High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

Science.gov (United States)

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

Energy Technology Data Exchange (ETDEWEB)

Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others

1994-09-01

A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

NARCIS (Netherlands)

E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

1983-01-01

textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

Science.gov (United States)

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

Science.gov (United States)

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Renal tubular dysfunction nephrocalcinosis in a patient with BetaThalassemia Minor

International Nuclear Information System (INIS)

Prabahar, M.R.; Jain, M.; Chandrasekaran, V.; Indumathi, E.; Soundrarajan, P.

2008-01-01

Thalassemia is a hereditary anemia resulting from defect in hemoglobinproduction. Beta thalassemia is due to impaired production. Beta thalassemiais due to impaired production of beta globin chains, leading to a relativeexcess of alpha globin chains. The term beta thalassemia minor is used todescribe heterozygotes, who carry one normal beta globin and one betathalassemic allele. The vast majority of these patients are asymptomatic.However, a variety of renal tubular abnormalities including hypercaliuria,hypomagnesemia with renal magnesium wasting, decreased tubular absorption ofphosphorous, hypouricemia with renal uric acid wasting, renal glycosuria andtubular proteinuria have been described even in patients with betathalassemia minor. We here in report a 24-year old patient who was found tohave thalassemia minor and nephrocalcinosis with evidence of renal tubulardysfunction. Investigations revealed normal renal function, hypercalciuria,reduced tubular reabsorption of phosphorous, hypomagnesemia and renalmagnesium wasting. Screening for aminoaciduria was found to be negative. Anacid loading test revealed normal urinary acidification. Ultrasonogram of theabdomen revealed nephrocalcinosis and splenomegaly. Detailed work up foranemia showed normal white cell and platelet count while peripheral smearshowed microcytic hypochromic anemia with few target cells. Hemoglobinelectrophoresis revealed hemoglobin A of 92%, hemoglobin A2 of 6.2% andhemoglobin F of 1.8% consistent with beta thalassemia minor. Her parentalscreening was normal. A diagnosis of beta thalassemia minor with renaltubular dysfunction was made and the patient was started on thiazidediuretics to reduce hypercalciuria and advised regular follow-up. (author)

Deletion of a region that is a candidate for the difference between the deletion forms of hereditary persistence of fetal hemoglobin and deltabeta-thalassemia affects beta- but not gamma-globin gene expression.

NARCIS (Netherlands)

R. Calzolari (Roberta); T. McMorrow (Tara); N. Yannoutsos (Nikos); A. Langeveld (An); F.G. Grosveld (Frank)

1999-01-01

textabstractThe analysis of a number of cases of beta-globin thalassemia and hereditary persistence of fetal hemoglobin (HPFH) due to large deletions in the beta-globin locus has led to the identification of several DNA elements that have been implicated in the switch

Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

Directory of Open Access Journals (Sweden)

Najmaddin Saki

2013-09-01

Full Text Available Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was performed on patients with abnormal hematological findings in favor of alpha-thalassemia, beta-thalassemia or beta-hemoglobinopathies. Patients with low MCV and MCH levels and high HbA2 (>3.5 and those with low MCV and MCH and normal or low HbA2 were candidate for molecular analysis for beta and alpha thalassemia respectively. Abnormal Hb electrophoresis was diagnostic criteria for molecular analysis of beta-hemoglobinopathies.   Results: Study revealed that more than half of the patients with alpha-thalassemia affected simultaneously by beta-thalassemia and about thirty percent inherited beta-hemoglobinopathies. Among patients with beta-thalassemia, HbSCd6 (A-T was the most common mutation and in alpha-thalassemic patients α 3.7 was the commonest mutation.   Conclusion: Relatively high prevalence of co-inheritance of alfa-thalassemia with beta-thalassemia and hemoglobinopathies reflect the necessity of genetic consulting and molecular analysis in diagnosis of such conditions.

Two cloned β thalassemia genes are associated with amber mutations at codon 39

Science.gov (United States)

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

Science.gov (United States)

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

Science.gov (United States)

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

High-level transfer and long-term expression of the human beta-globin gene in a mouse transplant model.

Science.gov (United States)

Raftopoulos, H; Ward, M; Bank, A

1998-06-30

Insertion of a normally functioning human beta-globin gene into the hematopoietic stem cells (HSC) of patients with beta-thalassemia may be an effective approach to the therapy of this disorder. Safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models are prerequisites for HSC somatic gene therapy. We have recently shown for the first time that, using a modified beta-globin retroviral vector in a mouse transplant model, long-term, high-level expression of a transferred human beta-globin gene is possible. The human beta-globin gene continues to be detected up to eight months post-transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice. The transferred human beta-globin gene is detected in three of five mice surviving long-term (> 4 months) transplanted with bone marrow cells transduced with high-titer virus. The unrearranged 5.1 kb human beta-globin gene-containing provirus is seen by Southern blotting in two of these mice. More importantly, long-term expression of the transferred gene is seen in two mice at levels of 5% and 20% that of endogenous murine beta-globin. We document stem cell transduction by showing continued high-level expression of the human beta-globin gene in secondarily transplanted recipient mice. These results provide evidence of HSC transduction with a human beta-globin gene in animals and demonstrate that retroviral-mediated unrearranged human beta-globin gene transfer leads to a high level of human beta-globin gene expression in the long term for the first time. A gene therapy strategy may be a feasible therapeutic approach to the beta-thalassemias if consistent human beta-globin gene transfer and expression into HSC can be achieved.

Current and future alternative therapies for beta-thalassemia major

Directory of Open Access Journals (Sweden)

Edouard de Dreuzy

2016-02-01

Full Text Available Beta-thalassemia is a group of frequent genetic disorders resulting in the synthesis of little or no β-globin chains. Novel approaches are being developed to correct the resulting α/β-globin chain imbalance, in an effort to move beyond the palliative management of this disease and the complications of its treatment (e.g. life-long red blood cell transfusion, iron chelation, splenectomy, which impose high costs on healthcare systems. Three approaches are envisaged: fetal globin gene reactivation by pharmacological compounds injected into patients throughout their lives, allogeneic hematopoietic stem cell transplantation (HSCT, and gene therapy. HSCT is currently the only treatment shown to provide an effective, definitive cure for β-thalassemia. However, this procedure remains risky and histocompatible donors are identified for only a small fraction of patients. New pharmacological compounds are being tested, but none has yet made it into common clinical practice for the treatment of beta-thalassemia major. Gene therapy is in the experimental phase. It is emerging as a powerful approach without the immunological complications of HSCT, but with other possible drawbacks. Rapid progress is being made in this field, and long-term efficacy and safety studies are underway.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

Science.gov (United States)

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Geographical distribution of β-globin gene mutations in Syria.

Science.gov (United States)

Murad, Hossam; Moasses, Faten; Dabboul, Amir; Mukhalalaty, Yasser; Bakoor, Ahmad Omar; Al-Achkar, Walid; Jarjour, Rami A

2018-04-11

Objectives β-Thalassemia disease is caused by mutations in the β-globin gene. This is considered as one of the common genetic disorders in Syria. The aim of this study was to identify the geographical distribution of the β-thalassemia mutations in Syria. Methods β-Globin gene mutations were characterized in 636 affected patients and 94 unrelated carriers using the amplification refractory mutations system-polymerase chain reaction technique and DNA sequencing. Results The study has revealed the presence of 38 β-globin gene mutations responsible for β-thalassemia in Syria. Important differences in regional distribution were observed. IVS-I.110 [G > A] (22.2%), IVS-I.1 [G > A] (17.8%), Cd 39 [C > T] (8.2%), IVS-II.1 [G > A] (7.6%), IVS-I.6 [T > C] (7.1%), Cd 8 [-AA] (6%), Cd 5 [-CT] (5.6%) and IVS-I.5 [G > C] (4.1%) were the eight predominant mutations found in our study. The coastal region had higher relative frequencies (37.9 and 22%) than other regions. A clear drift in the distribution of the third common Cd 39 [C > T] mutation in the northeast region (34.8%) to the northwest region (2.5%) was noted, while the IVS-I.5 [G > C] mutation has the highest prevalence in north regions. The IVS-I.6 [T > C] mutation had a distinct frequency in the middle region. Ten mutations -86 [C > G], -31 [A > G], -29 [A > G], 5'UTR; +22 [G > A], CAP + 1 [A > C], Codon 5/6 [-TG], IVS-I (-3) or codon 29 [C > T], IVS-I.2 [T > A], IVS-I.128 [T > G] and IVS-II.705 [T > G] were found in Syria for the first time. Conclusions These data will significantly facilitate the population screening, genetic counseling and prenatal diagnosis in Syrian population.

Oxidative stress and antioxidant status in beta-thalassemia heterozygotes

Directory of Open Access Journals (Sweden)

Luciana de Souza Ondei

2013-01-01

Full Text Available Background: Several studies have evaluated the oxidant and antioxidant status of thalassemia patients but most focused mainly on the severe and intermediate states of the disease. Moreover, the oxidative status has not been evaluated for the different beta-thalassemia mutations. Objective: To evaluate lipid peroxidation and Trolox equivalent antioxidant capacity in relation to serum iron and ferritin in beta thalassemia resulting from two different mutations (CD39 and IVS-I-110 compared to individuals without beta-thalassemia. Methods: One hundred and thirty subjects were studied, including 49 who were heterozygous for beta-thalassemia and 81 controls. Blood samples were subjected to screening tests for hemoglobin. Allele-specific polymerase chain reaction was used to confirm mutations for beta-thalassemia, an analysis of thiobarbituric acid reactive species was used to determine lipid peroxidation, and Trolox equivalent antioxidant capacity evaluations were performed. The heterozygous beta-thalassemia group was also evaluated for serum iron and ferritin status. Results: Thiobarbituric acid reactive species (486.24 ± 119.64 ng/mL and Trolox equivalent antioxidant capacity values (2.23 ± 0.11 mM/L were higher in beta-thalassemia heterozygotes compared to controls (260.86 ± 92.40 ng/mL and 2.12 ± 0.10 mM/L, respectively; p-value < 0.01. Increased thiobarbituric acid reactive species values were observed in subjects with the CD39 mutation compared with those with the IVS-I-110 mutation (529.94 ± 115.60 ng/mL and 453.39 ± 121.10 ng/mL, respectively; p-value = 0.04. However, average Trolox equivalent antioxidant capacity values were similar for both mutations (2.20 ± 0.08 mM/L and 2.23 ± 0.12 mM/L, respectively; p-value = 0.39. There was no influence of serum iron and ferritin levels on thiobarbituric acid reactive species and Trolox equivalent antioxidant capacity values. Conclusion: This study shows an increase of oxidative stress and

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

OpenAIRE

Selma Ünal; Günay Balta; Fatma Gümrük

2014-01-01

Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6?6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; ...

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTAcontaining venous ...

Rare and unexpected beta thalassemic mutations in Qazvin ...

African Journals Online (AJOL)

STORAGESEVER

2010-01-04

Jan 4, 2010 ... About 13 beta-globin mutations encompass 70 - 90% of mutation spectrum in Iran. These mutations are called common beta-globin mutations. The rest are rare or unknown mutations. The objective of this study was to identify and describe rare or unknown beta-globin mutations in Qazvin province. EDTA-.

Generation of a high-titer retroviral vector capable of expressing high levels of the human β-globin gene

NARCIS (Netherlands)

M. Sadelain (Michel); C.H.J. Wang (Jason); M. Antoniou (Michael); F.G. Grosveld (Frank); R.C. Mulligan

1995-01-01

textabstractRetrovirus-mediated gene transfer into hematopoietic cells may provide a means of treating both inherited and acquired diseases involving hematopoietic cells. Implementation of this approach for disorders resulting from mutations affecting the beta-globin gene (e.g., beta-thalassemia and

Molecular identification of Sicilian (dߺ-thalassemia associated with ß-thalassemia and hemoglobin S in Brazil

Directory of Open Access Journals (Sweden)

Andrade T.G. de

2002-01-01

Full Text Available We describe the clinical and molecular characteristics of two unrelated Brazilian families with an association of the Sicilian form of (deltaߺ-thalassemia with hemoglobin S and ß-thalassemia. Direct sequencing of the ß-globin gene showed only the hemoglobin S mutation in patient 1 and the ß-thalassemia IVS1-110 in patient 2. The other allele was deleted in both patients and PCR of DNA samples of the breakpoint region of both patients showed a band of approximately 1,150 bp, expected to be observed in the DNA of carriers of Sicilian (deltaߺ-thalassemia. The nucleotide sequence of this fragment confirmed the Sicilian deletion. There are few reports concerning the Hb S/(deltaߺ-thalassemia association and patient 2 is the first reported case of Sicilian type of (deltaߺ-thalassemia in association with ß-thalassemia documented at the molecular level.

Adipocytokine concentrations in children with different types of beta-thalassemia.

Science.gov (United States)

Enli, Yaşar; Balci, Yasemin I; Gönen, Cafer; Uzun, Ebru; Polat, Aziz

2014-06-01

Beta-thalassemia is an inherited blood disorder. It results from the impaired production of β-globin chains, leading to a relative excess of alpha-globin chains. Clinical severity separates this disease into three main subtypes: β- thalassemia major, β-thalassemia intermedia and β-thalassemia minor, the former two being clinically more significant. Inflammatory processes may play an important role in some of the complications of thalassemia. Adipose tissue is one of the most important endocrine and secretory organs that release adipocytokines like adiponectin, resistin and visfatin. The aim of our study was to analyze adipocytokine concentrations (adiponectin, resistin and visfatin) in different types of β-thalassemia patients and determine any possible correlations with disease severity. We recruited 29 patients who were transfusion-dependent β-thalassemia-major patients, 17 patients with β-thalassemia intermedia, 30 β-thalassemia minor patients. The control group consisted of 30 healthy children. Anthropometric measurements, complete blood count, biochemical parameters, serum concentrations of adiponectin, resistin, visfatin were performed for all subjects. Resistin and visfatin concentrations were significantly higher in β-thalassemia minor patients than in controls. Adiponetin, resistin and visfatin concentrations were significantly higher in both β-thalassemia intermedia and major patients than in controls. The concentrations of adiponectin, resistin and visfatin were significantly higher in both β-thalassemia intermedia and major patients than in β-thalassemia minor patients. There was no significant difference between β-thalassemia intermedia and β-thalassemia major patients for adipocytokines concentrations. We speculate that these adipocytokines may play a role in the development of complications in β-thalassaemia.

Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

Science.gov (United States)

Setianingsih, I; Williamson, R; Daud, D; Harahap, A; Marzuki, S; Forrest, S

1999-09-01

Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature. Neither ameliorating genetic factors such as alpha-globin gene deletions or the XmnI restriction site polymorphism at position -158 upstream of the (G)gamma-globin gene, nor differences in beta-globin gene haplotype, explain the phenotypic variation. These observations have implications for the development of antenatal diagnosis in Indonesia, as at present it is not possible to give an accurate prediction of severity of phenotype for this common genotype. Copyright 1999 Wiley-Liss, Inc.

[Beta thalassemia major and pregnancy during adolescence: report of two cases].

Science.gov (United States)

Trigo, Lucas Augusto Monteiro Castro; Surita, Fernanda Garanhani; Parpinelli, Mary Angela; Pereira, Belmiro Gonçalves; Fertrin, Kleber Yotsumoto; Costa, Maria Laura

2015-06-01

Beta thalassemia major is a rare hereditary blood disease in which impaired synthesis of beta globin chains causes severe anemia. Medical treatment consists of chronic blood transfusions and iron chelation. We describe two cases of adolescents with beta thalassemia major with unplanned pregnancies and late onset of prenatal care. One had worsening of anemia with increased transfusional requirement, fetal growth restriction, and placental senescence. The other was also diagnosed with hypothyroidism and low maternal weight, and was admitted twice during pregnancy due to dengue shock syndrome and influenza H1N1-associated respiratory infection. She also developed fetal growth restriction and underwent vaginal delivery at term complicated by uterine hypotonia. Both patients required blood transfusions after birth and chose medroxyprogesterone as a contraceptive method afterwards. This report highlights the importance of medical advice on contraceptive methods for these women and the role of a specialized prenatal follow-up in association with a hematologist.

ASSOCIATION OF HFE GENE MUTATION IN THALASSEMIA MAJOR PATIENTS

Directory of Open Access Journals (Sweden)

Amit Kumar Tiwari

2016-11-01

Full Text Available BACKGROUND Thalassemia major patients are dependent on frequent blood transfusion and consequently develop iron overload. HFE gene mutations (C282Y, H63D and S65C in hereditary haemochromatosis has been shown to be associated with iron overload. The study aims at finding the association of HFE gene mutations in β-thalassemia major patients. MATERIALS AND METHODS A descriptive observational pilot study was conducted including fifty diagnosed -thalassemia major cases. DNA analysis by PCR-RFLP method for HFE gene mutations was performed. RESULTS Only H63D mutation (out of three HFE gene mutations was detected in 8 out of 50 cases. Observed frequency of H63D mutation was 16%. While frequency of C282Y and S65C were 0% each. CONCLUSION The frequency of HFE mutation in -thalassemia major is not very common.

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

Science.gov (United States)

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Long-term transfer and expression of the human beta-globin gene in a mouse transplant model.

Science.gov (United States)

Raftopoulos, H; Ward, M; Leboulch, P; Bank, A

1997-11-01

Somatic gene therapy of hemoglobinopathies depends initially on the demonstration of safe, efficient gene transfer and long-term, high-level expression of the transferred human beta-globin gene in animal models. We have used a beta-globin gene/beta-locus control region retroviral vector containing several modifications to optimize gene transfer and expression in a mouse transplant model. In this report we show that transplantation of beta-globin-transduced hematopoietic cells into lethally irradiated mice leads to the continued presence of the gene up to 8 months posttransplantation. The transferred human beta-globin gene is detected in 3 of 5 mice surviving long term (>4 months) transplanted with bone marrow cells transduced with high-titer virus. Southern blotting confirms the presence of the unrearranged 5.1-kb human beta-globin gene-containing provirus in 2 of these mice. In addition, long-term expression of the transferred gene is seen in 2 mice at levels of 5% and 20% that of endogenous murine beta-globin at 6 and 8 months posttransplantation. We further document stem cell transduction by the successful transfer and high-level expression of the human beta-globin gene from mice transduced 9 months earlier into irradiated secondary recipient mice. These results demonstrate high-level, long-term somatic human beta-globin gene transfer into the hematopoietic stem cells of an animal for the first time, and suggest the potential feasibility of a retroviral gene therapy approach to sickle cell disease and the beta thalassemias.

Infusion of Autologous Retrodifferentiated Stem Cells into Patients with Beta-Thalassemia

Directory of Open Access Journals (Sweden)

Ilham Saleh Abuljadayel

2006-01-01

Full Text Available Beta-thalassemia is a genetic, red blood cell disorder affecting the beta-globin chain of the adult hemoglobin gene. This results in excess accumulation of unpaired alpha-chain gene products leading to reduced red blood cell life span and the development of severe anemia. Current treatment of this disease involves regular blood transfusion and adjunct chelation therapy to lower blood transfusion–induced iron overload. Fetal hemoglobin switching agents have been proposed to treat genetic blood disorders, such as sickle cell anemia and beta-thalassemia, in an effort to compensate for the dysfunctional form of the beta-globin chain in adult hemoglobin. The rationale behind this approach is to pair the excess normal alpha-globin chain with the alternative fetal gamma-chain to promote red blood cell survival and ameliorate the anemia. Reprogramming of differentiation in intact, mature, adult white blood cells in response to inclusion of monoclonal antibody CR3/43 has been described. This form of retrograde development has been termed “retrodifferentiation”, with the ability to re-express a variety of stem cell markers in a heterogeneous population of white blood cells. This form of reprogramming, or reontogeny, to a more pluripotent stem cell state ought to recapitulate early hematopoiesis and facilitate expression of a fetal and/or adult program of hemoglobin synthesis or regeneration on infusion and subsequent redifferentiation. Herein, the outcome of infusion of autologous retrodifferentiated stem cells (RSC into 21 patients with beta-thalassemia is described. Over 6 months, Infusion of 3-h autologous RSC subjected to hematopoietic-conducive conditions into patients with beta-thalassemia reduced mean blood transfusion requirement, increased mean fetal hemoglobin synthesis, and significantly lowered mean serum ferritin. This was always accompanied by an increase in mean corpuscular volume (MCV, mean corpuscular hemoglobin (MCH, and mean

Interação entre Hb C [beta6(A3Glu>Lys] e IVS II-654 (C>T beta-talassemia no Brasil Hb C [beta6(A3Glu>Lys] and IVS II - 654 (C>T beta thalassemia interaction in Brazil

Directory of Open Access Journals (Sweden)

Claudia R. Bonini-Domingos

2003-06-01

Full Text Available Thalassemias are a heterogeneous group of inherited disorders characterized by a microcytic hypochromic anemia and an imbalance in the synthesis of the globin-chains. Hb C is the second most frequently variant of hemoglobin found in Brazil. The laboratory diagnosis of hemoglobinopathies, including thalassemias, is growing in importance, particularly because of an increasing requirement for neonatal diagnosis of abnormal hemoglobins. Screening tests were carried out using alkaline and acid electrophoresis, globin-chain analysis by cellulose acetate in alkaline pH, isoelectric focusing and HPLC. The molecular characterization was made by PCR-ASO for Hb C and beta thalassemia mutants. Large-scale screening and discriminative methodologies must provide information about the hemoglobin polymorphisms in Brazilian population. HPLC is a powerful tool in these cases. Molecular characterization is important to genetic counseling and clinical management, in particular for the Brazilian population that have an intense racial admixture, with great variability of hemoglobins. In this paper an association between Hb C and beta thalassemia (IVS-II-654 in a black family from Brazil was described.

The effect of HBB:c.*+96T>C (3’UTR +1570 T>C on the mild b-thalassemia intermedia phenotype

Directory of Open Access Journals (Sweden)

Türker Bilgen

2011-09-01

Full Text Available Hemoglobin beta (HBB:c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family. HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype.

Evaluation of the BeTha gene 1 kit for the qualitative detection of the eight most common Mediterranean beta-thalassemia mutations.

Science.gov (United States)

Ugozzoli, L A; Lowery, J D; Reyes, A A; Lin, C I; Re, A; Locati, F; Galanello, R; Macioni, L; Maggio, A; Giambona, A; Loutradi, A; Boussiou, M; Wallace, R B

1998-11-01

We describe the evaluation of the Bio-Rad BeTha Gene 1 kit (Bio-Rad Laboratories, Hercules, CA), a DNA-probe assay designed for the qualitative determination of the eight most common Mediterranean beta-thalassemia mutations. The kit utilizes the principle of allele-specific oligonucleotide (ASO) hybridization. Following sample preparation and in vitro DNA amplification by the polymerase chain reaction (PCR), an allele-specific detection of the amplified products by a nonradioactive enzymatic assay is performed. Genomic DNA is prepared from an individual's whole blood with a DNA purification matrix. In a second step, the beta-globin gene is amplified in a multiplex PCR reaction containing four 5' biotinylated oligonucleotide primers. In a final step, an aliquot of the PCR reaction is first chemically denatured and then captured in two eight-well strips of a 96-well enzyme-linked immunosorbent assay (ELISA) plate by hybridization to an immobilized ASO probe. Each DNA sequence at each of the eight mutation sites is represented by one normal and one mutant ASO. During this capture/hybridization step, which is performed at 37 degrees C, only perfectly matched PCR products will be captured by an ASO. Subsequently, the allele-specific captured biotin-labeled PCR products are detected by a colorimetric enzymatic reaction. The system permits the detection of 16 beta-thalassemia alleles using a high-throughput format that can be automated easily. A clinical feasibility study was performed to evaluate the functionality (method comparison study, assay validity using samples previously collected and stored at various temperatures for different periods of time, interference on kit performance, and assay validity for prenatal diagnosis) and the usability (ease of use, sample throughput) of the kit. The analysis of 110 samples previously studied with reference methods showed 100% clinical sensitivity and specificity. We demonstrate here that the procedure not only increases the

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study

Directory of Open Access Journals (Sweden)

Selma Ünal

2014-09-01

Full Text Available OBJECTIVE: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group. METHODS: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years with beta-thalassemia major (BTM and 13 beta-thalassemia intermedia (BTI patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years were included in the study. The control group comprised 100 healthy blood donors. RESULTS: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group. CONCLUSION: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

Science.gov (United States)

Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

2018-01-01

Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

Effect ALPHA Globalin Gene Deletion and GAMMA Globin Gene -158 (C/T) Polymorphism in BETA- Thalassaemic Patients

International Nuclear Information System (INIS)

EL Serafi, T.I.; Ismail, E.F.; Mahmoud, M.A.; Mohamed, M.A.; Ghattas, M.H.; Badran, D.I.; El Serafi, I.T.; Mohamed, H.S.

2008-01-01

The beta-thalassemias (β- thalassemias) are among the most common autosomal recessive disorders. They have a remarkably high frequency in the Mediterranean region and represent one of the most common genetic diseases in Egypt. In this study, the spectrum of P- thalassemia mutations and genotype-to-phenotype correlations were defined in 32 β- thalassaemic patients (β- thalassemias major and intermedia) with varying disease severity in two cities of the Suez Canal region. Ten different mutations were identified and the most frequent ones were: Isi-6 (T-C) (37.5%), IVSI-110 (G-A) (34.4%) and both IVSI-1 (G-A), IVSII-745 (C-G) and -102 (C-G) (12.5% each). There was a wide spectrum of phenotypic severity in all patients. We studied the Xmnl polymorphism (C/T) in γ- globin gene position -158 of P- thalassemia as a modulating factor of the disease severity. Presence of the polymorphism was found in two patients and this was not sufficient to explain the diversity of the phenotype encountered. Co-inheritance of alpha thalassaemia as a modulating factor was not evident in our patients. In conclusion, we have been unable to find a molecular basis for the benign clinical course in all our patients. Other genetic or acquired factors must be hypothesized which ameliorate the clinical condition.

Hb H disease resulting from the association of an αº-thalassemia allele [-(α20.5] with an unstable α-globin variant [Hb Icaria]: first report on the occurrence in Brazil

Directory of Open Access Journals (Sweden)

Elza M. Kimura

2009-01-01

Full Text Available Hb H Disease is caused by the loss or inactivation of three of the four functional a-globin genes. Patients present chronic hemolytic anemia and splenomegaly. In some cases, occasional blood transfusions are required. Deletions are the main cause of this type of thalassemia (α-thalassemia. We describe here an unusual case of Hb H disease caused by the combination of a common αº deletion [-(α20.5] with a rare point mutation (c.427T > A, thus resulting in an elongated and unstable α-globin variant, Hb Icaria, (X142K, with 31 additional amino-acid residues. Very high levels of Hb H and Hb Bart's were detected in the patient's red blood cells (14.7 and 19.0%, respectively. This is the first description of this infrequent association in the Brazilian population.

