Hepcidin is suppressed by erythropoiesis in hemoglobin E β-thalassemia and β-thalassemia trait

Science.gov (United States)

Jones, Emma; Pasricha, Sant-Rayn; Allen, Angela; Evans, Patricia; Fisher, Chris A.; Wray, Katherine; Premawardhena, Anuja; Bandara, Dyananda; Perera, Ashok; Webster, Craig; Sturges, Pamela; Olivieri, Nancy F.; St. Pierre, Timothy; Armitage, Andrew E.; Porter, John B.; Weatherall, David J.

2015-01-01

Hemoglobin E (HbE) β-thalassemia is the most common severe thalassemia syndrome across Asia, and millions of people are carriers. Clinical heterogeneity in HbE β-thalassemia is incompletely explained by genotype, and the interaction of phenotypic variation with hepcidin is unknown. The effect of thalassemia carriage on hepcidin is also unknown, but it could be relevant for iron supplementation programs aimed at combating anemia. In 62 of 69 Sri Lankan patients with HbE β-thalassemia with moderate or severe phenotype, hepcidin was suppressed, and overall hepcidin inversely correlated with iron accumulation. On segregating by phenotype, there were no differences in hepcidin, erythropoiesis, or hemoglobin between severe or moderate disease, but multiple linear regression showed that erythropoiesis inversely correlated with hepcidin only in severe phenotypes. In moderate disease, no independent predictors of hepcidin were identifiable; nevertheless, the low hepcidin levels indicate a significant risk for iron overload. In a population survey of Sri Lankan schoolchildren, β-thalassemia (but not HbE) trait was associated with increased erythropoiesis and mildly suppressed hepcidin, suggesting an enhanced propensity to accumulate iron. In summary, the influence of erythropoiesis on hepcidin suppression associates with phenotypic disease variation and pathogenesis in HbE β-thalassemia and indicates that the epidemiology of β-thalassemia trait requires consideration when planning public health iron interventions. PMID:25519750

Thalassemias and hemoglobinopathies in Turkey.

Science.gov (United States)

Canatan, Duran

2014-01-01

Thalassemias and hemoglobinopathies are a serious health problem in Turkey. There is a 70-year history of thalassemia in Turkey. The first patient with β-thalassemia major (β-TM) was reported in 1941. The first clinical and hematological studies were published by Aksoy in 1958. The overall incidence of β-thalassemia (β-thal) was reported by Çavdar and Arcasoy to be 2.1% in 1971. Important steps such as written regulations, education and prevention campaigns, have been taken to prevent thalassemia in Turkey by the Ministry of Health (MOH), the Turkish National Hemoglobinopathy Council (TNHC) and the Thalassemia Federation of Turkey (TFT) since 2000. A national hemoglobinopathy prevention program was started in provinces with a high prevalence by the MOH in 2003. While the percentage of premarital screening test was 30.0% of all couples in 2003, it reached 86.0% in 2013. While the number of newborn with thalassemias and hemoglobinopathies was 272 in 2002, it had dropped to 25 in 2010. There has been a 90.0% reduction of affected births in the last 10 years.

A comparison of heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major.

Science.gov (United States)

Amoozgar, Hamid; Zeighami, Samaneh; Haghpanah, Sezaneh; Karimi, Mehran

2017-01-01

The goal of this study was to compare heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. In this cross-sectional study, 60 patients with beta thalassemia major and 60 patients with beta thalassemia intermedia who had clinically no symptoms of arrhythmia and clinically normal heart function were evaluated using 24-hour ambulatory electrocardiogram monitoring and echocardiography. For data analysis SPSS ver.20 software was used. A P-value of less than 0.05 was considered statistically significant. The mean age of the beta thalassemia intermedia patients was 24.18 ± 7.9 years and the mean age in beta thalassemia major was 24.38 ± 7.7 years (P>0.05). Premature atrial contractions (PACs) were observed in 14 (23.3%) patients with beta thalassemia intermedia and in 22 (36.6%) beta thalassemia major patients. Premature ventricular contractions (PVCs) were detected in 8 (13.3%) patients in the beta thalassemia intermediate group and 16 (26.6) patients in the beta thalassemia major group, respectively. The left ventricular diastolic dimension, end-diastolic volume, and stroke volume were significantly higher in beta thalassemia intermedia group (Pintermedia group. Both atrial and ventricular arrhythmias were more common in the beta thalassemia major group. Higher end-diastolic volume and stroke volume were detected in the beta thalassemia intermedia group. Pulmonary acceleration time was lower in the beta thalassemia intermedia group, which can be an indicator of higher pulmonary pressure.

Molecular identification of Sicilian (dߺ-thalassemia associated with ß-thalassemia and hemoglobin S in Brazil

Directory of Open Access Journals (Sweden)

Andrade T.G. de

2002-01-01

Full Text Available We describe the clinical and molecular characteristics of two unrelated Brazilian families with an association of the Sicilian form of (deltaߺ-thalassemia with hemoglobin S and ß-thalassemia. Direct sequencing of the ß-globin gene showed only the hemoglobin S mutation in patient 1 and the ß-thalassemia IVS1-110 in patient 2. The other allele was deleted in both patients and PCR of DNA samples of the breakpoint region of both patients showed a band of approximately 1,150 bp, expected to be observed in the DNA of carriers of Sicilian (deltaߺ-thalassemia. The nucleotide sequence of this fragment confirmed the Sicilian deletion. There are few reports concerning the Hb S/(deltaߺ-thalassemia association and patient 2 is the first reported case of Sicilian type of (deltaߺ-thalassemia in association with ß-thalassemia documented at the molecular level.

Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

OpenAIRE

Najmaddin Saki; Akbar Dorgalaleh; Zahra Kashani Khatib; Shaban Alizadeh; Fakher Rahim; Hamid Galehdari; Bijan Kaikhaei; Mohammad Pedram; Ali Dehghani Fard

2013-01-01

Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was pe...

Thalassemia: Complications and Treatment

Science.gov (United States)

... on Facebook Tweet Share Compartir If I have thalassemia, how does it affect my body? Since your ... like flu shots and other vaccines. How is thalassemia treated? The type of treatment a person receives ...

Thalassemia and Hemoglobin E in Southern Thai Blood Donors

Directory of Open Access Journals (Sweden)

Manit Nuinoon

2014-01-01

Full Text Available Thalassemia and hemoglobin E (Hb E are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%, heterozygous α-thalassemia 1 (1.7%, heterozygous β-thalassemia without α-thalassemia (0.9%, heterozygous Hb E without α-thalassemia (5.2%, double heterozygotes for Hb E/α-thalassemia 1 (1.7%, homozygous Hb E without α-thalassemia (0.9%, and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%. The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors.

Thalassemia and Hemoglobin E in Southern Thai Blood Donors

Science.gov (United States)

Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol

2014-01-01

Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were recruited for thalassemia and Hb E screening by red blood cell indices/dichlorophenolindophenol precipitation test. β-Thalassemia and Hb E were then identified by high performance liquid chromatography and 4 common α-thalassemia deletions were characterized by a single tube-multiplex gap-polymerase chain reaction. Overall frequency of hemoglobinopathies was 12.9%, classified as follows: homozygous α-thalassemia 2 (1.7%), heterozygous α-thalassemia 1 (1.7%), heterozygous β-thalassemia without α-thalassemia (0.9%), heterozygous Hb E without α-thalassemia (5.2%), double heterozygotes for Hb E/α-thalassemia 1 (1.7%), homozygous Hb E without α-thalassemia (0.9%), and homozygous Hb E with heterozygous α-thalassemia 2 (0.9%). The usefulness of thalassemia screening is not only for receiving highly effective red blood cells in the recipients but also for encouraging the control and prevention program of thalassemia in blood donors. PMID:25050123

Knowledge, Attitude and Practice of Carrier Thalassemia Marriage Volunteer in Prevention of Major Thalassemia.

Science.gov (United States)

Karimzaei, Tahmineh; Masoudi, Qolamreza; Shahrakipour, Mahnaz; Navidiyan, Ali; Jamalzae, Abd Al-Qaffar; Zoraqi Bamri, Ahmad

2015-06-09

Thalassemia is the most common genetic disorder and rising in the world as a health problem. Due to the criticality of this disease, in our country thalassemia prevention programs are more importance. The aim of this study was investigation of knowledge, attitude and behavior of marrying partners who were thalassemia genetic carriers in prevention of the birth of the children with major thalassemia. This study was a descriptive-analytic study. Data collection tool was a self-administered questionnaire that included 43 items. The content validity of questionnaire was investigated under the supervision of physicians, experts of health education and promotion. Its reliability was confirmed by Cronbach's Alpha test. The subjects in the study consisted of 100 marrying partners who were genetic carriers of thalassemia who referred to Premarital Counseling Center in Iranshahr City. Iranshahr is a a large city of Sistan and Balouchestan Province that located in southeast of Iran. The subjects were selected by convenience non-probability sampling method. Data analyzed using descriptive and analytic statistical tests in SPSS 16.00 and level of significance considered on αpre-diploma. The research findings showed that 7% and 62% of the subjects had poor and mediocre levels of knowledge respectively. Also results showed that only 13% of them had a satisfactory behavior and educational status had a positive correlation with knowledge, behavior, perceived susceptibility and perceived severity (Pcounseling (33%) and premarital screening (27%) were the most important strategies for prevention of thalassemia. The perceived barriers were the strongest predictors for preventive behaviors of incidence of major thalassemia in marrying partners, therefor educational interventions should focused on perceived barriers removing in Volunteer marrying partners.

Double heterozygocity for hemoglobin C and beta thalassemia dominant: A rare case of thalassemia intermedia

Directory of Open Access Journals (Sweden)

Alexandra Agapidou

2018-01-01

Full Text Available Beta thalassemia dominant results from mutations in the β globin chain gene resulting in the production of elongated, highly unstable beta globin chains. Several such mutations have been described and in a heterozygous state they may confer a phenotype more severe than that of β thalassemia trait and lead to a clinical syndrome of thalassemia intermedia and its associated complications such as extramedullary hemopoiesis, bone disease, endocrinopathies and iron overload even in the absence of transfusion. In this report we present a case of double heterozygocity for HbC and β thalassemia dominant leading to a series of complications that were treated successfully once the correct diagnosis was made.

β-Thalassemia Intermedia: A Bird's-Eye View.

Science.gov (United States)

Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

2014-03-01

Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum's extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia

Comparison of right and left side heart functions in patients with thalassemia major, patients with thalassemia intermedia, and control group.

Science.gov (United States)

Noori, Noormohammad; Mohamadi, Mehdi; Keshavarz, Kambiz; Alavi, Seyed Mostafa; Mahjoubifard, Maziar; Mirmesdagh, Yalda

2013-01-01

Heart disease is the main cause of mortality and morbidity in patients with beta thalassemia, rendering its early diagnosis vital. We studied and compared echocardiographic findings in patients with beta thalassemia major, patients with beta thalassemia intermedia, and a control group. Eighty asymptomatic patients with thalassemia major and 22 asymptomatic cases with thalassemia intermedia (8-25 years old) were selected from those referred to Ali Asghar Hospital (Zahedan-Iran) between June 2008 and June 2009. Additionally, 80 healthy individuals within the same age and sex groups were used as controls. All the individuals underwent echocardiography, the data of which were analyzed with the Student t-test. The mean value of the pre-ejection period/ejection time ratio of the left ventricle during systole, the diameter of the posterior wall of the left ventricle during diastole, the left and right isovolumic relaxation times, and the right myocardial performance index in the patients with beta thalassemia major and intermedia increased significantly compared to those of the controls, but the other parameters were similar between the two patient groups. The mean values of the left and right pre-ejection periods, left ventricular end systolic dimension, and left isovolumic contraction time in the patients with thalassemia intermedia increased significantly compared to those of the controls. In the left side, myocardial performance index, left ventricular mass index, isovolumic contraction time, and deceleration time exhibited significant changes between the patients with thalassemia major and those with thalassemia intermedia, whereas all the echocardiographic parameters of the right side were similar between these two groups. The results showed that the systolic and diastolic functions of the right and left sides of the heart would be impaired in patients with thalassemia major and thalassemia intermedia. Consequently, serial echocardiography is suggested in

BETA-THALASSEMIA SYNDROMES, CLINICAL AND LABORATORY APPROACH

OpenAIRE

Türkkan, Emine; Berrak, Su Gülsün; Canpolat, Cengiz

2016-01-01

The Beta ((3) thalassemia syndromes are a heterogeneous group of genetic disorders. The frequency of thalassemia is dependent on the ethnic origins of the patient population. Turkey is located in a geographic area of the world where thalassemia syndromes are common. The incidence rate of (3-thalassemia carriers was stated to be 2 per cent in Turkey. Clinical manifestations are diverse and range from asymptomatic hypochromia and microcytosis to profound anemia leading to death in early childho...

Peripheral neuropathy in thalassemia

International Nuclear Information System (INIS)

Sawaya, Raja A.; Tahir, A.; Zahad, L.

2006-01-01

Patients with thalassemia may complain of numbness and weakness of lower extremities. The aim of the study was to determine whether these patients suffer from a polyneuropathy and to determine any contributing factors for the development of neuropathy. We examined 30 patients with thalasemia major and intermedia, clinically and electrophysiologically. We correlated these findings with demographics, blood status and treatment and compared electrophysiologic data with 30 age and sex matched normal subjects or historical controls. We found that 78% of thalassemia patients suffer from a mild sensory polyneuropathy. The neuropathy seemed to be worse in the intermedia type. Thalassemia patients who received blood transfusions and deferoaximine had better nerve faction than those who did not, irrespective of the dose of the deferoxamine. The neuropathy was worse for the older patients, irrespective of the sex. The hemoglobin level, and the fact that some patients underwent spleenctomy, did not affect the status of the patient's nerves. Patients with thalassemia may suffer from a sensor polyneuropathy especially as they grow older and they are not optimally treated. (author)

Thalassemia major and consanguinity in Shiraz city, Iran.

Science.gov (United States)

Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh

2004-09-05

Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (pmarriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.

Adipocytokine concentrations in children with different types of beta-thalassemia.

Science.gov (United States)

Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

2014-06-01

Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

Pulmonary hypertension associated with thalassemia syndromes

Science.gov (United States)

Fraidenburg, Dustin R.; Machado, Roberto F.

2016-01-01

Chronic hemolytic anemia has increasingly been identified as an important risk factor for the development of pulmonary hypertension. Within the thalassemia syndromes, there are multiple mechanisms, both distinct and overlapping, by which pulmonary hypertension develops and that differ among β-thalassemia major or intermedia patients. Pulmonary hypertension in β-thalassemia major correlates with the severity of hemolysis, yet in patients whose disease is well treated with chronic transfusion therapy, the development of pulmonary hypertension can be related to cardiac dysfunction and the subsequent toxic effects of iron overload rather than hemolysis. β-thalassemia intermedia, on the other hand, has a higher incidence of pulmonary hypertension owing to the low level of hemolysis that exists over years without the requirement for frequent transfusions, while splenectomy is shown to play an important role in both types. Standard therapies such as chronic transfusion have been shown to mitigate pulmonary hypertension, and appropriate chelation therapy can avoid the toxic effects of iron overload, yet is not indicated in many patients. Limited evidence exists for the use of pulmonary vasodilators or other therapies, such as l-carnitine, to treat pulmonary hypertension associated with thalassemia. Here we review the most recent findings regarding the pathogenic mechanisms, epidemiology, presentation, diagnosis, and treatment of pulmonary hypertension in thalassemia syndromes. PMID:27008311

β-Thalassemia Intermedia: A Bird’s-Eye View

Science.gov (United States)

Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

2014-01-01

Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe

β-Thalassemia Intermedia: A Bird’s-Eye View

Directory of Open Access Journals (Sweden)

Anthony Haddad

2014-03-01

Full Text Available Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison

Hypertriglyceridemia Thalassemia Syndrome: Common Disease, Uncommon Association.

Science.gov (United States)

Das, Lipsa; Samprathi, Madhusudan; Shukla, Umesh; Bandyopadhyay, Debapriya; Das, Rashmi Ranjan

2016-07-01

Hypertriglyceridemia has been rarely described with thalassemia, an entity called hypertriglyceridemia-thalassemia syndrome. The authors describe a young infant diagnosed with thalassemia major with severe hypertriglyceridemia. The presence of severe hypertriglyceridemia in this child which rapidly resolved after transfusion, probably suggests a self limited mechanism which may not require therapy. Though hypertriglyceridemia has been reported with hemolytic anemias, the mechanism is unclear. This case illustrates that thalassemia may be associated with hypertriglyceridemia; once familial and secondary causes are ruled out, clinicians may wait for spontaneous resolution before considering specific therapy.

Risk of Erectile Dysfunction in Transfusion-naive Thalassemia Men

Science.gov (United States)

Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

2015-01-01

Abstract Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities. PMID:25837766

Coexistence of Malaria and Thalassemia in Malaria Endemic Areas of Thailand

Science.gov (United States)

Kuesap, Jiraporn; Chaijaroenkul, W.; Rungsihirunrat, K.; Pongjantharasatien, K.; Na-Bangchang, Kesara

2015-01-01

Hemoglobinopathy and malaria are commonly found worldwide particularly in malaria endemic areas. Thalassemia, the alteration of globin chain synthesis, has been reported to confer resistance against malaria. The prevalence of thalassemia was investigated in 101 malaria patients with Plasmodium falciparum and Plasmodium vivax along the Thai-Myanmar border to examine protective effect of thalassemia against severe malaria. Hemoglobin typing was performed using low pressure liquid chromatography (LPLC) and α-thalassemia was confirmed by multiplex PCR. Five types of thalassemia were observed in malaria patients. The 2 major types of thalassemia were Hb E (18.8%) and α-thalassemia-2 (11.9%). There was no association between thalassemia hemoglobinopathy and malaria parasitemia, an indicator of malaria disease severity. Thalassemia had no significant association with P. vivax infection, but the parasitemia in patients with coexistence of P. vivax and thalassemia was about 2-3 times lower than those with coexistence of P. falciparum and thalassemia and malaria without thalassemia. Furthermore, the parasitemia of P. vivax in patients with coexistence of Hb E showed lower value than coexistence with other types of thalassemia and malaria without coexistence. Parasitemia, hemoglobin, and hematocrit values in patients with coexistence of thalassemia other than Hb E were significantly lower than those without coexistence of thalassemia. Furthermore, parasitemia with coexistence of Hb E were 2 times lower than those with coexistence of thalassemia other than Hb E. In conclusion, the results may, at least in part, support the protective effect of thalassemia on the development of hyperparasitemia and severe anemia in malaria patients. PMID:26174819

Frequency of Thalassemia in Iran and Khorasan Razavi

Directory of Open Access Journals (Sweden)

Gholam Hasan Khodaei

2013-12-01

Full Text Available Introduction: Beta-thalassemia is the most common hereditary disease in Iran. More than two million carriers of beta-thalassemia live in Iran. Since the Iranian population is a mixture of different ethnic groups, it is necessary to determine the frequency  in the different parts of the country. Materials and Methods: This descriptive study is a cross sectional study with helping by professional groups fighting diseases in Khorasan Razavi province.   Results: In Iran, according to World Health Organization, about 4 percent of the population, are carriers of the thalassemia gene. In other words, about 2-3 million people are suffering from thalassemia minor.Now, more than 18 thousand cases of thalassemia are scattered across the country in different provinces, are different. Mazandaran, Gilan, Hormozgan, Khuzestan, kohgiloyeh, Fars, Bushehr, Sistan and Baluchestan, Kerman and Isfahan, are 10 provinces with high prevalence in our country. We have 342 cases of thalassemia major in Khorasan Razavi province.   Conclusion: Prevalence  of thalassemia in our country is 3.6%  and Iran is located on the belt of thalassemia and due to a history of consanguinity, this disease has a prevalence of 0.6% among in the provinces of Khorasan Razavi.

β-Thalassemia intermedia: a comprehensive overview and novel approaches.

Science.gov (United States)

Asadov, Chingiz; Alimirzoeva, Zohra; Mammadova, Tahira; Aliyeva, Gunay; Gafarova, Shahla; Mammadov, Jeyhun

2018-01-29

β-Thalassemia intermedia is a clinical condition of intermediate gravity between β-thalassemia minor, the asymptomatic carrier, and β-thalassemia major, the transfusion-dependent severe anemia. It is characterized by a significant clinical polymorphism, which is attributable to its genetic heterogeneity. Ineffective erythropoiesis, chronic anemia, and iron overload contribute to the clinical complications of thalassemia intermedia through stepwise pathophysiological mechanisms. These complications, including splenomegaly, extramedullary erythropoiesis, iron accumulation, leg ulcers, thrombophilia, and bone abnormalities can be managed via fetal hemoglobin induction, occasional transfusions, chelation, and in some cases, stem cell transplantation. Given its clinical diversity, thalassemia intermedia patients require tailored approaches to therapy. Here we present an overview and novel approaches to the genetic basis, pathophysiological mechanisms, clinical complications, and optimal management of thalassemia intermedia.

Endocrinopathies in thalassemia major patient

Science.gov (United States)

Lubis, D. A.; Yunir, E. M.

2018-03-01

Advanced in chelation therapy and regular blood transfusion have marked improvements in the life expectancy of patients with thalassemia major, however these patients still have to deal with several complications. We report a 19-year-old male, presented with multiple endocrine complication-related thalassemia; hypogonadism, short stature, osteoporosis with history of fracture, and subclinical hypothyroid.

Diagnosis of Compound Heterozygous Hb Tak/β-Thalassemia and HbD-Punjab/β-Thalassemia by HbA2 Levels on Capillary Electrophoresis.

Science.gov (United States)

Panyasai, Sitthichai; Sakkhachornphop, Supachai; Pornprasert, Sakorn

2018-01-01

A misdiagnosis of β-thalassemia carrier in samples with Hb Tak and HbD-Punjab, the β-variants, can be a cause of inappropriate genetic counseling thus having a new case of β-thalassemia major. A capillary electrophoresis (CE) is very efficient in separating and quantifying HbA 2 . In this study, HbA 2 levels of samples which were doubted for compound heterozygous Hb Tak/β-thalassemia or heterozygous HbD-Punjab/β-thalassemia were measured and compared between CE and high performance liquid chromatography (HPLC). The molecular confirmation for Hb Tak, HbD-Punjab and β-thalassemia codons 17 (A > T), 41/42 (-TCTT), 71/72 (+A) and IVSI-nt1 (G > T) mutations and 3.4 kb deletion were also performed. Based on DNA analysis, 3 cases were diagnosed as compound heterozygous Hb Tak/β-thalassemia and one for HbD-Punjab/β-thalassemia. The elevated HbA 2 levels were found in all 4 samples with rages of 4.6-7.3% on CE while those were not found on HPLC. Thus, the elevated HbA 2 measured by CE can be used as a screening parameter for differentiating the homozygote of Hb Tak and HbD-Punjab from the compound heterozygote of these hemoglobinopathies and β-thalassemia.

Distribution of thalassemias and associated hemoglobinopathies identified by prenatal diagnosis in Taiwan.

Science.gov (United States)

Peng, Ching-Tien; Liu, Su-Ching; Peng, Yi-Chin; Lin, Tsai-Hsiu; Wang, Shiow-Jain; Le, Ching-Yi; Shih, Mu-Chin; Tien, Ni; Lu, Jang-Jih; Lin, Chien-Yu

2013-10-01

Hemoglobin (Hb) gene disorders are common hereditary disorders in Taiwan, and α- and β-thalassemias are among the well-known Hb disorders here. Our study provides a primary reference for designing a locally relevant antenatal diagnostic test to control the spread of thalassemia. Between 1998 and 2011, prenatal diagnoses for identifying thalassemia and hemoglobinopathies were performed on 1240 fetuses at risk for α-hydrops and β-thalassemia major. Of 1240 specimens analyzed, 1082 (87%) were obtained by amniocentesis; 125 (10%), by chorionic villus sampling; and 33 (3%), by cordocentesis. Prenatal diagnoses revealed that 21.5% of these fetuses as thalassemia major (including α-thalassemia hydrops, β-thalassemia major, and Hb E/β-thalassemia); 50.2%, for thalassemia minor (include α-thalassemia carrier, β-thalassemia carrier, and α-thalassemia combined β-thalassemia carrier); and 28.3% for normal type (include non-α, β-thalassemia). The most common α-hydrops were SEA (Southeast Asian) and Philippine type (frequencies of 74.91 and 5.24%, respectively). The frequency of the IVS-II-654 combined codons 41/42 mutation, the most common β-thalassemia major mutation in this region, was 5.24%. Two fetuses were found with E/β-thalassemia (HbE/IVS-II-654 and HbE/codons 41/42, respectively). Since 1993, Taiwan's Department of Health adopted a national program for screening pregnancies to control spread of thalassemia. In the last 10years, less than 3 such cases have occurred per year. After 2003, this number was 0 for a total of 4years (2003, 2004, 2007, and 2008). In Taiwan, incidence and frequency of thalassemia genotypes were similar to those previously reported. The national program for screening pregnancies to control spread of thalassemia that resulted in a marked decline in the number of newborns with thalassemia major. Interestingly, prenatal diagnoses revealed 21.5% for thalassemia major, 50.2% for thalassemia minor, 28.3% normal comparison of thalassemia

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

Science.gov (United States)

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

Thalassemia and Hemoglobin E in Southern Thai Blood Donors

OpenAIRE

Nuinoon, Manit; Kruachan, Kwanta; Sengking, Warachaya; Horpet, Dararat; Sungyuan, Ubol

2014-01-01

Thalassemia and hemoglobin E (Hb E) are common in Thailand. Individuals with thalassemia trait usually have a normal hemoglobin concentration or mild anemia. Therefore, thalassemic individuals who have minimum acceptable Hb level may be accepted as blood donors. This study was aimed at determining the frequency of α-thalassemia 1 trait, β-thalassemia trait, and Hb E-related syndromes in Southern Thai blood donors. One hundred and sixteen voluntary blood donors, Southern Thailand origin, were ...

Beliefs about chelation among thalassemia patients

Directory of Open Access Journals (Sweden)

Trachtenberg Felicia L

2012-12-01

Full Text Available Abstract Background Understanding patients’ views about medication is crucial to maximize adherence. Thalassemia is a congenital blood disorder requiring chronic blood transfusions and daily iron chelation therapy. Methods The Beliefs in Medicine Questionnaire (BMQ was used to assess beliefs in chelation in thalassemia patients from North America and London in the Thalassemia Longitudinal Cohort (TLC of the Thalassemia Clinical Research Network (TCRN. Chelation adherence was based on patient report of doses administered out of those prescribed in the last four weeks. Results Of 371 patients (ages 5-58y, mean 24y, 93% were transfused and 92% receiving chelation (26% deferoxamine (DFO; a slow subcutaneous infusion via portable pump, 63% oral, 11% combination. Patients expressed high “necessity” for transfusion (96%, DFO chelation (92% and oral chelation (89%, with lower “concern” about treatment (48%, 39%, 19% respectively. Concern about oral chelation was significantly lower than that of DFO (p Conclusions Despite their requirement for multimodal therapy, thalassemia patients have positive views about medicine, more so than in other disease populations. Patients may benefit from education about the tolerability of chelation and strategies to effectively cope with side effects, both of which might be beneficial in lowering body iron burden. Clinicaltrials.gov identifier NCT00661804

Some endocrinal aspects of pancreas in beta thalassemia

Energy Technology Data Exchange (ETDEWEB)

Badder, M A; Megahed, Y M; Gafer, M; Abdel Kariem, M M [Pediatric dept., faculty of medicine, Zagazig university and Middle eastern regional Radioisotope Center for The Arab Countries, (Egypt)

1995-10-01

The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs.

Some endocrinal aspects of pancreas in beta thalassemia

International Nuclear Information System (INIS)

Badder, M.A.; Megahed, Y.M.; Gafer, M.; Abdel Kariem, M.M.

1995-01-01

The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs

COAGULOPATHY IN BETA-THALASSEMIA: CURRENT UNDERSTANDING AND FUTURE PERSPECTIVES

Directory of Open Access Journals (Sweden)

M. Domenica Cappellini

2009-12-01

Full Text Available As the life expectancy of β-thalassemia patients has markedly improved over the last decade, several new complications are being recognized. The presence of a high incidence of thromboembolic events, mainly in thalassemia intermedia patients, has led to the identification of a hypercoagulable state in thalassemia. In this review, the molecular and cellular mechanisms leading to hypercoagulability in thalassemia are highlighted, and the current clinical experience is summarized. Recommendations for thrombosis prophylaxis are also discussed.

Diabetes mellitus in β-thalassemia major patients

Directory of Open Access Journals (Sweden)

Riadi Wirawan

2003-06-01

Full Text Available β-thalassemia major is a disease caused by β polypeptide chain synthesis disorder which is inherited as an autosomal recessive from both parents which is marked by little or no β globin chain synthesis. Medication for β thalassemia major patients is by repeated blood transfusions, which causes hemochromatosis. Hemochromatosis can occur in various organs including the pancreas. The aim of the study was to assess the alteration of plasma glucose concentration and the hemochromatosis prevalence. Fasting plasma glucose concentration and serum ferritin examination were measured in 115 β thalassemia major patients with ages between 10-23 years who were out-patients in the Thalassemia Centre, Department of Child Health, Medical School, University of Indonesia / Dr. Cipto Mangunkusumo General Hospital, Jakarta. The plasma glucose concentration examination was conducted by the GDH enzymatic method, with American Diabetes Association (ADA criteria in the evaluation, while the serum ferritin examination was conducted with the microparticle enzyme immuno assay (MEIA method. All patients had hemochromatosis, 14.8% of the patients had impaired fasting glucose level and 2.6% of the patients showed indications of diabetes mellitus. β thalassemia major patients who receive frequent transfusions will develop hemochromatosis that will in turn impair the pancreatic function. (Med J Indones 2003; 12: 87-93 Keywords : β thalassemia major, hemochromatosis, diabetes mellitus

Non-transfusion Dependent Thalassemias: A Developing Country Perspective.

Science.gov (United States)

Mukherjee, Somnath; Das, Rashmi R; Raghuwanshi, Babita

2015-01-01

Non-transfusion-dependent thalassemias (NTDT) encompass a group of hereditary chronic hemolytic anemia, which, as the name indicates, not require regular blood transfusion for survival. These include β-thalassemia intermedia, hemoglobin E/β-thalassemia, and Hemoglobin H disease (α- thalassemia intermedia). Individuals with structural variant of hemoglobin especially Hemoglobin S and Hemoglobin C associated with "α" or "β" thalassemia in heterozygous condition may also present with similar features of NTDT. NTDT patients are not immune to the development of transfusion unrelated complications in the long run. These hereditary chronic hemolytic anemias are still under-recognized in developing countries like India, where the disease burden might be high causing significant morbidity. The pathophysiologic hallmark that characterizes this group of disorders (ineffective erythropoiesis, hemolysis, chronic anemia) leads to a number of serious complications, similar to transfusion dependent thalassemia. So, timely diagnosis and institution of appropriate preventive/remedial measures as well as education of patient population can help decrease the morbidity to a significant extent. In the present review, focus will be on the pathophysiological mechanisms and available management options of NTDT from a developing country perspective like India.

β-Thalassemia Intermedia: A Clinical Perspective

Science.gov (United States)

Musallam, Khaled M.; Taher, Ali T.; Rachmilewitz, Eliezer A.

2012-01-01

Our understanding of the molecular and pathophysiological mechanisms underlying the disease process in patients with β-thalassemia intermedia has substantially increased over the past decade. Earlier studies observed that patients with β-thalassemia intermedia experience a clinical-complications profile that is different from that in patients with β-thalassemia major. In this article, a variety of clinical morbidities are explored, and their associations with the underlying disease pathophysiology and risk factors are examined. These involve several organs and organ systems including the vasculature, heart, liver, endocrine glands, bone, and the extramedullary hematopoietic system. The effects of some therapeutic interventions on the development of clinical complications are also discussed. PMID:22762026

Portal vein thrombosis after splenectomy for beta-thalassemia major

International Nuclear Information System (INIS)

Al-Hawsawi, Zakaria M.; Tarawah, Ahmed M.; Hassan, Ruhul Amin A.; Haouimi, Ammar S.

2004-01-01

Portal vein thrombosis is a recognized complication after splenectomy for beta-thalassemia major due to the chronic hypercoagulable state which has been recognized to exist in childhood thalassemia and contribute to thromboembolic events. We reporting one patient with beta-thalassemia major developed portal vein thrombosis following splenectomy. (author)

Genetics Home Reference: alpha thalassemia X-linked intellectual disability syndrome

Science.gov (United States)

... Alpha thalassemia X-linked intellectual disability syndrome Alpha thalassemia X-linked intellectual disability syndrome Printable PDF Open ... to view the expand/collapse boxes. Description Alpha thalassemia X-linked intellectual disability syndrome is an inherited ...

GENETIC FACTORS INFLUENCING HEMOGLOBIN F LEVEL IN β-THALASSEMIA/HB E DISEASE.

Science.gov (United States)

Ruangrai, Waraporn; Jindadamrongwech, Sumalee

2016-01-01

Genetic factors influencing Hb F content in adult red blood cells include β-thalassemia genotypes, co-inheritance of α-thalassemia traits and single nucleotide polymorphisms (SNPs). Genotyping of α- and β-thalassemia and five SNPs in β-globin gene cluster previously identified in genome-wide association studies as being markers of elevated Hb F in β-thalassemia were performed in 81 subjects diagnosed with β-thalassemia/Hb E. Hb F levels are higher (0.9-7.1 g/dl) in subjects (n = 57) with the severe compared to mild β-thalassemia (0.8-2.5 g/ dl) (n = 4) genotypes, and are similarly low (0.7-3.5 g/dl) in those (n = 15) with α-thalassemia co-inheritance. Hb F levels in non-thalassemia controls (n = 150) range from 0 to 0.15 g/dl. The presence of homozygous minor alleles of the 5 SNPs are significant indicators of β-thalassemia/Hb E individuals with high Hb F (> 4 g/dl), independent of their thalassemia genotypes. Given that re-activation of γ-globin genes leads to amelioration of β-thalassemia severity, understanding how genetic factors up-regulate Hb F production may lead to possible therapeutic interventions, genetically or pharmacologically, of this debilitating disease in the not too distant future.

Premature epiphyseal fusion and extramedullary hematopoiesis in thalassemia

International Nuclear Information System (INIS)

Colavita, N.; Orazi, C.; Danza, S.M.; Falappa, P.G.; Fabbri, R.

1987-01-01

The main skeletal abnormalities in β-thalassemia are widening of medullary spaces, rarefaction of bone trabeculae, thinning of cortical bone, and perpendicular periosteal spiculation. Premature epiphyseal fusion (PEF) and extramedullary hematopoiesis (EH) are found, though more rarely. The incidence of PEF and EH in 64 patients affected by β-thalassemia is reported. The different incidence of such complications in thalassemia major and intermedia is reported, and a possible correlation with transfusion regimen is also considered. (orig.)

Fetal red blood cell parameters in thalassemia and hemoglobinopathies.

Science.gov (United States)

Karnpean, Rossarin; Fucharoen, Goonnapa; Fucharoen, Supan; Ratanasiri, Thawalwong

2013-01-01

With the lack of fetal blood specimens in routine practice, little is known about red blood cell (RBC) parameters of fetuses with various thalassemia syndromes. This study aimed to describe these in various forms of thalassemia. The study was performed on 93 fetal blood specimens obtained from pregnant women by cordocentesis during 18-24 weeks of gestation. RBC parameters were recorded on automated analyzer. Hemoglobin (Hb) and DNA analyses were performed for definite genotyping. No significant difference in RBC parameters was observed between non-thalassemic fetuses and those with β-thalassemia trait, Hb E trait, homozygous Hb E and β-thalassemia/Hb E disease. However, in those with α(0)-thalassemia trait and double heterozygous α(0)-thalassemia/Hb E, slight reduction in mean corpuscular volume (MCV) was noted. Fetuses with the Hb H disease showed significant reductions in Hb, MCV and mean corpuscular Hb (MCH). Marked reductions in Hb, hematocrit, MCH and mean cell Hb concentration and increased RBC distribution width with numerous nucleated RBC were clearly observed in Hb Bart's hydrops fetalis. Simple analysis of fetal RBC parameters is useful for making presumptive prenatal diagnosis of α-thalassemia syndromes including Hb H disease and Hb Bart's hydrops fetalis which can then be confirmed by Hb and DNA analyses. Copyright © 2013 S. Karger AG, Basel.

Increased knowledge of thalassemia promotes early carrier status examination among medical students

Directory of Open Access Journals (Sweden)

Julius Broto Dewanto

2016-04-01

A higher thalassemia knowledge score causes medical students to be willing to undergo thalassemia carrier status examination at an earlier point in timing. A well-organized educational program focusing on thalassemia and early screening in young adults may enhance the thalassemia prevention program.

Risk Factors to Growth Retardation in Major Thalassemia

Directory of Open Access Journals (Sweden)

Riva Uda

2011-03-01

Full Text Available The increasing in the life span of patients with major thalassemia should be followed by increased quality of life. There are factors which can affect growth retardation in these patients. The aim of this study was to find out the risk factors for growth retardation in patients with major thalassemia. An analytical study with cross-sectional design was conducted at Pediatric Thalassemia Clinics of Dr.Hasan Sadikin Hospital, Bandung, in June to July 2006. The subjects of this study were patients with major thalassemia. Inclusion criteria’s were age under 14 years old, had no chronic diseases like tuberculosis, cerebral palsy with complete medical records. Risk factors were the timing of diagnosis, initial and dose of deferoxamine, volume of transfused blood, mean pretransfusion hemoglobin level, family income, and age. Antropometric measurement indices were used to assess the growth which expressed in Z score. Growth evaluated based on height/age (H/A and growth retardation if H/A <-2 SD. Risk factors for growth retardation were analyzed separately using chi-square test and odds ratio (OR with 95% confidence interval (CI. Then they were analyzed simultaneously with logistic regression method. Subjects consisted of 152 patients with major thalassemia. Seventy three thalassemia patients were stunted. Analysis showed that age (OR: 5.42, 95% CI:2.32–12.65, p <0.001, dosage of deferoxamine (OR: 4.0, 95% CI: 1.29–12.41, p: 0.016, and family income (OR: 2.32, 95% CI: 1.06–5.06, p: 0.036 were risks factors for growth retardation. Conclusion, risk factors for growth retardation in major thalassemia are age, dosage of deferoxamine, and family income.

Learning about Thalassemia

Science.gov (United States)

Skip to main content Learning About Thalassemia Enter Search Term(s): Español Research Funding An Overview Bioinformatics Current Grants Education and Training Funding Extramural Research News Features Funding Divisions Funding ...

Altered erythropoiesis and iron metabolism in carriers of thalassemia

Science.gov (United States)

Guimarães, Jacqueline S.; Cominal, Juçara G.; Silva-Pinto, Ana Cristina; Olbina, Gordana; Ginzburg, Yelena Z.; Nandi, Vijay; Westerman, Mark; Rivella, Stefano; de Souza, Ana Maria

2014-01-01

The thalassemia syndromes (α- and β-thalassemia) are the most common and frequent disorders associated with ineffective erythropoiesis. Imbalance of α- or β-globin chain production results in impaired red blood cell synthesis, anemia and more erythroid progenitors in the blood stream. While patients affected by these disorders show definitive altered parameters related to erythropoiesis, the relationship between the degree of anemia, altered erythropoiesis and dysfunctional iron metabolism have not been investigated in both α-thalassemia carriers (ATC) and β-thalassemia carriers (BTC). Here we demonstrate that ATC have a significantly reduced hepcidin and increased soluble transferrin receptor levels but relatively normal hematological findings. In contrast, BTC have several hematological parameters significantly different from controls, including increased soluble transferrin receptor and erythropoietin levels. These changings in both groups suggest an altered balance between erythropoiesis and iron metabolism. The index sTfR/log ferrin and (hepcidin/ferritin)/sTfR are respectively increased and reduced relative to controls, proportional to the severity of each thalassemia group. In conclusion, we showed in this study, for the first time in the literature, that thalassemia carriers have altered iron metabolism and erythropoiesis. PMID:25307880

Aseptic necrosis of femoral head complicating thalassemia

International Nuclear Information System (INIS)

Orzincolo, C.; Castaldi, G.; Scutellary, P.N.; Bariani, L.; Pinca, A.

1986-01-01

Aseptic necrosis of the femoral head is described in 4 patients, selected from 280 patients with homozygous β-thalassemia (Cooley anemia). The incidence of the complication appears to be very high (14.5per mille) in thalassemia, compared to the general population. The possible mechanism are discussed. (orig.)

Oxidative stress and antioxidant status in beta-thalassemia heterozygotes

Directory of Open Access Journals (Sweden)

Luciana de Souza Ondei

2013-01-01

Full Text Available Background: Several studies have evaluated the oxidant and antioxidant status of thalassemia patients but most focused mainly on the severe and intermediate states of the disease. Moreover, the oxidative status has not been evaluated for the different beta-thalassemia mutations. Objective: To evaluate lipid peroxidation and Trolox equivalent antioxidant capacity in relation to serum iron and ferritin in beta thalassemia resulting from two different mutations (CD39 and IVS-I-110 compared to individuals without beta-thalassemia. Methods: One hundred and thirty subjects were studied, including 49 who were heterozygous for beta-thalassemia and 81 controls. Blood samples were subjected to screening tests for hemoglobin. Allele-specific polymerase chain reaction was used to confirm mutations for beta-thalassemia, an analysis of thiobarbituric acid reactive species was used to determine lipid peroxidation, and Trolox equivalent antioxidant capacity evaluations were performed. The heterozygous beta-thalassemia group was also evaluated for serum iron and ferritin status. Results: Thiobarbituric acid reactive species (486.24 ± 119.64 ng/mL and Trolox equivalent antioxidant capacity values (2.23 ± 0.11 mM/L were higher in beta-thalassemia heterozygotes compared to controls (260.86 ± 92.40 ng/mL and 2.12 ± 0.10 mM/L, respectively; p-value < 0.01. Increased thiobarbituric acid reactive species values were observed in subjects with the CD39 mutation compared with those with the IVS-I-110 mutation (529.94 ± 115.60 ng/mL and 453.39 ± 121.10 ng/mL, respectively; p-value = 0.04. However, average Trolox equivalent antioxidant capacity values were similar for both mutations (2.20 ± 0.08 mM/L and 2.23 ± 0.12 mM/L, respectively; p-value = 0.39. There was no influence of serum iron and ferritin levels on thiobarbituric acid reactive species and Trolox equivalent antioxidant capacity values. Conclusion: This study shows an increase of oxidative stress and

[Clinical analysis of three cases with beta-thalassemia].

Science.gov (United States)

Li, X Y; Liu, M J; Xu, L H; Xu, H G; Chen, H L; Fang, J P

2018-04-02

Objective: To study the diagnostic strategy of β-thalassemia through retrospective analysis of 3 cases of β-thalassemia. Methods: Three patients were admitted to the Department of Pediatrics, Sun Yat-sen Memorial Hospital of Sun Yat-sen University from January 2014 to June 2015. The clinical manifestations, hemoglobin electrophoresis and gene detection of these patients and their parents were analyzed, diagnostic ideas and key points were discussed when beta thalassemia gene detection did not explain clinical manifestations or hemoglobin electrophoresis. Results: Case 1, boy, 5 years old, was diagnosed as compound heterozygotes of β41-42 and IVS-Ⅱ-654 with hereditary persistence of fetal hemoglobin(HPFH) according to the clinical manifestations of mild anemia, normal size of liver and spleen, 92.8% fetal hemoglobin (HbF) and gene analysis. Case 2, girl, 3 years old, was confirmed the diagnosis of thalassemia intermedia with β41-42 heterozygote compound and ααα anti3.7 heterozygote in accordance with the manifestations of severe anemia, hepatosplenomegaly, 8.6% HbF, 4.1% hemoglobin A 2 (HbA 2 ) and gene analysis. Case 3, girl, 3 years old, with severe anemia, hepatosplenomegaly, 51.2% HbF and 3.7% HbA 2 , was diagnosed as thalassemia major with compound heterozygotes of PolyA (T→C) and β17 by DNA sequencing. Conclusion: The diagnosis of β-thalassemia should be confirmed by clinical manifestations of hemolytic anemia, hemoglobin electrophoresis, gene diagnosis and family survey.

Is beta-thalassemia trait a protective factor against ischemic cerebrovascular accidents?

Science.gov (United States)

Karimi, Mehran; Borhani Haghighi, Afshin; Yazdani, Maryam; Raisi, Hamideh; Giti, Rahil; Namazee, Mohammad Reza

2008-01-01

In this research, we sought to determine the association between beta-thalassemia trait and ischemic cerebrovascular accident (CVA). In acase-control study, 148 patients with thromboembolic cerebrovascular events were evaluated for the presence of hypertension, diabetes mellitus, hyperlipidemia, and beta-thalassemia trait. A total of 156 age- and sex-matched patients with no cardiac or cerebrovascular diseases, serving as the control group, were also investigated for the above-mentioned risk factors. We found that 6.1% of patients with ischemic CVA and 12.2% of the control group had beta-thalassemia trait (P = .066). In male patients, the negative association between ischemic CVA and presence of beta-thalassemia trait was significant (P = .008). In patients, the prevalence of hypertension was also significantly different between those with and without beta-thalassemia trait (P = .01); those with beta-thalassemia trait had a lower mean blood pressure than those without the trait. beta-Thalassemia trait may have a protective effect against ischemic CVA that might be caused by the lower arterial blood pressure observed in those with this trait.

Failure to replicate the internal structure of Greek-specific thalassemia quality of life instrument in adult thalassemia patients in Sabah.

Science.gov (United States)

Keowmani, Thamron; Lee, Lily Wong Lee

2016-01-01

To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI) in Sabah's adult thalassemia patients. This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach's alpha. The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913. This study was unable to replicate the internal structure of the Greek STQOLI in Sabah's adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.

Gene Therapy in Thalassemia and Hemoglobinopathies

OpenAIRE

Breda, Laura; Gambari, Roberto; Rivella, Stefano

2009-01-01

Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

Xmni polymorphism and disease severity in patients with beta thalassemia from northern Pakistan

International Nuclear Information System (INIS)

Hanif, T.B.; Ahmed, S.; Anwar, J.

2015-01-01

Thalassemia is a heterogeneous disorder and several genetic factors influence the severity of thalassemia. An accurate and early diagnosis of a mild thalassemia genotype helps to avoid unnecessary transfusion and its complications. The aim of this study is to identify the association between XmnI polymorphism and disease severity in patients with ?-thalassemia from northern Pakistan. Methods: The cross sectional study was conducted at the Department of Haematology, Armed Forces Institute of Pathology (AFIP) Rawalpindi, from September 2006 to June 2009. A total of 90 subjects including 30 with thalassemia major, 30 with thalassemia intermedia and 30 normal individuals were studied. DNA from each subject was tested for 15 ?-thalassemia mutations and the presence of XmnI polymorphism using Amplification Refractory Mutation System and Restriction Fragment Length Polymorphism respectively. Results: One normal and one thalassemia major subject were found to be positive for homozygous and heterozygous XmnI polymorphism respectively. Among the thalassemia intermedia group, XmnI polymorphism was found in 12/30 patients, of whom 10 were homozygous and 2 were heterozygous for it. Conclusion: XmnI polymorphism is an important genotypic factor in Pakistani population for making a prospective diagnosis of thalassemia intermedia and predicting the severity of the disease. (author)

Insulin-like growth factor-1 levels in children with Beta-thalassemia minor

Directory of Open Access Journals (Sweden)

Mehran Karimi

2008-09-01

Full Text Available Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH / insulin growth factor-1 (IGF-1 axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in healthy children. Material and Methods: Fifty children aged 6 months to 15 years with b-thalassemia minor (32 males, 18 females and 50 age- and sex-matched normal healthy children were selected. Medical history was taken and complete physical examination was done in each case; IGF-1 level was checked in all cases. This study was done in Shiraz, southern Iran, during 2005.Results: IGF-1 levels were significantly lower in b-thalassemia minor children than normal children (P = 0.015. This result demonstrates that some etiologies of growth failure in b-thalassemia major other than those described to date can exist, which may be shared with b-thalassemia minor in feature or may be transformed by genes that are either expressed or not.Conclusion: We conclude that in addition to that observed in b-thalassemia major, IGF-1 level is also decreased in b-thalassemia minor, and these two may have similar etiologies.

Diabetes mellitus complicating β-thalassemia: a case report

African Journals Online (AJOL)

A case of beta-thalassemia major complicated by diabetes mellitus in a Fiji national is presented. The mechanisms involved in the pathogenesis of this complication are highlighted. Keywords: β-thalassemia, diabetes mellitus, iron overload. Annals of African Medicine Vol.2(1) 2003: 36-38 ...

Recent trends in the gene therapy of β-thalassemia

Science.gov (United States)

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Prevalence of renal tubular dysfunction in beta thalassemia minor in shiraz

Directory of Open Access Journals (Sweden)

Ali Moradi Nakhodcheri

2012-02-01

Full Text Available  Background & objective: β-Thalassemia minor is an asymptomatic hereditary disease. The first study on the relation of renal tubular dysfunction and β-thalassemia minor was performed in 2002 but those studies seem inadequate.The main goal of this study is through evaluation of renal tubular function in 100 patients with thalassemia minor. Materials & Methods: 100 patients with β- thalassemia which confirmed by hemoglobin electrophoresis and CBC as well as RBC indices were studied.14 out of 100 cases exit because of Urinary Tract Infection, diabetes mellitus or hypertension.Complete chemistry profile was performed on serum and urine of all reminder 86 patients (46 female and 40 male. Patients classified into two groups: β-thalassemia minor with anemia and without anemia. Another control group include 50 healthy individuals also considered.Then data analyzed by proper statistical methods. Results: 20 out of 86 reminder cases e.g. 24% showed at least one index of renal tubular dysfunction.58% of patients was been anemic and 42% non anemic. The most prominent tubular dysfunction was seen in a 29 years old lady with glucosuria and without anemia. conclusion: β-Thalassemia minor is common in Iran specially in Fars province. This study revealed significant renal tubular dysfunction in patient with β-thalassemia minor. So it is necessary to check out thalassemic patients for renal function tests periodically. Key words: β-thalassemia, minor,renal tubular dysfunction

Peripheral Neuropathy: Not a Feature of Childhood Thalassemia

African Journals Online (AJOL)

Sedat Işıkay

an iron chelator, used for transfusion dependent thalassemia patients has been associated with sensorineural and sensorimotor neurotoxicity.[7,8] However, the data in literature regarding the peripheral neuropathy and beta thalassemia is limited. Moreover, there is a gap in literature about the factors that have a role in.

Thalassemia intermedia as a result of heterozygosis for ß0-thalassemia and aaaanti-3.7/aa genotype in a Brazilian patient

Directory of Open Access Journals (Sweden)

Kimura E.M.

2003-01-01

Full Text Available We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa. The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.

Failure to replicate the internal structure of Greek-specific thalassemia quality of life instrument in adult thalassemia patients in Sabah

Directory of Open Access Journals (Sweden)

Keowmani T

2016-02-01

Full Text Available Thamron Keowmani,1 Lily Wong Lee Lee21Clinical Research Centre, 2Hematology Unit, Queen Elizabeth Hospital, Kota Kinabalu, Sabah, MalaysiaPurpose: To study the validity and reliability of the Malay version of the Specific Thalassemia Quality of Life Instrument (STQOLI in Sabah’s adult thalassemia patients.Patients and methods: This cross-sectional study was done at Thalassemia Treatment Centre, Queen Elizabeth Hospital in Sabah, Malaysia. Eighty-two adult thalassemia patients who fulfilled the inclusion and exclusion criteria were conveniently selected for participation in the study. The English version of STQOLI was translated into Malay by using forward and back translations. The content of the questionnaire was validated by the chief hematologist of the hospital. The construct validity of the 40-item questionnaire was assessed by principal component analysis with varimax rotation and the scale reliability was assessed by Cronbach’s alpha.Results: The study failed to replicate the internal structure of the Greek STQOLI. Instead, 12 factors have been identified from the exploratory factor analysis, which accounted for 72.2% of the variance. However, only eight factors were interpretable. The factors were iron chelation pump impact, transfusion impact, time spent on treatment and its impact on work and social life, sex life, side effects of treatment, cardiovascular problems, psychology, and iron chelation pill impact. The overall scale reliability was 0.913.Conclusion: This study was unable to replicate the internal structure of the Greek STQOLI in Sabah’s adult thalassemia patients. Instead, a new structure has emerged that can be used as a guide to develop a questionnaire specific for adult thalassemia patients in Sabah. Future research should focus on the eight factors identified from this study.Keywords: STQOLI, validity, reliability, Malay, transfusion

Thalassemia and related hemoglobinopathies.

Science.gov (United States)

Sarnaik, Sharada A

2005-04-01

Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

My Story: Real Stories of People Living with Thalassemia

Science.gov (United States)

... Share Compartir Real Stories from People living with Thalassemia On this Page Rahul’s Story Aaron’s Story Rahul’s ... is Rahul Kapoor, and I was born with thalassemia, a blood disorder which requires transfusions every other ...

Coinheritance of Β-Thalassemia and Sickle Cell Anaemia

African Journals Online (AJOL)

GB

2016-11-06

Nov 6, 2016 ... ABSTRACT. BACKGROUND: Genes for haemoglobin S are found in high frequencies in Nigeria. However, there is little information on beta thalassemia in sickle cell anaemia in this population. The clinical presentation of HbS- β thalassemia is enormously variable, ranging from an asymptomatic state to a ...

Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

Energy Technology Data Exchange (ETDEWEB)

Karimi, Mehran [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)], E-mail: Karimim@sums.ac.ir; Bagheri, Mohammad Hadi [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Tahmtan, Mehdi [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of); Shakibafard, Alireza [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Rashid, Murtaza [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)

2009-01-15

Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 {+-} 133.97 and 126.29 {+-} 53.98 mm{sup 3}, respectively. Average spleen lengths in case and control groups were 10.71 {+-} 1.52 and 10.60 {+-} 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients.

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

Science.gov (United States)

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Metabolic syndrome in Iraqi female patients with major β-thalassemia

Directory of Open Access Journals (Sweden)

Shaemaa Hadi Abdulsada

2017-02-01

Full Text Available Patients with β-thalassemia may have an increased risk for diabetes mellitus and cardiovascular diseases due to high level of iron which may lead to insulin resistanceand metabolic syndrome. So this study aimed to evaluate the levels of lipids profile in Iraqi female patients with β-thalassemia. Forty twofemale (age 15-30 years were enrolled in this study. Blood was collected and the sera were separated from (22 female patients with β-thalassemia who were attended the Ibn-Al-Baladi hospital from September 2012 to January 2013 and (20 healthy subject as a control group. Body mass index (BMI, lipid profile, FSG, insulin, insulin resistance, insulin sensitivity, B-cell function, iron, atherogenic index of serum were estimated. The results showed the presence of a significant increase in serum iron and significant decrease in insulin, B-cell function, LDL, VLDL, and TC in serum of patients with β-thalassemia when compared with control group. BMI also showed a significant decrease in patients when compared with the controls. Serum Insulin resistance, insulin sensitivity, HDL, TG, AIS, and FSG showed no-significant differences in patients with β-thalassemia when compared with control group. We concluded there was no metabolic syndrome in female patients with β-thalassemia.

β-Thalassemia and Polycythemia vera : Targeting chronic stress erythropoiesis

NARCIS (Netherlands)

Crielaard, Bart J; Rivella, Stefano

β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective

thalassemia induced hypercoagulability

African Journals Online (AJOL)

Subjects and methods: Venous blood samples were collected from ten normal control subjects and thirty patients with beta-thalassemia major (divided into two groups, splenectomized and unsplenectomized). To all studied individuals, plasma substance P and sP-selectin were assayed by an enzyme linked Immunosorbent ...

ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Amit Kumar Tiwari

2016-11-01

Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

Energy Technology Data Exchange (ETDEWEB)

Karimi, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Hematology Research Center, Department of Pediatrics, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: karimim@sums.ac.ir; Rasekhi, A.R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: rasekhia@sums.ac.ir; Rasekh, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: Rasekhm@sums.ac.ir; Nabavizadeh, S.A. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: nabavia@gmail.com; Assadsangabi, R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: assadsangabi@yahoo.com; Amirhakimi, G.H. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: amirhakimig@sums.ac.ir

2009-06-15

Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

International Nuclear Information System (INIS)

Karimi, M.; Rasekhi, A.R.; Rasekh, M.; Nabavizadeh, S.A.; Assadsangabi, R.; Amirhakimi, G.H.

2009-01-01

Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

International Nuclear Information System (INIS)

Karimi, Mehran; Bagheri, Mohammad Hadi; Tahmtan, Mehdi; Shakibafard, Alireza; Rashid, Murtaza

2009-01-01

Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 ± 133.97 and 126.29 ± 53.98 mm 3 , respectively. Average spleen lengths in case and control groups were 10.71 ± 1.52 and 10.60 ± 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients

Growth and endocrine disorders in thalassemia: The international network on endocrine complications in thalassemia (I-CET position statement and guidelines

Directory of Open Access Journals (Sweden)

Vincenzo De Sanctis

2013-01-01

Full Text Available The current management of thalassemia includes regular transfusion programs and chelation therapy. It is important that physicians be aware that endocrine abnormalities frequently develop mainly in those patients with significant iron overload due to poor compliance to treatment, particularly after the age of 10 years. Since the quality of life of thalassemia patients is a fundamental aim, it is vital to monitor carefully their growth and pubertal development in order to detect abnormalities and to initiate appropriate and early treatment. Abnormalities should be identified and treatment initiated in consultation with a pediatric or an adult endocrinologist and managed accordingly. Appropriate management shall put in consideration many factors such as age, severity of iron overload, presence of chronic liver disease, thrombophilia status, and the presence of psychological problems. All these issues must be discussed by the physician in charge of the patient′s care, the endocrinologist and the patient himself. Because any progress in research in the field of early diagnosis and management of growth disorders and endocrine complications in thalassemia should be passed on to and applied adequately to all those suffering from the disease, on the 8 May 2009 in Ferrara, the International Network on Endocrine Complications in Thalassemia (I-CET was founded in order to transmit the latest information on these disorders to the treating physicians. The I-CET position statement outlined in this document applies to patients with transfusion-dependent thalassemia major to help physicians to anticipate, diagnose, and manage these complications properly.

Thalassemia and hemoglobinopathies in Southeast Asian newborns: diagnostic assessment using capillary electrophoresis system.

Science.gov (United States)

Srivorakun, Hataichanok; Fucharoen, Goonnapa; Changtrakul, Yossombat; Komwilaisak, Patcharee; Fucharoen, Supan

2011-04-01

We have investigated the Capillarys 2 Hemoglobin testing system to assist in presumptive diagnosis of thalassemia and hemoglobinopathies commonly found in Southeast Asia. Study was conducted on 226 newborns. Hematological parameters were recorded and Hb profiles were examined on the Capillarys 2 Hemoglobin analyzer (SEBIA). DNA analyses were used to establish the final diagnoses. Among 226 newborns examined, 122 had thalassemias with 17 different genotypes. The capillary electrophoresis system could provide useful data for presumptive diagnoses of cases, especially those with Hb E and α-thalassemia. Hb E was found to be 2.6-6.2% in heterozygote whereas Hb Bart's were clearly observed in cases with compound heterozygous or homozygous α(+)-thalassemia and heterozygous α(0)-thalassemia. Hb H disease and other forms of α-thalassemia could be differentiated based on the presence of Hb Bart's and its percentage. The capillary electrophoresis system is applicable to newborn screening for common forms of thalassemia in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Thalassemia intermedia: An overview

African Journals Online (AJOL)

Rabah M. Shawky

2012-04-25

Apr 25, 2012 ... abnormalities occur due to massive expansion of erythroid bone marrow activity ..... [3] Savage D, Wood NAP, Bidwell JL, Fitches A, Old JM, Hui KM. Detection of b-thalassemia mutations using DNA heteroduplex generator ...

Hydroxyurea for hemoglobin E/β-thalassemia: a systematic review and meta-analysis.

Science.gov (United States)

Algiraigri, Ali H; Kassam, Aliya

2017-12-01

Hemoglobin E-beta thalassemia (Hb E/β-thalassemia) is a distinct, yet common, type of β-thalassemia, in which the patient co-inherits a β-thalassemia allele from one parent, and a structural variant, Hb E, from the other parent. This co-inheritance leads to remarkable clinical heterogeneity, varying degrees of chronic anemia, and a wide spectrum of complications due to ineffective erythropoiesis and iron overload. Hydroxyurea (HU), an oral chemotherapeutic drug, is expected to decrease disease severity. To assess the clinical efficacy and safety of HU in Hb E/β-thalassemia patients. We searched MEDLINE, EMBASE, Cochrane databases, and major preceding conferences for studies that assessed HU in Hb E/β-thalassemias patients. The effect size was estimated as a proportion (responder/sample size). Qualities of eligible studies were assessed using NIH tools. A total of five [one randomized clinical trial (RCT) and four observational] studies involving 106 patients were included. HU was associated with a significant RR of 46% with no statistical heterogeneity. No serious adverse effects were reported. Patients with Hb E/β-thalassemia may benefit from a trial of HU, though large RCTs assessing efficacy should be conducted to confirm the findings of this meta-analysis and to assess long-term toxicity and response sustainability.

Echocardiographic evaluation of thalassemia intermedia patients in Duhok, Iraq.

Science.gov (United States)

Mohammad, Ameen Mosa

2014-12-11

Cardiac complications are among the most serious problems of thalassemia intermedia patients. The current study was initiated to address the latter issue through the study of the echocardiographic findings and correlate it with clinical characteristics of thalassemia intermedia patients in Duhok, Kurdistan region, Iraq. An echocardiographic assessment of 61 beta-thalassemia intermedia cases was performed. It included 30 males and 31 females, with a mean age 19.6 ± 7.5 years. The standard echostudy of two-dimension and M-mode measurements of cardiac chambers were done. The continuous doppler regurgitant jet of tricuspid and pulmonary valves were recorded. Left ventricle diastolic function was assessed by pulsed doppler of mitral valve inflow. To correlate the clinical with echocardiographic findings, patients were divided, according to tricuspid regurgitant velocity, into three groups (intermedia patients. Therapeutic trails targeting these complications are indicated, and echocardiographic assessment is necessary to be offered early for thalassemia intermedia.

