)

    Lindélia Sobreira Coriolano


    Full Text Available Objetivo: Avaliar a aplicação da técnica de relacionamento de banco de dados na melhoria de informações sobre óbitos maternos a partir da recuperação as variáveis não preenchidas e/ ou ignoradas de óbitos em menores de um ano infantis no município de Fortaleza em 2006. Métodos: Foi realizado o relacionamento dos bancos de dados dos Sistemas de Informação sobre Mortalidade (SIM e de Nascidos Vivos (SINASC, sendo selecionadas as variáveis comuns aos dois sistemas. Com o uso do software Reclink III foram identificados os pares perfeitos “Declaração de Óbito/Declaração de Nascimento” (DO/DN por meio das variáveis da DO: sexo, raça/cor, peso ao nascer, idade da mãe, idade gestacional, tipo de gravidez, tipo de parto, ocupação da mãe e escolaridade da mãe. Resultados: Foram registrados 40.391 nascidos vivos e 706 óbitos em menores de um ano. Identificou-se 516 (73,1% DO com suas respectivas DN. As variáveis ocupação e escolaridade da mãe passaram de 31,4% e 35,8% para 64,6% e 72,8% de preenchimento, respectivamente. Em relação à idade da mãe o ganho da informação foi de 45,2%. Conclusão: A utilização do aplicativo Reclink III na rotina dos serviços de saúde viabilizou uma grande recuperação de informações que não haviam sido preenchidas na Declaração de Óbito e, consequentemente, poderá promover uma melhor compreensão da mortalidade infantil em populações estudadas.

  2. Novice Academic Librarians Provide Insight into Choosing Their Careers, Graduate School Education, and First Years on the Job. A Review of: Sare, L., Bales, S., & Neville, B. (2012. New academic librarians and their perceptions of the profession. portal: Libraries and the Academy, 12(2, 179-203. doi: 10.1353/pla.2012.0017

    Directory of Open Access Journals (Sweden)

    Carol D. Howe


    Full Text Available Objective – To study the ways in which noviceacademic librarians’ perceptions oflibrarianship develop from the time theydecide to attend library school through theirfirst 6 to 24 months of library work.Design – Grounded theory method utilizingtwo qualitative research techniques: one-onone,face-to-face interviews and documentanalysis.Setting – The libraries of three Texasuniversities, three Texas four-year colleges,and one Texas community college.Subjects – 12 professional academic librarianswho graduated from eight different graduateschools. Participants were 6 to 24 months intotheir professional careers and had little or nopre-professional experience.Methods – The researchers sought participantsthrough mailings, emails, electronic mailinglist postings, and referrals from otherparticipants. They conducted a small pilotstudy with two novice librarians to refine theirresearch methodology. The researchersinterviewed additional participants andanalyzed the interview transcripts untilcategories of interest were identified andsaturated. Saturation occurred at 12participants, not including the pilotparticipants. Each interview was 30-45minutes. The researchers recorded theinterviews and systematically coded thetranscripts using activist imagery. Four of the participants gave the researchers their “statement of purpose” essay that they used when applying for graduate school. These documents were also discussed with participants and analyzed.Main Results – From the data they collected, the researchers identified six categories of interest regarding librarians’ perceptions of librarianship: deciding upon a career, experiencing graduate school, continuing education, defining the work, evaluating the work, and (reimagining the future. In considering librarianship as a career, the participants had not been entirely sure what it entailed, but they utilized what they did know about libraries and librarianship to generally deem the profession solid, safe, and/or noble. They had further explored librarianship to determine its compatibility with their personal characteristics. Such personal reflection had led participants to graduate school where they gained a real understanding of librarianship. The participants had not generally found graduate school to be academically challenging. They had also valued practical over theoretical instruction. Once in the workplace, the participants noted the value of continuing education to strengthen the skills they had learned in graduate school. Participants benefitted the most from informal mentoring and on-the-job training, i.e. “learning by doing” (p. 192. As novice librarians, the participants had learned to feel their way around their job expectations and note the differences between their responsibilities and those of paraprofessionals in the library. As the novice librarians further defined their work, they had also learned that academic librarianship is the sum of many parts, including collaboration with peers. In evaluating their work, the participants noted that they had come to distinguish “real” academic library work, that which uses their expertise and helps society, from “other” work such as clerical work (pp. 195-196. The sixth and final category was “(reimagining the future.” Most of the participants predicted having advanced as academic librarians in the next five years but were otherwise unsure about what their futures would hold.Conclusion – The researchers made a number of valuable observations in their work with novice librarians. As the step of deciding upon a career seemed to be a murky quest, they thought it would be helpful to analyze public opinion of librarianship and use that information to offset misperceptions about what librarians do. This might help those considering librarianship to make informed and conscious decisions.The study data also provided insight into graduate school. The fact that the participants did not consider graduate school to be rigorous concerned the researchers. They feared that librarians entering the field might not deem it a serious profession. Because the participants favored practical over theoretical classes, the researchers thought it important for graduate schools to teach theoretical concepts in a way that is more satisfying to students. They felt that other applied fields, such as nursing, might provide examples of how to do so. The researchers also noted that graduate schools could do more to prepare students for life on the job. As new librarians reported favouring “real” work over “other” work, the researchers felt that students should hear it first in graduate school that all the work librarians do is an important and necessary part of academic librarianship. As most participants were uncertain about what their futures as academic librarians might look like, the researchers thought that graduate school professors should address that issue as well.Data from this study also gave insight into how employers might best serve new librarians. The researchers suggest looking to new teacher induction programs to get ideas for orienting new librarians to the profession. Orientation might include a combination of formal and informal techniques such as peer mentors, peer observation, new librarian training, and new librarian handbooks in the first year of employment.Finally, the researchers proposed ideas for future research. They believe it might be helpful to study experienced academic librarians or new public librarians for comparison to this study.