Nonsense mutations in the human β-globin gene affect mRNA metabolism

International Nuclear Information System (INIS)

Baserga, S.J.; Benz, E.J. Jr.

1988-01-01

A number of premature translation termination mutations (nonsense mutations) have been described in the human α- and β-globin genes. Studies on mRNA isolated from patients with β 0 -thalassemia have shown that for both the β-17 and the β-39 mutations less than normal levels of β-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human β-globin mRNA). In vitro studies using the cloned β-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. The authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human β-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation

Regional and ethnic distribution of beta thalassemia mutations and effect of consanguinity in patients referred for prenatal diagnosis

International Nuclear Information System (INIS)

Hafeez, M.

2007-01-01

To determine the regional and ethnic distribution of beta thalassemia mutation and the effect of consanguinity in patients referred for prenatal diagnosis of beta b-thalassemia and to target the high risk population for screening. A total of 499 couples were referred to Gentec Lab., Lahore, from all over Pakistan for prenatal diagnosis of b-thalassemia. After counseling, chorionic villus sampling was done between 10-16 weeks of gestation. DNA analysis was done by Amplification Refractory Mutation System (ARMS) for type of mutation in the Armed Forces Institute of Pathology, Rawalpindi. Ethnicity, race and consanguineous relationship of parents was determined.b-thalassemia was prevalent in Punjabis (60.7%) followed by Saraikees (25.5%). Castewise it was most frequent in Rajputs followed by Jatts, Arain, Sheikhs and Pathans. 56.7% of the couples were first cousins and 19.8% were relatives. The commonest mutations were Frameshift 8-9 (Fr8-9) 33.5%, Intervening Sequence 1-5 (IVS 1-5) 17.2%, Fr4142 - 8%, IVS 1-1 - 5.2%, Deletion 619 (Del 619) 4.2% and Codon 5 (Cd 5) - 4.2%. In samples sent for analysis, 53.1% turned out to be carriers (trait), 25.3% were diseased (thalassemia major) and 21.6% were normal. P-value of all results was less than 0.001. In this series, the highest frequency was found in Punjabi Rajputs. The commonest mutation was Fr 8-9. Most parents were first cousins. Premarital thalassemia carrier testing can effectively reduce the disease. (author)

Thalassemia and related hemoglobinopathies.

Science.gov (United States)

Sarnaik, Sharada A

2005-04-01

Hemoglobinopathies are the most common single gene disorders in man. There are several hundred of these disorders though the thalassemias -- alpha and beta and the sickling disorders make up the vast majority. Recent advances in the understanding of the hemoglobin structure and the genetics of its synthesis has contributed significantly to the understanding of these diseases. Disorders include those with reduced globin synthesis, abnormal globin chains and failure to switch globin chain synthesis at the appropriate age. This review focuses on the clinical features, diagnosis and management strategies of the alpha and beta thalassemias, the sickling disorders and touches on a few rarer hemoglobinopathies. It also emphasizes prevention strategies and chronic transfusion safety in countries like India where there are limited resources.

Frequency of Hereditary Hemochromatosis (HFE) Gene Mutations in Egyptian Beta Thalassemia Patients and its Relation to Iron Overload.

Science.gov (United States)

Enein, Azza Aboul; El Dessouky, Nermine A; Mohamed, Khalda S; Botros, Shahira K A; Abd El Gawad, Mona F; Hamdy, Mona; Dyaa, Nehal

2016-06-15

This study aimed to detect the most common HFE gene mutations (C282Y, H63D, and S56C) in Egyptian beta thalassemia major patients and its relation to their iron status. The study included 50 beta thalassemia major patients and 30 age and sex matched healthy persons as a control group. Serum ferritin, serum iron and TIBC level were measured. Detection of the three HFE gene mutations (C282Y, H63D and S65C) was done by PCR-RFLP analysis. Confirmation of positive cases for the mutations was done by sequencing. Neither homozygote nor carrier status for the C282Y or S65C alleles was found. The H63D heterozygous state was detected in 5/50 (10%) thalassemic patients and in 1/30 (3.3%) controls with no statistically significant difference between patients and control groups (p = 0.22). Significantly higher levels of the serum ferritin and serum iron in patients with this mutation (p = 001). Our results suggest that there is an association between H63D mutation and the severity of iron overload in thalassemic patients.

Beta Thalassemia (For Parents)

Science.gov (United States)

... Safe Videos for Educators Search English Español Beta Thalassemia KidsHealth / For Parents / Beta Thalassemia What's in this ... Symptoms Diagnosis Treatment Print en español Beta talasemia Thalassemias Thalassemias are a group of blood disorders that ...

[Prevalence survey and molecular characterization of alpha and beta thalassemia in Liuzhou city of Guangxi].

Science.gov (United States)

Cai, Ren; Li, Liyan; Liang, Xin; Liu, Zhongying; Su, Liu; Li, Wenjun; Zhu, Qiangui; Mo, Qiuhua; Pan, Lizhen; Ouyang, Hong; Huang, Lihua; Xu, Xiangmin

2002-08-01

To investigate the gene frequencies and mutation patterns of alpha thalassemia (alpha-thal) and beta thalassemia (beta-thal) in Liuzhou city of Guangxi Zhuang Autonomous Region. Cluster sampling was used. A total of 1 028 of umbilical blood samples were collected for a prevalence study of alpha-thal and a total of 1 312 healthy young people when receiving pre-marriage consultation were recruited for a beta-thal prevalence survey. Individuals live in city or town area of Liuzhou. A complete blood count as well as hemoglobin electrophoresis analysis were done in all of samples for phenotyping of alpha and beta-thals. Those with Hb Bart's for alpha-thal indicator and those with both microcytosis (MCV /=4.0%) for beta-thal were further studied by DNA analysis. PCR-based methodologies were used to characterize the mutation contributions of alpha and beta-thals. All the subjects were tested for the state of carrying beta-thala alleles for evaluating the situation of the compound heterozygotes of alpha-thal with beta-thal. Of 1 028 random samples of umbilical blood screened, 112 of subjects were defined to be the gene carriers of alpha-thal. The alpha-thal carrier rate was as high as 11.19% including 3 compound heterozygotes. Five well-known types of alpha-thal alleles were detected with gene contributions of 37.4% (--(SEA) deletion), 31.3% (-alpha(3.7) deletion), 17.4% (-alpha(4.2) deletion), 12.1% (alpha(CS)alpha mutation), and 0.9% (alpha(QS)alpha mutation), successively. Of the 1 312 adult specimens studied, 89 with beta-thal including 14 of the compound higher Hb F subjects were detected. All of the 89 phenotypic beta-thal carriers had the mutations in the beta-globin gene, making the overall prevalence 6.78%. The commonly seen three mutations, beta CD41 - 42 (-CTTT) frameshift, beta CD17 (T-A) nonsense mutation and beta-28 (A-G) promoter variation were accounted for 90% of the beta-thal alleles in Liuzhou. Of these beta-thal subjects, 16 (accounting for 18%) were

Hemolytic disease of the newborn caused by a new deletion of the entire beta-globin cluster.

OpenAIRE

Pirastu, M; Kan, Y W; Lin, C C; Baine, R M; Holbrook, C T

1983-01-01

We describe a new type of gamma delta beta-thalassemia in four generations of a family of Scotch-Irish descent. The proposita presented with hemolytic disease of the newborn, which was characterized by a microcytic anemia. Initial restriction endonuclease analysis of the DNA showed no grossly abnormal patterns, but studies of polymorphic restriction sites and gene dosage revealed an extensive deletion that removed all the beta- and beta-like globin genes from the affected chromosome. In situ ...

Hemoglobina C em homozigose e interação com talassemia beta Homozygous hemoglobin C and its interaction with beta thalassemia

Directory of Open Access Journals (Sweden)

Ivan L. Angulo

2009-01-01

Full Text Available A hemoglobina C (Hb C é originária do oeste da África e é detectada por migração lenta na eletroforese alcalina em acetato de celulose. Consiste na mutação do gene da globina beta no códon 6 (GAG-AAG, resultando na substituição do sexto aminoácido da cadeia beta da hemoglobina humana, o ácido glutâmico, pelo aminoácido lisina. A cromatografia de alto desempenho (HPLC separa completamente as frações C e A2, permitindo caracterizar a presença da interação com talassemia beta. Esta entidade (Hb CC, em homozigoze é considerada benigna em relação à doença falciforme, já que a falcização não faz parte de sua fisiopatologia. A raridade do diagnóstico C homozigoto e C talassemia beta nos pacientes portadores de hemoglobinopatias nos alertou para a necessidade de se conhecer melhor e estudar aspectos clínicos e hematológicos dos casos dessa mutação em homozigose e na interação com a talassemia beta no ambulatório de anemias do Centro Regional de Hematologia e Hemoterapia de Ribeirão Preto, SP, Brasil.Hemoglobin C (Hb C originated in the west of Africa and is detected by alkaline electrophoresis by slow migration in cellulose acetate. It consists of a mutation of the beta globin gene in codon 6 (GAG-AAG, resulting in a substitution of glutamic acid, the sixth amino acid of the beta string of the human hemoglobin, for lysine. High performance chromatography (HPLC separates the C and A2 fractions completely, allowing the characterization of the presence of interactions with thalassemia beta. This entity (Hb CC is considered benign in respect to sickle cell disease, as sickle cells are not part of its physiopathology. The rarity of the diagnosis of homozygous C and beta thalassemia in patients with hemoglobinopathies showed the necessity of studying clinical and hematologic aspects of the cases of this mutation in homozygosis carriers and the interaction with beta thalassemia in the anemias clinic of the Regional Blood

X-ray scattering signatures of {beta}-thalassemia

Energy Technology Data Exchange (ETDEWEB)

Desouky, Omar S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt); Elshemey, Wael M. [Biophysics Department, Faculty of Science, Cairo University (Egypt)], E-mail: waelelshemey@yahoo.com; Selim, Nabila S. [Radiation Physics Department, National Center for Radiation Research and Technology (NCRRT) (Egypt)

2009-08-11

X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm{sup -1}, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; {beta}-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of {beta}-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm{sup -1}, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

Science.gov (United States)

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

Science.gov (United States)

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (Pthalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the

Gene Therapy in Thalassemia and Hemoglobinopathies

OpenAIRE

Breda, Laura; Gambari, Roberto; Rivella, Stefano

2009-01-01

Sickle cell disease (SCD) and ß-thalassemia represent the most common hemoglobinopathies caused, respectively, by the alteration of structural features or deficient production of the ß-chain of the Hb molecule. Other hemoglobinopathies are characterized by different mutations in the α- or ß-globin genes and are associated with anemia and might require periodic or chronic blood transfusions. Therefore, ß-thalassemia, SCD and other hemoglobinopathies are excellent candidates for genetic approac...

Genetics Home Reference: beta thalassemia

Science.gov (United States)

... Facebook Twitter Home Health Conditions Beta thalassemia Beta thalassemia Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Beta thalassemia is a blood disorder that reduces the production ...

EFFECT OF CIS ACTING POTENTIAL REGULATORS IN THE ß GLOBIN GENE CLUSTER ON THE PRODUCTION OF HBF IN THALASSEMIA PATIENTS

Directory of Open Access Journals (Sweden)

Anita Nadkarni

2013-02-01

Full Text Available The clinical presentation of   b-thalassemia intermedia phenotypes are influenced by many factors .The persistence of fetal hemoglobin and  several polymorphisms located in the promoters of  g- and b-globin genes are some of them .The aim of this study was to evaluate the combined effect of  the -158Gg (CàT polymorphism and of the (ATx(Ty configuration, as well as their eventual association with elevated levels of HbF  in  b-thalassemia carriers, b-thalassemia Intermedia , b-thalassemia major and normal controls of Indian origin. The -158 Gg T allele was found to be associated with increased levels of HbF in b-thalassemia carriers, and not in wild-type subjects. In the homozygous group the -158 Gg T allele was significantly higher in the thalassemia intermedia group (66% as against the thalassemia major group (21%. The (AT9(T5 allele did not show any association with raised HbF levels. However 24% of milder cases showed presence of this allele. This study suggests that two regions of the b globin cluster, whether in cis or in trans to each other, can interact to enhance HbF expression when a b thalassemic determinant is present in heterozigosity and help in amelioration of the severity of the disease in homozygotes.

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

Science.gov (United States)

Modares Sadeghi, Mehran; Shariati, Laleh; Hejazi, Zahra; Shahbazi, Mansoureh; Tabatabaiefar, Mohammad Amin; Khanahmad, Hossein

2018-03-01

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia. © 2017 Wiley Periodicals, Inc.

Mutation Spectrum of β-Thalassemia and Other Hemoglobinopathies in Chittagong, Southeast Bangladesh.

Science.gov (United States)

Chatterjee, Tridip; Chakravarty, Amit; Chakravarty, Sudipa; Chowdhury, Mahmood Ahmed; Sultana, Razia

2015-01-01

Thalassemia is one of the most common autosomal recessive blood disorders in the world. It shows a variety of clinical expression, starting from asymptomatic to severe blood transfusion dependence. More than 500 alleles have been characterized in or around the β-globin region. Moreover, most geographical regions have their own characteristics, frequency and availability of these alleles, predominantly circulating within the communities present in that particular region. In this study, we explored the spectrum of β-thalassemia (β-thal) alleles present in Chittagong, Southeast Bangladesh. This study comprises β-thal and Hb E (HBB: c.79 G > A) patients from in and around the area of Chittagong. Not only exploring the complete β-globin mutation spectrum of the area, but we also tried to look at the origin of the mutated alleles. The β-thal mutations of Bangladesh show a relatively wide spectrum of alleles, which further demonstrates the heterogeneity of the disease in this country. Although our study showed that the majority of the mutations have their origin in neighboring countries such as India, countries of Southeast Asia, Pakistan, etc., some unusual alleles do not originate in neighboring countries and put a little more diversity in the overall spectrum of β-thal-specific alleles. Overall, this study demonstrates the mutation spectrum related to β-thal in Chittagong, Southeast Bangladesh.

A comparison of heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major.

Science.gov (United States)

Amoozgar, Hamid; Zeighami, Samaneh; Haghpanah, Sezaneh; Karimi, Mehran

2017-01-01

The goal of this study was to compare heart function and arrhythmia in clinically asymptomatic patients with beta thalassemia intermedia and beta thalassemia major. In this cross-sectional study, 60 patients with beta thalassemia major and 60 patients with beta thalassemia intermedia who had clinically no symptoms of arrhythmia and clinically normal heart function were evaluated using 24-hour ambulatory electrocardiogram monitoring and echocardiography. For data analysis SPSS ver.20 software was used. A P-value of less than 0.05 was considered statistically significant. The mean age of the beta thalassemia intermedia patients was 24.18 ± 7.9 years and the mean age in beta thalassemia major was 24.38 ± 7.7 years (P>0.05). Premature atrial contractions (PACs) were observed in 14 (23.3%) patients with beta thalassemia intermedia and in 22 (36.6%) beta thalassemia major patients. Premature ventricular contractions (PVCs) were detected in 8 (13.3%) patients in the beta thalassemia intermediate group and 16 (26.6) patients in the beta thalassemia major group, respectively. The left ventricular diastolic dimension, end-diastolic volume, and stroke volume were significantly higher in beta thalassemia intermedia group (Pintermedia group. Both atrial and ventricular arrhythmias were more common in the beta thalassemia major group. Higher end-diastolic volume and stroke volume were detected in the beta thalassemia intermedia group. Pulmonary acceleration time was lower in the beta thalassemia intermedia group, which can be an indicator of higher pulmonary pressure.

Beta-thalassemia intermedia associated with moyamoya syndrome.

Science.gov (United States)

Göksel, Basak Karakurum; Ozdogu, Hakan; Yildirim, Tulin; Oğuzkurt, Levent; Asma, Suheyl

2010-07-01

Moyamoya syndrome (MMS) is a progressive disorder. We report a 19-year-old boy with beta-thalassemia who presented with a left hemiparesis. Brain MRI showed old middle cerebral artery and left frontal subcortical white matter infarcts. Brain magnetic resonance angiography and digital subtraction angiography revealed occlusion of the bilateral internal carotid arteries with a rich network of basal collateral vessels. To our knowledge this is the third report of beta-thalassemia intermedia and MMS, and the first report of a patient in Turkey. It emphasizes the potential for cerebral infarct due to anemia, protein S and thrombocytosis.

Identification of novel microsatellite markers preimplantation genetic diagnosis of beta-thalassemia.

Science.gov (United States)

Chen, Min; Tan, Arnold S C; Cheah, Felicia S H; Saw, Eugene E L; Chong, Samuel S

2015-12-01

Beta (β)-thalassemia is one of the most common monogenic diseases worldwide. Affected pregnancies can be avoided through preimplantation genetic diagnosis (PGD), which commonly involves customized assays to detect the different combinations of β-globin (HBB) gene mutations present in couples, in conjunction with linkage analysis of flanking microsatellite markers. Currently, the limited number of reported closely linked markers hampers their utility in indirect linkage-based PGD for this disorder. To increase the available markers closely flanking the HBB gene, an in silico search was performed to identify all markers within 1 Mb flanking the HBB gene. Fifteen markers with potentially high polymorphism information content (PIC) and heterozygosity values were selected and optimized into a single-tube pentadecaplex PCR panel. Allele frequencies and polymorphism and heterozygosity indices of each marker were assessed in five populations. A total of 238 alleles were observed from the 15 markers. PIC was >0.7 for all markers, with expected heterozygosity and observed heterozygosity values ranging from 0.74 to 0.90 and 0.72 to 0.88, respectively. Greater than 99% of individuals were heterozygous for at least seven markers, with at least two heterozygous markers on either side of the HBB gene. The pentadecaplex marker assay also performed reliably on single cells either directly or after whole genome amplification, thus validating its use in standalone linkage-based β-thalassemia PGD or in conjunction with HBB mutation detection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cardiac complications in beta-thalassemia: From mice to men.

Science.gov (United States)

Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C; Chattipakorn, Nipon

2017-06-01

Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

Cardiac complications in beta-thalassemia: From mice to men

Science.gov (United States)

Kumfu, Sirinart; Fucharoen, Suthat; Chattipakorn, Siriporn C.

2017-01-01

Beta-thalassemia is an inherited hemoglobin disorder caused by reduced or absent synthesis of the beta globin chains of hemoglobin. This results in variable outcomes ranging from clinically asymptomatic to severe anemia, which then typically requires regular blood transfusion. These regular blood transfusions can result in an iron overload condition. The iron overload condition can lead to iron accumulation in various organs, especially in the heart, leading to iron overload cardiomyopathy, which is the major cause of mortality in patients with thalassemia. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects that iron overload has on the hearts of β-thalassemic mice under conditions of iron overload as well as the efficacy of pharmacological interventions to combat these adverse effects on the heart are reviewed and discussed. The in-depth understanding of biomolecular alterations in the heart of these iron overload thalassemic mice will help give guidance for more effective therapeutic approaches in the near future. Impact statement Iron overload cardiomyopathy is a major cause of morbidity and mortality in patients with thalassemia. Since investigation of iron overload cardiomyopathy in thalassemia patients has many limitations, a search for an animal model for this condition has been ongoing for decades. In the past decades, there is no doubt that the use of β-thalassemic mice as a study model to investigate the pathophysiology of iron overload cardiomyopathy and the role of various pharmacological interventions, has shed some light in understanding this serious complication and in improving the associated cardiac dysfunction. In this review, the effects of

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

Science.gov (United States)

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

Is beta-thalassemia trait a protective factor against ischemic cerebrovascular accidents?

Science.gov (United States)

Karimi, Mehran; Borhani Haghighi, Afshin; Yazdani, Maryam; Raisi, Hamideh; Giti, Rahil; Namazee, Mohammad Reza

2008-01-01

In this research, we sought to determine the association between beta-thalassemia trait and ischemic cerebrovascular accident (CVA). In acase-control study, 148 patients with thromboembolic cerebrovascular events were evaluated for the presence of hypertension, diabetes mellitus, hyperlipidemia, and beta-thalassemia trait. A total of 156 age- and sex-matched patients with no cardiac or cerebrovascular diseases, serving as the control group, were also investigated for the above-mentioned risk factors. We found that 6.1% of patients with ischemic CVA and 12.2% of the control group had beta-thalassemia trait (P = .066). In male patients, the negative association between ischemic CVA and presence of beta-thalassemia trait was significant (P = .008). In patients, the prevalence of hypertension was also significantly different between those with and without beta-thalassemia trait (P = .01); those with beta-thalassemia trait had a lower mean blood pressure than those without the trait. beta-Thalassemia trait may have a protective effect against ischemic CVA that might be caused by the lower arterial blood pressure observed in those with this trait.

GENETIC HETEROGENEITY OF BETA GLOBIN MUTATIONS AMONG ASIAN-INDIANS AND IMPORTANCE IN GENETIC COUNSELLING AND DIAGNOSIS

Directory of Open Access Journals (Sweden)

Ravindra Kumar

2013-01-01

Full Text Available There are an estimated 45 million carriers of β-thalassemia trait and about 12,000-15,000 infants with β-thalassemia major are born every year in India. The consanguinity rates are higher in India, and thalassemia major constitutes a significant burden on the health care system. In present study, β-thalassemia mutations were characterized in 300 thalassemia cases from 2007 to 2010 using ARMS-PCR and DNA sequencing. The five most common mutations accounted 79.3% of the studied chromosomes that includes IVS1-5(G>C, Cod 41-42(-TCTT, Cod8-9(+G, Cod16(-C and 619bp del. Though IVS1-5(G>C is most common mutation when all the communities were included, the percentage prevalence were calculated on sub caste basis and found that IVS1-5(G>C percentage prevalence varied from 25 to 60 in Aroras & Khatris and Thakur respectively. Interestingly Cod41-42(-TCTT mutation which is the second commonest among the mutations reported was totally absent in Kayasthas and Muslim community. These findings have implications for providing molecular diagnosis, genetic counseling and prenatal diagnosis to high risk couples of β-thalassemia.

Compensatory increase in alpha 1-globin gene expression in individuals heterozygous for the alpha-thalassemia-2 deletion.

OpenAIRE

Liebhaber, S A; Cash, F E; Main, D M

1985-01-01

alpha-Globin is encoded by the two adjacent genes, alpha 1 and alpha 2. Although it is clearly established that both alpha-globin genes are expressed, their relative contributions to alpha-globin messenger RNA (mRNA) and protein synthesis are not fully defined. Furthermore, changes that may occur in alpha-globin gene activity secondarily to the loss of function of one or more of these genes (alpha-thalassemia [Thal]) have not been directly investigated. This study further defines the expressi...

Clinical and hematological response to hydroxyurea in a patient with Hb Lepore/beta-thalassemia.

Science.gov (United States)

Rigano, P; Manfré, L; La Galla, R; Renda, D; Renda, M C; Calabrese, A; Calzolari, R; Maggio, A

1997-05-01

The possibility of increasing Hb F in vivo using drugs like 5-azacytidine, hydroxyurea, and butyrate has been established. However, in many cases this does not entail an increase in total hemoglobin. We report on a patient with Hb Lepore/beta-thalassemia being treated with hydroxyurea (30 mg/Kg/day) because of the presence of erythroid extramedullary masses with severe neurological abnormalities. During therapy the patient showed a remarkable improvement in neurological signs due to the reduction in extra-medullary masses, a significant increase in both total hemoglobin (from 5.8 to 9.7 g/dl) and Hb F (from 4.9 g/dl to 9.1 g/dl). The marked improvement in hemoglobin level in our patient with Hb Lepore/beta-thalassemia suggests gamma-globin gene activation due to the DNA structure determined by the crossover event.

Molecular nature of alpha-globin genes in the Saudi population

Directory of Open Access Journals (Sweden)

J. Francis Borgio

2015-11-01

Full Text Available Alpha-thalassemia (α-thal is a disorder caused by the deletion of single or double α-globin genes, and/or point mutations in the α-globin genes. There are 2 common types of α-globin genes; HBA2 and HBA1. Recently, it has been discovered that the HBA2 gene is replaced by a unique HBA12 gene convert in 5.7% of the Saudi population. The α-globin genes have been emerging as a molecular target for the treatment of β-thalassemia (β-thal. Hence, it is essential to understand the molecular nature of α-globin genes to treat the most prevalent hemoglobin disorders, such as sickle cell disease, α-thal, and β-thal prevalent in the Kingdom of Saudi Arabia. Thirty-two different α-globin genotypes have been observed in the Saudi population. This review outlines the classification of the α-globin genes on the basis of their molecular nature and complex combinations of α-globin genes, and their variants predominant in Saudis.

Prevalence of Co-Inheritance of Alpha-Thalassemia with Beta-Thalassemia and Beta-Hemoglobinopathy in Ahvaz City

OpenAIRE

Najmaddin Saki; Akbar Dorgalaleh; Zahra Kashani Khatib; Shaban Alizadeh; Fakher Rahim; Hamid Galehdari; Bijan Kaikhaei; Mohammad Pedram; Ali Dehghani Fard

2013-01-01

Background: Co-inheritance of hemoglobin gene defects is a rare important status that can lead to double heterozygote or homozygote with significant clinical manifestations. Such conditions can be observed in co-inheritance of alpha-thalassemia with beta-thalassemia or hemoglobinopathy. The aim of this study was to evaluate the prevalence of alpha-thalassemia with beta-thalassemia and hemoglobinopathy co-inheritance in a considerable number of Iranian.   Methods: This descriptive study was pe...

Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

Science.gov (United States)

Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- - SEA ) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - - SEA deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α 0 -thal carrier.

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

Directory of Open Access Journals (Sweden)

Elza Miyuki Kimura

2015-04-01

Full Text Available Background: Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods: A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC. Mutations were identified by molecular analyses, and the oxygen affinity, heme-heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results: Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion: The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations.