Psychometric properties of the Specific Thalassemia Quality of Life Instrument for adults

Directory of Open Access Journals (Sweden)

Lyrakos GN

2012-07-01

Full Text Available Georgios N Lyrakos,1,2 Demetra Vini,2 Helen Aslani,2 Marouso Drosou-Servou212nd Department of Anesthesiology, School of Medicine, University of Athens, Pain Clinic, Attikon University Hospital, 2Thalassemia Unit, General Hospital of Nikaia Ag. Panteleimon, Athens, GreeceBackground: No specific questionnaire has been developed to assess the health-related quality of life of thalassemia patients. Thus, the main objective of this study was to develop, according to psychometric standards, a self-administered Specific Thalassemia Quality of Life Instrument (STQOLI for adult patients.Methods: First, a qualitative phase was conducted to generate items and identify domains using the critical analysis incident technique and a literature review. A list of easily comprehensible, non-redundant items was defined using the Delphi technique and a pilot study on ten thalassemia patients. This phase involved both patients and experts. The second step was a quantitative validation phase comprising a study of 128 thalassemia patients in a single hospital. It was designed to select items, identify dimensions, and measure reliability and internal and concurrent validity. The psychometric and scaling properties of the proposed 41-item Specific Thalassemia Quality of Life Instrument were then assessed among patients recruited from the Thalassemia Unit at the General Hospital of Nikaia, Greece.Results: The final questionnaire had 41 items comprising four main domains and one global item about general health. The factorial structure was satisfactory (loading > 0.40 on each factor of the four domains for all items. Interscale correlations ranged from 0.06 to 0.78, Cronbach's α-coefficients were 0.78 for the psychosocial domain, 0.77 for the chelation domain, 0.72 for the transfusion domain, 0.81 for the disease and symptoms domain, and 0.840 for the total score of the questionnaire.Conclusion: The 41-item Specific Thalassemia Quality of Life Instrument seems to be a

Carrier screening for thalassemia and hemoglobinopathies in Canada.

Science.gov (United States)

Langlois, Sylvie; Ford, Jason C; Chitayat, David

2008-10-01

To provide recommendations to physicians, midwives, genetic counsellors, and clinical laboratory scientists involved in pre-conceptional or prenatal care regarding carrier screening for thalassemia and hemoglobinopathies (e.g., sickle cell anemia and other qualitative hemoglobin disorders). To determine the populations to be screened and the appropriate tests to offer to minimize practice variations across Canada. The Medline database was searched for relevant articles published between 1986 and 2007 on carrier screening for thalassemia and hemoglobinopathies. Key textbooks were also reviewed. Recommendations were quantified using the Evaluation of Evidence guidelines developed by the Canadian Task Force on Preventive Health Care. The evidence collected from the Medline search was reviewed by the Prenatal Diagnosis Committee of the Canadian College of Medical Geneticists (CCMG) and the Genetics Committee of the Society of Obstetricians and Gynaecologists of Canada (SOGC). Screening of individuals at increased risk of being carriers for thalassemia and hemoglobinopathies can identify couples with a 25% risk of having a pregnancy with a significant genetic disorder for which prenatal diagnosis is possible. Ideally, screening should be done pre-conceptionally. However, for a significant proportion of patients, the screening will occur during the pregnancy, and the time constraint for obtaining screening results may result in psychological distress. This guideline does not include a cost analysis. 1. Carrier screening for thalassemia and hemoglobinopathies should be offered to a woman if she and/or her partner are identified as belonging to an ethnic population whose members are at higher risk of being carriers. Ideally, this screening should be done pre-conceptionally or as early as possible in the pregnancy. (II-2A) 2. Screening should consist of a complete blood count, as well as hemoglobin electrophoresis or hemoglobin high performance liquid chromatography. This

Thermogravimetric analysis coupled with chemometrics as a powerful predictive tool for ß-thalassemia screening.

Science.gov (United States)

Risoluti, Roberta; Materazzi, Stefano; Sorrentino, Francesco; Maffei, Laura; Caprari, Patrizia

2016-10-01

β-Thalassemia is a hemoglobin genetic disorder characterized by the absence or reduced β-globin chain synthesis, one of the constituents of the adult hemoglobin tetramer. In this study the possibility of using thermogravimetric analysis (TGA) followed by chemometrics as a new approach for β-thalassemia detection is proposed. Blood samples from patients with β-thalassemia were analyzed by the TG7 thermobalance and the resulting curves were compared to those typical of healthy individuals. Principal Component Analysis (PCA) was used to evaluate the correlation between the hematological parameters and the thermogravimetric results. The thermogravimetric profiles of blood samples from β-thalassemia patients were clearly distinct from those of healthy individuals as result of the different quantities of water content and corpuscular fraction. The hematological overview showed significant decreases in the values of red blood cell indices and an increase in red cell distribution width value in thalassemia subjects when compared with those of healthy subjects. The implementation of a predictive model based on Partial Least Square Discriminant Analysis (PLS-DA) for β-thalassemia diagnosis, was performed and validated. This model permitted the discrimination of anemic patients and healthy individuals and was able to detect thalassemia in clinically heterogeneous patients as in the presence of δβ-thalassemia and β-thalassemia combined with Hb Lepore. TGA and Chemometrics are capable of predicting ß-thalassemia syndromes using only a few microliters of blood without any pretreatment and with an hour of analysis time. A fast, rapid and cost-effective diagnostic tool for the β-thalassemia screening is proposed. Copyright © 2016 Elsevier B.V. All rights reserved.

Parathyroid hormone in pediatric patients with β-thalassemia major ...

African Journals Online (AJOL)

The aim of the study is to estimate the level of serum parathyroid hormone and its relation to bone mineral density in transfusion dependent beta-thalassemia major children. Subjects and methods: We measured serum calcium, phosphorus and parathyroid hormone in a sample of pediatric patients with thalassemia, ...

Marrow heterotopia in thalassemia

Energy Technology Data Exchange (ETDEWEB)

Papavasiliou, C.; Gouliamos, A.; Andreou, J.

1986-05-01

The subject of marrow heterotopia has been reviewed on the basis of 15 cases suffering from thalassemia. Other cases reported in the literature were also reviewed. Using conventional radiography, scintigraphy, computerized tomography and myelography, 17% of the cases admitted into the hospital with the diagnosis of Thalassemia, were found to have macroscopic masses of marrow heterotopia. The most common site of development of these masses was the costovertebral gutter, followed by the anterior end of the ribs and the extradural space of the spinal canal. In one case, masses were located in the maxillary antra. The clinical implications, the pathogenesis of the masses and the differential diagnosis from other tumour-like entities are discussed. Three patients presented with symptoms and signs of spinal cord compression. All three patients were treated satisfactorily with small doses of radiotherapy.

The Prevention of Thalassemia

Science.gov (United States)

Cao, Antonio; Kan, Yuet Wai

2013-01-01

The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598

Birth of healthy children after preimplantation diagnosis of β-thalassemia

Institute of Scientific and Technical Information of China (English)

焦泽旭; 庄广伦; 周灿权; 舒益民; 李洁; 梁晓燕

2004-01-01

Background Clinical programs for preventing β-thalassemia are presently based on prospective carrier screening and prenatal diagnosis. This paper report an achievement of a pregnancy with unaffected embryos using in vitro fertilization and embryo transfer (IVF-ET), in combination with preimplantation genetic diagnosis (PGD), for a couple at risk of having children with β-thalassemia.Methods A couple carrying different thalassemia mutations, both a codon 41-42 mutation and the IVS Ⅱ 654 mutation, received standard IVF treatment, with intracytoplasmic sperm injection, embryo biopsiy, single cell polymerase chain reaction (PCR) and DNA analysis. Only unaffected or carrier embryos were transferred to the uterine cavity. After confirmation of pregnancy, a prenatal diagnosis was performed.Results Of a total of 13 embryos analyzed for β-globin mutations, PGD indicated that 2 were normal,3 were affected, and 6 were carriers. Diagnosis could not be made in the other 2 embryos. Three embryos were transferred to the uterus on the third day after oocyte retrieval. Ultrasonography revealed a twin pregnancy with one blighted ovum. The prenatal genetic diagnosis revealed that both fetuses were unaffected, and two healthy boys were born, confirming the results of PGD.Conclusions We developed a single-cell based primer extension preamplification (PEP)-PCR assay for the detection of β-thalassemia mutations. The assays were efficient and accurate at all stages of the procedure, and resulted in the birth of PGD-confirmed β-thalassemia free children in China. PEP was used here in PGD for β-thalassemia.

Parathyroid hormone in pediatric patients with β-thalassemia major ...

African Journals Online (AJOL)

Mostafa El-Nashar

2016-04-09

Apr 9, 2016 ... 1. Introduction. Beta-thalassemia is an inherited anemia caused by unbalanced ... The work has been carried out in accordance with the World ... The life expectancy of patients with b-thalassemia has greatly improved with ...

Spectrum of α-thalassemia mutations in Qazvin Province, Iran

African Journals Online (AJOL)

use

2011-12-05

Dec 5, 2011 ... α-Thalassemia is a widespread inherited disease particularly prevalent in the middle East Asia population, including Iran. The aim of this study was to define the molecular spectrum and frequency of α-thalassemia mutations in prospective couples of Qazvin province. A total of 120,000 subjects were.

Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

Science.gov (United States)

Shah, Parth S; Shah, Nidhi D; Ray, Hari Shankar P; Khatri, Nikunj B; Vaghasia, Ketan K; Raval, Rutvik J; Shah, Sandip C; Rao, Mandava V

2017-01-01

Background β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors. Purpose The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management. Patients and methods Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods. Results Of these (75) referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%). The majority of case types were of β-thalassemia minor (49, 65.33%), followed by HbE traits (6, 8.0%) and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33%) types and then HbE homozygous (2, 2.66%), as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34%) combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29%) followed by deletion 619bp (9, 13.23%) and c.79G>A (8, 11.76%) in our study group. Five cases (nos. 24, 27, 33, 58, and 71) exhibited coinheritance between β0/β+ (2), β0/β D (1), and c.124_127delTTCT/β+ or β0(2) affecting the Rajasthani and Gujarati populations in our study of the Western region of India. Conclusion We strongly recommend these Western populations for genetic screening before adopting reproductive technologies and interracial marital relations. PMID:28546763

Hematopoietic Stem Cell Transplantation in Thalassemia and Sickle Cell Anemia

Science.gov (United States)

Lucarelli, Guido; Isgrò, Antonella; Sodani, Pietro; Gaziev, Javid

2012-01-01

The globally widespread single-gene disorders β-thalassemia and sickle cell anemia (SCA) can only be cured by allogeneic hematopoietic stem cell transplantation (HSCT). HSCT treatment of thalassemia has substantially improved over the last two decades, with advancements in preventive strategies, control of transplant-related complications, and preparative regimens. A risk class–based transplantation approach results in disease-free survival probabilities of 90%, 84%, and 78% for class 1, 2, and 3 thalassemia patients, respectively. Because of disease advancement, adult thalassemia patients have a higher risk for transplant-related toxicity and a 65% cure rate. Patients without matched donors could benefit from haploidentical mother-to-child transplantation. There is a high cure rate for children with SCA who receive HSCT following myeloablative conditioning protocols. Novel non-myeloablative transplantation protocols could make HSCT available to adult SCA patients who were previously excluded from allogeneic stem cell transplantation. PMID:22553502

Prevalence of periodontal disease in children with leukemia disease and thalassemia

Directory of Open Access Journals (Sweden)

Hardianti Maulidita

2016-06-01

Full Text Available Various periodontal disease can occur in children and adolescents. Some can take place quickly and periodontal tissue damage. Several previous studies indicate that systemic diseases associated with periodontal disease in children. This study aims to determine the prevalence of periodontal disease in children with leukemia and thalassemia. The design study is a cross-sectional approach. Periodontal pocket depth measurements performed using the WHO standard of measurement. The samples in this study were drawn from the entire population using accidental sampling method. Sampled population was pediatric patients with leukemia and thalassemia. These patients were undergoing treatment in hospital Wahidin Sudirohusodo Hospital Makassar. During the study, children with leukemia as many as 18 patients and children with thalassemia by 8 patients. Distribution of pediatric patients suffering from leukemia by CPITN score; score of 2 as many as 10 patients (55.6%, a score of 1 as 6 patients (33.3%, and  score of 0 as many as 2 patients (11.1%. CPITN score in children with thalassemia; scores 2 in 1 patient (12.5%, a score of 1 as 6 patients (75%, and score of 0 by 1 patient (12.5%. Children who have leukemia and thalassemia, showed the rate of occurrence of different periodontal disease. Children with leukemia shows the level of periodontal disease is higher than in children with thalassemia disease.

Scintigraphic evaluation of bone involvement in beta thalassemia major

International Nuclear Information System (INIS)

Armijo, Soledad; Hidalgo, Pablo

2000-01-01

In this article, the authors describe a 19 year old man with beta-thalassemia major and back pain, who was studied with a Tc99m Metilendiphosphonate (Tc99m MDP) bone scan. This case shows many of the complications of beta-thalassemia major in the skeletal system. Also we can see some indirect signs of endocrinopathies associated (Au)

Risk of erectile dysfunction in transfusion-naive thalassemia men: a nationwide population-based retrospective cohort study.

Science.gov (United States)

Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

2015-04-01

Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction. This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities.

Phenotype-genotype correlation in β-thalassemia

Directory of Open Access Journals (Sweden)

R. Galanello

2011-12-01

Full Text Available The clinical manifestations of β-thalassemia are extremely heterogeneous, ranging from severe transfusion-dependent anemia, to the mild non transfusion dependent thalassemia intermedia and to the asymptomatic carrier state. The remarkable phenotypic variability is primary due to variations in the different globin genes (primary gene modifiers. The main pathophysiological determinant of the severity of β-thalassemia syndromes is the extent of a/non-a globin chain imbalance. Therefore, any factor capable of reducing the globin chain imbalance may have an ameliorating effect on the clinical picture. The most common mechanisms responsible of the amelioration of the phenotype are mild or silent β thalassemia alleles, coinheritance of a thalassemia, or of genetic determinants associated with increased g globin chain production. Rarely, other complex mechanisms including dominantly inherited β thalassemia, somatic deletion of β globin gene and coinheritance of extra a globin genes with heterozygous β thalassemia have been reported. In addition to the variability of the phenotype resulting from primary gene modifiers, other genetic factors (secondary gene modifiers, mapping outside the β and a globin cluster, may influence the disease complications. Among these factors the ones best so far defined are those affecting bilirubin, iron and bone metabolism. However, the new methods of DNA analysis (i.e. GWAS and related methods are expect expand the number of genes or gene variants involved in the phenotypic variability and in the response to treatment of β thalassemia. 从严重的输液依赖型贫血症到轻度非输液依赖性中间型地中海贫血，再到无症状携带状态，β地中海贫血的临床表现极度异源性。 由于不同珠蛋白基因（初级基因修饰因子）发生各种变异，主要表现为显著的表型变异。 �

Thalassemia in the United Arab Emirates: Why it can be prevented but not eradicated.

Directory of Open Access Journals (Sweden)

Sehjeong Kim

Full Text Available Thalassemia is a genetic blood disorder that causes abnormal hemoglobin. Hemoglobin is a protein in red blood cells that carries oxygen and is made of two proteins from four α-globin genes and two β-globin genes. A defect in one or more of these genes causes thalassemia. The treatment of thalassemia mostly depends on life-long blood transfusions and removal of excessive iron from the blood stream. Such tremendous blood consumption puts pressure on the national blood stock in many countries. In particular, in the United Arab Emirates (UAE, various forms of thalassemia prevention have been used and hence, the substantial reduction of the thalassemia major population has been achieved. However, the thalassemia carrier population still remains high, which leads to the potential increase in the thalassemia major population through carrier-carrier marriages. In this work, we investigate the long-term impact and efficacy of thalassemia prevention measures via mathematical modeling at a population level. To our best knowledge, this type of assessment has not been done before and there is no mathematical model that has investigated such a problem for thalassemia or any blood disorders at a population level. By using UAE data, we perform numerical simulations of our model and conduct sensitivity analysis of parameter values to see which parameter values affect most the dynamics of our model. We discover that the prevention measures can contribute to reduce the prevalence of the disease only in the short term but not eradicate the disease in the long term.

Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor

International Nuclear Information System (INIS)

Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.

2008-01-01

Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)

Insulin-like growth factor-1 levels in children with Beta-thalassemia minor

OpenAIRE

Mehran Karimi; Hamdollah Karamifar; Nargrs Sobhani

2008-01-01

Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH) / insulin growth factor-1 (IGF-1) axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in he...

Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran.

Science.gov (United States)

Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat; Monavari, Seyed Hamidreza

2017-03-01

Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures.

Mental health status in patients with Thalassemia major in Iran

Directory of Open Access Journals (Sweden)

Mahdieh Nasiri

2014-02-01

Full Text Available Thalassemia major is a genetic blood disorder that is detected by the symptoms of chronic and severe anemia, enlarged liver and spleen, failure to thrive and bone deformities in particular deformed face and bulging forehead. Due to changes in physical appearance, the disease can influence on other aspects of the patient's life, so the disease can have a strong impact on the mental health of these patients and their families. Previous studies showed that 80% of patients with thalassemia major have at least one psychiatric disorder. The aim of this paper was to review the mental health status of patients with Beta-thalassemia major in Iran.

The Thalassemia International Federation: a global public health paradigm

Directory of Open Access Journals (Sweden)

Elpidoforos S. Soteriades

2014-09-01

Full Text Available Many international organizations are struggling today to coordinate limited economic and human resources in support of governments’ efforts to advance public health around the world. The United Nations and the World Health Organization, along with others play a pivotal role in this global effort. Furthermore, during the past few decades an increasingly higher percentage of global efforts on public health are carried out by specific health initiatives, international projects and non-governmental patient-oriented organizations. The Thalassemia International Federation (TIF is one such organization focusing on the control of thalassemia around the world. The current paper aims at presenting a comprehensive overview of the mission, goals, objectives and activities of this organization. Our ultimate goal is to highlight TIF’s public health paradigm and diffuse its success at an international levels for others to follow. TIF is devoted to disseminating information, knowledge, experience and best practices around the world to empower patients with thalassemia and their relatives, support health professionals providing care to such patients and promote national and international policies, which secure equal access to quality care for all patients with thalassemia.

Thalassemia and hemoglobinopathies in Thua Thien Hue Province, Central Vietnam.

Science.gov (United States)

Nguyen, Hoa Van; Sanchaisuriya, Kanokwan; Nguyen, Dung; Phan, Hoa Thi Thuy; Siridamrongvattana, Sirivara; Sanchaisuriya, Pattara; Fucharoen, Supan; Fucharoen, Goonnapa; Schelp, Frank P

2013-01-01

A community-based assessment of thalassemias and hemoglobinopathies was conducted at the Thua Thien Hue Province, Central Vietnam. By cluster sampling, a total of 410 pregnant women attending the antenatal care service at 30 commune health centers were recruited consecutively from September 2011 to June 2012. Hemoglobin (Hb) analysis was performed using an automated Hb analyzer. α-Thalassemia (α-thal) genes were identified by polymerase chain reaction (PCR)-based techniques. Out of the 410 pregnant women, 2.7% carried α(0)-thal and 1.2% were β-thal carriers. One woman with the - -(THAI) deletion was also found. Among the females under survey, structural Hb variants with 3.2% Hb E [β26(B8)Glu→Lys, GAG>AAG; HBB: c.78G>C] and 3.7% Hb Constant Spring [Hb CS; α142, Term→Gln, TAA>CAA (α2); HBA2: c.427T>C] were found. Assessing the frequency of thalassemias and hemoglobinopathies by ethnicity, Kinh (Vietnamese) and ethnic minority groups, Hb CS with a high frequency of 24.0% was observed in the ethnic minority groups. These results provide basic population-based information, are useful not only for implementing measures for prevention and control of thalassemias in the region but also for studying the importance of thalassemias and hemoglobinopathies in ethnic minorities within Southeast Asia.

Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

Directory of Open Access Journals (Sweden)

Shah PS

2017-05-01

Full Text Available Parth S Shah,1 Nidhi D Shah,2 Hari Shankar P Ray,3 Nikunj B Khatri,3 Ketan K Vaghasia,3 Rutvik J Raval,4 Sandip C Shah,3 Mandava V Rao5 1Department of Medicine, Lahey Hospital and Medical Center, Boston, MA, 2Department of Pediatrics, Nassau University Medical Centre, New York, NY, USA; 3Supratech Micropath Laboratory and Research Institute, 4Department of Zoology, 5School of Sciences, Gujarat University, Ahmedabad, Gujarat, India Background: β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors.Purpose: The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management.Patients and methods: Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods.Results: Of these (75 referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%. The majority of case types were of β-thalassemia minor (49, 65.33%, followed by HbE traits (6, 8.0% and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33% types and then HbE homozygous (2, 2.66%, as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34% combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29% followed by deletion 619bp (9, 13.23% and c.79G>A (8, 11

Extramedullary hematopoiesis and paraplegia in a patient with hemoglobin e-Beta thalassemia.

Science.gov (United States)

Alam, M R; Habib, M S; Dhakal, G P; Khan, M R; Rahim, M A; Chowdhury, A J; Mahmud, T K

2010-07-01

Extramedullary hematopoiesis (EMH) occurs in patients with various hematologic disorders involving a chronic increase in the production of red blood cells, and is often associated polycythemia vera and sickle cell anaemia, but is less common with thalassemia especially with hemoglobin E-beta thalassemia. Spinal cord compression due to EMH is a extremely rare complication of thalassemia and may present with paraparesis or paraplegia with or without sensory impairment. Treatment options mostly include surgery and/or radiotherapy. Whereas cases presenting with paraplegia have been treated with either surgery or radiotherapy with equal frequency and efficacy, almost all reported cases with paraplegia have been treated with surgery with or without radiation therapy. We hereby report a case of hemoglobin E-beta thalassemia with paraplegia treated successfully with radiotherapy.

Recent trends in the gene therapy of β-thalassemia

Directory of Open Access Journals (Sweden)

Finotti A

2015-02-01

Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

Serum zinc level in thalassemia

International Nuclear Information System (INIS)

Keikhaei, B.; Badavi, M.; Pedram, M.; Zandian, K.

2010-01-01

To compare serum zinc level between Thalassemia Major (TM) patients and normal population at Shafa Hospital in South West of Iran. A total of 25 male and 36 female of TM patients were enrolled in this study. Out of 61 patients thirty were treated by deferroxamine (DFO) and 31 were on the combination of DFO and deferiprone (DEF) protocol therapy. Sixty normal subjects of the matching age and gender were recruited as controls. From each patient and control group 2 ml of blood was taken in fasting condition. Cell blood count and serum zinc were carried out for both thalassemia patients and normal subjects. The mean age of patients and control group was 15+- 5 years. Mean serum zinc level was 68.97+- 21.12 mu g/dl, 78.10-28.50 mu g/dl, and 80.16+- 26.54 mu g/dl in the TM with DFO, TM with DFO + DEF combination protocol and control group respectively. There was no significant correlation between patients and control group. However 50 percent of TM with DFO, 38.7 percent of TM with DFO + DEF and 32.8 percent of control group had hypozincemia. Nearly 40 to 50 percent of TM patients and one third of normal subjects are suffering from hypozincemia. This study shows that low level of serum zinc is a health problem in both thalassemia patients and normal population in South West of Iran. (author)

Beta-thalassemia intermedia associated with moyamoya syndrome.

Science.gov (United States)

Göksel, Basak Karakurum; Ozdogu, Hakan; Yildirim, Tulin; Oğuzkurt, Levent; Asma, Suheyl

2010-07-01

Moyamoya syndrome (MMS) is a progressive disorder. We report a 19-year-old boy with beta-thalassemia who presented with a left hemiparesis. Brain MRI showed old middle cerebral artery and left frontal subcortical white matter infarcts. Brain magnetic resonance angiography and digital subtraction angiography revealed occlusion of the bilateral internal carotid arteries with a rich network of basal collateral vessels. To our knowledge this is the third report of beta-thalassemia intermedia and MMS, and the first report of a patient in Turkey. It emphasizes the potential for cerebral infarct due to anemia, protein S and thrombocytosis.

The marrow heterotopia in thalassemia

International Nuclear Information System (INIS)

Papavasiliou, C.; Gouliamos, A.; Andreou, J.

1986-01-01

The subject of marrow heterotopia has been reviewed on the basis of 15 cases suffering from thalassemia. Other cases reported in the literature were also reviewed. Using conventional radiography, scintigraphy, computerized tomography and myelography, 17% of the cases admitted into the hospital with the diagnosis of Thalassemia, were found to have macroscopic masses of marrow heterotopia. The most common site of development of these masses was the costovertebral gutter, followed by the anterior end of the ribs and the extradural space of the spinal canal. In one case, masses were located in the maxillary antra. The clinical implications, the pathogenesis of the masses and the differential diagnosis from other tumour-like entities are discussed. Three patients presented with symptoms and signs of spinal cord compression. All three patients were treated satisfactorily with small doses of radiotherapy. (orig.)

Relationship between Personality Traits and Happiness in Patients with Thalassemia

Directory of Open Access Journals (Sweden)

Babollah Bakhshipour

2014-12-01

Full Text Available Background: The aim of this study was determining the relationship between personality traits and happiness in patients with major thalassemia. Materials and Methods: The design of this study was descriptive (correlational study. The target population of this study was all under-treated patients with major thalassemia in Amirkola thalassemia center in 2011. Among these patients, 150 patients were sampled using simple random sampling method and Morgan's table. The data were analyzed by means of calculating Pearson correlation coefficients and multiple linear regression analysis. The patients were asked to complete NEO-five factor Inventory (short form and Oxford happiness inventory. Results: Based on the results, the coefficient of regression analysis of NEO personality factors (big five and happiness was 0.45, which shows a linear relationship between personality factors of NEO and happiness in patients with thalassemia. Thus, there is a statistically significant relationship among personality traits (neuroticism, extroversion, openness, agreeableness, conscientiousness and happiness. Conclusion: Among personality traits, extroversion, flexibility, agreeableness and conscientiousness had positive statistically meaningful relationship with happiness i.e. patients with lower scores in neuroticism, were happier.

Effects of α-Thalassemia on HbA1c Measurement.

Science.gov (United States)

Xu, Anping; Ji, Ling; Chen, Weidong; Xia, Yong; Zhou, Yu

2016-11-01

α-Thalassemia is a benign condition that is often present in patients with diabetes mellitus. Here, we evaluated the effects of different genotypes α-thalassemia on HbA 1c measurement. A total of 189 samples from nondiabetic patients were analyzed. HbA 1c analysis was performed by ion-exchange high-performance liquid chromatography, boronate affinity HPLC, immunoassay, and capillary electrophoresis. Fasting glucose, fructosamin, and HbA 2 were also performed. All samples were confirmed by genotyping for thalassemia. In patients with two or three functional α-genes, HbA 1c values were not significantly different from those of controls (P > 0.05); however, in individuals with α-thalassemia with one functional α-gene (i.e., HbH disease), HbA 1c levels were significantly different from those of controls (P 0.05). In this study, HbA 1c values in samples from individuals with two or three functional α-genes basically reflected the normal mean blood glucose level, while those in samples from individuals with one functional α-gene did not. © 2016 Wiley Periodicals, Inc.

Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

Science.gov (United States)

Calloway, Cassandra

2016-01-01

BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

Iron metabolism in heterozygotes for hemoglobin E (HbE), alpha-thalassemia1, or beta-thalassemia and in compound heterozygotes for HbE/ beta-thalassemia

NARCIS (Netherlands)

Zimmermann, M.B.; Fucharoen, S.; Winichagoon, P.; Sirankapracha, P.; Zeder, C.; Gowachirapant, S.; Judprasong, K.; Tanno, T.; Miller, J.L.; Hurrell, R.F.

2008-01-01

BACKGROUND: Despite large populations carrying traits for thalassemia in countries implementing universal iron fortification, there are few data on the absorption and utilization of iron in these persons. OBJECTIVE: We aimed to determine whether iron absorption or utilization (or both) in women

Factors associated with continuing emergence of β-thalassemia major despite prenatal testing: a cross-sectional survey

Directory of Open Access Journals (Sweden)

Al Sabbah H

2017-09-01

Full Text Available Haleama Al Sabbah,1 Sarah Khan,1 Abdallah Hamadna,2 Lamia Abu Ghazaleh,2 Anwar Dudin,2 Bashar Adnan Karmi3 1College of Natural and Health Sciences, Zayed University, Dubai, UAE; 2Faculty of Medicine, An-Najah National University, Nablus, Palestine; 3Thalassemia Patients’ Friends Society, Ramallah, Palestine Purpose: Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Methods: Convenience sampling was used to select 32 women (72 fetuses who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Results: Among the fetuses screened, 36 (50% were thalassemia carriers and 20 (28% had β-thalassemia; 17 (85% affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus (p<0.05. Conclusion: A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world. Keywords: abortion, Islam, fetus, awareness

Interaction of malaria with a common form of severe thalassemia in an Asian population

Science.gov (United States)

O'Donnell, A.; Premawardhena, A.; Arambepola, M.; Samaranayake, R.; Allen, S. J.; Peto, T. E. A.; Fisher, C. A.; Cook, J.; Corran, P. H.; Olivieri, Nancy F.; Weatherall, D. J.

2009-01-01

In many Asian populations, the commonest form of severe thalassemia results from the coinheritance of HbE and β thalassemia. The management of this disease is particularly difficult because of its extreme clinical diversity; although some genetic and adaptive factors have been identified as phenotypic modifiers, the reasons remain unclear. Because the role of the environment in the course of severe thalassemia has been neglected completely and because malaria due to both Plasmodium falciparum and Plasmodium vivax has been prevalent in Sri Lanka, we carried out a pilot study of patients with HbE β thalassemia that showed high frequencies of antibodies to both parasite species and that 28.6% of the children had DNA-based evidence of current infection with P. vivax. Malarial antibodies then were assessed in patients with HbE β thalassemia compared with those in age-matched controls. There was a significant increase in the frequency of antibodies in the thalassemic patients, particularly against P. vivax and in young children. There was also a higher frequency in those who had been splenectomized compared with those with intact spleens, although in the latter it was still higher than that in the controls. The thalassemic patients showed significant correlations between malaria antibody status and phenotype. Patients with HbE β thalassemia may be more prone to malaria, particularly P. vivax, which is reflected in their clinical severity. Because P. vivax malaria is widespread in Asia, further studies of its interaction with HbE β thalassemia and related diseases are required urgently as a part of ongoing thalassemia control programs. PMID:19841268

molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

International Nuclear Information System (INIS)

Kamel, S.A.L.M.

2004-01-01

β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle

Science.gov (United States)

Sakhnini, Lama

2003-05-01

In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.

Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

Science.gov (United States)

Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

2007-05-01

We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

High-resolution melting analysis for prenatal diagnosis of beta-thalassemia in northern Thailand.

Science.gov (United States)

Charoenkwan, Pimlak; Sirichotiyakul, Supatra; Phusua, Arunee; Suanta, Sudjai; Fanhchaksai, Kanda; Sae-Tung, Rattika; Sanguansermsri, Torpong

2017-12-01

High-resolution melting (HRM) analysis is a rapid mutation analysis which assesses the pattern of reduction of fluorescence signal after subjecting the amplified PCR product with saturated fluorescence dye to an increasing temperature. We used HRM analysis for prenatal diagnosis of beta-thalassemia disease in northern Thailand. Five PCR-HRM protocols were used to detect point mutations in five different segments of the beta-globin gene, and one protocol to detect the 3.4 kb beta-globin deletion. We sought to characterize the mutations in carriers and to enable prenatal diagnosis in 126 couples at risk of having a fetus with beta-thalassemia disease. The protocols identified 18 common mutations causing beta-thalassemia, including the rare codon 132 (A-T) mutation. Each mutation showed a specific HRM pattern and all results were in concordance with those from direct DNA sequencing or gap-PCR methods. In cases of beta-thalassemia disease resulting from homozygosity for a mutation or compound heterozygosity for two mutations on the same amplified segment, the HRM patterns were different to those of a single mutation and were specific for each combination. HRM analysis is a simple and useful method for mutation identification in beta-thalassemia carriers and prenatal diagnosis of beta-thalassemia in northern Thailand.

Posterior transverse interarch discrepancy on HbE β thalassemia patients

Directory of Open Access Journals (Sweden)

Yuniar Zen

2011-03-01

Full Text Available Background: One of the symptoms that often arises on thalassemia patients is disharmony dentofacial, class II skeletal malocclusion, as a result of the malrelation of maxilla and mandible. This malrelation can be affected by either maxillary bone position, dentoalveolar maxillary position, mandibular bone position, dentoalveolar mandibular position, or combinations of those components. Purpose: The study was aimed to examine whether there is posterior transverse interarch discrepancy on the HbE β thalassemia patients or not. Methods: This study is an observational research with cross-sectional design. The sample consisted of 33 HbE β thalassemia patients and 33 non-thalassemia patients as a control group aged 12–14 years. Lateral cephalogram was carried out and dental casts of maxillary and mandibular dental arches were also taken in all of those patients. Results: There was no difference between the maxillary intermolar width of the HbE β thalassemia patients and that of the normal ones, but the mandibular intermolar width of the HbE β thalassemia patients was significantly smaller than that of the normal ones. Beside that, posterior transverse interarch discrepancy of of the HbE β thalassemia patients was significantly greater than that of the normal ones, which showed great difference between maxillary and mandibular intermolar widths. Conclusion: Posterior transverse interarch discrepancy of the HbE β thalassemia patients was different from that of the normal ones. The dentofacial abnormalities on the HbE β thalassemia patients aged 12–14 years primarily was due to disporposional dentofacial growth in the vertical, sagittal, and transversal directions, especially in the posterior region.Latar belakang: Salah satu akibat yang sering timbul pada penderita talasemia adalah disharmoni dentofasial berupa maloklusi skeletal kelas II yang merupakan kelainan hubungan maksila dan mandibula. Malrelasi ini dapat dipengaruhi oleh posisi

Frequency of short stature in - thalassemia major patients

International Nuclear Information System (INIS)

Aslam, M.S.; Roshan, E.; Shahid, M.

2013-01-01

Objective: To determine the frequency of short stature in children with - thalassemia major receiving multiple transfusions at Military Hospital Rawalpindi. Study Design: Descriptive cross sectional study. Place and Duration of Study: Study was conducted at Military Hospital from 1st January 2010 to 30th June 2010. Subjects and Methods: Total 100 multi-transfused cases of - thalassemia major were included in the study. The height of every child was measured in centimeters using the same free-standing standard stadiometer, and the same technique by a single pediatrician. Results: Out of 100 patients of - thalassemia major 57.0% (n=57) were male while 43% (n=43) were female. Mean age was 9.94 years (SD +- 2.93) with range of 6 to 14 years. Mean height was 115.77 cm (SD +- 13.79) with range of 72.00 to 148.00 cm. 57.0% (n=57) were found to be short statured while 43.0% (n=43) were with normal height. Mean age of short statured patients was 11.61 +- 2.34 years and mean age of patients with normal height was 7.73 +- 2.05 years. Conclusion: The frequency of short stature in our patients with - thalassemia major receiving multiple transfusions is high. There is need to monitor the height of thalassemic children regularly and to improve the quality of care being provided to them so as to improve their quality of life. (author)

Two cloned β thalassemia genes are associated with amber mutations at codon 39

Science.gov (United States)

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

'Rakter dosh'--corrupting blood: The challenges of preventing thalassemia in Bengal, India.

Science.gov (United States)

Chattopadhyay, Sreeparna

2006-11-01

Thalassemia is an inherited blood disorder that has been receiving increasing attention in India. However, prevention of thalassemia in India continues to be difficult despite efforts of public health professionals and the government. Using West Bengal as a case study, this paper attempts to unravel some of the barriers to the prevention campaign and the consequent under utilization of the program. Lack of access, low awareness, low-risk perception and poverty are all important proximate constraints; however, one of the greatest barriers to the program is rooted in cultural notions of blood, marriage, identity, personhood and kinship in Bengali society. Blood is so deeply valued in the Bengali kinship system that this genetic mutation is perceived to be corrupting the blood (rakter dosh). Being a thalassemia carrier (i.e., having thalassemia minor) renders an individual unfit as a suitable marriage partner because of beliefs related to purity of blood, its association with the continuity of the lineage, and subsequent transmission of desirable traits to future generations. The risk of non-marriage affects women disproportionately, and parents are not inclined to test their daughters because of the possibility of not being able to marry them off to eligible suitors. The stigma associated with having thalassemia minor (TMI) is a deterrent to the disclosure of thalassemia status as well as to testing. Using anthropological theories and ethnographic methods, this paper focuses on the gendered process by which the diagnosis of a thalassemia carrier 'spoils' identities, thereby creating a disjuncture between the goals of the prevention program and people's need for social conformity, and ultimately between medical desirability and social desirability. The paper also suggests policies for enhancing the utilization of the program. Finally the conclusions from this study have potential applications for public health prevention programs that confront problems of stigma in

Hepatitis G virus infection and genotypes in Iraqi thalassemia patients

Directory of Open Access Journals (Sweden)

Maryam S Ibrahim

2015-01-01

Conclusion: the prevalence rate of HGV RNA in β-thalassemia major patients is 18.2%, while the prevalence rate of anti-HGV (past infection is 10.4%. No one of thalassemia patients had HGV RNA and anti-HGV simultaneously. The Gene sequence analysis of PCR products identified HGV genotypes 2 and 5 with percentage of 91.7% and 8.3% respectively

Molecular basis for dominantly inherited inclusion body β-thalassemia

International Nuclear Information System (INIS)

Thein, S.L.; Hesketh, C.; Wood, W.G.; Clegg, J.B.; Old, J.M.; Weatherall, D.J.; Taylor, P.; Temperley, I.J.; Hutchinson, R.M.

1990-01-01

Analysis of the molecular basis of dominantly inherited β-thalassemia in four families has revealed different mutations involving exon 3 of the β-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of β-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation

Prevalence of Pulmonary Hypertension in Patients with Thalassemia Intermedia in 2009: a single center's experience.

Science.gov (United States)

Moghaddam, Hassan Mottaghi; Badiei, Zahra; Eftekhari, Kambiz; Shakeri, Reza; Farhangi, Hamid

2015-07-01

There are various clinical symptoms of thalassemia intermedia, and they lie roughly between those of major and minor forms of the disease. Patients with thalassemia intermedia occasionally require blood transfusions. This renders them susceptible to pulmonary arterial hypertension (PAH) syndrome, which is one of the most significant complications in patients with thalassemia intermedia. PAH is more common in in thalassemia intermedia than in thalassemia major, and it may cause cardiac complications in patients who are older than 30. The objective of this study was to estimate the prevalence of PAH in thalassemia intermedia patients so that they can be referred expeditiously for treatment, thereby preventing the complications that occur later. This cross sectional study was conducted under the supervision of hematology department of Mashhad Medical University. Forty-one patients with thalassemia intermedia were examined at the Sarvar Thalassemia and Hemophilia Clinic of Mashhad. Electrocardiography, chest radiography, and echocardiography tests were performed for all of the patients by the same pediatric cardiologist. The data were processed by SPSS software, version 11.5, and the results were analyzed using chi-squared, Student's t, and Mann-Whitney tests. The mean age of the patients was 21.93±8.34. They had been under pediatric heart specialists' constant examination and treatment since their childhood when they were diagnosed with TI, and continue to receive regular follow-up care. The prevalence of pulmonary hypertension was 24% in our study population. In patients with thalassemia intermedia, the left ventricular (LV) mass indices were about 3-5 times higher than would be expected in a normal population. Patients with higher LV mass indices have a greater risk of developing pulmonary hypertension, and those with serum ferritin levels below 1000 ng/ml are less susceptible to diastolic dysfunction. Pulmonary hypertension is common in patients with thalassemia

Associations between a health-promoting lifestyle and quality of life among adults with beta-thalassemia major.

Science.gov (United States)

Maheri, Aghbabak; Sadeghi, Roya; Shojaeizadeh, Davoud; Tol, Azar; Yaseri, Mehdi; Ebrahimi, Mojtaba

2016-01-01

A health-promoting lifestyle (HPL) is a factor that affects the quality of life (QoL) in patients with beta-thalassemia (β-thalassemia). Due to the lack of studies of this issue, this study aimed to determine the association between HPL and QoL among adults with β-thalassemia. This cross-sectional (descriptive-analytic) study was conducted among 389 adult patients with β-thalassemia in Tehran, Iran. The research instrument included a questionnaire consisting of three parts: demographic items, the Short-Form Health Survey and the Health-Promoting Lifestyle Profile. The data were analyzed using SPSS version 23.0. The results were considered significant at the conventional pthalassemia; these four dimensions explained 37.9% of the variance in QoL. QoL and HPL were not at acceptable levels among patients with thalassemia. Therefore, educational interventions emphasizing spiritual growth, physical activity, and interpersonal relations are necessary for patients with thalassemia.

Thalassemia and malaria: new insights into an old problem.

Science.gov (United States)

Clegg, J B; Weatherall, D J

1999-01-01

The hemoglobinopathies are probably the world's most common genetic diseases: The World Health Organization has estimated that at least 5% of the population are carriers for one or other of the most serious forms, the alpha- and beta-thalassemias and the structural variant hemoglobins S, C, and E, which are found at polymorphic frequencies in many countries. All these hemoglobinopathies are believed to provide protection against malaria, and it is thought that, in malarial regions of the world, natural selection has been responsible for elevating and maintaining their gene frequencies, an idea first proposed 50 years ago by J.B.S. Haldane. Epidemiological studies undertaken in the 1950s on hemoglobin S in Africa provided support for the "malaria hypothesis," but until recently it has proved extremely difficult to verify it for the thalassemias. The application of molecular methods has, however, provided new opportunities to address this old question. Population and molecular genetic analysis of thalassemia variants, and microepidemiological studies of the relationship between alpha-thalassemia and malaria in the southwest Pacific, have provided unequivocal evidence for protection. Surprisingly, some of this protection appears to derive from enhanced susceptibility in very young thalassemic children to both Plasmodium falciparum and, especially, P. vivax, and this early exposure appears to provide the basis for better protection in later life.

Associations between a+-thalassemia and Plasmodium falciparum malarial infection in northeastern Tanzania

DEFF Research Database (Denmark)

Enevold, Anders; Alifrangis, Michael; Sanchez, Juan J

2007-01-01

BACKGROUND: The 2 most common hemoglobinopathies, sickle cell trait and alpha (+)-thalassemia, confer partial resistance to fatal forms of malaria, but the molecular basis for this protection is still not understood. Examination of the relationship between these traits and malaria transmission...... the prevalence of the 2 traits and malariometric indices were investigated by logistic regression. Short tandem repeat (STR) microsatellite allele frequencies were used to assess population substructuring. RESULTS: The frequency of alpha (+)-thalassemia ranged from 10%-25% in high-altitude villages (>1200 m......) to 45%-55% in low-altitude villages (thalassemia decreased by approximately 12% per 100-m increase in altitude (P

Paraplegia due to extramedullary hematopoiesis in thalassemia treated successfully with radiation therapy.

Science.gov (United States)

Malik, Monica; Pillai, Lakshmi S; Gogia, Nidhi; Puri, Tarun; Mahapatra, M; Sharma, Daya Nand; Kumar, Rajat

2007-03-01

Spinal cord compression due to extramedullary hematopoiesis (EMH) is a rare complication of thalassemia and generally presents as paraparesis with sensory impairment. Complete paraplegia is extremely rare in EMH due to thalassemia although it is known to occur in polycythemia vera and sickle cell anemia. Treatment options mostly include surgery and/or radiotherapy. Whereas cases presenting with paraparesis have been treated with either surgery or radiotherapy with equal frequency and efficacy, almost all reported cases with paraplegia have been treated with surgery with or without radiation therapy. We hereby report a case of thalassemia intermedia with paraplegia treated successfully with radiotherapy.

A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).

NARCIS (Netherlands)

Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.

2010-01-01

Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene

RAPID DETECTION OF -THALASSEMIA MUTATIONS IN THAILAND USING MULTIPLEX ARMS

Directory of Open Access Journals (Sweden)

D. Shimbhu

2017-11-01

Full Text Available The number of mutations underlining b-thalassemia generate a wide variety of different clinical phenotypes. An understanding of the genotype is important for medical personnel in order to provide proper counseling to patients and their families. Characterization of these mutations should aid the planning of a prenatal diagnosis program for bthalassemia. The heterogeneity of the mutations makes it difficult and time consuming to identify the mutation in some individuals. We developed a single-tube multiplex amplification refractory mutation system (multiplex ARMS to identify common ethnic- specific b-thalassemia mutations. Confirmation of multiplex ARMS results was carried out using direct sequencing. Three thousand three hundred twenty two people from Phitsanulok province were screened for the b-thalassemia trait by quantitation of HbA2 with microcolumn chromatography and the genotypes of mutations were characterized using multiplex ARMS and direct sequencing. We found that the deletion at codons 41/42 (-TCTT was the most frequent (48%, codon 17 (A®T (30%, -28 (A®G (6% and IVS-I-1(G®T (6% were the second and third in frequency respectively. A -87 (C®A mutation (4%, IVS II-654 (C®T (2%, codons 71/72 (+A (2% and codon 35 (C®A mutations (2% were also found. These techniques were found to be a valuable tool for analysis of b-thalassemia mutations because they are accurate, simple, and speedy in operation. The application for the diagnosis of severe thalassemia in high-risk pregnancies is promising.

Psychopathological tendencies and quality of life among patients with thalassemia

International Nuclear Information System (INIS)

Anwar, K.; Waqar, S.

2017-01-01

To explore the relationship between psychopathological tendencies and Quality of Life (QoL) among patients with Thalassemia major. Methodology: In this correlational study, data were collected from the blood transfusion dependent patients of beta-thalassemia major in Rawalpindi and Islamabad hospitals from September to December 2014. Urdu version of Worlds Health Organization Quality of Life Scale-BREF (WHOQOL-BREF) and Brief Symptom Inventory (BSI) methods were administered on 74 patients of thalassemia major. Pearson Product Correlation, Independent Sample t-test, One-way ANOVA and Post Hoc analysis were used. Results: There was higher levels of somatization, hostility and obsessive compulsive (OC) and lower levels of psychoticism. There was negatively affected social and psychological domains of life while comparatively better QoL related to environmental conditions of the patients. There was negative relationship between psychopathological tendencies and QoL among patients. Moreover, mother's education level negatively related with psychopathological tendencies among patients. Males scored high on depression and interpersonal sensitivity, whereas females scored high on anxiety, paranoid ideation and somatization. Female patients experienced better QoL as compared to male counterparts. Conclusion: There were higher degrees of psychopathological tendencies among patients with thalassemia major which affected their QoL mainly on social and psychological domains. (author)

Thalidomide has a significant effect in patients with thalassemia intermedia.

Science.gov (United States)

Li, YunShuan; Ren, Quan; Zhou, Yali; Li, Pingping; Lin, Wanhua; Yin, Xiaolin

2018-01-01

To investigate the effect of thalidomide in patients with thalassemia intermedia. We observed the effect of thalidomide in seven patients with thalassemia intermedia requiring blood transfusion. Four of the patients were transfusion-independent, and three patients were transfusion-dependent. For the four transfusion-independent patients, hemoglobin concentration increased significantly (≥2 g/dl) in three and moderately (1-2 g/dl) in one. After 3 months of treatment, hemoglobin concentration increased 3.2 ± 1.2 g/dl compared to pretreatment. Among the three transfusion-dependent patients, transfusion was terminated after one month of treatment in one patient and decreased >50% in the other two patients, accompanied by an increase in the average hemoglobin concentration. Thalidomide had a significant effect in patients with thalassemia intermedia. Further studies of a larger scale and more rigorous design are warranted.

Red cell distribution width in the diagnosis of iron deficiency anemia and thalassemia trait

International Nuclear Information System (INIS)

Adil, M.M.; Junaid, A.; Zaman, I.; Ishtiaque, Z.B.

2010-01-01

To evaluate diagnostic importance of Red Cell Distribution Width (RDW) in differentiating iron deficiency anemia from Thalassemia trait. A total of 100 cases aged 5 months to 50 years of either sex with diagnosed iron deficiency anemia or thalassemia trait were compared with respect to their RDW value. RDW value in iron deficiency anemia was between 36.2% to 55.2% (Mean 44.1%). The range of RDW in Thalassemia trait was 14.7% to 24.9% (Mean 19.8%). Conclusions The very high range of RDW in iron deficiency anemia as compared to slight elevation of the value in thalassemia trait in our study suggests that RDW value obtained from simple Complete Blood Counts (CBC) can help in differentiating the two pathologies. (author)

Critical appraisal of discriminant formulas for distinguishing thalassemia from iron deficiency in patients with microcytic anemia.

Science.gov (United States)

Urrechaga, Eloísa; Hoffmann, Johannes J M L

2017-08-28

Many discriminant formulas have been reported for distinguishing thalassemia trait from iron deficiency in patients with microcytic anemia. Independent verification of several discriminant formulas is deficient or even lacking. Therefore, we have retrospectively investigated discriminant formulas in a large, well-characterized patient population. The investigational population consisted of 2664 patients with microcytic anemia: 1259 had iron deficiency, 1196 'pure' thalassemia trait (877 β- and 319 α-thalassemia), 150 had thalassemia trait with concomitant iron deficiency or anemia of chronic disease, and 36 had other diseases. We investigated 25 discriminant formulas that only use hematologic parameters available on all analyzers; formulas with more advanced parameters were disregarded. The diagnostic performance was investigated using ROC analysis. The three best performing formulas were the Jayabose (RDW index), Janel (11T), and Green and King formulas. The differences between them were not statistically significant (p>0.333), but each of them had significantly higher area under the ROC curve than any other formula. The Jayabose and Green and King formulas had the highest sensitivities: 0.917 both. The highest specificity, 0.925, was found for the Janel formula, which is a composite score of 11 other formulas. All investigated formulas performed significantly better in distinguishing β- than α-thalassemia from iron deficiency. In our patient population, the Jayabose RDW index, the Green and King formula and the Janel 11T score are superior to all other formulas examined for distinguishing between thalassemia trait and iron deficiency anemia. We confirmed that all formulas perform much better in β- than in α-thalassemia carriers and also that they incorrectly classify approximately 30% of thalassemia carriers with concomitant other anemia as not having thalassemia. The diagnostic performance of even the best formulas is not high enough for making a final

Hepatic uptake of technetium-99m diphosphonate in thalassemia major

International Nuclear Information System (INIS)

Levy, H.M.; Smith, R.

1986-01-01

Two cases of thalassemia major are presented in which bone scintigraphy demonstrated diffuse hepatic uptake of Tc-99m diphosphonate. Although abnormal splenic and renal uptake of Tc-99m phosphates has been reported in patients with thalassemia major, hepatic uptake has not been reported previously. This scintigraphic finding is presumably due to increased iron deposition in the liver, resulting from increased iron turnover and retention in these patients and from multiple previous blood transfusions

Thalassemia, extramedullary hematopoiesis, and spinal cord compression: A case report

OpenAIRE

Bukhari, Syed Sarmad; Junaid, Muhammad; Rashid, Mamoon Ur

2016-01-01

Background: Extramedullary hematopoiesis (EMH) refers to hematopoiesis outside of the medulla of the bone. Chronic anemia states such as thalassemia can cause hematopoietic tissue to expand in certain locations. We report a case of spinal cord compression due to recurrent spinal epidural EMH, which was treated with a combination of surgery and radiotherapy. Pakistan has one of the highest incidence and prevalence of thalassemia in the world. We describe published literature on diagnosis and m...

Non-transfusion dependent thalassemia: translating evidence to guidelines

Directory of Open Access Journals (Sweden)

Afif R. Harb

2014-12-01

Full Text Available The thalassemias are a group of inherited disorders of hemoglobin synthesis characterized by various degrees of defective production of the α- or β-globin chains of adult hemoglobin A. Non-transfusion- dependent thalassemia (NTDT includes a group of thalassemia patients who do not require regular RBC transfusions for survival, but may require occasional transfusions due to infection or pregnancy or may require more regular transfusions later in life due to splenomegaly or other complications. Due to the rising phenomenon of global migration, this previously well-localized entity is currently spreading more and more worldwide reaching Northern America and Northern Europe. The clinical picture of NTDT is governed by the severity of the ineffective erythropoiesis and the chronic hemolytic anemia, which, in turn, lead to iron overload, hypercoagulability, and an array of clinical complications involving almost every organ system. Patients with NTDT suffer from complications that are distinct from those encountered in patients with transfusion- dependent thalassemia (TDT in addition to the complications shared by both TDT and NTDT. As a consequence, patients with NTDT deserve a care specifically tailored to their needs. In the care of patients with NTDT, aiming at a standardized yet personalized care is not an easy task especially that NTDT patients lie on a heterogeneous spectrum with a wide variability in their clinical presentation and response to therapy. Therefore, guidelines emerge as a necessity to answer the specific needs of NTDT patients and the clinicians caring for them. In this article, we summarize the complications most commonly associated with NTDT and the recommendations of the guidelines for the management of patients with NTDT, based on the best available evidence.

Diabetes in Patients with ß-thalassemia or other Hemoglobinopathies - Analysis from the DPV Database.

Science.gov (United States)

Warncke, K; Konrad, K; Kohne, E; Hammer, E; Ohlenschläger, U; Herrlinger, S; Jäger, A; Holl, R W

2016-11-01

Background: Diabetes mellitus is a common endocrinopathy in patients with thalassemia major, but the occurrence of hemoglobinopathies is rare in Germany and Western Europe. The longitudinal German-Austrian DPV (Diabetes Patienten Verlaufsdokumentation) registry allows a comprehensive characterization of this group of patients. Patients/methods: Patients from the DPV-registry agedthalassemia major or other hemoglobinopathies were compared to patients with type 1 diabetes (T1D) and type 2 diabetes (T2D) using the statistical software SAS 9.4. Results: 94 patients (0.13% of patients) with hemoglobinopathies are registered in DPV. 82.4% of 17 patients with thalassemia major, 100% of 12 patients with sickle cell disease (SCD) and >90% of 65 patients with other hemoglobinopathies receive insulin treatment. In the majority of patients with thalassemia major, hemosiderosis is documented. Patients with thalassemia major developed diabetes at a median age of 14.6 [IQR 8.4-18.0] years (9.0 years [5.3-12.5] in T1D; 18.7 years [14.2-25.6] in TD2; both pthalassemia major is probably caused by hemosiderosis due to polytransfusion, while patients with SCD/thalassemia minor are most likely affected by T1D. The high rate of hypoglycemia in patients with ß-thalassemia major may be caused by liver fibrosis and a lack of hepatic glycogen stores. © Georg Thieme Verlag KG Stuttgart · New York.

INFECTIONS IN THALASSEMIA AND HEMOGLOBINOPATHIES

Directory of Open Access Journals (Sweden)

Deborah Rund

2009-06-01

Full Text Available

Molecular Diagnostics of ?-Thalassemia

OpenAIRE

Atanasovska, B; Bozhinovski, G; Chakalova, L; Kocheva, S; Karanfilski, O; Plaseska-Karanfiska, D

2012-01-01

A high-quality hemoglobinopathy diagnosis is based on the results of a number of tests including assays for molecular identification of causative mutations. We describe the current diagnostic strategy for the identification of ?-thalassemias and hemoglobin (Hb) variants at the International Reference Laboratory for Haemoglobinopathies, Research Centre for Genetic Engineering and Biotechnology (RCGEB) ?Georgi D. Efremov,? Skopje, Republic of Macedonia. Our overall approach and most of the meth...

X-ray scattering signatures of β-thalassemia

International Nuclear Information System (INIS)

Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.

2009-01-01

X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1 , respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1 , in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

X-ray scattering signatures of β-thalassemia

Science.gov (United States)

Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.

2009-08-01

X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

X-ray scattering signatures of {beta}-thalassemia

Energy Technology Data Exchange (ETDEWEB)

Desouky, Omar S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt); Elshemey, Wael M. [Biophysics Department, Faculty of Science, Cairo University (Egypt)], E-mail: waelelshemey@yahoo.com; Selim, Nabila S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt)

2009-08-11

X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm{sup -1}, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; {beta}-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of {beta}-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm{sup -1}, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

Splenectomy for Children With Thalassemia: Total or Partial Splenectomy, Open or Laparoscopic Splenectomy.

Science.gov (United States)

Al-Salem, Ahmed H

2016-01-01

Splenomegaly and hypersplenism are common complications among children with thalassemia necessitating splenectomy. Thirty-six children (27 β-thalassemia major, 3 Hb H disease, and 6 thalassemia intermediate) had total splenectomy (11 laparoscopic and 13 open splenectomy) or partial splenectomy (12 patients). In the partial splenectomy group, 2 with Hb H required no transfusions. For those with β-thalassemia major who had partial splenectomy (9 patients), there was a reduction in the number of transfusions from a preoperative mean of 15.2 transfusions per year to a postoperative mean of 8.2 transfusions per year. Subsequently and as a result of increase in the size of splenic remnant, their transfusions increased, but none required total splenectomy. Twenty-four patients had total splenectomy (13 open and 11 laparoscopic splenectomy). Their postsplenectomy transfusions decreased from a preoperative mean of 17.8 transfusions per year to a postoperative mean of 10 transfusions per year. There was no mortality, and none developed postoperative sepsis or thrombotic complications. Total splenectomy is beneficial for children with β-thalassemia major and hypersplenism by reducing their transfusion requirements. Laparoscopic splenectomy is however more beneficial. Partial splenectomy reduces their transfusion requirements, but only as a temporary measure, and so it is recommended for children younger than 5 years of age.

Decreased bone uptake of technetium-99m polyphosphate in thalassemia major

International Nuclear Information System (INIS)

Valdez, V.A.; Jacobstein, J.G.

1980-01-01

Bone scans were performed with Tc-99m stannous polyphosphate on four patients with thalassemia major. Three of the scans show generalized decrease in skeletal uptake of the radiopharmaceutical, associated with renal enlargement and markedly increased renal radioactivity. The skeletal findings are consistent with the known bone abnormalities in thalassemia major, which are secondary to the extensive marrow hyperplasia and include loss of trabeculae and cortical thinning with consequent loss of bone mass. The increased renal uptake is probably due in part to the increased renal excretion (secondary to the poor bone uptake) and in part to the tubular dilatation and renal enlargement associated with thalassemia major. In addition, the presence of excessive amounts of iron in these patients may play a role in both the skeletal and renal findings

Alpha-thalassemia genetic testing: an important anemia diagnostic tool in patients of African heritage.

Science.gov (United States)

Dasanu, Constantin A

2010-01-01

Inherited alpha-thalassemia genotypes have been shown to have a rather high prevalence in some patient populations of African heritage. These genotypes lead to mild anemia with microcytic indices and a normal hemoglobin electrophoresis. In our outpatient department, we analyzed 54 consecutive patients of African descent with longstanding microcytic anemia, but no evidence of iron deficiency. We detected alpha-thalassemia gene deletions in 94 percent of these patients. Alpha-thalassemia genetic testing appears cost-effective in an otherwise unexplained, longstanding microcytic anemia in patients of African origin.

PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

Directory of Open Access Journals (Sweden)

Maria Cristina Rosatelli

2009-11-01

Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

Approaches to management of beta-thalassemia intermedia

Directory of Open Access Journals (Sweden)

Joseph E. Maakaron

2013-03-01

Full Text Available Thalassemia intermedia is a genetically diverse group of diseases that is the result of an imbalance in the production of the alpha and beta chains with ensuing chronic hemolysis, ineffective erythropoiesis, and iron overload.Resulting complications include bone changes, hypercoagulability, and end-organ damage due to iron overload. This decade has witnessed major breakthroughs in the management of thalassemia. In this article, we examine these novelties in therapy including iron chelation therapy, stem cell transplant, and gene therapy.Iron chelation therapy has been revolutionized with the advent of deferasirox, a once-daily oral iron chelator, that has been shown to be safe and efficacious.Gene therapy was also at the core of this revolution with the discovery of novel gene elements and viral vectors allowing for better control and improved outcomes.

Prevalence of Beta-Thalassemia in premarital screening in Al-Hassa, Saudi Arabia

International Nuclear Information System (INIS)

Al-Suliman, A.

2006-01-01

The Al-Hassa area is one of the regions in Saudi Arabia where hemoglobinopathies are prevalent. The Saudi Ministry of Health designed a protocol for premarital testing after the royal decree in December 2003. The protocol was implemented in a February 2004 order. The aim of this study was to determine the prevalence of beta-thalassemia trait among subjects coming for premarital screening in the Al-Hassa area. From February 2004 to November 2004, healthy subjects coming to six marriages consultation centers in the Al-Hassa area underwent routine mandatory tests. Subjects were considered to have beta-thalassemia trait if they had a mean corpuscular volume (MCV), 80 fL and/or a mean corpuscular hemoglobin (MCH) 3.2%. Venous blood was taken into ETDA tube and the complete blood count and red blood cell indices were measured by a Coulter automated cell counter on the same day of hemoglobin collection. Electrophoresis was done on cellulose acetate. All Saudi participants (n=8918), including 4218 (47.3%) males and 4700 (52.7%) females were screened. The prevalence of beta-thalassemia trait with high hemoglobin A2 and microcytic hypochromic anemia was 3.4% (307/8918). In countries with a high prelevance of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. With a 3.4% prevalence of beta-thalassemia trait in premarital couples, future comprehensive programs are needed to know the actual prevalence of beta-thalassemia in Al-Hassa. (author)

Evaluation of Discrimination Indices Validity for Screening of β-Thalassemia Trait

Directory of Open Access Journals (Sweden)

Ahmadi A.

2009-11-01

Full Text Available AbstractBackground and Objectives: β-thalassemia trait (β-TT and iron deficiency anemia (IDA are the most common forms of microcytic anemia. Screening of β-thalassemia trait is important for medical counseling before marriage and preventing β-thalassemia major birth results. The most common problem in screening -TT is differentiating it from IDA. The aim of this study was to define the sensitivity, specificity, and predictive values of some discrimination indices for screening of β-TT in a sample of such patients.Methods: A total of 82 patients with microcytic anemia (MCV< 80 fl were selected from Namazi Hospital, Shiraz, Iran, and 9 discrimination indices were calculated for them. The patients were divided intotwo groups: 42 patients with β-TT and 40 patients with IDA. The sensitivity, specificity, positive and negative predictive values and Youden,s index of each discrimination index were calculated for screening β-TT.Results: None of the discrimination indices showed 100% of sensitivity and specificity. But the Shin and Lal index, RDW index and RBC count showed the highest and valuable value for screening β-TT.Conclusion: Some discrimination indices like Shin and Lal index, RDW index and RBC index are valuable indices in screening β-TT.Keywords: Beta- Thalassemia; Anemia, Iron Deficiency.

[Results of hematopoietic stem cell transplantation in hemoglobinopathies: thalassemia major and sickle cell disease].