  3. Second Annual Clinical Diabetes Technology Meeting (United States)


    an ABG "* Check BUN/Cr. Check U/A to look for proteinuria "* Best test for proteinuria is urine microalbumin "* Clinical estimation of left ventricular... 150 -179 1.5 150 -179 2 150 -179 4 150 -179 7 180-209 2 180-209 3 180-209 5 180-209 9 210-239 2 210-239 4 210-239 6 210-239 12 240-269 3 240-269 5 240-269 8...120-149 1.5 120-149 3 120-149 5 150 -179 1.9 150 -179 2 150 -179 4 150 -179 7 180-209 2 180-209 3 180-209 5 180-209 9 210-239 2 210-239 4 210-239 6 210

  4. Gclust Server: 161931 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available HSA_28372507 Cluster Sequences - 179 NP_776258.1 breast cancer and salivary gland expression ; no annotation 1...179 Representative annotation NP_776258.1 breast cancer and salivary gland expression ; no annotation Number

  5. Environmental Risk Limits for Nine Trace Elements

    NARCIS (Netherlands)

    Vlaardingen PLA van; Posthumus R; Posthuma-Doodeman CJAM; SEC


    In this report, we present an update of environmental risk limits (ERLs), based on the literature, for nine trace elements, namely, beryllium (Be), vanadium (V), cobalt (Co), selenium (Se), molybdenum (Mo), tin (Sn), antimony (Sb), barium (Ba) and thallium (Tl). The updated ERLs, established for

  6. Obsahy galia, india a thalia v granitoidech Českého masivu a jejich hlavních horninotvorných minerálech

    Czech Academy of Sciences Publication Activity Database

    Breiter, Karel; Vašinová Galiová, M.; Korbelová, Zuzana; Vaňková, M.; Kanický, V.


    Roč. 2014, č. 1 (2015), s. 79-83 ISSN 0514-8057 R&D Projects: GA ČR GA14-13600S Institutional support: RVO:67985831 Keywords : gallium * indium * thallium * granitoids * rock-forming minerals * Bohemian Massif Subject RIV: DB - Geology ; Mineralogy

  7. Bhattacharyya Swarnapratim see Ghosh Dipak 789 Bichile GK see ...

    Indian Academy of Sciences (India)

    181. Arul Prakash K. A numerical study of the target system of an ADSS with different flow guides 365. Ashraf I M. Characteristics of photoconductivity in thallium monosulfide single crystals 467. Aslam M see Singh P .... A high resolution X-ray crystal spectrom- eter to study electron and heavy-ion im- pact atomic collisions.