Recent trends in the gene therapy of β-thalassemia

Science.gov (United States)

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

Science.gov (United States)

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Scintigraphic evaluation of bone involvement in beta thalassemia major

International Nuclear Information System (INIS)

Armijo, Soledad; Hidalgo, Pablo

2000-01-01

In this article, the authors describe a 19 year old man with beta-thalassemia major and back pain, who was studied with a Tc99m Metilendiphosphonate (Tc99m MDP) bone scan. This case shows many of the complications of beta-thalassemia major in the skeletal system. Also we can see some indirect signs of endocrinopathies associated (Au)

Hemochromatosis C282Y gene mutation as a potential susceptibility factor for iron-overload in Egyptian beta-thalassemia patients

Directory of Open Access Journals (Sweden)

G.M. Mokhtar

2018-04-01

Full Text Available Background: Hereditary hemochromatosis is the most frequent cause of primary iron overload that is associated with HFE gene’s mutation especially the C282Y mutation. The interaction between hemoglobin chain synthesis’ disorders and the C282Y mutation may worsen the clinical picture of beta-thalassemia major (β-TM. Aim: To establish the prevalence of the C282Y mutations in Egyptian β-TM patients and to address its adverse effects. Methods: Two-hundred and five β-TM patients were recruited and divided into two groups based on their serum ferritin (SF; group I (N = 125 (SF ≤ 2500 ng/dl and group II (N = 80 (SF > 2500 ng/dl. All patients were subjected to clinical and laboratory assessment with special emphasis on iron overload complications. Genotyping was assessed by polymerase chain reaction for detection of C282Y mutation in HFE gene. Results: The C282Y mutation was not detected in the studied β-TM neither in homozygous nor heterozygous state. There were several iron overload complications including cardiac complication (9.1%, liver disease (36.6%, delayed puberty (56.6%, primary (35.71% and secondary amenorrhea (21.42%, short stature (27.3%, diabetes (3.4%, neutropenia (9.7%, arthralgia (10.2%, gastrointestinal (21.1%, depression (2.9% and others (12.05%. Group I showed a statistically significant lower rate of taking iron-rich diet when compared to group II. Group II showed significant longer mean duration of disease, higher total transfusion rate per life, lower mean HbF% level, higher mean HbA% level, and higher rate of elevated liver enzymes than patients with SF ≤ 2500 ng/dl. Conclusion: The C282Y mutation was not detected in the studied cohort of Egyptian β-TM patients neither in homozygous nor heterozygous state in spite of manifestations of iron overload complications. Keywords: Beta-thalassemia major, Hereditary hemochromatosis, The C282Y mutation, Iron overload complications, Egyptian

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

Science.gov (United States)

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

β-Thalassemia Intermedia: A Bird's-Eye View.

Science.gov (United States)

Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

2014-03-01

Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum's extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia

Regional consensus opinion for the management of Beta thalassemia major in the Arabian Gulf area

Science.gov (United States)

2013-01-01

Thalassemia syndrome has diverse clinical presentations and a global spread that has far exceeded the classical Mediterranean basin where the mutations arose. The mutations that give rise to either alpha or beta thalassemia are numerous, resulting in a wide spectrum of clinical severity ranging from carrier state to life-threatening, inherited hemolytic anemia that requires regular blood transfusion. Beta thalassemia major constitutes a remarkable challenge to health care providers. The complications arising due to the anemia, transfusional iron overload, as well as other therapy-related complications add to the complexity of this condition. To produce this consensus opinion manuscript, a PubMed search was performed to gather evidence-based original articles, review articles, as well as published work reflecting the experience of physicians and scientists in the Arabian Gulf region in an effort to standardize the management protocol. PMID:24044606

Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

Science.gov (United States)

Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

2005-11-01

Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

α:Non–α and Gγ:Aγ globin chain ratios in thalassemia intermedia patients treated with hydroxyurea

Directory of Open Access Journals (Sweden)

Abbas Najjari

2014-05-01

Conclusions: Improvement in α:non-α ratio and consequent decrease of free α-globin chain might be the cause of beneficial effects of hydroxyurea therapy. Two patients who felt better didn't show significant increase in their fetal hemoglobin level, and this is in contradiction with the hypothesis claiming that the HbF level increase is the cause of such therapeutic effect. In spite of the unclear mechanism of action of this drug, hydroxyurea therapy had noticeable impacts on thalassemia intermedia and also sickle cell disease and even patients suffering from thalassemia major.

HB KURDISTAN [ALPHA-47(CE5)ASP-]TYR], A NEW ALPHA-CHAIN VARIANT IN COMBINATION WITH BETA-THALASSEMIA

NARCIS (Netherlands)

GIORDANO, PC; HARTEVELD, CL; STRENG, H; Oosterwijk, Jan; HEISTER, JGAM; AMONS, R; BERNINI, LF

1994-01-01

We have characterized the structural abnormality of a new alpha chain mutant found in a Kurdish; family. The clinical and hematological investigation of eight individuals have shown that the a variant is associated with a beta degrees-thalassemia mutation (nonsense codon 39). The tryptic peptide map

beta-Thalassemia present in cis to a new beta-chain structural variant, Hb Vicksburg [beta 75 (E19)Leu leads to 0].

Science.gov (United States)

Adams, J G; Steinberg, M H; Newman, M V; Morrison, W T; Benz, E J; Iyer, R

1981-01-01

Hemoglobin Vicksburg was discovered in a 6-year-old Black boy who had been anemic since infancy. Examination of his hemolysate revealed 87.5% Hb F, 2.4% Hb A2, and 7.6% Hb Vicksburg, which had the electrophoretic and chromatographic properties of Hb A. Structural analysis of Hb Vicksburg demonstrated a deletion of leucine at beta 75(E19), a new variant. Hb Vicksburg was neither unstable nor subject to posttranslational degradation. The alpha/non-alpha biosynthetic ratio was 2.6. Because the proband appeared to be a mixed heterozygote for Hb Vicksburg and beta 0-thalassemia, Hb Vicksburg should have comprised the major portion of the hemolysate. Thus, Hb Vicksburg was synthesized at a rate considerably lower than would be expected on the basis of gene dosage. There was no reason to suspect abnormal translation of beta Vicksburg mRNA; in individuals with Hb St. Antoine (beta 74 and beta 75 deleted), the abnormal hemoglobin comprised 25% of the hemolysate in the simple heterozygote yet was unstable. Deletion of beta 75, therefore, would not in itself appear to lead to diminished synthesis. There was a profound deficit of beta Vicksburg mRNA when measured by liquid hybridization analysis with beta cDNA. The most plausible explanation for the low output of Hb Vicksburg is that a mutation for beta +-thalassemia is present in cis to the structural mutation.

β-Thalassemia Intermedia: A Bird’s-Eye View

Science.gov (United States)

Haddad, Anthony; Tyan, Paul; Radwan, Amr; Mallat, Naji; Taher, Ali

2014-01-01

Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe

β-Thalassemia Intermedia: A Bird’s-Eye View

Directory of Open Access Journals (Sweden)

Anthony Haddad

2014-03-01

Full Text Available Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison

Hemoglobin Interlaken in combination with beta thalassemia trait

Directory of Open Access Journals (Sweden)

Mara J. Ojeda

2013-01-01

Full Text Available We report a rare a1 globin gene variant (Hb Interlaken found in a 63-year-old woman of Italian ancestry living in Buenos Aires Province, Argentina. The variant, a missense mutation at cd15 (GGT → GAT causing a Gly →Asp amino acid substitution and also known as Hb J Oxford, was found in combination with the common thalassemia trait cd 39 (C→T. The clinical picture of the patient was that of a b-thalassemia trait. 我们曾报道在阿根廷布宜诺斯艾利斯一名63岁意大利血统的妇女体内发现罕有的1珠蛋白基因（因特拉肯血红蛋白）变体。研究发现该变体是导致Gly → Asp氨基酸置的错义突变，也称为Hb J Oxford，与常见的地中海贫血性症cd 39 （C → T）有关。该患者临床症状与乙型地中海贫血特征相同。

Production and characterization of monoclonal antibodies against α-globin chain-containing human hemoglobins for detecting α-thalassemia disease.

Science.gov (United States)

Pakdeepak, Kanet; Pata, Supansa; Chiampanichayakul, Sawitree; Kasinrerk, Watchara; Tatu, Thanusak

2016-01-01

Monoclonal antibodies against α-globin containing human Hbs, named AMS-Alpha1 and AMS-Alpha 2, were produced by the hybridoma technique using spleen cells enriched by the newly developed B lymphocyte enrichment protocol. These two monoclonal antibodies were of IgM class, reacting to only intact form of human Hbs A, A2, E, and F, which contain α-globin chain. By the indirect ELISA, the AMS-Alpha1 and AMS-Alpha 2 quantified less amount of α-globin chain containing hemoglobins in HbH disease than the SEA-α thalassemia 1 carriers and normal individuals. It was thus anticipated that these monoclonal antibodies can be used for detecting Hb Bart's hydrops fetalis in which no α-globin chain is produced.

Perfil de beta talassemia heterozigota obtido a partir de análise data mining em banco de dados The profile of beta thalassemia obtained by data mining analysis in a database

Directory of Open Access Journals (Sweden)

Ana L. B. Domingos

2010-02-01

Full Text Available Variations in the phenotypic expression of heterozygous beta thalassemia reflect the formation of different populations. To better understand the profile of heterozygous beta-thalassemia of the Brazilian population, we aimed at establishing parameters to direct the diagnosis of carriers and calculate the frequency from information stored in an electronic database. Using a Data Mining tool, we evaluated information on 10,960 blood samples deposited in a relational database. Over the years, improved diagnostic technology has facilitated the elucidation of suspected beta thalassemia heterozygote cases with an average frequency of 3.5% of referred cases. We also found that the Brazilian beta thalassemia trait has classic increases of Hb A2 and Hb F (60%, mainly caused by mutations in beta zero thalassemia, especially in the southeast of the country.

alpha-thalassemia, HbS, and beta-globin gene cluster haplotypes in two Afro-Uruguayan sub-populations from northern and southern Uruguay

Directory of Open Access Journals (Sweden)

Julio A. da Luz

2006-01-01

Full Text Available Hemoglobinopathies are the most common monogenic disorders worldwide; however, they have never been systematically studied from a genetic perspective in Uruguay. In this study, we determined the frequencies of hemoglobin variants in Afro-Uruguayans. A sample of 52 healthy unrelated Afro-Uruguayans from the northern (N = 28 and southern (N = 24 regions of the country was analyzed. Eight individuals (15.4% were heterozygous for -alpha3,7thalassemia; seven of them (29.2% were originally from the southern region, whereas one of them (3.6% was from the northern region; the differences between both regions were statistically significant (p = 0.016 +/-0.003. The only structural mutation detected was betaS, which is typical of African populations. Four individuals (10% were heterozygous for betaS, three of them (13.6% from the South, and one (5.6% from the North. The betaS haplotypes were analyzed in eight individuals: two were homozygous betaS/betaS, two were heterozygous betaS/betathal, and four were heterozygous betaS/betaª. This haplotype distribution (60% Bantu, 20% Benin, and 20% Bantu A2 is in agreement with historical records reporting a predominantly Bantu origin for the enslaved Africans brought to Uruguay. Even though this is a preliminary study, due to the small sample size, our results are suggestive of a relatively high incidence of hemoglobinopathies in the Afro-Uruguayan population.

Relationship of the Interaction Between Two Quantitative Trait Loci with γ-Globin Expression in β-Thalassemia Intermedia Patients.

Science.gov (United States)

NickAria, Shiva; Haghpanah, Sezaneh; Ramzi, Mani; Karimi, Mehran

2018-05-10

Globin switching is a significant factor on blood hemoglobin (Hb) level but its molecular mechanisms have not yet been identified, however, several quantitative trait loci (QTL) and polymorphisms involved regions on chromosomes 2p, 6q, 8q and X account for variation in the γ-globin expression level. We studied the effect of interaction between a region on intron six of the TOX gene, chromosome 8q (chr8q) and XmnI locus on the γ-globin promoter, chr11p on γ-globin expression in 150 β-thalassemia intermedia (β-TI) patients, evaluated by statistical interaction analysis. Our results showed a significant interaction between one QTL on intron six of the TOX gene (rs9693712) and XmnI locus that effect γ-globin expression. Interchromosomal interaction mediates through transcriptional machanisms to preserve true genome architectural features, chromosomes localization and DNA bending. This interaction can be a part of the unknown molecular mechanism of globin switching and regulation of gene expression.

First Case of a Compound Heterozygosity for Two Nondeletional α-Thalassemia mutations, Hb Constant Spring and Hb Quong Sze.

Science.gov (United States)

Zhou, Jian-Ying; Yan, Jin-Mei; Li, Jian; Li, Dong-Zhi

2016-06-01

Nondeletional α-thalassemia (α-thal) is the result of point mutations in critical regions of the α-globin genes, affecting mRNA processing, mRNA translation, or α-globin stability. Hb Constant Spring (Hb CS, HBA2: c.427T > C) is the most common nondeletional α-thal that results from a nucleotide substitution at the termination codon of the α2-globin gene. Hb Quong Sze (Hb QS, HBA2: c.377T > C) is another nondeletional α-thal in South China with the missense mutation at codon 125 of the α2-globin gene making this hemoglobin (Hb) variant highly unstable. Although homozygosity for Hb CS (α(CS)α/α(CS)α) or Hb QS (α(QS)α/α(QS)α) has been reported, clinical pictures vary from severe hemolysis that developed early in life to only mild anemia, no clinical phenotypic data of compound heterozygosity for Hb CS/Hb QS (α(CS)α/α(QS)α) has been described. In this report we describe an adult case with such a compound heterozygosity who presented with a mild α-thal.

Synthetic review on the different anthropological aspects of ...

African Journals Online (AJOL)

Hemoglobinopathies are a group of hereditary hemolytic anemia characterized by qualitative (sickle cell disease) or quantitative (thalassemia) defects in the alpha or beta-globin chain synthesis. Homozygotes or compound heterozygotes for the mutated alpha or beta-globin genes can cause severe anemia at an early age.

Portal vein thrombosis after splenectomy for beta-thalassemia major

International Nuclear Information System (INIS)

Al-Hawsawi, Zakaria M.; Tarawah, Ahmed M.; Hassan, Ruhul Amin A.; Haouimi, Ammar S.

2004-01-01

Portal vein thrombosis is a recognized complication after splenectomy for beta-thalassemia major due to the chronic hypercoagulable state which has been recognized to exist in childhood thalassemia and contribute to thromboembolic events. We reporting one patient with beta-thalassemia major developed portal vein thrombosis following splenectomy. (author)

β-THALASSEMIA DISTRIBUTION IN THE OLD WORLD: A HISTORICAL STANDPOINT OF AN ANCIENT DISEASE

Directory of Open Access Journals (Sweden)

Vincenzo De Sanctis

2017-02-01

Full Text Available Abstract Background: Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β -thalassaemia is characterised by the reduced synthesis (β + or absence (β o of the β-globin chains in the HbA molecule, resulting in accumulation of  excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers of the β-thalassemias: there is a high incidence in populations extending from the Mediterranean basin throughout the Middle East, the Indian subcontinent, Southeast Asia, Melanesia and into the Pacific Islands Aim: The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and  in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations.     Results: Mutations involving the ß-globin gene are the most common cause of genetic disorders  in humans. To date, more than 350 β -thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of individual population’s specific mutations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions: Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at its geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity and settlements. The

Molecular basis for nondeletion alpha-thalassemia in American blacks. Alpha 2(116GAG----UAG).

OpenAIRE

Liebhaber, S A; Coleman, M B; Adams, J G; Cash, F E; Steinberg, M H

1987-01-01

An American black woman was found to have the phenotype of moderately severe alpha-thalassemia normally associated with the loss of two to three alpha-globin genes despite an alpha-globin gene map that demonstrated the loss of only a single alpha-globin gene (-alpha/alpha alpha). Several individuals in her kindred with normal alpha-globin gene mapping studies (alpha alpha/alpha alpha) had mild alpha-thalassemia hematologic values consistent with the loss of one to two alpha-globin genes. Thes...

β-Thalassemia Distribution in the Old World: an Ancient Disease Seen from a Historical Standpoint

Science.gov (United States)

De Sanctis, Vincenzo; Kattamis, Christos; Canatan, Duran; Soliman, Ashraf T.; Elsedfy, Heba; Karimi, Mehran; Daar, Shahina; Wali, Yasser; Yassin, Mohamed; Soliman, Nada; Sobti, Praveen; Al Jaouni, Soad; El Kholy, Mohamed; Fiscina, Bernadette; Angastiniotis, Michael

2017-01-01

Background Haemoglobinopathies constitute the commonest recessive monogenic disorders worldwide, and the treatment of affected individuals presents a substantial global disease burden. β-thalassaemia is characterised by the reduced synthesis (β+) or absence (βo) of the β-globin chains in the HbA molecule, resulting in accumulation of excess unbound α-globin chains that precipitate in erythroid precursors in the bone marrow and in the mature erythrocytes, leading to ineffective erythropoiesis and peripheral haemolysis. Approximately 1.5% of the global population are heterozygotes (carriers) of the β-thalassemias; there is a high incidence in populations from the Mediterranean basin, throughout the Middle East, the Indian subcontinent, Southeast Asia, and Melanesia to the Pacific Islands. Aim The principal aim of this paper is to review, from a historical standpoint, our knowledge about an ancient disease, the β-thalassemias, and in particular, when, how and in what way β-thalassemia spread worldwide to reach such high incidences in certain populations. Results Mutations involving the β-globin gene are the most common cause of genetic disorders in humans. To date, more than 350 β-thalassaemia mutations have been reported. Considering the current distribution of β- thalassemia, the wide diversity of mutations and the small number of specific mutations in individual populations, it seems unlikely that β-thalassemia originated in a single place and time. Conclusions Various processes are known to determine the frequency of genetic disease in human populations. However, it is almost impossible to decide to what extent each process is responsible for the presence of a particular genetic disease. The wide spectrum of β-thalassemia mutations could well be explained by looking at their geographical distribution, the history of malaria, wars, invasions, mass migrations, consanguinity, and settlements. An analysis of the distribution of the molecular spectrum of

Reactivation of fetal hemoglobin in thalassemia and sickle cell disease

Directory of Open Access Journals (Sweden)

Sandro Eridani

2014-09-01

Full Text Available Considerable attention has been recently devoted to mechanisms involved in the perinatal hemoglobin switch, as it was long ago established that the survival of fetal hemoglobin (HbF production in significant amount can reduce the severity of the clinical course in severe disorders like β-thalassemia and sickle cell disease (SCD. For instance, when β-thalassemia is associated with hereditary persistence of fetal hemoglobin (HPFH the disease takes a mild course, labeled as thalassemia intermedia. The same clinical amelioration occurs for the association between HPFH and SCD. As for the mechanism of this effect, some information has been obtained from the study of natural mutations at the human β-globin locus in patients with increased HbF, like the Corfu thalassemia mutations. Important evidence came from the discovery that drugs capable of improving the clinical picture of SCD, like decitabine ad hydroxycarbamide, are acting through the reactivation, to some extent, of HbF synthesis. The study of the mechanism of action of these compounds was followed by the identification of some genetic determinants, which promote this event. In particular, among a few genetic factors involved in this process, the most relevant appears the BCL11A gene, which is now credited to be able to silence γ-globin genes in the perinatal period by interaction with several erythroid-specific transcription factors and is actually considered as a barrier to HbF reactivation by known HbF inducing agents. Epigenetics is also a player in the process, mainly through DNA demethylation. This is certified by the recent demonstration that hypomethylating agents such as 5-azacytidine and decitabine, the first compounds used for HbF induction by pharmacology, act as irreversible inhibitors of demethyltransferase enzymes. Great interest has also been raised by the finding that several micro-RNAs, which act as negative regulators of gene expression, have been implicated in the

Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

Directory of Open Access Journals (Sweden)

Jorge S.B.

2003-01-01

Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

Shortened of the crown and root lengths of the mandibular permanent molar in beta major thalassemia children

Directory of Open Access Journals (Sweden)

Indra Primathena

2011-07-01

Full Text Available Beta major thalassemia is a genetically inherited blood disorder due to a genetic mutation on the polypeptide chains of hemoglobin which is manifested in the growth and development of the tooth. The objectives of the investigation were to obtain differences of the crown and root lengths of the mandibular first right side permanent molar between beta major thalassemia children and normal children group at the matching ages of 11 to 13 years old. The descriptive comparative method was used in the study and samples were selected using the purposive sampling technique. Sample numbers, which were obtained using the consecutive sampling technique, consists of 12 children of beta major thalassemia and 12 of normal children at the matching ages of 11 to 13 years. Periapical radiographs of both thalassemia and normal children were administered using the method of Seow and Lai. Data were analyzed using t-test method. The study revealed that the crown and root lengths of the mandibular first right side permanent molar of beta major thalassemia children were shorter than normal children at the ages of 11 to 13 years.

Associations between a health-promoting lifestyle and quality of life among adults with beta-thalassemia major.

Science.gov (United States)

Maheri, Aghbabak; Sadeghi, Roya; Shojaeizadeh, Davoud; Tol, Azar; Yaseri, Mehdi; Ebrahimi, Mojtaba

2016-01-01

A health-promoting lifestyle (HPL) is a factor that affects the quality of life (QoL) in patients with beta-thalassemia (β-thalassemia). Due to the lack of studies of this issue, this study aimed to determine the association between HPL and QoL among adults with β-thalassemia. This cross-sectional (descriptive-analytic) study was conducted among 389 adult patients with β-thalassemia in Tehran, Iran. The research instrument included a questionnaire consisting of three parts: demographic items, the Short-Form Health Survey and the Health-Promoting Lifestyle Profile. The data were analyzed using SPSS version 23.0. The results were considered significant at the conventional pthalassemia; these four dimensions explained 37.9% of the variance in QoL. QoL and HPL were not at acceptable levels among patients with thalassemia. Therefore, educational interventions emphasizing spiritual growth, physical activity, and interpersonal relations are necessary for patients with thalassemia.

One-Step Biallelic and Scarless Correction of a β-Thalassemia Mutation in Patient-Specific iPSCs without Drug Selection

Directory of Open Access Journals (Sweden)

Yali Liu

2017-03-01

Full Text Available Monogenic disorders (MGDs, which are caused by single gene mutations, have a serious effect on human health. Among these, β-thalassemia (β-thal represents one of the most common hereditary hematological diseases caused by mutations in the human hemoglobin β (HBB gene. The technologies of induced pluripotent stem cells (iPSCs and genetic correction provide insights into the treatments for MGDs, including β-thal. However, traditional approaches for correcting mutations have a low efficiency and leave a residual footprint, which leads to some safety concerns in clinical applications. As a proof of concept, we utilized single-strand oligodeoxynucleotides (ssODNs, high-fidelity CRISPR/Cas9 nuclease, and small molecules to achieve a seamless correction of the β-41/42 (TCTT deletion mutation in β thalassemia patient-specific iPSCs with remarkable efficiency. Additionally, off-target analysis and whole-exome sequencing results revealed that corrected cells exhibited a minimal mutational load and no off-target mutagenesis. When differentiated into hematopoietic progenitor cells (HPCs and then further to erythroblasts, the genetically corrected cells expressed normal β-globin transcripts. Our studies provide the most efficient and safe approach for the genetic correction of the β-41/42 (TCTT deletion in iPSCs for further potential cell therapy of β-thal, which represents a potential therapeutic avenue for the gene correction of MGD-associated mutants in patient-specific iPSCs.

Molecular basis for dominantly inherited inclusion body β-thalassemia

International Nuclear Information System (INIS)

Thein, S.L.; Hesketh, C.; Wood, W.G.; Clegg, J.B.; Old, J.M.; Weatherall, D.J.; Taylor, P.; Temperley, I.J.; Hutchinson, R.M.

1990-01-01

Analysis of the molecular basis of dominantly inherited β-thalassemia in four families has revealed different mutations involving exon 3 of the β-globin gene. It is suggested that the phenotypic difference between this condition and the more common recessive forms of β-thalassemia lies mainly in the length and stability of the abnormal translation products that are synthesized and, in particular, whether they are capable of binding heme and producing aggregations that are relatively resistant to proteolytic degradation

BETA-THALASSEMIA SYNDROMES, CLINICAL AND LABORATORY APPROACH

OpenAIRE

Türkkan, Emine; Berrak, Su Gülsün; Canpolat, Cengiz

2016-01-01

The Beta ((3) thalassemia syndromes are a heterogeneous group of genetic disorders. The frequency of thalassemia is dependent on the ethnic origins of the patient population. Turkey is located in a geographic area of the world where thalassemia syndromes are common. The incidence rate of (3-thalassemia carriers was stated to be 2 per cent in Turkey. Clinical manifestations are diverse and range from asymptomatic hypochromia and microcytosis to profound anemia leading to death in early childho...

Cross-Sectional Study for the Detection of Mutations in the Beta-Globin Gene Among Patients with Hemoglobinopathies in the Bengali Population.

Science.gov (United States)

Panja, Amrita; Chowdhury, Prosanto; Chakraborty, Sharmistha; Ghosh, Tapan Kumar; Basu, Anupam

2017-01-01

Thalassemia is a common autosomal recessive blood disorder, which is most prevalent in South East Asian and Mediterranean populations. It is considered as a major health burden in the Indian population. The aims of the present study were to investigate the common, as well as uncommon, mutations responsible for thalassemia in the Bengali population. The Bengali state was divided into four sampling zones. Mutation detection was done using Sanger sequencing of the HBB gene. A total of 14 different mutations were observed, including rare mutations IVS1-130(G>C), IVS1-129(A>C), -90(T>C), CD16(-C), -30(T>C), CD15(-T), and a novel mutation CD53(C>T). The frequencies of IVS1-5(G>C) and CD26(G>A) mutations were higher than other mutations. There were also some silent polymorphisms found in the studied group, CD3(T>C), CD10(C>A), IVSII-16(G>C), IVSII-74(T>G), -42(C>G). The present study is the first attempt to screen for β-thalassemia-causing mutations by direct sequencing in different districts of West Bengal. The information obtained from the present study may be helpful for thalassemia management and prenatal mutation detection.

Extramedullary hematopoiesis and paraplegia in a patient with hemoglobin e-Beta thalassemia.

Science.gov (United States)

Alam, M R; Habib, M S; Dhakal, G P; Khan, M R; Rahim, M A; Chowdhury, A J; Mahmud, T K

2010-07-01

Extramedullary hematopoiesis (EMH) occurs in patients with various hematologic disorders involving a chronic increase in the production of red blood cells, and is often associated polycythemia vera and sickle cell anaemia, but is less common with thalassemia especially with hemoglobin E-beta thalassemia. Spinal cord compression due to EMH is a extremely rare complication of thalassemia and may present with paraparesis or paraplegia with or without sensory impairment. Treatment options mostly include surgery and/or radiotherapy. Whereas cases presenting with paraplegia have been treated with either surgery or radiotherapy with equal frequency and efficacy, almost all reported cases with paraplegia have been treated with surgery with or without radiation therapy. We hereby report a case of hemoglobin E-beta thalassemia with paraplegia treated successfully with radiotherapy.

Thalassemia intermedia as a result of heterozygosis for ß0-thalassemia and aaaanti-3.7/aa genotype in a Brazilian patient

Directory of Open Access Journals (Sweden)

Kimura E.M.

2003-01-01

Full Text Available We report a case in which the interaction of heterozygosis for both the ß0-IVS-II-1 (G->A mutation and the aaaanti-3.7 allele was the probable cause for the clinical occurrence of thalassemia intermedia. The propositus, a 6-year-old Caucasian Brazilian boy of Portuguese descent, showed a moderately severe chronic anemia in spite of having the ß-thalassemia trait. Investigation of the alpha-globin gene status revealed heterozygosis for alpha-gene triplication (aaa/aa. The patient's father, also presenting mild microcytic and hypochromic anemia, had the same alpha and ß genotypes as his son, while the mother, not related to the father and hematologically normal, was also a carrier of the aaaanti-3.7 allele. The present case emphasizes the need for considering the possibility of alpha-gene triplication in ß-thalassemia heterozygotes who display an unexpected severe phenotype. The ß-thalassemia mutation found here is being described for the first time in Brazil.

Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

Energy Technology Data Exchange (ETDEWEB)

Karimi, Mehran [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)], E-mail: Karimim@sums.ac.ir; Bagheri, Mohammad Hadi [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Tahmtan, Mehdi [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of); Shakibafard, Alireza [Department of Radiology, School of Medicine, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of); Rashid, Murtaza [Hemostasis and Thrombosis Unit, Hematology Research Center, school of Medicine, Shiraz University of medical sciences, Shiraz (Iran, Islamic Republic of)

2009-01-15

Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 {+-} 133.97 and 126.29 {+-} 53.98 mm{sup 3}, respectively. Average spleen lengths in case and control groups were 10.71 {+-} 1.52 and 10.60 {+-} 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients.

molecular analysis of intron-1 mutation in β-Globin gene of β-Thalassemia

International Nuclear Information System (INIS)

Kamel, S.A.L.M.

2004-01-01

β-thalassemia is considered the most common genetic disorder worldwide, it occurs in a particularly high frequency in abroad belt extending from the mediterranean basin through the middle east, and abundance in egypt. the thalassemias are a group of genetic (inherited) blood disorders that share in common one feature, the defective production of hemoglobin. there are many different disorders with defective hemoglobin synthesis and, hence, many types of thalassemia. about 3% of the world's population (180 million people) carry β-thalassemia genes.the present study was carried out in the biological application department of nuclear research center, atomic energy authority and microbiology department and hematology unit of pediatrics department, faculty of medicine, Zagazig University

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

Science.gov (United States)

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

Interaction of hemoglobin Grey Lynn (Vientiane) with a non-deletional α(+)-thalassemia in an adult Thai proband.

Science.gov (United States)

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2014-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.

The effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients

Directory of Open Access Journals (Sweden)

Soleiman Mahjoub

2007-12-01

Full Text Available BACKGROUND: Thalassemia is the most common hereditary disease in the world. Thalassemic erythrocytes are exposed to higher oxidative stress and lipid peroxidation. The aim of this study was to investigate the effects of beta-carotene and vitamin E on erythrocytes lipid peroxidation in beta-thalassemia patients.
METHODS: A prospective double-blind, placebo-controlled study of the effect of beta-carotene and vitamin E on lipid peroxidation in erythrocytes membranes was performed on 120 beta-thalassemia major patients in four groups. The patients were supplemented for 4 weeks as follows: group 1 with beta-carotene (13 mg/day, group 2 with vitamin E (550 mg/day, group 3 with beta-carotene plus vitamin E and group 4 with placebo. We prepared all capsules for 4 roups in the same shape and color. Measurements of serum beta-carotene and vitamin E were performed by high performance
liquid chromatography. After preparation of ghost cells from blood specimens, malondialdehyde (MDA was determined as index of lipid peroxidation in erythrocytes membranes before and after treatment. RESULTS: The levels of serum beta-carotene and vitamin E were significantly lower and MDA concentrations in erythrocytes membranes were significantly higher in beta-thalassemia patients compared to controls (P<0.001. In groups that treated with vitamin supplements for 4-weeks, lipid peroxidation rates were significantly reduced after treatment (P<0.001, but in placebo group there was not significant difference (P>0.05.
CONCLUSIONS: Our findings provide evidence that an oral treatment with beta-carotene and vitamin E can significantly reduce lipid peroxidation of erythrocytes membranes and could be useful in management of beta-thalassemia major patients. KEYWORDS: Beta-thalassemia major, beta-carotene, vitamin E, malondialdehyde, lipid peroxidation.

Prevalence of hepatosplenomegaly in beta thalassemia minor subjects in Iran

International Nuclear Information System (INIS)

Karimi, Mehran; Bagheri, Mohammad Hadi; Tahmtan, Mehdi; Shakibafard, Alireza; Rashid, Murtaza

2009-01-01

Introduction: Thalassemia is the most common hereditary blood disorder in the world. Iran is located on the thalassemic belt and there is a high prevalence of the hepatosplenomegaly in beta thalassemia minor patients which is reported to be very variable. The goal of this research was to study the frequency of these signs in the cases with beta thalassemia minor patients in Iran. Materials and methods: Two hundred and fifty-nine cases that referred to center for pre-marriage tests were divided into two groups according to their MCV, MCH, and HbA2 (beta thalassemia minor cases and control groups). Liver and spleen sizes were determined by ultrasonographic method and the two groups were compared with each other. Results: Average spleen volumes in case and control groups were 163.48 ± 133.97 and 126.29 ± 53.98 mm 3 , respectively. Average spleen lengths in case and control groups were 10.71 ± 1.52 and 10.60 ± 5.4 cm, respectively. Conclusion: In the regions with high frequency of beta thalassemia, in case of finding large spleen size in the ultrasonography, a probable harmless differential diagnosis will be beta thalassemia minor that is not indicative of any serious disease. Volumetric measurement of spleen is more reliable for detection of splenomegaly in these patients

Dificuldades na identificação laboratorial da talassemia alfa Difficulty on laboratory identification of alpha thalassemia

Directory of Open Access Journals (Sweden)

Karlla Greick Batista Dias-Penna

2010-04-01

Full Text Available Introdução: Talassemia alfa é uma síndrome associada à redução da síntese de cadeias de globina do tipo alfa. A gravidade das manifestações clínicas está relacionada com a quantidade de globinas produzida e a estabilidade das cadeias beta presentes em excesso. A talassemia alfa mínima resulta da deleção de apenas um dos quatro genes a (-α/αα. Clinicamente apresenta anemia leve com microcitose ou ausência de anemia, sendo o diagnóstico realizado por meio de visualização da hemoglobina (Hb H por eletroforese alcalina em acetato de celulose ou por identificação de inclusões celulares de Hb H coradas pelo azul de crezil brilhante. Objetivo: Avaliar portadores de talassemia alfa e seus respectivos progenitores, correlacionando perfil hematológico e presença de Hb H, utilizando procedimentos laboratoriais clássicos em três diferentes amostragens. Discussão e conclusão: Os dados obtidos mostram que a presença de Hb H, indicativo de talassemia alfa, pode não ser confirmada em uma análise posterior. Entre os fatores que podem influenciar no não aparecimento de Hb H em pessoa comprovadamente com talassemia alfa está a deficiência de ferro. A talassemia alfa está associada a defeitos envolvendo os genes codificadores da cadeia alfa, mas também pode estar relacionada com desbalanciamento temporário na expressão dos genes globina, diminuição de alfa ou aumento de beta, o que poderia explicar o aparecimento de tetrâmeros de cadeia beta (Hb H, sugerindo diagnóstico de talassemia alfa mínima.Introduction: Alpha thalassemia is a syndrome with associated with the reduction of alpha globin chain synthesis. The severity of clinical manifestations is related to the amount of globins produced and the stability of beta chains that are present in excess. Alpha thalassemia minor is caused by the deletion of one of the four genes a (-α/αα. Clinically, it presents mild anemia with microcytosis or absence of anemia. The

Long-term high-level expression of human beta-globin occurs following transplantation of transgenic marrow into irradiated mice.

Science.gov (United States)

Himelstein, A; Ward, M; Podda, S; de la Flor Weiss, E; Costantini, F; Bank, A

1993-03-01

When the human beta-globin gene is transferred into the bone marrow cells of live mice, its expression is very low. To investigate the reason for this, we transferred the bone marrow of transgenic mice containing and expressing the human beta-globin into irradiated recipients. We demonstrate that long-term high level expression of the human beta-globin gene can be maintained in the marrow and blood of irradiated recipients following transplantation. Although expression decreased over time in most animals because of host marrow reconstitution, the ratio of human beta-globin transgene expression to endogenous mouse beta-globin gene expression in donor-derived erythroid cells remained constant over time. We conclude that there is no inherent limitation to efficient expression of an exogenous human beta-globin gene in mouse bone marrow cells following marrow transplantation.

Diagnostic utility of isoelectric focusing and high performance liquid chromatography in neonatal cord blood screening for thalassemia and non-sickling hemoglobinopathies.

Science.gov (United States)

Uaprasert, Noppacharn; Settapiboon, Rung; Amornsiriwat, Supaporn; Sarnthammakul, Patsita; Thanapat, Tassanee; Rojnuckarin, Ponlapat; Sutcharitchan, Pranee

2014-01-01

Thalassemia syndromes are highly prevalent in Southeast Asia. In Thailand, high performance liquid chromatography (HPLC) is the most common technique routinely performed in diagnosis of thalassemia and hemoglobinopathies, while isoelectric focusing (IEF) is rarely employed. We compared the diagnostic utility of IEF and HPLC in neonatal screening for thalassemia and non-sickling hemoglobinopathies. Two-hundred and forty-one cord blood samples were analyzed using IEF and HPLC, β-thalassemia short program. The results were correlated with red cell indices and molecular analyses. Hemoglobin (Hb) Bart's was quantified only on IEF. Of 241 newborns, IEF and HPLC yielded 85.4% and 76.4% sensitivity to identify α-thalassemia syndrome, respectively. HbBart's≥2% yielded 100% sensitivity to identify 2 α-globin gene deletions and/or mutations, while MCV≤95fl and MCH≤30pg yielded 100% sensitivity to identify 2 α-globin gene deletions. DNA analysis revealed HbE mutation in all 61 subjects with HbA2>1% on both IEF and HPLC. IEF is an effective method in neonatal screening for thalassemia and non-sickling hemoglobinopathies. The HbBart's level, MCV and MCH are helpful for identifying α-thalassemia. The presence of HbA2 higher than 1% in cord blood indicates HbE carriers in Southeast Asian newborns. © 2013.

Birth of healthy children after preimplantation diagnosis of β-thalassemia

Institute of Scientific and Technical Information of China (English)

焦泽旭; 庄广伦; 周灿权; 舒益民; 李洁; 梁晓燕

2004-01-01

Background Clinical programs for preventing β-thalassemia are presently based on prospective carrier screening and prenatal diagnosis. This paper report an achievement of a pregnancy with unaffected embryos using in vitro fertilization and embryo transfer (IVF-ET), in combination with preimplantation genetic diagnosis (PGD), for a couple at risk of having children with β-thalassemia.Methods A couple carrying different thalassemia mutations, both a codon 41-42 mutation and the IVS Ⅱ 654 mutation, received standard IVF treatment, with intracytoplasmic sperm injection, embryo biopsiy, single cell polymerase chain reaction (PCR) and DNA analysis. Only unaffected or carrier embryos were transferred to the uterine cavity. After confirmation of pregnancy, a prenatal diagnosis was performed.Results Of a total of 13 embryos analyzed for β-globin mutations, PGD indicated that 2 were normal,3 were affected, and 6 were carriers. Diagnosis could not be made in the other 2 embryos. Three embryos were transferred to the uterus on the third day after oocyte retrieval. Ultrasonography revealed a twin pregnancy with one blighted ovum. The prenatal genetic diagnosis revealed that both fetuses were unaffected, and two healthy boys were born, confirming the results of PGD.Conclusions We developed a single-cell based primer extension preamplification (PEP)-PCR assay for the detection of β-thalassemia mutations. The assays were efficient and accurate at all stages of the procedure, and resulted in the birth of PGD-confirmed β-thalassemia free children in China. PEP was used here in PGD for β-thalassemia.

A five' splice-region G → C mutation in exon 1 of the human β-globin gene inhibits pre-mRNA splicing: A mechanism for β+-thalassemia

International Nuclear Information System (INIS)

Vidaud, M.; Vidaud, D.; Amselem, S.; Rosa, J.; Goossens, M.; Gattoni, R.; Stevenin, J.; Chibani, J.

1989-01-01

The authors have characterized a Mediterranean β-thalassemia allele containing a sequence change at codon 30 that alters both β-globin pre-mRNA splicing and the structure of the homoglobin product. Presumably, this G → C transversion at position -1 of intron 1 reduces severely the utilization of the normal 5' splice site since the level of the Arg → Thr mutant hemoglobin (designated hemoglobin Kairouan) found in the erythrocytes of the patient is very low (2% of total hemoglobin). Since no natural mutations of the guanine located at position -1 of the CAG/GTAAGT consensus sequence had been isolated previously. They investigated the role of this nucleotide in the constitution of an active 5' splice site by studying the splicing of the pre-mRNA in cell-free extracts. They demonstrate that correct splicing of the mutant pre-mRNA is 98% inhibited. Their results provide further insights into the mechanisms of pre-mRNA maturation by revealing that the last residue of the exon plays a role at least equivalent to that of the intron residue at position +5

Improvements in the HbVar database of human hemoglobin variants and thalassemia mutations for population and sequence variation studies.

NARCIS (Netherlands)

G.P. Patrinos (George); B. Giardine (Belinda); C. Riemer (Cathy); W. Miller (Webb); D.H. Chui (David); N.P. Anagnou (Nicholas); H. Wajcman (Henri); R.C. Hardison (Ross)

2004-01-01

textabstractHbVar (http://globin.cse.psu.edu/globin/hbvar/) is a relational database developed by a multi-center academic effort to provide up-to-date and high quality information on the genomic sequence changes leading to hemoglobin variants and all types of thalassemia and

[Clinical management of beta-thalassaemia].

Science.gov (United States)

Thuret, Isabelle

2014-10-01

Beta-thalassemia syndromes are autosomal recessive disorders related to the inability to produce beta-globin chains. Thalassemia major is by definition a transfusion dependent anemia and iron overload is the leading cause of death and morbidity. Beta-thalassemia is rarely encountered in France where patients mainly originated from Mediterranean countries and South East Asia. Recently, two major advances have substantially improved the disease management: oral iron chelation therapy and the introduction of cardiac MRI for monitoring cardiac iron. Hematopoietic stem cell transplantation remains, in clinical practice, the only curative approach and is proposed to children having an HLA-identical sibling. Diagnosis of thalassemia trait is important in order to propose genetic counseling to couples at risk. Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Clinical severity increases with age with a more severe anemia, thrombotic complications and extra-medullary hematopoiesis. Iron overload, optimally monitored with liver MRI, occurs in adult patients and is related to increased iron hyper-absorption.

A new alpha(0)-thalassemia deletion found in a Dutch family (--(AW)).

NARCIS (Netherlands)

Phylipsen, M.; Vogelaar, I.P.; Schaap, R.A.; Arkesteijn, S.G.; Boxma, G.L.; Helden, W.C. van; Wildschut, I.C.; Bruin-Roest, A.C. de; Giordano, P.C.; Harteveld, C.L.

2010-01-01

Alpha-thalassemia is an inherited hemoglobin disorder characterized by a microcytic hypochromic anemia caused by a quantitative reduction of the alpha-globin chain. The majority of the alpha-thalassemias is caused by deletions in the alpha-globin gene cluster. A deletion in the alpha-globin gene

Q Sepharose micro-column chromatography: A simple screening method for identifying beta thalassemia traits and hemoglobin E carriers.

Science.gov (United States)

Wong, Peerapon; Sritippayawan, Suchila; Suwannakhon, Narutchala; Tapprom, Akamon; Deoisares, Rawisut; Sanguansermsri, Torpong

2016-11-01

For beta thalassemia control program in pregnancy, mass screening of the carrier state by determination of the hemoglobin (Hb) A 2 and Hb E proportions and mutation analysis is a preferred method for making prenatal diagnoses. Q Sepharose micro-column chromatography, developed for the determination of Hb A 2 and Hb E for screening purposes, was compared with high performance liquid chromatography (HPLC) to ascertain its relative accuracy and reliability. Results using Q Sepharose micro-column chromatography in 350 blood specimens, including 50 samples genetically proven to be beta thalassemia heterozygotes, were compared to HPLC for validation. An additional study was conducted to test a clinical application on a large-scale survey for beta thalassemia in 1581 pregnant women and their spouses. The mean (±SD) Hb A 2 proportions in the normal and genetically proven beta thalassemia heterozygotes were 2.70±0.40% and 6.30±1.23%, respectively, as determined by Q-Sepharose micro-column chromatography, and 2.65±0.31% and 5.37±0.96%, respectively, as determined by HPLC. The mean Hb E proportions in the Hb E heterozygotes were 23.25±4.13% and 24.72±3.5% as determined by Q Sepharose micro-column chromatography and HPLC, respectively. In the large-scale survey for beta thalassemia, 23 at risk couples were detected. Seven affected fetuses were identified by prenatal diagnosis. Q Sepharose micro-column chromatography was found to be reliable, reproducible and well-suited for large-scale surveys. Additionally, by being reusable and convenient, this simple and economical chromatography method may be an alternative means to screen for beta thalassemia and Hb E carriers in the mass population. Copyright © 2016 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Xmni polymorphism and disease severity in patients with beta thalassemia from northern Pakistan

International Nuclear Information System (INIS)

Hanif, T.B.; Ahmed, S.; Anwar, J.

2015-01-01

Thalassemia is a heterogeneous disorder and several genetic factors influence the severity of thalassemia. An accurate and early diagnosis of a mild thalassemia genotype helps to avoid unnecessary transfusion and its complications. The aim of this study is to identify the association between XmnI polymorphism and disease severity in patients with ?-thalassemia from northern Pakistan. Methods: The cross sectional study was conducted at the Department of Haematology, Armed Forces Institute of Pathology (AFIP) Rawalpindi, from September 2006 to June 2009. A total of 90 subjects including 30 with thalassemia major, 30 with thalassemia intermedia and 30 normal individuals were studied. DNA from each subject was tested for 15 ?-thalassemia mutations and the presence of XmnI polymorphism using Amplification Refractory Mutation System and Restriction Fragment Length Polymorphism respectively. Results: One normal and one thalassemia major subject were found to be positive for homozygous and heterozygous XmnI polymorphism respectively. Among the thalassemia intermedia group, XmnI polymorphism was found in 12/30 patients, of whom 10 were homozygous and 2 were heterozygous for it. Conclusion: XmnI polymorphism is an important genotypic factor in Pakistani population for making a prospective diagnosis of thalassemia intermedia and predicting the severity of the disease. (author)

Novel interactions of two α-Hb variants with SEA deletion α0-thalassemia: hematological and molecular analyses.

Science.gov (United States)

Srivorakun, Hataichanok; Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2018-04-01

To report the hematological and molecular features as well as diagnostic aspects of the hitherto un-described interactions of two rare α-globin chain variants with α 0 -thalassemia commonly found among Southeast Asian populations. The study was done on two adult Thai patients (P1 and P2) who had hypochromic microcytic anemia. Hb analysis was carried out using high performance liquid chromatography (HPLC) and capillary electrophoresis (CE). Mutations were identified by PCR and related techniques. Hb analysis of P1 using HPLC showed a normal Hb pattern, but CE demonstrated an abnormal peak at zone 7. DNA sequencing identified a CCG-CTG mutation at codon 95 of the α2 globin gene corresponding to the Hb G-Georgia [α95(G2)Pro → Leu(α2)] previously undescribed in the Thai population. In contrast, Hb analysis of P2 demonstrated an abnormal peak not fully separated from Hb A on HPLC, but not on CE. DNA analysis identified the rarely described Hb Nakhon Ratchasima [α63(E12)Ala → Val(α2)] mutation. Routine DNA analysis detected the SEA deletion α 0 -thalassemia in trans to the Hb variants in both cases. Hematological parameters were compared with those of patients with compound heterozygote for other α-globin variants and α 0 -thalassemia previously documented. Identification of the patients confirmed that interaction of these rare Hb variants with α 0 -thalassemia does not lead to the Hb H disease. Differentiation of these two Hb variants from other clinically relevant hemoglobinopathies in a routine setting is, however, necessary. This can be accomplished using a combined Hb-HPLC and CE analysis followed by PCR-RFLP assays.

Pathophysiology and treatment of patients with beta-thalassemia – an update [version 1; referees: 2 approved

Directory of Open Access Journals (Sweden)

Eitan Fibach

2017-12-01

Full Text Available Thalassemia (thal is an autosomal recessive, hereditary, chronic hemolytic anemia due to a partial or complete deficiency in the synthesis of α-globin chains (α-thal or β-globin chains (β-thal that compose the major adult hemoglobin (α2β2. It is caused by one or more mutations in the corresponding genes. The unpaired globin chains are unstable; they precipitate intracellularly, resulting in hemolysis, premature destruction of red blood cell [RBC] precursors in the bone marrow, and a short life-span of mature RBCs in the circulation. The state of anemia is treated by frequent RBC transfusions. This therapy results in the accumulation of iron (iron overload, a condition that is exacerbated by the breakdown products of hemoglobin (heme and iron and the increased iron uptake for the chronic accelerated, but ineffective, RBC production. Iron catalyzes the generation of reactive oxygen species, which in excess are toxic, causing damage to vital organs such as the heart and liver and the endocrine system. Herein, we review recent findings regarding the pathophysiology underlying the major symptoms of β-thal and potential therapeutic modalities for the amelioration of its complications, as well as new modalities that may provide a cure for the disease.

Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

Science.gov (United States)

Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

2015-05-01

The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

A Family with γ-Thalassemia and High Hb A2 Levels.

Science.gov (United States)

Parmeggiani, Giulia; Gualandi, Francesca; Selvatici, Rita; Rimessi, Paola; Bigoni, Stefania; Taddei Masieri, Marina; Dolcini, Bernadetta; Venturoli, Anna; Cappabianca, Maria P; Ferlini, Alessandra; Ravani, Anna

2016-06-01

We describe a family carrying a γ-globin gene deletion associated with an increase of Hb A2 level beyond the normal range. The family included the proband, his sister and their father, all with increased Hb A2 and normal Hb F levels. The proband and his sister showed borderline values of mean corpuscular volume (MCV) and reduced values of mean corpuscular hemoglobin (Hb) (MCH). The proband was referred to our Medical Genetics Service for preconception counseling together with his partner, a typical β-thalassemia (β-thal) carrier. The results were negative for the most frequent α-thalassemia (α-thal) mutations, and had no significant sequence variations of the coding sequences and promoter of the β- and δ-globin genes. Quantitative analysis by multiplex ligation-dependent probe amplification (MPLA) of the β-globin gene cluster detected a heterozygous deletion, ranging between 2.1 and 4.7 kb, in the proband, his sister and the father. The deletion involved the (G)γ gene and (G)γ-(A)γ intergenic region, whereas the 3' region of the (A)γ gene was preserved. A subsequent gap-polymerase chain reaction (gap-PCR) showed that a hybrid (GA)γ fusion gene was present. The deletion segregated with the elevation of Hb A2. The MLPA analysis of the β-globin gene cluster in 150 control alleles excluded a common polymorphism. Despite stronger evidence being needed, the described family suggests a possible role of this γ-globin gene deletion in contributing to Hb A2 elevation, possibly by altering the transcription regulation of the cluster. We propose γ-globin gene dosage analysis to be performed in patients with unexplained elevated Hb A2 levels.

Recent trends in the gene therapy of β-thalassemia

Directory of Open Access Journals (Sweden)

Finotti A

2015-02-01

Full Text Available Alessia Finotti,1–3 Laura Breda,4 Carsten W Lederer,6,7 Nicoletta Bianchi,1–3 Cristina Zuccato,1–3 Marina Kleanthous,6,7 Stefano Rivella,4,5 Roberto Gambari1–3 1Laboratory for the Development of Gene and Pharmacogenomic Therapy of Thalassaemia, Biotechnology Centre of Ferrara University, Ferrara, Italy; 2Associazione Veneta per la Lotta alla Talassemia, Rovigo, Italy; 3Department of Life Sciences and Biotechnology, Section of Biochemistry and Molecular Biology, Ferrara University, Ferrara, Italy; 4Department of Pediatrics, Division of Haematology/Oncology, Weill Cornell Medical College, New York, NY, USA; 5Department of Cell and Development Biology, Weill Cornell Medical College, New York, NY, USA; 6Department of Molecular Genetics Thalassaemia, The Cyprus Institute of Neurology and Genetics, Nicosia, Cyprus; 7Cyprus School of Molecular Medicine, Nicosia, Cyprus Abstract: The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most

Magnetic measurements on human erythrocytes: Normal, beta thalassemia major, and sickle

Science.gov (United States)

Sakhnini, Lama

2003-05-01

In this article magnetic measurements were made on human erythrocytes at different hemoglobin states (normal and reduced hemoglobin). Different blood samples: normal, beta thalassemia major, and sickle were studied. Beta thalassemia major and sickle samples were taken from patients receiving lifelong blood transfusion treatment. All samples examined exhibited diamagnetic behavior. Beta thalassemia major and sickle samples showed higher diamagnetic susceptibilities than that for the normal, which was attributed to the increase of membrane to hemoglobin volume ratio of the abnormal cells. Magnetic measurements showed that the erythrocytes in the reduced state showed less diamagnetic response in comparison with erythrocytes in the normal state. Analysis of the paramagnetic component of magnetization curves gave an effective magnetic moment of μeff=7.6 μB per reduced hemoglobin molecule. The same procedure was applied to sickle and beta thalassemia major samples and values for μeff were found to be comparable to that of the normal erythrocytes.

Updates of the HbVar database of human hemoglobin variants and thalassemia mutations

NARCIS (Netherlands)

B. Giardine (Belinda); J. Borg (Joseph); E. Viennas (Emmanouil); C. Pavlidis (Cristiana); K. Moradkhani (Kamran); P. Joly (Philippe); M. Bartsakoulia (Marina); C. Riemer (Cathy); W. Miller (Webb); G. Tzimas (Giannis); H. Wajcman (Henri); R.C. Hardison (Ross); G.P. Patrinos (George)

2014-01-01

textabstractHbVar (http://globin.bx.psu.edu/hbvar) is one of the oldest and most appreciated locus-specific databases launched in 2001 by a multi-center academic effort to provide timely information on the genomic alterations leading to hemoglobin variants and all types of thalassemia and

Evolution of a genetic disease in an ethnic isolate: β-Thalassemia in the Jews of Kurdistan

International Nuclear Information System (INIS)

Rund, D.; Cohen, T.; Filon, D.; Rachmilewitz, E.; Oppenheim, A.; Dowling, C.E.; Warren, T.C.; Kazazian, H.H. Jr.; Barak, I.