Science.gov (United States)

Hladun, R; Elorza, I; Olivé, T; Dapena, J L; Llort, A; Sánchez de Toledo, J; Díaz de Heredia, C

2013-08-01

The prevalence of hemoglobinopathies in Spain is increasing as a result of immigration. Thalassemia major presents with chronic hemolytic anemia that requires regular red blood cell transfusions within the first year of life. Patients with sickle cell disease suffer from chronic anemia, vasculopathy and progressive damage in almost any organ. There is decreased life expectancy in both conditions. Allogeneic hematopoietic stem cell transplantation represents the only potentially curative option. Seventeen patients (fourteen thalassemia major, and three sickle cell disease) underwent allogeneic hematopoietic stem cell transplantations. In the thalassemia group, nine donors were HLA-geno-identical siblings, two were partially matched related donors (one HLA allele mismatch), and three unrelated donors. All three patients with sickle cell disease were transplanted from HLA-geno-identical siblings. The source of stem cells was bone marrow in sixteen cases. Median patient age at transplant was six years (range: 1-16) in the thalassemia group, and twelve years (range: 8-15) in the sickle cell disease group. The graft was successful in all patients. Secondary graft rejection was observed in two thalassemia patients rendering them dependent on blood transfusions. Complete chimerism was observed in thirteen patients and, although mixed chimerism occurred in two, with all of them showing normal hemoglobin levels after transplantation and not requiring further transfusion support. Patients affected by sickle cell disease did not present with new vaso-occlusive crises, and stabilization of pulmonary and neurological function was observed. Chronic graft-versus-host disease was detected in three patients affected by thalassemia, and hypogonadotrophic hypogonadism in five patients. We conclude that for thalassemia major and sickle cell disease, allogenic hematopoietic stem cell transplantation from HLA-geno-identical siblings offers a high probability of complication-free survival

Improving adherence with deferoxamine regimen in thalassemia major using education

Directory of Open Access Journals (Sweden)

Gholamreza Pouladfar

2006-02-01

Full Text Available Background: Subcutaneous deferoxamine is the first line for management of iron overload in thalassemia major. There is a wide deferoxamine adherence variation in patients with thalassemia major. In order to assess the effect of education on patients and their parents, a cognitive approach was used. Methods: In a randomized control trial, 78 consecutive patients with thalassemia major were randomly divided into educational (38 cases, 50% male and 50% female and control (40 cases, 65% male and 35% female groups. Oral and practical education sessions for deferoxamine injection were planned. Deferoxamine usage, pump function, side effects, knowledge levels of the patients and their parents, and ferritin serum levels were assessed before and after the trail. The knowledge was also evaluated promptly after educational sessions. Results: the mean age of experimental and control groups were 14.6 and 13.0 years, respectively. There was no significant difference in age, sex and weight (P>0.05 at the end of the study, there was no significant change in the level of knowledge in both groups however, the patients who used deferoxamine at least 5 times a week were increased in the experimental group (P0.001. Conclusion: A cognitive approach had relatively significant effect on deferoxamine adherence. However, educational sessions had not dramatic change in knowledge levels of the patients and their parents, but oral and practical education produced a significant change in decreasing local side effects of subcutaneous deferoxamine in thalassemia major.

[Outcomes of pregnancy among women with alpha-thalassemia minor: A retrospective study of Pingguo county in Guangxi Zhuang Autonomous Region].

Science.gov (United States)

Pang, T; Guo, X F; Zhou, Y H; Qiu, X Q; Li, S; Liang, Z R; Qin, X L; Li, K H; Zeng, X Y

2017-12-10

Objective: To investigate the association between the value of α-thalassemia minor and the outcomes in pregnant women. Methods: A total of 445 pregnant women with α-thalassemia minor were selected as thalassemia group in the Pingguo County Maternal and Child Health Hospital of Guangxi from January 2011 to December 2015, with ratio of 1∶4 healthy pregnant women was randomly recruited as non-thalassemia group. Clinical characteristics and pregnancy outcomes of the two groups were retrospectively analyzed using methods including t test, χ (2) test, and logistic regression model and ROC curve. Results: There were no significant differences noticed in factors as age, BMI, gestational age and educational level of the two groups. Hemoglobin of the thalassemia group was significantly lower than that of the non-thalassemia group ( P pregnancy outcomes was comparable on parameters as preterm birth, stillbirth, macrosomia. Findings from the unconditional logistic regression showed that pregnancy complicated with α-thalassemia minor appeared a risk for both newborns with low birth weight (a OR =2.29, 95% CI : 1.32-3.95) and small for date infant (a OR = 2.11, 95% CI : 1.16-3.84). The ROC curve showed that α-thalassemia minor combined with multiple indicators presented a certain predictive value on neonatal birth weight. Conclusion: Pregnancy complicated with α-thalassemia minor was likely to increase the risk of birth weight loss in newborns, suggesting that prenatal care for pregnant women with thalassemia be strengthened, in order to reduce the incidence of adverse pregnancy outcomes.

Recent patents and technology transfer for molecular diagnosis of β-thalassemia and other hemoglobinopathies.

Science.gov (United States)

Breveglieri, Giulia; Finotti, Alessia; Borgatti, Monica; Gambari, Roberto

2015-01-01

Biological tests and genetic analyses for diagnosis and characterization of hematological diseases in health laboratories are designed with the aim of meeting the major medical needs of hospitals and pharmaceutical companies involved in this field of applied biomedicine. Genetic testing approaches to perform diagnosis consist of molecular techniques, which should be absolutely reproducible, fast, sensitive, cheap, and portable. Biological tests analyzed involve adult/newborn subjects, whereas genetic analyses involve adult thalassemia patients, newborns, embryos/fetuses (including non-invasive prenatal diagnosis), pre-implantation embryos, and pre-fertilization oocytes. The most recent findings in the diagnostic approach for β-thalassemias are related to three major fields of investigation: moving towards ultrasensitive methodologies for effective detection of the primary causative mutation of β-thalassemia, including the development of polymerase chain reaction-free approaches and non-invasive prenatal diagnosis; comparing analyses of the genotype of β-thalassemia patients to high-HbF-associated polymorphisms; introducing whole genome association assays and next-generation sequencing. All these issues should be considered and discussed in the context of several aspects, including regulatory, ethical and social issues. DNA sequence data aligned with the identification of genes central to the induction, development, progression, and outcome of β-thalassemia will be a key point for directing personalized therapy.

Evaluation of cardiac functions in patients with thalassemia major

International Nuclear Information System (INIS)

Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G.

1999-01-01

It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1±3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7±4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1±71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

Evaluation of cardiac functions in patients with thalassemia major

Energy Technology Data Exchange (ETDEWEB)

Kucuk, N.O.; Aras, G.; Sipahi, T.; Ibis, E.; Akar, N.; Soylu, A.; Erbay, G. [Ankara Univ. (Turkey). Medical School

1999-06-01

It is known that a blood transfusion is necessary for survival in patients with thalassemia, but it may cause myocardial dysfunction due to myocardial siderosis as in other organs. The aim of this study was to evaluate myocardial perfusion by means of stress thallium scanning (MPS) and left ventricular functions by rest radionuclide ventriculography (RNV). Twenty-one patients at ages 9-16 (mean 12.1{+-}3.2) who have been diagnosed with thalassemia for 4-15 years mean 12.7{+-}4.8) were included in the study. They had blood transfusion 78-318 times (mean 162.1{+-}71). MPS and RNV was performed within two days after the any transfusion. MPS showed ischemia in 3 patients and normal perfusion in 18 patients. RNV revealed normal systolic parameters (wall motion, EF, PER, TPE) but diminished diastolic parameters (TPF, PFR) compared with normal values (p<0.05). We conclude that ischemia or fixed defects may be seen in stress MPS as results of cardiac involvement in patients with thalassemia. But, RNV is an important and preferable test for the early detection of subclinic cardiomyopathy. RNV may therefore show diastolic abnormalities before the systolic abnormalities show up. (author)

Current and future alternative therapies for beta-thalassemia major

Directory of Open Access Journals (Sweden)

Edouard de Dreuzy

2016-02-01

Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.

Hemoglobin Q-Thailand and its combinations with other forms of thalassemia or hemoglobinopathies in northern Thailand.

Science.gov (United States)

Panyasai, Sitthichai; Pornprasert, Sakorn

2014-01-01

There have been no reports for the frequency of Hb Q-Thailand [alpha 74(EF3)Asp --> His, GAC > CAC] and its combinations either with other forms of thalassemia or hemoglobinopathies in Northern Thailand. The aims of this study were to search for Hb Q-Thailand and its combinations in Northern Thai population and to analyze fractions of hemoglobin in Hb Q-Thailand and its combinations on high performance liquid chromatography (HPLC) chromatograms and/or capillary electrophoresis (CE) electrophoregrams. Blood samples from public and private hospitals in 7 northern provinces of Thailand were analyzed for thalassemia and hemoglobinopathy diagnoses using HPLC and/or CE and DNA analysis techniques at the Thalassemia Laboratory, Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand. Hb Q-Thailand was found in 13 of 13,596 (0.10%) samples; 6 were heterozygous Hb Q-Thailand, 4 were compound Hb Q-Thailand/alpha-thalassemia-1 Southeast Asian (SEA) type deletion and 3 with combinations of Hb Q-Thailand/beta(0)-thalassemia, Hb Q-Thailand/Hb E and Hb Q-Thailand/Hb E/alpha-thalassemia-1 SEA type deletion. The fractions of hemoglobin on HPLC chromatograms and CE electrophoregrams were observed based on types of combinations. Hb Q-Thailand and its combinations could be found in northern Thai population with the frequency of 0.10%. Thus, the better understanding of HPLC chromatogram and/or CE electrophoregram patterns of Hb Q-Thailand and its combination is essential for diagnosis and genetic counseling of thalassemia and hemoglobinopathies in this area.

Assessment of cognitive function in children with beta-thalassemia major: a cross-sectional study.

Science.gov (United States)

Raafat, Nelly; El Safy, Usama; Khater, Nahed; Hassan, Tamer; Hassan, Basheir; Siam, Ahmed; Youssef, Amira; El Shabrawy, Amany

2015-03-01

Multiple risk factors contribute to cognitive impairment in children with β-thalassemia major. For a more refined understanding of this issue, we attempted to evaluate cognitive function in β-thalassemia major patients and identify the relationship between possible cognitive dysfunction and the following: demography, transfusion and chelation characteristics, iron overload, and disease complications. We studied 100 β-thalassemia major children and 100 healthy controls who matched well in terms of age, sex, and socioeconomic status. All participants underwent psychometric assessment using Wechsler Intelligence Scale for Children-Third Edition, Arabic version. The mean Full-Scale IQ and Performance IQ of patients were significantly lower than those of controls, whereas no significant difference was found for Verbal IQ. No significant relationship existed between IQ and any of the assessed parameters. We concluded that Performance IQ, not Verbal IQ, was significantly affected in β-thalassemia major patients, but there was no clear association between IQ and any of the parameters. © The Author(s) 2014.

Premarital Screening of Beta Thalassemia Minor in north-east of Iran

Science.gov (United States)

Hashemizadeh, H; Noori, R

2013-01-01

Background Beta thalassemia is a preventable disease. Iran has about 20,000Patients who are homozygote for β-thalassaemia and 3,750,000 carriers. The aim of this study was to determine the prevalence of beta thalassemia minor among men who underwent premarital screening in Quchana city in Khorasan Razavi region of Iran Materials and Methods This research is a descriptive cross-sectional study. From 2010 to 2011, all participants (1000) under marriage coming to health center of Quchan underwent routine mandatory tests. Participants were considered to have beta-thalassemia minor on the condition that hey had a mean corpuscular volume (MCV) 3.5%. Venous blood was taken into an EDTA tube and the complete blood count and red blood cell indices were measured with a Coulter automated cell counter. Electrophoresis was performed on cellulose acetate. Results Mean and SD of hemoglobin, MCV and MCH were 16±2.9, 91±4 and 28.4±2, respectively. Hemoglobin A2 Higher than 3.5 percent was reported as 3.5%.The prevalence of beta-thassemia minor with high hemoglobin A2 and microcytic hypochromic anemia was 3.5% (P-value). Conclusion In countries with high prevalence of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. Detecting carrier couples with premarital screening program is an effective way of controlling thalassemia major. PMID:24575266

[Advances in Pathogenesis and Related Clinical Research of Thromboembolism in Patients with Thalassemia after Splenectomy].

Science.gov (United States)

Sun, Na; Cheng, Peng; Deng, Dong-Hong

2016-06-01

Thalassemia is the most common human hereditary hemolytic anemia. Due to splenomegaly and hypersp-lenism, splenectomy can be used as a means of treatment for thalassemia. Various complications following splenectomy, however, especially thromboembolic complications are remarkable. This review summarizes the incidence, clinical manifestations and development time of thromboembolism. The pathogenesis of thromboembolism after splenectomy in thalassemia, such as abnormal platelet number and function, changes in red cell membrane, endothelial cell damage, dysfunction of other procoagulant and anticoagulant factors, and local factors associated with splenectomy are elaborated and the trategies to prevent and treat the thromboembolic events in thalassemia after splenectomy, including the attention to risk factors associated with splenectomy, a reassessment of splenectomy, regular blood transfusion to reduce the ratio of abnormal red blood cells, treatment with anticoagulant and antiplatelet drugs, application of hydroxyurea and stem cell transplantation are discussed.

Body Composition in Adult Patients with Thalassemia Major

Directory of Open Access Journals (Sweden)

Marianna Vlychou

2016-01-01

Full Text Available Objective. To assess body composition in adult male and female patients with thalassemia major by dual-energy X-ray absorptiometry (DXA and to compare the findings with a group of healthy age-matched controls. Methods. Our study group included sixty-two patients (27 males, mean age 36 years, and 35 females, mean age 36.4 years and fifteen age-matched healthy controls. All patients had an established diagnosis of thalassemia major and followed a regular blood transfusion scheme since childhood and chelation treatment. Fat, lean, and bone mineral density (BMD were assessed with dual-energy X-ray absorptiometry. Ferritin levels and body mass index of all patients and controls were also recorded. Student t-test and Wilcoxon test were performed and statistical significance was set at p<0.05. Results. BMD and whole body lean mass are lower in both male and female adult patients compared with controls (p<0.01 in both groups, whereas whole body fat mass was found to have no statistically significant difference compared to controls. Regional trunk fat around the abdomen was found to be lower in male patients compared to controls (p=0.02. Conclusion. Severe bone loss and diminished lean mass are expected in adult male and female patients with thalassemia major. Fat changes seem to affect mainly male patients.

Association of erythrocyte deformability with red blood cell distribution width in metabolic diseases and thalassemia trait.

Science.gov (United States)

Vayá, Amparo; Alis, Rafael; Suescún, Marta; Rivera, Leonor; Murado, Julian; Romagnoli, Marco; Solá, Eva; Hernandez-Mijares, Antonio

2015-01-01

Increased red blood distribution width (RDW) in anemia is related to disturbances in the cellular surface/volume ratio, usually accompanied by morphological alterations, while it has been shown in inflammatory diseases that the activity of pro-inflammatory cytokines disturbing erythropoiesis increases RDW. Recently it has been reported that higher RDW is related with decreased erythrocyte deformability, and that it could be related with the association of RDW and increased risk of cardiovascular diseases. In order to analyze the influence of morphological alterations and proinflammatory status on the relationship between RDW and erythrocyte deformability, we analyzed erythrocyte deformability along with RDW and other hematological and biochemical parameters in 36 α-thalassemia, 20 β-thalassemia, 20 δβ-thalassemia trait carriers, 61 metabolic syndrome patients and 76 morbidly obese patients. RDW correlated inversely with erythrocyte deformability in minor β-thalassemia (r =-0.530, p thalassemia is often accompanied by more marked cell-shaped perturbations than other thalassemia traits. This could be the reason for this negative association only in this setting. Higher anisocytosis seems to be associated with greater morphologic alterations (shape/volume), which reduce erythrocyte deformability. The proinflammatory profile in metabolic patients can be related to the positive association of RDW with erythrocyte deformability found in these patients. However, further research is needed to explain the mechanisms underlying this association.

Plasma microRNA-451 as a novel hemolytic marker for β0-thalassemia/HbE disease

Science.gov (United States)

Leecharoenkiat, Kamonlak; Tanaka, Yuka; Harada, Yasuko; Chaichompoo, Porntip; Sarakul, Orawan; Abe, Yasunobu; Smith, Duncan Richard; Fucharoen, Suthat; Svasti, Saovaros; Umemura, Tsukuru

2017-01-01

In Southeast Asia, particularly in Thailand, β0-thalassemia/hemoglobin E (HbE) disease is a common hereditary hematological disease. It is associated with pathophysiological processes, such as the intramedullary destruction of immature erythroid cells and peripheral hemolysis of mature red blood cells. MicroRNA (miR) sequences, which are short non-coding RNA that regulate gene expression in a suppressive manner, serve a crucial role in human erythropoiesis. In the present study, the plasma levels of the erythroid-expressed miRNAs, miR-451 and miR-155, were analyzed in 23 patients with β0-thalassemia/HbE and 16 control subjects. Reverse transcription-quantitative polymerase chain reaction analysis revealed significantly higher levels of plasma miR-451 and miR-155 in β0-thalassemia/HbE patients when compared to the control subjects. Notably, among the β0-thalassemia/HbE patients, a significant increase in miR-451 levels was detected in severe cases when compared with mild cases. The levels of plasma miR-451 correlated with reticulocyte and platelet counts. The results suggest that increased plasma miR-451 levels may be associated with the degree of hemolysis and accelerated erythropoiesis in β0-thalassemia/HbE patients. In conclusion, miR-451 may represent a relevant biomarker for pathological erythropoiesis associated with β0-thalassemia/HbE. PMID:28447765

Thalassemia and hemoglobinopathies in an ethnic minority group in Central Vietnam: implications to health burden and relationship between two ethnic minority groups.

Science.gov (United States)

Nguyen, Nga Thi; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Van Nguyen, Hoa; Phan, Hoa Thi Thuy; Fucharoen, Goonnapa; Fucharoen, Supan

2017-07-01

Thalassemia is a genetic condition that can result in long and expensive treatments, and severe thalassemia may lead to death if left untreated. Couples contributing two genes for thalassemia place their children at particular risk for severe thalassemia. Gene frequency of thalassemia varies in Vietnam, but presents remarkably high levels among some ethnic minority groups. Limited information about thalassemia frequency makes prevention and control of thalassemia difficult. This study aimed to determine gene frequency of certain types of thalassemia among 390 women of reproductive age of the Ta-Oi ethnic minority. Hemoglobin and DNA analyses were carried out to diagnose thalassemia and hemoglobinopathies. Of the total participants, 56.1% (95% CI = 51.1-61.1) carried thalassemia genes. A remarkably high frequency of hemoglobin Constant Spring (Hb CS) of 23.8% (95% CI = 19.7-28.4) was noted. The frequency of α + -thalassemia (-3.7 kb deletion) was 26.4% (95% CI = 22.1-31.1), while hemoglobin E (Hb E) and hemoglobin Paksé (Hb Ps) were identified at frequencies of 14.6 (95% CI = 11.2-18.5) and 2.6% (95% CI = 1.4-5.0), respectively. Further analysis of α-globin gene haplotype revealed the same Hb CS haplotype (+ - M + + -) as of the Co-Tu minority, a neighboring minority of the Ta-Oi, indicating that these two minorities may share the same ancestors. This information will be helpful for further studies in population genetics, as well as the development prevention and control program in the region.

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

Science.gov (United States)

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Pain in thalassemia - an emerging complication

Directory of Open Access Journals (Sweden)

P.J. Giardina

2011-12-01

Full Text Available Many thalassemia subjects both transfused Major (TM and nontransfused Intermedia (TI suffer from longstanding bone disease, reduced or low bone mass (osteopenia or osteoporosis, fractures and bone pain. Unexpected musculoskeletal disease occurs despite longstanding hypertransfusion and new iron chelation strategies. Conditions which have been implicated in its pathogenesis include the massive ineffective erythropoiesis, chronic hypoxia associated with anemia, the local metabolic dysfunction from hemochromatosis, iron chelation toxicity, trace mineral deficiencies such as zinc deficiency, low vitamin D concentrations, the effect of endocrine dysfunction such as hypoparathyroidism, hypogonadism and growth hormone deficiency from hemochromatosis and the chronic inflammatory state induced by iron excess. The pathogenesis of bone disease has been attributed to the underlying marrow expansion of medullary bone caused by the massive ineffective erythropoiesis and subsequent cortical thinning. The process of normal bone health is maintained by a metabolic interplay of several hormonal factors including growth hormone, estrogen, testosterone, parathyroid hormone all of which can be diminished by iron overload in Thalassemia. Trace metals and vitamins including calcium, copper, zinc or vitamin C can also be deficient from iron excess or iron chelation which are also important contributors to bone metabolism. Indeed toxicities of iron chelation itself on bone development in the growing child associated with zinc deficiency, high Deferoxamine dosing and low iron burdens or the collagenous joint disease associated with deferiprone chelation have further contributed to the current musculoskeletal disease of Thalassemias. Decreased spinal height, vertebral flattening and scoliosis have also been reported. Magnetic Resonance Imaging (MRI of adolescent and adult β Thalassemia Major and Intermedia patients with osteoporosis and pain have assisted in defining the

Nitroblue tetrazolium test in patients with beta-thalassemia major

International Nuclear Information System (INIS)

Ghaffari, J.; Vahidshahi, K.; Kosaryan, M.; Karami, H.; Mahdavi, M.; Parvinnejad, N.

2008-01-01

Objective to assess the neutrophil function in thalassemia major (TM)patients and compare it with the control group and to recognize its relevantfactors. This was a retrospective cohort study, which was carried out fromOctober 2007 to February 2008 in the Thalassemia research Center in Boo AliSina Hospital in Sari, Mazandaran, North of Iran. The study populationconsisted of TM patients in Boo Ali Sina Teaching Hospital. The method ofsampling in the case group was systematic and it was target based in thecontrol group. The sample size determined was based on previous studies.Thalassemia major was diagnosed based on hemoglobin electrophoresis (casegroup). The control group was their brothers and sisters, who had +-5 yearsof age difference and were of the same gender as the patients. Datacollection was based on interview, investigating demographic characteristicsand also obtaining medical information from medical records of the patients.The neutrophil function was by performing nitroblue tetrazolium (NBT)reduction test. The test was carried out on both groups and the data wereanalyzed by software using SPSS version 13.0. In this study, 39 patients and39 healthy controls were compared. The average age of the patients was21.6+-5.3 years and it was 22.4+-5.1 years in healthy controls (p=0.7). Therewas a significant correlation between the test's results and the patients age(p=0.008). The rate of impaired NBT results in the patients was 36%, while itwas 10% in controls, which were significantly different. The neutrophilactivity based on NBT test was 89.9+-11.6% in the case group and 93.7+-2.51%in the control group (p=0.025). This study indicates that neutrophil activityin thalassemia patients was significantly lower, compared to the normalcontrol group, especially in young patients. Based on the results, evaluationof neutrophil function and pyogenic infections in TM patients seemsnecessary. (author)

Spinal cord compression in {beta}-thalassemia: follow-up after radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Fonseca, Silvana Fahel da; Figueiredo, Maria Stella; Cancado, Rodolfo Delfini; Nakadakare, Fernando; Segreto, Roberto; Kerbauy, Jose [Universidade Federal de Sao Paulo (UNIFESP), SP (Brazil). Escola Paulista de Medicina

1998-12-01

Spinal cord compression due to extramedullary hematopoiesis is a well-described bu rare syndrome encountered in several hematologic disorders, including {beta}-thalassemia. We report a case of a patient with intermediate {beta}-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms. (author)

Spinal cord compression in β-thalassemia: follow-up after radiotherapy

International Nuclear Information System (INIS)

Fonseca, Silvana Fahel da; Figueiredo, Maria Stella; Cancado, Rodolfo Delfini; Nakadakare, Fernando; Segreto, Roberto; Kerbauy, Jose

1998-01-01

Spinal cord compression due to extramedullary hematopoiesis is a well-described bu rare syndrome encountered in several hematologic disorders, including β-thalassemia. We report a case of a patient with intermediate β-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms. (author)

[Analysis of Cut-off Value in Screening of Thalassemia by Capillary Hemoglobin Electrophoresis for Pregnant Women from Shenzhen Region of China].

Science.gov (United States)

Huo, Mei; Wu, Wen-Yuan; Liu, Mei; Gan, Zhi-Biao; Mao, Wei-Yu; Lin, Rong-Yao; Liu, Ai-Qin; He, Gui-Rong

2016-04-01

To investigate the cut-off value in screening of thalassemia in pregnant women from Shenzhen region by capillary hemoglobin electrophoresis. The data of capillary hemoglobin electrophoresis and genetic diagnosis of thalassemia from 2122 examined prenatal women were retrospectively analyzed. Capillary hemoglobin electrophoresis and α-, β- genetic diagnosis of thalassemia were carried out for every woman. Hemoglobin electrophoresis was performed using Capillarys 2 full-automated electrophoresis instrument. Gap polymerase chain reaction and reverse dot blot were used for genetic diagnosis of thalassemia genotyping test. The cut-off value in screening of thalassemia was determined by receiver operating characteristic curve and next to analyze the value of HbA2 and HbF in screening of thalassemia using the decided cut-off value. The areas under the curve (AUC(Roc)) of HbA2 for diagnosis of α-, β- thalassemia were 0.75 and 0.981 respectively, and the AUC(Roc) of HbF for diagnosis of β-thalassemia was 0.787. When HbA2 ≤ 2.55 was taken as the cut-off value of HbA2 for diagnosis of α-thalassemia, the sensitivity, specificity, positive likelihood ratio (LR(+)) and negative likelihood ratio (LR(-)) were 89.5%, 54.8%, 1.98, 0.19 respectively. When HbA2 ≥3.9 was taken as the cut off value of HbA2 for diagnosis of β-thalassemia, the sensitivity, specificity, LR(+) and LR(-) were 96.1%, 99.8% 480.5, 0.04 respectively. When HbF ≥0.75 was taken as the cut off value of HbF for diagnosis of β-thalassemia, the sensitivity, specificity, LR(+) and LR(-) were 83.6%, 61.8% respectively. The cut-off value in screening of thalassemia by capillarys 2 full automated electrophoresis instrument is different from that of the traditional method of hemoglobin electrophoresis, such as cellulose acetate membrane electrophoresis and agarose gel electrophoresis. Each laboratory should establish their own respective cut off value.

Prevalence of β-thalassemia and other haemoglobinopathies in six cities in India: a multicentre study.

Science.gov (United States)

Mohanty, D; Colah, R B; Gorakshakar, A C; Patel, R Z; Master, D C; Mahanta, J; Sharma, S K; Chaudhari, U; Ghosh, M; Das, S; Britt, R P; Singh, S; Ross, C; Jagannathan, L; Kaul, R; Shukla, D K; Muthuswamy, V

2013-01-01

The population of India is extremely diverse comprising of more than 3,000 ethnic groups who still follow endogamy. Haemoglobinopathies are the commonest hereditary disorders in India and pose a major health problem. The data on the prevalence of β-thalassemias and other haemoglobinopathies in different caste/ethnic groups of India is scarce. Therefore the present multicentre study was undertaken in six cities of six states of India (Maharashtra, Gujarat, West Bengal, Assam, Karnataka and Punjab) to determine the prevalence of haemoglobinopathies in different caste/ethnic groups using uniform methodology. Fifty-six thousand seven hundred eighty individuals (college students and pregnant women) from different caste/ethnic groups were screened. RBC indices were measured on an automated haematology counter while the percentage of HbA(2), HbF and other abnormal Hb variants were estimated by HPLC on the Variant Hemoglobin Testing System. The overall prevalence of β-thalassemia trait was 2.78 % and varied from 1.48 to 3.64 % in different states, while the prevalence of β-thalassemia trait in 59 ethnic groups varied from 0 to 9.3 %. HbE trait was mainly seen in Dibrugarh in Assam (23.9 %) and Kolkata in West Bengal (3.92 %). In six ethnic groups from Assam, the prevalence of HbE trait varied from 41.1 to 66.7 %. Few subjects with δβ-thalassemia, HPFH, HbS trait, HbD trait, HbE homozygous and HbE β-thalassemia as well as HbS homozygous and HbS-β-thalassemia (India.

Atypical location of extramedullary hematopoietic masses in thalassemia

International Nuclear Information System (INIS)

Gemenis, T.; Philippou, A.; Gouliamos, A.; Kalovidouris, A.; Papavasiliou, C.; Papacharalambus, X.; Panani, A.; Chalevelakis, G.; Raptis, S.

1989-01-01

A case of β-thalassemia with multiple foci of extramedullary hematopoiesis (EH) is reported. EH masses were demonstrated in the presacral and the costovertebral space. EH foci were also encountered in the spleen. (orig.) [de

Glutathione Redox System in β-Thalassemia/Hb E Patients

Directory of Open Access Journals (Sweden)

Ruchaneekorn W. Kalpravidh

2013-01-01

Full Text Available β-thalassemia/Hb E is known to cause oxidative stress induced by iron overload. The glutathione system is the major endogenous antioxidant that protects animal cells from oxidative damage. This study aimed to determine the effect of disease state and splenectomy on redox status expressed by whole blood glutathione (GSH/glutathione disulfide (GSSG and also to evaluate glutathione-related responses to oxidation in β-thalassemia/Hb E patients. Twenty-seven normal subjects and 25 β-thalassemia/Hb E patients were recruited and blood was collected. The GSH/GSSG ratio, activities of glutathione-related enzymes, hematological parameters, and serum ferritin levels were determined in individuals. Patients had high iron-induced oxidative stress, shown as significantly increased serum ferritin, a decreased GSH/GSSG ratio, and increased activities of glutathione-related enzymes. Splenectomy increased serum ferritin levels and decreased GSH levels concomitant with unchanged glutathione-related enzyme activities. The redox ratio had a positive correlation with hemoglobin levels and negative correlation with levels of serum ferritin. The glutathione system may be the body’s first-line defense used against oxidative stress and to maintain redox homeostasis in thalassemic patients based on the significant correlations between the GSH/GSSH ratio and degree of anemia or body iron stores.

Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion).

Science.gov (United States)

Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida

2013-06-01

Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

Preventing thalassemia in Lebanon: successes and challenges in a developing country.

Science.gov (United States)

Abi Saad, Michele; Haddad, Anthony G; Alam, Elie S; Aoun, Sanaa; Maatouk, Pascale; Ajami, Najat; Khairallah, Therese; Koussa, Suzanne; Musallam, Khaled M; Taher, Ali T

2014-01-01

Thalassemia continues to be a major health burden. The chronicity of the disease and the high cost of life-long treatment make prevention strategies crucial in the management of this disease. In this article, we revisit different successful prevention strategies, and underline the Lebanese model. The Chronic Care Center (CCC), Beirut, is the only specialized center in Lebanon for the treatment and prevention of thalassemia. The current number of patients registered up to August 2013 was 724, representing cases from all over Lebanon. In 1994, the center launched a national prevention program following the World Health Organization (WHO) recommendations. The major activities of the program include awareness campaigns, screening for thalassemia carriers in the general population and high risk groups, registry of new cases and follow-up on the mandatory premarital law (established at the same time). Screening programs showed a carrier rate of around 2.3% in the general population, and 4.0-41.0% in high risk groups. The major pitfall in the law is that only persons with a mean corpuscular volume (MCV) of >70.0 fL are asked to perform further hemoglobin (Hb) testing. A significant decrease in the number of new cases of thalassemia patients in Lebanon reflects the efforts deployed in the prevention of the disease. However, some limitations are faced in reaching a complete eradication of the disease, mainly due to the fact that abortion is illegal and due to pitfalls and incorrect implementation of the premarital law.

Comparison of hematocrit/hemoglobin ratios in subjects with alpha-thalassemia, with subjects having chronic kidney disease and normal subjects.

Science.gov (United States)

Insiripong, Somchai; Supattarobol, Tanarat; Jetsrisuparb, Arunee

2013-07-04

The ratio of hematocrit (Hct) to hemoglobin (Hb) in the people with normal red blood cell (RBC) morphology is generally three to one. We studied Hct/Hb ratios among patients with alpha-thalassemias (Hb H, H-CS, AEBart, AEBart-CS, EFBart and EFBart-CS diseases) diagnosed by high performance liquid chromatography, and compared them with normal subjects and with patients having anemia due to chronic kidney disease (CKD). The Hct and Hb levels were derived by automated analyzer. The means +/- SD of the Hct/Hb ratios were 3.5 +/- 0.2 (range 3.3 - 4.1), 3.0 +/- 0.1 (range 2.9 - 3.2) and 3.0 +/- 0.1 (range 2.8 - 3.2) in the alpha-thalassemia, normal and CKD groups, respectively. The mean Hct/Hb ratio in subjects with alpha-thalassemia was higher than the mean in normal subjects and in those with CKD. The Hct/Hb ratios for each genotype of the alpha-thalassemia were not different from each other. The underlying mechanisms for the higher Hct/Hb ratio among those with alpha-thalassemia are theorized to be less density and/or more hydration of a-thalassemia RBCs, more entrapment of plasma in the spun RBC, the high percent of nucleated RBC and WBC interference. A ratio of 3.5 +/- 0.2 may be helpful in cases of moderate anemia when typing only shows Hb A and E, to consider investigation for alpha-thalassemia, or in cases of alpha-thalassemia with acute blood loss, if the Hct is less than 35%, in the decision to transfuse.

The impact of thalassemia on Southeast Asian and Asian Indian families in the United States: a qualitative study.

Science.gov (United States)

Liem, Robert I; Gilgour, Brynnan; Pelligra, Stephanie A; Mason, Maryann; Thompson, Alexis A

2011-01-01

To describe the challenges, including sociocultural and socioeconomic barriers, faced by an urban immigrant population in the United States affected by thalassemia major. Ethnographic, semi-structured, 1-on-1 interviews using an interview guide developed for this study. Digital recordings were transcribed and data analyzed using constant comparative method. University-based, Comprehensive Thalassemia Program at Children's Memorial Hospital, Chicago, IL, USA. Fourteen Southeast Asian and Asian Indian parents of children with transfusion dependent thalassemia. Qualitative descriptions of parental experiences, frequency of codes applied to interviews and emergent themes. Thalassemia has its greatest impact on the emotional and social well-being of affected children and their parents. Current and future concerns were related to disease-specific complications and challenges with management such as transfusions and chelation therapy. These perceptions were tied to parental hope for a cure, a frequently coded coping mechanism. Despite their availability, few parents relied on support systems beyond immediate family members due to perceived public knowledge gaps about thalassemia. Culturally based past experiences and barriers did not emerge as dominant themes in our analysis. The impact of thalassemia is tremendous for affected children and their parents and is due more to factors that were either disease-specific or common to other chronic disease models rather than those influenced by culture. The unmet needs of these families require additional investigation to facilitate the development of initiatives aimed at improving quality of life and lessening overall impact of thalassemia

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

Science.gov (United States)

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

Burden of thalassemia in India: The road map for control

Directory of Open Access Journals (Sweden)

Roshan Colah

2017-12-01

Full Text Available The thalassemias and structural haemoglobin variants are the commonest monogenic disorders globally. India has a huge burden with an estimated 100,000 patients with a β thalassemia syndrome and around 150,000 patients with sickle cell disease, but few among them are optimally managed, and allogeneic stem cell transplant is unaffordable for the majority of families. A feasible option for control is to promote education and awareness programmes, intensify screening in all the states with micromapping to assess the true burden, and develop adequate facilities for genetic counselling and prenatal diagnosis in public sector Institutions. Government and non-government organizations have been working towards this goal for the last 3 to 4 decades but community control in a vast and diverse country is challenging and a national programme reaching all rural regions where almost 70% of the population resides is yet to begin. Strategies to control thalassemia need to include 1 Educating health professionals, school and college students, pregnant women and the population at large 2 Establishing prenatal diagnosis facilities in different regions of the country 3 Setting up a greater number of Day Care Centres for managing existing thalassemia patients 4 Developing cost-effective facilities for stem cell transplantation across the country. This review explores strategies by which Central and State Governments, NGOs, Parents-Patients Societies and Corporate Houses can work together to successfully reduce the burden of hemoglobinopathies in India. Guidelines for implementation of such a national programme have recently been prepared by the National Health Mission, Ministry of Health and Family Welfare with the help of several experts in the country.

Thalassemia mutations in Gaziantep, Turkey

African Journals Online (AJOL)

STORAGESEVER

2010-02-22

Feb 22, 2010 ... Table 3. Frequency of β-thalassemia mutations in the Eastern Mediterranean. Mutation. This study Turkey Cyprus Greece Syria Palestine Bulgaria Azerbaijan Iran Iraq. IVS 1.110 (G>A). 29.1. 39.3. 79.7. 42.1. 24.1. 17.6. 24.2. 20.2. 4.8 1.9. IVS 2.1 (G>A). 12.3. 4.7. -. 3.3. 4.2. 2.9. -. -. 33.9 18.3. IVS 1.1 (G>A).

Thalassemia in Messina: a sociological approach to chronic disease

Directory of Open Access Journals (Sweden)

Silvia Carbone

2014-04-01

Full Text Available Changing the care along with improved treatment, have altered the life of thalassemia patients, one of the world’s most common genetic diseases (Thalassemia International Federation; http://www.thalassemia.org.cy. The new demography of the disease, with its widely variable phenotypes, has implications for its diagnosis, counseling, and management. Improved of the new treatment of this ancient disease is essential for optimizing survival. From June 2010 to January 2011, we interviewed 36 people with thalassemia from a primary care in Messina (Center of Genetics and Immunology. The aim of this study is to show the results of a survey conducted in this Center in Messina. This study shows the importance of influence of a multidisciplinary approach, medical, psychological and social, that addresses the changing treatment and epidemiology of thalassemia in order to ensure a better quality of life and survival. Understanding the influence of all three types of resources, medical, psychological and social, is critical for constructing ways to enhance health capability, chronic disease self-management, and health.  以更好的护理方式改善治疗，改变了地中海贫血(一种世界上最常见的遗传性疾病）患者的生活。地中海贫血国际联合会，http://www.thalassemia.org.cy。新的疾病人口统计学方法，凭借着不同的方式地中海贫血症的诊断，咨询和管理产生了影响。对于这种古老的疾病，改善的新疗法对病人生存能力至关重要。从2010年6月至2011年1月，我们在墨西拿的一家初级保健中心(遗传学及免疫学）采访了36位地中海贫血患者。本研究的目的是在墨西拿的这家保健中心得出调查结果。研究显示了针对地中海贫血症，运用多学科方法 —— 医疗，心理和社会以确保患者拥有更好的生存力和生活质量的重要影响力。理解这三种资源的影响力 —— 医疗，心理和社会，对于慢性病患者的健康和自我调理疾病的能力至关重要。

Study on Moessbauer spectra of hemoglobin in thalassemia

International Nuclear Information System (INIS)

Guo Xuanhui; Zhao Nanming; Zhang Xiufang

1988-01-01

The 57 Fe Moessbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed. (orig.)

Oxidative stress and age-related changes in T cells: is thalassemia a model of accelerated immune system aging?

Science.gov (United States)

Ghatreh-Samani, Mahdi; Esmaeili, Nafiseh; Soleimani, Masoud; Asadi-Samani, Majid; Ghatreh-Samani, Keihan; Shirzad, Hedayatolah

2016-01-01

Iron overload in β-thalassemia major occurs mainly due to blood transfusion, an essential treatment for β-thalassemia major patients, which results in oxidative stress. It has been thought that oxidative stress causes elevation of immune system senescent cells. Under this condition, cells normally enhance in aging, which is referred to as premature immunosenescence. Because there is no animal model for immunosenescence, most knowledge on the immunosenescence pattern is based on induction of immunosenescence. In this review, we describe iron overload and oxidative stress in β-thalassemia major patients and how they make these patients a suitable human model for immunosenescence. We also consider oxidative stress in some kinds of chronic virus infections, which induce changes in the immune system similar to β-thalassemia major. In conclusion, a therapeutic approach used to improve the immune system in such chronic virus diseases, may change the immunosenescence state and make life conditions better for β-thalassemia major patients.

Co-inheritance of α0 -thalassemia elevates Hb A2 level in homozygous Hb E: Diagnostic implications.

Science.gov (United States)

Singha, K; Srivorakun, H; Fucharoen, G; Fucharoen, S

2017-10-01

Differentiation of homozygous hemoglobin (Hb) E with and without α 0 -thalassemia is subtle on routine hematological ground. We examined in a large cohort of homozygous Hb E if the level of Hb A 2 is helpful. A total of 592 subjects with homozygous Hb E were recruited from ongoing thalassemia screening program. Additionally, five couples at risk of having fetuses with Hb Bart's hydrops fetalis who were homozygous Hb E were also investigated. Hb analysis was performed using capillary electrophoresis system. Globin genotypes were defined by DNA analysis. Subjects were classified into four groups including pure homozygous Hb E (n=532), homozygous Hb E/α 0 -thalassemia (n=48), Hb Constant Spring EE Bart's disease (n=8), and Hb EE Bart's disease (n=4). The levels of Hb A 2 were found, respectively, to be 4.97±0.69, 6.64±1.02, 4.86±0.87, and 7.60±1.04%. Among five couples at risk, α 0 -thalassemia was identified in three subjects with Hb A 2 >6.0%. Increased Hb A 2 level is a useful marker for differentiation of homozygous Hb E with and without α 0 -thalassemia. This should lead to a significant reduction in number of referral cases of homozygous Hb E for molecular testing of α 0 -thalassemia in routine practice. © 2017 John Wiley & Sons Ltd.

Spinal cord compression in b-thalassemia: follow-up after radiotherapy

Directory of Open Access Journals (Sweden)

Silvana Fahel da Fonseca

Full Text Available CONTEXT: Spinal cord compression due to extramedullary hematopoiesis is a well-described but rare syndrome encountered in several clinical hematologic disorders, including b-thalassemia. CASE REPORT: We report the case of a patient with intermediate b-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. DISCUSSION: Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms.

RESEARCH ARTICLE The prevalence and spectrum of thalassemia ...

Indian Academy of Sciences (India)

Navya

Thalassemia is the most common autosomal recessive disorder worldwide (Joly et al. ... results from a gross gene deletion (Bank 2015; Colah et al. ... France) to assess the concentration of hemoglobin (Hb) A, A2, and F, and any abnormal.

Molecular analysis of the beta-thalassemia phenotype associated with inheritance of hemoglobin E (alpha 2 beta2(26)Glu leads to Lys).

OpenAIRE

Benz, E J; Berman, B W; Tonkonow, B L; Coupal, E; Coates, T; Boxer, L A; Altman, A; Adams, J G

1981-01-01

Inheritance of the gene for betaE-globin is associated with hypochromia and microcytosis, reminiscent of typical heterozygous beta-thalassemia. Patients with hemoglobin (Hb)E-beta-thalassemia exhibit clinical phenotypes of severe beta-thalassemia, a circumstance not encountered in other compound heterozygous states for structural beta-chain mutations and beta-thalassemia. We have analyzed the kinetics of globin synthesis and the levels of globin messenger (m) RNA accumulation in patients with...

Bone marrow transplantation for thalassemia: a global perspective

Directory of Open Access Journals (Sweden)

Mohamed Hamed Hussein

2013-03-01

Full Text Available Even though severe thalassemia is a preventable disease, over 100,000 new cases are born yearly, particularly in the Middle East and South-East Asia. Most of these children may not reach adulthood because long-term appropriate supportive care is either inaccessible or unaffordable. Bone marrow transplantation (BMT remains the only available definitive cure and success rates can be very high in appropriately selected patients, i.e. low-risk younger children with a matched family donor. In these circumstances BMT may be justified medically, ethically as well as financially, in fact, the cost of low-risk BMT is equivalent to that of a few years of non-curative supportive. This manuscript will briefly review the current status of bone marrow transplantation for thalassemia major with particular emphasis on a global prospective and present the experience of the Cure2Children Foundation supporting sustainable and scalable start up BMT programs in low-resource settings. The initial twelve consecutive patients managed in two start up BMT units in Pakistan (Children’s Hospital of the Pakistan Institute of Medical Sciences, Islamabad and India (South East Asia Institute for Thalassemia, Jaipur were included in this analysis. These initial six patients per each institution where purposely chosen as the focus of this report because they represent the steepest phase of the learning curve. The median age at transplant was 3.9 years, range 0.9 to 6.0, liver was no greater than 2 cm from costal margin, and all received matched related BMT. A structured on-site focused training program as well as ongoing intensive on-line cooperation was provided by the Cure2Children team of professionals. At a median follow-up of 7.5 months (range 3.5 to 33.5 months both thalassemia-free and overall survival are 92%, one patient died of encephalitis-meningitis of unknown cause. No rejections where observed. Neutrophil recovery occurred at a median of 15.5 days (range 13

Blood transfusion versus hydroxyurea in beta-thalassemia in Iran: a cost-effectiveness study.

Science.gov (United States)

Ravangard, Ramin; Mirzaei, Zahra; Keshavarz, Khosro; Haghpanah, Sezaneh; Karimi, Mehran

2017-11-21

Thalassemia intermedia is a type of anemia which has several treatments modalities. We aimed to study the cost effectiveness of two treatments, including blood transfusion and hydroxyurea, in patients with beta-thalassemia intermedia in south of Iran referred to a referral center affiliated to Iran, Shiraz University of Medical Sciences in 2015. This was a cost-effectiveness study which was conducted on 122 patients with beta-thalassemia intermedia. The indicator of effectiveness in this study was the reduction of growth disorder (normal BMI). Data analysis was done using SPSS 21, Excel 2010 and Treeage 2011. Finally, the one-way sensitivity analysis was performed to determine the robustness of the results. The average annual costs of blood transfusion and the use of hydroxyurea in 2015 were 20733.27 purchasing power parity (PPP)$ and 7040.29 PPP$, respectively. The effectiveness of blood transfusion was57.4% while in hydroxyurea group was 60.7%. The results showed that the cost effectiveness of using hydroxyurea was more than that of blood transfusion. Therefore, it is recommended that the use of hydroxyurea in the treatment of patients with beta-thalassemia intermedia would become the first priority, and more basic and supplementary insurance coverage for treating such patients using hydroxyurea should be considered.

Levels of Beta-2 Microglobulin and Cystatin C in Beta Thalassemia Major Patients

Directory of Open Access Journals (Sweden)

Ayse Kacar

2014-03-01

Full Text Available Aim: Thalassemia is accepted to be the most common genetic disease in the world. This study was performed to establish whether there was a glomerular renal damage, which was usually a less mentioned subject in patients with Beta Thalassemia Major, and to compare urea, creatinine and creatinine clearance with early indicators of kidney damage as Cystatin-C and %u03B2-2 microglobulin as on determining the glomerular damage. Material and Method: This study was prospectively performed in patients, who were regularly followed in the children hematology outpatient clinic with a diagnosis of Beta Thalassemia Major. Results: There was no statistically significant difference between urea and levels of creatinine clearance and Cystatin-C. There was a statistically negative relationship between creatinine and creatinine clearance at an advanced level as 53.7% (p: 0.002, p

Multiple transfused thalassemia major: Ocular manifestations in a hospital-based population

Directory of Open Access Journals (Sweden)

Taneja Rashi

2010-01-01

Full Text Available Purpose: To study the ocular manifestations in multiple transfused beta-thalassemia major patients and assess the ocular side-effects of iron chelating agents. Materials and Methods: In this prospective observational study, 45 multiple transfused beta-thalassemia major children between six months and 21 years of age were enrolled and assigned groups according to the treatment regimens suggested. Group A received only blood transfusions, Group B blood transfusions with subcutaneous desferrioxamine, Group C blood transfusions with desferrioxamine and oral deferriprone and Group D blood transfusions with deferriprone. Ocular status at the time of enrolment was documented. Subjects were observed quarterly for one year for changes in ocular status arising due to the disease process and due to iron chelation therapy. Children with hemoglobinopathies other than beta-thalassemia major, congenital ocular anomalies and anemia due to other causes were excluded. Results: Ocular involvement was observed in 58% of patients. Lenticular opacities were the most common ocular finding (44%, followed by decreased visual acuity (33%. An increased occurrence of ocular changes was observed with increase of serum ferritin and serum iron levels as well as with higher number of blood transfusions received. Desferrioxamine seemed to have a protective influence on retinal pigment epithelium (RPE mottling. Occurrence of lenticular opacities and RPE degeneration correlated positively with use of desferrioxamine and deferriprone respectively. Follow-up of patients for one year did not reveal any change in ocular status. Conclusion: Regular ocular examinations can aid in preventing, delaying or ameliorating the ocular complications of thalassemia.

The epidemiologic transition of thalassemia and associated hemoglobinopathies in southern Taiwan.

Science.gov (United States)

Wang, Hui-Ching; Hsieh, Li-Ling; Liu, Yi-Chang; Hsiao, Hui-Hua; Lin, Shu-Kai; Tsai, Wen-Chan; Liu, Ta-Chih

2017-02-01

Since 1993, following the National Thalassemia Major Prevention Program and an increase in immigration and interracial marriages, especially in southern Taiwan, the distribution of hemoglobinopathies may have changed. This study investigates the epidemiologic transition of hemoglobinopathies. We analyzed 1870 specimens collected between 2003 and 2012 in southern Taiwan, used gap-polymerase chain reaction and PCR-restriction fragment length polymorphism-based methods, and confirmed genotypes of hemoglobinopathies by DNA sequencing. We found a 91% reduction in the incidence of thalassemia major compared with samples from between 1986 and 1995. The most common genotypes of α-thalassemia and α Hb variants were the SEA type (69.4%) and Hb Quong Sze (1.54%). The most common genotypes of β-thalassemia and β Hb variants were IVS-II-654 (46.2%) and Hb E (2.2%), respectively. Compared with studies performed in different areas of and time intervals in Taiwan, a higher prevalence of -α 3.7 , Hb Quong Sze, and Hb E and a lower prevalence of the SEA type were found in this study. However, the SEA type remained the most common genotype observed. In addition, an increasing number of cases with an -α 3.7 type carrier, Hb Quong Sze carrier, and G γ (A γ δβ)° were identified following a peak of interracial marriages between 2003 and 2005, reflecting a regional difference and the impact of interracial marriage. In conclusion, global migration and international marriage have changed the distribution of hemoglobinopathies in Taiwan. A more comprehensive prenatal screening for new immigrants with a longer follow-up is warranted.

Post-transfusion hypertension, convulsion and intracranial haemorrhage in beta-thalassemia major

International Nuclear Information System (INIS)

Masood, S.A.; Zaidi, A.

2012-01-01

The haematologic disorder b-thalassemia major is common in Pakistan. We describe a patient with undiagnosed thalassemia presenting with hypertension and convulsions and found to have cerebral haemorrhage on neuro-imaging. He had been transfused 2 weeks before this illness. Our experience is similar to a few case reports described in literature that were found to have cerebral haemorrhages post-mortem after a similar clinical presentation. All patients had a blood transfusion within 2 weeks prior to the presentation so association with transfusion has been proposed. We have reviewed the several mechanisms presented and discussed the findings. (author)

Cardiac iron overload in chronically transfused patients with thalassemia, sickle cell anemia, or myelodysplastic syndrome.

Directory of Open Access Journals (Sweden)

Mariane de Montalembert

Full Text Available The risk and clinical significance of cardiac iron overload due to chronic transfusion varies with the underlying disease. Cardiac iron overload shortens the life expectancy of patients with thalassemia, whereas its effect is unclear in those with myelodysplastic syndromes (MDS. In patients with sickle cell anemia (SCA, iron does not seem to deposit quickly in the heart. Our primary objective was to assess through a multicentric study the prevalence of cardiac iron overload, defined as a cardiovascular magnetic resonance T2*8 ECs in the past year, and age older than 6 years. We included from 9 centers 20 patients with thalassemia, 41 with SCA, and 25 with MDS in 2012-2014. Erythrocytapharesis did not consistently prevent iron overload in patients with SCA. Cardiac iron overload was found in 3 (15% patients with thalassemia, none with SCA, and 4 (16% with MDS. The liver iron content (LIC ranged from 10.4 to 15.2 mg/g dry weight, with no significant differences across groups (P = 0.29. Abnormal T2* was not significantly associated with any of the measures of transfusion or chelation. Ferritin levels showed a strong association with LIC. Non-transferrin-bound iron was high in the thalassemia and MDS groups but low in the SCA group (P<0.001. Hepcidin was low in thalassemia, normal in SCA, and markedly elevated in MDS (P<0.001. Two mechanisms may explain that iron deposition largely spares the heart in SCA: the high level of erythropoiesis recycles the iron and the chronic inflammation retains iron within the macrophages. Thalassemia, in contrast, is characterized by inefficient erythropoiesis, unable to handle free iron. Iron accumulation varies widely in MDS syndromes due to the competing influences of abnormal erythropoiesis, excess iron supply, and inflammation.

The prevalence of Hepatitis C virus antibodies among thalassemia patients referring to Shahid Beheshti Hospital, Abadan, Iran

Directory of Open Access Journals (Sweden)

Sara Kooti

2017-11-01

Full Text Available Abstract: Hepatitis C virus (HCV infection as an awesome medical issue is one of the most important pathogens of the human. Youngsters with thalassemia who get visit blood transfusions will be endangered with a high danger of HCV contamination. The point of this review is to decide the predominance of HCV disease among thalassemia patients in Abadan, Khuzestan region that is situated in the south-west of Iran. For this study a specific questionnaire on demographic information (Demographic information, for example, age, number of blood transfusions were acquired from patient records in which completed by trained personnel and also blood samples were taken at the same time in order to check the presence and amount of anti-HCV-Ab as a result, it showed that 11.17% (179/20, 11.17% of samples were positive. The HCV contamination is an illness which influences the extensive number of thalassemia patients in the world. The Lack of knowledge about blood safety of HCV contamination as the most predominant transfusion-transmitted sickness of blood in thalassemia patients is a major threat to public health in a group of countries in which the most obtained data from this region came from provinces of Iran. The anti-HCV prevalence in patients with thalassemia who live in Khuzestan province is less than other provinces of Iran and also neighbor countries and researchers should be paid attention to hepatitis C infection in order to prevent thalassemia cases.

Cardiac complications in beta-thalassemia: From mice to men.

Science.gov (United States)

Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C; Chattipakorn, Nipon

2017-06-01

Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

Cardiac complications in beta-thalassemia: From mice to men

Science.gov (United States)

Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C.

2017-01-01

Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

Shortened of the crown and root lengths of the mandibular permanent molar in beta major thalassemia children

Directory of Open Access Journals (Sweden)

Indra Primathena

2011-07-01

Full Text Available Beta major thalassemia is a genetically inherited blood disorder due to a genetic mutation on the polypeptide chains of hemoglobin which is manifested in the growth and development of the tooth. The objectives of the investigation were to obtain differences of the crown and root lengths of the mandibular first right side permanent molar between beta major thalassemia children and normal children group at the matching ages of 11 to 13 years old. The descriptive comparative method was used in the study and samples were selected using the purposive sampling technique. Sample numbers, which were obtained using the consecutive sampling technique, consists of 12 children of beta major thalassemia and 12 of normal children at the matching ages of 11 to 13 years. Periapical radiographs of both thalassemia and normal children were administered using the method of Seow and Lai. Data were analyzed using t-test method. The study revealed that the crown and root lengths of the mandibular first right side permanent molar of beta major thalassemia children were shorter than normal children at the ages of 11 to 13 years.

Evaluation of the URIT-2900 automated hematology analyzer for screening of thalassemia and hemoglobinopathies in Southeast Asian populations.

Science.gov (United States)

Karnpean, Rossarin; Pansuwan, Anupong; Fucharoen, Goonnapa; Fucharoen, Supan

2011-07-01

The effectiveness of the URIT-2900 Hematology Analyzer for screening of hemoglobinopathies commonly found in Southeast Asian populations was examined. Appropriate cut-off values of MCV and MCH for screening of α(0) and β thalassemias were derived from the receiver operator characteristic curve conducted initially on 279 subjects with various thalassemia genotypes. Validation was performed additionally in a cohort of another unrelated 313 subjects. The best cut off values of MCV and MCH were found to be 78fL and 27pg, respectively. Using these cut off values in combination with the dichlorophenolindophenol test in screening of α(0) thalassemia, β thalassemia and Hb E in a cohort study revealed 100% sensitivity, 79.6% specificity, 80.0% positive predictive value and 100% negative predictive value. The combined blood cell counting using the URIT-2900 Automated Hematology Analyzer and dichlorophenolindophenol test is suitable for population screening of thalassemia and hemoglobinopathies in Southeast Asia. Copyright © 2011 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Management of ß-thalassemia – Consensus and controversies!

Directory of Open Access Journals (Sweden)

Mamta V. Manglani

2017-12-01

Full Text Available The mainstay of treatment of ß-Thalassemia major includes life-long regular packed red cell transfusions and iron chelation. With advances in understanding the molecular biology and its implications in the patients, newer modalities are now being explored to offer a better quality of life to transfusion dependent thalassemic patients. Improved safety of transfusions, newer chelator drugs and combination of chelators have improved outcomes in these patients. Amlodipine along with chelators may be a future option for preventing cardiac iron overload related complications. Drugs which improve HbF levels and thus ameliorate anemia such as hydroxyurea, butyrates azacytidine etc. have also been explored with little relief to transfusion dependent patients. HSCT, which is the only curative treatment available at present, has its own limitations as sibling donors may not be available to many. However, there has been extensive work done on improving outcomes with MUD and Haplo-identical HSCT in the recent times. Gene therapy using lentiviral vectors is also offering great hope to these children. Induced Pluripotent Stem Cells (iPSC is a promising advance in the treatment of thalassemia. Several newer molecules targeting different pathophysiologic aspects are being explored and have met with good success. These include luspatercept, sotatercept, macrophage inhibition, JAK2 inhibition using ruxolitinib etc. Controversies regarding use of wheat grass and ESAs are relatively less worrisome. But use of thalidomide should be done with great caution. Despite its success reported in anecdotal reports, in the absence of adequate data with larger trials, its role in routine management of thalassemia syndromes remains to be ascertained.

β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis.

Science.gov (United States)

Crielaard, Bart J; Rivella, Stefano

2014-06-01

β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.

β-THALASSEMIA DISTRIBUTION IN THE OLD WORLD: A HISTORICAL STANDPOINT OF AN ANCIENT DISEASE

Directory of Open Access Journals (Sweden)

Vincenzo De Sanctis

2017-02-01

Full Text Available Abstract Background: Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β -thalassaemia is characterised by the reduced synthesis (β + or absence (β o of the β-globin chains in the HbA molecule, resulting in accumulation of  excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers of the β-thalassemias: there is a high incidence in populations extending from the Mediterranean basin throughout the Middle East, the Indian subcontinent, Southeast Asia, Melanesia and into the Pacific Islands Aim: The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and  in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations.     Results: Mutations involving the ß-globin gene are the most common cause of genetic disorders  in humans. To date, more than 350 β -thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of individual population’s specific mutations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions: Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at its geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity and settlements. The

EFFECT OF CIS ACTING POTENTIAL REGULATORS IN THE ß GLOBIN GENE CLUSTER ON THE PRODUCTION OF HBF IN THALASSEMIA PATIENTS

Directory of Open Access Journals (Sweden)

Anita Nadkarni

2013-02-01

Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

The Effects of an Orientation Program on Quality of Life of Patients with Thalassemia: a Quasi-Experimental Study.

Science.gov (United States)

Rafii, Zahra; Ahmadi, Fazlollah; Nourbakhsh, Sayed Mohamad Kazem; Hajizadeh, Ebrahim

2016-09-01

Introduction: Medical advances have improved life expectancy and survival of patients with thalassemia. However, as getting older, patients with thalassemia experience different complications which impair their quality of life. The aim of this study was to examine the effects of a nurse-implemented orientation program on quality of life in patients with thalassemia. Methods: A convenience sample of 55 patients with thalassemia were recruited in this quasi-experimental study. Patients were randomly allocated to control or experimental groups. A demographic questionnaire, Thalassemia quality of life questionnaire, and 36-item short form health survey were used for data collection before and one month after the intervention. In the intervention group, 1.5-month orientation program including of the three steps of inauguration, implementation, and closure was implemented, while the control group received routine care. The Chi-square, independent t-test and paired-samples t-test were used for data analysis by using SPSS ver.13 software. Results: The intervention and control group did not differ significantly from each other regarding demographic characteristics. Moreover, no significant difference was observed between the two groups regarding the quality of life scores after the implementation of orientation program. Conclusion: Implementing a short-term orientation program was not effective in enhancing the quality of life in patients with thalassemia; hence, developing long-term multimodal strategies may result in better improvement.

The Effects of an Orientation Program on Quality of Life of Patients with Thalassemia: a Quasi-Experimental Study

Directory of Open Access Journals (Sweden)

Zahra Rafii

2016-09-01

Full Text Available Introduction: Medical advances have improved life expectancy and survival of patients with thalassemia. However, as getting older, patients with thalassemia experience different complications which impair their quality of life. The aim of this study was to examine the effects of a nurse-implemented orientation program on quality of life in patients with thalassemia. Methods: A convenience sample of 55 patients with thalassemia were recruited in this quasi-experimental study. Patients were randomly allocated to control or experimental groups. A demographic questionnaire, Thalassemia quality of life questionnaire, and 36-item short form health survey were used for data collection before and one month after the intervention. In the intervention group, 1.5-month orientation program including of the three steps of inauguration, implementation, and closure was implemented, while the control group received routine care. The Chi-square, independent t-test and paired-samples t-test were used for data analysis by using SPSS ver.13 software. Results: The intervention and control group did not differ significantly from each other regarding demographic characteristics. Moreover, no significant difference was observed between the two groups regarding the quality of life scores after the implementation of orientation program. Conclusion: Implementing a short-term orientation program was not effective in enhancing the quality of life in patients with thalassemia; hence, developing long-term multimodal strategies may result in better improvement.

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

Science.gov (United States)

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Diagnostic utility of isoelectric focusing and high performance liquid chromatography in neonatal cord blood screening for thalassemia and non-sickling hemoglobinopathies.

Science.gov (United States)

Uaprasert, Noppacharn; Settapiboon, Rung; Amornsiriwat, Supaporn; Sarnthammakul, Patsita; Thanapat, Tassanee; Rojnuckarin, Ponlapat; Sutcharitchan, Pranee

2014-01-01

Thalassemia syndromes are highly prevalent in Southeast Asia. In Thailand, high performance liquid chromatography (HPLC) is the most common technique routinely performed in diagnosis of thalassemia and hemoglobinopathies, while isoelectric focusing (IEF) is rarely employed. We compared the diagnostic utility of IEF and HPLC in neonatal screening for thalassemia and non-sickling hemoglobinopathies. Two-hundred and forty-one cord blood samples were analyzed using IEF and HPLC, β-thalassemia short program. The results were correlated with red cell indices and molecular analyses. Hemoglobin (Hb) Bart's was quantified only on IEF. Of 241 newborns, IEF and HPLC yielded 85.4% and 76.4% sensitivity to identify α-thalassemia syndrome, respectively. HbBart's≥2% yielded 100% sensitivity to identify 2 α-globin gene deletions and/or mutations, while MCV≤95fl and MCH≤30pg yielded 100% sensitivity to identify 2 α-globin gene deletions. DNA analysis revealed HbE mutation in all 61 subjects with HbA2>1% on both IEF and HPLC. IEF is an effective method in neonatal screening for thalassemia and non-sickling hemoglobinopathies. The HbBart's level, MCV and MCH are helpful for identifying α-thalassemia. The presence of HbA2 higher than 1% in cord blood indicates HbE carriers in Southeast Asian newborns. © 2013.