  8. DC Polarographic and Plane Polarographic investigation of the ...

    African Journals Online (AJOL)

    The reduction behavior Thallium (I) at DME has been studied by several authors with different equivalent circuits and arrived at varying results. The complexity is due to the rapid reduction process and the adsorption behavior in the mercury solution interface. So, a thorough investigation was carried out on the reduction ...

  9. High temperature superconducting materials

    Energy Technology Data Exchange (ETDEWEB)

    Alario-Franco, M.A. [Universidad Complutense de Madrid (Spain). Facultad de Ciencias Quimicas


    The perovskite structure is the basis of all known high-temperature superconducting materials. Many of the most successful (highest T{sub c}) materials are based on mercury and thallium phases but, due to the high toxicity of the component compounds effort has been invested in the substitution of these elements with silver. Progress is reviewed. (orig.)

  10. Detecting asymptomatic coronary artery disease using routine ...

    African Journals Online (AJOL)


    Sep 1, 1990 ... ECG-monitored exercise testing has been proposed as a relatively inexpensive and effective means of screening for asymptomatic coronary artery disease in patients presenting for peripheral vascular surgery. Despite the fact that exercise thallium scintigraphy is also dependent on the patient's ability.

  11. Detecting asymptomatic coronary artery disease using routine ...

    African Journals Online (AJOL)

    ECG-monitored exercise testing has been proposed as a relatively inexpensive and effective means of screening for asymptomatic coronary artery disease in patients presenting for peripheral vascular surgery. Despite the fact that exercise thallium scintigraphy is also dependent on the patient's ability to exercise, using this ...

  12. Sensitive and rapid detection of Mycoplasma capricolum subsp ...

    African Journals Online (AJOL)



    May 21, 2014 ... with 1.7% lactalbumin hydrolysate, 1% MEM, 20% de- complemented horse serum, 5% fresh yeast extract, 1% thallium acetate, 0.4% sodium pyruvate) in a high security laboratory. The. DNA of Pasteurella multocida and Mannheimia haemolytica was maintained at the State Key Laboratory of Veterinary ...

  13. Cardiology; Cardiologie

    Energy Technology Data Exchange (ETDEWEB)

    Edet-Sanson, A.; Manrique, A.; Hitzel, A.; Vera, P. [Centre Henri Becquerel, 76 - Rouen (France); Kober, F.; Guedj, E.; Quilici, J.; Caus, T.; Mundler, O.; Cozzone, P.J.; Bonnet, J.L.; Bernard, M. [Centre Hospitalier Universitaire de la Timone, 13 - Marseille (France); Daou, D.; Coaguila, C.; Benada, A.; Tawileh, M.; Kaci, N. [Hopital Foch, 92 - Suresnes (France); Vilain, D. [Hopital Lariboisiere AP-HP, 75 - Paris (France); Maskali, F.; Poussier, S.; Boutley, H.; Karcher, G.; Olivier, P.; Py, M. [INSERM U684, Faculte de Medecine de Nancy, 54 (France); Vanhove, C.; Franken, P.R. [AZ-VUB Bruxelles (Belgium); Tran, N.; Groubatch, F. [Centre Hospitalier Universitaire, 54 - Nancy (France)


    Spectrometry by nuclear magnetic resonance of the P31 and myocardium viability in correlation with the rest scintigraphy using thallium 201 is developed here, an imaging technique, the pinhole gated-SPECT allows to predict and quantify an experimental model of coronaries occlusion for the rat and is detailed. (N.C.)

  14. Charged Particle Monitor on the Astrosat Mission

    Indian Academy of Sciences (India)

    A. R. Rao


    Jun 19, 2017 ... Abstract. Charged Particle Monitor (CPM) on-board the Astrosat satellite is an instrument designed to detect the flux of charged particles at the satellite location. A Cesium Iodide Thallium (CsI(Tl)) crystal is used with a Kapton window to detect protons with energies greater than 1 MeV. The ground ...