1991-01-01

β-Thalassemia is a hereditary disease caused by any of 90 different point mutations in the β-globin gene. Specific populations generally carry a small number of mutations, the most common of which are those that are widely distributed regionally. The present study constitutes an extensive molecular characterization of this disease in a small, highly inbred ethnic group with a high incidence of β-thalassemia-the Jews of Kurdistan. An unusual mutational diversity was observed. In 42 sibships 13 different mutations were identified, of which 3 are newly discovered. Four of the mutations are unique to Kurdish Jews and have not been discovered in any other population. A fifth was found outside Kurdish Jews only in an Iranian from Khuzistan, a region bordering Kurdistan. Two-thirds of the mutant chromosomes carry the mutations unique to Kurdish Jews. The authors traced the origin of the mutations to specific geographic regions within Kurdistan. This information, supported by haplotype analysis, suggests that thalassemia in central Kurdistan (northern Iraq) has evolved primarily from multiple mutational events. They conclude that several evolutionary mechanisms contributed to the evolution of β-thalassemia in this small ethnic isolate

Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

Energy Technology Data Exchange (ETDEWEB)

Karimi, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Hematology Research Center, Department of Pediatrics, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: karimim@sums.ac.ir; Rasekhi, A.R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: rasekhia@sums.ac.ir; Rasekh, M. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: Rasekhm@sums.ac.ir; Nabavizadeh, S.A. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: nabavia@gmail.com; Assadsangabi, R. [Iran-Shiraz-Namazee Hospital, Namazee Square, Imaging Research Center, Department of Radiology, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: assadsangabi@yahoo.com; Amirhakimi, G.H. [Iran-Shiraz-Namazee Hospital, Namazee Square, Department of Endocrinology and Metabolism, Shiraz University of Medical Sciences, Shiraz (Iran, Islamic Republic of)], E-mail: amirhakimig@sums.ac.ir

2009-06-15

Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

Hypoparathyroidism and intracerebral calcification in patients with beta-thalassemia major

International Nuclear Information System (INIS)

Karimi, M.; Rasekhi, A.R.; Rasekh, M.; Nabavizadeh, S.A.; Assadsangabi, R.; Amirhakimi, G.H.

2009-01-01

Background: Hypoparathyroidism is one of the most important endocrine complications of thalassemia major. This study was conducted to evaluate the prevalence of intracerebral calcifications in patients with thalassemia with and without hypoparathyroidism. Methods: 47 beta-thalassemia patients with hypoparathyroidism underwent a brain CT scan to investigate the presence and extent of intracerebral calcification. 30 age- and sex-matched beta-thalassemic patients with normal parathyroid function who had undergone brain CT for headache, or some other minor neurologic problems were also enrolled in the study serving as controls. The amount of intracerebral calcification, hematologic parameters, and some clinical findings were compared between both groups. Results: Intracerebral calcification was present in 54.2% of beta-thalassemia patients with hypoparathyroidism. The most frequent sites of calcification were basal ganglia, and frontoparietal areas of the brain. Thalami, internal capsule, cerebellum and posterior fossa were other less frequently calcified regions of the brain. In contrast, there was no evidence of intracerebral calcifications in the 30 thalassemic patients with normal parathyroid function. There was not a statistically significant difference between serum ferritin concentrations in thalassemia patient with hypoparathyroidism and those with normal parathyroid function (2781 vs. 2178, P > 0.05). Conclusion: Intracranial calcification is a common finding in thalassemia patients with hypoparathyroidism, it can be extensive and involves most regions of the brain.

Genome scan identifies a locus affecting gamma-globin expression in human beta-cluster YAC transgenic mice

Energy Technology Data Exchange (ETDEWEB)

Lin, S.D.; Cooper, P.; Fung, J.; Weier, H.U.G.; Rubin, E.M.

2000-03-01

Genetic factors affecting post-natal g-globin expression - a major modifier of the severity of both b-thalassemia and sickle cell anemia, have been difficult to study. This is especially so in mice, an organism lacking a globin gene with an expression pattern equivalent to that of human g-globin. To model the human b-cluster in mice, with the goal of screening for loci affecting human g-globin expression in vivo, we introduced a human b-globin cluster YAC transgene into the genome of FVB mice . The b-cluster contained a Greek hereditary persistence of fetal hemoglobin (HPFH) g allele resulting in postnatal expression of human g-globin in transgenic mice. The level of human g-globin for various F1 hybrids derived from crosses between the FVB transgenics and other inbred mouse strains was assessed. The g-globin level of the C3HeB/FVB transgenic mice was noted to be significantly elevated. To map genes affecting postnatal g-globin expression, a 20 centiMorgan (cM) genome scan of a C3HeB/F VB transgenics [prime] FVB backcross was performed, followed by high-resolution marker analysis of promising loci. From this analysis we mapped a locus within a 2.2 cM interval of mouse chromosome 1 at a LOD score of 4.2 that contributes 10.4% of variation in g-globin expression level. Combining transgenic modeling of the human b-globin gene cluster with quantitative trait analysis, we have identified and mapped a murine locus that impacts on human g-globin expression in vivo.

GENETIC FACTORS INFLUENCING HEMOGLOBIN F LEVEL IN β-THALASSEMIA/HB E DISEASE.

Science.gov (United States)

Ruangrai, Waraporn; Jindadamrongwech, Sumalee

2016-01-01

Genetic factors influencing Hb F content in adult red blood cells include β-thalassemia genotypes, co-inheritance of α-thalassemia traits and single nucleotide polymorphisms (SNPs). Genotyping of α- and β-thalassemia and five SNPs in β-globin gene cluster previously identified in genome-wide association studies as being markers of elevated Hb F in β-thalassemia were performed in 81 subjects diagnosed with β-thalassemia/Hb E. Hb F levels are higher (0.9-7.1 g/dl) in subjects (n = 57) with the severe compared to mild β-thalassemia (0.8-2.5 g/ dl) (n = 4) genotypes, and are similarly low (0.7-3.5 g/dl) in those (n = 15) with α-thalassemia co-inheritance. Hb F levels in non-thalassemia controls (n = 150) range from 0 to 0.15 g/dl. The presence of homozygous minor alleles of the 5 SNPs are significant indicators of β-thalassemia/Hb E individuals with high Hb F (> 4 g/dl), independent of their thalassemia genotypes. Given that re-activation of γ-globin genes leads to amelioration of β-thalassemia severity, understanding how genetic factors up-regulate Hb F production may lead to possible therapeutic interventions, genetically or pharmacologically, of this debilitating disease in the not too distant future.

Genetics of Iranian Alpha-Thalassemia Patients: A Comprehensive Original Study.

Science.gov (United States)

Keikhaei, Bijan; Slehi-Fard, Pejman; Shariati, Gholamreza; Khosravi, Abbas

2018-04-07

Alpha thalassemia is the most prevalent monogenic gene disorder in the world, especially in Mediterranean countries. In the current hematological phenotype of patients with different genotypes, the effects of missense mutations on the protein function and also stability were evaluated in a large cohort study. A total of 1,560 subjects were enrolled in the study and divided into two groups: 259 normal subjects; and 1301 alpha-thalassemia carriers. Genomic DNA was extracted and analyzed using ARMS PCR, Multiplex Gap, and direct sequencing. The effects of single nucleotide change on the protein function and stability were predicted by freely available databases of human polymorphisms. Sixty-three different genotypes were seen in the patients. The more prevalent was heterozygote form of -α3.7 (41.4%) followed by -α3.7 homozygote (11.6%) and -MED (3.8%). The significant differences were seen in mean hemoglobin level [F = 20.5, p < 0.001] between the Alpha-globin genotypes, when adjusted for gender. Moreover, 28 different mutations were found in our study. A significant relationship was seen between ethnicity and the alpha-globin mutation frequency χ 2 (df;8) = 38.36, p < 0.0001). Different genotypes could display as different phenotypes. The mutation frequency distributions in our region are different from those of other parts of Iran. Significant differences are seen in the spectrum of mutation frequency among various ethnicities. Finally, some missense mutations might not have considerable effect on the proteins, and they could be neutral mutations.

RAPID DETECTION OF -THALASSEMIA MUTATIONS IN THAILAND USING MULTIPLEX ARMS

Directory of Open Access Journals (Sweden)

D. Shimbhu

2017-11-01

Full Text Available The number of mutations underlining b-thalassemia generate a wide variety of different clinical phenotypes. An understanding of the genotype is important for medical personnel in order to provide proper counseling to patients and their families. Characterization of these mutations should aid the planning of a prenatal diagnosis program for bthalassemia. The heterogeneity of the mutations makes it difficult and time consuming to identify the mutation in some individuals. We developed a single-tube multiplex amplification refractory mutation system (multiplex ARMS to identify common ethnic- specific b-thalassemia mutations. Confirmation of multiplex ARMS results was carried out using direct sequencing. Three thousand three hundred twenty two people from Phitsanulok province were screened for the b-thalassemia trait by quantitation of HbA2 with microcolumn chromatography and the genotypes of mutations were characterized using multiplex ARMS and direct sequencing. We found that the deletion at codons 41/42 (-TCTT was the most frequent (48%, codon 17 (A®T (30%, -28 (A®G (6% and IVS-I-1(G®T (6% were the second and third in frequency respectively. A -87 (C®A mutation (4%, IVS II-654 (C®T (2%, codons 71/72 (+A (2% and codon 35 (C®A mutations (2% were also found. These techniques were found to be a valuable tool for analysis of b-thalassemia mutations because they are accurate, simple, and speedy in operation. The application for the diagnosis of severe thalassemia in high-risk pregnancies is promising.

Frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism in patients with homozygous/compound heterozygous beta thalassaemia.

Science.gov (United States)

Ali, Nadir; Ayyub, Muhammad; Khan, Saleem Ahmed; Ahmed, Suhaib; Abbas, Kazim; Malik, Hamid Saeed; Tashfeen, Sunila

2015-03-01

Response to hydroxyurea therapy in homozygous or compound heterozygous beta thalassaemia (BT) has been reported as more favourable in the presence of XmnI polymorphism. The prevalence of XmnI polymorphism may vary with BT phenotypes and genotypes, and differs geographically in distribution. Prevalence of XmnI polymorphism is not known in northern Pakistan. To determine the frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism (XmnI polymorphism) in patients with homozygous or compound heterozygous beta thalassaemia. Polymerase chain reaction (PCR) for common beta thalassaemia mutations and Gγ-globin promoter -158 (C>T) XmnI polymorphism was performed on 107 blood samples of transfusion dependent beta thalassaemia (BT) patients in Pakistan. One hundred samples of unrelated BT traits and 94 samples of healthy subjects as controls were also analysed for BT mutations and XmnI polymorphism. Out of 301 DNA samples, XmnI polymorphism was detected in 71(24%); in normal controls, XmnI polymorphism was detected in 34/94 (36%) subjects; while in homozygous/compound heterozygous BT, it was detected in 14/107(13%) patients (Fisher's exact test, p=.0002). In heterozygous BT group, XmnI polymorphism was detected in 23/100 subjects (Fisher's exact test, p=.03 with normal controls, and p=.049 with homozygous/compound heterozygous BT). The most common BT genotype was Frame Shift (Fr) 8-9/Fr 8-9, and none of the patients with this genotype had XmnI polymorphism. The second most common genotype was IVSI-5/IVSI-5; 4/26 (15%). Cases with this genotype had XmnI polymorphism. XmnI polymorphism in homozygous/compound heterozygous BT group is 13%. The most common genotype associated with XmnI polymorphism was IVSI-5/IVSI-5. Copyright © 2015 King Faisal Specialist Hospital & Research Centre. Published by Elsevier B.V. All rights reserved.

α-Thalassemia Associated with Hb Instability: A Tale of Two Features. The Case of Hb Rogliano or α1 Cod 108(G15)Thr→Asn and Hb Policoro or α2 Cod 124(H7)Ser→Pro.

Science.gov (United States)

Musollino, Gennaro; Cardiero, Giovanna; Flagiello, Angela; La Porta, Gaetana; Lagona, Laura; Prezioso, Romeo; Qualtieri, Gabriele; Gaudiano, Carlo; Medulla, Emilia; Merlino, Antonello; Pucci, Piero; Lacerra, Giuseppina

2015-01-01

We identified two new variants in the third exon of the α-globin gene in families from southern Italy: the Hb Rogliano, α1 cod108 ACC>AAC or α1[α108(G15)Thr→Asn] and the Hb Policoro, α2 cod124 TCC>CCC or α2[α124(H7)Ser→Pro]. The carriers showed mild α-thalassemia phenotype and abnormal hemoglobin stability features. These mutations occurred in the G and H helices of the α-globin both involved in the specific recognition of AHSP and β1 chain. Molecular characterization of mRNA, globin chain analyses and molecular modelling studies were carried out to highlight the mechanisms causing the α-thalassemia phenotype. The results demonstrated that the α-thalassemia defect associated with the two Hb variants originated by different defects. Hb Rogliano showed an intrinsic instability of the tetramer due to anomalous intra- and inter-chain interactions suggesting that the variant chain is normally synthesized and complexed with AHSP but rapidly degraded because it is unable to form the α1β1 dimers. On the contrary in the case of Hb Policoro two different molecular mechanisms were shown: the reduction of the variant mRNA level by an unclear mechanism and the protein instability due to impairment of AHSP interaction. These data highlighted that multiple approaches, including mRNA quantification, are needed to properly identify the mechanisms leading to the α-thalassemia defect. Elucidation of the specific mechanism leads to the definition of a given phenotype providing important guidance for the diagnosis of unstable variants. PMID:25730315

Levels of Beta-2 Microglobulin and Cystatin C in Beta Thalassemia Major Patients

Directory of Open Access Journals (Sweden)

Ayse Kacar

2014-03-01

Full Text Available Aim: Thalassemia is accepted to be the most common genetic disease in the world. This study was performed to establish whether there was a glomerular renal damage, which was usually a less mentioned subject in patients with Beta Thalassemia Major, and to compare urea, creatinine and creatinine clearance with early indicators of kidney damage as Cystatin-C and %u03B2-2 microglobulin as on determining the glomerular damage. Material and Method: This study was prospectively performed in patients, who were regularly followed in the children hematology outpatient clinic with a diagnosis of Beta Thalassemia Major. Results: There was no statistically significant difference between urea and levels of creatinine clearance and Cystatin-C. There was a statistically negative relationship between creatinine and creatinine clearance at an advanced level as 53.7% (p: 0.002, p

A Dual Reporter Mouse Model of the Human β-Globin Locus: Applications and Limitations

NARCIS (Netherlands)

P. Papadopoulos (Petros); L. Gutiérrez (Laura); R. van der Linden (Reinier); J. Kong-a-San (John); A. Maas (Alex); D.D. Drabek (Dubravka); G.P. Patrinos (George); J.N.J. Philipsen (Sjaak); F.G. Grosveld (Frank)

2012-01-01

textabstractThe human β-globin locus contains the β-like globin genes (i.e. fetal γ-globin and adult β-globin), which heterotetramerize with α-globin subunits to form fetal or adult hemoglobin. Thalassemia is one of the commonest inherited disorders in the world, which results in quantitative

Human parvovirus B19 in patients with beta thalassemia major from Tehran, Iran.

Science.gov (United States)

Arabzadeh, Seyed Ali Mohammad; Alizadeh, Farideh; Tavakoli, Ahmad; Mollaei, Hamidreza; Bokharaei-Salim, Farah; Karimi, Gharib; Farahmand, Mohammad; Mortazavi, Helya Sadat; Monavari, Seyed Hamidreza

2017-03-01

Due to the tropism of human parvovirus B19 to erythroid progenitor cells, infection in patients with an underlying hemolytic disorder such as beta-thalassemia major leads to suppression of erythrocyte formation, referred to as transient aplasia crisis (TAC), which may be life-threatening. We investigated the prevalence of parvovirus B19 among patients with beta thalassemia major attending the Zafar Adult Thalassemia Clinic in Tehran, Iran. This cross-sectional study was performed to determine the presence of parvovirus B19 DNA in blood samples and parvovirus B19 genotypes in plasma samples of patients with thalassemia major. The population consisted of 150 patients with beta-thalassemia major who attended the Zafar clinic in Tehran. Specimens were studied using a real-time polymerase chain reaction assay. The prevalence of parvovirus B19 in our study population was 4%. Of 150 patients with thalassemia, six (4%) were positive for B19 DNA. There was no significant correlation between blood transfusion frequency and B19 DNA positivity. Finally, phylogenetic analysis of human parvovirus B19 revealed genotype I in these six patients. In this study, acute B19 infections were detected in patients with beta thalassemia major. Screening of such high-risk groups can considerably reduce the incidence and prevalence of B19 infection; thus, screening is required for epidemiologic surveillance and disease-prevention measures.

One-step genetic correction of hemoglobin E/beta-thalassemia patient-derived iPSCs by the CRISPR/Cas9 system.

Science.gov (United States)

Wattanapanitch, Methichit; Damkham, Nattaya; Potirat, Ponthip; Trakarnsanga, Kongtana; Janan, Montira; U-Pratya, Yaowalak; Kheolamai, Pakpoom; Klincumhom, Nuttha; Issaragrisil, Surapol

2018-02-26

Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression. The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein. Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.

Prevalence of Beta-Thalassemia in premarital screening in Al-Hassa, Saudi Arabia

International Nuclear Information System (INIS)

Al-Suliman, A.

2006-01-01

The Al-Hassa area is one of the regions in Saudi Arabia where hemoglobinopathies are prevalent. The Saudi Ministry of Health designed a protocol for premarital testing after the royal decree in December 2003. The protocol was implemented in a February 2004 order. The aim of this study was to determine the prevalence of beta-thalassemia trait among subjects coming for premarital screening in the Al-Hassa area. From February 2004 to November 2004, healthy subjects coming to six marriages consultation centers in the Al-Hassa area underwent routine mandatory tests. Subjects were considered to have beta-thalassemia trait if they had a mean corpuscular volume (MCV), 80 fL and/or a mean corpuscular hemoglobin (MCH) 3.2%. Venous blood was taken into ETDA tube and the complete blood count and red blood cell indices were measured by a Coulter automated cell counter on the same day of hemoglobin collection. Electrophoresis was done on cellulose acetate. All Saudi participants (n=8918), including 4218 (47.3%) males and 4700 (52.7%) females were screened. The prevalence of beta-thalassemia trait with high hemoglobin A2 and microcytic hypochromic anemia was 3.4% (307/8918). In countries with a high prelevance of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. With a 3.4% prevalence of beta-thalassemia trait in premarital couples, future comprehensive programs are needed to know the actual prevalence of beta-thalassemia in Al-Hassa. (author)

Thalassemia mutations in Gaziantep, Turkey

African Journals Online (AJOL)

STORAGESEVER

2010-02-22

Feb 22, 2010 ... Table 3. Frequency of β-thalassemia mutations in the Eastern Mediterranean. Mutation. This study Turkey Cyprus Greece Syria Palestine Bulgaria Azerbaijan Iran Iraq. IVS 1.110 (G>A). 29.1. 39.3. 79.7. 42.1. 24.1. 17.6. 24.2. 20.2. 4.8 1.9. IVS 2.1 (G>A). 12.3. 4.7. -. 3.3. 4.2. 2.9. -. -. 33.9 18.3. IVS 1.1 (G>A).

Resolution of alloimmunization and refractory autoimmune hemolytic anemia in a multi-transfused beta-thalassemia major patient

Directory of Open Access Journals (Sweden)

Joseph Philip

2014-01-01

Full Text Available Beta-thalassemia is one of the most prevalent autosomal disorders, which affect more than 400,000 newborn per year worldwide. In India, the carrier rate of beta-thalassemia varies from 3-17%. The overall rate of alloimmunization in thalassemia patients has been reported to be 5-30% in the world, which is mostly contributed by the alloimmunization to minor blood group antigen. Among Asians, the incidence of red cell alloimmunization is 22%. The recommended treatment for beta-thalassemia major is regular blood transfusion every 3 to 4 weeks. The development of anti-red cell antibodies (alloantibodies and/or autoantibodies can significantly complicate transfusion therapy. Alloantibodies are commonly associated with red cell hemolysis. Red cell autoantibodies appear less frequently, but they can result in clinical hemolysis called autoimmune hemolytic anemia (AIHA, and in difficulty in cross-matching blood. Patients with autoantibodies may have a higher transfusion rate and often require immunosuppressive drugs or alternative treatments including intravenous immunoglobulin (IVIg and rituximab (anti-CD20 monoclonal antibody.

Phenotype-genotype correlation in β-thalassemia

Directory of Open Access Journals (Sweden)

R. Galanello

2011-12-01

Full Text Available The clinical manifestations of β-thalassemia are extremely heterogeneous, ranging from severe transfusion-dependent anemia, to the mild non transfusion dependent thalassemia intermedia and to the asymptomatic carrier state. The remarkable phenotypic variability is primary due to variations in the different globin genes (primary gene modifiers. The main pathophysiological determinant of the severity of β-thalassemia syndromes is the extent of a/non-a globin chain imbalance. Therefore, any factor capable of reducing the globin chain imbalance may have an ameliorating effect on the clinical picture. The most common mechanisms responsible of the amelioration of the phenotype are mild or silent β thalassemia alleles, coinheritance of a thalassemia, or of genetic determinants associated with increased g globin chain production. Rarely, other complex mechanisms including dominantly inherited β thalassemia, somatic deletion of β globin gene and coinheritance of extra a globin genes with heterozygous β thalassemia have been reported. In addition to the variability of the phenotype resulting from primary gene modifiers, other genetic factors (secondary gene modifiers, mapping outside the β and a globin cluster, may influence the disease complications. Among these factors the ones best so far defined are those affecting bilirubin, iron and bone metabolism. However, the new methods of DNA analysis (i.e. GWAS and related methods are expect expand the number of genes or gene variants involved in the phenotypic variability and in the response to treatment of β thalassemia. 从严重的输液依赖型贫血症到轻度非输液依赖性中间型地中海贫血，再到无症状携带状态，β地中海贫血的临床表现极度异源性。 由于不同珠蛋白基因（初级基因修饰因子）发生各种变异，主要表现为显著的表型变异。 �

Premarital Screening of Beta Thalassemia Minor in north-east of Iran

Science.gov (United States)

Hashemizadeh, H; Noori, R

2013-01-01

Background Beta thalassemia is a preventable disease. Iran has about 20,000Patients who are homozygote for β-thalassaemia and 3,750,000 carriers. The aim of this study was to determine the prevalence of beta thalassemia minor among men who underwent premarital screening in Quchana city in Khorasan Razavi region of Iran Materials and Methods This research is a descriptive cross-sectional study. From 2010 to 2011, all participants (1000) under marriage coming to health center of Quchan underwent routine mandatory tests. Participants were considered to have beta-thalassemia minor on the condition that hey had a mean corpuscular volume (MCV) 3.5%. Venous blood was taken into an EDTA tube and the complete blood count and red blood cell indices were measured with a Coulter automated cell counter. Electrophoresis was performed on cellulose acetate. Results Mean and SD of hemoglobin, MCV and MCH were 16±2.9, 91±4 and 28.4±2, respectively. Hemoglobin A2 Higher than 3.5 percent was reported as 3.5%.The prevalence of beta-thassemia minor with high hemoglobin A2 and microcytic hypochromic anemia was 3.5% (P-value). Conclusion In countries with high prevalence of hemoglobinopathies, a premarital screening program is helpful for identification and prevention of high-risk marriages. Detecting carrier couples with premarital screening program is an effective way of controlling thalassemia major. PMID:24575266

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

Science.gov (United States)

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Hb D/Talassemia beta associada à anemia crônica Hb D/ Beta thalassaemia associated with chronic anaemia

Directory of Open Access Journals (Sweden)

Paulo C. Naoum

2002-03-01

Full Text Available We describe a case of Hb D/Beta thalassemia associated with chronic anemia. Hematological analyses performed in a patient with chronic anemia demonstrating microcytosis and hypochromic in his erythrocytes. Specific laboratory diagnosis performed by alkaline and acid electrophoresis, and fetal determination by alkali resistance, indicated it to be Hb D associated with beta thalassemia. Analyses carried out on his family (father, mother and brother confirmed the suspected diagnosis. Hb D/Beta thalassemia is a very rare interaction in the Brazilian population, and its determination required specific laboratorial techniques and hematological analyses.

Spectrum of α-thalassemia mutations in Qazvin Province, Iran

African Journals Online (AJOL)

use

2011-12-05

Dec 5, 2011 ... α-Thalassemia is a widespread inherited disease particularly prevalent in the middle East Asia population, including Iran. The aim of this study was to define the molecular spectrum and frequency of α-thalassemia mutations in prospective couples of Qazvin province. A total of 120,000 subjects were.

Spinal cord compression in {beta}-thalassemia: follow-up after radiotherapy

Energy Technology Data Exchange (ETDEWEB)

Fonseca, Silvana Fahel da; Figueiredo, Maria Stella; Cancado, Rodolfo Delfini; Nakadakare, Fernando; Segreto, Roberto; Kerbauy, Jose [Universidade Federal de Sao Paulo (UNIFESP), SP (Brazil). Escola Paulista de Medicina

1998-12-01

Spinal cord compression due to extramedullary hematopoiesis is a well-described bu rare syndrome encountered in several hematologic disorders, including {beta}-thalassemia. We report a case of a patient with intermediate {beta}-thalassemia and crural paraparesis due to spinal cord compression by a paravertebral extramedullary mass. She was successfully treated with low-dose radiotherapy and transfusions. After splenectomy, she was regularly followed up for over four years without transfusion or recurrence of spinal cord compression. Extramedullary hematopoiesis should be investigated in patients with hematologic disorders and spinal cord symptoms. The rapid recognition and treatment with radiotherapy can dramatically alleviate symptoms. (author)

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

Science.gov (United States)

Capretto, Lorenzo; Mazzitelli, Stefania; Brognara, Eleonora; Lampronti, Ilaria; Carugo, Dario; Hill, Martyn; Zhang, Xunli; Gambari, Roberto; Nastruzzi, Claudio

2012-01-01

This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH), based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF) accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of β-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying β-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol for β-thalassemia. PMID:22287841

Both TALENs and CRISPR/Cas9 directly target the HBB IVS2-654 (C > T) mutation in β-thalassemia-derived iPSCs.

Science.gov (United States)

Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

2015-07-09

β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

Science.gov (United States)

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

Science.gov (United States)

Shah, Parth S; Shah, Nidhi D; Ray, Hari Shankar P; Khatri, Nikunj B; Vaghasia, Ketan K; Raval, Rutvik J; Shah, Sandip C; Rao, Mandava V

2017-01-01

Background β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors. Purpose The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management. Patients and methods Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods. Results Of these (75) referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%). The majority of case types were of β-thalassemia minor (49, 65.33%), followed by HbE traits (6, 8.0%) and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33%) types and then HbE homozygous (2, 2.66%), as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34%) combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29%) followed by deletion 619bp (9, 13.23%) and c.79G>A (8, 11.76%) in our study group. Five cases (nos. 24, 27, 33, 58, and 71) exhibited coinheritance between β0/β+ (2), β0/β D (1), and c.124_127delTTCT/β+ or β0(2) affecting the Rajasthani and Gujarati populations in our study of the Western region of India. Conclusion We strongly recommend these Western populations for genetic screening before adopting reproductive technologies and interracial marital relations. PMID:28546763

Frequency and origin of haplotypes associated with the beta-globin gene cluster in individuals with trait and sickle cell anemia in the Atlantic and Pacific coastal regions of Colombia.