Alloimmunization and autoimmunization in transfusion dependent thalassemia major patients: Study on 319 patients

Directory of Open Access Journals (Sweden)

Hari Krishan Dhawan

2014-01-01

Full Text Available Background: The development of anti-red blood cell antibodies (both allo-and autoantibodies remains a major problem in thalassemia major patients. We studied the frequency of red blood cell (RBC alloimmunization and autoimmunization among thalassemia patients who received regular transfusions at our center and analyzed the factors, which may be responsible for development of these antibodies. Materials and Methods: The study was carried out on 319 multiply transfused patients with β-thalassemia major registered with thalassemia clinic at our institute. Clinical and transfusion records of all the patients were examined for age of patients, age at initiation of transfusion therapy, total number of blood units transfused, transfusion interval, status of splenectomy or other interventions. Alloantibody screening and identification was done using three cell and 11 cell panel (Diapanel, Bio-rad, Switzerland respectively. To detect autoantibodies, autocontrol was carried out using polyspecific coombs (IgG + C3d gel cards. Results: Eighteen patients out of total 319 patients (5.64% developed alloantibodies and 90 (28.2% developed autoantibodies. Nine out of 18 patients with alloantibodies also had autoantibodies. Age at first transfusion was significantly higher in alloimmunized than non-immunized patients (P = 0.042. Out of 23 alloantibodies, 52.17% belonged to Rh blood group system (Anti-E = 17%, Anti D = 13%, Anti-C = 13%, Anti-C w = 9%, 35% belonged to Kell blood group system, 9% of Kidd and 4% of Xg blood group system. Conclusion: Alloimmunization was detected in 5.64% of multitransfused thalassemia patients. Rh and Kell blood group system antibodies accounted for more than 80% of alloantibodies. This study re-emphasizes the need for RBC antigen typing before first transfusion and issue of antigen matched blood (at least for Rh and Kell antigen. Early institution of transfusion therapy after diagnosis is another means of decreasing

Study of alpha hemoglobin stabilizing protein expression in patients with β thalassemia and sickle cell anemia and its impact on clinical severity.

Science.gov (United States)

Mahmoud, Hanan Mohamed; Shoeib, Ahmed Al-Saiid Hamed; Abd El Ghany, Shereen Mohamed; Reda, Marwa Mohamed; Ragab, Iman Ahmed

2015-12-01

The α hemoglobin stabilizing protein (AHSP) binds α-Hb and prevents its precipitation limiting free α-Hb toxicities. Our aim was to study AHSP expression in β thalassemia syndromes in relation to their clinical severity and to compare it with its level in sickle cell anemia. We compared patients with β-thalassemia (n=37) (β-thalassemia major (BTM) (n=19) and β-thalassemia intermedia (BTI) (n=18)) with 12 patients with sickle cell anemia as regards clinical severity, age at presentation, transfusion dependency, mean pre-transfusion hemoglobin level, use of hydroxyurea and AHSP expression by real time quantitative PCR. Median (and IQR) AHSP expression was significantly higher in patients with sickle cell anemia 2275 (3898) compared to thalassemia 283 (718), P=0.001, with no significant difference between BTM and BTI (P=0.346). It was also significantly higher in non-transfusion dependent patients with β thalassemia (NTDT) compared to transfusion dependent ones (P=0.019), and in patients on hydroxyurea therapy (Psickle cell anemia versus thalassemia, with no significant difference between BTM and BTI. Expression was higher in patients with NTDT and on hydroxyurea therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group.

Science.gov (United States)

Tan, Jin-Ai Mary Anne; Lee, Ping-Chin; Wee, Yong-Chui; Tan, Kim-Lian; Mahali, Noor Fadzlin; George, Elizabeth; Chua, Kek-Heng

2010-01-01

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.

What Unrelated Hematopoietic Stem Cell Transplantation in Thalassemia Taught us about Transplant Immunogenetics

Science.gov (United States)

La Nasa, Giorgio; Vacca, Adriana; Littera, Roberto; Piras, Eugenia; Orru, Sandro; Greco, Marianna; Carcassi, Carlo; Caocci, Giovanni

2016-01-01

Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT) continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA)-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cord blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS) and thalassemia-free survival (TFS) rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD) remains the most important complication in unrelated HSCT in thalassemia, leading to significant rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individualize appropriate strategies for its prevention and management. This review provides an overview of recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia. PMID:27872728

WHAT UNRELATED HEMATOPOIETIC STEM CELL TRANSPLANTATION IN THALASSEMIA TAUGHT US ABOUT TRANSPLANT IMMUNOGENETICS.

Directory of Open Access Journals (Sweden)

Giorgio La Nasa

2016-10-01

Full Text Available Abstract Although the past few decades have shown an improvement in the survival and complication-free survival rates in patients with beta-thalassemia major and gene therapy is already at an advanced stage of experimentation, hematopoietic stem cell transplantation (HSCT continues to be the only effective and realistic approach to the cure of this chronic non-malignant disease. Historically, human leukocyte antigen (HLA-matched siblings have been the preferred source of donor cells owing to superior outcomes compared with HSCT from other sources. Nowadays, the availability of an international network of voluntary stem cell donor registries and cordon blood banks has significantly increased the odds of finding a suitable HLA matched donor. Stringent immunogenetic criteria for donor selection have made it possible to achieve overall survival (OS and thalassemia-free survival (TFS rates comparable to those of sibling transplants. However, acute and chronic graft-versus-host disease (GVHD remains the most important complication in unrelated HSCT in thalassemia, leading to considerable rates of morbidity and mortality for a chronic non-malignant disease. A careful immunogenetic assessment of donors and recipients makes it possible to individuate appropriate strategies for its prevention and management. This review provides an overview on recent insights about immunogenetic factors involved in GVHD, which seem to have a potential role in the outcome of transplantation for thalassemia.

Study on Mössbauer spectra of hemoglobin in thalassemia

Science.gov (United States)

Xuanhui, Guo; Nanming, Zhao; Xiufang, Zhang; Naifei, Gao; Youwen, Huang; Rongxin, Wang

1988-02-01

The57Fe Mössbauer spectra of erythrocytes in normal subjects and nine patients of different thalassemias were studied. Together with clinical analysis, the correlation between the components in the spectra and different types of anemias was discussed.

Treating iron overload in patients with non-transfusion-dependent thalassemia

Science.gov (United States)

Taher, Ali T; Viprakasit, Vip; Musallam, Khaled M; Cappellini, M Domenica

2013-01-01

Despite receiving no or only occasional blood transfusions, patients with non-transfusion-dependent thalassemia (NTDT) have increased intestinal iron absorption and can accumulate iron to levels comparable with transfusion-dependent patients. This iron accumulation occurs more slowly in NTDT patients compared to transfusion-dependent thalassemia patients, and complications do not arise until later in life. It remains crucial for these patients' health to monitor and appropriately treat their iron burden. Based on recent data, including a randomized clinical trial on iron chelation in NTDT, a simple iron chelation treatment algorithm is presented to assist physicians with monitoring iron burden and initiating chelation therapy in this group of patients. Am. J. Hematol. 88:409–415, 2013. © 2013 Wiley Periodicals, Inc. PMID:23475638

Population Screening and Prevention Strategies for Thalassemias and other Hemoglobinopathies of Eastern India: Experience of 18,166 cases.

Science.gov (United States)

Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa

2015-01-01

We evaluated population screening programs (1999-2011), conducted by the Thalassaemia Foundation, Kolkata, India, for the first time in Eastern India in different districts of West Bengal, for prevention of thalassemia comprising screening of heterozygotes and β-thalassemia intermedia (β-TI) cases [β(+), β(++), β(0)/β(+), β(E)/β(E) (codon 26 or HBB: c.79G > A), Hb-E-β-thalassemia (Hb E-β-thal)]. Among 18,166 cases, we found 2092 heterozygotes and 2245 β-TI individuals (who had no information about their disorders). Results were evaluated with standard hematological analyses including erythrocyte indices, hemoglobin (Hb) typing and quantification. Participants were divided into five groups (children, pre-marriage cases, pre-pregnancy cases, affected family members, pregnant women). The objectives of this evaluation were to fix cut-off values of red blood cells (RBCs), mean corpuscular volume (MCV), mean corpuscular Hb (MCH), red blood cell distribution width (RDW) and Hb A2, as the standard World Health Organization (WHO) guidelines were not strictly followed in mass-scale screening programs. We have observed many dilemmas in considering the status of the thalassemia subject, due to presence of some other clinical conditions such as iron deficiency anemia, α-thalassemia (α-thal), δ-thalassemia (δ-thal), clinically silent Hb variants, and some cases of non hemoglobinopathies (such as pregnancy) along with thalassemia. The MCV values varied greatly in different conditions of hemoglobinopathies, whereas MCH provided a more stable measurement. We found an MCH value of <27.0 pg is a suitable cut-off point for screening in this population. Participants with an MCH of <27.0 pg should be investigated further to confirm or exclude a diagnosis of β-thal trait.

Irradiation for progressive paraparesis in β-thalassemia intermedia

International Nuclear Information System (INIS)

Wilson, J.J.; Hill, M.E.; Crookston, J.H.

1980-01-01

This article describes the case history of a patient suffering from β-thalassemia intermedia. The patient was treated with radiation to the thoraic spine (1500 rad in 5 days) and his condition improved. Subsequent tomography indicated the success of this type of irradiation without recourse to laminectomy. (T.I.)

β-Thalassemia mutations and hemoglobinopathies in Adana, Turkey: results from a single center study

OpenAIRE

Guvenc, Birol; Canataroglu, Abdullah; Unsal, Cagatay; Yildiz, Sule Menziletoglu; Turhan, Ferda Tekin; Bozdogan, Sevcan Tug; Dincer, Suleyman; Erkman, Hakan

2012-01-01

Introduction β-Thalassemia and hemoglobinopathies are common genetic disorders in Turkey and in this retrospective study our aim was to determine the frequency of β-thalassemia and hemoglobinopathies in Adana, which is one of the biggest cities located in the southern part of Turkey. Material and methods Data from 3000 individuals admitted to Seyhan Hereditary Blood Disorders Center in Adana were evaluated. The blood samples were collected into EDTA-containing tubes and hematological paramete...

The effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients

Directory of Open Access Journals (Sweden)

Soleiman Mahjoub

2007-12-01

Full Text Available BACKGROUND: Thalassemia is the most common hereditary disease in the world. Thalassemic erythrocytes are exposed to higher oxidative stress and lipid peroxidation. The aim of this study was to investigate the effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients.
METHODS: A prospective double-blind, placebo-controlled study of the effect of beta-carotene and vitamin E on lipid peroxidation in erythrocytes membranes was performed on 120 beta-thalassemia major patients in four groups. The patients were supplemented for 4 weeks as follows: group 1 with beta-carotene (13 mg/day, group 2 with vitamin E (550 mg/day, group 3 with beta-carotene plus vitamin E and group 4 with placebo. We prepared all capsules for 4 roups in the same shape and color. Measurements of serum beta-carotene and vitamin E were performed by high performance
liquid chromatography. After preparation of ghost cells from blood specimens, malondialdehyde (MDA was determined as index of lipid peroxidation in erythrocytes membranes before and after treatment. RESULTS: The levels of serum beta-carotene and vitamin E were significantly lower and MDA concentrations in erythrocytes membranes were significantly higher in beta-thalassemia patients compared to controls (P<0.001. In groups that treated with vitamin supplements for 4-weeks, lipid peroxidation rates were significantly reduced after treatment (P<0.001, but in placebo group there was not significant difference (P>0.05.
CONCLUSIONS: Our findings provide evidence that an oral treatment with beta-carotene and vitamin E can significantly reduce lipid peroxidation of erythrocytes membranes and could be useful in management of beta-thalassemia major patients. KEYWORDS: Beta-thalassemia major, beta-carotene, vitamin E, malondialdehyde, lipid peroxidation.

Global burden, distribution and prevention of β-thalassemias and hemoglobin E disorders.

Science.gov (United States)

Colah, Roshan; Gorakshakar, Ajit; Nadkarni, Anita

2010-02-01

The β-thalassemias, including the hemoglobin E disorders, are not only common in the Mediterranean region, South-East Asia, the Indian subcontinent and the Middle East but have now become a global problem, spreading to much of Europe, the Americas and Australia owing to migration of people from these regions. Approximately 1.5% of the global population are heterozygotes or carriers of the β-thalassemias. While the overall frequencies of carriers of these disorders are known in most countries, there have been few attempts at micromapping and wherever this has been done, significant variations are seen even within small geographic regions. Thus, the figures for the estimated numbers of births each year of homozygous β-thalassemia and the severe compound states involving other hemoglobin disorders may be an underestimate. Screening strategies have varied from premarital to antenatal in different countries depending on socio-cultural and religious customs in different populations. Prenatal diagnosis programs are ongoing in many countries and the knowledge of the distribution of mutations has facilitated the establishment of successful control programs. Many of these were through North-South partnerships and networking. Yet, there are many countries in Asia where they are lacking, and South-South partnerships are now being developed in South-East Asia and the Indian subcontinent to link centers with expertise to centers where expertise needs to be developed. Although the carrier frequencies will remain unaltered, this will eventually help to bring down the burden of the birth of affected children with β-thalassemias and hemoglobin E disorders in Asia.

Resolution of alloimmunization and refractory autoimmune hemolytic anemia in a multi-transfused beta-thalassemia major patient

Directory of Open Access Journals (Sweden)

Joseph Philip

2014-01-01

Full Text Available Beta-thalassemia is one of the most prevalent autosomal disorders, which affect more than 400,000 newborn per year worldwide. In India, the carrier rate of beta-thalassemia varies from 3-17%. The overall rate of alloimmunization in thalassemia patients has been reported to be 5-30% in the world, which is mostly contributed by the alloimmunization to minor blood group antigen. Among Asians, the incidence of red cell alloimmunization is 22%. The recommended treatment for beta-thalassemia major is regular blood transfusion every 3 to 4 weeks. The development of anti-red cell antibodies (alloantibodies and/or autoantibodies can significantly complicate transfusion therapy. Alloantibodies are commonly associated with red cell hemolysis. Red cell autoantibodies appear less frequently, but they can result in clinical hemolysis called autoimmune hemolytic anemia (AIHA, and in difficulty in cross-matching blood. Patients with autoantibodies may have a higher transfusion rate and often require immunosuppressive drugs or alternative treatments including intravenous immunoglobulin (IVIg and rituximab (anti-CD20 monoclonal antibody.

Complementary and alternative medicine use in thalassemia patients in Shiraz, southern Iran: A cross-sectional study

Directory of Open Access Journals (Sweden)

Mohammadreza Bordbar

2018-01-01

Full Text Available This study aimed to determine the frequency and pattern of complementary and alternative medicine (CAM use in thalassemia patients in south of Iran. The survey was done using a validated questionnaire which was distributed among 122 thalassemia patients. Only 108 questionnaires were completed and turned back (response rate 88.5%. Patients referred to an outpatient thalassemia clinic in Shiraz, southern Iran for blood transfusion. The mean age of the patients was 22.9 ± 7.9 years (range 4–45 years with female/male ratio 1.84. Seventy four (68.5% of the responders used CAM at least once during their life, and about half of them used it concurrently with their conventional treatments. The most reported CAM product was mint juice (50%. The most common reason of CAM use was increased general health. The most common information source about CAM was physicians who were the most trusted source as well. CAM is frequently being used in thalassemia patients to ensure their sense of well-being and help them overcome the complications of their illnesses.

Mixed chimerism following hematopoietic stem cell transplantation in pediatric thalassemia major patients: a single center experience

Directory of Open Access Journals (Sweden)

Elif Ünal İnce

2010-03-01

Full Text Available Objective: Stable mixed chimerism (MC may result in cure for thalassemia major patients following hematopoietic stem cell transplantation (HSCT, but rejection can occur. Twenty-eight HSCTs for thalassemia major were reviewed retrospectively to evaluate the clinical course of MC with possible risk factors and predictors of outcome, with a median follow-up of 1669 days (811-3576 days. Materials and Methods: Chimerism was detected by fluorescence in situ hybridization (FISH or multiplex polymerase chain reaction depending on the sex match between the donor and the recipient. Results: Primary rejection, stable MC and full donor chimerism was detected in 3.6%, 17.8% and 78.6% of patients, respectively. Clinically, 4/5 patients with stable MC had thalassemia trait with donor chimerism as low as 14%. One patient was started on pRBC transfusions at 2.5 years postHSCT. Conclusion: Stable MC can result in cure for thalassemia major patients. The clinical picture remains as the best guide for intervention until a more reliable predictor is available.

One-step genetic correction of hemoglobin E/beta-thalassemia patient-derived iPSCs by the CRISPR/Cas9 system.

Science.gov (United States)

Wattanapanitch, Methichit; Damkham, Nattaya; Potirat, Ponthip; Trakarnsanga, Kongtana; Janan, Montira; U-Pratya, Yaowalak; Kheolamai, Pakpoom; Klincumhom, Nuttha; Issaragrisil, Surapol

2018-02-26

Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression. The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein. Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.

Alpha+ -thalassemia protects against anemia associated with asymptomatic malaria: evidence from community-based surveys in Tanzania and Kenya.

NARCIS (Netherlands)

Veenemans, J.; Andang'o, P.E.; Mbugi, E.V.; Kraaijenhagen, R.J.; Mwaniki, D.L.; Mockenhaupt, F.P.; Roewer, S.; Olomi, R.M.; Shao, J.F.; Meer, J.W.M. van der; Savelkoul, H.F.J.; Verhoef, H.

2008-01-01

BACKGROUND: In hospital-based studies, alpha(+)-thalassemia has been found to protect against severe, life-threatening falciparum malaria. alpha(+)-Thalassemia does not seem to prevent infection or high parasite densities but rather limits progression to severe disease--in particular, severe

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

OpenAIRE

Selma Ünal; Günay Balta; Fatma Gümrük

2014-01-01

Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

β-Thalassemia Distribution in the Old World: an Ancient Disease Seen from a Historical Standpoint

Science.gov (United States)

De Sanctis, Vincenzo; Kattamis, Christos; Canatan, Duran; Soliman, Ashraf T.; Elsedfy, Heba; Karimi, Mehran; Daar, Shahina; Wali, Yasser; Yassin, Mohamed; Soliman, Nada; Sobti, Praveen; Al Jaouni, Soad; El Kholy, Mohamed; Fiscina, Bernadette; Angastiniotis, Michael

2017-01-01

Background Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β-thalassaemia is characterised by the reduced synthesis (β+) or absence (βo) of the β-globin chains in the HbA molecule, resulting in accumulation of excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers) of the β-thalassemias; there is a high incidence in populations from the Mediterranean basin, throughout the Middle East, the Indian subcontinent, Southeast Asia, and Melanesia to the Pacific Islands. Aim The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations. Results Mutations involving the β-globin gene are the most common cause of genetic disorders in humans. To date, more than 350 β-thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of specific mutations in individual populations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at their geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity, and settlements. An analysis of the distribution of the molecular spectrum of

MR imaging of femoral marrow in treated β-thalassemia major

International Nuclear Information System (INIS)

Shen Jun; Liang Biling; Chen Jianyu; Zhao Jiquan; Xu Honggui; Chen Chun

2006-01-01

Objective: To investigate MR imaging features of femoral marrow in treated β-thalassemia major. Methods: MR imaging of the proximal femoral marrow was performed in 35 cases of β-thalassemia major and 45 age- and sex-matched normal children as control. Coronal images of femoral marrow with the techniques of spin echo and fast field echo (FFE) were obtained. On T 1 -weighted imaging the red and yellow femoral marrow were judged and marrow distribution was classified into five groups. The hemosiderosis of marrow was judged on the basis of signal intensity of marrow on FFE imaging. The marrow distribution classification and the hemosiderosis on MR imaging were correlated with clinical features. Results: On FFE, marrow hemosiderosis occurred in 15 patients with a marked hypo-intensity signal and was related to the age (P=0.032). On T 1 -weighted imaging, the femoral marrow in 35 patients was classified as group III and IV, while the marrow distribution was group I or II in all normal children, there was statistically significant difference (P<0.001). The marrow distribution correlated positively with blood transfusion (P=0.049). Conclusion: The red marrow hyperplasia and hemosiderosis could occur in the femoral marrow of the treated β-thalassemia major. The marrow hyperplasia on MR imaging was related to the blood transfusion, and the hemosiderosis related to the age. (authors)

Thalassemia, extramedullary hematopoiesis, and spinal cord compression: A case report.

Science.gov (United States)

Bukhari, Syed Sarmad; Junaid, Muhammad; Rashid, Mamoon Ur

2016-01-01

Extramedullary hematopoiesis (EMH) refers to hematopoiesis outside of the medulla of the bone. Chronic anemia states such as thalassemia can cause hematopoietic tissue to expand in certain locations. We report a case of spinal cord compression due to recurrent spinal epidural EMH, which was treated with a combination of surgery and radiotherapy. Pakistan has one of the highest incidence and prevalence of thalassemia in the world. We describe published literature on diagnosis and management of such cases. An 18-year-old male presented with bilateral lower limb paresis. He was a known case of homozygous beta thalassemia major. He had undergone surgery for spinal cord compression due to EMH 4 months prior to presentation. Symptom resolution was followed by deterioration 5 days later. He was operated again at our hospital with complete resection of the mass. He underwent local radiotherapy to prevent recurrence. At 2 years follow-up, he showed complete resolution of symptoms. Follow-up imaging demonstrated no residual mass. The possibility of EMH should be considered in every patient with ineffective erythropoiesis as a cause of spinal cord compression. Treatment of such cases is usually done with blood transfusions, which can reduce the hematopoietic drive for EMH. Other options include surgery, hydroxyurea, radiotherapy, or a combination of these on a case to case basis.

The effect of alpha-thalassemia on cord blood red cell indices and interaction with sickle cell gene

International Nuclear Information System (INIS)

Quadri, Mohammad I.; Islam, Sherief I.A.M.; Nasserullah, Z.

2000-01-01

Alpha-thalassemia is known to be prevalent in the Eastern region of Saudi Arabia. There are no large scale reports regarding the effect of alpha-thalassemia on red cell indices of cord blood from Saudi Arabia. Similarly, there are reports regarding the interaction of alpha-thalassemia and the sickle-cell gene in relation to red cell indices in cord blood. To address these issues, we undertook a study on neonatal cold blood samples. In a prospective study, cord blood samples from 504 neonates from the Qatif area of the Eastern Province of Saudi Arabia were analyzed for complete blood counts (CBC) and cellulose acetate Hb electrophoresis. Hb S was confirmed by citrate agar Hb electrophoresis. There were 243 case samples with normal Hb electrophoresis (Hb A 27.2+- 7% and Hb F 72.6+-7.7%). Their mean Hb (g/dL), RBC (x10/L), Hct (%), MCV (pg), MCHC (g/dL), RDW-SD (fl) and RDW-CV (%) were 15.05+-1.6, 4.5+-0.5, 47.4+-5.3, 106+-8, 33.6+-2.3, 31.8+-1.7, 69.2+-9.5 and 17.9+-1.7, respectively. There were 136 cases with alpha-thalassemia trait (alphaTT), 57 cases with sickle cell trait (SCT) and 50 cases of sickle cell trait with alplha-thalassemia trait (SCT/ alphaTT). There were ten cases of Hb H disease (6 definite), including one with sickle cell disease (SCD) and two with SCT, Hb Bart's 23.9%-43.6%; four probable with Hb Bart's 10.9%-16.1% and one with SCT. The effect on red cell parameters in Hb H disease were most pronounced. In addition, there seven cases of SCD, four of whom had coexistent alpha-thalassemia trait (SCD/alphaTT). The prevalence of alpha-thalassemia in this cohort of Saudi population was 39.99%. Hb H disease appeared as common as SCD. Sickle cell gene was seen in 23.4% of neonatal samples. Apha-thalassemia gene significantly reduces MCH, MCV, RDW-SD, Hct, Hb and increase RBC count in both normal or sickle cell trait neonates. Generally, the variation of red cell parameters is directly proportional to the amount of Hb Bart's in the cord blood. Sickle cell

Sickle Cell Beta-Plus Thalassemia with Subcapsular Hematoma of the Spleen

Directory of Open Access Journals (Sweden)

Suyash Dahal

2017-01-01

Full Text Available While splenic complications like hypersplenism, sequestration crisis, and infarction are commonly reported in sickle cell variants like sickle cell beta-plus thalassemia, splenic rupture with hematoma is rare. We present a case of a 32-year-old young male who presented with dull left upper quadrant pain who was found to have multiple subcapsular splenic lacerations and hematoma on abdominal imaging. Hemoglobin electrophoresis confirmed sickle cell beta-plus thalassemia in the patient. There was no history of trauma, and rest of the workup for possible cause of spontaneous rupture of spleen was negative. With the patient refusing splenectomy, he was managed conservatively. Clinicians need to be aware of this rare complication of sickle cell variants.

Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

International Nuclear Information System (INIS)

Hafeez, M.

2007-01-01

To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

PREVENTION OF Β THALASSEMIA IN NORTHERN ISRAEL - A COST-BENEFIT ANALYSIS.

Directory of Open Access Journals (Sweden)

Ariel Koren

2014-02-01

Full Text Available Background:β Thalassemia major is characterized by hemolytic anemia, ineffectiveerythropoiesis and hemosiderosis. About 4 % of the world population carries a Thalassemiagene. Management includes blood transfusions and iron chelation, this treatmentis costly and population screening may be significantly more cost benefit. Purpose: Thepurpose of the current study is to analyze the cost of running a preventionprogram for β Thalassemia in Israel and compare it to the actual expensesincurred by treating Thalassemia patients. Methods: Threecost parameters were analyzed and compared: The prevention program, routinetreatment of patients and treatment of complications. An estimation of theexpenses needed to treat patients that present with complications werecalculated based on our ongoing experience in treatment of deterioratingpatients. Results andConclusions: The cost of preventing one affected newborn was $63,660 comparedto $1,971,380 for treatment of a patient during 50 years (mean annual cost:  $39,427. Thus, the prevention of 45 affectednewborns over a ten years period represents a net saving of $88.5 million tothe health budget. Even after deducting the cost of the prevention program ($413.795/yr., the program still represents abenefit of $ 76 million over ten years. Each prevented case could pay thescreening and prevention program for 4.6 ys.

Prenatal control of nondeletional α-thalassemia: first experience in mainland China.

Science.gov (United States)

Li, Jian; Li, Ru; Zhou, Jian-Ying; Xie, Xing-Mei; Liao, Can; Li, Dong-Zhi

2013-09-01

To demonstrate the performance of nondeletional α-thalassemia prevention at a mainland Chinese hospital. A prenatal control program for nondeletional hemoglobin H (Hb H) disease was conducted from January 2010 to June 2012. All couples were screened for α-thalassemia trait, and for couples in whom one partner was tested positive for α(0) -thalassemia, the other was subjected to screening for Hb Constant Spring and Hb Quong Sze mutations. Prenatal diagnoses were offered in pregnancies of couples at-risk for nondeletional Hb H disease. Of the 30,152 couples screened, 18 (0.06%) were diagnosed as at risk for nondeletional Hb H disease. There were other 13 at-risk couples who were referred to prenatal diagnosis because they had previously an affected child. Of the 31 cases with prenatal invasive tests, 11 (35.5%) had diagnosis by chorionic villous sampling, and 20 (64.5%) had amniocentesis. Totally, 12 fetuses were diagnosed with nondeletional Hb H disease, and all of the affected pregnancies were terminated. Implementation of a prevention and control program accompanying with a referral system for prenatal diagnosis is technically feasible in southern China, and a number of nondeletional Hb H disease have been prevented during the past 3 years of operation. © 2013 John Wiley & Sons, Ltd.

Hemoglobinopathies and thalassemia screening among Senoi Orang Asli in Peninsular Malaysia

Science.gov (United States)

Rong, Danny Koh Xuan; Ismail, Endom; Sabudin, Raja Zahratul Azma Raja; Hussin, Noor Hamidah; Othman, Ainoon

2015-09-01

Orang Asli are the minority indigenous people in Peninsular Malaysia and can be divided into 3 main groups (Negrito, Senoi and Proto Malay) with different six sub-ethnics under each group. Within the Senoi group, the six sub-ethnics are sub-ethnic Mah Meri, Semoq Beri, Che Wong, Jah Hut, Semai and Temiar. This study was aimed to investigate the current prevalence of α- and β-thalassemia and hemoglobinopathies and their mutation types among all six sub-ethnics of Senoi Orang Asli. Blood samples from 685 Senoi participants were collected and sent immediately for routine full blood count analysis and hemoglobin sub-typing. Of 378 subjects screened, 7 subjects were found to be Hemoglobin E (HbE) beta thalassemia carriers, 13 beta thalassaemic, 35 Hemoglobin Constant Spring (HbCS) carriers, 6 compound HbE and HbCS carriers, 32 with HbE disease and 163 HbE heterozygote carriers. The findings of high HbE among Temiars and Jah Huts and high HbCS exclusively in Jah Huts in this study suggest distinct differences across sub-ethnics under Senoi group. Understanding of prevalence and wide spectrum of thalassemia and hemoglobinopathies among Senoi and Orang Asli is essential for national thalassaemia awareness and prevention program, especially in Orang Asli communities.

a+- Thalassemia Protects against Anemia Associated with Asymptomatic Malaria: Evidence from Community-Based Surveys in Tanzania and Kenya

NARCIS (Netherlands)

Veenemans, J.; Andang'o, P.E.A.; Mbugi, E.V.; Kraaijenhagen, R.; Mwaniki, D.; Mockenhaupt, F.P.; Roewer, S.; Olomi, R.M.; Shao, J.F.; Meer, van der J.W.M.; Savelkoul, H.F.J.; Verhoef, J.C.M.

2008-01-01

Background. In hospital-based studies, ¿+-thalassemia has been found to protect against severe, life-threatening falciparum malaria. ¿+-Thalassemia does not seem to prevent infection or high parasite densities but rather limits progression to severe disease¿in particular, severe malarial anemia. We

Diagnosis of thalassemia and iron deficiency anemia using confocal and atomic force microscopy

Science.gov (United States)

Tariq, Saira; Bilal, Muhammad; Shahzad, Shaheen; Firdous, Shamaraz; Aziz, Uzma; Ahmed, Mushtaq

2017-11-01

Anemia is the most prevalent blood disorder, categorized into thalassemia and iron deficiency anemia. In anemia, the morphology of erythrocytes is disturbed, thus leading to abnormal functioning of the erythrocytes. Globally, thalassemia affects 1.3% of individuals and is one of the most widespread monogenic disorders in Pakistan. All over the World, women and children are most frequently affected by a type of nutritional deficiency known as iron deficiency anemia. The morphological changes that occur in erythrocytes due to these diseases are investigated in this study at the nano-scale level. Fifty samples of blood from individuals suffering from thalassemia or iron deficiency anemia were obtained from different hospitals in Rawalpindi and Islamabad. The blood samples were scanned using atomic force microscopy (AFM) and laser scanning confocal microscopy (LSCM) to check the morphological changes in both types of anemia. According to the present study, thalassemia is most prevalent in females in the age group between 5 and 15 years old, and iron deficiency is most prevalent in females in the age groups of 16-25 and 36-45 years old. Erythrocyte morphology is the significant determinant for diagnosing and discriminating between these two types of diseases. The study reports deformed erythrocytes in anemic patients, which were different from the ones that existed in the control. Thalassemia erythrocytes showed a crenated shape, iron deficiency anemia erythrocytes showed an elliptocyte shape and healthy erythrocytes showed a biconcave disk shape when using AFM and LSCM. These techniques seem to be very promising, cheap and less time consuming in determining the structure-function relationship of erythrocytes of thalassemic and iron deficiency anemic patients. The results of LSCM and AFM are quite useful in determining the morphological changes in erythrocytes and to study the disease at the molecular level within short period of time. Hence, we encourage employing

ARKRAY ADAMS A1c HA-8180T Analyzer for Diagnosis of Thalassemia and Hemoglobinopathies Common in Southeast Asia.

Science.gov (United States)

Kunwandee, Jatuphol; Srivorakun, Hataichanok; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2014-01-01

To evaluate the ARKRAY ADAMS A1c HA-8180T analyzer for diagnosis of thalassemias and hemoglobinopathies commonly found in the Southeast Asian population. Our cohort consisted of 557 specimens from adults referred for thalassemia diagnosis. From these, we selected 457 specimens and subjected them to DNA analysis to determine various thalassemia genotypes. Also, to confirm the reference range for HbA2, we obtained an additional 48 specimens from healthy individuals. We estimated the diagnostic range for Hb E from specimens from another 52 subject individuals previously diagnosed with heterozygous HbE. All of these individuals had negative results in DNA testing for all common α-thalassemia alleles found in Thailand. We performed hemoglobin (Hb) analysis and compared the results with those we derived from testing the CAPILLARYS 2 Flex Piercing device. We defined genotypes via by DNA analysis. Performance evaluation revealed the within- and between-run precision for analysis of HbA2 and HbE, with coefficients of variation (CVs) ranging from 0.6% to 2.5%. We determined the reference ranges of HbA2 and HbE in the HbE heterozygote to be 2.2% to 3.4 % and 25.7% to 31.0%, respectively. We were able to identify all cases of β-thalassemia and HbE disorders. We coeluted HbH and Hb Bart and interfered with acetylated HbF. The ARKRAY ADAMS A1c HA-8180T analyzer could accurately identify which individuals had β-thalassemia and HbE disorders. However, compared with other high-performance liquid chromatography instruments in diagnosing α-thalassemia disease with HbH and Hb Bart, this analyzer is relatively difficult to use. Copyright© by the American Society for Clinical Pathology (ASCP).

Low-cost matched sibling bone marrow transplant for standard-risk thalassemia in a limited-resource setting

Directory of Open Access Journals (Sweden)

Stalin Ramprakash

2017-12-01

Full Text Available Thalassemias are the most common inherited genetic disorder in India and a major public health burden with bone marrow transplant (BMT considered the only established curative therapy. We describe outcomes for patients (n = 71 with standard-risk thalassemia (liver size 80 at the last follow up. 5 patients (7% died, mortality related to transplant. Enough data existed for 2 centers in India (36/71 transplants to analyze overall costs from admission up to one-year post-BMT which revealed a median cost of Rs 7,30,445 ($11519 [Range Rs 4,52,821–10,32,842 ($ 7079–16147]. In conclusion, children with thalassemia in resource limited settings can achieve good outcomes with BMT at a reasonable cost.

Study of glycolytic intermediates in hereditary elliptocytosis with thalassemia

Directory of Open Access Journals (Sweden)

Pavri Roshan

1977-01-01

Full Text Available Glycolytic intermediates like ATP, DPG and GSH have been studied in a family with. hereditary elliptocytosis and thalassemia. Results indicate a fall in ATP with a concomitant rise in DPG in the Patient. Findings are discussed in relation to other data.

Health related quality of life in Middle Eastern children with beta-thalassemia.

Science.gov (United States)

Caocci, Giovanni; Efficace, Fabio; Ciotti, Francesca; Roncarolo, Maria Grazia; Vacca, Adriana; Piras, Eugenia; Littera, Roberto; Markous, Raji Suleiman Dawood; Collins, Gary Stephen; Ciceri, Fabio; Mandelli, Franco; Marktel, Sarah; La Nasa, Giorgio

2012-06-22

Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL) in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years). HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL) 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002), Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015) and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047). HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046) and their parents (p = 0.007). The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children's HRQoL.

Serum ferritin, serum nitric oxide, and cognitive function in pediatric thalassemia major

Directory of Open Access Journals (Sweden)

Septiana Nur Qurbani

2017-06-01

Full Text Available Background Hemolysis and repeated blood transfusions in children with thalassemia major cause iron overload in various organs, including the brain, and may lead to neurodegeneration. Hemolysis also causes decreased levels of nitric oxide, which serves as a volume transmitter and slow dynamic modulation, leading to cognitive impairment. Objective To assess for correlations between serum ferritin as well as nitric oxide levels and cognitive function in children with thalassemia major.  Methods This analytical study with cross-sectional design on 40 hemosiderotic thalassemia major patients aged 6−14 years, was done at the Thalassemia Clinic in Dr. Hasan Sadikin Hospital, Bandung, West Java, from May to June 2015. Serum ferritin measurements were performed by an electrochemiluminescence immunoassay; serum nitric oxide was assayed by a colorimetric procedure based on Griess reaction; and cognitive function was assessed by the Wechsler Intelligence Scale for Children test. Statistical analysis was done using Spearman’s Rank correlation, with a significance value of 0.05. Results Abnormal values in verbal, performance, and full scale IQ were found in 35%, 57.5% and 57.5%, respectively. Serum nitric oxide level was significantly correlated with performance IQ (P=0.022, but not with verbal IQ (P=0.359 or full scale IQ (P=0.164. There were also no significant correlations between serum ferritin level and full scale, verbal, or performance IQ (P=0.377, 0.460, and 0.822, respectively. Conclusion Lower serum nitric oxide level is significantly correlated to lower cognitive function, specifically in the performance IQ category. However, serum ferritin level has no clear correlation with cognitive function.

Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).

OpenAIRE

Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H

1987-01-01

An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...

Urine β2 Microglobulin and other Biochemical Indices in β Thalassemia Major

Directory of Open Access Journals (Sweden)

Yazdan Ghandi

2009-12-01

Full Text Available To find if some indices have predictive value for renal complications. We conducted a cross sectional and included 80 patients with the age ranged 5-17 years, all with the proven diagnosis of β-thalassemia major. A urine and 5 ml of blood sample were obtained from all of the cases. Biochemical indices such as serum levels of creatinine, Na, Mg, Hb, and ferritin and also urine levels of Na, Mg, creatinine and β2 microglobulin was measured. All data analysis was performed using SPSS 14.0. P-Spearman test was applied to assess correlation between urine beta-2-microglobulin and other variables. Patients GFR was in normal range. Abnormal level of urine β2 microglobulin was reported in 44 patients (55%. P Spearman test proved correlation only between urine β2 microglobulin and FE-Mg. We concluded that renal proximal tubular dysfunction may oocur in children with β thalassemia major without clinical manifestations of renal dysfunction or decrease in GFR. We warn not to rely only on GFR as a early indicator for renal complications among children with β thalassemia major.

Regional consensus opinion for the management of Beta thalassemia major in the Arabian Gulf area

Science.gov (United States)

2013-01-01

Thalassemia syndrome has diverse clinical presentations and a global spread that has far exceeded the classical Mediterranean basin where the mutations arose. The mutations that give rise to either alpha or beta thalassemia are numerous, resulting in a wide spectrum of clinical severity ranging from carrier state to life-threatening, inherited hemolytic anemia that requires regular blood transfusion. Beta thalassemia major constitutes a remarkable challenge to health care providers. The complications arising due to the anemia, transfusional iron overload, as well as other therapy-related complications add to the complexity of this condition. To produce this consensus opinion manuscript, a PubMed search was performed to gather evidence-based original articles, review articles, as well as published work reflecting the experience of physicians and scientists in the Arabian Gulf region in an effort to standardize the management protocol. PMID:24044606

Incomplete paraplegia caused by extramedullary hematopoiesis in a patient with thalassemia intermedia.

Science.gov (United States)

Hisamud-Din, Nurhasyimah; Mustafah, Nadia Mohd; Fauzi, Aishah Ahmad; Hashim, Natiara Mohamad

2017-01-01

Extramedullary hematopoiesis (EMH) is the production of blood cell precursors outside the bone marrow that occur in various hematological diseases. In patients with thalassemia intermedia, ineffective erythropoiesis drives compensatory EMH in the liver, pancreas, pleura, spleen, ribs and spine. We describe a patient with thalassemia intermedia who presented with acute neurological symptoms caused by paraspinal EMH, which responded well to combination therapy of steroid, hypertransfusion, laminectomy and excision of pseudotumor and hydroxyurea therapy to boost the formation of fetal haemoglobin. Prompt recognition of EMH based on clinical presentation and typical radiological findings should be made. Early treatment is recommended to prevent irreversible damage to the spinal cord.

Evolution of a genetic disease in an ethnic isolate: β-Thalassemia in the Jews of Kurdistan

International Nuclear Information System (INIS)

Rund, D.; Cohen, T.; Filon, D.; Rachmilewitz, E.; Oppenheim, A.; Dowling, C.E.; Warren, T.C.; Kazazian, H.H. Jr.; Barak, I.

1991-01-01

β-Thalassemia is a hereditary disease caused by any of 90 different point mutations in the β-globin gene. Specific populations generally carry a small number of mutations, the most common of which are those that are widely distributed regionally. The present study constitutes an extensive molecular characterization of this disease in a small, highly inbred ethnic group with a high incidence of β-thalassemia-the Jews of Kurdistan. An unusual mutational diversity was observed. In 42 sibships 13 different mutations were identified, of which 3 are newly discovered. Four of the mutations are unique to Kurdish Jews and have not been discovered in any other population. A fifth was found outside Kurdish Jews only in an Iranian from Khuzistan, a region bordering Kurdistan. Two-thirds of the mutant chromosomes carry the mutations unique to Kurdish Jews. The authors traced the origin of the mutations to specific geographic regions within Kurdistan. This information, supported by haplotype analysis, suggests that thalassemia in central Kurdistan (northern Iraq) has evolved primarily from multiple mutational events. They conclude that several evolutionary mechanisms contributed to the evolution of β-thalassemia in this small ethnic isolate

Increased levels of advanced glycation end products positively correlate with iron overload and oxidative stress markers in patients with β-thalassemia major.

Science.gov (United States)

Mirlohi, Maryam Sadat; Yaghooti, Hamid; Shirali, Saeed; Aminasnafi, Ali; Olapour, Samaneh

2018-04-01

The impaired biosynthesis of the β-globin chain in β-thalassemia leads to the accumulation of unpaired alpha globin chains, failure in hemoglobin formation, and iron overload due to frequent blood transfusion. Iron excess causes oxidative stress and massive tissue injuries. Advanced glycation end products (AGEs) are harmful agents, and their production accelerates in oxidative conditions. This study was conducted on 45 patients with major β-thalassemia who received frequent blood transfusions and chelation therapy and were compared to 40 healthy subjects. Metabolic parameters including glycemic and iron indices, hepatic and renal functions tests, oxidative stress markers, and AGEs (carboxymethyl-lysine and pentosidine) levels were measured. All parameters were significantly increased in β-thalassemia compared to the control except for glutathione levels. Blood glucose, iron, serum ferritin, non-transferrin-bound iron (NTBI), MDA, soluble form of low-density lipoprotein receptor, glutathione peroxidase, total reactive oxygen species (ROS), and AGE levels were significantly higher in the β-thalassemia patients. Iron and ferritin showed a significant positive correlation with pentosidine (P overload in β-thalassemia major patients and highlight the enhanced formation of AGEs, which may play an important role in the pathogenesis of β-thalassemia major.

IRON CHELATION THERAPY IN THALASSEMIA SYNDROMES

Directory of Open Access Journals (Sweden)

Paolo Cianciulli

2009-06-01

Full Text Available Transfusional hemosiderosis is a frequent complication in patients with transfusion dependent chronic diseases such as  thalassemias and severe type of sickle cell diseases. As there are no physiological mechanisms to excrete the iron contained in transfused red cells (1 unit of blood contains approximately 200 mg of iron the excess of iron is stored in various organs. Cardiomyopathy is the most severe complication covering more than 70% of the causes of death of thalassemic patients. Although the current reference standard iron chelator deferoxamine (DFO has been used clinically for over four decades, its effectiveness is limited by a demanding therapeutic regimen that leads to poor compliance. Despite poor compliance, because of the inconvenience of subcutaneous infusion, DFO improved considerably the survival and quality of life of patients with thalassemia. Deferiprone since 1998 and Deferasirox since 2005 were licensed for clinical use. The oral chelators have a better compliance because of oral use, a comparable efficacy to DFO in iron excretion and probably a better penetration to myocardial cells. Considerable increase in iron excretion was documented with combination therapy of DFO and Deferiprone. The proper use of the three chelators will improve the prevention and treatment of iron overload, it will reduce  complications, and improve survival and quality of life of transfused patients

A Comparison of Quality of Life between Adolescences with Beta Thalassemia Major and their Healthy Peers

Directory of Open Access Journals (Sweden)

Shahram Baraz

2016-01-01

Full Text Available Background The chronic genetic blood disorder, thalassemia, affects Quality of life (QOL negatively. Regarding this, if adolescences with thalassemia are treated well, they will grow into an adult who will have a good potential for participating in society. Objectives: to determine the strongest predictor of QOL, compare QOL between the adolescents with beta-type major and their peers in Abadan city. Materials and Methods This was a cross-sectional study; the population consisted of 65 beta thalassemia major patients and 65  healthy peers with the same ages as the witness group. The data collection tools included SF-36 questionnaire and a questionnaire for demographic information. Data analysis was performed using independent t-test, correlation and linear regression by SPSS-16. Results The results of the study revealed that there is a significant difference (P < 0.05 in the average quality of life between the two groups of the study. On the other hand, the results showed that there was a meaningful relation between different aspects of life quality and family history of thalassemia            (P< 0.05. Also, there was a negative correlation between quality of life and the frequency of blood transfusion per year (P< 0.05. Conclusion Adolescences with beta thalassemia major do not have a desirable quality of life, therefore, this fact shows the necessity of serious reforming in various fields of health care, treatment, family, social and financial support, and rehabilitation that need more attention from health care policymakers.

Setting up low-risk bone marrow transplantation for children with thalassemia may facilitate pediatric cancer care

Directory of Open Access Journals (Sweden)

Lawrence B Faulkner

2013-01-01

Full Text Available Background: In many South Asian countries there is shortage of centers providing care for pediatric malignancies. This report describes the experience of the Cure2Children Foundation (C2C in supporting, both financially and professionally, the startup of two bone marrow transplant (BMT centers, one in Pakistan and one in India, for the cure of transfusion-dependent thalassemia. Even though transplantation is generally considered as a more complex and advanced step relatively to basic pediatric cancer care, the authors argue that BMT for low-risk thalassemia patients with a matched sibling is a relatively simple procedure amenable to focused training. Materials and Methods: Since 2008 the C2C, an Italian Nongovernmental Organization (NGO, has supported a BMT network in Pakistan. The primary aim of this project was to assess feasibility, outcomes, and costs of matched-related BMT for thalassemia in young low-risk children employing a well established and quite tolerable strategy employed in Italy. This initiative relied primarily on focused training and task-shift strategies within a structured cooperation program. The initial success of that strategy led to its replication in India with 100 total BMTs performed over the past 4 years, 91 of which were for thalassemia major. Results: Low-risk matched-related BMT in children younger than 5 years could deliver a 92% thalassemia-free survival with 100% performance score and no extensive chronic graft versus host disease (GVHD, for an average cost of 10,000 USD per BMT. Within an existing hospital facility, 50,000 USD were sufficient to renovate and fully equip a 2-3 bedded start up BMT unit capable of performing safe low-risk compatible marrow transplantation. Conclusions: In low resource settings matched-related low-risk BMT for thalassemia can be performed with outcomes comparable to richer countries and with a fraction of the costs. Within structured and intensive cooperation, good outcomes can be

Reduced risk of uncomplicated malaria episodes in children with a+-thalassemia in northeastern Tanzania

DEFF Research Database (Denmark)

Enevold, Anders; Lusingu, John P; Mmbando, Bruno

2008-01-01

the susceptibility to uncomplicated malaria. We compared the risk of suffering from febrile, uncomplicated malaria between individuals carrying three common RBC polymorphisms (sickle cell trait, alpha(+)-thalassemia, and glucose-6-phosphate-dehydrogenase deficiency) and controls. The study was performed in an area...... measured with flow cytometry and ELISA assays, respectively. Regression analyses showed that alpha(+)-thalassemia was associated with a reduced risk of uncomplicated malaria episodes and that this advantageous effect seemed to be more predominant in children older than 5 years of age, but was independent...

Attitudes and beliefs among high- and low-risk population groups towards β-thalassemia prevention: a cross-sectional descriptive study from India.

Science.gov (United States)

Chawla, Swati; Singh, Rajnish Kumar; Lakkakula, Bhaskar V K S; Vadlamudi, Raghavendra Rao

2017-07-01

β-thalassemia is an autosomal recessive blood disorder caused by gene mutations that affect all aspects of β-globin production. In majority of Asian countries including India, the frequency of β-thalassemia is closely intertwined with social, cultural, and religious issues of the respective country. Several national level screening programs imparted education regarding β-thalassemia, but follow-up evaluation revealed that education was not effective. It has been hypothesized that the beliefs and attitudes, carrier screening, and education among "high risk communities" will have far-reaching implications towards β-thalassemia prevention in the country. The present study is aimed to investigate attitudes, intention, and behavior of β-thalassemia high- and low-risk ethnic groups towards carrier screening and education. A structured questionnaire on knowledge, attitude, and practice regarding β-thalassemia was administered on 926 individuals belong to Arora, a high-risk ethnic group for β-thalassemia (347 rural (AR) and 202 urban (AU)) and 377 cosmopolitan commoners (CC) aged above 18 years of both sexes. To understand the relationship between various questions, Pearson's correlation test and factor analysis was performed. The responses were further categorized into the theory of planned behavior (TPB) constructs with the measures of the main constructs reported as a mean. Various dimensions of knowledge, attitude, and practice reveal that the urban groups (AU and CC) are better aware of the disease "β-thalassemia" than the rural group (AR) who witness suffering at close quarters. The AR group is more positive for preventive measures than the urban groups. Significant correlations and factor analysis show "intentions" for premarital and prenatal screening highly loaded as outcome behaviors. The Ajzen's "Theory of planned behavior" support that the "intention" and "perceived behavior control" are better predictors of "outcome behavior" compared to "attitude

Physical growth in children with transfusion-dependent thalassemia

Directory of Open Access Journals (Sweden)

Harish K Pemde

2011-02-01

Full Text Available Harish K Pemde, Jagdish Chandra, Divya Gupta, Varinder Singh, Rajni Sharma, AK DuttaDepartment of Pediatrics, Lady Hardinge Medical College, Kalawati Saran Children's Hospital, New Delhi, IndiaObjective: To describe physical growth and related factors in transfusion-dependent thalassemia patients.Methods: This is a cross-sectional analysis of the records of the patients registered at and being followed up by the Thalassemia Day Care Center (TDCC at Kalawati Saran Children's Hospital, New Delhi, India. Clinical and laboratory parameters were recorded on a spreadsheet for analysis. Clinical parameters included weight, height, sexual maturity ratings, and general and systemic physical examination. Laboratory parameters included pretransfusion hemoglobin (Hb, periodic serum ferritin, and tests for viral markers of human immunodeficiency virus (HIV and hepatitis B and C. Z-scores for weight, height, and body mass index (BMI were calculated using World Health Organization reference data. Statistical analysis was carried out using Microsoft Excel® and Stata® software.Results: Out of 214 patients registered at the TDCC since 2001, 154 were included in this study. The mean age of patients was 9.19 years (range 0.5–20 years. Pretransfusion Hb was well maintained (mean 9.21 g/dL; 95% confidence interval [CI]: 9.06–9.36, but the mean serum ferritin levels were approximately three times (3112 ng/mL the desired value despite the patients being on deferiprone (72% or deferasirox (25%. One-third (33.11% of the patients had short stature, 13% were thin, and 10.82% were very thin (BMI z-score <-3. No patient was overweight or obese. Linear regression coefficient showed that for every 1-year increase in age, the mean ferritin value increased by 186.21 pg/mL (95% CI: 143.31–228.27. Height z-scores had significant correlation with mean ferritin levels, whereas correlation with mean pretransfusion Hb was not significant statistically. Mean ferritin levels

Assessing the potential success of cystic fibrosis carrier screening: lessons learned from Tay-Sachs disease and beta-thalassemia.

Science.gov (United States)

Laberge, A-M; Watts, C; Porter, K; Burke, W

2010-01-01

The objective of this study was to identify factors involved in the success of 2 well-established population-based carrier screening programs - Tay-Sachs disease (TSD) in Ashkenazi Jews and beta-thalassemia in Sardinia and Cyprus - and to assess the potential for success of a population-based cystic fibrosis (CF) carrier screening strategy using these factors. We performed a literature review and key informant interviews. Factors involved in the success of TSD and beta-thalassemia carrier screening programs include disease characteristics (well-defined population at risk, severe disease with predictable course, availability of effective treatment), test characteristics (high sensitivity, straightforward interpretation of results), and community characteristics (involvement of community, support of families and advocacy groups, consensus in favor of avoiding affected births). Current CF screening strategies include few of the factors listed above. Unlike TSD and beta-thalassemia, the purpose of current CF carrier screening strategies is informed reproductive decision-making, without an explicit goal of reducing disease incidence. When compared to TSD and beta-thalassemia, CF is a less favorable candidate for population-based carrier screening. Because of its different purpose, CF carrier screening will require different measures of success than those used for TSD and beta-thalassemia carrier screening, and a consensus on the value or success of CF carrier screening may be difficult to achieve.

STUDY OF SERUM HAPTOGLOBIN LEVEL AND ITS RELATION TO ERYTHROPOIETIC ACTIVITY IN BETA THALASSEMIA CHILDREN .

Directory of Open Access Journals (Sweden)

Seham Ragab

2015-02-01

Full Text Available Background  :Serum haptoglobin (Hp is a reliable marker for hemolysis regardless the inflammatory state.  Objective: We investigated the possible relation between Hp depletion and hemolysis severity, hepatitis C virus (HCV infection and iron load in β-thalassemia children. Methods: Twenty  two β-thalassemia major (TM ,20 β-thalassemia  intermedia (TI children with 20 age and sex matched healthy controls were involved. Pre-transfusion hemoglobin level was considered . Serum ferritin , Hp  and transferrin receptor  levels (sTfR  (by ELISA , alanine aminotransferase (ALT and  aspartate aminotransferase (AST  (by colorimetric method were assayed. Markers of hepatitis C virus  (HCV  were done by PCR. Results:  The mean Hp levels among the studied groups were as follows; 8.02 ± 0.93 (mg/dl , 8.6 ±0.72 (mg/dl  and 122  ± 18.5(mg/dl   for TM ,TI and the controls respectively . Both patient groups had significantly lower Hp level compared to the controls (P<0.0001  with significant lower level in TM compared to TI  children ( P= 0.034  .Significant inverse correlations were  found between serum Hp and sTfR levels in thalassemia children combined and in each group (TM and TI as well as among HCV infected children. STfR   was the only significant independent predictor for  serum Hp level (t= -5.585 , P<0.0001 . Among  HCV infected patients , no significant correlation was found between serum Hp and serum transaminases  .Conclusion:  Serum Hp depletion in thalassemia had significant relation to disease severity and correlated   well with their erythropoietic activity, as assessed by the measurement of  sTfR without significant relation  HCV infection . Large sample  multicenter studies are  recommended.

A rapid quantification method for the screening indicator for β-thalassemia with near-infrared spectroscopy

Science.gov (United States)

Chen, Jiemei; Peng, Lijun; Han, Yun; Yao, Lijun; Zhang, Jing; Pan, Tao

2018-03-01

Near-infrared (NIR) spectroscopy combined with chemometrics was applied to rapidly analyse haemoglobin A2 (HbA2) for β-thalassemia screening in human haemolysate samples. The relative content indicator HbA2 was indirectly quantified by simultaneous analysis of two absolute content indicators (Hb and Hb • HbA2). According to the comprehensive prediction effect of the multiple partitioning of calibration and prediction sets, the parameters were optimized to achieve modelling stability, and the preferred models were validated using the samples not involved in modelling. Savitzky-Golay smoothing was firstly used for the spectral pretreatment. The absorbance optimization partial least squares (AO-PLS) was used to eliminate high-absorption wave-bands appropriately. The equidistant combination PLS (EC-PLS) was further used to optimize wavelength models. The selected optimal models were I = 856 nm, N = 16, G = 1 and F = 6 for Hb and I = 988 nm, N = 12, G = 2 and F = 5 for Hb • HbA2. Through independent validation, the root-mean-square errors and correlation coefficients for prediction (RMSEP, RP) were 3.50 g L- 1 and 0.977 for Hb and 0.38 g L- 1 and 0.917 for Hb • HbA2, respectively. The predicted values of relative percentage HbA2 were further calculated, and the calculated RMSEP and RP were 0.31% and 0.965, respectively. The sensitivity and specificity for β-thalassemia both reached 100%. Therefore, the prediction of HbA2 achieved high accuracy for distinguishing β-thalassemia. The local optimal models for single parameter and the optimal equivalent model sets were proposed, providing more models to match possible constraints in practical applications. The NIR analysis method for the screening indicator of β-thalassemia was successfully established. The proposed method was rapid, simple and promising for thalassemia screening in a large population.

HEMATOPOIETIC STEM CELL TRANSPLANTATION IN THALASSEMIA AND SICKLE CELL DISEASE: EXPERIENCE OF MEDITERRANEAN INSTITUTE OF HEMATOLOGY IN A MULTI-ETHNIC POPULATION.

Directory of Open Access Journals (Sweden)

Marco Marziali

2009-12-01

Full Text Available Hematopoietic stem cell transplantation (HSCT still remains the only definitive cure currently available for patients with thalassemia and sickle cell anemia.  Results of transplant in thalassemia  and in sickle cell anemia  have steadily improved over the last two decades due to improvements in preventive strategies, and effective control of transplant-related complications. From 2004 through  2009,  145 consecutive patients with thalassemia and sickle cell anemia, ethnically heterogeneous from Mediterranean and Middle East countries, were given HSCT in the International Center for Transplantation in Thalassemia and Sickle Cella Anemia in Rome. This experience is characterized by two peculiarities: patients were ethnically very heterogeneous and the vast majority of these patients were not regularly transfesed/chelated and therefore were highly sensitized due to RBC transfusions without leukodepletion filters. Consequently, they could have a high risk of graft rejection as a result of sensitization to HLA antigens. The Rome experience of SCT in patients with thalassemia and sickle cell anemia confirmed the results obtained in Pesaro, and most importantly showed the reproducibility of these results in other centers.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

Science.gov (United States)

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Papillary Fibroelastoma as a Cause of Cardiogenic Embolic Stroke in a β-Thalassemia Patient: Case Report and Literature Review

Directory of Open Access Journals (Sweden)

Re-I Chin

2017-01-01

Full Text Available We describe a case of a young male without stroke risk factors who presented with a sudden onset of left-sided weakness, left hand numbness, and left eye blurriness. CT scan of the head without contrast and diffusion-weighted MRI of the brain with contrast revealed an ischemic stroke in the right middle cerebral artery distribution. Transesophageal echocardiography (TEE revealed a mobile pedunculated mass on the posterior surface of the mitral valve. This mass was resected and pathology showed a cardiac papillary fibroelastoma (CPFE, which was determined to be the cause of the patient’s cardioembolic stroke. Further workup also found that patient had microcytic anemia secondary to β-thalassemia intermedia, a rare hematologic disorder due to defective hemoglobin synthesis. Recently, another case report suggested β-thalassemia major may underlie the pathogenesis of CPFE. β-Thalassemia major causes a state of chronic inflammation and endothelial damage, which can mediate CPFE formation. Based on literature review, this is the first case report of a CPFE in a patient with β-thalassemia intermedia. This hypothesis-generating case report calls attention to the need for elucidating the relationship between CPFE and β-thalassemia in future studies to better understand the diagnosis and management of a rare cardiac tumor.

Allogeneic stem cell transplantation for thalassemia major in India

Directory of Open Access Journals (Sweden)

Vikram Mathews

2017-12-01

Full Text Available Allogeneic stem cell transplantation (allo-SCT is the only currently available curative treatment for thalassemia major. Since it was first done in 1981, several thousand patients have benefited from it and it is now possible to offer this treatment in different parts of the world with good results. With better risk stratification and supportive care, the results of allo-SCT are now very good even in high risk patients who have significant iron overload related organ dysfunction. The improvements have mainly been in the conditioning strategies with less toxic myeloablation and management of the complications of SCT. However, several challenges remain. Transplant related complications still cause significant morbidity and mortality. There is data to show that the results of transplantation as best if done in well transfused and chelated patients <7 years of age. As only a third of the patients will have a matched related donor, there is need for investigating SCT with alternative donors. Experience with SCT for thalassemia major from matched unrelated donors or haplo-identical donors is still limited but needs further exploration. Adequate management needs to be provided post-SCT for all pre-existing complications particularly iron chelation to prevent further organ dysfunction. Systematic follow-up is needed to measure long term outcomes. The biggest challenges in India are the cost of this treatment and access to centres capable of providing this treatment. With greater support from the government, health insurance and philanthropic programs, there has been a rapid increase in the number of SCTs for thalassemia major in India. The number centres providing this treatment are also increasing making this curative treatment more widely available in India.

Health related quality of life in Middle Eastern children with beta-thalassemia

Directory of Open Access Journals (Sweden)

Caocci Giovanni

2012-06-01

Full Text Available Abstract Background Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. Methods We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years. HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. Results The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002, Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015 and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047. HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046 and their parents (p = 0.007. Conclusions The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children’s HRQoL.

Seroprevalence of parvovirus B19 infection in patients with beta thalassemia major in Fayoum University Hospital

Directory of Open Access Journals (Sweden)

Mohamed E. Al Ghwass

2016-09-01

Conclusion: Parvovirus B19 infection is detected in high rates among children with beta thalassemia major. Measures to avoid iatrogenic and nosocomial transmission have to be implemented including screening of donated blood for B19 especially blood given to patients with hematological disorders. Also data from this study support the need for introduction of an approved B19 vaccine that primarily protects children with thalassemia major against that infection.

Spinal cord compression due to extramedullary hematopoiesis in beta-thalassemia intermedia

International Nuclear Information System (INIS)

Munn, Rita K.; Kramer, Carol A.; Arnold, Susanne M.

1998-01-01

Background: Extramedullary hematopoiesis (EMH) occurs in many disorders, including thalassemias and other hemoglobinopathies, and commonly presents in the spleen and liver. We present a case of spinal cord compression in a patient with beta-thalassemia intermedia, and review the literature and available treatment options. Patient and Methods: A 35-year-old black female with beta-thalassemia intermedia presented with a 3-week history of back pain and lower extremity weakness. Neurologic examination was consistent with spinal cord compression, and gadolinium enhanced magnetic resonance imaging (MRI) confirmed this diagnosis. She was given intravenous steroids and radiotherapy was begun in 200 cGy fractions to a total dose of 2000 cGy. Results: At the completion of radiotherapy the patient was ambulatory with mild residual weakness. MRI scans 16 months later showed smaller, but persistent masses, and she remains asymptomatic 5 years from her diagnosis. Conclusion: Recognition of spinal cord EMH requires prompt physical examination and MRI for accurate diagnosis. EMH can be managed with radiation, surgery, transfusions, or a combination of these therapies. Radiation in conservative doses of (750-3500 cGy) is non-invasive, avoids the surgical risks of potentially severe hemorrhage and incomplete resection, and has a high complete remission rate in the majority of patients. Relapse rates are moderate (37.5%), but retreatment provides excellent chance for second remission

the characterization of exon-1 mutation(s) of beta globin gene in beta thalassemia

International Nuclear Information System (INIS)

Abass, M.M.E.