  15. What is the value of emission tomography studies in patients with a primary glioblastoma multiforme treated by Ir-192 brachytherapy?

    NARCIS (Netherlands)

    Koot, R. W.; Habraken, J. B. A.; Paans, A. M. J.; Bosch, D. A.; Pruim, J.; Hulshof, M.C.C.M.

    Background. We studied the use of (201)Thallium SPECT and L-[1-C-11]-tyrosine PET in patients with a primary glioblastoma multiforme treated with Ir-192 brachytherapy after surgery and external beam radiation therapy. We hypothesised that the patients most likely to benefit from further surgery

  16. PET detection of viable tissue in myocardial segments with persistent defects at T1-201 SPECT

    Energy Technology Data Exchange (ETDEWEB)

    Brunken, R.C.; Kottou, S.; Nienaber, C.A.; Schwaiger, M.; Ratib, O.M.; Phelps, M.E.; Schelbert, H.R.


    To assess myocardial glucose metabolism and perfusion in 142 myocardial segments with defects seen at thallium-201 single photon emission computed tomography (SPECT), 27 studies with positron emission tomography (PET) utilizing nitrogen-13 ammonia and fluorine-18 deoxyglucose were performed in 26 patients. Myocardial infarction was defined on the basis of concordant reductions in segmental perfusion and glucose utilization; myocardial ischemia, on the basis of preservation of glucose utilization (metabolic viability) in segments with hypoperfusion at rest. Of the 142 segments analyzed, 101 had fixed defects, 31 had partially reversible defects, and ten had completely reversible defects. Preserved glucose utilization was identified in 47 (46.5%) of the segments with fixed defects and 20 (64.5%) of the segments with partially reversible defects. Of the ten segments with completely reversible defects, five (50%) were normal, and five (50%) exhibited ischemia at PET. Visual improvement in a persistent thallium defect at delayed imaging was not associated with residual glucose metabolic activity. Thus, PET can be used to detect glucose metabolic activity in a significant proportion of myocardial segments with fixed or partially redistributing defects seen at thallium SPECT, which suggests that the extent of tissue viability in patients with ischemic heart disease is underestimated at thallium scintigraphy.

  17. EDITORIAL POISONING PATTERN Human poisoning with ...

    African Journals Online (AJOL)


    Bioaccumulation of methylmercury then occurred in fish which were eventually eaten by humans. Thallium poisoning is characterized by alopecia often seen one to two weeks later when the patient is about to be discharged from hospital. Thus, in chronic poisoning, it is difficult to establish definitive cause-effect relationship.

  18. Bulletin of the Chemical Society of Ethiopia - Vol 19, No 1 (2005)

    African Journals Online (AJOL)


  19. Extension of magnetic anomaly rule (United States)

    Moskowitz, P. A.


    The Moskowitz-Lombardi rule which has established a relationship for magnetic hyperfine-structure anomalies for ten mercury, Z = 80, isotopes and isomers is extended, in the light of new experimental work, to iridium, gold, and thallium, Z = 77, 79, and 81 respectively

  20. Kinetic Studies of Catalytic Oxidation of Cyclohexene Using ...

    African Journals Online (AJOL)


    70oC in the presence of ruthenium catalyst. N2O was equally reported to effectively oxidize cyclohexene in gaseous phase to cyclohexanone with nearly 100% selectivity. (Avdeev et al, 2003). The kinetics of the reaction by which thallium(III) acetate oxidizes cyclohexene in glacial acetic acid medium at 30°C, was studied ...

  1. Stable angina (United States)

    ... Most occur between 6 a.m. and noon. Exams and Tests Your health care provider will examine you and check your blood pressure. Tests that may be done include: Coronary angiography Blood cholesterol profile ECG Exercise tolerance test (stress test or treadmill test) Nuclear medicine (thallium) stress ...

  2. Variation in Heavy Metal Accumulation and Genetic Diversity at a Regional Scale Among Metallicolous and Non-Metallicolous Populations of the Facultative Metallophyte Biscutella laevigata subsp. laevigata

    NARCIS (Netherlands)

    Pošćić, F.; Fellet, G.; Vischi, M.; Casolo, V.; Schat, H.; Marchiol, L.