Science.gov (United States)

Fong, Cristian; Lizarralde-Iragorri, María Alejandra; Rojas-Gallardo, Diana; Barreto, Guillermo

2013-12-01

Sickle cell anemia is a genetic disease with high prevalence in people of African descent. There are five typical haplotypes associated with this disease and the haplotypes associated with the beta-globin gene cluster have been used to establish the origin of African-descendant people in America. In this work, we determined the frequency and the origin of haplotypes associated with hemoglobin S in a sample of individuals with sickle cell anemia (HbSS) and sickle cell hemoglobin trait (HbAS) in coastal regions of Colombia. Blood samples from 71 HbAS and 79 HbSS individuals were obtained. Haplotypes were determined based on the presence of variable restriction sites within the β-globin gene cluster. On the Pacific coast of Colombia the most frequent haplotype was Benin, while on the Atlantic coast Bantu was marginally higher than Benin. Eight atypical haplotypes were observed on both coasts, being more diverse in the Atlantic than in the Pacific region. These results suggest a differential settlement of the coasts, dependent on where slaves were brought from, either from the Gulf of Guinea or from Angola, where the haplotype distributions are similar. Atypical haplotypes probably originated from point mutations that lost or gained a restriction site and/or by recombination events.

[Current management of thalassemia intermedia].

Science.gov (United States)

Thuret, I

2014-11-01

Thalassemia intermedia is a clinical entity where anemia is mild or moderate, requiring no or occasional transfusion. Non-transfusion-dependent thalassemia encompasses 3 main clinical forms: beta-thalassemia intermedia, hemoglobin E/beta-thalassemia and alpha-thalassemia intermedia (HbH disease). Clinical severity of thalassemia intermedia increases with age, with more severe anemia and more frequent complications such as extramedullary hematopoiesis and iron overload mainly related to increased intestinal absorption. Numerous adverse events including pulmonary hypertension and hypercoagulability have been associated with splenectomy, often performed in thalassemia intermedia patients. The potential preventive benefit of transfusion and chelation therapies on the occurrence of numerous complications supports the strategy of an earlier therapeutic intervention. Increasing knowledge about pathophysiological mechanisms involved in thalassemia erythropoiesis and related iron overload is currently translating in novel therapeutic approaches. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

Science.gov (United States)

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Development of a PCR/LDR/capillary electrophoresis assay with potential for the detection of a beta-thalassemia fetal mutation in maternal plasma.

Science.gov (United States)

Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li

2010-08-01

Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.

β-Thalassemia and Polycythemia vera : Targeting chronic stress erythropoiesis

NARCIS (Netherlands)

Crielaard, Bart J; Rivella, Stefano

β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective

Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish ...

African Journals Online (AJOL)

Thalassemia is an inherited blood disorder which is divided into two groups: alpha and beta. HBA1 and HBA2 are the two genes associated with alpha thalassemia. The aim of this study is to investigate abnormal hemoglobin variants of alpha globin gene in healthy abnormal hemoglobin carrying individuals with intact beta ...

Inactivation of human α-globin gene expression by a de novo deletion located upstream of the α-globin gene cluster

International Nuclear Information System (INIS)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.; Griese, E.U.; Horst, J.; Ayyub, H.; Higgs, D.R.

1990-01-01

Synthesis of normal human hemoglobin A, α 2 β 2 , is based upon balanced expression of genes in the α-globin gene cluster on chromosome 15 and the β-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the β-globin cluster depend on sequences located at a considerable distance 5' to the β-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the α-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with α-thalassemia in whom structurally normal α-globin genes have been inactivated in cis by a discrete de novo 35-kilobase deletion located ∼30 kilobases 5' from the α-globin gene cluster. They conclude that this deletion inactivates expression of the α-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the α-globin genes

A study of membrane protein defects and alpha hemoglobin chains of red blood cells in human beta thalassemia

International Nuclear Information System (INIS)

Rouyer-Fessard, P.; Garel, M.C.; Domenget, C.; Guetarni, D.; Bachir, D.; Colonna, P.; Beuzard, Y.

1989-01-01

The soluble pool of alpha hemoglobin chains present in blood or bone marrow cells was measured with a new affinity method using a specific probe, beta A hemoglobin chain labeled with [ 3 H]N-ethylmaleimide. This pool of soluble alpha chains was 0.067 ± 0.017% of hemoglobin in blood of normal adult, 0.11 ± 0.03% in heterozygous beta thalassemia and ranged from 0.26 to 1.30% in homozygous beta thalassemia intermedia. This elevated pool of soluble alpha chains observed in human beta thalassemia intermedia decreased 33-fold from a value of 10% of total hemoglobin in bone marrow cells to 0.3% in the most dense red blood cells. The amount of insoluble alpha chains was measured by using the polyacrylamide gel electrophoresis in urea and Triton X-100. In beta thalassemia intermedia the amount of insoluble alpha chains was correlated with the decreased spectrin content of red cell membrane and was associated with a decrease in ankyrin and with other abnormalities of the electrophoretic pattern of membrane proteins. The loss and topology of the reactive thiol groups of membrane proteins was determined by using [ 3 H]N-ethylmaleimide added to membrane ghosts prior to urea and Triton X-100 electrophoresis. Spectrin and ankyrin were the major proteins with the most important decrease of thiol groups

[Clinical analysis of three cases with beta-thalassemia].

Science.gov (United States)

Li, X Y; Liu, M J; Xu, L H; Xu, H G; Chen, H L; Fang, J P

2018-04-02

Objective: To study the diagnostic strategy of β-thalassemia through retrospective analysis of 3 cases of β-thalassemia. Methods: Three patients were admitted to the Department of Pediatrics, Sun Yat-sen Memorial Hospital of Sun Yat-sen University from January 2014 to June 2015. The clinical manifestations, hemoglobin electrophoresis and gene detection of these patients and their parents were analyzed, diagnostic ideas and key points were discussed when beta thalassemia gene detection did not explain clinical manifestations or hemoglobin electrophoresis. Results: Case 1, boy, 5 years old, was diagnosed as compound heterozygotes of β41-42 and IVS-Ⅱ-654 with hereditary persistence of fetal hemoglobin(HPFH) according to the clinical manifestations of mild anemia, normal size of liver and spleen, 92.8% fetal hemoglobin (HbF) and gene analysis. Case 2, girl, 3 years old, was confirmed the diagnosis of thalassemia intermedia with β41-42 heterozygote compound and ααα anti3.7 heterozygote in accordance with the manifestations of severe anemia, hepatosplenomegaly, 8.6% HbF, 4.1% hemoglobin A 2 (HbA 2 ) and gene analysis. Case 3, girl, 3 years old, with severe anemia, hepatosplenomegaly, 51.2% HbF and 3.7% HbA 2 , was diagnosed as thalassemia major with compound heterozygotes of PolyA (T→C) and β17 by DNA sequencing. Conclusion: The diagnosis of β-thalassemia should be confirmed by clinical manifestations of hemolytic anemia, hemoglobin electrophoresis, gene diagnosis and family survey.

Mutation analysis of β-thalassemia in East-Western Indian population: a recent molecular approach

Directory of Open Access Journals (Sweden)

Shah PS

2017-05-01

Full Text Available Parth S Shah,1 Nidhi D Shah,2 Hari Shankar P Ray,3 Nikunj B Khatri,3 Ketan K Vaghasia,3 Rutvik J Raval,4 Sandip C Shah,3 Mandava V Rao5 1Department of Medicine, Lahey Hospital and Medical Center, Boston, MA, 2Department of Pediatrics, Nassau University Medical Centre, New York, NY, USA; 3Supratech Micropath Laboratory and Research Institute, 4Department of Zoology, 5School of Sciences, Gujarat University, Ahmedabad, Gujarat, India Background: β-Thalassemia is the most prevalent genetic disorder in India. Its traits and coinheritance vary from mild to severe conditions, resulting in thalassemia minor, intermediate, and major, depending upon many factors.Purpose: The objective of this study was to identify the incidence of β-thalassemia traits, their coinheritance, and mutations, as well as to support the patients already diagnosed with β-thalassemia in East-Western Indian population for better management.Patients and methods: Seventy-five referral cases for β-thalassemia were analyzed for various β-thalassemia traits, heterozygosity, and homozygosity conditions. Blood phenotypic parameters using cell counter and capillary electrophoresis were investigated. Analyses of eight common mutations of thalassemia in India were carried out using polymerase chain reaction-amplification refractory mutation system, end point polymerase chain reaction, and DNA sequencing methods.Results: Of these (75 referral cases from East-Western Indian region, 68 were positive for β-thalassemia (90.67%. The majority of case types were of β-thalassemia minor (49, 65.33%, followed by HbE traits (6, 8.0% and β-thalassemia major, including heterozygous and homozygous (5, 6.66%; 4, 5.33% types and then HbE homozygous (2, 2.66%, as well as one each of the HbE/β-thalassemia and HbD/β-thalassemia (1, 1.34% combination. Mutation analysis also revealed that the highest frequency of mutation was c.92+5G>C (41, 60.29% followed by deletion 619bp (9, 13.23% and c.79G>A (8, 11

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

Science.gov (United States)

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Approaches to management of beta-thalassemia intermedia

Directory of Open Access Journals (Sweden)

Joseph E. Maakaron

2013-03-01

Full Text Available Thalassemia intermedia is a genetically diverse group of diseases that is the result of an imbalance in the production of the alpha and beta chains with ensuing chronic hemolysis, ineffective erythropoiesis, and iron overload.Resulting complications include bone changes, hypercoagulability, and end-organ damage due to iron overload. This decade has witnessed major breakthroughs in the management of thalassemia. In this article, we examine these novelties in therapy including iron chelation therapy, stem cell transplant, and gene therapy.Iron chelation therapy has been revolutionized with the advent of deferasirox, a once-daily oral iron chelator, that has been shown to be safe and efficacious.Gene therapy was also at the core of this revolution with the discovery of novel gene elements and viral vectors allowing for better control and improved outcomes.

Effect of ATRX and G-Quadruplex Formation by the VNTR Sequence on α-Globin Gene Expression.

Science.gov (United States)

Li, Yue; Syed, Junetha; Suzuki, Yuki; Asamitsu, Sefan; Shioda, Norifumi; Wada, Takahito; Sugiyama, Hiroshi

2016-05-17

ATR-X (α-thalassemia/mental retardation X-linked) syndrome is caused by mutations in chromatin remodeler ATRX. ATRX can bind the variable number of tandem repeats (VNTR) sequence in the promoter region of the α-globin gene cluster. The VNTR sequence, which contains the potential G-quadruplex-forming sequence CGC(GGGGCGGGG)n , is involved in the downregulation of α-globin expression. We investigated G-quadruplex and i-motif formation in single-stranded DNA and long double-stranded DNA. The promoter region without the VNTR sequence showed approximately twofold higher luciferase activity than the promoter region harboring the VNTR sequence. G-quadruplex stabilizers hemin and TMPyP4 reduced the luciferase activity, whereas expression of ATRX led to a recovery in reporter activity. Our results demonstrate that stable G-quadruplex formation by the VNTR sequence downregulates the expression of α-globin genes and that ATRX might bind to and resolve the G-quadruplex. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Beta-thalassemia- institution based analysis of ethnic and geographic distribution, effect of consanguinity and safety of chorionic villus sampling as a diagnostic, tool for pre-natal diagnosis in selected patients

International Nuclear Information System (INIS)

Abdullah, K.N.; Liaqat, J.; Azim, W.

2011-01-01

To study the ethnic and geographic distribution of Beta-thalassemia amongst the patients included and to study the effect of consanguinity in promoting this disease. Also, to establish the safety of CVS when used as a pre-natal diagnostic tool in aiding the early diagnosis of Beta-thalassemia in selected patients. Study Design: Descriptive Study. Place and Duration of Study: PNS Shifa Karachi, from Jan 2008 to Dec 2008. Patients and Methods: A total of 223 women out of 240 that were referred from all over Sindh to PNS Shifa Hospital Karachi for susceptible gene mutations participated in the study. The standard procedure that was used in this study was trans-abdominal aspiration of chorionic villi through suction needle. The samples were then sent for further analysis to the Pathology Department at PNS Shifa Hospital Karachi. Results: In our study population Beta-thalassemia was most prevalent in Sindhi 107 (48%) followed by Punjabi 46 (21%), 27 (12%) Pathan, and 43 (19%) Balochi. Out of 223 women, 95 were of thalassemia trait, while 85 were of thalassemia major. Fifty five percent of thalassemia trait and 56% of thalassemia major fetus parents were first cousins. The rate of pregnancy loss after performing CVS was 2.0% with no complications reported. Conclusion: It is concluded that highest percentage of thalassemia is in first cousins and sindhi origin families are mostly affected. However CVS is a safe and effective tool for prenatal diagnosis and subsequent counselling in selected couples. (author)

Sickle Cell Beta-Plus Thalassemia with Subcapsular Hematoma of the Spleen

Directory of Open Access Journals (Sweden)

Suyash Dahal

2017-01-01

Full Text Available While splenic complications like hypersplenism, sequestration crisis, and infarction are commonly reported in sickle cell variants like sickle cell beta-plus thalassemia, splenic rupture with hematoma is rare. We present a case of a 32-year-old young male who presented with dull left upper quadrant pain who was found to have multiple subcapsular splenic lacerations and hematoma on abdominal imaging. Hemoglobin electrophoresis confirmed sickle cell beta-plus thalassemia in the patient. There was no history of trauma, and rest of the workup for possible cause of spontaneous rupture of spleen was negative. With the patient refusing splenectomy, he was managed conservatively. Clinicians need to be aware of this rare complication of sickle cell variants.

Blood transfusion versus hydroxyurea in beta-thalassemia in Iran: a cost-effectiveness study.

Science.gov (United States)

Ravangard, Ramin; Mirzaei, Zahra; Keshavarz, Khosro; Haghpanah, Sezaneh; Karimi, Mehran

2017-11-21

Thalassemia intermedia is a type of anemia which has several treatments modalities. We aimed to study the cost effectiveness of two treatments, including blood transfusion and hydroxyurea, in patients with beta-thalassemia intermedia in south of Iran referred to a referral center affiliated to Iran, Shiraz University of Medical Sciences in 2015. This was a cost-effectiveness study which was conducted on 122 patients with beta-thalassemia intermedia. The indicator of effectiveness in this study was the reduction of growth disorder (normal BMI). Data analysis was done using SPSS 21, Excel 2010 and Treeage 2011. Finally, the one-way sensitivity analysis was performed to determine the robustness of the results. The average annual costs of blood transfusion and the use of hydroxyurea in 2015 were 20733.27 purchasing power parity (PPP)$ and 7040.29 PPP$, respectively. The effectiveness of blood transfusion was57.4% while in hydroxyurea group was 60.7%. The results showed that the cost effectiveness of using hydroxyurea was more than that of blood transfusion. Therefore, it is recommended that the use of hydroxyurea in the treatment of patients with beta-thalassemia intermedia would become the first priority, and more basic and supplementary insurance coverage for treating such patients using hydroxyurea should be considered.

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

Science.gov (United States)

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

NARCIS (Netherlands)

Loucari, C.C. (Constantinos C.); Patsali, P. (Petros); T.B. van Dijk (Thamar); Stephanou, C. (Coralea); Papasavva, P. (Panayiota); Zanti, M. (Maria); Kurita, R. (Ryo); Nakamura, Y. (Yukio); S. Christou (Soteroula); Sitarou, M. (Maria); J.N.J. Philipsen (Sjaak); C.W. Lederer (Carsten); M. Kleanthous (Marina)

2018-01-01

textabstractThe β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of

Mithramycin encapsulated in polymeric micelles by microfluidic technology as novel therapeutic protocol for beta-thalassemia

Directory of Open Access Journals (Sweden)

Capretto L

2012-01-01

Full Text Available Lorenzo Capretto1, Stefania Mazzitelli2, Eleonora Brognara2, Ilaria Lampronti2, Dario Carugo1, Martyn Hill1, Xunli Zhang1, Roberto Gambari2, Claudio Nastruzzi31Engineering Sciences, University of Southampton, Southampton, UK; 2Department of Biochemistry and Molecular Biology, 3Department of Pharmaceutical Sciences, University of Ferrara, Ferrara, ItalyAbstract: This report shows that the DNA-binding drug, mithramycin, can be efficiently encapsulated in polymeric micelles (PM-MTH, based on Pluronic® block copolymers, by a new microfluidic approach. The effect of different production parameters has been investigated for their effect on PM-MTH characteristics. The compared analysis of PM-MTH produced by microfluidic and conventional bulk mixing procedures revealed that microfluidics provides a useful platform for the production of PM-MTH with improved controllability, reproducibility, smaller size, and polydispersity. Finally, an investigation of the effects of PM-MTH, produced by microfluidic and conventional bulk mixing procedures, on the erythroid differentiation of both human erythroleukemia and human erythroid precursor cells is reported. It is demonstrated that PM-MTH exhibited a slightly lower toxicity and more pronounced differentiative activity when compared to the free drug. In addition, PM-MTH were able to upregulate preferentially γ-globin messenger ribonucleic acid production and to increase fetal hemoglobin (HbF accumulation, the percentage of HbF-containing cells, and their HbF content without stimulating α-globin gene expression, which is responsible for the clinical symptoms of ß-thalassemia. These results represent an important first step toward a potential clinical application, since an increase in HbF could alleviate the symptoms underlying ß-thalassemia and sickle cell anemia. In conclusion, this report suggests that PM-MTH produced by microfluidic approach warrants further evaluation as a potential therapeutic protocol

[Pretreatment doses of antithymocyte globubin-fresenius for allogeneic hematopoietic stem cell transplantation for beta-thalassemia major].

Science.gov (United States)

Li, Chunfu; Wang, Yanhua; Wu, Xuedong; Pei, Fuyu; He, Yuelin; Feng, Xiaoqin; Liu, Huaying

2012-05-01

To investigate the effects of different doses of antithymocyte globubin-fresenius (ATG-F) for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in patients with beta-thalassemia Major. Sixty-four children with beta-thalassemia major undergoing allo-HSCT were divided into two equal groups to receive ATG-F pretreatments at high (30 mg/kg) or low (15 mg/kg) doses as part of the conditioning regimen including mainly cyclophosphamide, busulfan, fludarabine, and thiotepa. The outcomes of the patients were compared between the two groups. No obvious difference were noted in the time to leukocyte and platelet engraftment between the two groups. The incidence of grade II-IV acute graft-versus-host disease (aGVHD) appeared to be higher in the low-dose group than in the high-dose group (12.5% vs 9.4%). The incidence of grade III-IV aGVHD was also higher in the low dose group (12.5% vs 6.3%), but the difference was not statistically significant. Application of high-dose ATG-F was associated with a higher rate of probable and possible fungal infection (P<0.05). The two doses of ATG-F is feasible as a part of the conditioning regimen for allo-HSCT in children with beta-thalassemia major.

Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

Energy Technology Data Exchange (ETDEWEB)

Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui [Nan fang Hospital, Southern Medical University, Guangzhou (China); Tamrakar, Karuna [Zhujiang Hospital, Southern Medical University, Guangzhou (China)

2012-03-15

Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

Intracranial extramedullary hematopoiesis in beta-thalassemia.

Science.gov (United States)

Karki, Bivek; Xu, Yi-Kai; Tamrakar, Karuna; Wu, Yuan-Kui

2012-01-01

Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

Intracranial Extramedullary Hematopoiesis in Beta-Thalassemia

International Nuclear Information System (INIS)

Karki, Bivek; Xu, Yi Kai; Wu, Yuan Kui; Tamrakar, Karuna

2012-01-01

Extramedullary hematopoiesis (EMH) represents tumor-like proliferation of hemopoietic tissue which complicates chronic hemoglobinopathy. Intracranial EMH is an extremely rare occurrence. Magnetic resonance imaging (MRI) offers a precise diagnosis. It is essential to distinguish EMH from other extradural central nervous system tumors, because treatment and prognosis are totally different. Herein, we report the imaging findings of beta-thalassemia in a 13-year-old boy complaining of weakness of left side of the body and gait disturbance; CT and MRI revealed an extradural mass in the right temporoparietal region.

Coexistence of Malaria and Thalassemia in Malaria Endemic Areas of Thailand

Science.gov (United States)

Kuesap, Jiraporn; Chaijaroenkul, W.; Rungsihirunrat, K.; Pongjantharasatien, K.; Na-Bangchang, Kesara

2015-01-01

Hemoglobinopathy and malaria are commonly found worldwide particularly in malaria endemic areas. Thalassemia, the alteration of globin chain synthesis, has been reported to confer resistance against malaria. The prevalence of thalassemia was investigated in 101 malaria patients with Plasmodium falciparum and Plasmodium vivax along the Thai-Myanmar border to examine protective effect of thalassemia against severe malaria. Hemoglobin typing was performed using low pressure liquid chromatography (LPLC) and α-thalassemia was confirmed by multiplex PCR. Five types of thalassemia were observed in malaria patients. The 2 major types of thalassemia were Hb E (18.8%) and α-thalassemia-2 (11.9%). There was no association between thalassemia hemoglobinopathy and malaria parasitemia, an indicator of malaria disease severity. Thalassemia had no significant association with P. vivax infection, but the parasitemia in patients with coexistence of P. vivax and thalassemia was about 2-3 times lower than those with coexistence of P. falciparum and thalassemia and malaria without thalassemia. Furthermore, the parasitemia of P. vivax in patients with coexistence of Hb E showed lower value than coexistence with other types of thalassemia and malaria without coexistence. Parasitemia, hemoglobin, and hematocrit values in patients with coexistence of thalassemia other than Hb E were significantly lower than those without coexistence of thalassemia. Furthermore, parasitemia with coexistence of Hb E were 2 times lower than those with coexistence of thalassemia other than Hb E. In conclusion, the results may, at least in part, support the protective effect of thalassemia on the development of hyperparasitemia and severe anemia in malaria patients. PMID:26174819

The Combination of CRISPR/Cas9 and iPSC Technologies in the Gene Therapy of Human β-thalassemia in Mice.

Science.gov (United States)

Ou, Zhanhui; Niu, Xiaohua; He, Wenyin; Chen, Yuchang; Song, Bing; Xian, Yexing; Fan, Di; Tang, Daolin; Sun, Xiaofang

2016-09-01

β-thalassemia results from point mutations or small deletions in the β-globin (HBB) gene that ultimately cause anemia. The generation of induced pluripotent stem cells (iPSCs) from the somatic cells of patients in combination with subsequent homologous recombination-based gene correction provides new approaches to cure this disease. CRISPR/Cas9 is a genome editing tool that is creating a buzz in the scientific community for treating human diseases, especially genetic disorders. Here, we reported that correction of β-thalassemia mutations in patient-specific iPSCs using the CRISPR/Cas9 tool promotes hematopoietic differentiation in vivo. CRISPR/Cas9-corrected iPSC-derived hematopoietic stem cells (HSCs) were injected into sublethally-irradiated NOD-scid-IL2Rg-/- (NSI) mice. HBB expression was observed in these HSCs after hematopoietic differentiation in the NSI mice. Importantly, no tumor was found in the livers, lungs, kidneys, or bone marrow at 10 weeks in the NSI mice after implantation with these HSCs. Collectively, our findings demonstrated that CRISPR/Cas9 successfully corrects β-thalassemia mutations in patient-specific iPSCs. These CRISPR/Cas9-corrected iPSC-derived HSCs express normal HBB in mice without tumorigenic potential, suggesting a safe strategy for personalized treatment of β-thalassemia.

Assessing the potential success of cystic fibrosis carrier screening: lessons learned from Tay-Sachs disease and beta-thalassemia.

Science.gov (United States)

Laberge, A-M; Watts, C; Porter, K; Burke, W

2010-01-01

The objective of this study was to identify factors involved in the success of 2 well-established population-based carrier screening programs - Tay-Sachs disease (TSD) in Ashkenazi Jews and beta-thalassemia in Sardinia and Cyprus - and to assess the potential for success of a population-based cystic fibrosis (CF) carrier screening strategy using these factors. We performed a literature review and key informant interviews. Factors involved in the success of TSD and beta-thalassemia carrier screening programs include disease characteristics (well-defined population at risk, severe disease with predictable course, availability of effective treatment), test characteristics (high sensitivity, straightforward interpretation of results), and community characteristics (involvement of community, support of families and advocacy groups, consensus in favor of avoiding affected births). Current CF screening strategies include few of the factors listed above. Unlike TSD and beta-thalassemia, the purpose of current CF carrier screening strategies is informed reproductive decision-making, without an explicit goal of reducing disease incidence. When compared to TSD and beta-thalassemia, CF is a less favorable candidate for population-based carrier screening. Because of its different purpose, CF carrier screening will require different measures of success than those used for TSD and beta-thalassemia carrier screening, and a consensus on the value or success of CF carrier screening may be difficult to achieve.

Frequency of hepatitis B and hepatitis C in multi - transfused beta thalassemia major patients

International Nuclear Information System (INIS)

Iqbal, M.M.; Hassan, S.; Aziz, S.

2010-01-01

To determine the frequency of hepatitis B and C virus infection among children with beta thalassemia major registered at Military Hospital Rawalpindi. Children attending Thalassemia Centre Military Hospital Rawalpindi for regular blood transfusion were registered. They belonged to different ethnic groups and came from different parts of the country. Their demographic data was recorded, detailed history taken and physical examination was carried out. Their serum samples were tested for hepatitis B surface antigen and anti HCV antibody assay with third generation commercial ELISA method. During the study; 141 patients of beta thalassemia major were screened. Out of them 50 patients (35.5% ,95% confidence interval 27.8-43.5)w ere found hepatitis C virus antibody positive and 1 patient (0.7 %) hepatitis B surface antigen positive. One patient (0.7%) had both hepatitis B and C virus infection. Mean age of hepatitis C infected patients was 10.4+3.85y ears (range 2-16 years). Mean age of uninfected patients was 6.1 + 3.59 years. (p value 0.000) In addition, the results indicate that higher prevalence of anti-HCV was significantly associated with longer duration of transfusion (p value <0.003). In spite of the fact that screened blood is used for transfusions, still a large number of patients have been found infected with hepatitis C. Therefore more accurate techniques are required for screening of blood to prevent transfusion associated transmission. (author)

alpha-Globin genes: thalassemic and structural alterations in a Brazilian population

Directory of Open Access Journals (Sweden)

M.R.S.C. Wenning

2000-09-01

Full Text Available Seven unrelated patients with hemoglobin (Hb H disease and 27 individuals with alpha-chain structural alterations were studied to identify the alpha-globin gene mutations present in the population of Southeast Brazil. The -alpha3.7, --MED and -(alpha20.5 deletions were investigated by PCR, whereas non-deletional alpha-thalassemia (alphaHphalpha, alphaNcoIalpha, aaNcoI, alphaIcalpha and alphaTSaudialpha was screened with restriction enzymes and by nested PCR. Structural alterations were identified by direct DNA sequencing. Of the seven patients with Hb H disease, all of Italian descent, two had the -(alpha20.5/-alpha3.7 genotype, one had the --MED/-alpha3.7 genotype, one had the --MED/alphaHphalpha genotype and three showed interaction of the -alpha3.7 deletion with an unusual, unidentified form of non-deletional alpha-thalassemia [-alpha3.7/(aaT]. Among the 27 patients with structural alterations, 15 (of Italian descent had Hb Hasharon (alpha47Asp->His associated with the -alpha3.7 deletion, 4 (of Italian descent were heterozygous for Hb J-Rovigo (alpha53Ala->Asp, 4 (3 Blacks and 1 Caucasian were heterozygous for Hb Stanleyville-II (alpha78Asn->Lys associated with the alpha+-thalassemia, 1 (Black was heterozygous for Hb G-Pest (alpha74Asp->Asn, 1 (Caucasian was heterozygous for Hb Kurosaki (alpha7Lys->Glu, 1 (Caucasian was heterozygous for Hb Westmead (alpha122His->Gln, and 1 (Caucasian was the carrier of a novel silent variant (Hb Campinas, alpha26Ala->Val. Most of the mutations found reflected the Mediterranean and African origins of the population. Hbs G-Pest and Kurosaki, very rare, and Hb Westmead, common in southern China, were initially described in individuals of ethnic origin differing from those of the carriers reported in the present study and are the first cases to be reported in the Brazilian population.