2004-01-01

β-thalassemia constitutes one of the most serious health problems worldwide, it is the most common chronic hemolytic anemia in egypt. the aim of this work is to study the mutations of exon-1 of β-globin gene in β-thalassaemic children in sharkia governorate. the present study was included 25 healthy children and 50 patients diagnosed as β-thalassemia. this work showed that the thalassaemic patients had significantly decrease in Hb conc . than the control group (p 2 showed a significant increase as compared with the control group

Bone marrow transplantation in patients with Thalassemia

Directory of Open Access Journals (Sweden)

Ghavamzadeh A

1993-05-01

Full Text Available During April, 1991 and September, 1993, eighteen patients with major thalassemia admitted to Shariati BMT center. Seventeen patients were transplanted were from HLA identical siblings and one from. his HLA identical father. Eleven of the donors were the known cases of minor thalassemia. The range of patients' age was within 3-10 years (with the average of 5 years and 11 months. Among them, seven patients were male and eleven were female. As the other international BMT centers, we classified our patients into three classes. Our criteria for this classification were hepatomegaly, ferretin, and liver fibrous; 60% of our patients were put in class I and 40% in class II. All of our patients revealed a GVHD (severe graft vs. host disease three weeks post-BMT as pruritus, diarrhea, and skin erythema especially in hands and feet. Two of the patients showed severe GVHD. One of the patients had chimerism after BMT. Although one year after BMT has passed, the patients is still depended on blood transfusion. One patient, despite graft rejection, died nine months post-BMT; another one died after +70 due to GVHD. During 2.5 years, the overall graft survival rate was 88% in our center

Nephrogenic diabetes insipidus with intracranial calcification in a child with thalassemia minor.

Science.gov (United States)

Dimple, Jain; Alka, Jadhav; Mona, Gajre; Atul, Deshmukh

2013-09-01

There are numerous causes for intracranial calcification in children. We describe an unusual cause of intracranial calcification in a child, namely, nephrogenic diabetes insipidus (NDI). A 12-year-old boy presented with seizures and developmental delay. MRI of the brain revealed intracranial calcification. Evaluation showed findings suggestive of NDI. The lack of evidence of any other metabolic defect suggests that these calcifications were secondary to NDI. He also had anemia for which he was investigated and diagnosed as thalassemia minor. Detailed literature review failed to reveal any reported association between NDI and thalassemia minor. We report this case to emphasize the importance of early diagnosis and treatment of NDI to prevent organic brain damage.

SCREENING CORD BLOOD FOR HEMOGLOBINOPATHIES AND THALASSEMIA BY HPLC

NARCIS (Netherlands)

VANDERDIJS, FPL; VANDENBERG, GA; SCHERMER, JG; MUSKIET, FD; LANDMAN, H; MUSKIET, FAJ

We evaluated the use of an HPLC method for screening hemoglobins in cord blood. We studied the genotype frequencies of the structural hemoglobin variants HbS and HbC and the synthesis variants alpha- and beta+-thalassemia in babies born on Curacao. During three months, 67.2% of all (748) newborns

Investigating Challenges Facing Self-Management Empowerment Education in Adolescents and Youths with Major Thalassemia

Directory of Open Access Journals (Sweden)

Razzazan

2014-10-01

Full Text Available Background Thalassemia is considered an important public health problem worldwide, especially in developing and poor countries. Although several advanced techniques have been developed for prevention of thalassemia in the recent years, many adolescents and youths are still living with this disease. Independence from parents, decisions about high-risk behaviors, uncovering the identity, and adapting to mental and physical effects of the disease occur together in adolescents. Objectives This study was conducted to explore challenges of self-management empowerment in adolescents and youths with major thalassemia. Materials and Methods This was a descriptive-exploratory study. The study population consisted of adolescents and youths with major thalassemia who had medical records in the Bushehr Thalassemia Center, affiliated with Bushehr University of Medical Sciences. The study samples were purposively selected. Demographic information questionnaire and empowerment questionnaire were used to collect data from the semistructured interview. We analyzed qualitative data by content analysis method and quantitative data by descriptive (mean, standard deviation and analytical (Student's t-test, ANOVA and Pearson’s correlation coefficient statistical methods, using the statistical software SPSS 18. Results In qualitative part of the study, data from semistructured in-depth interviews with 15 participants were coded and summarized in five themes including: 1 awareness of personal changes; 2 need for adaptation; 3 maintaining independence and self-management; 4 uncovering the identity and role playing; and 5 sense of control and satisfaction. Results of the quantitative part showed that the overall score of participants on empowerment was 92.46 of 149 scores, which showed a moderate situation in the empowerment of these individuals. In addition, the empowerment score showed no statistically significant correlation with demographic characteristics

Endocrinopathies in Turkish children with Beta thalassemia major: results from a single center study.

Science.gov (United States)

Isik, Pamir; Yarali, Nese; Tavil, Betül; Demirel, Fatma; Karacam, Gülşah Bayram; Sac, Rukiye Unsal; Fettah, Ali; Ozkasap, Serdar; Kara, Abdurrahman; Tunc, Bahattin

2014-10-01

The endocrinological complications in β-thalassemia major patients do affect the life quality to a large extend. In this study, the endocrinological complications of 47 β-thalassemia patients, who have been followed-up at our hospital's pediatric hematology department, were evaluated. Out of β-thalassemia major cases included to this study, the 55.3% was male and 44.7% was female. The patients' mean levels of ferritin, whose mean age was 10.0 ± 4.5 years (2-20 years), were 2497 ± 1469 ng/mL (472-8558 ng/mL). At least one endocrinological pathology in 27 out of 47 (57.4%) and more than one endocrinological pathology in 14 out of 47 (29.7%) thalassemia patients were observed. The most frequently observed complication in followed-up cases was vitamin D insufficiency and deficiency (78.2%). The other complications in decreasing order were pubertal failure (41.6%), growth retardation (25.5%), decreased bone-mineral density (22.2%), secondary hyperparathyroidism (11.5%), overt hypothyroidism (4.25%), subclinical hypothyroidism (2.12%), and impaired glucose tolerance (2.12%). There was no statistically significant difference between serum mean ferritin level and endocrin complications (P > .05). Four patients (8.5%) had decreased signal intensity in pituitary magnetic resonance imaging (MRI) but this finding was not associated with ferritin levels (P = .87). MRI parameters were similar between patients with and without gonadal dysfunction. Mean height of the pituitary gland was 4.98 ± 1.1 mm (3-9 mm) and this was similar to those normal values in the literature. Ferritin levels were not correlated with pituitary height (P > .05). Beta thalassemia major, having the potential of leading to multisystemic complications, is a chronic disease that should be treated and followed-up by a multidisciplinary approach. Due to frequently encountered endocrinological complications, beta thalassemic patients should be followed-up regularly by hematology and endocrinology

Q Sepharose micro-column chromatography: A simple screening method for identifying beta thalassemia traits and hemoglobin E carriers.

Science.gov (United States)

Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong

2016-11-01

For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Hydroxyurea decreases hospitalizations in pediatric patients with Hb SC and Hb SB+ thalassemia

Directory of Open Access Journals (Sweden)

Lebensburger JD

2015-12-01

Full Text Available Jeffrey D Lebensburger, Rakeshkumar J Patel, Prasannalaxmi Palabindela, Christina J Bemrich-Stolz, Thomas H Howard, Lee M HilliardDivision of Pediatric Hematology Oncology, University of Alabama at Birmingham, Birmingham, AL, USAPurpose: Patients with hemoglobin SC (Hb SC and hemoglobin SB+ (Hb SB+ thalassemia suffer from frequent hospitalizations yet strong evidence of a clinical benefit of hydroxyurea (HU in this population is lacking. Patients with recurrent hospitalizations for pain crisis are offered HU at our institution based on small cohort data and anecdotal benefit. This study identifies outcomes from a large cohort of patients with Hb SC and SB+ thalassemia who were treated with HU for 2 years.Materials and methods: A retrospective review was conducted of 32 patients with Hb SC and SB+ thalassemia who were treated with HU. We reviewed the number, and reasons for hospitalization in the 2 years prior to, and 2 years post-HU treatment as well as laboratory changes from baseline, over 1 year.Results: Patients with Hb SC and SB+ thalassemia started on HU for frequent pain, had a significant reduction in hospitalizations over 2 years as compared to the 2 years prior to HU initiation (mean total hospitalizations/year: pre-HU: 1.6 vs post-HU 0.4 hospitalizations, P<0.001; mean pain hospitalizations/year: pre-HU 1.5 vs post-HU 0.3 hospitalizations, P<0.001. Patients demonstrated hematologic changes including an increase in percent fetal hemoglobin (%HbF pre–post HU (4.5% to 7.7%, P=0.002, mean corpuscular volume (74 to 86 fL, P<0,0001, and decrease in absolute neutrophil count (5.0 to 3.2×109/L, P=0.007. Patients with higher doses of HU demonstrated the greatest reduction in hospitalizations but this was unrelated to absolute neutrophil count.Conclusion: This cohort of patients with Hb SC and SB+ thalassemia provides additional support for using HU in patients with recurrent hospitalizations for pain. A large randomized multicenter trial of

Relationship among chelator adherence, change in chelators, and quality of life in thalassemia.

Science.gov (United States)

Trachtenberg, Felicia L; Gerstenberger, Eric; Xu, Yan; Mednick, Lauren; Sobota, Amy; Ware, Hannah; Thompson, Alexis A; Neufeld, Ellis J; Yamashita, Robert

2014-10-01

Thalassemia, a chronic blood disease, necessitates life-long adherence to blood transfusions and chelation therapy to reduce iron overload. We examine stability of health-related quality of life (HRQOL) in thalassemia and adherence to chelation therapy over time, especially after changes in chelator choice. Thalassemia Longitudinal Cohort participants in the USA, UK, and Canada completed the SF-36v2 (ages 14+) and the PF-28 CHQ (parents of children health status) at baseline who made a single change in chelator, but declined among participants with multiple changes and/or high iron burden (worse health status). Mental health improved among participants with lower iron burden, but iron overload was negatively associated with social functioning. Adherence did not significantly change over follow-up except for an increase after a change from deferoxamine (DFO) infusion to oral deferasirox (p = 0.03). Predictors of lower adherence for adults/adolescents at follow-up included side effects, smoking, younger age, problems preparing DFO, increased number of days per week DFO prescribed, and lower physical quality of life . Strategies to balance medical needs with family, work, and personal life may assist in adherence.

Micromapping of thalassemia and hemoglobinopathies in diferent regions of northeast Thailand and Vientiane, Laos People's Democratic Republic.

Science.gov (United States)

Tritipsombut, Jaruwan; Sanchaisuriya, Kanokwan; Phollarp, Prachatip; Bouakhasith, Dalouny; Sanchaisuriya, Pattara; Fucharoen, Goonnapa; Fucharoen, Supan; Schelp, Frank P

2012-01-01

In order to determine the prevalence of thalassemia and hemoglobinopathies in different regions of northeast (NE) Thailand and Vientiane, Laos People's Democratic Republic (PDR), a total of 1,809 blood samples were collected consecutively from individuals attending antenatal care services at 11 community hospitals in different regions of NE Thailand and three hospitals in Vientiane, Laos PDR, from May 2009 to April 2010. All individuals were investigated for thalassemia and hemoglobinopathies using standard methods. For individuals from NE Thailand, the carrier frequencies were 41.7% for Hb E [β26(B8)Glu→Lys, GAG>AAG], 5.8% for α(0)-thalassemia (α(0)-thal), and 0.9% for β-thal. The THAI deletion type of α(0)-thal was found in one individual from an ethnic minority. From a group of pregnant Laotian women, 30.1% were Hb E carriers. The prevalence of α(0)-thal of 8.6% for the Laotian women was similar to that found in the upper northeastern part of Thailand. The frequency of β-thal was 2.3 %. The proportion of carriers of α(+)-thal and Hb Constant Spring (Hb CS, α142, Term→Gln (TAA>CAA in α2)] ) from Thailand and Laos was significantly different. The frequency of Hb Paksé [α142, Term→Tyr (TAA>TAT in α2)] was relatively low for Thailand as well as for Laos. The results indicate that thalassemia and hemoglobinopathies are a significant health burden in the region and that a prevention and control program for severe thalassemia diseases should be established in Laos.

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

Science.gov (United States)

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

Splenectomized versus non-splenectomized patients with thalassemia major: Echocardiographic comparison

International Nuclear Information System (INIS)

Morsy, Mohamed-Mofeed F.; Ahmed, Ali A.; Al-Najjar, Abdulhameed A.; Almuzainy, Ibrahim S.; Alhawsawi, Zakria M.; Alserafi, Mona H.

2008-01-01

Objective was to study the effect of splenectomy in patients with thalassemia major on the cardiovascular system through echocardiographic study. A prospective, cross-sectional study was carried out from December 2006 to December 2007. Patients from the Thalassemia Center in the Maternity and Children's Hospital, Madina, Kingdom of Saudi Arabia, were screened by means of history, physical examination, laboratory studies and echocardiography. Fifty-seven patients were studied: 36 were non-splenectomized, while 21 were surgically splenectomized. The 2 study groups were well matched for age, gender, height and weight. The total amount of blood given previous year (6577+-206.9 ml versus 5390.5+-220.2 ml, p=0.0005) and the annual transfusion index (200.9+-11.3 ml versus 134.1+-7.3, p=0.0001) were significantly lower in the splenectomized group. There was no significant difference between 2 groups regarding laboratory studies. Left ventricular systolic function shows no difference regarding fraction shortening between the 2 groups. The mitral valve E/A ratio was significantly higher in the splenectomized group (1.6+-0.2 versus1.4+-0.2, p=0.02). The pulmonary artery pressure was higher in the splenectomized group (34.2+-9.1 versus 20.8+-9.2 mm Hg, p=0.0001). There was a significantly higher number of patients with pulmonary hypertension in the splenectomized group (14[66.7%] versus 6[1.7%], p=0.0004). Splenectomized patients with thalassemia major are at high risk of having impaired diastolic left ventricular function and pulmonary hypertension. (author)

Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

Energy Technology Data Exchange (ETDEWEB)

Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui [Nan fang Hospital, Southern Medical University, Guangzhou (China); Tamrakar, Karuna [Zhujiang Hospital, Southern Medical University, Guangzhou (China)

2012-03-15

Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

Intracranial extramedullary hematopoiesis in beta-thalassemia.

Science.gov (United States)

Karki, Bivek; Xu, Yi-Kai; Tamrakar, Karuna; Wu, Yuan-Kui

2012-01-01

Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

International Nuclear Information System (INIS)

Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui; Tamrakar, Karuna

2012-01-01

Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

Prevalence and Intensity of Depression in Mothers of Children with Beta-Thalassemia Major In Talghani Hospital of Gorgan, Iran

Directory of Open Access Journals (Sweden)

Nargesbeygom Mirbehbahani

2014-01-01

Full Text Available Background: Thalassemia is a chronic disease that it leads to psychological and social problems for parents. Mothers are at markedly increased risk of suffering from psychological distress and depression because they usually take on a considerable part of extra care that their children need.This study was designed to determine prevalence and intensity of depression in mothers with a thalassemic child. Material and Methods: In this cross – sectional study, 65 mothers of children with thalassemia major (case group and 65 mothers of children without thalassemia major (control group were assessed using the Beck Depression Inventory (BDI. Data were analyzed by using SPSS (v 16.0 for windows. Results: Prevalence of depression was significantly higher in case group than that in control group (84.6%vs. 56.9%, p <0.05. Moderate depression had a highest prevalence in the both groups (33.4% in case group and 30.8% in control group. Prevalence of severe depression in case group was markedly higher than that in control group (29.2% vs. 3.1% p<0.05. There was a significant difference between intensity of depression in mothers of case group that had another child with beta-thalassemia major (p<0.05. Conclusion: Mothers of children with thalassemia major are vulnerable to depression. They need psychosocial support to promote their health.

Quantitative assessment of metal dysregulation in β-thalassemia patients in comparison with healthy controls by ICP-MS and chemometric analyses.

Science.gov (United States)

Farooq, Sabiha; Mazhar, Wardah; Siddiqui, Amna Jabbar; Ansari, Saqib Hussain; Musharraf, Syed Ghulam

2018-01-31

β-Thalassemia is one of the most common inherited disorders and is widely distributed throughout the world. Owing to severe deficiencies in red blood cell production, blood transfusion is required to correct anemia for normal growth and development but causes additional complications owing to iron overload. The aim of this study is to quantify the biometal dysregulations in β-thalassemia patients as compared with healthy controls. A total of 17 elements were analyzed in serum samples of β-thalassemia patients and healthy controls using ICP-MS followed by chemometric analyses. Out of these analyzed elements, 14 showed a significant difference between healthy and disease groups at p 3. A PLS-DA model revealed an excellent separation with 89.8% sensitivity and 97.2% specificity and the overall accuracy of the model was 92.2%. This metallomic study revealed that there is major difference in metallomic profiling of β-thalassemia patients specifically in Co, Mn, Ni, V and Ba, whereas the fold changes in Co, Mn, V and Ba were found to be greater than that in Fe, providing evidence that, in addition to Fe, other metals are also altered significantly and therefore chelation therapy for other metals may also needed in β-thalassemia patients. Copyright © 2018 John Wiley & Sons, Ltd.

Alpha thalassemia among sickle cell anaemia patients in Kampala ...

African Journals Online (AJOL)

Keywords: Alpha thalassemia, sickle cell anaemia patients, Kampala, Uganda. DOI: http://dx.doi.org/10.4314/ahs.v15i2.48. Introduction. In the early 1960's many adults with sickle cell anaemia. (SCA) as well as those with mild disease were reported in Jamaica1. Various factors, both genetic and environmental, are.

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

Science.gov (United States)

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

Extramedullary hematopoiesis with spinal cord compression in a child with thalassemia intermedia.

Science.gov (United States)

Ileri, Talia; Azik, Fatih; Ertem, Mehmet; Uysal, Zumrut; Gozdasoglu, Sevgi

2009-09-01

Spinal cord compression due to extramedullary hematopoiesis is an extremely rare complication of thalassemia intermedia. No cases with this complication have been reported in the first decade of life, because masses of heterotropic marrow developed in patients as a result of continuous erythropoiesis. We report the 9-year-old patient suffering from thalassemia intermedia and presenting spinal cord compression. We also review the literature about treatment options, because there is no consensus about the optimal treatment of these patients. Our patient was successfully treated with radiation therapy followed by hydroxyurea. With this combination therapy, he had no recurrence during the 4-year follow-up period. Clinical awareness of this phenomenon with the early treatment is essential for optimizing the successful outcome.

Relationship between Plasma Ferritin Level and Siderocyte Number in Splenectomized β-Thalassemia/HbE Patients

Directory of Open Access Journals (Sweden)

A. Tripatara

2012-01-01

Full Text Available Introduction. In iron overload status, excess iron deposits in reticuloendothelial cells and tissues and can be detected using Prussian blue staining. The aim of this paper was to investigate the relationship between siderocyte numbers and plasma ferritin levels (a practically standard marker of iron overload in the blood of the splenectomized and nonsplenectomized β-thalassemia/HbE patients, who are at risk of iron overload. Methods. EDTA blood samples from 64 patients with 35 splenectomized and 29 nonsplenectomized β-thalassemia/HbE patients, who received regular blood transfusions, and 20 normal individuals were investigated for siderocyte numbers, plasma ferritin levels, and complete blood counts. Results. The average percent siderocytes in splenectomized and nonsplenectomized β-thalassemia/HbE patients were 11.5% and 0.08%, respectively, and plasma ferritin levels of 2,332 μg/L and 1,279 μg/L, respectively. Percent siderocytes showed a good correlation with plasma ferritin levels only in splenectomized patients (r=0.69, P<0.001. A receiver operating curve analysis from splenectomized patients’ data indicated that siderocytes at 3% cut-off are the best predictor for plasma ferritin level ≥1,000 μg/L with 92.9% sensitivity and 42.9% specificity. Conclusion. Circulating siderocyte numbers can be used as a screening test for the assessment of the iron overload in splenectomized β-thalassemia/HbE patients in the place where serum ferritin is not available.

Amelogenesis Imperfecta with Taurodontism, Microdontia, and Minor Thalassemia: A Case Report

Directory of Open Access Journals (Sweden)

Fatemeh Mazhari

2013-12-01

Full Text Available Amelogenesis imperfecta is a group of genetic disorders that affects both the morphology and quality of tooth structure. Although the disease entity is primarily associated with abnormalities of dental and oral structures, it has been reported to be associated with a few syndromes. A 9-year-old girl with minor thalassemia referred to the Department of Pediatric Dentistry of the Mashhad Faculty of Dentistry with a complaint of sensitivity of first permanent molars. Dental findings consisted of amelogenesis imperfecta, microdontia, posterior cross bite and taurodontism. This is the first report of thalassemia accompanied with amelogenesis imperfecta. Although the patients often are non-symptomatic, the trait can be passed on to a child and if both parents carry the trait, the child could develop a more severe form of the disease; therefore, early diagnosis is important.

Incidence of hemoglobinopathies and thalassemias in Northern Alberta. Establishment of reference intervals for HbF and HbA2.

Science.gov (United States)

Rodriguez-Capote, Karina; Higgins, Trefor N

2015-07-01

The aims of this study were to identify the incidence of hemoglobinopathies and thalassemias in Northern Alberta and calculate the reference intervals (RI) for hemoglobin (Hb) HbF and HbA2. A retrospective ad-hoc analysis of the structural Hb variants and thalassemias identified on patients who had a hemoglobinopathy/thalassemia investigation performed between February 1 to December 31, 2013. Results were extracted from the Laboratory Information System. Statistical analysis was performed using MedCalc® version 11.4.2.0 for Windows software. 6616 hemoglobinopathy/thalassemia investigations and HbS screens were physician requested and 602 Hb variants were fortuitously found during HbA1c analysis. 3438 were interpreted as "normal" and 532 were classified as iron deficient. 3306 individuals, with age ranging from 3 to 92 years were included in the RI calculation. HbA2 RI was 2.3% to 3.4% and HbF 0.0% to 1.8%. 524 and 423 α and β thalassemia traits respectively were identified. Additionally ten δβ thalassemia traits and twelve cases of HbH disease were identified. Regarding hemoglobinopathies, 7% were classified as α-chain variants and 93% as β-chain variants with HbS (46%), HbE (16%), HbD Punjab (8%) and HbC (7%) traits being the most prevalent. We also documented 20 homozygous hemoglobinopathies and 36 compound/double heterozygous hemoglobinopathies. A wide diversity of hemoglobinopathies is found in the Northern Alberta population, 80% of the hemoglobinopathies were found as a reflex to HbA1c testing. Reference intervals for HbF and HbA2 were established. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Effectiveness of Eye Movement Desensitization and Reprocessing on Anxiety in Children with Thalassemia in a 12-month follow up

Directory of Open Access Journals (Sweden)

A Shahnavazi

2016-02-01

Full Text Available Background and  Objective: Thalassemia is the most common genetic diseases in the world and especially in our country. For many reasons, including chronic disease, health care costs, the expected mortality Ray disease states such as anxiety, psychological and social problems in thalassemia. The aim of the present study was to assess the efficacy of Eye Movement Desensitization and Reprocessing (EMDR on anxiety of children with thalassemia in a 12-month follow up..  Methods: It was a clinical trial study, which was performed on 60 patients with Thalassemia in 2013-2014. A total of 60 thalassemic patients based on Beck anxiety inventory, selected using sampling and were randomly divided into experimental and Control groups. in experimental group, eye movement desensitization and reprocessing therapy was perfomed in five sessions and The control group received no intervention. In order to collect information on demographic questionnaire and Beck Anxiety Inventory were used. data were gathered on anxiety symptoms at pretreatment, posttreatment and 12 month follow up and were analyzed using descriptive statistics, repeated measures and chi square. Results: The average age of the participants was 15.22±1.93  years old. This study shows that the mean or average level of anxiety children with thalassemia in the experimental group before and after intervention and in a 12-month follow up group 34.73 ± 5.62, 19.90 ± 2.48 and 19.23 ± 2.48 respectively; repeated measures ANOVA showed significant statistical difference (p.05 Conclusion: This study shows that Method of eye movement desensitization and reprocessing as an alternative method to treat or reduce anxiety, aggressive children with thalassemia .Trained Nurses can use this new method is effective in the treatment of anxiety.

Development of hemoglobin typing control materials for laboratory investigation of thalassemia and hemoglobinopathies.

Science.gov (United States)

Pornprasert, Sakorn; Tookjai, Monthathip; Punyamung, Manoo; Pongpunyayuen, Panida; Jaiping, Kanokwan

2016-01-01

To date, the hemoglobin (Hb) typing control materials for laboratory investigation of thalassemia with low (1.8%-3.2%) and high (4%-6%) levels of HbA2 are available but there are no Hb typing quality control materials for analysis of thalassemia and hemoglobinopathies which are highly prevalent in South-East Asian countries. The main aim of the present study was to develop the lyophilized Hb typing control materials for laboratory investigation of thalassemia and hemoglobinopathies that are commonly found in South-East Asia. Erythrocytes of blood samples containing Hb Bart's, HbH, HbE, HbF, Hb Constant Spring (CS), Hb Hope, and Hb Q-Thailand were washed and dialysed with 0.85% saline solution. The erythrocytes were then lysed in 5% sucrose solution. The lyophilized Hb typing control materials were prepared by using a freeze drying (lyophilization) method. The high performance liquid chromatography (HPLC) analysis of lyophilized Hb was performed after the storage at -20 °C for 1 year and also after reconstitution and storage at 4 or -20 °C for 30 days. In addition, the Hb analysis was compared between the three different methods of HPLC, low pressure liquid chromatography (LPLC) and capillary electrophoresis (CE). Following a year of storage at -20 °C, the HPLC chromatograms of lyophilized Hb typing control materials showed similar patterns to the equivalent fresh whole blood. The stability of reconstituted Hb typing control materials was also observed through 30 days after reconstitution and storage at -20 °C. Moreover, the Hb typing control materials could be analyzed by three methods, HPLC, LPLC and CE. Even a degraded peak of HbCS was found on CE electropherogram. The lyophilized Hb typing control materials could be developed and used as control materials for investigation of thalassemia and hemoglobinopathies.

High prevalence of alpha-thalassemia among individuals with microcytosis and hypochromia without anemia

Directory of Open Access Journals (Sweden)

E. Borges

2001-06-01

Full Text Available In order to determine the contribution of alpha-thalassemia to microcytosis and hypochromia, 339 adult outpatients seen at Unicamp University Hospital (with the exception of the Clinical Hematology outpatient clinics, who showed normal hemoglobin (Hb levels and reduced mean corpuscular volume and mean corpuscular hemoglobin, were analyzed. Ninety-eight were Blacks (28.9% and 241 were Caucasians (71.1%. In all cases, Hb A2 and F levels were either normal or low. The most common deletional and nondeletional forms of alpha-thalassemia [-alpha3.7, -alpha4.2, --MED, -(alpha20.5, alphaHphIalpha, alphaNcoIalpha, aaNcoI and alphaTSAUDI] were investigated by PCR and restriction enzyme analyses. A total of 169 individuals (49.9% presented alpha-thalassemia: 145 (42.8% were heterozygous for the -alpha3.7 deletion (-alpha3.7/aa and 18 (5.3% homozygous (-alpha3.7/-alpha3.7, 5 (1.5% were heterozygous for the nondeletional form alphaHphIalpha (alphaHphIalpha/aa, and 1 (0.3% was a --MED carrier (--MED/aa. Among the Blacks, 56 (57.1% showed the -alpha3.7/aa genotype, whereas 12 (12.2% were -alpha3.7/-alpha3.7 and 1 (1.0% was an alphaHphIalpha carrier; among the Caucasians, 89 (36.9% were -alpha3.7/aa, 6 (2.5% had the -alpha3.7/-alpha3.7 genotype, 4 (1.7% presented the nondeletional form (alphaHphIalpha/aa, and 1 (0.4% was a --MED carrier. These results demonstrate that alpha-thalassemia, mainly through the -alpha3.7 deletion, is an important cause of microcytosis and hypochromia in individuals without anemia. These data are of clinical relevance since these hematological alterations are often interpreted as indicators of iron deficiency.

Education and employment status of children and adults with thalassemia in North America.

Science.gov (United States)

Pakbaz, Zahra; Treadwell, Marsha; Kim, Hae-Young; Trachtenberg, Felicia; Parmar, Nagina; Kwiatkowski, Janet L; Cunningham, Melody J; Martin, Marie; Sweeters, Nancy; Neufeld, Ellis J; Giardina, Patricia J; Olivieri, Nancy; Yamashita, Robert C; Vichinsky, Elliott

2010-10-01

Advances in the management of thalassemia have resulted in increased life expectancy and new challenges. We conducted the first survey of education and employment status of people with thalassemia in North America. A total of 633 patients (349 adults and 284 school age children) enrolled in the Thalassemia Clinical Research Network (TCRN) registry in Canada and the U.S. were included in the data analysis. Predictors considered for analysis were age, gender, race/ethnicity, site of treatment (Canada vs. United States), transfusion and chelation status, serum ferritin, and clinical complications. Seventy percent of adults were employed of which 67% reported working full-time. Sixty percent had a college degree and 14% had achieved some post-college education. Eighty-two percent of school age children were at expected grade level. In a multivariate analysis for adults, Whites (OR = 2.76, 95% CI: 1.50-5.06) were more likely to be employed compared to Asians. Higher education in adults was associated with older age (OR = 1.67, 95% CI: 1.29-2.15), female gender (OR = 2.08, 95% CI: 1.32-3.23) and absence of lung disease (OR = 14.3, 95% CI: 2.04-100). Younger children (OR = 5.7 for 10-year increments, 95% CI: 2.0-16.7) and Canadian patients (OR = 5.6, 95% CI: 1.5-20) were more likely to be at the expected education level. Neither transfusion nor chelation was associated with lower employment or educational achievement. Individuals with thalassemia in North America can achieve higher education; however, full-time employment remains a problem. Transfusion and chelation do not affect employment or education status of this patient population. Copyright 2010 Wiley-Liss, Inc.

The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

Science.gov (United States)

Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

2014-04-01

α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

Effect of Average Annual Mean Serum Ferritin Levels on QTc Interval and QTc Dispersion in Beta-Thalassemia Major

Directory of Open Access Journals (Sweden)

Yazdan Ghandi

2017-08-01

Full Text Available Background There is evidence indicating impaired cardiomyocytic contractility, delayed electrical conduction and increased electrophysiological heterogeneities due to iron toxicity in beta-thalassemia major patients. In the present study, we compared the electrocardiographic and echocardiographic features of beta-thalassemia major patients with a healthy control group. Materials and Methods The average annual serum ferritin levels of fifty beta-thalassemia major patients were assessed. For each patient, corrected QT (QTc intervals and QTc dispersions (QTcd were calculated and V1S and V5R were measured. All subjects underwent two-dimensional M-mode echocardiography and Doppler study and were compared with 50 healthy subjects as a control group. Results QTc interval and dispersion were significantly higher in beta-thalassemia major patients (P= 0.001. The mean V5R (20.04 ± 4.34 vs. 17.14 ± 2.55 mm and V1S (10.24 ± 2.62 vs. 7.83 ± 0.38 mm showed considerably higher mean values in patients in comparison with control group.Peak mitral inflow velocity at early diastole and early to late ratio in the case- group was markedly higher(P

Hubungan Kadar Feritin Serum dengan Gangguan Fungsi Paru Pasien Thalassemia Mayor Anak

Directory of Open Access Journals (Sweden)

Marte Robiul Sani

2016-11-01

Kesimpulan. Terdapat hubungan bermakna kadar feritin serum dengan gangguan fungsi paru pasien thalassemia mayor anak dan kadar feritin 4.839 μg/L merupakan batasan kadar feritin yang berhubungan dengan gangguan fungsi paru.

Thalassemia paravertebral tumors and bone marrow scan

International Nuclear Information System (INIS)

Huglo, D.; Rose, C.; Deveaux, M.; Bauters, F.; Marchandise, X.

1995-01-01

Two first cousins with thalassemia and with a paravertebral mass had had an indium 111 chloride bone marrow scan. Result of scan influenced therapy: medical treatment in one case where an extramedullary erythropoiesis was confirmed, surgical treatment in the other case. The use of dual-isotope SPECT (indium 111 chloride, HDP -99 Tc) constitutes a contribution to the establishment of diagnosis of extramedullary erythropoiesis, giving to bone marrow scintigraphy a merited importance, avoiding the biopsy. (authors). 15 refs., 5 figs

Characterization of beta-thalassemia mutations in patients from the state of Rio Grande do Norte, Brazil

Directory of Open Access Journals (Sweden)

Zama Messala Luna da Silveira

2011-01-01

Full Text Available 35 unrelated individuals were studied for characterization as either heterozygous or homozygous for beta-thalassemia. Molecular analysis was done by PCR/RFLP to detect the mutations most commonly associated with beta-thalassemia (β0IVS-I-1, β+IVS-I-6, and β039. In the patients who showed none of these mutations, the beta-globin genes were sequenced. Of the 31 heterozygous patients, 13 (41.9% had the β+IVS-I-6 mutation, 15 (48.4% the β0IVS-I-1 mutation, 2 (6.5% the β+IVS-I-110 mutation and 1 (3.2% the β+IVS-I-5 mutation. IVS-I-6 was detected in the four homozygotes. The mutation in codon 39, often found in previous studies in Brazil, was not detected in the present case. This is the first study aiming at identifying mutations that determine beta-thalassemia in the state of Rio Grande do Norte.

Methemoglobinemia and ascorbate deficiency in hemoglobin E β thalassemia: metabolic and clinical implications

Science.gov (United States)

Allen, Angela; Fisher, Christopher; Premawardhena, Anuja; Bandara, Dayananda; Perera, Ashok; Allen, Stephen; St Pierre, Timothy; Olivieri, Nancy

2012-01-01

During investigations of the phenotypic diversity of hemoglobin (Hb) E β thalassemia, a patient was encountered with persistently high levels of methemoglobin associated with a left-shift in the oxygen dissociation curve, profound ascorbate deficiency, and clinical features of scurvy; these abnormalities were corrected by treatment with vitamin C. Studies of erythropoietin production before and after treatment suggested that, as in an ascorbate-deficient murine model, the human hypoxia induction factor pathway is not totally dependent on ascorbate levels. A follow-up study of 45 patients with HbE β thalassemia showed that methemoglobin levels were significantly increased and that there was also a significant reduction in plasma ascorbate levels. Haptoglobin levels were significantly reduced, and the high frequency of the 2.2 haptoglobin genotype may place an additional pressure on ascorbate as a free-radical scavenger in this population. There was, in addition, a highly significant correlation between methemoglobin levels, splenectomy, and factors that modify the degree of globin-chain imbalance. Because methemoglobin levels are modified by several mechanisms and may play a role in both adaptation to anemia and vascular damage, there is a strong case for its further study in other forms of thalassemia and sickle-cell anemia, particularly when splenic function is defective. PMID:22885163

Reactivation of fetal hemoglobin in thalassemia and sickle cell disease

Directory of Open Access Journals (Sweden)

Sandro Eridani

2014-09-01

Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the

Partial Splenectomy in the treatment of an adult with β thalassemia intermedia: A case report.

Science.gov (United States)

Correia, João Guardado; Moreira, Nídia; Costa Almeida, Carlos Eduardo; Reis, Luís Simões

2017-01-01

Thalassemia is a common disease which treatment is often based on splenectomy. The risks associated with total splenectomy stimulated partial splenectomy as a potentially alternative therapy. A 45 year-old female patient with long term follow-up for β thalassemia intermedia started to develop signs of hypersplenism and iron overload. A partial splenectomy was performed and was observed a marked hematologic improvement while preserving the desired splenic function. Partial splenectomy proved to provide a persistent decrease in hemolytic rate while preserving the integrity of splenic phagocytic function, presenting itself as an effective alternative to total splenectomy. After being subjected to partial splenectomy, our patient experienced a sustained control of hemolysis and showed no signs of hypersplenism or iron overload. No splenic regrowth or infectious complications were observed. The major drawbacks of partial splenectomy are the increased risk of intra- and postoperative bleeding, splenic remnant torsion and splenic regrowth. Partial splenectomy is an alternative to total splenectomy for the treatment of adult β Thalassemia intermedia patients avoiding the risks associated with total splenectomy.

Detection of thalassemia genes using smeared blood film or leukocytes adhering to polysthylene fibers.

Science.gov (United States)

Tatsumi, N; Yokota, M; Shindoh, K; Funahara, Y; Nathalang, O; Sukpanichnant, S; Bunyaratvej, A; Fucharoen, S

1997-01-01

Presently genetic analyses for thalassemia types require relatively large amounts of heparinized blood (5 to 10 ml), and transport as well as degeneration of these sample is a problem in the developing world. We have developed a new method to simplify this procedure and obtain DNAs from small specimens. As experimental materials, thinly smeared blood on a glass slide or blood filtered with and adhered on polysthylene telephtalate (PST) fibers were used. These materials could be safely stored without interfering with DNA extraction for up to 3 months. The slide materials were digested with proteinase K, and DNA was extracted with Tris-EDTA-phenol:chloroform and precipitated with absolute ethanol. The PST specimens were washed with physiologic saline and treated in the same manner as described above. Products were easily amplified by PCR and digested with restriction endonucleases for beta thalassemia typing as well as for HLA-DQA1 gene typing. Results obtained by this method correlated well with previously reported incidences for thalassemia and HLA-DQA1 types in Thailand. This method can be used in the routine laboratory because it allows for stable and biosafe genetic analyses.

Social Determinants of Health from the Perspective of Women with Thalassemia: A Qualitative Study

Directory of Open Access Journals (Sweden)

Aboo Torab Talebi

2016-03-01

Full Text Available Background and Objective: In recent years, social determinants of health have received much attention from researchers in the social sciences. One of the major problems of the health sector in developing countries is the unequal distribution of health which leads to inequalities in social status and living conditions of people. The purpose of this study was to identify and describe the social determinants of health from the perspective of women with the Thalassemia disease.Materials and Methods: This study is a qualitative and thematic analysis. Participants in the study were 24 women with Thalassemia disease. The sampling method was purposeful. To collect qualitative data observation and participation, semi-structured interviews and study of the documents were used. For data analysis, thematic analysis and Wolcott method were used.Results: Social determinants of health from the perspective of women with thalassemia included economic factors (lack of interest-free banking facilities, health expenditure, social factors (inequality in employment, cultural factors (lack of awareness in society and health factors (inefficient health services.Conclusion: If the needs of disadvantaged people, women, and patients in the design and management of the health system be considered, health system performance would be desirable.

Comparison between β-thalassemia minor and normal individuals using the Wechsler Adult Intelligence Scale.

Science.gov (United States)

Zangiabadi, Nasser; Yarahmadi, Fahimeh; Darekordi, Ali; Shabani, Mohammad; Dadgar, Mehrak Memaran

2013-01-01

The present study aimed at investigating and comparing patients suffering from β-thalassemia (β-thal) minor with normal individuals in regard to their performances in the short version of the Wechsler Adult Intelligence Scale (WAIS) test. Patients with β-thal minor are carriers of β-thal genes. They have mild microcytic and hypochromic anemia and are usually asymptomatic. In this cross-sectional study, a total of 60 individuals were divided into two equal groups of β-thal minor and normal subjects; they were then studied by the WAIS subscales. The mean performance scores of the normal group in the subtests of arithmetic and vocabulary (p <0.01) and picture completion (p <0.05) were higher than those of the thalassemia group. The mean performance score and ability of the normal group on the verbal scale was higher in comparison to the thalassemia group (p <0.05), while on the non verbal scale, there was no significant difference between the two groups. It can be concluded that β-thal minor negatively influences verbal fluency, reasoning and conceptualization, and sequencing tasks, perceptual skill, prediction of social situations and abstract thinking.

Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia

Directory of Open Access Journals (Sweden)

Ilham Saleh Abuljadayel

2006-01-01

Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean

Hemoglobin Interlaken in combination with beta thalassemia trait

Directory of Open Access Journals (Sweden)

Mara J. Ojeda

2013-01-01

Full Text Available We report a rare a1 globin gene variant (Hb Interlaken found in a 63-year-old woman of Italian ancestry living in Buenos Aires Province, Argentina. The variant, a missense mutation at cd15 (GGT → GAT causing a Gly →Asp amino acid substitution and also known as Hb J Oxford, was found in combination with the common thalassemia trait cd 39 (C→T. The clinical picture of the patient was that of a b-thalassemia trait. 我们曾报道在阿根廷布宜诺斯艾利斯一名63岁意大利血统的妇女体内发现罕有的1珠蛋白基因（因特拉肯血红蛋白）变体。研究发现该变体是导致Gly → Asp氨基酸置的错义突变，也称为Hb J Oxford，与常见的地中海贫血性症cd 39 （C → T）有关。该患者临床症状与乙型地中海贫血特征相同。

Correction of β-thalassemia mutant by base editor in human embryos

Directory of Open Access Journals (Sweden)

Puping Liang

2017-09-01

Full Text Available Abstract β-Thalassemia is a global health issue, caused by mutations in the HBB gene. Among these mutations, HBB −28 (A>G mutations is one of the three most common mutations in China and Southeast Asia patients with β-thalassemia. Correcting this mutation in human embryos may prevent the disease being passed onto future generations and cure anemia. Here we report the first study using base editor (BE system to correct disease mutant in human embryos. Firstly, we produced a 293T cell line with an exogenous HBB −28 (A>G mutant fragment for gRNAs and targeting efficiency evaluation. Then we collected primary skin fibroblast cells from a β-thalassemia patient with HBB −28 (A>G homozygous mutation. Data showed that base editor could precisely correct HBB −28 (A>G mutation in the patient’s primary cells. To model homozygous mutation disease embryos, we constructed nuclear transfer embryos by fusing the lymphocyte or skin fibroblast cells with enucleated in vitro matured (IVM oocytes. Notably, the gene correction efficiency was over 23.0% in these embryos by base editor. Although these embryos were still mosaic, the percentage of repaired blastomeres was over 20.0%. In addition, we found that base editor variants, with narrowed deamination window, could promote G-to-A conversion at HBB −28 site precisely in human embryos. Collectively, this study demonstrated the feasibility of curing genetic disease in human somatic cells and embryos by base editor system.

[Symptomatic extramedullary haematopoiesis in β-thalassemia: A retrospective single centre study].

Science.gov (United States)

Maazoun, F; Gellen Dautremer, J; Boutekadjirt, A; Pissard, S; Habibi, A; Bachir, D; Rahmouni, A; Bartolucci, P; Debbache, K; Lagrange, J-L; Michel, M; Galacteros, F

2016-01-01

Symptomatic extramedullary hematopoiesis (EH) is a rare but potentially severe phenomenon which occurs in β-thalassemia. There are no treatment guidelines. Retrospective single centre study including the cases of symptomatic EH encountered between 1997 and 2014 in a unit specialised in red blood cell genetic disorders. Description of clinical, biological and radiological characteristics of the patients, treatments received, and outcomes. Among 182 β-thalassemia patients followed during the study period, 7 cases of symptomatic EH were diagnosed. They were 5 men and 2 women, and their mean age was 37 years. Four patients were splenectomised, two patients were regularly transfused, and four patients had already received erythropoietin. EH was localised in intravertebral areas and responsible for dorsal spinal cord compression in 5 patients, in paravertebral dorsal area in 1 patient, and in presacral area in 1 patient. The mean hemoglobin level at diagnosis was 7.9 g/dL. Treatment administered included: red cell transfusion in 6 cases, associated with hydroxyurea in 5 cases and/or radiotherapy in 3 patients. One patient was treated with surgery and HU. After a median follow-up of 41 months, clinical recovery was complete in 2 patients and partial in 5 patients. EH must be suspected in β-thalassemia in patients presenting clinical signs of organ compression, and a typical radiological aspect. The functional prognosis depends on the rapidity of treatment, which includes red blood cell transfusion, hydroxyurea, radiotherapy, and rarely surgery. Long-term outcome is uncertain. Copyright © 2015. Published by Elsevier SAS.

The Effects of Group Play Therapy on Self-Concept Among 7 to 11 Year-Old Children Suffering From Thalassemia Major.

Science.gov (United States)

Tomaj, Ome Kolsoum; Estebsari, Fatemeh; Taghavi, Taraneh; Borim Nejad, Leili; Dastoorpoor, Maryam; Ghasemi, Afsaneh

2016-04-01

Children suffering from thalassemia have higher levels of depression and lower levels of self-concept. The aim of this study was to determine if group play therapy could significantly increase self-concept among children with thalassemia major ages 7 to 11 years old in teaching hospitals of Golestan province, Iran, in 2012. In this randomized, controlled clinical trial, 60 children with thalassemia major were randomly assigned to intervention (30 children) and control (30 children) groups. The intervention included eight 45 to 60 minute sessions during four weeks, during which the intervention group received group play therapy. The control group received no interventions. Self-concept was measured three times using the Piers-Harris children's self-concept scale: before, immediately after, and a month after the intervention. For the intervention group, results showed that the mean self-concept score was significantly higher at the second point in time compared to the baseline (P 0.05). The results showed that group play therapy improves self-concept in children suffering from thalassemia major.

UPF1 silenced cellular model systems for screening of read-through agents active on β039 thalassemia point mutation.

Science.gov (United States)

Salvatori, Francesca; Pappadà, Mariangela; Breveglieri, Giulia; D'Aversa, Elisabetta; Finotti, Alessia; Lampronti, Ilaria; Gambari, Roberto; Borgatti, Monica

2018-05-15

Nonsense mutations promote premature translational termination, introducing stop codons within the coding region of mRNAs and causing inherited diseases, including thalassemia. For instance, in β 0 39 thalassemia the CAG (glutamine) codon is mutated to the UAG stop codon, leading to premature translation termination and to mRNA destabilization through the well described NMD (nonsense-mediated mRNA decay). In order to develop an approach facilitating translation and, therefore, protection from NMD, ribosomal read-through molecules, such as aminoglycoside antibiotics, have been tested on mRNAs carrying premature stop codons. These findings have introduced new hopes for the development of a pharmacological approach to the β 0 39 thalassemia therapy. While several strategies, designed to enhance translational read-through, have been reported to inhibit NMD efficiency concomitantly, experimental tools for systematic analysis of mammalian NMD inhibition by translational read-through are lacking. We developed a human cellular model of the β 0 39 thalassemia mutation with UPF-1 suppressed and showing a partial NMD suppression. This novel cellular model could be used for the screening of molecules exhibiting preferential read-through activity allowing a great rescue of the mutated transcripts.

Quantitative T2* magnetic resonance imaging for evaluation of iron deposition in the brain of β-thalassemia patients.

Science.gov (United States)

Akhlaghpoor, S; Ghahari, A; Morteza, A; Khalilzadeh, O; Shakourirad, A; Alinaghizadeh, M R

2012-09-01

Iron overload is a common clinical problem in patients with β-thalassemia major. The purpose of this study was to assess the presence of excess iron in certain areas of the brain (thalamus, midbrain, adenohypophysis and basal ganglia) in patients with β-thalassemia major and evaluate the association with serum ferritin and liver iron content. A cross-sectional study on 53 patients with β-thalassemia major and 40 healthy controls was carried out. All patients and healthy controls underwent magnetic resonance imaging (MRI) examinations of the brain and liver. Multiecho fast gradient echo sequence was used and T2* values were calculated based on the Brompton protocol. Correlations between T2* values in the brain with T2* values in the liver as well as serum ferritin levels were investigated. There were no significant differences between patients and healthy controls with respect to age and sex. Patients had significantly lower T2* values in basal ganglia (striatum), thalamus and adenohypophysis compared to controls while there were no differences in the midbrain (red nucleus). There were no significant correlations between liver T2* values or serum ferritin with T2* values of basal ganglia (striatum), thalamus and adenohypophysis in patients or healthy controls. There were no significant correlations between T2* values of adenohypophysis and thalamus or basal ganglia (striatum) while these variables were significantly correlated in healthy controls. Serum ferritin and liver iron content may not be good indicators of brain iron deposition in patients with β thalassemia major. Nevertheless, the quantitative T2* MRI technique is useful for evaluation of brain iron overload in β thalassemia major patients.

Impact of educational programme regarding chelation therapy on the quality of life for B-thalassemia major children.

Science.gov (United States)

Abu Samra, Omayma; Auda, Wafaa; Kamhawy, Heba; Al-Tonbary, Youssef

2015-06-01

Objectives Thalassemia is the most common genetic disorder in Egypt, with an estimated carrier rate of 9-10%. It is a genetic blood disorder which can be fatal if proper chelation is not received. The introduction of chelating agents capable of removing excessive iron from the body has dramatically increased life expectancy and improved the overall quality of life. The aim of this study was to assess the impact of educational programmes regarding chelation therapy on the quality of life of thalassemic children. Methods The study was carried out at the Mansoura University Children's Hospital in the period between March 2010 and May 2011. It included 173 B-thalassemia children (84 boys and 89 girls) with age ranging between 8-18 years. The researcher used a predesigned interviewing questionnaire to collect data regarding children's knowledge about thalassemia and its management, especially regarding chelation therapy. The paediatric quality-of-life inventory tool (Peds QL 4.0 generic core) was also used to assess the studied children's quality of life. Results There was a significant statistical difference of the studied children's knowledge regarding chelation therapy and their quality of life. Conclusion There was a positive effect of the educational programme in improving children's knowledge score and their quality of life. Application of educational programmes for thalassemic children and their nurses regarding chelation therapy and its importance in preventing thalassemia complications is established.

Study of Insulin Resistance in Patients With β Thalassemia Major and Validity of Triglyceride Glucose (TYG) Index.

Science.gov (United States)

Ansari, Arif M; Bhat, Kamalakshi G; Dsa, Smitha S; Mahalingam, Soundarya; Joseph, Nitin

2018-03-01

Complications like impaired glucose tolerance and diabetes mellitus due to iron overload need early identification in thalassemia. We studied the proportion of insulin resistance in thalassemia major patients on chronic transfusion, identified insulin resistance using homeostasis model assessment of insulin resistance (HOMA-IR) and triglyceride glucose (TYG) index, compared them and validated TYG index. In total, 73 thalassemia patients on regular transfusion for 3 years with serum ferritin >1500 ng/mL were studied. Serum ferritin, fasting blood glucose, triglycerides, and insulin levels were measured, HOMA-IR, and TYG index calculated and analyzed. Mean fasting glucose, triglyceride, and serum insulin values were 104 mg/dL, 164.18 mg/dL, and 19.6 m IU/mL, respectively. Mean serum ferritin was 5156 ng/mL. Insulin resistance was prevalent in one third of thalassemia patients and showed increase with age and serum ferritin. Insulin resistance by HOMA-IR was 32% as against 16% by TYG index with a cut-off value of 4.3. Using receiver operating charecteristic curve analysis, it was found that, by lowering the value of TYG index to 4.0215, sensitivity improved to 78.3% (from 39.13%) with specificity of 70%. Hence, we recommend a newer lower cut-off value of 4.0215 for TYG index for better sensitivity and specificity in identifying insulin resistance.

Hematopoietic stem cell transplantation from non-sibling matched family donors for patients with thalassemia major in Jordan.

Science.gov (United States)

Hussein, Ayad Ahmed; Al-Zaben, Abdulhadi; Khattab, Eman; Haroun, Anas; Frangoul, Haydar

2016-02-01

There are limited data on the outcome of patients with thalassemia receiving HSCT from non-sibling matched family donors. Of the 341 patients with thalassemia major that underwent donor search at our center from January 2003 to December 2011, 236 (69.2%) had fully matched family donor of which 28 patients (8.2%) had non-sibling matched family donors identified. We report on seven patients with a median age of eight yr (4-21) who underwent myeloablative (n = 4) or RIC (n = 3) HSCT. The median age of the donors was 33 yr (4-47), three were parents, two first cousins, one paternal uncle, and one paternal aunt. All patients achieved primary neutrophil and platelet engraftment at a median of 18 (13-20) and 16 days (11-20), respectively. One patient developed grade II acute GVHD, and two patients developed limited chronic GVHD. One patient experienced secondary GF requiring a second transplant. At a median follow-up of 69 months (7-110), all patients are alive and thalassemia free. Our data emphasize the need for extended family HLA typing for patients with thalassemia major in regions where there is high rate of consanguinity. Transplant from non-sibling matched family donor can result in excellent outcome. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Interaction of hemoglobin Grey Lynn (Vientiane) with a non-deletional α(+)-thalassemia in an adult Thai proband.

Science.gov (United States)

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2014-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.

Embryo genome profiling by single-cell sequencing for preimplantation genetic diagnosis in a β-thalassemia family

DEFF Research Database (Denmark)

Xu, Yanwen; Chen, Shengpei; Yin, Xuyang

2015-01-01

for a β-thalassemia-carrier couple to have a healthy second baby. We carried out sequencing for single blastomere cells and the family trio and further developed the analysis pipeline, including recovery of the missing alleles, removal of the majority of errors, and phasing of the embryonic genome...... leukocyte antigen matching tests. CONCLUSIONS: This retrospective study in a β-thalassemia family demonstrates a method for embryo genome recovery through single-cell sequencing, which permits detection of genetic variations in preimplantation genetic diagnosis. It shows the potential of single...

α:Non–α and Gγ:Aγ globin chain ratios in thalassemia intermedia patients treated with hydroxyurea

Directory of Open Access Journals (Sweden)

Abbas Najjari

2014-05-01

Conclusions: Improvement in α:non-α ratio and consequent decrease of free α-globin chain might be the cause of beneficial effects of hydroxyurea therapy. Two patients who felt better didn't show significant increase in their fetal hemoglobin level, and this is in contradiction with the hypothesis claiming that the HbF level increase is the cause of such therapeutic effect. In spite of the unclear mechanism of action of this drug, hydroxyurea therapy had noticeable impacts on thalassemia intermedia and also sickle cell disease and even patients suffering from thalassemia major.

Treatment of β-Thalassemia/Hemoglobin E with Antioxidant Cocktails Results in Decreased Oxidative Stress, Increased Hemoglobin Concentration, and Improvement of the Hypercoagulable State

Directory of Open Access Journals (Sweden)

Orn-uma Yanpanitch

2015-01-01

Full Text Available Studies on the antioxidant treatment for thalassemia have reported variable outcomes. However, treatment of thalassemia with a combination of hydrophobic and hydrophilic antioxidants and an iron chelator has not been studied. This study investigated the effects of antioxidant cocktails for the treatment of β-thalassemia/hemoglobin E (HbE, which is the most common form of β-thalassemia in Southeast Asia. Sixty patients were divided into two groups receiving N-acetylcysteine, deferiprone, and either curcuminoids (CUR or vitamin E (Vit-E, and their hematological parameters, iron load, oxidative stress, and blood coagulation potential were evaluated. Patients were classified as responders if they showed the improvements of the markers of iron load and oxidative stress, otherwise as nonresponders. During treatment, the responders in both groups had significantly decreased iron load, oxidative stress, and coagulation potential and significantly increased antioxidant capacity and hemoglobin concentration. The significantly maximum increase (P<0.01 in hemoglobin concentration was 11% at month 4 in CUR group responders and 10% at month 10 in Vit-E group responders. In conclusion, the two antioxidant cocktails can improve anemia, iron overload, oxidative stress, and hypercoagulable state in β-thalassemia/HbE.

Hydroxyurea for nontransfusion-dependent β-thalassemia: A systematic review and meta-analysis.

Science.gov (United States)

Algiraigri, Ali H; Wright, Nicola A M; Paolucci, Elizabeth Oddone; Kassam, Aliya

2017-09-01

Nontransfusion-dependent β-thalassemia (NTDβT) syndromes consist of β-thalassemia intermedia and moderate hemoglobin E/β thalassemias. They are characterized by varying degrees of chronic anemia and a wide spectrum of complications due to ineffective erythropoiesis and iron overload from chronic transfusions. Hydroxyurea (HU), an oral chemotherapeutic drug, is anticipated to decrease disease severity. We performed a meta-analysis to evaluate the clinical efficacy and safety of HU in NTDβT patients of any age. MEDLINE, EMBASE, Cochrane databases, and major conference proceedings for studies that assessed HU in NTDβT patients were searched. Qualities of eligible studies were assessed by National Institutes of Health tools. Seventeen studies, collectively involving 709 patients, fulfilled the eligibility criteria. HU was associated with a significant decrease in transfusion need in severe NTDβT with complete and overall (≥50%) response rates of 42% and 79%, respectively. For mild NTDβT, HU was effective in raising hemoglobin by 1g/L in 64% of patients. HU appears to be effective, well tolerated, and associated with mild and transient adverse events. NTDβT patients may benefit from a trial of HU, although large randomized clinical trials assessing its efficacy should be conducted to confirm the findings of this meta-analysis and to assess its long-term toxicity and response sustainability. Copyright © 2017 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

Quality of Life in Children with Thalassemia and their Caregivers in India.

Science.gov (United States)

Sharma, Sapna; Seth, Bageshree; Jawade, Prashant; Ingale, Madhavi; Setia, Maninder Singh

2017-03-01

To assess and compare the Quality of Life (QOL) of children with beta-thalassemia major on regular transfusion therapy with normal children, and of the caregivers of children with beta-thalassemia major to that of caregivers of normal children. A cross-sectional comparison of QOL in 75 thalassemic and 80 non-thalassemic children was conducted using the PedsQL™ 4.0 generic core scale. Also self-rated health was assessed in their caregivers using Short Form-36 Health Survey. The total QOL score according to child-self report [83.7 (10.8) vs. 97.6 (3.3); p < 0.001] and parent-proxy report [84.2 (11.9) vs. 96.7 (3.5); p < 0.001] was significantly lower in cases as compared with controls. It was found that a significantly higher proportion of caregivers of cases reported poor health compared with caregivers of controls (29.2% vs. 2.5%, p < 0.001). Even after adjusting for age, sex, socio-economic status, and total QOL score by the parent, it was found that caregivers of thalassemic children were significantly more likely to report poor health compared with those of controls (odds ratio: 15.8, 95% confidence intervals: 2.8-89.9). Health Related QOL is significantly affected in children with beta-thalassemia major on regular transfusion across all age groups, gender and socio-economic classes and also in their caregivers.

Prevalence of anemia, iron deficiency, thalassemia and glucose-6-phosphate dehydrogenase deficiency among hill-tribe school children in Omkoi District, Chiang Mai Province, Thailand.

Science.gov (United States)

Yanola, Jintana; Kongpan, Chatpat; Pornprasert, Sakorn

2014-07-01

The prevalaence of anemia, iron deficiency, thalassemia and glucose-6-phosphate dehydrogenase (G-6-PD) deficiency were examined among 265 hill-tribe school children, 8-14 years of age, from Omkoi District, Chiang Mai Province, Thailand. Anemia was observed in 20 school children, of whom 3 had iron deficiency anemia. The prevalence of G-6-PD deficiency and β-thalassemia trait [codon 17 (A>T), IVSI-nt1 (G>T) and codons 71/72 (+A) mutations] was 4% and 8%, respectively. There was one Hb E trait, and no α-thalassemia-1 SEA or Thai type deletion. Furthermore, anemia was found to be associated with β-thalassemia trait in 11 children. These data can be useful for providing appropriate prevention and control of anemia in this region of Thailand.

Epidemiology of hemoglobinopathies and thalassemias in individuals referred to the haematology research centre, Shiraz University of Medical Sciences, Shiraz, Iran from 2006 to 2011.

Science.gov (United States)

Haghpanah, Sezaneh; Ramzi, Mani; Zakerinia, Maryam; Nourani Khojasteh, Habib; Haghshenas, Mansour; Rezaei, Narges; Moayed, Vida; Rezaei, Alireza; Karimi, Mehran

2014-01-01

Hemoglobinopathies and thalassemias are the most frequent genetic hereditary disorders with an increasing global health burden, especially in low- and middle-income countries. We aimed to determine the epidemiologic pattern of hemoglobinopathies and thalassemias in individuals referred to the Haematology Research Centre, Shiraz University of Medical Sciences, Shiraz, Iran, which is the most important referral center in Southern Iran during 2006 to 2011. The most frequent abnormality was β-thalassemia (β-thal) minor (24.0%), followed by α-thalassemia (α-thal) trait (10.0%), hemoglobin (Hb) S trait (4.0%) and Hb D-Punjab trait (4.0%). Because this center is a referral center, we detected a higher prevalence compared to the normal population; however, these data could help policymakers and health service providers to better programming for prevention of births affected with Hb disorders.

HbA2 measurements in β-thalassemia and in other conditions

Directory of Open Access Journals (Sweden)

Giovanni Ivaldi

2014-09-01

Full Text Available Quite a few papers have been written on the significance of elevated hemoglobin (Hb A2 as a parameter for the diagnosis of β-thalassemia trait, on the cutoff values to be used in diagnostics and on the significance and effects of factors reducing or elevating the expression of HbA2 and last but not least on the need for reliable measurement methods and precise calibrations with accurate standards. However, little has been published on the causes that elevate or reduce the HbA2 levels in β- and a-thalassemia and in other conditions. For a better understanding of the value of a precise measurement of this parameter we summarize and elucidate in this review the direct and indirect mechanisms that cause the variations in HbA2 expression and that influence the value of this parameter in particular conditions. We conclude by explaining the advantages and disadvantages of trusting on a precise measurement in the complete diagnostic contest.

[Beta thalassemia major and pregnancy during adolescence: report of two cases].

Science.gov (United States)

Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

2015-06-01

Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

The survival analysis of beta thalassemia major patients in South East of Iran

International Nuclear Information System (INIS)

Roudbari, M.; Soltani-Rad, M.; Roudbari, S.