    Biscutella laevigata is a facultative metallophyte, with populations on non-metalliferous and metalliferous soils. Some of its metallicolous populations have been shown to hyperaccumulate thallium or lead in nature. Only Tl hyperaccumulation has been experimentally confirmed. We aimed to compare the

  3. Accelerated idioventricular rhythm during flexible fiberoptic bronchoscopy

    Energy Technology Data Exchange (ETDEWEB)

    Borgeat, A.; Chiolero, R.; Mosimann, B.; Freeman, J.


    We report the case of a patient who developed severe hypoxemia and an unusual arrhythmia, accelerated idioventricular rhythm, during flexible fiberoptic bronchoscopy. Coronary artery disease was subsequently suspected despite an unremarkable history and physical examination, and confirmed by a thallium 201 imaging. The appearance of accelerated idioventricular rhythm during fiberoptic bronchoscopy should raise the possibility of underlying coronary artery disease.

  4. aDepartment of Chemist.r__v_. University of Nairobi

    African Journals Online (AJOL)

    complex during electrolysis. The above mechanism differs irorn the mechanism for the demetalation of lead (Tl) phthalocyanine. where the ligand is reduced fast followed by a slow dernetalation process (13). Nor i.s it similar to the ciemetalation rnechanisrn of silver and thallium porphyriris, where the central cation is ...

  5. Assessment of radioactivity concentration in soil of some mining ...

    African Journals Online (AJOL)

    A study was conducted to determine 226Ra, 232Th, and 40K natural activity concentrations in surface soils/sediments of some mining areas in Central Nasarawa State Nigeria, using Sodium Iodide-Thallium Gamma Spectroscopy. Seven major sites were identified from the highly mining areas of the zone and a total of ...

  6. Estudio de la reserva de perfusión miocárdica mediante tomografía de emisión de fotón único con talio-201 y estrés farmacológico con adenosina trifosfato en pacientes con factores de riesgo cardiovascular

    National Research Council Canada - National Science Library

    Huelmos Rodrigo, Ana; Alegría Ezquerra, Eduardo; Martínez Caro, Diego; José García Velloso, María; Ángel Richter Echevarría, José


    ...- nificativamente más bajas en los individuos con factores de riesgo cardiovascular que en los suje- aquellos con enfermedad coronaria, lo que puede sugerir que se encuentran en una etapa precoz de aterosclerosis. STUDY OF MYOCARDIAL PERFUSION RESERVE WITH SINGLE-PHOTON-EMISSION COMPUTED TOMOGRAPHY WITH THALLIUM-201 AND PHARMACOLOGICAL STRESS W...

  7. Gene : CBRC-MDOM-11-0196 [SEVENS

    Lifescience Database Archive (English)


  8. Construction work

    CERN Multimedia


    Construction work on building 179 will start on the 16th February 2004 and continue until November 2004. The road between buildings 179 and 158 will temporarily become a one way street from Route Democrite towards building 7. The parking places between buildings 179 and 7 will become obsolete. The ISOLDE collaboration would like to apologize for any inconveniences.

  9. Development of radiation detection and measurement system - Development of scintillation radiation sensor

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Hee Dong; Kim, Wan [Kyungpook National University, Taegu (Korea); Kim, Do Sung [Taegu University, Taegu (Korea)