Bone metabolism and mineral density in patients with beta-thalassemia major

International Nuclear Information System (INIS)

Dundar, U.; Kupesiz, A.; Yesilipeck, A.; Ozdem, S.; Gultekin, M.; Gilgil, E.; Tuncer, T.

2007-01-01

To evaluate bone metabolism in patients with beta-thalassemia major and to determine the factors associated with the development of osteoporosis. We studied 25 patients with thalassemia major with a mean age of 18.4 years (rang 5-31), age and gender matched 24 healthy controls who were attending the outpatient physical medicine and rehabilitation clinic of Akdeniz University Hospital between January 2004 and March 2004 in Turkey. Bone mineral density (BMD) of lumbar spine (L-1-L4) and proximal femur were determined using dual x-ray absorptiometry (DXA). Venous blood samples were obtained for determination of blood cell count and markers of bone formation and resorption. The BMD values, both at lumbar and femoral neck levels were significantly lower in patients compared to controls. Serum N-telopeptide level was slightly higher, whereas osteocalcin was slightly lower in patients, however, the values were not statistically significant. Plasma levels of insulin like growth factor-1 (IGF-I) and insulin like growth factor for binding protein-3 (IGFBP-3) were significantly lower in patients. Also, serum levels of estradiol and progesterone in females, luteinizing, hormone and follicle-stimulating hormone in both genders were significantly lower in patients. Serum levels of free testosterone and total testosterone were lower in patients, but not statistically significant. Patients also had significantly higher serum phosphorous levels and lower serum calcitonin levels compared to controls. The BMD is decreased in thalassemic patients. Growth retardation, growth hormone/IGF-I/IGFP-3 axis dysfunction, gonadal dysfunction and hypothalomo-pituitary-gonadal axis dysfunction may be responsible for the development of osteoporosis in the patients with beta-thalassemia major. (author)

Altered erythropoiesis and iron metabolism in carriers of thalassemia

Science.gov (United States)

Guimarães, Jacqueline S.; Cominal, Juçara G.; Silva-Pinto, Ana Cristina; Olbina, Gordana; Ginzburg, Yelena Z.; Nandi, Vijay; Westerman, Mark; Rivella, Stefano; de Souza, Ana Maria

2014-01-01

The thalassemia syndromes (α- and β-thalassemia) are the most common and frequent disorders associated with ineffective erythropoiesis. Imbalance of α- or β-globin chain production results in impaired red blood cell synthesis, anemia and more erythroid progenitors in the blood stream. While patients affected by these disorders show definitive altered parameters related to erythropoiesis, the relationship between the degree of anemia, altered erythropoiesis and dysfunctional iron metabolism have not been investigated in both α-thalassemia carriers (ATC) and β-thalassemia carriers (BTC). Here we demonstrate that ATC have a significantly reduced hepcidin and increased soluble transferrin receptor levels but relatively normal hematological findings. In contrast, BTC have several hematological parameters significantly different from controls, including increased soluble transferrin receptor and erythropoietin levels. These changings in both groups suggest an altered balance between erythropoiesis and iron metabolism. The index sTfR/log ferrin and (hepcidin/ferritin)/sTfR are respectively increased and reduced relative to controls, proportional to the severity of each thalassemia group. In conclusion, we showed in this study, for the first time in the literature, that thalassemia carriers have altered iron metabolism and erythropoiesis. PMID:25307880

Effect of Average Annual Mean Serum Ferritin Levels on QTc Interval and QTc Dispersion in Beta-Thalassemia Major

Directory of Open Access Journals (Sweden)

Yazdan Ghandi

2017-08-01

Full Text Available Background There is evidence indicating impaired cardiomyocytic contractility, delayed electrical conduction and increased electrophysiological heterogeneities due to iron toxicity in beta-thalassemia major patients. In the present study, we compared the electrocardiographic and echocardiographic features of beta-thalassemia major patients with a healthy control group. Materials and Methods The average annual serum ferritin levels of fifty beta-thalassemia major patients were assessed. For each patient, corrected QT (QTc intervals and QTc dispersions (QTcd were calculated and V1S and V5R were measured. All subjects underwent two-dimensional M-mode echocardiography and Doppler study and were compared with 50 healthy subjects as a control group. Results QTc interval and dispersion were significantly higher in beta-thalassemia major patients (P= 0.001. The mean V5R (20.04 ± 4.34 vs. 17.14 ± 2.55 mm and V1S (10.24 ± 2.62 vs. 7.83 ± 0.38 mm showed considerably higher mean values in patients in comparison with control group.Peak mitral inflow velocity at early diastole and early to late ratio in the case- group was markedly higher(P

A cross-sectional study of metabolic and endocrine complications in beta-thalassemia major

International Nuclear Information System (INIS)

Najafipour, F.; Aliasgarzadeh, A.; Aghamohamadzadeh, N.; Bahrami, A.; Mobasri, M.; Niafar, M.; Khoshbaten, M.

2008-01-01

Iron overload is a major problem in patients with beta-thalassemia major, and it has many structural and metabolic consequences. The aim of this study was evaluation of endocrine disturbances in patients with beta-thalassemia major who were older than 10 years of age. In this cross-sectional study, investigator collected demographic data and medical histories, as well as menstrual history in females, from the medical records of 56 patients with beta-thalassemia major. Patients were examined to determine their pubertal status and the standard deviation score for height for evaluation of short stature. For evaluation of glucose tolerance, a fasting blood glucose and oral glucose tolerance tests were performed. Evidence for diabetes mellitus was based on American Diabetes Association and World Health Organization criteria. Serum levels of calcium, phosphorous, thyroid-stimulating hormone, free thyroxin, luteinizing hormone and follicular-stimulating hormone and estradiol in girls and testosterone in boys were measured. The mean and standard deviation for age in the 56 patients (36 males and 20 females) was 15.62+-4.44 years. Diabetes mellitus was present in 5 patients (8.9%), impaired fasting glucose was found in 16 patients (28.6%) and an impaired glucose tolerance test was found in 4 patients (7.1%). Short stature (standard deviation score <-2) was seen in 25 (70%) boys and 14 (73%) girls. Impaired puberty was found in 40 patients (71%). Hypocalcaemia and primary overt hyperthyroidism were present in 23 (41%) and 9 patients (16%), respectively. Only eight patients (14.3%) had no endocrine abnormalities. Despite therapy with deferoxamine to treat iron overload, the risk of secondary endocrine dysfunction remained high. Hypogonadism was one of the most frequent endocrine complications. Impaired glucose tolerance, short stature, hypocalcemia, subclinical and overt hypothyroidism are also frequent. (author)

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

Science.gov (United States)

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

Diabetes mellitus in β-thalassemia major patients

Directory of Open Access Journals (Sweden)

Riadi Wirawan

2003-06-01

Full Text Available β-thalassemia major is a disease caused by β polypeptide chain synthesis disorder which is inherited as an autosomal recessive from both parents which is marked by little or no β globin chain synthesis. Medication for β thalassemia major patients is by repeated blood transfusions, which causes hemochromatosis. Hemochromatosis can occur in various organs including the pancreas. The aim of the study was to assess the alteration of plasma glucose concentration and the hemochromatosis prevalence. Fasting plasma glucose concentration and serum ferritin examination were measured in 115 β thalassemia major patients with ages between 10-23 years who were out-patients in the Thalassemia Centre, Department of Child Health, Medical School, University of Indonesia / Dr. Cipto Mangunkusumo General Hospital, Jakarta. The plasma glucose concentration examination was conducted by the GDH enzymatic method, with American Diabetes Association (ADA criteria in the evaluation, while the serum ferritin examination was conducted with the microparticle enzyme immuno assay (MEIA method. All patients had hemochromatosis, 14.8% of the patients had impaired fasting glucose level and 2.6% of the patients showed indications of diabetes mellitus. β thalassemia major patients who receive frequent transfusions will develop hemochromatosis that will in turn impair the pancreatic function. (Med J Indones 2003; 12: 87-93 Keywords : β thalassemia major, hemochromatosis, diabetes mellitus

Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

Science.gov (United States)

Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

The pancreas in {beta}-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

Energy Technology Data Exchange (ETDEWEB)

Papakonstantinou, Olympia [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece); Attikon Hospital, 2nd Department of Radiology, Athens (Greece); Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos [Thalassemia Unit, University of Athens, ' ' Aghia Sophia' ' Children' s Hospital, Athens (Greece); Maris, Thomas; Gourtsoyiannis, Nicholas [University Hospital of Heraklion, Medical School of Crete, Department of Radiology, Heraklion, Crete (Greece)

2007-06-15

The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)

Thalassemia major and consanguinity in Shiraz city, Iran.

Science.gov (United States)

Asadi-Pooya, Ali Akbar; Doroudchi, Mehrnoosh

2004-09-05

Beta-thalassemia is among the most common genetic disorders in the world and in Iran, with widespread occurrence. A cross-sectional study on 648 beta-thalassemia patients in Shiraz, Iran was carried out to determine the demography of beta-thalassemia major in Shiraz city, Fars province, Iran and also the rate of consanguinity and the significance of pre-marriage counseling in decreasing familial marriages and consequently preventing this autosomal recessive genetic disease. All interviewed patients had thalassemia major and their age, sex, and the consanguinity between parents were recorded. 40.6% of beta-thalassemia patients were outcomes of first-cousin marriages. Comparison of the percentages of familial marriages (consanguinity) between parents of beta-thalassemia patients and a sample of normal population, revealed a statistically significant difference (pmarriages among thalassemic families, however, more education and awareness of young women and men about the increased risk of beta-thalassemia after familial marriage through pre-marriage counseling is still necessary.

Endocrinopathies in Turkish children with Beta thalassemia major: results from a single center study.

Science.gov (United States)

Isik, Pamir; Yarali, Nese; Tavil, Betül; Demirel, Fatma; Karacam, Gülşah Bayram; Sac, Rukiye Unsal; Fettah, Ali; Ozkasap, Serdar; Kara, Abdurrahman; Tunc, Bahattin

2014-10-01

The endocrinological complications in β-thalassemia major patients do affect the life quality to a large extend. In this study, the endocrinological complications of 47 β-thalassemia patients, who have been followed-up at our hospital's pediatric hematology department, were evaluated. Out of β-thalassemia major cases included to this study, the 55.3% was male and 44.7% was female. The patients' mean levels of ferritin, whose mean age was 10.0 ± 4.5 years (2-20 years), were 2497 ± 1469 ng/mL (472-8558 ng/mL). At least one endocrinological pathology in 27 out of 47 (57.4%) and more than one endocrinological pathology in 14 out of 47 (29.7%) thalassemia patients were observed. The most frequently observed complication in followed-up cases was vitamin D insufficiency and deficiency (78.2%). The other complications in decreasing order were pubertal failure (41.6%), growth retardation (25.5%), decreased bone-mineral density (22.2%), secondary hyperparathyroidism (11.5%), overt hypothyroidism (4.25%), subclinical hypothyroidism (2.12%), and impaired glucose tolerance (2.12%). There was no statistically significant difference between serum mean ferritin level and endocrin complications (P > .05). Four patients (8.5%) had decreased signal intensity in pituitary magnetic resonance imaging (MRI) but this finding was not associated with ferritin levels (P = .87). MRI parameters were similar between patients with and without gonadal dysfunction. Mean height of the pituitary gland was 4.98 ± 1.1 mm (3-9 mm) and this was similar to those normal values in the literature. Ferritin levels were not correlated with pituitary height (P > .05). Beta thalassemia major, having the potential of leading to multisystemic complications, is a chronic disease that should be treated and followed-up by a multidisciplinary approach. Due to frequently encountered endocrinological complications, beta thalassemic patients should be followed-up regularly by hematology and endocrinology

Genotyping of Kell, Duffy, Kidd and RHD in patients with b Thalassemia

Directory of Open Access Journals (Sweden)

Castilho Lilian

2000-01-01

Full Text Available Determination of Rh, Kell, Duffy and Kidd phenotypes in addition to ABO is used to prevent the alloimmunization to red blood cells (RBCs antigens and as part of the antibody identification process in patients with beta Thalassemia. However, phenotyping in these patients can be time consuming and difficult to interpret. In these situations, it would be valuable to have an alternative to hemagglutination tests to determine the patient's antigen profile. We used PCR-RFLP to genotype such patients. DNA was prepared from 50 patients with beta Thalassemia who had been phenotyped by routine hemagglutination, and tested for Kell, Kidd, Duffy/GATA mutation by PCR-RFLP. RHD/non-D was analysed by PCR product size associated to RHD gene sequence in intron 4 and exon 10/3'UTR. The genotyping assays were performed without knowledge of phenotype results. For RHD/non-D, 47 were RhD+ and RHD+/RHCE+, and 3 were RhD- and RHD-/RHCE+. For Kell, 48 kk were K2K2 and 2 Kk were K1K2. For Duffy, of 44 samples that had normal GATA box, 8 Fy(a+b- were FYA/FYA, 15 Fy(a+b+ were FYB/FYB, and 19 Fy(a+b+ were FYA/FYB; of the other 4 samples 3 were FYA/FYB and heterozygous GATA mutation, and 1 Fy(a-b- was FYB/FYB, homozygous GATA mutation. Two samples phenotyped as Fy(a+b- that had normal GATA , presented the 265T/298A mutations and two samples phenotyped as Fy(a-b+ were genotyped was FYA/FYB.. For Kidd , 15 Jk(a+b were JKA/JKA, 12 Jk(a-b+ were JKB/JKB, and 20 Jk(a+b+ were JKA/JKB. Three samples phenotyped as JK(a+b+ were genotyped as JKB/JKB. Genotype is more accurate than phenotype for determination of blood groups in polytransfused patients with betaThalassemia. Genotyping in these patients can be helpful to select antigen-negative RBCs for transfusion.

Spinal cord compression due to extramedullary hematopoiesis in beta-thalassemia intermedia

International Nuclear Information System (INIS)

Munn, Rita K.; Kramer, Carol A.; Arnold, Susanne M.

1998-01-01

Background: Extramedullary hematopoiesis (EMH) occurs in many disorders, including thalassemias and other hemoglobinopathies, and commonly presents in the spleen and liver. We present a case of spinal cord compression in a patient with beta-thalassemia intermedia, and review the literature and available treatment options. Patient and Methods: A 35-year-old black female with beta-thalassemia intermedia presented with a 3-week history of back pain and lower extremity weakness. Neurologic examination was consistent with spinal cord compression, and gadolinium enhanced magnetic resonance imaging (MRI) confirmed this diagnosis. She was given intravenous steroids and radiotherapy was begun in 200 cGy fractions to a total dose of 2000 cGy. Results: At the completion of radiotherapy the patient was ambulatory with mild residual weakness. MRI scans 16 months later showed smaller, but persistent masses, and she remains asymptomatic 5 years from her diagnosis. Conclusion: Recognition of spinal cord EMH requires prompt physical examination and MRI for accurate diagnosis. EMH can be managed with radiation, surgery, transfusions, or a combination of these therapies. Radiation in conservative doses of (750-3500 cGy) is non-invasive, avoids the surgical risks of potentially severe hemorrhage and incomplete resection, and has a high complete remission rate in the majority of patients. Relapse rates are moderate (37.5%), but retreatment provides excellent chance for second remission

Chorionic villus sampling for beta-thalassemia: the first report of experience in Iran.

Science.gov (United States)

Akhlaghpoor, Shahram

2006-12-01

Beta-thalassemia is one of the most common hereditary disorders in Iran. The prenatal diagnosis of beta-thalassemia is part of a control program in our country and it began 13 years ago. During the past 8 years the number of procedures has increased significantly as also the legal abortions. This is the first report made on the CVS program in Iran. One thousand six hundred and sixty-one cases of transabdominal Chorionic Villus Sampling (CVS) have been retrospectively evaluated. Among them 1381 cases had inclusion criteria. CVS results, complications and fetal loss rate were evaluated. The distributions of the population at risk were divided between eight regions that have been proposed for beta-thalassemia mapping previously. The mean age of the patients was 26.2 +/- 5.2 years with mean gestational age of 11.4 +/- 1.4 weeks. CVS was successful in all the patients (100%) although 1% required a second procedure. Post CVS fetal loss was 1.45%. Other minor complications were bleeding or spotting (1.81%), amniotic fluid leak (0.5%), small sub-chorionic hematoma (0.58%), severe abdominal pain (0.6%) and severe vasovagal reaction (0.14%). Late complications were seen in 0.21% (oligohydraminos). Approximately 2/3 of the patients were referred from three regions of the country, North (26.8%), South West (22.4%), Central (19.5%) and the remainder (31.3%) were from the other five regions. CVS is a safe and effective method for prenatal diagnosis of beta-thalassemia in countries with a high prevalence as in Iran. The overall complication rate is quite low and acceptable. Fortunately the recent acceptance of legal abortion with respect to Muslim rules has increased the effectiveness of the procedure and made great advances in its application in Iran. Correspondingly, social knowledge has also improved but still there is a gap between the population at risk and the required prenatal diagnosis laboratories and sampling centers. 2006 John Wiley & Sons, Ltd.

Better Renal Resistive Index Profile in Subjects with Beta Thalassemia Minor .

Science.gov (United States)

Basut, Fahrettin; Keşkek, Şakir Özgür; Gülek, Bozkurt

2018-05-03

Beta thalassaemia minor is a common genetic disorder without any characteristic symptoms except mild anemia. It is found to be associated with some cardiovascular risk factors such as insulin resistance and diabetes mellitus. The renal resistive index (RRI) is a measure of renal arterial resistance to blood flow. The aim of this study was to evaluate the renal resistive index in subjects with beta thalassaemia minor (BTM). A total of 253 subjects were included in this cross-sectional study. The study group consisted of 148 subjects with BTM and the control group consisted of 105 healthy subjects. Beta thalassaemia minor was diagnosed by complete blood count and hemoglobin electrophoresis. Blood pressure measurement and biochemical tests were performed. Renal resistive index of all subjects was measured using renal Doppler ultrasonography. Subjects with beta thalassemia minor had lower renal resistive indices compared to healthy subjects (0.58 ± 0.04 vs. 0.60 ± 0.06, p = 0.0016). Additionally, the RRI levels of subjects with BTM were correlated with systolic blood pressure (p = 0.017, r = 0.194). In this study, lower renal resistive index was found in subjects with BTM. This may be associated with decreased vascular resistance and blood viscosity in these subjects. ©2018The Author(s). Published by S. Karger AG, Basel.

A Comparison of Quality of Life between Adolescences with Beta Thalassemia Major and their Healthy Peers

Directory of Open Access Journals (Sweden)

Shahram Baraz

2016-01-01

Full Text Available Background The chronic genetic blood disorder, thalassemia, affects Quality of life (QOL negatively. Regarding this, if adolescences with thalassemia are treated well, they will grow into an adult who will have a good potential for participating in society. Objectives: to determine the strongest predictor of QOL, compare QOL between the adolescents with beta-type major and their peers in Abadan city. Materials and Methods This was a cross-sectional study; the population consisted of 65 beta thalassemia major patients and 65  healthy peers with the same ages as the witness group. The data collection tools included SF-36 questionnaire and a questionnaire for demographic information. Data analysis was performed using independent t-test, correlation and linear regression by SPSS-16. Results The results of the study revealed that there is a significant difference (P < 0.05 in the average quality of life between the two groups of the study. On the other hand, the results showed that there was a meaningful relation between different aspects of life quality and family history of thalassemia            (P< 0.05. Also, there was a negative correlation between quality of life and the frequency of blood transfusion per year (P< 0.05. Conclusion Adolescences with beta thalassemia major do not have a desirable quality of life, therefore, this fact shows the necessity of serious reforming in various fields of health care, treatment, family, social and financial support, and rehabilitation that need more attention from health care policymakers.

Distribution of thalassemias and associated hemoglobinopathies identified by prenatal diagnosis in Taiwan.

Science.gov (United States)

Peng, Ching-Tien; Liu, Su-Ching; Peng, Yi-Chin; Lin, Tsai-Hsiu; Wang, Shiow-Jain; Le, Ching-Yi; Shih, Mu-Chin; Tien, Ni; Lu, Jang-Jih; Lin, Chien-Yu

2013-10-01

Hemoglobin (Hb) gene disorders are common hereditary disorders in Taiwan, and α- and β-thalassemias are among the well-known Hb disorders here. Our study provides a primary reference for designing a locally relevant antenatal diagnostic test to control the spread of thalassemia. Between 1998 and 2011, prenatal diagnoses for identifying thalassemia and hemoglobinopathies were performed on 1240 fetuses at risk for α-hydrops and β-thalassemia major. Of 1240 specimens analyzed, 1082 (87%) were obtained by amniocentesis; 125 (10%), by chorionic villus sampling; and 33 (3%), by cordocentesis. Prenatal diagnoses revealed that 21.5% of these fetuses as thalassemia major (including α-thalassemia hydrops, β-thalassemia major, and Hb E/β-thalassemia); 50.2%, for thalassemia minor (include α-thalassemia carrier, β-thalassemia carrier, and α-thalassemia combined β-thalassemia carrier); and 28.3% for normal type (include non-α, β-thalassemia). The most common α-hydrops were SEA (Southeast Asian) and Philippine type (frequencies of 74.91 and 5.24%, respectively). The frequency of the IVS-II-654 combined codons 41/42 mutation, the most common β-thalassemia major mutation in this region, was 5.24%. Two fetuses were found with E/β-thalassemia (HbE/IVS-II-654 and HbE/codons 41/42, respectively). Since 1993, Taiwan's Department of Health adopted a national program for screening pregnancies to control spread of thalassemia. In the last 10years, less than 3 such cases have occurred per year. After 2003, this number was 0 for a total of 4years (2003, 2004, 2007, and 2008). In Taiwan, incidence and frequency of thalassemia genotypes were similar to those previously reported. The national program for screening pregnancies to control spread of thalassemia that resulted in a marked decline in the number of newborns with thalassemia major. Interestingly, prenatal diagnoses revealed 21.5% for thalassemia major, 50.2% for thalassemia minor, 28.3% normal comparison of thalassemia

Elevated Hb A₂ Levels in a Patient with a Compound Heterozygosity for the (β⁺) -31 (A > G) and (β⁰) Codon 17 (A > T) Mutations Together with a Single α-Globin Gene.

Science.gov (United States)

Panyasai, Sitthichai; Jaiping, Kanokwan; Pornprasert, Sakorn

2015-01-01

We report the molecular and hematological feature of a Thai woman who had clinical diagnosis of β-thalassemia intermedia (β-TI). Hemoglobin (Hb) high performance liquid chromatography (HPLC) analysis identified Hb A (64.4%), Hb F (12.3%) and Hb A2/E (15.9%) with small peaks of Hb Bart's (γ4) and Hb H (β4). She was initially diagnosed as EA Bart's disease, which occurs from combination of Hb H disease and Hb E (HBB: c.79G > A) trait. However, the Hb analysis using capillary electrophoresis (CE) demonstrated no Hb E, 68.5% Hb A, 15.5% Hb F and 16.0% Hb A2. DNA analysis showed a compound heterozygosity for (β(+)) -31 (A > G) (HBB: c.-81A > G) and (β(0)) codon 17 (A > T) (HBB: c.52A > T) mutations and deletional Hb H (- -(SEA)/-α(3.7)). Thus, she was finally diagnosed with a combination of Hb H disease and compound heterozygosity of β(+)/β(0)-thalassemia (β(+)/β(0)-thal). The β-globin mutations could affect not only hematological parameters but also elevate the Hb A2 levels. These effects could not be ameliorated by the coinheritance of Hb H disease. Therefore, a better understanding of the effects of this combination on hematological analysis data will be useful for providing accurate diagnosis, genetic counseling, prevention and control programs of β-thalassemia major (β-TM).

Complex Interaction of Hb Q-Thailand (HBA1: c.223G>C) with β-Thalassemia/Hb E (HBB: c.79G>A) Disease.

Science.gov (United States)

Panyasai, Sitthichai; Satthakarn, Surada; Pornprasert, Sakorn

2018-01-01

Hb Q-Thailand [α74(EF3)Asp→His (α1), GAC>CAC, HBA1: c.223G>C] is an abnormal hemoglobin (Hb) frequently found in Thailand and Southeast Asian countries. The association of the α Q-Thailand allele with other globin gene disorders has important implications in diagnosis. Here, we report how to diagnose the coinheritance of Hb Q-Thailand with β-thalassemia (β-thal)/Hb E disease in four Thai samples from high performance liquid chromatography (HPLC) and capillary electrophoresis (CE) testing results. Understanding of the HPLC chromatogram and CE electropherogram patterns of this complex mutation is important for interpretation of testing results and providing genetic counseling.

Rapid screening of β-Globin gene mutations by Real-Time PCR in ...

African Journals Online (AJOL)

Introduction of the real time PCR has made a revolution in the time taken for the PCR reactions. We present a method for the diagnosis of the common mutations of the B-thalassemia in Egyptian children & families. The procedure depends on the real-time PCR using specific fluorescently labeled hybridization probes.

Thalassemia in the United Arab Emirates: Why it can be prevented but not eradicated.