2008-01-01

The objective was to determine the survival of beta-thalassemia major patients with transfusion, and its related factors in Southeast of Iran. This cross-sectional study was performed in Zahedan, Iran in 2007. The sample included patients who were referred from all over the Zahedan Thalassemia Center from 1998 to 2006. The data were collected using the patient's records, which were recorded by the staff during transfusion. The data included demographic and medical information blood group, blood RH, the kind of transfused blood [KTB], annual number of transfusions [ANOT], accompanied disease [AD], Hemoglobin [Hb] and ferritin level. For data analysis, the Kaplan-Meyer method, and Long Rank test together with Cox Regression were used. Forty-six of 578 patients died and 99% survived for the first year. The ages survival proportions were 5 (97.9%), 10 (97%), 15 (92.1%), and 20 (81.2%) years. The survival time showed significant relationships with the ANOT p=0.0053, KTB p=0.003, Hb=0.002 and ferritin level p=0.0087, and AD p=0.00. Using regular transfusion, paying attention to screening of transfused blood, increasing the families knowledge on the disease to prevent the bearing of thalassemia fetus, are recommended; finally, the detection and treating of the AD, are of great importance to extend the lifetime of the patients. (author)

Glucose homeostasis in Egyptian children and adolescents with β-Thalassemia major: Relationship to oxidative stress

Directory of Open Access Journals (Sweden)

Kotb Abbass Metwalley

2014-01-01

Full Text Available Background: Oxidative stress in children with β-thalassemia may contribute to shortened life span of erythrocytes and endocrinal abnormalities. Aim: This study was aimed to evaluate glucose homeostasis in Egyptian children and adolescents with β-thalassemia major and its relation to oxidative stress. Materials and Methods: Sixty children and adolescents with β-thalassemia major were studied in comparison to 30 healthy age and sex-matched subjects. Detailed medical history, thorough clinical examination, and laboratory assessment of oral glucose tolerance test (OGTT, serum ferritin, alanine transferase (ALT, fasting insulin levels, plasma malondialdehyde (MDA as oxidant marker and serum total antioxidants capacity (TAC were performed. Patients were divided into two groups according to the presence of abnormal OGTT. Results: The prevalence of diabetes was 5% (3 of 60 and impaired glucose tolerance test (IGT was 8% (5 of 60. Fasting blood glucose, 2-hour post-load plasma glucose, serum ferritin, ALT, fasting insulin level, homeostatic model assessment for insulin resistance index (HOMA-IR and MDA levels were significantly elevated while TAC level was significantly decreased in thalassemic patients compared with healthy controls (P < 0.001 for each. The difference was more evident in patients with abnormal OGTT than those with normal oral glucose tolerance (P < 0.001 for each. We also observed that thalassemic patients not receiving or on irregular chelation therapy had significantly higher fasting, 2-h post-load plasma glucose, serum ferritin, ALT, fasting insulin, HOMA-IR, oxidative stress markers OSI and MDA levels and significantly lower TAC compared with either those on regular chelation or controls. HOMA-IR was positively correlated with age, serum ferritin, ALT, MDA, and negatively correlated with TAC. Conclusions: The development of abnormal glucose tolerance in Egyptian children and adolescents with β--thalassemia is associated with

Intracranial extramedullary hematopoiesis in patients with thalassemia: a case report and review of the literature.

Science.gov (United States)

Eskazan, Ahmet Emre; Ar, Muhlis Cem; Baslar, Zafer

2012-08-01

Extramedullary hematopoiesis (EH) is a compensatory phenomenon that results in the production of blood cell precursors outside the marrow in patients with chronic hemolytic anemia and ineffective erythropoiesis. EH usually involves the liver, spleen, and lymph nodes. It can also be found at paravertebral, intrathoracic, or pelvic locations. Intracranial EH is a rare entity and often asymptomatic but can sometimes lead to symptomatic tumor-like masses. Treatment options are controversial and include hypertransfusion, surgical excision, radiotherapy, and hydroxyurea (HU). Successful treatment of an intracranial EH mass with HU and blood transfusions in a beta-thalassemia major patient was discussed along with a review of the published literature on intracranial EH in thalassemia. In our patient, the extramedullary hematopoietic mass in the interhemispheric fissure showed a marked improvement after 6 months of HU and hypertransfusion therapy. In the English literature, there are a few cases with intracranial EH and thalassemia, which were treated with different treatment modalities, with different outcomes. There is no standard treatment approach in patients with symptomatic EH. HU with hypertransfusion regimen is a reasonable first-choice modality in treating intracranial EH masses. © 2012 American Association of Blood Banks.

Chorionic villus sampling for beta-thalassemia: the first report of experience in Iran.

Science.gov (United States)

Akhlaghpoor, Shahram

2006-12-01

Beta-thalassemia is one of the most common hereditary disorders in Iran. The prenatal diagnosis of beta-thalassemia is part of a control program in our country and it began 13 years ago. During the past 8 years the number of procedures has increased significantly as also the legal abortions. This is the first report made on the CVS program in Iran. One thousand six hundred and sixty-one cases of transabdominal Chorionic Villus Sampling (CVS) have been retrospectively evaluated. Among them 1381 cases had inclusion criteria. CVS results, complications and fetal loss rate were evaluated. The distributions of the population at risk were divided between eight regions that have been proposed for beta-thalassemia mapping previously. The mean age of the patients was 26.2 +/- 5.2 years with mean gestational age of 11.4 +/- 1.4 weeks. CVS was successful in all the patients (100%) although 1% required a second procedure. Post CVS fetal loss was 1.45%. Other minor complications were bleeding or spotting (1.81%), amniotic fluid leak (0.5%), small sub-chorionic hematoma (0.58%), severe abdominal pain (0.6%) and severe vasovagal reaction (0.14%). Late complications were seen in 0.21% (oligohydraminos). Approximately 2/3 of the patients were referred from three regions of the country, North (26.8%), South West (22.4%), Central (19.5%) and the remainder (31.3%) were from the other five regions. CVS is a safe and effective method for prenatal diagnosis of beta-thalassemia in countries with a high prevalence as in Iran. The overall complication rate is quite low and acceptable. Fortunately the recent acceptance of legal abortion with respect to Muslim rules has increased the effectiveness of the procedure and made great advances in its application in Iran. Correspondingly, social knowledge has also improved but still there is a gap between the population at risk and the required prenatal diagnosis laboratories and sampling centers. 2006 John Wiley & Sons, Ltd.

THE CERVICAL VERTEBRAL BONE MATURATION OF Hb E BETA THALASSEMIA PATIENTS OF DEUTEROMALAY AGED 9 – 14 YEARS

Directory of Open Access Journals (Sweden)

Loes D. Sjahruddin

2006-04-01

Full Text Available One of the growth indicators that can be used to assess a child’s developmental growth is through skeletal maturation. Skeletal maturity can be evaluated by using anatomical changes of the cervical vertebral bones observed on the lateral cephalometric radiographs. The purpose of this study was to determine the stage of cervical vertebrae maturation of Hb E β thalassemia patients by comparing the shape changes of the second to fourth cervical vertebrae bodies with a control group. The design of this study was cross sectional. The subjects were children with Hb E β thalassemia aged 9 – 14 years. The results showed that the retarded maturation of the cervical vertebrae in Hb E β thalassemia was not found in the subjects of pre-puberty age (9 – 11 years old, but in those of puberty age (12 – 14 years old.

Bone metabolism and mineral density in patients with beta-thalassemia major

International Nuclear Information System (INIS)

Dundar, U.; Kupesiz, A.; Yesilipeck, A.; Ozdem, S.; Gultekin, M.; Gilgil, E.; Tuncer, T.

2007-01-01

To evaluate bone metabolism in patients with beta-thalassemia major and to determine the factors associated with the development of osteoporosis. We studied 25 patients with thalassemia major with a mean age of 18.4 years (rang 5-31), age and gender matched 24 healthy controls who were attending the outpatient physical medicine and rehabilitation clinic of Akdeniz University Hospital between January 2004 and March 2004 in Turkey. Bone mineral density (BMD) of lumbar spine (L-1-L4) and proximal femur were determined using dual x-ray absorptiometry (DXA). Venous blood samples were obtained for determination of blood cell count and markers of bone formation and resorption. The BMD values, both at lumbar and femoral neck levels were significantly lower in patients compared to controls. Serum N-telopeptide level was slightly higher, whereas osteocalcin was slightly lower in patients, however, the values were not statistically significant. Plasma levels of insulin like growth factor-1 (IGF-I) and insulin like growth factor for binding protein-3 (IGFBP-3) were significantly lower in patients. Also, serum levels of estradiol and progesterone in females, luteinizing, hormone and follicle-stimulating hormone in both genders were significantly lower in patients. Serum levels of free testosterone and total testosterone were lower in patients, but not statistically significant. Patients also had significantly higher serum phosphorous levels and lower serum calcitonin levels compared to controls. The BMD is decreased in thalassemic patients. Growth retardation, growth hormone/IGF-I/IGFP-3 axis dysfunction, gonadal dysfunction and hypothalomo-pituitary-gonadal axis dysfunction may be responsible for the development of osteoporosis in the patients with beta-thalassemia major. (author)

Platelet activation and platelet-leukocyte interaction in β-thalassemia/hemoglobin E patients with marked nucleated erythrocytosis.

Science.gov (United States)

Keawvichit, Rassamon; Khowawisetsut, Ladawan; Chaichompoo, Porntip; Polsrila, Korakot; Sukklad, Suchana; Sukapirom, Kasama; Khuhapinant, Archrob; Fucharoen, Suthat; Pattanapanyasat, Kovit

2012-11-01

Patients with thalassemia, an inherited hemolytic anemia, have increased risk of hypercoagulable complications. A whole blood flow cytometric (FCM) method has been used for studies of platelet activation and platelet-leukocyte aggregation in these patients. However, this FCM method presents technical difficulties because of the high proportion of immature red blood cells (RBCs) in these patients. A protocol for the simultaneous measurement of platelet activation and their aggregation with leukocyte populations in whole blood using four-color FCM which excluded immature RBC was devised, and evaluated for the evaluation of platelet function in patients with β-thalassemia/hemoglobin E (HbE). Whole blood from these patients and from healthy volunteers was stained for platelet activation and platelet-leukocyte aggregates using anti-CD42a, anti-CD62P, anti-CD45 and glycophorin A (GPA) conjugated with different fluorochromes. Our FCM method is simple, effective and based on the assumption that GPA is present on all immature RBCs, but is not expressed on CD45⁺ leukocytes. Results from the studies showed that blood samples from these patients contained a high frequency of circulating activated platelets (CD42a⁺/CD62P⁺) when compared to samples from healthy individuals. The percentage of platelet-neutrophil, platelet-monocyte-but not platelet-lymphocyte-aggregates were also elevated in both thalassemia genotypes with marked increase in patients who had undergone splenectomy. These findings suggest that platelets adhere to neutrophils and monocytes are activated which support the clinical observation that splenectomized thalassemia patients have an increased risk of arterial or venous thrombotic manifestations.

[Epidemiological study on thalassemia among the children of 0 - 7 years old among the six ethnic groups in Xishuangbanna and Dehong of Yunnan province].

Science.gov (United States)

Zhao, Zhong-Ming; Yao, Li-Qin; Fan, Li-Mei; Zou, Tuan-Biao; Chen, Qian; Hu, Li-Sha; Yang, Fa-Bin; Liu, Jin-Tao; Wang, Xing-Tian

2011-04-01

To investigate the prevalence rate of thalassemia among children of 0 - 7 years old, from six ethnic groups in Xishuangbanna and Dehong, Yunnan province. 4973 blood samples from children under 7 years old were automatically undergone blood cell count, red cell osmotic fragility and hemoglobin electrophoresis testings. The incidence rates of thalassaemia, β-thalassemia was 37.4%, and α-thalassaemia were 22.6% and 14.7% respectively. The thalassaemia incidence rates were significantly different among age groups but not in gender. The incidence of α-thalassaemia was decreasing along with the increase of age, while the incidence of β-thalassaemia was increasing along with the increase of age. Xishuangbanna had the higher incidence than in Dehong and the differences were significant between counties, The incidence of thalassemia of Mengla ranked the first (52.2%) in Xishuangbanna, The differences between different regions and different nationalities were significant, with β-thalassemia of Achang ranked the first (40.6%), The incidence of α-thalassemia among Han ranked the first as 45.5% while α-thalassaemia and β-thalassemia were different in regions. α-thalassaemia and β-thalassemia were significantly different between different ethnic people in the same regions. Multiple factor analysis showed that region seemed to be a risk factor and the mother's ethnicity was a protective factor and dependent variable on thalassaemia. The incidence of thalassaemia in Yunnan Xishuangbanna and Dehong was high among children under the age of 7 and were related to ethnic and regional differences in the areas. Specific genes were proliferated along with the extension of time. Our data provided valuable information on prevention and genetic studies on thalassaemia in the minorities of Xishuangbanna and Dehong in Yunnan province.

Malabsorption of vitamin B12 in homozygous β-thalassemia

International Nuclear Information System (INIS)

Vlachos, P.; Liakakos, D.

1976-01-01

Schilling tests were performed in ten children aged 5-12 years suffering from homozygous β-thalassemia. 57 Co labelled vitamin B 12 values excreted in the urine have been found much lower than normal and remained low when the same procedure was repeated with the addition of intrinsic factor. The possible factors responsible for this malabsorption of vitamin B 12 seemed to be liver damage and folic acid deficiency. (orig.) [de

A study of membrane protein defects and alpha hemoglobin chains of red blood cells in human beta thalassemia

International Nuclear Information System (INIS)

Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y.

1989-01-01

The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with [ 3 H]N-ethylmaleimide. This pool of soluble alpha chains was 0.067 ± 0.017% of hemoglobin in blood of normal adult, 0.11 ± 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using [ 3 H]N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups

Transfusion Complications in Thalassemia Patients: A Report from the Centers for Disease Control and Prevention (CDC)

Science.gov (United States)

Vichinsky, Elliott; Neumayr, Lynne; Trimble, Sean; Giardina, Patricia J.; Cohen, Alan R.; Coates, Thomas; Boudreaux, Jeanne; Neufeld, Ellis J.; Kenney, Kristy; Grant, Althea; Thompson, Alexis A.

2015-01-01

Background and Study Objectives Transfusions are the primary therapy for thalassemia but have significant cumulative risks. In 2004, the Centers for Disease Control and Prevention (CDC) established a national blood safety monitoring program for thalassemia. The purpose of this report is to summarize the patient population as well as previous non-immune and immune transfusion complications at the time of enrollment into the program. A focus on factors associated with allo- and auto-immunization in chronically transfused patients and a description of blood product preparation and transfusion practices at the participating institutions are included. Study Design and Methods The CDC Thalassemia Blood Safety Network is a consortium of thalassemia centers, longitudinally following patients to determine transfusion-related complications. Enrollment occurred from 2004 through 2012 and annual data collection is ongoing. Demographic data, transfusion history, and previous transfusion and non-transfusion complications were summarized for patients enrolled between 2004 and 2011. Logistic analyses of factors associated with allo- and auto-immunization were developed. Summary statistics of infections reported at the time of enrollment were also calculated. Results The race/ethnicity of the 407 thalassemia patients enrolled in the Network was predominantly Asian or Caucasian and 27% were immigrants. The average age was 22.3 years ± 13.2 and patients received an average total number of 149 ± 103.4 units of red blood cells. Iron-induced multi-organ dysfunction was common despite chelation. At study entry, 86 patients had previously been exposed to possible transfusion-associated pathogens, including Hepatitis-C (61), Hepatitis B (20), Hepatitis A (3), Parvovirus (9), HIV (4), malaria (1), staphylococcus aureus (1) and babesia (1). As 27% of the population was born outside of the United States (India, Pakistan, Thailand, China, Vietnam and Iran accounting for 57%), the source of

Quality of life assessment of children with thalassemia

OpenAIRE

Masyitah Sri Wahyuni; Muhammad Ali; Nelly Rosdiana; Bidasari Lubis

2011-01-01

Background Thalassemia is a chronic disease that is becoming a major health problem in the world, including the Mediterranean, as well as Malaysia, Thailand and Indonesia. This condition clearly affects the patient's quality of life, because of the condition itself and the effects of treatment. Assessment is needed to detennine actions to be taken to improve the quality of life in thalassemic children. Objective To assess the differences in quality of life of thalassemic children comp...

Adrenal extramedullary hematopoiesis associated with β-thalassemia major

OpenAIRE

Bijan Keikhaei; Ahmad Soltani Shirazi; Mahboob Mohammad Pour

2012-01-01

The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hema - topoiesis (EMH). EMH is a rare complication in thalassemia major (TM) and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdomin...

Beta-thalassemia- institution based analysis of ethnic and geographic distribution, effect of consanguinity and safety of chorionic villus sampling as a diagnostic, tool for pre-natal diagnosis in selected patients

International Nuclear Information System (INIS)

Abdullah, K.N.; Liaqat, J.; Azim, W.

2011-01-01

To study the ethnic and geographic distribution of Beta-thalassemia amongst the patients included and to study the effect of consanguinity in promoting this disease. Also, to establish the safety of CVS when used as a pre-natal diagnostic tool in aiding the early diagnosis of Beta-thalassemia in selected patients. Study Design: Descriptive Study. Place and Duration of Study: PNS Shifa Karachi, from Jan 2008 to Dec 2008. Patients and Methods: A total of 223 women out of 240 that were referred from all over Sindh to PNS Shifa Hospital Karachi for susceptible gene mutations participated in the study. The standard procedure that was used in this study was trans-abdominal aspiration of chorionic villi through suction needle. The samples were then sent for further analysis to the Pathology Department at PNS Shifa Hospital Karachi. Results: In our study population Beta-thalassemia was most prevalent in Sindhi 107 (48%) followed by Punjabi 46 (21%), 27 (12%) Pathan, and 43 (19%) Balochi. Out of 223 women, 95 were of thalassemia trait, while 85 were of thalassemia major. Fifty five percent of thalassemia trait and 56% of thalassemia major fetus parents were first cousins. The rate of pregnancy loss after performing CVS was 2.0% with no complications reported. Conclusion: It is concluded that highest percentage of thalassemia is in first cousins and sindhi origin families are mostly affected. However CVS is a safe and effective tool for prenatal diagnosis and subsequent counselling in selected couples. (author)

The ICET-A Recommendations for the Diagnosis and Management of Disturbances of Glucose Homeostasis in Thalassemia Major Patients

Science.gov (United States)

De Sanctis, Vincenzo; Soliman, Ashraf T.; Elsedfy, Heba; Yaarubi, Saif AL; Skordis, Nicos; Khater, Doaa; El Kholy, Mohamed; Stoeva, Iva; Fiscina, Bernadette; Angastiniotis, Michael; Daar, Shahina; Kattamis, Christos

2016-01-01

Iron overload in patients with thalassemia major (TM) affects glucose regulation and is mediated by several mechanisms. The pathogenesis of glycaemic abnormalities in TM is complex and multifactorial. It has been predominantly attributed to a combination of reduced insulin secretory capacity and insulin resistance. The exact mechanisms responsible for progression from norm glycaemia to overt diabetes in these patients are still poorly understood but are attributed mainly to insulin deficiency resulting from the toxic effects of iron deposited in the pancreas and insulin resistance. A group of endocrinologists, haematologists and paediatricians, members of the International Network of Clinicians for Endocrinopathies in Thalassemia and Adolescence Medicine (ICET-A) convened to formulate recommendations for the diagnosis and management of abnormalities of glucose homeostasis in thalassemia major patients on the basis of available evidence from clinical and laboratory data and consensus practice. The results of their work and discussions are described in this article. PMID:27872738

Diagnostic Value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP in Cardiac Involvement in Patients with Beta- Thalassemia

Directory of Open Access Journals (Sweden)

Noor Mohammad Noori

2017-04-01

Full Text Available Background Heart failure is a major cause of death in thalassemia. The study aimed to determine the diagnostic value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP, to early diagnose the cardiac involvement in beta- thalassemia major patients. Materials and Methods  80 thalassemia patients aged 7 to 18 years old (patients group, and 80 healthy age and gender matched controls were enrolled in the case-control study. Patients were selected from those attending to the clinic of Aliasghar hospital, Zahedan-Iran. They were subjected to echo-Doppler tissue and conventional examination for both right and left heart function. Data were analysis using SPSS 18.0 software. Results  NT-pro BNP increased in patients compared the controls (P

Interaction between Hb E and Hb Yala (HBB:c.129delT); a novel frameshift beta globin gene mutation, resulting in Hemoglobin E/β0 thalassemia.

Science.gov (United States)

Ekwattanakit, Supachai; Riolueang, Suchada; Viprakasit, Vip

2018-03-01

There are more than 200 known mutations found in patients with β-thalassemia, a possibility to identify an unknown or novel mutation becomes less possible. Here, we report a novel mutation in a patient from Thailand who presented with chronic hemolytic anemia. A comprehensive hematology and DNA analysis was applied in the index patient and her mother. Hematological and hemoglobin analyses were consistent with the clinical diagnosis of Hb E/β 0 -thalassemia. However, we could find only Hb E heterozygous mutation using our common polymerase chain reaction-based mutation detection of the β-globin genes. Furthermore, the molecular analysis demonstrated a novel T-deletion at codon 42 of the second exon of the β-globin gene which we named 'Hb Yala' according to the origin of this index family. This mutation was assumed to generate a truncated β-globin chain terminating at codon 60 with possible unstable variant leading to a 'null' or β 0 -thalassemia. However, the clinical phenotype was surprisingly mild and no other ameliorating genetic factors, including co-inheritance of α-thalassemia and high propensity of Hb F by Xmn I polymorphism, were found. This report has provided evidence that genotype-phenotype correlation in thalassemia syndromes is highly complex and a correct clinical severity classification of thalassemia should be mainly based on clinical evaluation.

Fine-tiling array CGH to improve diagnostics for alpha- and beta-thalassemia rearrangements

NARCIS (Netherlands)

Phylipsen, M.; Chaibunruang, A.; Vogelaar, I.P.; Balak, J.R.; Schaap, R.A.; Ariyurek, Y.; Fucharoen, S.; den Dunnen, J.T.; Giordano, P.C.; Bakker, E.; Harteveld, C.L.

2012-01-01

Implementation of multiplex ligation-dependent probe amplification (MLPA) for thalassemia causing deletions has lead to the detection of new rearrangements. Knowledge of the exact breakpoint sequences should give more insight into the molecular mechanisms underlying these rearrangements, and would

Current Trends of Drug Resistance Patterns of Acinetobacter baumannii Infection in Blood Transfusion-dependent Thalassemia Patients.

Science.gov (United States)

Almani, Suhail Ahmed; Naseer, Ali; Maheshwari, Sanjay Kumar; Maroof, Pir; Naseer, Raza; Khoharo, Haji Khan

2017-01-01

The present study aimed to evaluate the current trends of drug resistance patterns of Acinetobacter baumannii infection in blood transfusion-dependent thalassemia patients. This study was a cross sectional study, conducted at the Liaquat University of Medical and Health Sciences, Jamshoro/Hyderabad, Sindh, Pakistan from October 2014 to January 2016. Of 921 blood samples, A. baumannii strains were isolated from 100 blood samples. Blood samples were processed for the isolation, identification, and drugs sensitivity as per the Clinical and Laboratory Standards Institute. A. baumannii strains were identified by microbiological methods and Gram's staining. API 20 E kit (Biomeriuex, USA) was also used for identification. Data were analyzed on Statisti × 8.1 (USA). Mean ± standard deviation age was 11.5 ± 2.8 years. Nearly 70% were male and 30% were female ( P = 0.0001). Of 921 blood transfusion-dependent thalassemia patients, 100 (10.8%) patients showed growth of A. baumannii . Drug resistance was observed against the ceftazidime, cefixime, cefepime, imipenem, meropenem, amikacin, minocycline, tigecycline, and tazocin except for the colistin. The present study reports drug-resistant A. baumannii in blood transfusion-dependent thalassemia patients. National multicenter studies are recommended to estimate the size of the problem.

Comparison of Bone Mineral Density in Thalassemia Major Patients with Healthy Controls

Directory of Open Access Journals (Sweden)

Mahesh Chand Meena

2015-01-01

Full Text Available Chronic hemoglobinopathies like thalassemia are associated with many osteopathies like osteoporosis. Methods. This observational study was carried out to compare the bone mineral density (BMD in transfusion dependent thalassemics with that of healthy controls. Thirty-two thalassemia patients, aged 2–18 years, and 32 age and sex matched controls were studied. The bone mineral concentration (BMC and BMD were assessed at lumbar spine, distal radius, and neck of femur. Biochemical parameters like serum calcium and vitamin D levels were also assessed. Results. The BMC of neck of femur was significantly low in cases in comparison to controls. We also observed significantly lower BMD at the lumbar spine in cases in comparison to controls. A significantly positive correlation was observed between serum calcium levels and BMD at neck of femur. Conclusion. Hence, low serum calcium may be used as a predictor of low BMD especially in populations where incidence of hypovitaminosis D is very high.

Beta thalassemia major: The effect of age on glomerular filtration rate

Directory of Open Access Journals (Sweden)

Majid Malaki

2011-01-01

Full Text Available Thalassemia is a common hereditary hemoglobinopathy disorder that affects many organs in the body. Estimation of kidney function is important, as it is the vital organ that plays the major role in the elimination of accumulated iron as well as the chelating drugs that have to be used as therapy. Sixty- three patients aged 1-29 years, with a mean ± SD of 14 ± 6.7 years, affected with beta- thalassemia major in Tabriz Children′s Hospital were evaluated for their renal function on the basis of their age, serum iron, serum ferritin and serum creatinine levels along with two methods of estimating glomerular filtration rate (GFR; by Schwartz method for those under 18 years old and using Modification of Diet in Renal Disease (MDRD formula for those who were 18 years and above. Elevation of serum creatinine denoting renal dysfunction was not seen in our patients, but hyperfiltration was a common finding. An increasing GFR was observed, which corresponded to age, but no relationships were seen between serum iron, serum ferritin, regular blood transfusion, chelating therapy to GFR.

Evaluation of cardiac and hepatic iron overload in thalassemia major patients with T2* magnetic resonance imaging.

Science.gov (United States)

Wahidiyat, Pustika Amalia; Liauw, Felix; Sekarsari, Damayanti; Putriasih, Siti Ayu; Berdoukas, Vasili; Pennell, Dudley J

2017-09-01

Recent advancements have promoted the use of T2* magnetic resonance imaging (MRI) in the non-invasive detection of iron overload in various organs for thalassemia major patients. This study aims to determine the iron load in the heart and liver of patients with thalassemia major using T2* MRI and to evaluate its correlation with serum ferritin level and iron chelation therapy. This cross-sectional study included 162 subjects diagnosed with thalassemia major, who were classified into acceptable, mild, moderate, or severe cardiac and hepatic iron overload following their T2* MRI results, respectively, and these were correlated to their serum ferritin levels and iron chelation therapy. The study found that 85.2% of the subjects had normal cardiac iron stores. In contrast, 70.4% of the subjects had severe liver iron overload. A significant but weak correlation (r = -0.28) was found between cardiac T2* MRI and serum ferritin, and a slightly more significant correlation (r = 0.37) was found between liver iron concentration (LIC) and serum ferritin. The findings of this study are consistent with several other studies, which show that patients generally manifest with liver iron overload prior to cardiac iron overload. Moreover, iron accumulation demonstrated by T2* MRI results also show a significant correlation to serum ferritin levels. This is the first study of its kind conducted in Indonesia, which supports the fact that T2* MRI is undoubtedly valuable in the early detection of cardiac and hepatic iron overload in thalassemia major patients.

The Combination of CRISPR/Cas9 and iPSC Technologies in the Gene Therapy of Human β-thalassemia in Mice.

Science.gov (United States)

Ou, Zhanhui; Niu, Xiaohua; He, Wenyin; Chen, Yuchang; Song, Bing; Xian, Yexing; Fan, Di; Tang, Daolin; Sun, Xiaofang

2016-09-01

β-thalassemia results from point mutations or small deletions in the β-globin (HBB) gene that ultimately cause anemia. The generation of induced pluripotent stem cells (iPSCs) from the somatic cells of patients in combination with subsequent homologous recombination-based gene correction provides new approaches to cure this disease. CRISPR/Cas9 is a genome editing tool that is creating a buzz in the scientific community for treating human diseases, especially genetic disorders. Here, we reported that correction of β-thalassemia mutations in patient-specific iPSCs using the CRISPR/Cas9 tool promotes hematopoietic differentiation in vivo. CRISPR/Cas9-corrected iPSC-derived hematopoietic stem cells (HSCs) were injected into sublethally-irradiated NOD-scid-IL2Rg-/- (NSI) mice. HBB expression was observed in these HSCs after hematopoietic differentiation in the NSI mice. Importantly, no tumor was found in the livers, lungs, kidneys, or bone marrow at 10 weeks in the NSI mice after implantation with these HSCs. Collectively, our findings demonstrated that CRISPR/Cas9 successfully corrects β-thalassemia mutations in patient-specific iPSCs. These CRISPR/Cas9-corrected iPSC-derived HSCs express normal HBB in mice without tumorigenic potential, suggesting a safe strategy for personalized treatment of β-thalassemia.

Prevalence of Periodontal Disease in Children with Leukemia and Thalassemia

OpenAIRE

Marhamah; Maulidita, Hardianti

2014-01-01

Background. Various periodontal disease can occur in children and adolescents. Some can take place quickly and periodontal tissue damage. Several previous studies indicate that systemic diseases associated with periodontal disease in children. Objectives. This study aims to determine the prevalence of periodontal disease in children with leukemia and thalassemia. Methods. The design study is a cross-sectional approach. Periodontal pocket depth measurements performed using the WHO standa...

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

Directory of Open Access Journals (Sweden)

Selma Ünal

2014-09-01

Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

Perfil de beta talassemia heterozigota obtido a partir de análise data mining em banco de dados The profile of beta thalassemia obtained by data mining analysis in a database

Directory of Open Access Journals (Sweden)

Ana L. B. Domingos

2010-02-01

Full Text Available Variations in the phenotypic expression of heterozygous beta thalassemia reflect the formation of different populations. To better understand the profile of heterozygous beta-thalassemia of the Brazilian population, we aimed at establishing parameters to direct the diagnosis of carriers and calculate the frequency from information stored in an electronic database. Using a Data Mining tool, we evaluated information on 10,960 blood samples deposited in a relational database. Over the years, improved diagnostic technology has facilitated the elucidation of suspected beta thalassemia heterozygote cases with an average frequency of 3.5% of referred cases. We also found that the Brazilian beta thalassemia trait has classic increases of Hb A2 and Hb F (60%, mainly caused by mutations in beta zero thalassemia, especially in the southeast of the country.

Same β-globin gene mutation is present on nine different β-thalassemia chromosomes in a Sardinian population

International Nuclear Information System (INIS)

Pirastu, M.; Galanello, R.; Doherty, M.A.; Tuveri, T.; Cao, A.; Kan, Y.W.

1987-01-01

The predominant β-thalassemia in Sardinia is the β 0 type in which no β-globin chains are synthesized in the homozygous state. The authors determined the β-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same β/sup 39(CAG→TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the β-globin gene region

Complex Interaction of Hb Q-Thailand with α0- and β0-Thalassemia in a Chinese Family.

Science.gov (United States)

He, Sheng; Qin, Qian; Lin, Li; Chen, Qiuli; Yi, Shang; Wei, Honhwei; Du, Juan; Zheng, Chenguang; Qiu, Xiaoxia; Chen, Biyan

2017-01-01

Hb Q-Thailand [α74(EF3)Asp→His (α1); HBA1: c.223 G>C] is an abnormal hemoglobin (Hb), variant found mainly in China and Southeast Asian countries. The association of the α Q -Thailand allele with other globin gene disorders has important implications in diagnosis. Here, we report a hitherto undescribed condition of patients with a double heterozygosity for Hb Q-Thailand with α 0 -thalassemia (α 0 -thal) and in combination with β 0 -thalassemia (β 0 -thal) in a Chinese family. Our study will provide some clinical manifestations, laboratory diagnosis and genetic counseling for complex hemoglobinopathies.

Treatment with hydroxyurea in thalassemia intermedia with paravertebral pseudotumors of extramedullary hematopoiesis.

Science.gov (United States)

Cario, H; Wegener, M; Debatin, K-M; Kohne, E

2002-08-01

Excessive ineffective erythropoiesis in thalassemia intermedia may cause paravertebral pseudotumors of extramedullary hematopoiesis. Due to the proximity to the spinal canal, these paravertebral masses carry the risk of severe neurological damage. Treatment strategies include hypertransfusion, radiotherapy, and laminectomy. Hydroxyurea, stimulating fetal hemoglobin synthesis, may represent an alternative therapeutic approach. We report on a 26-year-old patient suffering from thalassemia intermedia with progressive anemia symptoms and presenting multiple intrathoracic paravertebral pseudotumors of extramedullary hematopoiesis. Hypertransfusion therapy and splenectomy were followed by regular transfusion (baseline hemoglobin 10 g/dl) and chelation with desferrioxamine. With this treatment, clinical symptoms disappeared, paravertebral hematopoietic masses did not progress, but severe hemosiderosis developed within a few years. Hydroxyurea therapy was initiated to increase the efficacy of erythropoiesis, thereby reducing the required transfusion volume but suppressing concomitantly further expansion of extramedullary hematopoiesis, and finally leading to a reduction of transfusional iron load. Treatment was started with 4 mg/kg per day and stepwise increased to 12.5 mg/kg per day. The fetal hemoglobin concentration increased from 4.5 to 5.5 g/dl after 1 year and to 9.9 g/dl after 2 years of treatment. The yearly transfusion volume was halved during the 1st year of treatment. At present, after 26 months of treatment, the patient has been transfusion-independent for 10 months. Serum ferritin levels decreased from 2844 to 1335 ng/ml. Size and shape of paravertebral hematopoietic pseudotumors remained stable. No side effects of hydroxyurea have been observed. In thalassemia intermedia patients with extramedullary hematopoiesis, hydroxyurea may lead to independence from regular transfusion therapy without further expansion of ectopic hematopoietic tissue.

Thalassemia treatment and prevention in Uva Province, Sri Lanka: a public opinion survey.

Science.gov (United States)

Mudiyanse, Rasnayaka M

2006-01-01

Due to its excessive cost thalassemia management is a major health care problem in Sri Lanka. The majority of doctors are using only desferrioxamine (DFO), in grossly inadequate doses mainly because of its unavailability. Deferiprone (L1), which is more affordable, is not used due to fear of toxicity, as previously reported. Arthropathy attributed to L1 has been observed in some patients, and has led to the discontinuation of the drug in all patients, without scientific rationale. The proposed thalassemia prevention project for Uva Province is based on prevention of marriages between carriers. This could be achieved by carrier screening and counseling of teenagers and adolescents well before they select their partners. In Sri Lanka, people find their marriage partners at their work place or universities, by themselves, or with the help of professional marriage brokers (they are called Kapuwa), through relatives and close friends. This process of finding a partner may also be helped by paper advertisements. However, in addition to the appearance and attitude of the prospective partner, the caste, social background and horoscope are major considerations in selecting a partner. Even when they select partners on their own at the work place or university, they keep these factors in the back of their minds to ensure social acceptance. Many relationships are given up due to objections and advice from parents when the caste or social background does not match. A horoscope is a written document that almost every child gets, written by a professional horoscope reader and depending on the time of birth. It is believed, according to the horoscope, that a person's attitudes, desires, future prospects of finding a suitable partner, could be predicted. It is rare to proceed with a marriage if the horoscope does not match. These customs are considered less seriously among educated people when they find their partner at the work place or university. The concept of thalassemia risk

Spectrum of types of thalassemias and hemoglobinopathies: study in a tertiary level children hospital in Bangladesh

Directory of Open Access Journals (Sweden)

Waqar A. Khan

2017-05-01

Full Text Available Thalassemias and hemoglobinopathies are the most common hemolytic congenital disorders in Bangladesh as in many parts of the world. This study was done to find the common types of thalassemias and abnormal hemoglobin variants seen in Bangladeshi populations. A total of 4813 samples were analyzed for hemoglobin disorders out of which 2308 (49.95% showed abnormalities. The samples were analyzed by Bio Rad D 10 Analyzer in 3914 (81.32% cases, BIORAD VARIANTβ thalassemia short program using the principle of high performance liquid chromatography in 474 (9.85% cases and by CAPILLARYS 2 FLEX PIERCING utilizing capillary electrophoresis in 425 (8.83% cases. The samples were analyzed in the Department of Biochemistry and Molecular Biology of Dhaka Shishu (Children Hospital, Dhaka, Bangladesh. The common hemoglobin disorders seen were β trait 863 (17.94%, Hb E trait 601 (12.50%, Hb E β thalassemia 524 (10.87%, β thalassemia major 192(4.00 %, Hb E disease 99 (2.05%. Other Hb abnormalities detected were Hb D trait 17 (0.35%, Sickle cell trait 4 (0.08%, hereditary persistence of fetal hemoglobin (HPFH 2 (0.04%, and Hb Lepore, δ β thalassemia, sickle cell β thalassemia, Sickle cell disease, compound heterozygote for HbE+D and Hb Q band one case each (0.02%.   与世界许多地方一样，地中海和血红蛋白病是孟加拉国最常见的溶血性先天性疾病。本研究的目的是找到孟加拉国人群的常见地中海贫血类型和异常血红蛋白变体。总共对4813例样本进行了血红蛋白疾病分析，其中2308例（49.95%）显示异常。3914例（81.32%）样本使用Bio Rad D 10分析仪分析，由BIORAD VARIANTβ地中海贫血症短期计划使用高效液相色谱法分析了474例（9.85%），由CAPILLARYS 2 FLEX PIERCING使用毛细管电泳分析了425例（8.83%）。样本在孟加拉达卡的达卡生化与分子生物学教研室进行分析。观察到的常见血红蛋白疾病是863例（17.94%�

Dificuldades na identificação laboratorial da talassemia alfa Difficulty on laboratory identification of alpha thalassemia

Directory of Open Access Journals (Sweden)

Karlla Greick Batista Dias-Penna

2010-04-01

Full Text Available Introdução: Talassemia alfa é uma síndrome associada à redução da síntese de cadeias de globina do tipo alfa. A gravidade das manifestações clínicas está relacionada com a quantidade de globinas produzida e a estabilidade das cadeias beta presentes em excesso. A talassemia alfa mínima resulta da deleção de apenas um dos quatro genes a (-α/αα. Clinicamente apresenta anemia leve com microcitose ou ausência de anemia, sendo o diagnóstico realizado por meio de visualização da hemoglobina (Hb H por eletroforese alcalina em acetato de celulose ou por identificação de inclusões celulares de Hb H coradas pelo azul de crezil brilhante. Objetivo: Avaliar portadores de talassemia alfa e seus respectivos progenitores, correlacionando perfil hematológico e presença de Hb H, utilizando procedimentos laboratoriais clássicos em três diferentes amostragens. Discussão e conclusão: Os dados obtidos mostram que a presença de Hb H, indicativo de talassemia alfa, pode não ser confirmada em uma análise posterior. Entre os fatores que podem influenciar no não aparecimento de Hb H em pessoa comprovadamente com talassemia alfa está a deficiência de ferro. A talassemia alfa está associada a defeitos envolvendo os genes codificadores da cadeia alfa, mas também pode estar relacionada com desbalanciamento temporário na expressão dos genes globina, diminuição de alfa ou aumento de beta, o que poderia explicar o aparecimento de tetrâmeros de cadeia beta (Hb H, sugerindo diagnóstico de talassemia alfa mínima.Introduction: Alpha thalassemia is a syndrome with associated with the reduction of alpha globin chain synthesis. The severity of clinical manifestations is related to the amount of globins produced and the stability of beta chains that are present in excess. Alpha thalassemia minor is caused by the deletion of one of the four genes a (-α/αα. Clinically, it presents mild anemia with microcytosis or absence of anemia. The

Frequency of hepatitis B and hepatitis C in multi - transfused beta thalassemia major patients

International Nuclear Information System (INIS)

Iqbal, M.M.; Hassan, S.; Aziz, S.

2010-01-01

To determine the frequency of hepatitis B and C virus infection among children with beta thalassemia major registered at Military Hospital Rawalpindi. Children attending Thalassemia Centre Military Hospital Rawalpindi for regular blood transfusion were registered. They belonged to different ethnic groups and came from different parts of the country. Their demographic data was recorded, detailed history taken and physical examination was carried out. Their serum samples were tested for hepatitis B surface antigen and anti HCV antibody assay with third generation commercial ELISA method. During the study; 141 patients of beta thalassemia major were screened. Out of them 50 patients (35.5% ,95% confidence interval 27.8-43.5)w ere found hepatitis C virus antibody positive and 1 patient (0.7 %) hepatitis B surface antigen positive. One patient (0.7%) had both hepatitis B and C virus infection. Mean age of hepatitis C infected patients was 10.4+3.85y ears (range 2-16 years). Mean age of uninfected patients was 6.1 + 3.59 years. (p value 0.000) In addition, the results indicate that higher prevalence of anti-HCV was significantly associated with longer duration of transfusion (p value <0.003). In spite of the fact that screened blood is used for transfusions, still a large number of patients have been found infected with hepatitis C. Therefore more accurate techniques are required for screening of blood to prevent transfusion associated transmission. (author)

Novel interactions of two α-Hb variants with SEA deletion α0-thalassemia: hematological and molecular analyses.

Science.gov (United States)

Srivorakun, Hataichanok; Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2018-04-01

To report the hematological and molecular features as well as diagnostic aspects of the hitherto un-described interactions of two rare α-globin chain variants with α 0 -thalassemia commonly found among Southeast Asian populations. The study was done on two adult Thai patients (P1 and P2) who had hypochromic microcytic anemia. Hb analysis was carried out using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE). Mutations were identified by PCR and related techniques. Hb analysis of P1 using HPLC showed a normal Hb pattern, but CE demonstrated an abnormal peak at zone 7. DNA sequencing identified a CCG-CTG mutation at codon 95 of the α2 globin gene corresponding to the Hb G-Georgia [α95(G2)Pro → Leu(α2)] previously undescribed in the Thai population. In contrast, Hb analysis of P2 demonstrated an abnormal peak not fully separated from Hb A on HPLC, but not on CE. DNA analysis identified the rarely described Hb Nakhon Ratchasima [α63(E12)Ala → Val(α2)] mutation. Routine DNA analysis detected the SEA deletion α 0 -thalassemia in trans to the Hb variants in both cases. Hematological parameters were compared with those of patients with compound heterozygote for other α-globin variants and α 0 -thalassemia previously documented. Identification of the patients confirmed that interaction of these rare Hb variants with α 0 -thalassemia does not lead to the Hb H disease. Differentiation of these two Hb variants from other clinically relevant hemoglobinopathies in a routine setting is, however, necessary. This can be accomplished using a combined Hb-HPLC and CE analysis followed by PCR-RFLP assays.

Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

Science.gov (United States)

Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

1997-05-01

The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major

Science.gov (United States)

Soman, Salil; Rosenfeld, David L; Roychowdhury, Sudipta; Drachtman, Richard A; Cohler, Alan

2009-01-01

We describe a 16 year-old male with β thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH). After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions and near complete resolution of his neurological symptoms. While EMH causing cord compression in adolescents is rare in the current era of bone marrow transplantation or chronic transfusions, it should be considered when thalassemia major patients present with neurological deficits. The well defined imaging features of EMH can play a central role in its diagnosis and management, especially because surgical and / or radiotherapeutic intervention are often considered in cases of failed medical treatment. PMID:22470615

Vitamin D deficiency and its relationship with cardiac iron and function in patients with transfusion-dependent thalassemia at Chiang Mai University Hospital.

Science.gov (United States)

Dejkhamron, Prapai; Wejaphikul, Karn; Mahatumarat, Tuanjit; Silvilairat, Suchaya; Charoenkwan, Pimlak; Saekho, Suwit; Unachak, Kevalee

2018-02-01

Vitamin D deficiency is common in patients with thalassemia. Vitamin D deficiency could be related to cardiac dysfunction. Increased parathyroid hormone (PTH) is also known to be associated with heart failure. To determine the prevalence of Vitamin D deficiency and to explore the impact of Vitamin D deficiency on cardiac iron and function in patients with transfusion-dependent thalassemia. A cross-sectional study in patients with Transfusion-dependent thalassemia was conducted. Patients with liver disease, renal disease, type 1 diabetes, malabsorption, hypercortisolism, malignancy, and contraindication for MRI were excluded. Calcium, phosphate, PTH, vitamin D-25OH were measured. CardiacT2 * and liver iron concentration (LIC) and left ventricular ejection fraction (LVEF) were determined. Results Sixty-one (33M/28F) patients with Transfusion-dependent thalassemia were enrolled. The prevalence of Vitamin D deficiency was 50.8%. Patients with cardiac siderosis had tendency for lower D-25OH than those without siderosis (15.9 (11.7-20.0) vs. 20.2 (15.85-22.3) ng/mL); p = 0.06). Serum calcium, phosphate, PTH, LIC, cardiac T2 * , and LVEF were not different between the groups with or without Vitamin D deficiency. Patients with Vitamin D deficiency had significantly lower hemoglobin levels compared to those without Vitamin D deficiency (7.5 (6.93-8.33) vs. 8.1 (7.30-8.50) g/dL; p = 0.04). The median hemoglobin in the last 12 months was significantly correlated with D-25OH. Cardiac T2 * had significant correlation with PTH. Vitamin D deficiency is prevalent in patients with Transfusion-dependent thalassemia. Vitamin D level is correlated with hemoglobin level. Vitamin D status should be routinely assessed in these patients. Low PTH is correlated with increased cardiac iron. This study did not demonstrate an association between Vitamin D deficiency and cardiac iron or function in patients with Transfusion-dependent thalassemia.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Directory of Open Access Journals (Sweden)

Giulia Breveglieri

2015-01-01

Full Text Available Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6 carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a the transgenic integration region is located in mouse chromosome 7; (b the expression of the transgene is tissue specific; (c as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin αmu-globin2/βhu-globin2 and, more importantly, (d the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

Science.gov (United States)

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

[Pretreatment doses of antithymocyte globubin-fresenius for allogeneic hematopoietic stem cell transplantation for beta-thalassemia major].

Science.gov (United States)

Li, Chunfu; Wang, Yanhua; Wu, Xuedong; Pei, Fuyu; He, Yuelin; Feng, Xiaoqin; Liu, Huaying

2012-05-01

To investigate the effects of different doses of antithymocyte globubin-fresenius (ATG-F) for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in patients with beta-thalassemia Major. Sixty-four children with beta-thalassemia major undergoing allo-HSCT were divided into two equal groups to receive ATG-F pretreatments at high (30 mg/kg) or low (15 mg/kg) doses as part of the conditioning regimen including mainly cyclophosphamide, busulfan, fludarabine, and thiotepa. The outcomes of the patients were compared between the two groups. No obvious difference were noted in the time to leukocyte and platelet engraftment between the two groups. The incidence of grade II-IV acute graft-versus-host disease (aGVHD) appeared to be higher in the low-dose group than in the high-dose group (12.5% vs 9.4%). The incidence of grade III-IV aGVHD was also higher in the low dose group (12.5% vs 6.3%), but the difference was not statistically significant. Application of high-dose ATG-F was associated with a higher rate of probable and possible fungal infection (P<0.05). The two doses of ATG-F is feasible as a part of the conditioning regimen for allo-HSCT in children with beta-thalassemia major.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

Science.gov (United States)

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Determination of the spectrum of beta-thalassemia genes in Spain by use of dot-blot analysis of amplified beta-globin DNA.

OpenAIRE

Amselem, S; Nunes, V; Vidaud, M; Estivill, X; Wong, C; d'Auriol, L; Vidaud, D; Galibert, F; Baiget, M; Goossens, M

1988-01-01

We have delineated the molecular lesions causing beta-thalassemia in Spain, a country that has witnessed the passage of different Mediterranean populations over the centuries, in order to evaluate the extent of heterogeneity of these mutations and to make possible simplified prenatal diagnosis of the disorder in that country. The use of the polymerase chain-reaction (PCR) technique to preferentially amplify beta-globin DNA sequences that contain the most frequent beta-thalassemia mutations in...

Updates of the HbVar database of human hemoglobin variants and thalassemia mutations

NARCIS (Netherlands)

B. Giardine (Belinda); J. Borg (Joseph); E. Viennas (Emmanouil); C. Pavlidis (Cristiana); K. Moradkhani (Kamran); P. Joly (Philippe); M. Bartsakoulia (Marina); C. Riemer (Cathy); W. Miller (Webb); G. Tzimas (Giannis); H. Wajcman (Henri); R.C. Hardison (Ross); G.P. Patrinos (George)

2014-01-01

textabstractHbVar (http://globin.bx.psu.edu/hbvar) is one of the oldest and most appreciated locus-specific databases launched in 2001 by a multi-center academic effort to provide timely information on the genomic alterations leading to hemoglobin variants and all types of thalassemia and

Impact of beta thalassemia on maxillary sinuses and sino-nasal passages: A case control study.

Science.gov (United States)

Ragab, Ahmed; Ragab, Seham Mohammed; Shawki, Mohammed

2015-12-01

Skeletal changes among beta (β) thalassemia children are well documented, but without available data regarding sino-nasal passages alterations. The authors investigated the maxillary sinuses and sino-nasal passages changes in β-thalassemia children and correlated such changes with the amount of transfused red cells and the erythroid marrow activity. Clinical analyses including otorhinolaryngical examination (ORL) were obtained in twenty β-thalassemia children and 20 matched healthy controls. Hemoglobin (Hb), serum ferritin, soluble transferrin receptor (sTfR) levels and bone mineral density of the lumbar spine (BMD ls) were assayed. The two groups were analyzed for the CT image parameters: bone thickness, anterior and posterior choanae diameters, extramedullary hematopoiesis and chronic rhinosinusitis (CRS) RESULTS: Nasal congestion/obstruction was identified in 14 (70%) children. Eight patients (40%) had criteria of chronic rhinosinusitis. In comparison with the normal controls, the increase in the roof, floor, medial, anterior, lateral and posterior maxillary bony walls thickness was significantly higher (1.26, 2.46, 2.6, 2.9, 3.23 and 5.34-folds, respectively). The mean posterior choanae horizontal, vertical diameters and their surface area were significantly reduced in the patients compared to the controls. The mean anterior maxillary wall bone thickness directly correlated with sTfR (P=0.047) while that of the posterior wall correlated inversely with Hb level (P=0.013). The mean vertical posterior choanae diameter had positive correlation with the amount of transfused red cells (P=0.001) and negative correlation with sTfR (P=0.001). The Hounsfield unit of maxillary sinus wall had direct relation with BMDls (P=0.003) CONCLUSIONS: Thalassemia children are at risk of different folds increase of maxillary sinuses walls thicknesses utmost at posterior and lateral walls. Other sino-nasal morbidities include diminished posterior choanal diameter, nasal obstruction

Community participation for thalassemia prevention initiated by village health volunteers in northeastern Thailand.

Science.gov (United States)

Jopang, Yupin; Petchmark, Suthep; Jetsrisuparb, Arunee; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Schelp, Frank Peter

2015-03-01

The study was conducted to assess the achievement of a thalassemia screening program at a community level supported by village health volunteers (VHVs) of 2 subdistricts in the northeast of Thailand. One subdistrict served as the intervention and the other as the control area. A training program was organized for the village health volunteers from the intervention area. Essential information about the risk and danger of thalassemia was given to the participants who wanted to have children in the community as well. Of the 206 individuals who wanted to have children living in the intervention area, 190 (92.2%) agreed to undergo screening. Of the 196 individuals within the control area, only 26 (13.3%) voluntarily participated in the screening tests. Attitude toward prevention and knowledge about the disease improved significantly in both areas, but the differences between the scores were statistically significantly higher for individuals living in the intervention area. © 2012 APJPH.

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

Science.gov (United States)

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

Coronary atherosclerosis burden is not advanced in patients with β-thalassemia despite premature extracardiac atherosclerosis: a coronary artery calcium score and carotid intima-media thickness study.

Science.gov (United States)

Hahalis, George; Zacharioglou, Evangelia; Xanthopoulou, Ioanna; Koniari, Ioanna; Kalogeropoulou, Chistina; Tsota, Irene; Rigopoulou, Aspasia; Diamantopoulos, Athanasios; Gkizas, Vasilios; Davlouros, Periklis; Akinosoglou, Karolina; Leopoulou, Marianna; Gogos, Charalampos; Alexopoulos, Dimitrios

2016-02-01

Thalassemic patients demonstrate an increased rate of extracardiac vascular complications and increased carotid wall intima-media thickness (cIMT), but very low prevalence of coronary artery disease (CAD). We investigated the atheroma burden by assessing the coronary artery calcium (CAC) and cIMT in these patients. We examined 37 patients with β-thalassemia and 150 healthy control volunteers with multi-detector computer tomography (CT) and ultrasonography to determine CAC score and cIMT, respectively. Propensity score matching (C-statistic: 0.88; 95% CI: 0.83-0.93) resulted in 27 pairs of patients; severe CAC was observed in 2 (7.4%) and 0 of β-thalassemia patients and healthy volunteers respectively (P = 0.5). Median calcium score was 0 (0-0) in β-thalassemia patients and 0 (0-4) in healthy volunteers (P = 0.8). Median intima-media thickness was higher in β-thalassemia patients compared to control group [0.45 (0.06-0.65) vs. 0.062 (0.054-0.086); P = 0.04]. Patients with β-thalassemia in comparison with healthy control subjects exhibit similar CAC score and increased cIMT. Our findings indicate a disparate rate of progression of atherosclerosis between coronary and extracardiac arteries in these patients lending support to the epidemiological evidence.

ESR spectroscopy of blood serum in thalassemia: computer simulation of methemalbumin spectrum

International Nuclear Information System (INIS)

Preoteasa, E.A.; Duliu, O.G.; Grecu, V.V.; Schianchi, G.; Giori, D.C.; Pedrazzi, G.

1997-01-01

In pathological states with severe hemolysis such as homozygous β-thalassemia, human serum albumin (HSA) binds ferric heme to form the methemalbumin (MHA) molecular complex. Low-temperature X-band ESR monitored MHA in patients' serum, while in vitro studies prompted a molecular model for the complex. On the assumption of axial symmetry with small rhombic distortion for high spin Fe (III) in MHA, we used a simulation program written in FORTRAN V for ESR spectra of vitreous samples containing subsystems with effective electronic spin S' = 1/2 and nuclear spin I ≥ 0. We have take also into account the individual resonance line shape and half-width, and the magnetic field dependence of the transition probability. Two distinct forms of MHA were found in patients' serum, the second one showing a stronger rhombic distortion around Fe (III) as compared to the in-vitro complex. This suggested a conformational change of HSA around heme binding site, possibly produced by free radicals occurring in thalassemia intense oxidative stress; these could generate more forms of MHA. (authors)

Hb A1c Determination by Capillary Electrophoresis is an Efficient Method for Detecting β-Thalassemias and Hemoglobin Variants.

Science.gov (United States)

Orts, Juan A; Zúñiga, Ángel; Bello, Yanis; Fabregat, Aleix B; Vicente, Ana I

2016-09-01

Glycated hemoglobin (Hb A 1c ) determination by multicapillary zone electrophoresis (MZE) can additionally be used to detect Hb A 2 , Hb F and most common hemoglobin (Hb) variants. We assessed the effectiveness of this method for detecting β-thalassemia (β-thal), δβ-thalassemia (δβ-thal) and most common Hb variants. Moreover, Hb F/Hb A 2 is evaluated as an index for discriminating between β- and δβ-thal traits. The theoretical β-thalassemia major (β-TM) birth rate in our healthcare area is calculated and contrasted with real data. A MZE technique was used for Hb A 1c measurements in 27,724 patients. Previous criteria for carrier detection were established and subsequently confirmed by molecular biology techniques. Positive predictive value (PPV) was 100.0%. The prevalence of β-thal trait (including δβ-thal) was 0.34%. The most prevalent mutations (estimated per 100,000 population) were HBB: c.118C > T (57.7%), HBB: c.93-21G>A (50.5%), HBB: c.92 + 1G > A (43.3%), HBB: c.92 + 6T > C (32.5%) and HBB: c.20delA (18.0%) for β-thalassemias, and Hb S (HBB: c.20A > T) (32.5%) and Hb J-Baltimore (HBB:c.3880T>A) (28.9%) for Hb variants. We found a paradoxical result between the theoretical β-TM birth rate and real data. We calculated an optimal Hb F/Hb A 2 index cutoff of 0.71 for discriminating between β- and δβ-thal traits. This method is highly cost-effective for detecting β-thalassemias and common Hb variants. Prevalence results match previous data for the Spanish population. Heterogeneity of mutations in Spain has markedly increased as a consequence of migration. The Hb F/Hb A 2 index cutoff could be used to predict δβ-thal trait.

Immunological Evaluation of -Thalassemia Major Patients Receiving Oral Iron Chelator Deferasirox

International Nuclear Information System (INIS)

Aleem, A.; Alsaleh, K.; Algahtani, F.; Momen, A. A.; Shakoor, Z.; Iqbal, Z.

2014-01-01

Objective: To determine the immune abnormalities and occurrence of infections in transfusion-dependent -thalassemia major patients receiving oral iron chelator deferasirox (DFX). Study Design: An observational study. Place and Duration of Study: Hematology Clinics, King Khalid University Hospital, Riyadh, Saudi Arabia, from July to December 2010. Methodology: Seventeen patients with -thalassemia major (12 females, median age 26 years) receiving deferasirox (DFX) for a median duration of 27 months were observed for any infections and had their immune status determined. Immune parameters studied included serum immunoglobulins and IgG subclasses, serum complement (C3 and C4) and anti-nuclear antibody (ANA) level, total B and T-lymphocytes, CD4+ and CD8+ counts, CD4+/CD8+ ratio, and natural killer (NK) cells. Immunological parameters of the patients were compared with age, gender, serum ferritin level and splenectomy status. Lymphocyte subsets were also compared with age and gender matched normal controls. Results: A considerable reduction in serum ferritin was achieved by DFX from a median level of 2528 to 1875 mol/l. Serum IgG levels were increased in 7 patients. Low C4 levels were found in 9 patients. Total B and T-lymphocytes were increased in 14 patients each, while CD4+, CD8+ and NK cells were increased in 13, 12 and 11 patients respectively. Absolute counts for all lymphocyte subsets were significantly higher compared to the normal controls (p=0.05 for all parameters). Raised levels of IgG were associated with older age, female gender, splenectomized status and higher serum ferritin levels but this did not reach statistical significance except for the higher ferritin levels (p=0.044). Increased tendency to infections was not observed. Conclusion: Patients with -thalassemia major receiving DFX exhibited significant immune abnormalities. Changes observed have been described previously, but could be related to DFX. The immune abnormalities were not associated with

Measurement of HbA1c and HbA2 by Capillarys 2 Flex Piercing HbA1c programme for simultaneous management of diabetes and screening for thalassemia.

Science.gov (United States)

Ke, Peifeng; Liu, Jiawei; Chao, Yan; Wu, Xiaobin; Xiong, Yujuan; Lin, Li; Wan, Zemin; Wu, Xinzhong; Xu, Jianhua; Zhuang, Junhua; Huang, Xianzhang

2017-10-01

Thalassemia could interfere with some assays for haemoglobin A 1c (HbA 1c ) measurement, therefore, it is useful to be able to screen for thalassemia while measuring HbA 1c . We used Capillarys 2 Flex Piercing (Capillarys 2FP) HbA 1c programme to simultaneously measure HbA 1c and screen for thalassemia. Samples from 498 normal controls and 175 thalassemia patients were analysed by Capillarys 2FP HbA 1c programme (Sebia, France). For method comparison, HbA 1c was quantified by Premier Hb9210 (Trinity Biotech, Ireland) in 98 thalassaemia patients samples. For verification, HbA 1c from eight thalassaemia patients was confirmed by IFCC reference method. Among 98 thalassaemia samples, Capillarys 2FP did not provide an HbA 1c result in three samples with HbH due to the overlapping of HbBart's with HbA 1c fraction; for the remaining 95 thalassaemia samples, Bland-Altman plot showed 0.00 ± 0.35% absolute bias between two systems, and a significant positive bias above 7% was observed only in two HbH samples. The HbA 1c values obtained by Capillarys 2FP were consistent with the IFCC targets (relative bias below ± 6%) in all of the eight samples tested by both methods. For screening samples with alpha (α-) thalassaemia silent/trait or beta (β-) thalassemia trait, the optimal HbA 2 cut-off values were ≤ 2.2% and > 2.8%, respectively. Our results demonstrated the Capillarys 2FP HbA 1c system could report an accurate HbA 1c value in thalassemia silent/trait, and HbA 2 value (≤ 2.2% for α-thalassaemia silent/trait and > 2.8% for β-thalassemia trait) and abnormal bands (HbH and/or HbBart's for HbH disease, HbF for β-thalassemia) may provide valuable information for screening.

Thalassemia in Western Australia: 11 novel deletions characterized by Multiplex Ligation-dependent Probe Amplification.

NARCIS (Netherlands)

Phylipsen, M.; Prior, J.F.; Lim, E.; Lingam, N.; Vogelaar, I.P.; Giordano, P.C.; Finlayson, J.; Harteveld, C.L.

2010-01-01

The number of immigrants in Western Australia from many different areas where hemoglobinopathies are endemic has increased dramatically since the 1970s. Therefore, many different thalassemia mutations have been introduced in the country, which add a technological diagnostic problem to the serious

Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major

Directory of Open Access Journals (Sweden)

Alan COHLER

2009-01-01

Full Text Available We describe a 16 year-old male with ß thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH. After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions and near complete resolution of his neurological symptoms. While EMH causing cord compression in adolescents is rare in the current era of bone marrow transplantation or chronic transfusions, it should be considered when thalassemia major patients present with neurological deficits. The well defined imaging features of EMH can play a central role in its diagnosis and management, especially because surgical and / or radiotherapeutic intervention are often considered in cases of failed medical treatment.

Hubungan Jumlah Darah Transfusi, Pemberian Deferoksamin, dan Status Gizi Dengan Kadar Seng Plasma Pada Penderita Thalassemia Mayor Anak

Directory of Open Access Journals (Sweden)

Ivan Rachmad Bachtiar

2009-06-01

Full Text Available Roles of zinc have been known in many important biologic activities. Previous studies found that there were low plasma zinc level in children with major thalassemia. The aim of this study was to determinate correlation the amount of blood transfusion, deferoxamine usage and nutrition status with plasma zinc level in pediatric major thalassemia. The cross-sectional study was conducted from Mei to June 2008 at Clinic of Pediatric Thalassemia Dr. Hasan Sadikin Hospital Bandung with subjects below 14 years. The amount of blood transfusion was calculated, deferoxamine usage was divided into optimal and non-optimal, nutritional status was classified into well-nourished and undernourished. Statistical analysis were performed with Pearson correlation test and Chi square test, with 95% confidence interval. The amount of 57 subjects consisted of 29 boys and 28 girls, ages ranged from 2 years 1 month to 13 years 9 months. The plasma zinc levels ranged from 42 to 91 g/dL (68.65; 11.68 and the amount of blood transfusion ranged from 1,680 to 45,700 mL (17,913.25; 10,404.18. The Pearson correlation test which showed the correlation between plasma zinc level and the amount of blood transfusion was stated by r=-0.189; p=0.0795. Chi-square test showed the impact of deferoxamine usage and nutritional status on plasma zinc level were x2=0.073; p=0.786 and x2=0.468; p=0.494. We conclude that the amount of blood transfusion, deferoxamine usage, and nutritional status are not correlated with plasma zinc level in children with major thalassemia.

Side effects of Deferasirox Iron Chelation in Patients with Beta Thalassemia Major or Intermedia

Directory of Open Access Journals (Sweden)

Murtadha Al-Khabori

2013-03-01

Full Text Available Objectives: Chelating agents remain the mainstay in reducing the iron burden and extending patient survival in homozygous beta-thalassemia but adverse and toxic effects may increase with the institution and long term use of this essential therapy. This study aimed to estimate the incidence of deferasirox (DFX side effects in patients with thalassemia major or intermedia.Methods: A retrospective study of 72 patients (mean age: 20.3±0.9 yrs; 36 male, 36 female with thalassemia major or intermedia treated at Sultan Qaboos University Hospital, Oman, was performed to assess the incidence of side effects related to deferasirox over a mean of 16.7 month follow-up period.Results: Six patients experienced rashes and 6 had gastro-intestinal upset. DFX was discontinued in 18 patients for the following reasons: persistent progressive rise(s in serum creatinine (7 patients; 40% mean serum creatinine rise from baseline, feeling unwell (2, severe diarrhea (1, pregnancy (1, death unrelated to chelator (2 and rise in serum transaminases (2. Three patients were reverted to desferoxamine and deferiprone combination therapy as DFX was no longer biochemically effective after 18 months of therapy. There was no correlation between baseline serum ferritin and serum creatinine or a rise in serum creatinine. Cardiac MRI T2* did not change with DFX therapy. However, there was an improvement in liver MRI T2* (p=0.013.Conclusion: Renal side effects related to deferasirox appear to be higher than those reported in published clinical trials. Further larger studies are required to confirm these findings.