    We have been fabricated CsI(Tl) scintillation crystals and plastic scintillators for radiation-based measuring equipment. CsI (Tl) single crystals doped with thallium as an activator were grown using the Czochralski method. The crystal structure of grown CsI(Tl) was bcc, and it was confirmed that its lattice constant was 4,568 A. The spectral range of luminescence of CsI(Tl) was 350 {approx} 700 nm independent of thallium concentration, and the fast component of the luminescence was decreased with increasing thallium concentration. The energy resolution of CsI(Tl) scintillator doped with 0.1 mole% thallium was about 9% for 137 Cs {gamma}-rays. The relation formula of {gamma}-ray energy versus energy resolution was ln(FWHM%)=-0.705ln({epsilon})+6.75. The radiation damage of CsI(Tl) increased in proportion to thallium concentration and radiation damage of CsI(Tl) increased in proportion to thallium concentration and radiation dosage, and the irradiated crystals were colored reddish. The radiation induced absorption bands appeared around 355, 425, 520 and 555 nm, and their energy level were about 3.50, 2.88, 2.39 and 2.21 eV. Plastic scintillators were fabricated thermal polymerization method. Those were polymerizing at 120 deg. C, during 72 hours, and annealing at 75 deg. C, during 24 hours. When the concentration of 1st solute was 1.5 wt% and concentration of 2nd solute was 0.01 wt%, the characteristics of scintillation were very excellent. Also 3.0 wt% tetraphenyl lead were loaded to improve the detection efficiency of {gamma}-ray. The range of emission spectrum was 400 {approx} 450nm, and the central peak was 415 nm. The radiation damage was not appear under 1*10{sup 3}Gy, but the color of plastic scintillator was changed to brown, over 1*10{sup 4}Gy exposured. 84 refs., 39 figs. (Author)

  10. TI-201-imaging as a follow-up method after left ventricular aneurysmectomy

    Energy Technology Data Exchange (ETDEWEB)

    Eichstaedt, H.; Groeber, L.; Feine, U.; Kochsiek, K.


    Thallium myocardial scanning was performed in 30 patients after aneurysma resection of left ventricle. The aim of the study was to try an assertion about the completenes of adaptation of the marginal zones of aneurysma and about the postoperative reduction of left ventricular size. After standardization of size and distance of pictures we suggested quantification of dimensions of left ventricle by counting picture-points using a computer matrix. For that purpose left ventricle had to be deliminated exceptional distinctly from the background. That intention was realized by an interpolating background subtraction. Postoperatively an evident reduction of heart size, especially of ventricle cavity could be proved. Thallium myocardial scanning therefore seems to be suitable for postoperative supervision after aneurysma resection too.

  11. Tomographic myocardial perfusion scintigraphy in children with Kawasaki disease

    Energy Technology Data Exchange (ETDEWEB)

    Spielmann, R.P.; Nienaber, C.A.; Hausdorf, G.; Montz, R.


    Myocardial infarction and stenotic coronary lesions are serious late complications in children with Kawasaki disease. For the noninvasive assessment of myocardial perfusion, dipyridamole-redistribution /sup 201/Tl emission computed tomography (ECT) was performed in seven children (age 2 8/12-8 7/12 yr) 3-20 mo after the acute stage of the disease. In all patients, coronary aneurysms had been demonstrated by cross-sectional echocardiography. The scintigrams of six children showed no significant regional reduction of myocardial thallium uptake. These children had remained asymptomatic since the acute stage of Kawasaki disease. Persistent and transient thallium defects were present in one child with documented myocardial infarction. For this patient, obstruction of corresponding coronary vessels was confirmed by contrast angiography. It is suggested, that /sup 201/Tl ECT after dipyridamole-induced vasodilation may be used as a safe alternative to invasive coronary angiography for follow-up investigations in patients with Kawasaki disease.

  12. In vivo effects of radioactive properties of Tl-201 on human carbonic anhydrase activity (United States)

    Sahin, Ali; Senturk, Murat


    Carbonic anhydrase (CA) is a family of metalloenzymes that requires Zn as a cofactor and catalyze the quick conversion of CO2 to HCO3- and H+. Inhibitors of the carbonic anhydrases (CAs) have medical usage of significant diseases such as glaucoma, epilepsy, gastroduodenal ulcers, acid-base disequilibria and neurological disorders. The most useful radioisotope, Tl-201, decays by electron capture, emitting Hg X-rays ( 70-80 keV), and photons of 135 and 167 keV in 10% total abundance. Therefore, it has good imaging characteristics without excessive patient radiation dose. It is the most popular isotope used for thallium 201 nuclear cardiac stress tests. In the present study, In vivo inhibitory effect of Tl-201 (Thallium-201) on human erythrocyte carbonic anhydrase (CA) activity were investigated.