A randomized, controlled study evaluating effects of amlodipine addition to chelators to reduce iron loading in patients with thalassemia major.

Science.gov (United States)

Eghbali, Aziz; Kazemi, Hamideh; Taherahmadi, Hassan; Ghandi, Yazdan; Rafiei, Mohammad; Bagheri, Bahador

2017-12-01

Cardiomyopathy due to iron overload can be fatal in patients with thalassemia major. Calcium channel blockers seem to be effective to reduce iron loading. Our goal was to study effects of amlodipine addition to chelators on iron loading in patients with thalassemia major. This randomized, controlled, and single-center trial was performed on 56 patients with thalassemia major. Patients were randomized 1:1 to combined group (iron chelator plus amlodipine) or control group (iron chelator) for 1 year. Iron content was measured by magnetic resonance imaging; heart T2*, and liver T2*. Serum ferritin was also measured. After 12 months of treatment, myocardial T2* values had significant improvement in combined group (21.9 ± 8.0 ms to 24.5 ± 7.6 ms; P < .05); Difference between two groups was significant (P = .02). Combined treatment had no effect on hepatic T2* value (9.6 ± 2.8 ms to 9.5 ± 3.6 ms); difference between two groups was not significant (P = .2). In addition, a significant reduction was seen in serum ferritin levels in two groups. Mild gastrointestinal upset was the most common untoward effect. Addition of amlodipine to iron chelators has beneficial effects for reduction of iron loading in patients with thalassemia major. This combination therapy seems safe. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

Science.gov (United States)

Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

2012-01-01

This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

Relation of anthropometric measurements to ocular biometric changes and refractive error in children with thalassemia.

Science.gov (United States)

Elkitkat, Rania S; El-Shazly, Amany A; Ebeid, Weam M; Deghedy, Marwa R

2018-03-01

To evaluate and correlate anthropometric, biometric, and refractive error changes in thalassemia major (TM). One hundred children with TM and another hundred healthy controls were recruited. Height, weight, body mass index (BMI), and occipitofrontal circumference (OFC) were the anthropometric parameters recorded. Full ophthalmologic examination was performed, including best-corrected visual acuity, cycloplegic refraction, slit-lamp examination, Goldmann applanation tonometry, indirect ophthalmoscopy, keratometry (K readings), and ocular biometry. Compared to controls, children with TM were shorter and lighter, with a smaller BMI (pbiometric data, patients with thalassemia had steeper mean K readings (p = 0.03), shorter axial length (AXL) (p = 0.005), shorter vitreous chamber depth (pbiometric changes (steeper corneas and thicker lenses) to reach emmetropization, with an exaggerated response and subsequent myopic shift. However, growth retardation is not directly related to ocular growth changes, myopic shift, or variations in biometric parameters.

Transfusion regimens in thalassemia intermedia

Directory of Open Access Journals (Sweden)

Z. Karakas

2011-12-01

Full Text Available Thalassemia intermedia (TI is a heterogeneous disease, in terms of both clinical manifestations and underlying molecular defects. Some TI patients are asymptomatic until adult life, whereas others are symptomatic from early childhood. In contrast with patients with Thalassemia major (TM, the severity of anemia is less and the patients do not require transfusions during at least the first few years of life. Many patients with TI, especially older ones, have been exposed to the multiple long-term effects of chronic anemia and tissue hypoxia and their compensatory reactions, including enhanced erythropoiesis and increased iron absorption. Bone marrow expansion and extramedullary hematopoiesis lead to bone deformities and liver and spleen enlargement. Therapeutic strategies in TI are not clear and different criteria are used to decide the initiation of transfusion and chelation therapy, modulation of fetal hemoglobin production, and hematopoietic stem cell transplantation on an individual basis. The clinical picture of well-treated TM patients with regular transfusionchelation therapy is better from TI patients who have not received adequate transfusion therapy. There is a significant role of early blood transfusion to prevent and treat complications commonly associated with TI, such as extramedullary erythropoiesis and bone deformities, autoimmune hemolytic anemia, leg ulcers, gallstones, pseudoxantoma elasticum, hyperuricosuria, gout and pulmonary hypertension, which are rarely seen in thalassemia major. Nowadays, indications of transfusion in patients with TI are chronic anemia (Hb < 7 g/dL, bone deformities, growth failure, extramedullary erythropoiesis, heart failure, pregnancy and preparation for surgical procedures. Conclusion: Adequate (regular or tailored transfusion therapy is an important treatment modality for increasing the quality of life in patients with thalassemia intermedia during childhood

A cross-sectional study of metabolic and endocrine complications in beta-thalassemia major

International Nuclear Information System (INIS)

Najafipour, F.; Aliasgarzadeh, A.; Aghamohamadzadeh, N.; Bahrami, A.; Mobasri, M.; Niafar, M.; Khoshbaten, M.

2008-01-01

Iron overload is a major problem in patients with beta-thalassemia major, and it has many structural and metabolic consequences. The aim of this study was evaluation of endocrine disturbances in patients with beta-thalassemia major who were older than 10 years of age. In this cross-sectional study, investigator collected demographic data and medical histories, as well as menstrual history in females, from the medical records of 56 patients with beta-thalassemia major. Patients were examined to determine their pubertal status and the standard deviation score for height for evaluation of short stature. For evaluation of glucose tolerance, a fasting blood glucose and oral glucose tolerance tests were performed. Evidence for diabetes mellitus was based on American Diabetes Association and World Health Organization criteria. Serum levels of calcium, phosphorous, thyroid-stimulating hormone, free thyroxin, luteinizing hormone and follicular-stimulating hormone and estradiol in girls and testosterone in boys were measured. The mean and standard deviation for age in the 56 patients (36 males and 20 females) was 15.62+-4.44 years. Diabetes mellitus was present in 5 patients (8.9%), impaired fasting glucose was found in 16 patients (28.6%) and an impaired glucose tolerance test was found in 4 patients (7.1%). Short stature (standard deviation score <-2) was seen in 25 (70%) boys and 14 (73%) girls. Impaired puberty was found in 40 patients (71%). Hypocalcaemia and primary overt hyperthyroidism were present in 23 (41%) and 9 patients (16%), respectively. Only eight patients (14.3%) had no endocrine abnormalities. Despite therapy with deferoxamine to treat iron overload, the risk of secondary endocrine dysfunction remained high. Hypogonadism was one of the most frequent endocrine complications. Impaired glucose tolerance, short stature, hypocalcemia, subclinical and overt hypothyroidism are also frequent. (author)

Which psychosocial factors are related to chelation adherence in thalassemia? A systematic review.

Science.gov (United States)

Evangeli, Michael; Mughal, Kulsoom; Porter, John B

2010-06-01

Good adherence to iron chelation therapy in thalassemia is crucial. Although there is evidence that adherence is related to regimen factors, there has been less emphasis on the relationship between psychosocial (psychological, demographic and social) factors and adherence. We present a systematic review of psychosocial correlates of chelation adherence in thalassemia. Nine studies met the inclusion criteria. Information was extracted regarding the study characteristics and the relationship between psychosocial factors and chelation adherence. Methodological quality was rated. The studies took place in a range of countries, were mostly cross sectional in design, and examined adherence to deferoxamine (DFO) only. Sample sizes ranged from 15 to 1573. A variety of psychosocial variables were examined. Definitions of adherence varied between studies and non adherence rates were also variable (9 to 66%). Older age was consistently associated with lower levels of chelation adherence. There were few other consistent findings. The methodological quality of studies was variable. There is a need for more methodologically sophisticated and theoretically informed studies on psychosocial correlates of chelation adherence. We offer specific suggestions.

The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype

Directory of Open Access Journals (Sweden)

Türker Bilgen

2011-09-01

Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.

A persistent cough as atypical clinical presentation of intrathoracic extramedullary hematopoiesis (EMH) in a female with thalassemia intermedia.

Science.gov (United States)

Abdulla, Mohammad Aj; Yassin, Mohamed A; Abdelrazek, Mohamed; Mudawi, Deena; Ibrahim, Firyal; Soliman, Dina S; ElOmri, Halima; Nashwan, Abdulqadir J; Fernihough, Liam; De Sanctis, Vincenzo; Soliman, Ashraf T

2018-02-16

Extramedullary hematopoiesis (EMH) is a rare disorder, defined as the appearance of hematopoietic elements outside the bone marrow or peripheral blood. The most common sites of EMH are liver and spleen, but it has been documented in other organs such as the mediastinum, lymph nodes, breast, and central nervous system. EMH occurs as a compensatory mechanism for bone marrow dysfunction in severe thalassemia. We report a case of EMH presenting as a posterior mediastinal mass in a 34-year-old woman with thalassemia intermedia with chronic cough and shortness of breath on exertion. The diagnosis of EMH was confirmed by a CT-guided fine needle biopsy. All symptoms disappeared after surgical removal of the mass.

Genotyping of Kell, Duffy, Kidd and RHD in patients with b Thalassemia

Directory of Open Access Journals (Sweden)

Castilho Lilian

2000-01-01

Full Text Available Determination of Rh, Kell, Duffy and Kidd phenotypes in addition to ABO is used to prevent the alloimmunization to red blood cells (RBCs antigens and as part of the antibody identification process in patients with beta Thalassemia. However, phenotyping in these patients can be time consuming and difficult to interpret. In these situations, it would be valuable to have an alternative to hemagglutination tests to determine the patient's antigen profile. We used PCR-RFLP to genotype such patients. DNA was prepared from 50 patients with beta Thalassemia who had been phenotyped by routine hemagglutination, and tested for Kell, Kidd, Duffy/GATA mutation by PCR-RFLP. RHD/non-D was analysed by PCR product size associated to RHD gene sequence in intron 4 and exon 10/3'UTR. The genotyping assays were performed without knowledge of phenotype results. For RHD/non-D, 47 were RhD+ and RHD+/RHCE+, and 3 were RhD- and RHD-/RHCE+. For Kell, 48 kk were K2K2 and 2 Kk were K1K2. For Duffy, of 44 samples that had normal GATA box, 8 Fy(a+b- were FYA/FYA, 15 Fy(a+b+ were FYB/FYB, and 19 Fy(a+b+ were FYA/FYB; of the other 4 samples 3 were FYA/FYB and heterozygous GATA mutation, and 1 Fy(a-b- was FYB/FYB, homozygous GATA mutation. Two samples phenotyped as Fy(a+b- that had normal GATA , presented the 265T/298A mutations and two samples phenotyped as Fy(a-b+ were genotyped was FYA/FYB.. For Kidd , 15 Jk(a+b were JKA/JKA, 12 Jk(a-b+ were JKB/JKB, and 20 Jk(a+b+ were JKA/JKB. Three samples phenotyped as JK(a+b+ were genotyped as JKB/JKB. Genotype is more accurate than phenotype for determination of blood groups in polytransfused patients with betaThalassemia. Genotyping in these patients can be helpful to select antigen-negative RBCs for transfusion.

Outcomes, utilization, and costs among thalassemia and sickle cell disease patients receiving deferoxamine therapy in the United States.

Science.gov (United States)

Delea, Thomas E; Hagiwara, May; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D

2008-04-01

Deferoxamine mesylate (DFO) reduces morbidity and mortality associated with transfusional iron overload. Data on the utilization and costs of care among U.S. patients receiving DFO in typical clinical practice are limited however. This was a retrospective study using a large U.S. health insurance claims database spanning 1/97-12/04 and representing 40 million members in >70 health plans. Study subjects (n = 145 total, 106 sickle cell disease [SCD], 39 thalassemia) included members with a diagnosis of thalassemia or SCD, one or more transfusions (whole blood or red blood cells), and one or more claims for DFO. Mean transfusion episodes were 12 per year. Estimated mean DFO use was 307 g/year. Central venous access devices were required by 20% of patients. Cardiac disease was observed in 16% of patients. Mean total medical costs were $59,233 per year including $10,899 for DFO and $8,722 for administration of chelation therapy. In multivariate analyses, potential complications of iron overload were associated with significantly higher medical care costs. In typical clinical practice, use of DFO in patients with thalassemia and SCD receiving transfusions is low. Administration costs represent a large proportion of the cost of chelation therapy. Potential complications of iron overload are associated with increased costs. (c) 2007 Wiley-Liss, Inc.

The pancreas in {beta}-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

Energy Technology Data Exchange (ETDEWEB)

Papakonstantinou, Olympia [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece); Attikon Hospital, 2nd Department of Radiology, Athens (Greece); Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos [Thalassemia Unit, University of Athens, ' ' Aghia Sophia' ' Children' s Hospital, Athens (Greece); Maris, Thomas; Gourtsoyiannis, Nicholas [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece)

2007-06-15

The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)

The pancreas in β-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

International Nuclear Information System (INIS)

Papakonstantinou, Olympia; Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos; Maris, Thomas; Gourtsoyiannis, Nicholas

2007-01-01

The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)

Treating thalassemia major-related iron overload: the role of deferiprone

Directory of Open Access Journals (Sweden)

Berdoukas V

2012-10-01

Full Text Available Vasilios Berdoukas,1 Kallistheni Farmaki,2 Susan Carson,1 John Wood,3 Thomas Coates11Division of Hematology/Oncology, Children's Hospital Los Angeles, Los Angeles, CA, USA; 2Thalassemia Unit, General Hospital of Corinth, Corinth, Greece; 3Division of Cardiology, Children's Hospital Los Angeles, Los Angeles, CA, USAAbstract: Over the last 20 years, management for thalassemia major has improved to the point where we predict that patients' life expectancy will approach that of the normal population. These outcomes result from safer blood transfusions, the availability of three iron chelators, new imaging techniques that allow specific organ assessment of the degree of iron overload, and improvement in the treatment of hepatitis. In October 2011, the Food and Drug Administration licensed deferiprone, further increasing the available choices for iron chelation in the US. The ability to prescribe any of the three chelators as well as their combinations has led to more effective reduction of total body iron. The ability to determine the amount of iron in the liver and heart by magnetic resonance imaging allows the prescription of the most appropriate chelation regime for patients and to reconsider what our aims with respect to total body iron should be. Recent evidence from Europe has shown that by normalizing iron stores not only are new morbidities prevented but also reversal of many complications such as cardiac failure, hypothyroidism, hypogonadism, impaired glucose tolerance, and type 2 diabetes can occur, improving survival and patients' quality of life. The most effective way to achieve normal iron stores seems to be with the combination of deferoxamine and deferiprone. Furthermore, outcomes should continue to improve in the future. Starting relative intensive chelation in younger children may prevent short stature and abnormal pubertal maturation as well as other iron-related morbidities. Also, further information should become available on the

PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

Directory of Open Access Journals (Sweden)

Luisella Saba

2009-06-01

Full Text Available

Prenatal diagnosis of β-thalassemia was accomplished for the first time in the 1970s by globin chain synthesis analysis on fetal blood obtained by placental aspiration at 18-22 weeks gestation. Since then, the molecular definition of the β- globin gene pathology, the development of procedures of DNA analysis, and the introduction of chorionic villous sampling have dramatically improved prenatal diagnosis of this  disease and of related disorders.  Much information is now available about the molecular mechanisms of the diseases and the molecular testing is widespread.

As prenatal diagnosis has to provide an accurate, safe and early result, an efficient screening of the population and a rapid molecular characterization of the couple at risk, are necessary prerequisites. In the last decades  earlier and less invasive approaches for prenatal diagnosis were developed . A overview of the most promising procedure will be done.

Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

Iron Overload Leading to Torsades de Pointes in β-Thalassemia and Long QT Syndrome

DEFF Research Database (Denmark)

Refaat, Marwan M; El Hage, Lea; Steffensen, Annette Buur

2016-01-01

The authors present a unique case of torsades de pointes in a β-thalassemia patient with early iron overload in the absence of any structural abnormalities as seen in hemochromatosis. Genetic testing showed a novel KCNQ1 gene mutation 1591C>T [Gln531Ter(X)]. Testing of the gene mutation in Xenopus...

Awareness among Parents of β-Thalassemia Major Patients Regarding Prenatal Diagnosis and Premarital Screening in Day Care Centre of Transfusion Medicine Department.

Science.gov (United States)

Rudra, S; Chakrabarty, P; Hossain, M A; Ripon, M J; Rudra, M; Mirza, T T

2016-01-01

Thalassemia is one of the most common genetic diseases in the world. It is a major health problem, brings much morbidity, early mortality and a great deal of misery for a family both financially and emotionally. The patients suffering from beta thalassemia major do not survive for more than 5 years without blood transfusion. Blood transfusion is usually administered every two to five weeks to maintain the pre-transfusion hemoglobin level of 9-10 gm/dL. This study carried out in the department of Transfusion Medicine of Mymensingh Medical College Hospital from January 2014 to June 2014. A total of 200 parents were interviewed. There was a slight preponderance of females which accounted for 57.5% of the parents. Ninety seven (45.5%) had an income less than Rs. 5000 per month. Nearly 50% were illiterate with only 24.5% with a higher education. Consanguinity was positive in 72.5% of the parents with extended family history of thalassemia positive in 40.8%. Only 29.5% were immunized against Hepatitis B. Around 27.5% did not know whether they should be immunized. Fifty five percent of parents knew children should receive Dysferol. Twelve percent were aware of consanguinity to be a risk factor for thalassaemia with only 5% having undergone antenatal diagnosis. Parental knowledge about thalassemia and its preventive measures is inadequate; this requires intervention in the form of public health education programs concentrating on high risk/targeted population.

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR

Directory of Open Access Journals (Sweden)

Ta-Hsien Lee

2017-08-01

Conclusion: The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

Science.gov (United States)

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Plasma lipid pattern and red cell membrane structure in β-thalassemia patients in Jakarta

Directory of Open Access Journals (Sweden)

Seruni K.U. Freisleben

2011-08-01

Full Text Available Background: Over the last 10 years, we have investigated thalassemia patients in Jakarta to obtain a comprehensive picture of iron overload, oxidative stress, and cell damage.Methods: In blood samples from 15 transfusion-dependent patients (group T, 5 non-transfused patients (group N and 10 controls (group C, plasma lipids and lipoproteins, lipid-soluble vitamin E, malondialdehyde (MDA and thiol status were measured. Isolated eryhtrocyte membranes were investigated with electron paramagnetic resonance (EPR spectroscopy using doxyl-stearic acid and maleimido-proxyl spin lables. Data were analyzed statistically with ANOVA.Results: Plasma triglycerides were higher and cholesterol levels were lower in thalassemic patients compared to controls. Vitamin E, group C: 21.8 vs T: 6.2 μmol/L and reactive thiols (C: 144 vs. T: 61 μmol/L were considerably lower in transfused patients, who exert clear signs of oxidative stress (MDA, C: 1.96 vs T: 9.2 μmol/L and of tissue cell damage, i.e., high transaminases plasma levels. Non-transfused thalassemia patients have slight signs of oxidative stress, but no significant indication of cell damage. Erythrocyte membrane parameters from EPR spectroscopy differ considerably between all groups. In transfusion-dependent patients the structure of the erythrocyte membrane and the gradients of polarity and fluidity are destroyed in lipid domains; binding capacity of protein thiols in the membrane is lower and immobilized.Conclusion: In tranfusion-dependent thalassemic patients, plasma lipid pattern and oxidative stress are associated with structural damage of isolated erythrocyte membranes as measured by EPR spectroscopy with lipid and proteinthiol spin labels. (Med J Indones 2011; 20:178-84Keywords: electron paramagnetic resonance spectroscopy, erythrocyte membrane, lipoproteins, oxidative stress, thalassemia, plasma lipids.

Targeted correction of a thalassemia-associated beta-globin mutation induced by pseudo-complementary peptide nucleic acids

DEFF Research Database (Denmark)

Lonkar, Pallavi; Kim, Ki-Hyun; Kuan, Jean Y

2009-01-01

Beta-thalassemia is a genetic disorder caused by mutations in the beta-globin gene. Triplex-forming oligonucleotides and triplex-forming peptide nucleic acids (PNAs) have been shown to stimulate recombination in mammalian cells via site-specific binding and creation of altered helical structures...

THE PROTECTIVE ROLE OF VITAMIN E AGAINST OXYGEN FREE RADICAL AND DNA DAMAGE IN CHILDREN WITH β-THALASSEMIA MAJOR

International Nuclear Information System (INIS)

NASSAR, E.M.

2008-01-01

The present study aimed to determine the benefits of vitamin E as antioxidant supplement in β thalassemia children who are at risk of iron overload due to multiple blood transfusion and oxidative stress. Antioxidant markers, oxidative products, hematological parameters and biomarkers of cell damage were studied in 24 transfusion-dependent β -thalassemia children before and after treatment with vitamin E at a dose of 10 mg/kg /day for a period of four weeks. Plasma thiobarbituric acid reactive species (TBARS) and urinary 8-hydroxy-2 ' -deoxyguanosine (8-OHdG) were analyzed as oxidative markers, whereas the plasma vitamin E and the activities of the antioxidant enzymes glutathione peroxidase (GSH-Px), superoxide dismutase(SOD) and catalase were measured to show the antioxidant status of thalassemic children. All these parameters were also studied in 15 non-anemic healthy controls .The results showed that all the patients had increased signs of iron overload and cell damage that were obvious from the increase in serum iron, ferritin, alanine transaminases (ALT), aspartate transaminases (AST) and both total and direct bilirubin .The level of plasma vitamin E in the thalassemia patients were found to be significantly lower as compared to normal subjects (1.3 ± 0.7 and 3.14 ± 1.5 mg % , respectively). The activities of antioxidants enzymes, glutathione peroxidase and catalase in untreated β-thalassemic patients were found to be significantly (P<0.001) less than that of the normal subjects. However, SOD level was significantly increased. Markers of free radical injury such as TBARS , urinary 8-OHdG levels in thalassemic children were significantly higher than control levels . All these changes in the antioxidant status as well as the hematological parameters, iron overload and cell damage markers in β-thalassemia patients showed significant improvement after vitamin E supplementation. Vitamin E levels showed significant positive correlations with each of Hb, GSH

Dimensions of social capital of families with thalassemia in an indigenous population in Tamil Nadu, India - a qualitative study.

Science.gov (United States)

Palanisamy, Bharathi; Kosalram, Kalpana; Gopichandran, Vijayaprasad

2017-06-24

Studies have shown that social capital is positively associated with health, and the association is context-based. Indigenous populations with poor access to health care largely depend on social capital for their health care needs. This study was conducted to explore the dimensions and types of social capital and its utilization by families with thalassemia for their health and well-being in an indigenous population in Tamil Nadu, India. The participants in the study were parents who had children with thalassemia, belonged to an indigenous community in Tamil Nadu, were poor and marginalized, and had poor access to health care. Different dimensions and types of social capital were examined with the help of qualitative in-depth interviews using a phenomenological approach. A total of 8 in-depth interviews were conducted and transcribed. Thematic analysis of the data was performed. The social capital identified through the in-depth interviews consisted of various levels of family support, financial support from relatives and neighbors, the provision of information from formal and informal networks, and trust in the physician. Indigenous communities are close-knit due to their geographical remoteness and limited accessibility. Family ties were a form of social capital that encouraged bonding, and provided support and care to the children affected by thalassemia. The bonding also helped to meet the regular requirement of blood donation for the children. Relatives and neighbors were an asset that served as a bridge for the families affected, helping them in times of immediate and urgent financial need, making it easier to sustain long-term treatment and providing emotional support. There were informal networks that bridged parents belonging to indigenous and non-indigenous communities, with the latter providing the former with information to help them choose better health care at an affordable cost. The other formal links were the ties between the parents and

Magnetic resonance imaging of transfusional hemosiderosis complicating thalassemia major

International Nuclear Information System (INIS)

Brasch, R.C.; Wesbey, G.E.; Gooding, C.A.; Koerper, M.A.

1984-01-01

Tissue deposits of hemosiderin, a paramagnetic iron-protein complex, resulted in marked abnormalities of magnetic resonance (MR) spin-echo signal intensity within the viscera of three children with transfusional hemosiderosis and thalassemia major. In all patients the liver and bone marrow demonstrated abnormally low spin-echo intensities and the kidneys and muscles had abnormally high intensities. These observations correlate with in vitro MR observation of ferric (Fe +3 ) solutions, in which concentrations of ferric salts greater than 20 mmol yielded higher intensities than did water alone. MR imaging is sensitive to the tissue deposition of hemosiderin, and MR intensity appears to provide a rough measure of the amount of iron deposited

Intrathoracic extramedullary hematopoiesis presenting as tumor-simulating lesions of the mediastinum in α-thalassemia: A case report.

Science.gov (United States)

An, Jun; Weng, Yimin; He, Jinyuan; Li, Yun; Huang, Shaohong; Cai, Songwang; Zhang, Junhang

2015-10-01

Extramedullary hematopoiesis (EMH) is a rare disease, where hematological disorder drives extramedullary hematopoietic tumor formation in multiple regions of the body. The present study reports a case of EMH presenting as multiple tumor-like lesions of mediastinum in a 61-year-old male with α-thalassemia, which was subjected to a video-assisted thoracoscopic surgery tissue biopsy to differentiate it from other mediastinal tumors. To date, only three cases of EMH in patients with α-thalassemia have been described in the literature. Patients with EMH typically exhibit no hematological disorder preoperatively and therefore EMH is frequently misdiagnosed. In the present study, along with a literature review of the clinicopathological features of EMH, the diagnosis and treatment of this rare case was discussed, in order to differentiate diagnosis, and particularly to distinguish EHM from extramedullary myeloid sarcoma.

The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

NARCIS (Netherlands)

E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

1983-01-01

textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

Preimplantation diagnosis: efficient tool for human leukocyte antigen matched bone marrow transplantation for thalassemia

Directory of Open Access Journals (Sweden)

Anver Kuliev

2011-08-01

Full Text Available Thalassemia is among the most frequent indications for preimplantation genetic diagnosis (PGD to allow at risk couples reproducing without fear of having an affected child. In addition, those already having the affected child, have also the option to produce an unaffected offspring that may be also a complete human leukocyte antigen (HLA match to affected child to ensure successful bone marrow transplantation. We present here the results of retrospective analysis of 293 PGD cycles for thalassemia, including 144cases of simultaneous HLA typing, resulting in birth of 70 thalassemia-free children and 12 unaffected HLA matched ones, providing their cord blood and/or bone marrow for transplantation treatment of their affected siblings. The present overall experience includes successful cord blood or bone marrow transplantation in more than three dozens of cases with HLA matched stem cells obtained from children born after PGD, demonstrating that PGD is an efficient approach for improving success of bone marrow transplantation treatment for thalassemia.   植入前遗传学诊断（PGD）是地中海贫血（地贫）最常用的疗法，该病患者夫妇无须担心孕儿受到感染。此外，如果已经怀上受到感染的宝宝，他们也可有选择性再生育一个未受感染的后代，提供完全匹配的HLA，来确保骨髓成功移植。本文将提供293个地贫病例的PGD周期诊断结果，包括144例HLA同时配型，有70例宝宝无地贫出生和12例未受感染的HLA配型宝宝出生。将这些健康宝宝的脐带血和/或骨髓取出以完成对他们同胞的移植手术，通过使用经诊断后的，出生宝宝身上取出的HLA配型干细胞，成功完成36例宝宝的脐带或骨髓移植手术。结果表明PGD能有效提高地贫患儿骨髓移植手术的成功率。

Thrombotic thrombocytopenic purpura or immune thrombocytopenia in a sickle cell/β+-thalassemia patient: a rare and challenging condition.

Science.gov (United States)

Vlachaki, Efthymia; Agapidou, Aleka; Neokleous, Nikolaos; Adamidou, Despoina; Vetsiou, Evaggelia; Boura, Panagiota

2014-10-01

The diagnosis of thrombotic thrombocytopenic purpura is one of the possible diagnosis when a patient is admitted with unexpected micro-angiopathic hemolytic anemia and thrombocytopenia. The combination of sickle cell/β(+)-thalassemia and thrombotic thrombocytopenic purpura is rare and triggering. This article describes the poor outcome of a patient with sickle cell/β(+)-thalassemia presenting with gingival bleeding, severe thrombocytopenia and anemia. The patient had normal renal function, no neurological deficit and he was initially treated as immune thrombocytopenic purpura. He eventually died due to multi-organ failure and brain hemorrhage even though he had started plasma exchange sessions. The co-existence of thrombotic thrombocytopenic purpura and sickle cell anemia is making the diagnosis of the former difficult. Early and rapid intervention is critical to the outcome. Copyright © 2014 Elsevier Ltd. All rights reserved.

Adrenal extramedullary hematopoiesis associated with β-thalassemia major.

Science.gov (United States)

Keikhaei, Bijan; Shirazi, Ahmad Soltani; Pour, Mahboob Mohammad

2012-05-10

The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hematopoiesis (EMH). EMH is a rare complication in thalassemia major (TM) and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdominal computed tomography scan revealed a right well-defined suprarenal mass 7.7×7.3×5.8 cm in size. The diagnosis of EMH was confirmed with ultrasonographic-guided fine needle biopsy. Treatment options which include intensified regular blood transfusion and hydroxyurea have been started.

Paraspinal extramedullary hematopoiesis in patients with thalassemia intermedia.

Science.gov (United States)

Haidar, Rachid; Mhaidli, Hani; Taher, Ali T

2010-06-01

Ineffective erythropoiesis in patients with thalassemia intermedia drives extramedullary hematopoietic tumor formation in several parts of the body. Paraspinal involvement has received increasing attention due to the associated morbidity secondary to spinal cord compression. Although the history and physical examination may help narrow the differential diagnosis, radiographic imaging remains essential to confirm the existence of hematopoietic tissue. Characteristic appearance has been observed mainly on magnetic resonance imaging. Several treatment options have been described, including transfusion therapy, laminectomy, radiotherapy, and the use of fetal hemoglobin inducing agents that decrease the hematopoietic drive. However, the ideal management scheme remains controversial. Until large prospective trials evaluate the efficacy and safety of the available treatment options, both in single and in combination therapy, an individualized approach should be entertained.

Simple and Easy to Perform Preimplantation Genetic Diagnosis for β-thalassemia Major Using Combination of Conventional and Fluorescent Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Rasoul Salehi

2017-01-01

Full Text Available Background: Thalassemias are the most common monogenic disorders in many countries throughout the world. The best practice to control the prevalence of the disease is prenatal diagnosis (PND services. Extensive practicing of PND proved effective in reducing new cases but on the other side of this success high abortion rate is hided, which ethically unfair and for many couples, especially with a previous experience of a therapeutic abortion, or moral concerns, is not a suitable choice. Preimplantation genetic diagnosis (PGD is a strong alternative to conventional PND. At present PGD is the only abortion free fetal diagnostic process. Considering the fact that there are more than 6000 single gene disorders affecting approximately 1 in 300 live-births, the medical need for PGD services is significant. Materials and Methods: In the present study development of a PGD protocol for a thalassemia trait couple using nested multiplex fluorescent polymerase chain reaction (PCR for the combination of polymorphic linked short tandem repeat (STR markers and thalassemia mutations is described. Restriction fragment length polymorphism used to discriminate between wild and mutated alleles. Results: In PGD clinical cycle, paternal and maternal alleles for D11S988 and D11S1338 STR markers were segregated as it was expected. PCR product for IVSII-1 mutation was subsequently digested with BtscI restriction enzyme to differentiate normal allele from the mutant allele. The mother's mutation, being a comparatively large deletion, was detectable through size differences on agarose gel. Conclusion: The optimized single cell protocol developed and evaluated in this study is a feasible approach for preimplantation diagnosis of β-thalassemia in our patients.

Genetics of Iranian Alpha-Thalassemia Patients: A Comprehensive Original Study.

Science.gov (United States)

Keikhaei, Bijan; Slehi-Fard, Pejman; Shariati, Gholamreza; Khosravi, Abbas

2018-04-07

Alpha thalassemia is the most prevalent monogenic gene disorder in the world, especially in Mediterranean countries. In the current hematological phenotype of patients with different genotypes, the effects of missense mutations on the protein function and also stability were evaluated in a large cohort study. A total of 1,560 subjects were enrolled in the study and divided into two groups: 259 normal subjects; and 1301 alpha-thalassemia carriers. Genomic DNA was extracted and analyzed using ARMS PCR, Multiplex Gap, and direct sequencing. The effects of single nucleotide change on the protein function and stability were predicted by freely available databases of human polymorphisms. Sixty-three different genotypes were seen in the patients. The more prevalent was heterozygote form of -α3.7 (41.4%) followed by -α3.7 homozygote (11.6%) and -MED (3.8%). The significant differences were seen in mean hemoglobin level [F = 20.5, p < 0.001] between the Alpha-globin genotypes, when adjusted for gender. Moreover, 28 different mutations were found in our study. A significant relationship was seen between ethnicity and the alpha-globin mutation frequency χ 2 (df;8) = 38.36, p < 0.0001). Different genotypes could display as different phenotypes. The mutation frequency distributions in our region are different from those of other parts of Iran. Significant differences are seen in the spectrum of mutation frequency among various ethnicities. Finally, some missense mutations might not have considerable effect on the proteins, and they could be neutral mutations.

Cost utility analysis of reduced intensity hematopoietic stem cell transplantation in adolescence and young adult with severe thalassemia compared to hypertransfusion and iron chelation program.

Science.gov (United States)

Sruamsiri, Rosarin; Chaiyakunapruk, Nathorn; Pakakasama, Samart; Sirireung, Somtawin; Sripaiboonkij, Nintita; Bunworasate, Udomsak; Hongeng, Suradej

2013-02-05

Hematopoieticic stem cell transplantation is the only therapeutic option that can cure thalassemia disease. Reduced intensity hematopoietic stem cell transplantation (RI-HSCT) has demonstrated a high cure rate with minimal complications compared to other options. Because RI-HSCT is very costly, economic justification for its value is needed. This study aimed to estimate the cost-utility of RI-HSCT compared with blood transfusions combined with iron chelating therapy (BT-ICT) for adolescent and young adult with severe thalassemia in Thailand. A Markov model was used to estimate the relevant costs and health outcomes over the patients' lifetimes using a societal perspective. All future costs and outcomes were discounted at a rate of 3% per annum. The efficacy of RI-HSCT was based a clinical trial including a total of 18 thalassemia patients. Utility values were derived directly from all patients using EQ-5D and SF-6D. Primary outcomes of interest were lifetime costs, quality adjusted life-years (QALYs) gained, and the incremental cost-effectiveness ratio (ICER) in US ($) per QALY gained. One-way and probabilistic sensitivity analyses (PSA) were conducted to investigate the effect of parameter uncertainty. In base case analysis, the RI-HSCT group had a better clinical outcomes and higher lifetime costs. The incremental cost per QALY gained was US $3,236 per QALY. The acceptability curve showed that the probability of RI-HSCT being cost-effective was 71% at the willingness to pay of 1 time of Thai Gross domestic product per capita (GDP per capita), approximately US $4,210 per QALY gained. The most sensitive parameter was utility of severe thalassemia patients without cardiac complication patients. At a societal willingness to pay of 1 GDP per capita, RI-HSCT was a cost-effective treatment for adolescent and young adult with severe thalassemia in Thailand compared to BT-ICT.

Prevalence of high blood pressure, heart disease, thalassemia, sickle-cell anemia, and iron-deficiency anemia among the UAE adolescent population.

Science.gov (United States)

Barakat-Haddad, Caroline

2013-01-01

This study examined the prevalence of high blood pressure, heart disease, and medical diagnoses in relation to blood disorders, among 6,329 adolescent students (age 15 to 18 years) who reside in the United Arab Emirates (UAE). Findings indicated that the overall prevalence of high blood pressure and heart disease was 1.8% and 1.3%, respectively. Overall, the prevalence for thalassemia, sickle-cell anemia, and iron-deficiency anemia was 0.9%, 1.6%, and 5%, respectively. Bivariate analysis revealed statistically significant differences in the prevalence of high blood pressure among the local and expatriate adolescent population in the Emirate of Sharjah. Similarly, statistically significant differences in the prevalence of iron-deficiency anemia were observed among the local and expatriate population in Abu Dhabi city, the western region of Abu Dhabi, and Al-Ain. Multivariate analysis revealed the following significant predictors of high blood pressure: residing in proximity to industry, nonconventional substance abuse, and age when smoking or exposure to smoking began. Ethnicity was a significant predictor of heart disease, thalassemia, sickle-cell anemia, and iron-deficiency anemia. In addition, predictors of thalassemia included gender (female) and participating in physical activity. Participants diagnosed with sickle-cell anemia and iron-deficiency anemia were more likely to experience different physical activities.

From Prenatal to Preimplantation Genetic Diagnosis of β-Thalassemia. Prevention Model in 8748 Cases: 40 Years of Single Center Experience

Directory of Open Access Journals (Sweden)

Giovanni Monni

2018-02-01

Full Text Available The incidence of β-thalassemia in Sardinia is high and β-39 is the most common mutation. The prevention campaign started in 1977 and was performed in a single center (Microcitemico Hospital, Cagliari, Sardinia, Italy. It was based on educational programs, population screening by hematological and molecular identification of the carriers. Prenatal and pre-implantation diagnosis was offered to couples at risk. 8564 fetal diagnosis procedures using different invasive approaches and analysis techniques were performed in the last 40 years. Trans-abdominal chorionic villous sampling was preferred due to lower complication risks and early diagnosis. Chorionic villous DNA was analyzed by PCR technique. 2138 fetuses affected by β-thalassemia were diagnosed. Women opted for termination of the pregnancy (TOP in 98.2% of these cases. Pre-implantation genetic diagnosis (PGD was proposed to couples at risk to avoid TOP. A total of 184 PGD were performed. Initially, the procedure was exclusively offered to infertile couples, according to the law in force. The success rate of pregnancies increased from 11.1% to 30.8% when, crucial law changes were enacted, and PGD was offered to fertile women as well. Forty years of β-thalassemia prevention programs in Sardinia have demonstrated the important decrease of this severe genetic disorder.

From Prenatal to Preimplantation Genetic Diagnosis of β-Thalassemia. Prevention Model in 8748 Cases: 40 Years of Single Center Experience.

Science.gov (United States)

Monni, Giovanni; Peddes, Cristina; Iuculano, Ambra; Ibba, Rosa Maria

2018-02-20

The incidence of β-thalassemia in Sardinia is high and β-39 is the most common mutation. The prevention campaign started in 1977 and was performed in a single center (Microcitemico Hospital, Cagliari, Sardinia, Italy). It was based on educational programs, population screening by hematological and molecular identification of the carriers. Prenatal and pre-implantation diagnosis was offered to couples at risk. 8564 fetal diagnosis procedures using different invasive approaches and analysis techniques were performed in the last 40 years. Trans-abdominal chorionic villous sampling was preferred due to lower complication risks and early diagnosis. Chorionic villous DNA was analyzed by PCR technique. 2138 fetuses affected by β-thalassemia were diagnosed. Women opted for termination of the pregnancy (TOP) in 98.2% of these cases. Pre-implantation genetic diagnosis (PGD) was proposed to couples at risk to avoid TOP. A total of 184 PGD were performed. Initially, the procedure was exclusively offered to infertile couples, according to the law in force. The success rate of pregnancies increased from 11.1% to 30.8% when, crucial law changes were enacted, and PGD was offered to fertile women as well. Forty years of β-thalassemia prevention programs in Sardinia have demonstrated the important decrease of this severe genetic disorder.

Identification of novel microsatellite markers preimplantation genetic diagnosis of beta-thalassemia.

Science.gov (United States)

Chen, Min; Tan, Arnold S C; Cheah, Felicia S H; Saw, Eugene E L; Chong, Samuel S

2015-12-01

Beta (β)-thalassemia is one of the most common monogenic diseases worldwide. Affected pregnancies can be avoided through preimplantation genetic diagnosis (PGD), which commonly involves customized assays to detect the different combinations of β-globin (HBB) gene mutations present in couples, in conjunction with linkage analysis of flanking microsatellite markers. Currently, the limited number of reported closely linked markers hampers their utility in indirect linkage-based PGD for this disorder. To increase the available markers closely flanking the HBB gene, an in silico search was performed to identify all markers within 1 Mb flanking the HBB gene. Fifteen markers with potentially high polymorphism information content (PIC) and heterozygosity values were selected and optimized into a single-tube pentadecaplex PCR panel. Allele frequencies and polymorphism and heterozygosity indices of each marker were assessed in five populations. A total of 238 alleles were observed from the 15 markers. PIC was >0.7 for all markers, with expected heterozygosity and observed heterozygosity values ranging from 0.74 to 0.90 and 0.72 to 0.88, respectively. Greater than 99% of individuals were heterozygous for at least seven markers, with at least two heterozygous markers on either side of the HBB gene. The pentadecaplex marker assay also performed reliably on single cells either directly or after whole genome amplification, thus validating its use in standalone linkage-based β-thalassemia PGD or in conjunction with HBB mutation detection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Correlation between Troponin and Ferritin Serum Levels in the Patients with Major Beta-Thalassemia

Directory of Open Access Journals (Sweden)

Iraj Shahramian

2013-06-01

Full Text Available Background: Thalassemia is a hereditary hemoglobinopathy whose most common complication is cardiac involvement which ends up in these patients’ death. Since troponin is a sensitive and specific marker for the detection of microinfarct, we studied the relationship between troponin and ferritin serum levels for early diagnosis of cardiac involvement in these patients. Materials and Methods: This case-control study was performed on 80 patients, including 40 patients with major thalassemia and normal echocardiography and 40 healthy volunteers ranging from 6 months to 16 years old. All the children were examined and the eligible children who were not infected with known heart disease, iron deficiency anemia, kidney disease, diabetes, fever, and systemic diseases were enrolled into the study after obtaining written informed consents from their parents. At 8:00 A.M. before breakfast, 5cc blood was drawn from these children. After collecting the samples, ferritin and troponin serum levels were evaluated using ELISA and electro- kymonolonsense methods, respectively. The gathered data were analyzed through the SPSS statistical software (v. 20 and T-test. Besides, P value<0.05 was considered as statistically significant. Results: The study results revealed a significant difference between the two groups regarding the mean of the serum levels of troponin (P=0.045 and ferritin (P=0.001. In this study, no significant correlation was observed between serum troponin and ferritin levels and age and BMI in the two groups. Also, no significant relationship was found between serum troponin level and sex (P=0.264. Conclusions: In microinfarct, troponin increases independent of ferritin; therefore, it can be used for early detection of cardiac involvement in thalassemia patients to determine the sub-clinical effects.

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

Directory of Open Access Journals (Sweden)

Capretto L

2012-01-01

Full Text Available Lorenzo Capretto1, Stefania Mazzitelli2, Eleonora Brognara2, Ilaria Lampronti2, Dario Carugo1, Martyn Hill1, Xunli Zhang1, Roberto Gambari2, Claudio Nastruzzi31Engineering Sciences, University of Southampton, Southampton, UK; 2Department of Biochemistry and Molecular Biology, 3Department of Pharmaceutical Sciences, University of Ferrara, Ferrara, ItalyAbstract: This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH, based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of ß-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying ß-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol

A pharmaco-economic evaluation of deferasirox for treating patients with iron overload caused by transfusion-dependent thalassemia in Taiwan

Directory of Open Access Journals (Sweden)

Wan-Ling Ho

2013-04-01

Conclusion: Compared with infusional deferoxamine, oral deferasirox improved clinical outcomes and quality of life in terms of iron chelation in transfusion-dependent patients with thalassemia at a reasonable cost from a healthcare perspective.

Incidence of Hepatocellular Carcinoma in Patients with Thalassemia Who Had Hepatitis C

Directory of Open Access Journals (Sweden)

Shahla Ansari

2013-06-01

Full Text Available Hepatitis is the infections of a common cause disease among poly transfused patients. Hepatitis C is slowed progression and inducing HCC. This study assessed HCC incidences, the role of iron and possible antitumor activity of chelators in 170 thalassemia patients using deferoxamine (DFO therapy. They are diagnosed with Hepatitis C due to positive PCR-RNA. They are Treated with IFN. The follow up program including tests every 3 Months and PCR-RNA, AFP and liver US every 6 months. Whenever there was suspicion of liver malignancy, Biopsy was performed. From the total of 170 patients, 59.4% were male, and 40.6% were female. Mean age of thalassemia diagnosis was 2.69±5.403 (1-41 years and mean Age of hepatitis diagnosis was 17.37±7.263 (3-51 years. 92.4 % of Patient’s MT, 0.6 % SS, 2.9% TI. the viral genome was 1a3a. 73.5% of patients had first course of therapy. The frequency of AFP greater than 10 was 5.9%. And the incidence of HCC was 0.6 %(1/170 with a 95% confidence interval. The main risk factor for HCC was HCV infection in TM patients, but it was iron activity in TI patients. Iron chelation with DFO appeared to play a Protective role.

Mutation Spectrum of β-Thalassemia and Other Hemoglobinopathies in Chittagong, Southeast Bangladesh.

Science.gov (United States)

Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa; Chowdhury, Mahmood Ahmed; Sultana, Razia

2015-01-01

Thalassemia is one of the most common autosomal recessive blood disorders in the world. It shows a variety of clinical expression, starting from asymptomatic to severe blood transfusion dependence. More than 500 alleles have been characterized in or around the β-globin region. Moreover, most geographical regions have their own characteristics, frequency and availability of these alleles, predominantly circulating within the communities present in that particular region. In this study, we explored the spectrum of β-thalassemia (β-thal) alleles present in Chittagong, Southeast Bangladesh. This study comprises β-thal and Hb E (HBB: c.79 G > A) patients from in and around the area of Chittagong. Not only exploring the complete β-globin mutation spectrum of the area, but we also tried to look at the origin of the mutated alleles. The β-thal mutations of Bangladesh show a relatively wide spectrum of alleles, which further demonstrates the heterogeneity of the disease in this country. Although our study showed that the majority of the mutations have their origin in neighboring countries such as India, countries of Southeast Asia, Pakistan, etc., some unusual alleles do not originate in neighboring countries and put a little more diversity in the overall spectrum of β-thal-specific alleles. Overall, this study demonstrates the mutation spectrum related to β-thal in Chittagong, Southeast Bangladesh.

Improvement in liver pathology of patients with β-thalassemia treated with deferasirox for at least 3 years.

Science.gov (United States)

Deugnier, Yves; Turlin, Bruno; Ropert, Martine; Cappellini, M Domenica; Porter, John B; Giannone, Vanessa; Zhang, Yiyun; Griffel, Louis; Brissot, Pierre

2011-10-01

Most data on the effects of iron chelation therapy for patients with liver fibrosis come from small studies. We studied the effects of the oral iron chelator deferasirox on liver fibrosis and necroinflammation in a large population of patients with iron overload β-thalassemia. We studied data from 219 patients with β-thalassemia, collected from histologic analyses of biopsy samples taken at baseline and after at least 3 years of treatment with deferasirox. Treatment response was assessed from liver iron concentrations at baseline and the end of the study. Liver fibrosis, necroinflammation, and markers of iron overload and liver enzymes were recorded. Patients were also assessed, by serologic analysis at baseline, for hepatitis C virus infection. By the end of the study, stability of Ishak fibrosis staging scores (change of -1, 0, or +1) or improvements (change of ≤-2) were observed in 82.6% of patients; Ishak necroinflammatory scores improved by a mean value of -1.3 (P<.001). Improvements in fibrosis stage and necroinflammation were independent of hepatitis C virus exposure or reduction in liver iron concentration defined by the response criteria. Absolute changes in concentrations of liver iron by the end of the study did not correlate with improved Ishak fibrosis or necroinflammatory scores. Deferasirox treatment for 3 or more years reversed or stabilized liver fibrosis in 83% of patients with iron-overloaded β-thalassemia. This therapeutic effect was independent of reduced concentration of liver iron (defined by the response criteria) or previous exposure to hepatitis C virus. Copyright © 2011 AGA Institute. Published by Elsevier Inc. All rights reserved.

Evaluation of the children with beta-thalassemia in terms of their self-concept, behavioral, and parental attitudes.

Science.gov (United States)

Yalçn, Siddika Songül; Durmuşoğlu-Sendoğdu, Mine; Gümrük, Fatma; Unal, Selma; Karg, Eda; Tuğrul, Belma

2007-08-01

This study was planned to explore the self-concept, behavioral, and parental attitudes of the children with beta-thalassemia major, and the factors that affect them. The study was undertaken between January and June 2004 at the Hacettepe University Ihsan Doğramaci Children's Hospital, Pediatric Hematology Unit, Ankara and 43 voluntary children with beta-thalassemia major on regular blood transfusion and iron chelation treatment between the ages of 5.0 and 18.0 years were included into the study. Age, sex, birth order, school performance, hemoglobin value, serum ferritin levels, associated illness, splenectomy status, presence of thalassemic sibling or relatives, death of thalassemic relatives, place of residence, maternal and paternal education were recorded. Parental Attitude Research Instrument, Piers-Harris Self-Concept Scale, and Child Behavior Checklist were applied. Higher educated mothers have lower overprotection (P=0.009), parental discordance (P=0.044), and discipline scores (P=0.002) than lower educated mothers. In cases with death of thalassemic relatives, democratic/equality attitude scores were decreased (P=0.034). With stepwise multiple linear regression analysis, splenectomy, good school achievement, absence of death of thalassemic relatives, and serum ferritin levels were found to increase Piers-Harris Self-Concept Scale; however, total behavior problem score was found to decrease with increasing age, splenectomy and decreasing overprotection subscale of Parental Attitude Research Instrument scores. The self-esteem and behavior problems of children with thalassemia depended not only on the variables related exclusively to the child (age, school achievement) and the illness-associated conditions (splenectomy, serum ferritin levels) but also on the parental attitude (overprotection).

Relationship between myocardial T2* values and cardiac volumetric and functional parameters in β-thalassemia patients evaluated by cardiac magnetic resonance in association with serum ferritin levels

Energy Technology Data Exchange (ETDEWEB)

Liguori, Carlo, E-mail: c.liguori@unicampus.it [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Pitocco, Francesca, E-mail: f.pitocco@unicampus.it [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Di Giampietro, Ilenia, E-mail: i.digiampietro@unicampus.it [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Vivo, Aldo Eros de, E-mail: devivoeros@gmail.com [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Schena, Emiliano, E-mail: e.schena@unicampus.it [Unit of Measurements and Biomedical Instrumentation, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy); Cianciulli, Paolo, E-mail: CIANCIULLI.PAOLO@aslrmc.it [Thalassemia Unit, Ospedale Sant Eugenio, Piazzale dell’Umanesimo 10, 00143 Rome (Italy); Zobel, Bruno Beomonte, E-mail: b.zobel@unicampus.it [Department of Diagnostic Imaging, Campus Bio Medico University, via Alvaro del Portillo 200, 00128 Rome (Italy)

2013-09-15

Purpose: Myocardial T2* cardiovascular magnetic resonance provides a rapid and reproducible assessment of cardiac iron load in thalassemia patients. Although cardiac involvement is mainly characterized by left ventricular dysfunction caused by iron overload, little is known about right ventricular function. The aim of this study was to assess the relationship between T2* value in myocardium and left–right ventricular volumetric and functional parameters and to evaluate the existing associations between left–right ventricles volumetric and functional parameter, myocardial T2* values and blood ferritin levels. Materials and methods: A retrospective analysis of 208 patients with β-thalassemia major and thalassemia intermedia was performed (109 males and 99 females; mean age 37.7 ± 13 years; 143 thalassemia major, 65 thalassemia intermedia). Myocardial iron load was assessed by T2* measurements, and volumetric functions were analyzed using the steady state free precession sequence. Results: A significant correlation was observed between EFLV and T2* (p = 0.0001), EFRV and T2* (p = 0.0279). An inverse correlation was present between DVLV and T2* (p = 0.0468), SVLV and T2* (p = 0.0003), SVRV and T2* (p = 0.0001). There was no significant correlation between cardiac T2* and LV–RV mass indices. A significant correlation was observed between T2* and serum ferritin levels (p < 0.001) and between EFLV and serum ferritin (p < 0.05). Conclusion: Myocardial iron load assessed by T2* cardiac magnetic resonance is associated with deterioration in left–right ventricular function; this is more evident when T2* values fall below 14 ms. CMR appears to be a promising approach for cardiac risk evaluation in TM patients.

Relationship between myocardial T2* values and cardiac volumetric and functional parameters in β-thalassemia patients evaluated by cardiac magnetic resonance in association with serum ferritin levels

International Nuclear Information System (INIS)

Liguori, Carlo; Pitocco, Francesca; Di Giampietro, Ilenia; Vivo, Aldo Eros de; Schena, Emiliano; Cianciulli, Paolo; Zobel, Bruno Beomonte

2013-01-01

Purpose: Myocardial T2* cardiovascular magnetic resonance provides a rapid and reproducible assessment of cardiac iron load in thalassemia patients. Although cardiac involvement is mainly characterized by left ventricular dysfunction caused by iron overload, little is known about right ventricular function. The aim of this study was to assess the relationship between T2* value in myocardium and left–right ventricular volumetric and functional parameters and to evaluate the existing associations between left–right ventricles volumetric and functional parameter, myocardial T2* values and blood ferritin levels. Materials and methods: A retrospective analysis of 208 patients with β-thalassemia major and thalassemia intermedia was performed (109 males and 99 females; mean age 37.7 ± 13 years; 143 thalassemia major, 65 thalassemia intermedia). Myocardial iron load was assessed by T2* measurements, and volumetric functions were analyzed using the steady state free precession sequence. Results: A significant correlation was observed between EFLV and T2* (p = 0.0001), EFRV and T2* (p = 0.0279). An inverse correlation was present between DVLV and T2* (p = 0.0468), SVLV and T2* (p = 0.0003), SVRV and T2* (p = 0.0001). There was no significant correlation between cardiac T2* and LV–RV mass indices. A significant correlation was observed between T2* and serum ferritin levels (p < 0.001) and between EFLV and serum ferritin (p < 0.05). Conclusion: Myocardial iron load assessed by T2* cardiac magnetic resonance is associated with deterioration in left–right ventricular function; this is more evident when T2* values fall below 14 ms. CMR appears to be a promising approach for cardiac risk evaluation in TM patients

Internal distribution of excess iron and sources of serum ferritin in patients with thalassemia

Energy Technology Data Exchange (ETDEWEB)

Cazzola, M; Bergamaschi, G; Dezza, L; Borgna-Pignatti, C C; De Stefano, P; Bongo, I G; Avato, F [Pavia Univ. (Italy)

1983-01-01

Liver and spleen iron concentrations, serum ferritin level and binding of S-ferritin to concanavalin A (Con A) were measured in 12 patients with thalassemia major or intermedia at the time of splenectomy. All these subjects had increased liver iron concentration, most of them had hepatic fibrosis but none of them had histological evidence of chronic hepatitis. No patient had ascorbic acid deficiency. Serum ferritin concentration was increased in all cases, ranging from 266 to 5504 ..mu..g/l. In all but 2 subjects most of the protein did not bind to Con A, thus behaving as tissue ferritin. There were highly significant correlations between serum ferritin concentration, amount of blood transfused and liver iron concentration. On the average, iron concentration in the liver was about 3 times that in the spleen. The findings obtained suggest that in patients with thalassemia major or intermedia most of the iron is deposited in parenchymal tissues and most of the S-ferritin derives by leakage from the cytosol of iron-loaded parenchymal cells. S-ferritin is a valid index of liver iron overload in thalassemic patients witout complications such as viral hepatitis and/or ascorbic acid defiency.

Noninvasive analysis of skin iron and zinc levels in beta-thalassemia major and intermedia

International Nuclear Information System (INIS)

Gorodetsky, R.; Goldfarb, A.; Dagan, I.; Rachmilewitz, E.A.

1985-01-01

Diagnostic x-ray spectrometry, a method based on x-ray fluorescence analysis, was used for noninvasive determination of iron and zinc in two distinct skin areas, representing predominantly dermal and epidermal tissues, in 56 patients with beta-thalassemia major and intermedia. The mean iron levels in the skin of patients with beta-thalassemia major and intermedia were elevated by greater than 200% and greater than 50%, respectively, compared with control values. The zinc levels of both skin areas examined were within the normal range. The data indicate that the rate and number of blood transfusions, which correlated well with serum ferritin levels (r . 0.8), are not the only factors that determine the amount of iron deposition in the skin (r less than 0.6). Other sources of iron intake contribute to the total iron load in the tissues, particularly in patients who are not given multiple transfusions. The noninvasive quantitation of skin levels may reflect the extent of iron deposition in major parenchymal organs. Repeated DXS examinations of the skin could monitor the clearance of iron from the tissues of patients with iron overload in the course of therapy with chelating agents

Extraosseous radiotracer uptake on bone scan in beta-thalassemia: report of one case

International Nuclear Information System (INIS)

Guezguez, M.; Nouira, M.; Sfar, R.; Chatti, K.; Ben Fradj, M.; Ben Ali, K.; Ajmi, S.; Essabbah, H.; Zrour, S.

2009-01-01

Red blood cell transfusion, main therapeutic modality of beta-thalassemia, leads to iron overload which may perturb several metabolic ways. The aim of this paper is to illustrate the uptake abnormalities observed on bone scan of thalassaemic patients and to discuss mechanisms of extraosseous accumulation of the radiopharmaceutical in this pathology. We report a 16-year-old child suffering from beta-thalassemia major undergoing transfusion therapy. A bone scan was indicated to look for osseous infection. This study revealed a little skeletal uptake and abnormal liver, splenic and renal accumulation. A repeat bone scan, performed three weeks later showed a better skeletal uptake which enabled the discovery of focal abnormalities and made the diagnostic easier. The effect of iron overload on radiopharmaceuticals uptake in bone scan is known since 1975. Dissociation of 99m Tc from the carrier ligand due to the presence of iron excess seems the most plausible hypothesis. Free 99m Tc can be bound to other tissular substrates which can explain extraosseous uptake. The normally available pool for bone is reduced and then the skeletal uptake decreased. This report limits considerably the sensitivity of the bone scan. A well-led iron chelation and eventually the use of diuretic drug may guarantee a better quality of bone scan images. (authors)

Adrenal extramedullary hematopoiesis associated with β-thalassemia major

Directory of Open Access Journals (Sweden)

Bijan Keikhaei

2012-01-01

Full Text Available The presence of apparently normal hematopoietic tissue outside of bone marrow cavity is defined as extramedullary hema - topoiesis (EMH. EMH is a rare complication in thalassemia major (TM and adrenal gland as well. This report describes a case of adrenal EMH in a 26-year-old man with β-TM. He has been transfused with regular blood transfusion since 9 months. During the routine physical examination he was incidentally found to have a hypoechoic mass at his abdominal ultrasonography. Abdominal computed tomography scan revealed a right well-defined suprarenal mass 7.7¥7.3¥5.8 cm in size. The diagnosis of EMH was confirmed with ultrasonographic-guided fine needle biopsy. Treatment options which include intensified regular blood transfusion and hydroxyurea have been started.

Community genetics and health approaches for bringing awareness in tribals for the prevention of beta-thalassemia in India

Directory of Open Access Journals (Sweden)

Ranbir S. Balgir

2011-08-01

Full Text Available Beta (β thalassemia syndromes are a group of hereditary disorders characterized by a genetic deficiency in the synthesis of β-globin chains. In the homozygous state, β-thalassemia (i.e., thalassemia major causes severe transfusion-dependent anemia. Inherited β-thalassemia syndromes cause high degree of hemolytic anemia, recurrent fever, clinical jaundice, frequent infections, bossing of cheek bones, growth retardation, splenomegaly, etc. and are responsible for high infant morbidity, mortality and fetal wastage in India. The victims include the infants, growing children, adolescent girls, pregnant women and a large chunk of ignorant people. In view of heavy genetic load, frequent requirement of blood transfusions, high cost of treatment and management, physical trauma, and mental and psychological harassment to the patients and their families, it has been realized that preventive community health and genetics approach is the most suitable for India. After carrier detection, prenatal diagnosis, and genetic couselling are the important options for couples at high risk for β-thalassemia. A prerequisite for successful prevention and intervention approach in India is the health education, bringing public awareness, sensitization, and community screening for the identification of heterozygotes or carriers in the concerned community. Some suggestions for the prevention of β-thalassemia in the vulnerable communities of India have been over emphasized for amelioration.β地中海贫血综合症是一簇遗传性异常，其特点是β球蛋白链接合处基因缺失。β地贫（或重型地贫）在纯和状态下导致严重的输液依赖型贫血症。遗传性的β地贫综合症引起严重的溶血�

[Oromaxillofacial changes in thalassemia major].

Science.gov (United States)

De Mattia, D; Pettini, P L; Sabato, V; Rubini, G; Laforgia, A; Schettini, F

1996-01-01

Sixty patients (31 male and 29 female) with thalassemia major, aged between 6 and 26 years, 18 of which were splenectomized, were observed in this study evaluating the oro-maxillo-facial alterations and correlating them to transfusion indexes, serum ferritin levels, splenectomy and age. For each patient a haematologic and odontostomatologic card was filed with a view to report the medical and clinical history regarding: the haematologic picture, the prevention of caries and parodontal disease, the facies characteristics, the odonto-stomatologic examination, the orthodontic diagnosis, the skull X-rays and the orthopantomography. Poor oral hygiene as well as misknowledge of prevention were generally observed. All the patients showed carious lesions but most of them had never seen a dentist for therapy. The disharmonious growth of splanchnocranium, with the enlargement of the jaw and of its alveolar process, induced by the bone marrow hyperplasia, produced various and serious malocclusion stages (Angle's II class, deep bite, open bite), gnathologic alterations, hypodiaphanous paranasal sinuses and orbital hypertelorism, with a typical oriental-like facies. Malocclusion and the poor oral hygienic conditions determined the occurrence of marginal gingivitis, mainly localized at the level of the lower frontal teeth. In only 3 patients the oral mucous membrane was pale and atrophic. During this investigation agenesia and dental retention were reported in 30% and in 26% of the examined cases respectively, while no patients had supernumerary teeth. Tooth volume, position and shape abnormalities rarely occurred. Only in two patients was enamel hypoplasia described. The caries frequency greatly varied in number and in degree. Only five patients did not show any carious lesions. The caries index (DMF) for the permanent teeth calculated in all the 60 subjects was 5, 12 +/- 4.76. By utilizing Spearman's rank test the number of teeth with caries in the permanent dentition (DFM

Vascular endothelial dysfunction in β-thalassemia occurs despite increased eNOS expression and preserved vascular smooth muscle cell reactivity to NO.

Directory of Open Access Journals (Sweden)

Ekatherina Stoyanova

Full Text Available The hereditary β-thalassemia major condition requires regular lifelong blood transfusions. Transfusion-related iron overloading has been associated with the onset of cardiovascular complications, including cardiac dysfunction and vascular anomalies. By using an untransfused murine model of β-thalassemia major, we tested the hypothesis that vascular endothelial dysfunction, alterations of arterial structure and of its mechanical properties would occur despite the absence of treatments.Vascular function and structure were evaluated ex vivo. Compared to the controls, endothelium-dependent vasodilation with acetylcholine was blunted in mesenteric resistance arteries of β-thalassemic mice while the endothelium-independent vasodilator (sodium nitroprusside produced comparable vessel dilation, indicating endothelial cell impairment with preserved smooth muscle cell reactivity to nitric oxide (NO. While these findings suggest a decrease in NO bioavailability, Western blotting showed heightened expression of aortic endothelial NO synthase (eNOS in β-thalassemia. Vascular remodeling of the common carotid arteries revealed increased medial elastin content. Under isobaric conditions, the carotid arteries of β-thalassemic mice exhibited decreased wall stress and softening due to structural changes of the vessel wall.A complex vasculopathy was identified in untransfused β-thalassemic mice characterized by altered carotid artery structure and endothelial dysfunction of resistance arterioles, likely attributable to reduced NO bioavailability despite enhanced vascular eNOS expression.

A comprehensive screening program for β-thalassemia and other hemoglobinopathies in the Hooghly District of West Bengal, India, dealing with 21 137 cases.

Science.gov (United States)

Bhattacharyya, Kallol Kumar; Chatterjee, Tridip; Mondal, Ujjalendu Bikash

2016-11-01

We here present a report of population screening programs (January 2012-December 2015) conducted by the Thalassemia Control Unit, Imambara Sadar Hospital, Chinsurah, Hooghly in the Hooghly District of West Bengal, India for prevention of thalassemia. We screened β-thalassemia (β-thal) heterozygotes and homozygotes, and Hb E (HBB: c.79G > A)-β-thal compound heterozygotes. Among 21 137 cases, we found 1968 heterozygotes and 192 homozygotes or compound heterozygotes. Results were evaluated with standard hematological analyses including red cell indices, hemoglobin (Hb) typing and quantification. The participants of the screening program were divided into six groups (children, pre-marriage cases, post-marital cases, family members of affected individuals, family members of carriers and pregnant women). While considering the average frequency of carriers, many reports recorded both related individuals (family members of trait and affected individuals) as well as unrelated individuals such as school children and pregnant women. These would have to be considered separately and only the unrelated individuals taken to estimate carrier frequencies in this article that would give more realistic data on carrier frequency of unrelated individuals.

Consanguinity Ratio in Beta-Thalassemia Major Patients in District Bannu

International Nuclear Information System (INIS)

Khan, M. S.; Ahmed, M.; Khan, R. A.; Mushtaq, N.; Shah, M. W. U.

2015-01-01

Objective: To assess the frequency of consanguinity in b-thalassemia major patients and its association with age, gender and hepatitis C virus antibody positivity. Methods: The cross-sectional study was conducted from June 2013 to July 2014 at various hospitals of district Bannu in the North Western Khyber Pakhtunkhwa province of Pakistan. Data was recorded on a predesigned questionnaire. Results: Out of 180 subjects, 133(74 percent) parents were cousins, while 47(26 percent) were unrelated. The frequency of anti-hepatitis C virus antibody positivity was 14(7.77 percent). Conclusion: High prevalence of the disease in the study region was due to consanguineous marriages. (author)

Effects of blood transfusion on exercise capacity in thalassemia major patients.

Directory of Open Access Journals (Sweden)

Daniela Benedetto

Full Text Available Anemia has an important role in exercise performance. However, the direct link between rapid changes of hemoglobin and exercise performance is still unknown.To find out more on this topic, we studied 18 beta-thalassemia major patients free of relevant cardiac dysfunction (age 33.5±7.2 years,males = 10. Patients performed a maximal cardiopulmolmonary exercise test (cycloergometer, personalized ramp protocol, breath-by-breath measurements of expired gases before and the day after blood transfusion (500 cc of red cell concentrates. After blood transfusion, hemoglobin increased from 10.5±0.8 g/dL to 12.1±1.2 (p<0.001, peak VO2 from 1408 to 1546mL/min (p<0.05, and VO2 at anaerobic threshold from 965 to 1024mL/min (p<0.05. No major changes were observed as regards heart and respiratory rates either at peak exercise or at anaerobic threshold. Similarly, no relevant changes were observed in ventilation efficiency, as evaluated by the ventilation vs. carbon dioxide production relationship, or in O2 delivery to the periphery as analyzed by the VO2 vs. workload relationship. The relationship between hemoglobin and VO2 changes showed, for each g/dL of hemoglobin increase, a VO2 increase = 82.5 mL/min and 35 mL/min, at peak exercise and at anaerobic threshold, respectively. In beta-thalassemia major patients, an acute albeit partial anemia correction by blood transfusion determinates a relevant increase of exercise performance, observed both at peak exercise and at anaerobic threshold.

Cost utility analysis of reduced intensity hematopoietic stem cell transplantation in adolescence and young adult with severe thalassemia compared to hypertransfusion and iron chelation program

Directory of Open Access Journals (Sweden)

Sruamsiri Rosarin

2013-02-01

Full Text Available Abstract Background Hematopoieticic stem cell transplantation is the only therapeutic option that can cure thalassemia disease. Reduced intensity hematopoietic stem cell transplantation (RI-HSCT has demonstrated a high cure rate with minimal complications compared to other options. Because RI-HSCT is very costly, economic justification for its value is needed. This study aimed to estimate the cost-utility of RI-HSCT compared with blood transfusions combined with iron chelating therapy (BT-ICT for adolescent and young adult with severe thalassemia in Thailand. Methods A Markov model was used to estimate the relevant costs and health outcomes over the patients’ lifetimes using a societal perspective. All future costs and outcomes were discounted at a rate of 3% per annum. The efficacy of RI-HSCT was based a clinical trial including a total of 18 thalassemia patients. Utility values were derived directly from all patients using EQ-5D and SF-6D. Primary outcomes of interest were lifetime costs, quality adjusted life-years (QALYs gained, and the incremental cost-effectiveness ratio (ICER in US ($ per QALY gained. One-way and probabilistic sensitivity analyses (PSA were conducted to investigate the effect of parameter uncertainty. Results In base case analysis, the RI-HSCT group had a better clinical outcomes and higher lifetime costs. The incremental cost per QALY gained was US $ 3,236 per QALY. The acceptability curve showed that the probability of RI-HSCT being cost-effective was 71% at the willingness to pay of 1 time of Thai Gross domestic product per capita (GDP per capita, approximately US $ 4,210 per QALY gained. The most sensitive parameter was utility of severe thalassemia patients without cardiac complication patients. Conclusion At a societal willingness to pay of 1 GDP per capita, RI-HSCT was a cost-effective treatment for adolescent and young adult with severe thalassemia in Thailand compared to BT-ICT.

Cord Compression due to Extramedullary Hematopoiesis in an Adolescent with Known Beta Thalassemia Major

OpenAIRE

Soman, Salil; Rosenfeld, David L; Roychowdhury, Sudipta; Drachtman, Richard A; Cohler, Alan

2009-01-01

We describe a 16 year-old male with ß thalassemia major and gait disturbances that had not been given blood transfusions due to a severe childhood transfusion reaction. Thoracic spine MRI demonstrated hematopoietic marrow throughout the spine and epidural masses causing cord compression consistent with extramedullary hematopoiesis (EMH). After treatment with steroids, radiotherapy and monitored blood transfusions, the patient demonstrated significant improvement of his paraspinal lesions a...

Raman spectroscopy technology to monitor the carotenoids in skin of thalassemia patients: a novel non-invasive tool relating oxidative stress with iron burden

Directory of Open Access Journals (Sweden)

Anna Perrone

2014-09-01

Full Text Available In this work we approach the relationship between redox state and iron overload by noninvasive instrumental techniques. Intracardiac, liver iron and liver fibrosis have been monitored in transfusion-dependent thalassemia patients by magnetic resonance imaging and hepatic transient elastography examinations. These measurements have been matched with a non-invasive, and yet unexplored in clinical practice, evaluation of body’s oxidative stress through measurement of antioxidant carotenoids in skin, by a spectroscopic method based on Raman technology (RRS. The global body’s antioxidant status results from a balance between the level of antioxidants in cells and body fluids, including blood, and pro-oxidant species endogenously produced or coming from external sources. On this basis, the level of skin carotenoids can be considered a biomarker of the entire antioxidant status. In our work the use of RRS method provided information on the redox state of thalassemia patients, which was correlated with the iron status of the patients. Due to the highly adverse effects of accumulated iron, the novel, simple, non-invasive RRS to monitor dermal carotenoids with high compliance of the patients may be a useful tool for the management of thalassemia patients.

Low and fixed dose of hydroxyurea is effective and safe in patients with HbSβ(+) thalassemia with IVS1-5(G→C) mutation.

Science.gov (United States)

Dehury, Snehadhini; Purohit, Prasanta; Patel, Siris; Meher, Satyabrata; Kullu, Bipin Kishore; Sahoo, Lulup Kumar; Patel, Nayan Kumar; Mohapatra, Alok Kumar; Das, Kishalaya; Patel, Dilip Kumar

2015-06-01

Despite compelling evidence that hydroxyurea is safe and effective in sickle cell disease, it is prescribed sparingly due to several barriers like knowledge gaps in certain genotypes, apprehension about its safety and toxicity, and limited resources. We undertook this study to find out the efficacy and safety of HU in patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. We registered 318 patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. Of these, 203 were enrolled for hydroxyurea treatment at a low and fixed dose of 10 mg/kg/day. One hundred four patients (Group-I: 37 children and Group-II: 67 adults) with ≥2 years of hydroxyurea treatment were studied. The rate of vaso-occlusive crises, requirement of blood transfusion and rate of hospitalization reduced from 3 to 0.5, 1 to 0 and 1 to 0 in Group-I and 3 to 0, 1 to 0 and 0.5 to 0 in Group-II respectively after HU therapy (P hydroxyurea is suitable for treatment of patients with HbSβ(+) -thalassemia in resource poor setting. © 2014 Wiley Periodicals, Inc.

Therapeutic hemoglobin levels after gene transfer in β-thalassemia mice and in hematopoietic cells of β-thalassemia and sickle cells disease patients.

Directory of Open Access Journals (Sweden)

Laura Breda

Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these

The co-inheritance of alpha-thalassemia and sickle cell anemia is associated with better hematological indices and lower consultations rate in Cameroonian patients and could improve their survival.

Directory of Open Access Journals (Sweden)

Maryam Bibi Rumaney

Full Text Available BACKGROUND: Co-inheritance of α-thalassemia was reported to be associated with a delayed age of disease onset among Cameroonian Sickle Cell Anemia (SCA patients. The present study aimed to explore the correlation between α-thalassemia, hematological indices, and clinical events in these patients. METHODS AND FINDINGS: We studied 161 Cameroonian SCA patients and 103 controls (59.1% HbAA with median ages of 17.5 and 23 years. RFLP-PCR was used to confirm SCA genotype and to describe haplotypes in the HBB-like genes cluster. Multiplex Gap-PCR was performed to investigate the 3.7 kb α-globin gene deletions. SNaPshot PCR, capillary electrophoresis and cycle sequencing were used for the genotyping of 10 SNPs in BCL11A, HMIP1/2, OR51B5/6 and HBG loci, known to influence HbF levels. Generalised linear regression models adjusted for age, sex and SNPs genotypes was used to investigate effects of α-thalassemia on clinical and hematological indices. The median rate of vaso-occlusive painful crisis and hospitalisations was two and one per year, respectively. Stroke was reported in eight cases (7.4%. Benin haplotype was the most prevalent (66.3%; n = 208 chromosomes. Among patients, 37.3% (n = 60 had at least one 3.7 kb deletion, compared to 10.9% (n = 6 among HbAA controls (p<0.001. Among patients, the median RBC count increased with the number of 3.7 kb deletions [2.6, 3.0 and 3.4 million/dl, with no, one and two deletions (p = 0.01]. The median MCV decreased with the number of 3.7 kb deletion [86, 80, and 68fl, with no, one and two deletions (p<0.0001], as well as median WBC counts [13.2, 10.5 and 9.8×109/L (p<0.0001. The co-inheritance of α-thalassemia was associated with lower consultations rate (p = 0.038. CONCLUSION: The co-inheritance of α-thalassemia and SCA is associated with improved hematological indices, and lower consultations rate in this group of patients. This could possibly improve their survival and explain the

The Co-Inheritance of Alpha-Thalassemia and Sickle Cell Anemia Is Associated with Better Hematological Indices and Lower Consultations Rate in Cameroonian Patients and Could Improve Their Survival

Science.gov (United States)

Rumaney, Maryam Bibi; Ngo Bitoungui, Valentina Josiane; Vorster, Anna Alvera; Ramesar, Raj; Kengne, Andre Pascal; Ngogang, Jeanne; Wonkam, Ambroise

2014-01-01

Background Co-inheritance of α-thalassemia was reported to be associated with a delayed age of disease onset among Cameroonian Sickle Cell Anemia (SCA) patients. The present study aimed to explore the correlation between α-thalassemia, hematological indices, and clinical events in these patients. Methods and Findings We studied 161 Cameroonian SCA patients and 103 controls (59.1% HbAA) with median ages of 17.5 and 23 years. RFLP-PCR was used to confirm SCA genotype and to describe haplotypes in the HBB-like genes cluster. Multiplex Gap-PCR was performed to investigate the 3.7 kb α-globin gene deletions. SNaPshot PCR, capillary electrophoresis and cycle sequencing were used for the genotyping of 10 SNPs in BCL11A, HMIP1/2, OR51B5/6 and HBG loci, known to influence HbF levels. Generalised linear regression models adjusted for age, sex and SNPs genotypes was used to investigate effects of α-thalassemia on clinical and hematological indices. The median rate of vaso-occlusive painful crisis and hospitalisations was two and one per year, respectively. Stroke was reported in eight cases (7.4%). Benin haplotype was the most prevalent (66.3%; n = 208 chromosomes). Among patients, 37.3% (n = 60) had at least one 3.7 kb deletion, compared to 10.9% (n = 6) among HbAA controls (p<0.001). Among patients, the median RBC count increased with the number of 3.7 kb deletions [2.6, 3.0 and 3.4 million/dl, with no, one and two deletions (p = 0.01)]. The median MCV decreased with the number of 3.7 kb deletion [86, 80, and 68fl, with no, one and two deletions (p<0.0001)], as well as median WBC counts [13.2, 10.5 and 9.8×109/L (p<0.0001. The co-inheritance of α-thalassemia was associated with lower consultations rate (p = 0.038). Conclusion The co-inheritance of α-thalassemia and SCA is associated with improved hematological indices, and lower consultations rate in this group of patients. This could possibly improve their survival and explain the higher

Evaluation of cognition in children with beta-thalassemia major and healthy counterparts in terms of abstract thinking and visual organization

Directory of Open Access Journals (Sweden)

Samaneh Homayouni-Meymandi

2014-04-01

Conclusion: The results show the potential impact of the disease on children›s cognitive levels and suggest that children with beta-thalassemia major need more attention in the field of education to promote their understanding.

A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

Science.gov (United States)

Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

2018-01-01

Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

Current status and developments in gene therapy for thalassemia and sickle cell disease

Directory of Open Access Journals (Sweden)

Evangelia Yannaki

2014-12-01

Full Text Available β-thalassemias and sickle cell anemia (SCA are the most common monogenic diseases worldwide for which curative treatments remain a desired goal. Allogeneic hematopoietic stem cell transplantation (allo-HCT, - the only curative treatment currently available for hemoglobinopaties-, has a narrow application window whereas it incurs several immunological risks. Gene therapy (GT, that is the autologous transplantation of genetically modified hematopoietic stem cells (CD34+, represents a promising new therapeutic strategy which is anticipated to reestablish effective hemoglobin production and render patients transfusion- and drug- independent without the immunological complications that normally accompany allo-HCT. Prior to the application of GT for hemoglobinopathies in the clinic, many years of extensive preclinical research were spent for the optimization of the gene transfer tools and conditions. To date, three GT clinical trials for β-thalassemia and sickle cell disease (SCD have been conducted or are in progress and 3 cases of transfusion independence in thalassemic β0/βΕ patients have been reported. In the present review, the prerequisites for successful implementation of GT, the tough pathway of GT for hemoglobinopathies towards the clinic and the knowledge gained from the first clinical trials as well as the remaining questions and challenges, will be discussed. Overall, after decades of research including achievements but pitfalls as well, the path to GT of human patients with hemoglobinopathies is currently open and highly promising...

Serum Prohepcidin Levels in Children with Thalassemia Major and Intermedia

Directory of Open Access Journals (Sweden)

Celil Yılmaz

2017-04-01

Full Text Available Objective: To determine the role of hepcidin hormone levels in iron accumulation in patients with thalassemia major (TM and thalassemia intermedia (TI. Materials and Methods: Serum prohepcidin and ferritin levels were determined in 34 patient with TM, 10 patient with TI, who attended the Department of Pediatric Hematology Adnan Menderes University Medical Faculty and the Department of Pediatrics at Aydın Atatürk State Hospital between 1 September 2006 and 30 September 2007 and 40 control patients without infection/inflammation, hepatitis or liver failure. Serum prohepcidin levels were measured using a commercial enzyme-linked immunosorbent assay kit (DRG International, Inc. Marburg, Germany; ferritin was studied with chemiluminescence method (Immulite 2000 DPC. Results: Mean serum ferritin levels in TM, TI and control groups were 2347.97±1724.81 ng/mL (range: 144-8015 ng/mL, 1352.40±918.94 ng/mL (range: 311-3109 ng/mL, and 33.35±12.03 ng/mL (range: 20-69.1 ng/mL, respectively. Serum prohepcidin levels in the same groups were 221.78±74.38 ng/mL (range: 7l.14-446.57 ng/mL, 173.31±52.14 ng/mL (range: 100.83-267.69 ng/mL, and 218.20±50.37 ng/mL (range: 116.18-330.43 ng/mL, respectively. There was a statistically significant difference in prohepcidin levels between patients with TI and control group only (p=0.016. No correlation was found between prohepcidin and ferritin levels in all groups (r=-0.023, p=0.839. Conclusion: Low levels of prohepcidin in patients with TI may be related to increased erythropoietic activity. Prohepcidin can be an indicator of active erythropoiesis.

A brief review on newborn screening methods for hemoglobinopathies and preliminary results selecting beta thalassemia carriers at birth by quantitative estimation of the HbA fraction.

Science.gov (United States)

Mantikou, Eleni; Arkesteijn, Sandra G; Beckhoven van, Jaqueline M; Kerkhoffs, Jean-Louis; Harteveld, Cornelis L; Giordano, Piero Carlo

2009-12-01

We present in a brief summary the basic aspects of the most rational technologies used for new born screening (NBS) of the hemoglobinopathies and we report the preliminary results for the identification of beta-thalassemia carriers at birth by measuring the expression of the HbA fraction. Separation and measurement of the Hb fractions in 1.500 cord blood samples collected among the multi-ethnic Dutch population using different methods. By using a cut of thalassemia can be preselected at birth with a reasonable degree of sensitivity and be confirmed by parent analysis.

HB KURDISTAN [ALPHA-47(CE5)ASP-]TYR], A NEW ALPHA-CHAIN VARIANT IN COMBINATION WITH BETA-THALASSEMIA

NARCIS (Netherlands)

GIORDANO, PC; HARTEVELD, CL; STRENG, H; Oosterwijk, Jan; HEISTER, JGAM; AMONS, R; BERNINI, LF

1994-01-01

We have characterized the structural abnormality of a new alpha chain mutant found in a Kurdish; family. The clinical and hematological investigation of eight individuals have shown that the a variant is associated with a beta degrees-thalassemia mutation (nonsense codon 39). The tryptic peptide map

Current Standards of Care and Long Term Outcomes for Thalassemia and Sickle Cell Disease.

Science.gov (United States)

Chonat, Satheesh; Quinn, Charles T

2017-01-01

Thalassemia and sickle cell disease (SCD) are disorders of hemoglobin that affect millions of people worldwide. The carrier states for these diseases arose as common, balanced polymorphisms during human history because they afforded protection against severe forms of malaria. These complex, multisystem diseases are reviewed here with a focus on current standards of clinical management and recent research findings. The importance of a comprehensive, multidisciplinary and lifelong system of care is also emphasized.

Health-Related Quality of Life, Treatment Satisfaction, Adherence and Persistence in β-Thalassemia and Myelodysplastic Syndrome Patients with Iron Overload Receiving Deferasirox: Results from the EPIC Clinical Trial

Directory of Open Access Journals (Sweden)

John Porter

2012-01-01

Full Text Available Treatment of iron overload using deferoxamine (DFO is associated with significant deficits in patients' health-related quality of life (HRQOL and low treatment satisfaction. The current article presents patient-reported HRQOL, satisfaction, adherence, and persistence data from β-thalassemia (n=274 and myelodysplastic syndrome (MDS patients (n=168 patients participating in the Evaluation of Patients' Iron Chelation with Exjade (EPIC study (NCT00171821; a large-scale 1-year, phase IIIb study investigating the efficacy and safety of the once-daily oral iron chelator, deferasirox. HRQOL and satisfaction, adherence, and persistence to iron chelation therapy (ICT data were collected at baseline and end of study using the Medical Outcomes Short-Form 36-item Health Survey (SF-36v2 and the Satisfaction with ICT Questionnaire (SICT. Compared to age-matched norms, β-thalassemia and MDS patients reported lower SF-36 domain scores at baseline. Low levels of treatment satisfaction, adherence, and persistence were also observed. HRQOL improved following treatment with deferasirox, particularly among β-thalassemia patients. Furthermore, patients reported high levels of satisfaction with deferasirox at end of study and greater ICT adherence, and persistence. Findings suggest deferasirox improves HRQOL, treatment satisfaction, adherence, and persistence with ICT in β-thalassemia and MDS patients. Improving such outcomes is an important long-term goal for patients with iron overload.

Role of XmnIgG Polymorphism in Hydroxyurea Treatment and Fetal Hemoglobin Level at Isfahanian Intermediate β-Thalassemia Patients.

Science.gov (United States)

Motovali-Bashi, Majid; Ghasemi, Tayyebeh

2015-01-01

β-thalassemia is the most common monogenic disorder in human. The (C-->T) polymorphism at -158 upstream region of the γG-globin gene and pharmacological factors such as hydroxyurea have been reported to influence γ-globin gene expression and the severity of clinical symptoms of β-thalassemia. In the present study, 51 β-thalassemia intermediate patients were studied. Xmn1γG polymorphism genotype was determined using Tetra-Primer ARMS-PCR technique. Hemoglobin (Hb) and fetal hemoglobin (HbF) levels were determined by gel electrophoresis. Of 51 patients, 35 (68.6%) patients were heterozygous (CT) and 16 (31.4%) patients were homozygous (CC). Of 30 patients under treatment by hydroxyurea, 20 (66.7%) patients were heterozygous (CT) and 10 (33.3%) patients were homozygous (CC). Our results demonstrated that in the heterozygous (CT) genotype, the Hb (9.58 ± 1.25 gm/dl) and HbF (89.30 ± 21.87) levels were significantly higher in comparison with homozygous (CC) genotype (7.94 ± 1.34 gm/dl and 70.32 ± 40.56, respectively). Furthermore, we observed that after drug usage, the Hb and HbF levels in patients with heterozygous (CT) genotype (0.7 ± 1.26 gm/dl and 5.95 ± 14.8, respectively) raised more in comparison with homozygous (CC) genotype (0.26 ± 1.43 gm/dl and 0.8 ± 1.31, respectively). Hb and HbF levels in the patients carrying T allele are increased significantly, and they also response to hydroxyurea treatment.

Consequences and costs of noncompliance with iron chelation therapy in patients with transfusion-dependent thalassemia: a literature review.

Science.gov (United States)

Delea, Thomas E; Edelsberg, John; Sofrygin, Oleg; Thomas, Simu K; Baladi, Jean-Francois; Phatak, Pradyumna D; Coates, Thomas D

2007-10-01

Patients with thalassemia major require iron chelation therapy (ICT) to prevent complications from transfusional iron overload. Deferoxamine is effective, but requires administration as a slow continuous subcutaneous or intravenous infusion five to seven times per week. Deferiprone is a three-times-daily oral iron chelator, but has limited availability in the United States. Deferasirox is a once-daily oral iron chelator that was approved in the United States in 2005 for patients older than 2 years of age with transfusional iron overload. Published evidence on rates of compliance with ICT and the association between compliance, and the incidence and costs of complications of iron overload, in patients with thalassemia major was reviewed. A total of 18 studies were identified reporting data on compliance with ICT, including 7 that examined deferoxamine only, 6 that examined deferiprone only, and 5 that compared deferoxamine and deferiprone; no studies reporting compliance with deferasirox were identified. In studies of deferoxamine only, estimated mean compliance ranged from 59 to 78 percent. Studies of deferiprone generally reported better compliance, ranging from 79 to 98 percent. Results of comparative studies of deferoxamine and deferiprone suggest that compliance may be better with oral therapy. Numerous studies demonstrate that that poor compliance with ICT results in increased risk of cardiac disease and endocrinopathies, as well as lower survival. Although data on the costs of noncompliance are limited, a recent model-based study estimated the lifetime costs of inadequate compliance with deferoxamine to be $33,142. Inadequate compliance with ICT in thalassemia major is common and results in substantial morbidity and mortality, as well as increased costs.

Post Splenectomy Outcome in β-Thalassemia.

Science.gov (United States)

Merchant, Rashid H; Shah, Ami R; Ahmad, Javed; Karnik, Alka; Rai, Nooralam

2015-12-01

To evaluate changes in annual blood transfusion requirements and complications after splenectomy in patients with β-thalassemia. Forty post-splenectomy β-thalassemic patients aged 8-33 y, receiving regular blood transfusions and chelation therapy were included and non transfusion dependant patients were excluded from this retrospective cross-sectional study. Details about their surgery, transfusion requirements, and platelet levels were recorded on a standard proforma. All patients underwent a B-mode and color-coded duplex sonography of the hepatoportal system during the study period. The average ferritin level in the year prior to the study was 4432 mcg/L (range 480-12,200 mcg/L). The annual blood transfusion requirement in the first year and 5 y post splenectomy [mean ± SD (138.41 ± 90.38 ml/kg/y); (116 ± 41.44 ml/kg/y)] were significantly different from requirements before splenectomy [(mean ± SD) 294.85 ± 226 ml/kg/y; p value splenectomy with a mean rise of 4,51,000/mm(3) (p value splenectomy. Increase in annual blood transfusion requirement should be investigated to find the cause.

A presacral mass in a patient with thalassemia intermedia: A case report and review of the literature

Directory of Open Access Journals (Sweden)

Mohammad Hossein Anbardar

2016-01-01

Full Text Available Extramedullary hematopoiesis (EMH is defined as the production of the myeloid and erythroid elements outside the bone marrow. It is usually a compensatory mechanism of the myeloid and erythroid production due to increased breakdown or diminished production of erythrocytes. Presacral EMH is an extremely rare condition, and there is a limited number of case reports published in the literature. A 39-year-old female patient as a known case of thalassemia intermedia presented with lower abdominal pain. A computerized tomography scan showed a large presacral mass, associated with bone destruction. The patient was admitted for exploratory laparotomy with suspicion to malignant lesions, but the final pathological diagnosis was EMH. It should be considered in differential diagnosis of mass-like lesions in the presacral area in patients with predisposing factors such as thalassemia, although there were malignant features such as bone destruction in imaging studies. Preoperative diagnostic tools such as fine needle aspiration and biopsy could help us to render the definite diagnosis and prevent unnecessary operation.

Proxy indicators for identifying iron deficiency among anemic vegetarians in an area prevalent for thalassemia and hemoglobinopathies.

Science.gov (United States)

Wongprachum, Kasama; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Siridamrongvattana, Sirivara; Manpeun, Suwanna; Schlep, Frank P

2012-01-01

The study aimed to determine the proportion of iron deficiency (ID) anemia (IDA) among vegans in northeast Thailand and to explore whether mathematical formulas derived from red blood cell (RBC) indices are applicable for IDA screening in the study population. Blood samples from 234 individuals (age 6-45 years) living in a vegan community were taken. Complete blood cell count, serum ferritin, hemoglobin profiles and DNA analysis for α-thalassemia were determined. Anemia was defined using the WHO criteria adjusted for age and sex. Serum ferritin thalassemia and hemoglobinopathies was 56.4% (95% CI = 49.8-62.9%). Of the anemic participants, 45.4% had ID. Based on the receiver-operating characteristic curve analysis, 4 formulas were applicable for predicting ID among anemic individuals (highest sensitivity of 86.4%). The proposed formulas might be used as proxy indicators for the identification of ID among anemic children and adult vegans if more sophisticated laboratory determinations are not available due to limited financial resources. Copyright © 2012 S. Karger AG, Basel.

Improvements in the HbVar database of human hemoglobin variants and thalassemia mutations for population and sequence variation studies.

NARCIS (Netherlands)

G.P. Patrinos (George); B. Giardine (Belinda); C. Riemer (Cathy); W. Miller (Webb); D.H. Chui (David); N.P. Anagnou (Nicholas); H. Wajcman (Henri); R.C. Hardison (Ross)

2004-01-01

textabstractHbVar (http://globin.cse.psu.edu/globin/hbvar/) is a relational database developed by a multi-center academic effort to provide up-to-date and high quality information on the genomic sequence changes leading to hemoglobin variants and all types of thalassemia and

Sequential alternating deferiprone and deferoxamine treatment compared to deferiprone monotherapy: main findings and clinical follow-up of a large multicenter randomized clinical trial in -thalassemia major patients

DEFF Research Database (Denmark)

Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela

2011-01-01

In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...

Spinal cord compression secondary to extramedullary hematopoiesis: A rareness in a young adult with thalassemia major.

Science.gov (United States)

Fareed, Shehab; Soliman, Ashraf T; De Sanctis, Vincenzo; Kohla, Samah; Soliman, Dina; Khirfan, Diala; Tambuerello, Adriana; Talaat, Mohamed; Nashwan, Abdulqadir; Caparrotti, Palmira; Yassin, Mohamed A

2017-08-23

We report a case of a thalassemia major male patient with back pain associated to severe weakness in lower extremities resulting in the ability to ambulate only with assistance. An urgent magnetic resonance imaging (MRI) of  thoracic and lumbosacral spine was requested. A posterior intraspinal extradural mass lesion compressing the spinal cord at the level of thoracic T5-8 was present, suggesting an extramedullary hematopoietic centre, compressing the spinal cord. He was treated successfully with thalassemia major alone. The patient was treated with blood transfusion, dexamethasone, morphine and paracetamol, followed by radiotherapy in 10 fractions to the spine (daily fraction of 2Gy from T3 to T9, total dose 20 Gy). His pain and neurologic examination quickly improved. A new MRI of the spine, one week after radiotherapy, showed an improvement of the extramedullary hematopoietic mass compression. In conclusion, EMH should be considered in every patient with ineffective erythropoiesis and spinal cord symptoms. MRI is the most effective method of demonstrating EMH. The rapid recognition and treatment can dramatically alleviate symptoms. There is still considerable controversy regarding indications, benefits, and risks of each of modality of treatment due to the infrequency of this disorder.

Complications of Transfusion-Dependent β-Thalassemia Patients in Sistan and Baluchistan, South-East of Iran

Science.gov (United States)

Yaghobi, Maryam; Miri-Moghaddam, Ebrahim; Majid, Naderi; Bazi, Ali; Navidian, Ali; Kalkali, Asiyeh

2017-01-01

Background: Thalassemia syndromes are among prevalent hereditary disorders imposing high expenses on health-care system worldwide and in Iran. Organ failure represents a life-threatening challenge in transfusion- dependent β-thalassemia (TDT) patients. The purpose of the present study was to determine the frequency of organ dysfunctions among TDT patients in Sistan and Baluchistan province in South-East of Iran. Materials and Methods: Laboratory and clinical data were extracted from medical records as well as by interviews. Standard criteria were applied to recognize cardiac, gonadal, endocrine and renal dysfunctions. The collected data were analyzed using the SPSS statistics software (Ver.19). Results: A total of 613 TDT patients (54.3% males and 45.7% females) were included in this study. The mean age of patients was 13.3 ±7.7 years old. Cardiac events comprised the most encountered complications (76.4%), following by hypogonadism (46.8%), parathyroid dysfunction (22%), thyroid abnormalities (8.3%), diabetes (7.8%) and renal disease (1.8%). Hypogonadism comprised the most identified complication in patient 15 years old (P<0.01). Conclusion: As cardiac events are significantly more common among TDT patients, close monitoring of the heart function is recommended for identifying patients with cardiac problems. PMID:29340121

Evaluation of staff performance and interpretation of the screening program for prevention of thalassemia.

Science.gov (United States)

Prommetta, Simaporn; Sanchaisuriya, Kanokwan; Fucharoen, Goonnapa; Yamsri, Supawadee; Chaiboonroeng, Attawut; Fucharoen, Supan

2017-06-15

Thalassemia screening program has been implemented for years in Southeast Asia, but no external quality assessment program has been established. We have developed and initiated the proficiency testing (PT) program for the first time in Thailand with the aim to assess the screening performance of laboratory staff and their competency in interpretation of the screening results. Three PT cycles per year were organized. From the first to the third cycle of the PT scheme, a total number of participant laboratories increased from 59 to 67. In each cycle, 2 PT items (assigned as blood samples of the couple) were provided. Performance evaluation was based on the accuracy of screening results, i.e . mean corpuscular volume (MCV), mean corpuscular haemoglobin (MCH) and the dichlorophenolindophenol (DCIP) test for haemoglobin E, including the competency in interpretation of screening results and assessment of foetal risk. Performance was assessed by comparing the participants' result against the assigned value. Of all 3 cycles, most laboratories reported acceptable MCV and MCH values. From the first to the third cycle, incorrect DCIP test and misinterpretation rates were decreased while incorrect risk assessment varied by cycle to cycle. Combining the accuracy of thalassemia screening and the competency in interpretation and risk assessment, approximately half of participants showed excellent performance. Improved performance observed in many laboratories reflects the achievement and benefit of the PT program which should be regularly provided.

MR imaging of deferoxamine-induced bone dysplasia in an 8-year-old female with thalassemia major

International Nuclear Information System (INIS)

Miller, T.T.; Caldwell, G.; Kaye, J.J.; Arkin, S.; Burke, S.; Brill, P.W.

1993-01-01

Bone changes in thalassemic patients receiving deferoxamine therapy for iron chelation include metaphyseal and growth plate irregularities. We present a case of an 8-year-old female with thalassemia major, who had magnetic resonance imaging after plain radiographs had shown metaphyseal changes in the distal femur. The signal characteristics of these abnormalities were consistent with hyaline cartilage; the surrounding marrow showed no evidence of iron overrload. (orig.)

MR imaging of deferoxamine-induced bone dysplasia in an 8-year-old female with thalassemia major

Energy Technology Data Exchange (ETDEWEB)

Miller, T.T. (Dept. of Radiology and Nuclear Medicine, Hospital for Special Surgery, New York, NY (United States)); Caldwell, G. (Dept. of Orthopedic Surgery, Hospital for Special Surgery, New York, NY (United States)); Kaye, J.J. (Dept. of Radiology and Nuclear Medicine, Hospital for Special Surgery, New York, NY (United States)); Arkin, S. (Dept. of Pediatrics, Mount Sinai Medical Center, New York, NY (United States)); Burke, S. (Dept. of Orthopedic Surgery, Hospital for Special Surgery, New York, NY (United States)); Brill, P.W. (Dept. of Radiolgy, New York Hospital, Cornell Univ. Medical Center, New York, NY (United States))

1993-11-01

Bone changes in thalassemic patients receiving deferoxamine therapy for iron chelation include metaphyseal and growth plate irregularities. We present a case of an 8-year-old female with thalassemia major, who had magnetic resonance imaging after plain radiographs had shown metaphyseal changes in the distal femur. The signal characteristics of these abnormalities were consistent with hyaline cartilage; the surrounding marrow showed no evidence of iron overrload. (orig.)

Splenic uptake of both technetium-99m diphosphonate and technetium-99m sulfur colloid in sickle cell beta degrees thalassemia

International Nuclear Information System (INIS)

Heck, L.L.; Brittin, G.M.

1989-01-01

A 19-year-old black woman with sickle cell beta degrees thalassemia had experienced more than 100 hospital admissions for sickle cell crisis and aseptic necrosis of both femoral heads. Her spleen was enlarged threefold and accumulated both radiocolloid and bone-seeking agent on two occasions, demonstrating an exception to the rule in sickle cell anemia that spleens that take up bone-seeking agents demonstrate functional asplenia. In the context of fever, left upper quadrant pain, and splenomegaly, the pattern of calcification in the patient's spleen as revealed in ultrasound and CT studies suggested possible abscess and led to unnecessary splenectomy. The nuclear medicine studies did not support this diagnosis. Nuclear medicine physicians should not be misled by splenic findings of sickle cell thalassemia (and possibly of other heterozygous sickle cell disorders) that differ from those of the more familiar homozygous sickle cell anemia

Visualization of the liver with sup(99m)Tc-EHDP in thalassemia major

International Nuclear Information System (INIS)

Valdez, V.A.; Jacobstein, J.G.

1981-01-01

A case is reported in which substantial liver uptake of sup(99m)Tc-hydroxyethylidene diphosphonate sup(99m)Tc-EHDP) was seen on bone scan. The patient, a 25-year-old male with the diagnosis of thalassemia major made at the age of 3 years, had received regular blood transfusions over many years. Clinical and laboratory evidence of hemosiderosis suggests that the presence of large quantities of iron in the liver of this patient may have been responsible for the hepatic uptake of the bone scanning agent. (orig.)

Moessbauer studies of blood diseases: thalassemia and malaria

International Nuclear Information System (INIS)

Bauminger, E.R.

1988-01-01

In 57 F Moessbauer studies of blood samples obtained from patients with thalassemia large amounts of iron, yielding a well defined spectrum, different from that obtained in oxy - or deoxy-hemoglobin, were found. The additional iron component was identified as due to ferritin - the iron storage protein. The amounts of ferritin-like iron were comparable to those of hemoglobin iron and were especially large in reticulocytes. Desferral was found to remove ferritin-like iron from serum, but not from red blood cells. In malaria, a parasite induced blood disease, the iron containing compound in the malarial pigment in rats infected by Plasmodium berghei was found to be trivalent high spin, different from any known iron porphyrin, yet was found to be similar to hemin in human blood cells infected by P. falciparum. The difference in the spectra obtained in RBC infected with drug sensitive and drug resistance strains and the effect of medication on the spectra is discussed. (author)

Detection of Hb Constant Spring (HBA2: c.427T>C) Heterozygotes in Combination with β-Thalassemia or Hb E Trait by Capillary Electrophoresis.

Science.gov (United States)

Pornprasert, Sakorn; Saoboontan, Supansa; Punyamung, Manoo

2015-01-01

Hb Constant Spring (Hb CS; HBA2: c.427T>C) is often missed by routine laboratory testing as its mRNA as well as gene product are unstable and presented at a low level in peripheral blood. This study aimed to analyze the efficacy of capillary electrophoresis (CE) for detecting and quantifying of Hb CS in β-thalassemia (β-thal) trait or Hb E (HBB: c.79G>A) trait samples with reduced β-globin chain expression. Thalassemia diagnostic data were reviewed in 2524 blood samples that were submitted to the laboratory of the Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand for hemoglobinopathy and thalassemia diagnosis. DNA analysis for Hb CS was performed in 322 β-thal trait and 397 Hb E trait samples using the amplification refractory mutation system (ARMS). The CE electropherogram of Hb CS at zone 2 was observed in all five samples with β-thal trait and nine samples with Hb E trait with levels varying from 0.1-2.8 and 0.1-2.3%, respectively. Thus, the CE method proved useful for screening of Hb CS in samples with β-thal trait or Hb E trait, which is essential for providing accurate diagnosis, genetic counseling, prevention and control programs of Hb H-CS disease.

A Family with γ-Thalassemia and High Hb A2 Levels.

Science.gov (United States)

Parmeggiani, Giulia; Gualandi, Francesca; Selvatici, Rita; Rimessi, Paola; Bigoni, Stefania; Taddei Masieri, Marina; Dolcini, Bernadetta; Venturoli, Anna; Cappabianca, Maria P; Ferlini, Alessandra; Ravani, Anna

2016-06-01

We describe a family carrying a γ-globin gene deletion associated with an increase of Hb A2 level beyond the normal range. The family included the proband, his sister and their father, all with increased Hb A2 and normal Hb F levels. The proband and his sister showed borderline values of mean corpuscular volume (MCV) and reduced values of mean corpuscular hemoglobin (Hb) (MCH). The proband was referred to our Medical Genetics Service for preconception counseling together with his partner, a typical β-thalassemia (β-thal) carrier. The results were negative for the most frequent α-thalassemia (α-thal) mutations, and had no significant sequence variations of the coding sequences and promoter of the β- and δ-globin genes. Quantitative analysis by multiplex ligation-dependent probe amplification (MPLA) of the β-globin gene cluster detected a heterozygous deletion, ranging between 2.1 and 4.7 kb, in the proband, his sister and the father. The deletion involved the (G)γ gene and (G)γ-(A)γ intergenic region, whereas the 3' region of the (A)γ gene was preserved. A subsequent gap-polymerase chain reaction (gap-PCR) showed that a hybrid (GA)γ fusion gene was present. The deletion segregated with the elevation of Hb A2. The MLPA analysis of the β-globin gene cluster in 150 control alleles excluded a common polymorphism. Despite stronger evidence being needed, the described family suggests a possible role of this γ-globin gene deletion in contributing to Hb A2 elevation, possibly by altering the transcription regulation of the cluster. We propose γ-globin gene dosage analysis to be performed in patients with unexplained elevated Hb A2 levels.

Iron chelation therapy in thalassemia major: a systematic review with meta-analyses of 1520 patients included on randomized clinical trials

DEFF Research Database (Denmark)

Maggio, Aurelio; Filosa, Aldo; Vitrano, Angela

2011-01-01

The effectiveness of deferoxamine (DFO), deferiprone (DFP), or deferasirox (DFX) in thalassemia major was assessed. Outcomes were reported as means±SD, mean differences with 95% CI, or standardized mean differences. Statistical heterogeneity was tested using χ2 (Q) and I2. Sources of bias...

CARDIAC FUNCTION AND IRON CHELATION IN THALASSEMIA MAJOR AND INTERMEDIA: A REVIEW OF THE UNDERLYING PATHOPHYSIOLOGY AND APPROACH TO CHELATION MANAGEMENT

Directory of Open Access Journals (Sweden)

Athanasios Aessopos

2009-07-01

Full Text Available Heart disease is the leading cause of mortality and one of the main causes of morbidity in beta-thalassemia. Patients with homozygous thalassemia may have either a severe phenotype which is usually transfusion dependent or a milder form that is thalassemia intermedia.  The two main factors that determine cardiac disease in homozygous β thalassemia are the high output state that results from chronic tissue hypoxia, hypoxia-induced compensatory reactions and iron overload.  The high output state playing a major role in thalassaemia intermedia and the iron load being more significant in the major form. Arrhythmias, vascular involvement that leads to an increased pulmonary vascular resistance and an increased systemic vascular stiffness and valvular abnormalities also contribute to the cardiac dysfunction in varying degrees according to the severity of the phenotype.  Endocrine abnormalities, infections, renal function and medications can also play a role in the overall cardiac function.  For thalassaemia major, regular and adequate blood transfusions and iron chelation therapy are the mainstays of management. The approach to thalassaemia intermedia, today, is aimed at monitoring for complications and initiating, timely, regular transfusions and/or iron chelation therapy.  Once the patients are on transfusions, then they should be managed in the same way as the thalassaemia major patients.  If cardiac manifestations of dysfunction are present in either form of thalassaemia, high pre transfusion Hb levels need to be maintained in order to reduce cardiac output and appropriate intensive chelation therapy needs to be instituted.  In general recommendations on chelation, today, are usually made according to the Cardiac Magnetic Resonance findings, if available.  With the advances in the latter technology and the ability to tailor chelation therapy according to the MRI findings as well as the availability of three iron chelators, together with

Non-Transfusion-Dependent Thalassemia: An Update on Complications and Management

Directory of Open Access Journals (Sweden)

Joseph Sleiman

2018-01-01

Full Text Available Patients with non-transfusion-dependent thalassemia (NTDT experience many clinical complications despite their independence from frequent transfusions. Morbidities in NTDT stem from the interaction of multiple pathophysiological factors: ineffective erythropoiesis, iron overload (IOL, and hypercoagulability. Ineffective erythropoiesis and hemolysis are associated with chronic hypoxia and a hypercoagulable state. The latter are linked to a high prevalence of thromboembolic and cerebrovascular events, as well as leg ulcers and pulmonary hypertension. IOL in NTDT patients is a cumulative process that can lead to several iron-related morbidities in the liver (liver fibrosis, kidneys, endocrine glands (endocrinopathies, and vascular system (vascular disease. This review sheds light on the pathophysiology underlying morbidities associated with NTDT and summarizes the mainstays of treatment and some of the possible future therapeutic interventions.

Limb defects in homozygous {alpha}-thalassemia: Report of three cases

Energy Technology Data Exchange (ETDEWEB)

Chitayat, D.; Thomas, M.; Silver, M.M. [Univ. of Toronto, Ontario (Canada)] [and others

1997-01-20

Homozygosity for the South-Asian {alpha}-thalassemia (--{sup SEA}/) deletion is a serious hematological condition that results, in most cases, in intrauterine or postnatal death due to anemia and severe hypoxia of prenatal onset. A relationship between congenital abnormalities and intrauterine hypoxia has been postulated. However, since homozygosity for the (--{sup SEA}/) deletion is most common in underdeveloped countries where detailed autopsies are lacking, the incidence of congenital abnormalities among these babies has not been well delineated. We report on three newborn infants, homozygous for the (--{sup SEA}/) deletion, who were born with limb defects. We postulate that this combination is the result of prenatal hypoxia which may affect other fetal body organs. This should be taken into consideration when prenatal treatment of affected fetuses, with intrauterine blood transfusion, is suggested. 47 refs., 3 figs.

2,3,7,8-tetrachlorodibenzo-p-dioxin decrease expression of aryl hydrocarbon receptor in peripheral lymphocyte of β-thalassemia major patients.

Science.gov (United States)

Ghatrehsamani, Mahdi; Soleimani, Masoud; Esfahani, Behjat Al-Sadat Moayedi; Hakemi, Mazdak Ganjalikhani; Shirzad, Hedayatollah; Eskandari, Nahid; Adib, Minoo

2015-01-01

β-thalassemia major is a hereditary disease with inefficient erythropoiesis. Level of inflammatory cytokine is elevated in these patients. In this study, we investigate the effect of aryl hydrocarbon receptor (AhR) ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), on the expression of inflammatory mediators in β-thalassemia major patient's lymphocytes. Peripheral blood mononuclear cells of patients and healthy participants was isolated and cultured in favor of lymphocytes increment. Based on the treatment, we divided the cell into four groups. The orders of group's treatments were no treatment, tumor necrosis factor-α (TNF-α) treatment, TNF-α and TCDD treatment, TCDD treatment in Group 1-4, respectively. After cell culture, we extracted the cells RNA and converted them to cDNA. Real-time polymerase chain reaction was performed to assessment relative expression of caspase-1, NLRP3, and AhR. We compared all patient groups with equal healthy (control) groups. Results showed that expression of caspase-1 in patients (Groups 1 and 2) was significantly lower than healthy individuals (P 0.05). Expression of AhR in other groups of patients (3 and 4) was significantly lower than control groups (P < 0.05). Expression of caspase-1 in Group 4 was significantly larger than the control group (P < 0.001). We show here that chronic inflammation decrease caspase-1 expression and exposure of human lymphocytes to TCDD promote caspase-1 expression. Furthermore, activation of AhR with TCDD decreases AhR expression in lymphocytes of β-thalassemia major disease.

β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.

Science.gov (United States)

Patel, Ashwin P; Patel, Rupesh B; Patel, Saumyaa A; Vaniawala, Salil N; Patel, Dipika S; Shrivastava, Naina S; Sharma, Narmadeshwar P; Zala, Jayendrasinh V; Parmar, Prakash H; Naik, Madhuben R

2014-01-01

Prenatal diagnosis (PND) is one of the most cost effective preventive methods, but it is available only in the large cities of India. Therefore, we initiated a program that offers PND and allows us to determine the prevalence of various mutations. Pregnant females (n = 111,426) were screened for hemoglobinopathies using complete blood count (CBC) and high performance liquid chromatography (HPLC). If the female had a hemoglobinopathy, her husband was then tested. If hemoglobinopathies were seen in both partners, a genetic mutation study was performed on the couple. Fetal samples were obtained by either chorionic villus sampling (CVS) in 70.6% or amniocentesis in 29.4%. The study included 282 couples. IVS-I-5 (G > C) was the most common mutation in all castes except in the Sindhis and Lohanas, where the 619 bp deletion was the most common. Prenatal testing was informative in 97.9% of the couples. A significant number of couples (41.0%) underwent PND during their first pregnancy. Seven patients with β-thalassemia (β-thal) trait had normal Hb A2 levels. The Hb A2 and Hb F values varied significantly (p  T or G > A), were present in 81.0% of the couples tested. β-Thalassemia mutation frequency varied among the different castes, underlining the need for evolving a testing strategy that considers the caste system. Targeting antenatal clinics could also prove to be a most cost effective way of preventing hemoglobinopathies.

The effect of some medical treatments of Thalassemia on the red blood cells

International Nuclear Information System (INIS)

Zhang Xiufang; Shen Linming; Bao Hongxia; Din Xiaolan; Wang Rongxin; Huang Youwen; Liu Yuanyuan; Gao Naifei

1992-01-01

The Moessbauer spectroscopy (MS) and circular dichroism (CD) measurements have been used to investigate the effect of some medical treatments on the red blood cells (RBCs) of the patients with HbH disease and β-thalassemia (Thal.) major, respectively. The results indicate that both splenectomy and treatment with myleran are effective to alleviate the symptoms of anemia for some patients, but both of them are different in the effect on the RBCs of the patients. On the basis of the results, a hypothesis on the course of denaturation in hemoglobin (Hb) of the patients is proposed. (orig.)

Pulsed and Tissue Doppler Echocardiographic Changes in Patients with Thalassemia Major

Directory of Open Access Journals (Sweden)

Taysir S. Garadah

2010-01-01

Full Text Available Background Doppler echocardiographic studies of left ventricle (LV systolic and diastolic function in patients with β-Thalassemia Major (β-TM had shown different patterns of systolic and diastolic dysfunction. Aim This cross-sectional study was designed to study the LV systolic and diastolic function in patients with β-TM using Pulsed Doppler (PD and Tissue Doppler (TD echocardiography. Methods All patients were evaluated clinically and by echocardiography, The study included patients with β-TM (n = 38, age 15.7 ± 8.9 years compared with an age-matched control group (n = 38, age 15.9 ± 8.9 years. The pulse Doppler indices were normalized for age and heart rate. Results Compared with control patients, M-Mode showed that patients with β-TM have thicker LV septal wall index (0.659 ± 0.23 vs. 0.446 ± 0.219 cm, P ≤ 0.001, posterior wall index (0.659 ± 0.235 vs. 0.437 ± 0.214 cm, P ≤ 0.01, and larger LVEDD index is (3.99 ± 0.48 vs. 2.170 ± 0.57 mm. P = 0.035. Pulsed Doppler showed high LV trans-mitral E wave velocity (70.818 ± 10.139 vs. 57.532 ± 10.139, p = 0.027 and E/A ratio (1.54 vs. 1.23, P ≤ 0.01. The duration of Deceleration time (DT and isovolumic relaxation time (IVRT were significantly shorter in patients with β-TM (150.234 ± 20.0.23 vs. 167.123 ± 19.143 msec, P ≤ 0.01 and (60.647 ± 6.77 vs. 75.474 ± 5.83 msec, P ≤ 0.001, respectively. The ratio of transmitral E wave velocity to the tissue Doppler E wave at the basal septal mitral annulus E/Em – was significantly higher in β-TM group (14.024 ± 2.29 vs. 12.132 ± 1.82, P ≤ 0.01. The Tissue Doppler systolic velocity (Sm and the early diastolic velocity (Em were significantly lower in β-TM group compared to control (4.31 ± 1.2 cm/s vs. 6.95 ± 2.1, P ≤ 0.01 and 4.31 ± 2.7 cm/s vs. 5.82 ± 2.5, P ≤ 0.01 respectively. The tricuspid valve velocity was significantly higher than controls (2.993 ± 0.569 vs. 1.93 ± 0.471 m/sec, respectively, P ≤ 0

Neonatal screening for sickle cell disease, Glucose-6-PhosphateDehydrogenase deficiency and Alpha-Thalassemia in Qatif and Al-Hasa

International Nuclear Information System (INIS)

Nasserullah, Z.; Srair, Hussain Abu; Al-Jame, A.; Mokhtar, M.; Al-Qatari, G.; Al-Naim, S.; Al-Aqib, A.

1998-01-01

Screening programs to determine the frequency of sickle cell,glucose-6-phosphate dehydrogenase deficiency and alpha-thalassemia gene areavailable in Saudi Arabia, although not used frequently. Greater use of theseprograms will decrease the morbidity and mortality of Saudi children affectedby these disorders. Neonatal hemoglobin electrophoresis andglucose-6-dehydrogenase fluorescent spot tests were performed on new bornbabies delivered between December 1992 and December 1993 at the Qatif CentralHospital and at the King Fahd Hospital in Al-Hasa. Cord blood samples werecollected from babies born in these two hospitals. Babies born in otherhospitals had blood collected in their first visit to Qatif primary carecenters at the time of vaccination. All specimens were sent to Dammam CentralLaboratory. The diagnosis of sickle cell and alpha-thalassemia was based oncellulose acetate electrophoresis and confirmed by agar gel electrophoresisand glucose-6-phosphate dehydrgenase was confirmed by fluorescent spot test.A total of 12,220 infants, including 11,313 Saudis (92.6%), were screenedover a 12-month period. The common phenotype detected in these infantsincluded AF, SFA, SFA Bart's, FS and FS Bart's. In Saudi infants, homozygoussickle cell disease was detected in 2.35% and 1.08% in Qatif and Al-Hasa,respectively. The frequencies of sickle cell gene were 0.1545% and 0.1109% inQatif and Al-Hasa. Alpha-thalassemia genes based on an elevated level of HbBart's were 28% and 16.3% in Qatif and Al-Hasa. The screening for G6PDdeficiency revealed a high prevalence of 30.6% and 14.7% in Qatif andAl-Hasa. In the non-Saudi infants the frequencies were low. The outcome ofthis study indicates that the Saudi populations in Qatif and Al-Hasa are atrisk for hemoglobinopathies and G6PD. Neonatal screening programs areessential and cost effective and should be maintained as a routine practice.(author)

The prevalence and characterization of β-thalassemia trait by using high-performance liquid chromatography among the rural population in West Bengal, India

Directory of Open Access Journals (Sweden)

Suman K. Maji

2014-04-01

Full Text Available Hemoglobinopathies, common genetic disorders of hemoglobin, can be prevented by population screening and genetic counseling. Identification of these disorders is immensely important epidemiologically and aid in prevention of more serious hemoglobin disorders. Thalassemia is the commonest monogenic disorder in India, which belongs to the thalassemia belt of the world. The present study was undertaken to find out the characteristics of β-thalassemia trait and spectrum of this disorder among the rural population, screened under the hospital-based screening program in West Bengal, a state in eastern part of India. This study was carried out in school and college students, newly married couples and pregnant women after proper counseling in the rural areas of five southern districts of this state. Blood samples were tested by high-performance liquid chromatography. Total 1429 β-thalassemia traits were detected by random screening from this population. The mean value of HbA2 of the study population, having β-thalassemia trait is 4.9%. The prevalence (10.5% of β-thalassemia trait in West Bengal is higher than other parts of the country. These data are likely to help us in future planning for screening programmes in rural areas of West Bengal, India.  血红蛋白病——常见的血红蛋白遗传疾病，是可以通过人口筛查和遗传咨询的方法来预防的。鉴定此种疾病，对于其传播性及预防其导致的更加严重的血红蛋白疾患有非常重大的意义。印度所处世界地中海贫血带，地中海贫血在印度是最常见的单基因疾病。本研究的目的是通过医院筛查程序来研究印度西孟买邦农村人口有关β-地中海贫血症频谱和特征。该研究在印度南部的五个农村地区进行，研究对象是接受过相关咨询后的在校生，大学生，新婚夫妇和孕妇。血液样本通过高效液相色谱法检测。总计1429�

Neurotic manifestations in adolescents with thalassemia major.

Science.gov (United States)

Moorjani, J D; Issac, Chithira

2006-07-01

To study the neurotic manifestations in thalassemic adolescents as a consequence of long-term illness. From July 2003, thirty six thalassemic adolescents and forty normal adolescents were selected with age ranging from 13 to 18 and with same socio economic status and family background. Middlesex Hospital Questionnaire by Crown and Crisp [1966] was administered and Mann Whiteny 'U' test was employed to measure free-floating anxiety, phobia, somatic anxiety, obsession, depression, hysteria and total neuroticism score. An interview was conducted along with the questionnaire to detect the problems in depth. Parents of thalassemic adolescents were interviewed subsequently to realize the behavioral problems existing along with neuroticism. Thirty-six of thalassemic and all forty normal adolescents returned the questionnaires. The responses suggest a marked difference in total neuroticism score and all other variables except that of hysteria. The interview on parents of thalassemic adolescents exposed various behavioral problems in these adolescents. Thalassemic adolescents were having higher scores in neuroticism. Some behavioral problems are also found to exist along with neurotic manifestations. There remains a need to improve the management of thalassemia in terms of psychological aspects in order to improve the mental health of this group.

The relationship between heart and liver iron in thalassemia: a quantitative analysis using MRI

International Nuclear Information System (INIS)

Peng Peng; Huang Zhongkui; Long Liliang; Long Mei; Zhao Fanyu; Li Chunyan; Li Wenmei

2012-01-01

Objective: To quantify the heart and liver iron overload in thalassemia patients and discuss the relationship of iron deposition between them, and to evaluate the accuracy of using hepatic iron concentration > 15 mg/g dry tissue as an index to predict heart iron deposition as used in clinical practice. Methods: One hundred and three transfusion-dependent patients with thalassemia, who were older than 5 years, underwent MRI heart and liver measurement to obtain T 2 * values. The Spearman rank correlation was employed to analyze the relationship between cardiac T 2 * and liver T 2 * values. By using liver T 2 * =0.96 ms as standard setting, patients were divided into two groups, and the differences of cardiac T 2 * values between the two groups were compared by Wilcoxon rank sum test. Then by using cardiac T 2 * =10, 20 ms as standard setting, patients were divided into 3 groups, and the differences of liver T 2 * values among the 3 groups were compared by Wilcoxon rank sum test. The ROC curves were drawn to predict the possibility of using hepatic iron concentration > 15 mg/g dry tissue as an index of cardiac iron deposition. Results: The cardiac and liver T 2 * values of the 103 thalassemia patients showed low correlation (r=0.453, P=0.000). With the liver T 2 * value reduced, the cardiac T 2 * value did not decline proportionally. The cardiac T 2 * value range and median of 25 patients' group whose liver T 2 * < 0.96 ms were 4.70 to 41.70 ms and 12.10 ms, respectively. The cardiac T 2 * value range and the median of 78 patients' group whose liver T 2 * > 0.96 ms were 4.80 to 51.10 ms and 26.10 ms, respectively. There was statistically significant difference between those of the two groups (Z=-3.566, P=0.000). The liver T 2 * value range and the median of 20 patients' group whose cardiac T 2 * < 10 ms was 0.68 to 3.83 ms and 1.06 ms, respectively. The liver T 2 * value range and the median of 58 patients' group whose cardiac T 2 * ≥20 ms were

Variability in State-Based Recommendations for Management of Alpha Thalassemia Trait and Silent Carrier Detected on the Newborn Screen.

Science.gov (United States)

Fogel, Benjamin N; Nguyen, Hong Loan T; Smink, Gayle; Sekhar, Deepa L

2018-04-01

We conducted an inventory of state-based recommendations for follow-up of alpha thalassemia silent carrier and trait identified on newborn screen. We found wide variability in the nature and timing of these recommendations. We recommend a standardized recommendation to guide pediatricians in evidenced-based care for this population. Copyright © 2017 Elsevier Inc. All rights reserved.

Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

Science.gov (United States)

Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

2016-06-15

This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

Colloid clearance rate changes in children with homozygous-β-thalassemia in relation to blood transfusion

International Nuclear Information System (INIS)

Dimitriou, P.A.; Karpathios, T.E.; Antipas, S.E.; Fretzayias, A.M.; Kasfiki, A.G.; Melissinos, K.G.; Matsaniotis, N.S.

1980-01-01

The plasma clearance rate of heat denatured human serum albumin (DHAI-125, 5 mg/kg body weight) was studied in 20 children with homozygous-β-thalassemia before and 7-10 days after blood transfusion. A significant increase of the DHAI-125 clearance rate (P < 0.02) was found 7-10 days after blood transfusion while the spleen presented its minimum size. This finding may be relevant to the improved intrasplenic blood circulation after blood transfusion due to the release of the blood trapped within the spleen. (orig.)

Oral Health and Dentofacial Anomalies among β-THALASSEMIA Major in Erbil City, Iraq

Science.gov (United States)

Saeed, Lamya M.; Majeed, Vian O.

2010-04-01

Thalassemias are a heterogeneous group of genetic disorders characterized by hypochromic microcytic anemia that caused by deficient synthesis of one or more of globin subunits of human hemoglobin. This study has been conducted in the Northern part of Iraq among 238 subjects having β-thalassemia major (BTM). To evaluate their oral health status, dentofacial anomalies of patients who attended the Thalassemic center in Erbil city, were compared to 258 subjects of a control group according to the criteria suggested by the WHO in 1997, which is used to assess permanent teeth. Only 8.51% of the total study group demonstrated crowding of anterior teeth in one or both segments compared to the control group. Spacing in the incisal segments was higher, namely 19.23% in BTM compared to13.6% in the control group with a statistically significant difference (p<0.05). A higher percentage of both study and control groups were having an overbite grade (0.3-5.0 mm) of 49.59%, and 56.81%, respectively. It was found that the distal deviation from the normal anteroposterior molar relation in BTM was higher compared to the control group. Nearly similar percentages of patients were found to have an over jet grade(0.0-3.5 mm). Values of plaque and gingival health indices were recorded to be higher among the study group (plaque index = 1.570, ∓0.321 and gingival index = 1.205, ∓0.308). Differences were statistically highly significant for all indices (p<0.01). This may indicate that there is a negative attitude and poor dental knowledge of thalassemic subjects and their parents toward proper oral hygiene and dental health.