  13. Department of Defense Report on Search for Human Radiation Experiment Records, 1944 - 1994, Volume 1 (United States)


    size and its relation to tears of the anterior cruciate ligament Treatment of localized non-Hodgkin’s lymphoma: Comparison of chemotherapy (CHOP...NHOAK-028 Radionuclide imaging of chronic anterior cruciate ligament deficient knees 1989 NHOAK-025 Comparison of thallium scintigraphic... postoperative radiation therapy of operable colorectal carcinoma (RTOG 81-15 - SGO 84-028) Randomized phase l/ll study to evaluate twice daily

  14. 2271-IJBCS-Article-Dr Boudié Guel

    African Journals Online (AJOL)


    non acidifié servira à l'analyse des paramètres physico-chimiques au laboratoire dans les heures qui suivent le prélèvement .... Forage sur la route du marché. 663124. 1389698. 5. Forage dit pompe de Daniell. 667573 ..... Les risques liés à cet élément imposent que les eaux avec les fortes teneurs en thallium enregistrées ...

  15. Syntheses, structure and intercalation properties of low-dimensional ...

    Indian Academy of Sciences (India)


    We reported18 the synthesis, characterization and intercalation chemistry of seven new phenylphos- phonates, A(HO3PC6H5)(H2O3PC6H5) (A = alkali metals, NH4 and ... tered, washed with n-hexane and finally air-dried. Similarly intercalates of thallium (1) phenylar- sonate, 1•(CH3(CH2)n–1NH2)x (n = 5, 8 and 16) were.

  16. Distribution et structure des communautés de vers de terre et leur ...

    African Journals Online (AJOL)

    Le thallium, le zinc, le nickel, le plomb et le cuivre sont les principaux polluants qui semblent influencer la survie des communautés des vers de terre. Parmi les espèces de vers collectées, Dichogaster bolaui, Dichogaster sp1, Dichogaster sp2, Millsonia ghanaensis sont négativement influencés par les ETM. Ces résultats ...

  17. 77 FR 21870 - National Oil and Hazardous Substances Pollution Contingency Plan; National Priorities List... (United States)


    ... to placing clean fill over the area. All compounds analyzed for, including PCBs, were at non... was then filled with clean soil, graded, and vegetated. The groundwater monitoring program was agreed... Chromium 0.05 Copper 1.02 Iron 0.3 Lead 1.05 Manganese 0.05 Nickel 13.4 Silver 0.005 Thallium 0.013 Zinc 1...

  18. Annual reports in inorganic and general syntheses 1973

    CERN Document Server

    Niedenzu, Kurt


    Annual Reports in Inorganic and General Syntheses-1973 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book covers the synthetic aspects and structural or mechanistic features of elements, including the main group hydrides, alkali and alkaline earth elements, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, and lead, nitrogen, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens and pseudohalogens, and noble gases. The text also discusses the synthetic aspects and structural or mechanistic features of

  19. Annual reports in inorganic and general syntheses 1974

    CERN Document Server

    Niedenzu, Kurt


    Annual Reports in Inorganic and General Syntheses-1974 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses the chemistry of simple and complex metal hydrides of main groups I, II, and III, boron, aluminium, gallium, indium, thallium, silicon, germanium, tin, lead, phosphorus, arsenic, antimony, bismuth, chalcogens, halogens, and pseudohalogens. The text also describes the chemistry of scandium, yttrium, lanthanides, actinides, titanium, zirconium, hafnium, vanadium, niobium, tantalum, chromium, molybdenum, tungsten, ma

  20. Annual reports in inorganic and general syntheses 1972

    CERN Document Server

    Niedenzu, Kurt


    Annual Reports in Inorganic and General Syntheses-1972 presents an organized annual summary of synthetic developments in inorganic chemistry and its related areas. The book discusses alkali and alkaline earth elements, alloys, silver, gold, zinc, cadmium, mercury, boron, aluminum, gallium, indium, thallium, yttrium, scandium, lanthanides, actinides, titanium, zirconium, hafnium, Group V and VI transition elements, manganese, technetium, rhenium, iron, cobalt, nickel, ruthenium, osmium, rhodium, and iridium. The text also describes the chemistry of palladium, platinum, silicon, germanium, tin,