Directory of Open Access Journals (Sweden)

Sehjeong Kim

Full Text Available Thalassemia is a genetic blood disorder that causes abnormal hemoglobin. Hemoglobin is a protein in red blood cells that carries oxygen and is made of two proteins from four α-globin genes and two β-globin genes. A defect in one or more of these genes causes thalassemia. The treatment of thalassemia mostly depends on life-long blood transfusions and removal of excessive iron from the blood stream. Such tremendous blood consumption puts pressure on the national blood stock in many countries. In particular, in the United Arab Emirates (UAE, various forms of thalassemia prevention have been used and hence, the substantial reduction of the thalassemia major population has been achieved. However, the thalassemia carrier population still remains high, which leads to the potential increase in the thalassemia major population through carrier-carrier marriages. In this work, we investigate the long-term impact and efficacy of thalassemia prevention measures via mathematical modeling at a population level. To our best knowledge, this type of assessment has not been done before and there is no mathematical model that has investigated such a problem for thalassemia or any blood disorders at a population level. By using UAE data, we perform numerical simulations of our model and conduct sensitivity analysis of parameter values to see which parameter values affect most the dynamics of our model. We discover that the prevention measures can contribute to reduce the prevalence of the disease only in the short term but not eradicate the disease in the long term.

Characterizing a cohort of α-thalassemia couples collected during screening for hemoglobinopathies: 14 years of an Iranian experience.

Science.gov (United States)

Hafezi-Nejad, Nima; Khosravi, Mohsen; Bayat, Nooshin; Kariminejad, Ariana; Hadavi, Valeh; Oberkanins, Christian; Azarkeivan, Azita; Najmabadi, Hossein

2014-01-01

Our study aimed to determine the number of couples with normal hemoglobin (Hb) electrophoresis and low-borderline hematological values, which may come up with a clinically critical status in their offspring. The number of couples at risk for severe α-thalassemia (α-thal) needed to be estimated before recommending genetic counseling and prenatal diagnosis (PND). During the past 14 years, from at least 7000 referrals, 754 couples were investigated for α-thal by direct mutation detection methods followed by reverse strip assay and α-globin gene sequencing for inconclusive cases. Detection of silent β-thalassemia (β-thal) mutations was done in suspected cases by complete β-globin gene sequencing. We were able to provide a molecular diagnosis in 87.3% (658/754) of couples. A total of 9.1% (60/658) may have a clinically significant hemoglobinopathy in their offspring. Significant conditions included hydrops fetalis (20.0%; 12/60), certain Hb H (β4) genotypes (78.3%; 47/60) and β-thal intermedia (β-TI) (1.7%; 1/60). The diagnostic flowchart for couples with microcytic hypochromic anemia in countries with a high prevalence of hemoglobinopathies should include α and β gene sequencing. As our results indicate, every nine out of 100 of these couples will face significant hemoglobinopathies and every two out of 100 can carry Hb Bart's (γ4) hydrops fetalis in their pregnancies. For such cases, PND should be utilized to allow the carrier couples to decide whether or not to abort the fetus.

Peripheral Neuropathy: Not a Feature of Childhood Thalassemia

African Journals Online (AJOL)

Sedat Işıkay

an iron chelator, used for transfusion dependent thalassemia patients has been associated with sensorineural and sensorimotor neurotoxicity.[7,8] However, the data in literature regarding the peripheral neuropathy and beta thalassemia is limited. Moreover, there is a gap in literature about the factors that have a role in.

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

Directory of Open Access Journals (Sweden)

Roberta Faria Camilo-Araújo

2014-10-01

Full Text Available Objectives: To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method: The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction. Results: The genotype distribution of haplotypes was 43 (36.7% Central African Republic/Benin, 41 (35.0% Central African Republic/Central African Republic, 20 (17.0% Rare/atypical, and 13 (11.1% Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7 and 11.9% as heterozygous (−α3.7/αα. The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions: In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations.

Differentiation of the mRNA transcripts originating from the alpha 1- and alpha 2-globin loci in normals and alpha-thalassemics.

OpenAIRE

Liebhaber, S A; Kan, Y W

1981-01-01

The alpha-globin polypeptide is encoded by two adjacent genes, alpha 1 and alpha 2. In the normal diploid state (alpha alpha/alpha alpha) all four alpha-globin genes are expressed. Loss or dysfunction of one or more of these genes leads to deficient alpha-globin production and results in alpha-thalassemia. We present a technique to differentially assess the steady-state levels of the alpha 1- and alpha-2-globin messenger RNA (mRNA) transcripts and thus delineate the relative level of expressi...

Comparison of right and left side heart functions in patients with thalassemia major, patients with thalassemia intermedia, and control group.

Science.gov (United States)

Noori, Noormohammad; Mohamadi, Mehdi; Keshavarz, Kambiz; Alavi, Seyed Mostafa; Mahjoubifard, Maziar; Mirmesdagh, Yalda

2013-01-01

Heart disease is the main cause of mortality and morbidity in patients with beta thalassemia, rendering its early diagnosis vital. We studied and compared echocardiographic findings in patients with beta thalassemia major, patients with beta thalassemia intermedia, and a control group. Eighty asymptomatic patients with thalassemia major and 22 asymptomatic cases with thalassemia intermedia (8-25 years old) were selected from those referred to Ali Asghar Hospital (Zahedan-Iran) between June 2008 and June 2009. Additionally, 80 healthy individuals within the same age and sex groups were used as controls. All the individuals underwent echocardiography, the data of which were analyzed with the Student t-test. The mean value of the pre-ejection period/ejection time ratio of the left ventricle during systole, the diameter of the posterior wall of the left ventricle during diastole, the left and right isovolumic relaxation times, and the right myocardial performance index in the patients with beta thalassemia major and intermedia increased significantly compared to those of the controls, but the other parameters were similar between the two patient groups. The mean values of the left and right pre-ejection periods, left ventricular end systolic dimension, and left isovolumic contraction time in the patients with thalassemia intermedia increased significantly compared to those of the controls. In the left side, myocardial performance index, left ventricular mass index, isovolumic contraction time, and deceleration time exhibited significant changes between the patients with thalassemia major and those with thalassemia intermedia, whereas all the echocardiographic parameters of the right side were similar between these two groups. The results showed that the systolic and diastolic functions of the right and left sides of the heart would be impaired in patients with thalassemia major and thalassemia intermedia. Consequently, serial echocardiography is suggested in

Molecular characterization of hemoglobin D Punjab traits and clinical-hematological profile of the patients

Directory of Open Access Journals (Sweden)

Sanjay Pandey

Full Text Available CONTEXT AND OBJECTIVE: Hemoglobin (Hb D hemoglobinopathies are widespread diseases in northwestern India and usually present with mild hemolytic anemia and mild to moderate splenomegaly. The heterozygous form of Hb D is clinically silent, but coinheritance of Hb D with Hb S or beta-thalassemia produces clinically significant conditions like thalassemia intermedia of moderate severity. Under heterozygous conditions with coinheritance of alpha and beta-thalassemia, patients show a degree of clinical variability. Thus, our aim was to molecularly characterize the Hb D trait among individuals who were clinically symptomatic because of co-inheritance of alpha deletions or any beta-globin gene mutations. DESIGN AND SETTING: This was a cross-sectional study conducted in an autonomous tertiary-care hospital. METHODS: Complete blood count and red cell indices were measured using an automated cell analyzer. Quantitative assessment of hemoglobin Hb F, Hb A, Hb A2 and Hb D was performed by means of high performance liquid chromatography (HPLC. DNA extraction was done using the phenol-chloroform method. Molecular analyses on common alpha deletions and common beta mutations were done using the Gap polymerase chain reaction and Amplification Refractory Mutation System, respectively. RESULTS: We evaluated 30 patients and found clinical variation in the behavior of Hb D traits. In six patients, the Hb D traits were clinically symptomatic and behaved like those of thalassemia intermedia. Molecular characterization showed that three out of these six were IVS-1-5 positive. CONCLUSIONS: HPLC may not be the gold standard for diagnosing symptomatic Hb D Punjab traits. Hence, standard confirmation should include molecular studies.

Seroprevalence of parvovirus B19 infection in patients with beta thalassemia major in Fayoum University Hospital

Directory of Open Access Journals (Sweden)

Mohamed E. Al Ghwass

2016-09-01

Conclusion: Parvovirus B19 infection is detected in high rates among children with beta thalassemia major. Measures to avoid iatrogenic and nosocomial transmission have to be implemented including screening of donated blood for B19 especially blood given to patients with hematological disorders. Also data from this study support the need for introduction of an approved B19 vaccine that primarily protects children with thalassemia major against that infection.

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

Science.gov (United States)

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

Evaluation of the children with beta-thalassemia in terms of their self-concept, behavioral, and parental attitudes.

Science.gov (United States)

Yalçn, Siddika Songül; Durmuşoğlu-Sendoğdu, Mine; Gümrük, Fatma; Unal, Selma; Karg, Eda; Tuğrul, Belma

2007-08-01

This study was planned to explore the self-concept, behavioral, and parental attitudes of the children with beta-thalassemia major, and the factors that affect them. The study was undertaken between January and June 2004 at the Hacettepe University Ihsan Doğramaci Children's Hospital, Pediatric Hematology Unit, Ankara and 43 voluntary children with beta-thalassemia major on regular blood transfusion and iron chelation treatment between the ages of 5.0 and 18.0 years were included into the study. Age, sex, birth order, school performance, hemoglobin value, serum ferritin levels, associated illness, splenectomy status, presence of thalassemic sibling or relatives, death of thalassemic relatives, place of residence, maternal and paternal education were recorded. Parental Attitude Research Instrument, Piers-Harris Self-Concept Scale, and Child Behavior Checklist were applied. Higher educated mothers have lower overprotection (P=0.009), parental discordance (P=0.044), and discipline scores (P=0.002) than lower educated mothers. In cases with death of thalassemic relatives, democratic/equality attitude scores were decreased (P=0.034). With stepwise multiple linear regression analysis, splenectomy, good school achievement, absence of death of thalassemic relatives, and serum ferritin levels were found to increase Piers-Harris Self-Concept Scale; however, total behavior problem score was found to decrease with increasing age, splenectomy and decreasing overprotection subscale of Parental Attitude Research Instrument scores. The self-esteem and behavior problems of children with thalassemia depended not only on the variables related exclusively to the child (age, school achievement) and the illness-associated conditions (splenectomy, serum ferritin levels) but also on the parental attitude (overprotection).

Search for antisense copies of beta-globin mRNA in anemic mouse spleen

Directory of Open Access Journals (Sweden)

Taylor John M

2001-03-01

Full Text Available Abstract Background Previous studies by Volloch and coworkers have reported that during the expression of high levels of β-globin mRNA in the spleen of anemic mice, they could also detect small but significant levels of an antisense (AS globin RNA species, which they postulated might have somehow arisen by RNA-directed RNA synthesis. For two reasons we undertook to confirm and possibly extend these studies. First, previous studies in our lab have focussed on what is an unequivocal example of host RNA-directed RNA polymerase activity on the RNA genome of human hepatitis delta virus. Second, if AS globin species do exist they could in turn form double-stranded RNA species which might induce post-transcriptional gene silencing, a phenomenon somehow provoked in eukaryotic cells by AS RNA sequences. Results We reexamined critical aspects of the previous globin studies. We used intraperitoneal injections of phenylhydrazine to induce anemia in mice, as demonstrated by the appearance and ultimate disappearance of splenomegaly. While a 30-fold increase in globin mRNA was detected in the spleen, the relative amount of putative AS RNA could be no more than 0.004%. Conclusions Contrary to earlier reports, induction of a major increase in globin transcripts in the mouse spleen was not associated with a detectable level of antisense RNA to globin mRNA.

UPF1 silenced cellular model systems for screening of read-through agents active on β039 thalassemia point mutation.

Science.gov (United States)

Salvatori, Francesca; Pappadà, Mariangela; Breveglieri, Giulia; D'Aversa, Elisabetta; Finotti, Alessia; Lampronti, Ilaria; Gambari, Roberto; Borgatti, Monica

2018-05-15

Nonsense mutations promote premature translational termination, introducing stop codons within the coding region of mRNAs and causing inherited diseases, including thalassemia. For instance, in β 0 39 thalassemia the CAG (glutamine) codon is mutated to the UAG stop codon, leading to premature translation termination and to mRNA destabilization through the well described NMD (nonsense-mediated mRNA decay). In order to develop an approach facilitating translation and, therefore, protection from NMD, ribosomal read-through molecules, such as aminoglycoside antibiotics, have been tested on mRNAs carrying premature stop codons. These findings have introduced new hopes for the development of a pharmacological approach to the β 0 39 thalassemia therapy. While several strategies, designed to enhance translational read-through, have been reported to inhibit NMD efficiency concomitantly, experimental tools for systematic analysis of mammalian NMD inhibition by translational read-through are lacking. We developed a human cellular model of the β 0 39 thalassemia mutation with UPF-1 suppressed and showing a partial NMD suppression. This novel cellular model could be used for the screening of molecules exhibiting preferential read-through activity allowing a great rescue of the mutated transcripts.

Activation of Fetal γ-globin Gene Expression via Direct Protein Delivery of Synthetic Zinc-finger DNA-Binding Domains

Directory of Open Access Journals (Sweden)

Mir A Hossain

2016-01-01

Full Text Available Reactivation of γ-globin expression has been shown to ameliorate disease phenotypes associated with mutations in the adult β-globin gene, including sickle cell disease. Specific mutations in the promoter of the γ-globin genes are known to prevent repression of the genes in the adult and thus lead to hereditary persistence of fetal hemoglobin. One such hereditary persistence of fetal hemoglobin is associated with a sequence located 567 bp upstream of the Gγ-globin gene which assembles a GATA-containing repressor complex. We generated two synthetic zinc-finger DNA-binding domains (ZF-DBDs targeting this sequence. The -567Gγ ZF-DBDs associated with high affinity and specificity with the target site in the γ-globin gene promoter. We delivered the -567Gγ ZF-DBDs directly to primary erythroid cells. Exposure of these cells to the recombinant -567Gγ ZF-DBDs led to increased expression of the γ-globin gene. Direct protein delivery of ZF-DBDs that compete with transcription regulatory proteins will have broad implications for modulating gene expression in analytical or therapeutic settings.

Effect of long-term transfusion therapy on the glycometabolic status and pancreatic beta cell function in patients with beta Thalassemia major

Directory of Open Access Journals (Sweden)

Kamalakshi G Bhat

2014-01-01

Full Text Available Background: Diabetes mellitus is a major complication of iron overload in patients with beta thalassemia major. Design: This is a descriptive study conducted in a Tertiary Care Teaching Hospital to analyze beta cell function and insulin resistance, and their relation to iron overload status in beta thalassemia major. Fasting glucose, two-hour post load glucose, fasting insulin, alanine amino transaminase (ALT, and ferritin were used as outcome measures. The homeostatic model assessment (HOMA model was used to calculate the beta cell function and insulin resistance index. Results: Of the 30 cases, 20% had impaired fasting glucose, 3.3% had impaired glucose tolerance, and none had diabetes. Fasting glucose was not significant between the cases and controls (P = 0.113. Fasting insulin (P = 0.001, ferritin (P = 0.001, and ALT (P = 0.001 levels were significantly high in the cases. Insulin resistance index was significantly higher in the cases (P = 0.001 as also the beta cell function (P = 0.001. With increase in age and the number of units transfused there is a decline in beta cell function, fasting insulin, and insulin resistance after attaining the maximum level. This suggests that initial insulin resistance is followed by insulin depletion due to loss of beta cell function, leading to diabetes mellitus. Conclusion: Impaired glucose tolerance (IGT and insulin resistance precede the onset of insulin-dependent diabetes and adequate chelation therapy is essential for delaying the onset or for prevention of diabetes.

Complex Interaction of Hb Q-Thailand with α0- and β0-Thalassemia in a Chinese Family.

Science.gov (United States)

He, Sheng; Qin, Qian; Lin, Li; Chen, Qiuli; Yi, Shang; Wei, Honhwei; Du, Juan; Zheng, Chenguang; Qiu, Xiaoxia; Chen, Biyan

2017-01-01

Hb Q-Thailand [α74(EF3)Asp→His (α1); HBA1: c.223 G>C] is an abnormal hemoglobin (Hb), variant found mainly in China and Southeast Asian countries. The association of the α Q -Thailand allele with other globin gene disorders has important implications in diagnosis. Here, we report a hitherto undescribed condition of patients with a double heterozygosity for Hb Q-Thailand with α 0 -thalassemia (α 0 -thal) and in combination with β 0 -thalassemia (β 0 -thal) in a Chinese family. Our study will provide some clinical manifestations, laboratory diagnosis and genetic counseling for complex hemoglobinopathies.

Hypertriglyceridemia Thalassemia Syndrome: Common Disease, Uncommon Association.

Science.gov (United States)

Das, Lipsa; Samprathi, Madhusudan; Shukla, Umesh; Bandyopadhyay, Debapriya; Das, Rashmi Ranjan

2016-07-01

Hypertriglyceridemia has been rarely described with thalassemia, an entity called hypertriglyceridemia-thalassemia syndrome. The authors describe a young infant diagnosed with thalassemia major with severe hypertriglyceridemia. The presence of severe hypertriglyceridemia in this child which rapidly resolved after transfusion, probably suggests a self limited mechanism which may not require therapy. Though hypertriglyceridemia has been reported with hemolytic anemias, the mechanism is unclear. This case illustrates that thalassemia may be associated with hypertriglyceridemia; once familial and secondary causes are ruled out, clinicians may wait for spontaneous resolution before considering specific therapy.

Increased levels of advanced glycation end products positively correlate with iron overload and oxidative stress markers in patients with β-thalassemia major.

Science.gov (United States)

Mirlohi, Maryam Sadat; Yaghooti, Hamid; Shirali, Saeed; Aminasnafi, Ali; Olapour, Samaneh

2018-04-01

The impaired biosynthesis of the β-globin chain in β-thalassemia leads to the accumulation of unpaired alpha globin chains, failure in hemoglobin formation, and iron overload due to frequent blood transfusion. Iron excess causes oxidative stress and massive tissue injuries. Advanced glycation end products (AGEs) are harmful agents, and their production accelerates in oxidative conditions. This study was conducted on 45 patients with major β-thalassemia who received frequent blood transfusions and chelation therapy and were compared to 40 healthy subjects. Metabolic parameters including glycemic and iron indices, hepatic and renal functions tests, oxidative stress markers, and AGEs (carboxymethyl-lysine and pentosidine) levels were measured. All parameters were significantly increased in β-thalassemia compared to the control except for glutathione levels. Blood glucose, iron, serum ferritin, non-transferrin-bound iron (NTBI), MDA, soluble form of low-density lipoprotein receptor, glutathione peroxidase, total reactive oxygen species (ROS), and AGE levels were significantly higher in the β-thalassemia patients. Iron and ferritin showed a significant positive correlation with pentosidine (P overload in β-thalassemia major patients and highlight the enhanced formation of AGEs, which may play an important role in the pathogenesis of β-thalassemia major.

Comparison of MicroRNAs Mediated in Reactivation of the γ-Globin in β-Thalassemia Patients, Responders and Non-Responders to Hydroxyurea.

Science.gov (United States)

Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser

2017-03-01

Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.

Detection of Hb Constant Spring (HBA2: c.427T>C) Heterozygotes in Combination with β-Thalassemia or Hb E Trait by Capillary Electrophoresis.

Science.gov (United States)

Pornprasert, Sakorn; Saoboontan, Supansa; Punyamung, Manoo

2015-01-01

Hb Constant Spring (Hb CS; HBA2: c.427T>C) is often missed by routine laboratory testing as its mRNA as well as gene product are unstable and presented at a low level in peripheral blood. This study aimed to analyze the efficacy of capillary electrophoresis (CE) for detecting and quantifying of Hb CS in β-thalassemia (β-thal) trait or Hb E (HBB: c.79G>A) trait samples with reduced β-globin chain expression. Thalassemia diagnostic data were reviewed in 2524 blood samples that were submitted to the laboratory of the Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand for hemoglobinopathy and thalassemia diagnosis. DNA analysis for Hb CS was performed in 322 β-thal trait and 397 Hb E trait samples using the amplification refractory mutation system (ARMS). The CE electropherogram of Hb CS at zone 2 was observed in all five samples with β-thal trait and nine samples with Hb E trait with levels varying from 0.1-2.8 and 0.1-2.3%, respectively. Thus, the CE method proved useful for screening of Hb CS in samples with β-thal trait or Hb E trait, which is essential for providing accurate diagnosis, genetic counseling, prevention and control programs of Hb H-CS disease.

Molecular analysis of Hb Q-H disease and Hb Q-Hb E in a Singaporean family.

Science.gov (United States)

Tan, J; Tay, J S; Wong, Y C; Kham, S K; Bte Abd Aziz, N; Teo, S H; Wong, H B

1995-01-01

Hb Q (alpha 74Asp-His) results from a mutation in the alpha-gene such that abnormal alpha Q-chains are synthesized. The alpha Q-chains combine with the normal Beta A-chains to form abnormal Hb alpha 2Q beta 2A (Hb Q). Hb Q-H disease is rare, and has been reported only in the Chinese. We report here a Chinese family, were the mother diagnosed with Hb Q-H disease and the father with Hb E heterozygosity and a child with Hb Q-E-thalassemia. Thalassemia screening of the mother's blood revealed a Hb level of 6.8g/dl with low MCV and MCH. Her blood film was indicative of thalassemia. Cellulose acetate electrophoresis showed Hb H and Hb Q with the absence of Hb A. Globin chain biosynthesis was carried out and alpha Q- and beta-chains were detected. Normal alpha- chains were absent. Digestion of the mother's DNA with Bam HI and Bgl II followed by hybridization with the 1.5 kb alpha-Pst probe showed a two alpha-gene deletion on one chromosome and the -alpha Q chain mutant with the -alpha 4.2 defect on the other chromosome. DNA amplification studies indicated the two-gene deletion to be of the -SEA/ defect. The patient was concluded to possess Hb Q-H disease (--SEA/-alpha 4.2Q). Cellulose acetate electrophoresis of the father's blood showed the presence of Hb A, F and E. Molecular analysis of the father's DNA confirmed an intact set of alpha-genes (alpha alpha/alpha alpha). Globin chain biosynthesis of fetal blood of their child showed gamma, beta A, beta E, alpha A and alpha Q-chains. Molecular analysis of the child's DNA showed one alpha-gene deletion, thus giving a genotype of alpha alpha/-alpha 4.2Q beta beta E.

Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

NARCIS (Netherlands)

Pourfarzad, Farzin; von Lindern, Marieke; Azarkeivan, Azita; Hou, Jun; Kia, Sima Kheradmand; Esteghamat, Fatemehsadat; van Ijcken, Wilfred; Philipsen, Sjaak; Najmabadi, Hossein; Grosveld, Frank

2013-01-01

β-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult β-globin

Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

Science.gov (United States)

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2015-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

Pulmonary hypertension associated with thalassemia syndromes

Science.gov (United States)

Fraidenburg, Dustin R.; Machado, Roberto F.

2016-01-01

Chronic hemolytic anemia has increasingly been identified as an important risk factor for the development of pulmonary hypertension. Within the thalassemia syndromes, there are multiple mechanisms, both distinct and overlapping, by which pulmonary hypertension develops and that differ among β-thalassemia major or intermedia patients. Pulmonary hypertension in β-thalassemia major correlates with the severity of hemolysis, yet in patients whose disease is well treated with chronic transfusion therapy, the development of pulmonary hypertension can be related to cardiac dysfunction and the subsequent toxic effects of iron overload rather than hemolysis. β-thalassemia intermedia, on the other hand, has a higher incidence of pulmonary hypertension owing to the low level of hemolysis that exists over years without the requirement for frequent transfusions, while splenectomy is shown to play an important role in both types. Standard therapies such as chronic transfusion have been shown to mitigate pulmonary hypertension, and appropriate chelation therapy can avoid the toxic effects of iron overload, yet is not indicated in many patients. Limited evidence exists for the use of pulmonary vasodilators or other therapies, such as l-carnitine, to treat pulmonary hypertension associated with thalassemia. Here we review the most recent findings regarding the pathogenic mechanisms, epidemiology, presentation, diagnosis, and treatment of pulmonary hypertension in thalassemia syndromes. PMID:27008311

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

Science.gov (United States)

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion).

Science.gov (United States)

Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida

2013-06-01

Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

Some endocrinal aspects of pancreas in beta thalassemia

Energy Technology Data Exchange (ETDEWEB)

Badder, M A; Megahed, Y M; Gafer, M; Abdel Kariem, M M [Pediatric dept., faculty of medicine, Zagazig university and Middle eastern regional Radioisotope Center for The Arab Countries, (Egypt)

1995-10-01

The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs.

Some endocrinal aspects of pancreas in beta thalassemia

International Nuclear Information System (INIS)

Badder, M.A.; Megahed, Y.M.; Gafer, M.; Abdel Kariem, M.M.

1995-01-01

The study was carried out to evaluate endocrinal aspects of the pancreas in thalassemia children, ages 5 - 10 years maintained under either regular or irregular iron chelation therapy. A matched control on healthy children, was included for comparison. As regards laboratory findings, fasting and post prandial blood sugar was significantly elevated in thalassemia children than the control and serum insulin was significantly lower in the irregular iron chelation group than both in the regular one and in the control group. Most cases of diabetic thalassemia children clinically and biochemically were of irregular iron chelation and with older age. They were frequently higher transfused. There is significant rise of serum ferritin in diabetic group than in diabetic thalassemia children. In conclusion, pancreatic dysfunction can be detected in thalassemia children, but regular iron chelation can reduce its occurrence. 10 tabs

Therapeutic hemoglobin levels after gene transfer in β-thalassemia mice and in hematopoietic cells of β-thalassemia and sickle cells disease patients.

Directory of Open Access Journals (Sweden)

Laura Breda

Full Text Available Preclinical and clinical studies demonstrate the feasibility of treating β-thalassemia and Sickle Cell Disease (SCD by lentiviral-mediated transfer of the human β-globin gene. However, previous studies have not addressed whether the ability of lentiviral vectors to increase hemoglobin synthesis might vary in different patients.We generated lentiviral vectors carrying the human β-globin gene with and without an ankyrin insulator and compared their ability to induce hemoglobin synthesis in vitro and in thalassemic mice. We found that insertion of an ankyrin insulator leads to higher, potentially therapeutic levels of human β-globin through a novel mechanism that links the rate of transcription of the transgenic β-globin mRNA during erythroid differentiation with polysomal binding and efficient translation, as reported here for the first time. We also established a preclinical assay to test the ability of this novel vector to synthesize adult hemoglobin in erythroid precursors and in CD34(+ cells isolated from patients affected by β-thalassemia and SCD. Among the thalassemic patients, we identified a subset of specimens in which hemoglobin production can be achieved using fewer copies of the vector integrated than in others. In SCD specimens the treatment with AnkT9W ameliorates erythropoiesis by increasing adult hemoglobin (Hb A and concurrently reducing the sickling tetramer (Hb S.Our results suggest two major findings. First, we discovered that for the purpose of expressing the β-globin gene the ankyrin element is particularly suitable. Second, our analysis of a large group of specimens from β-thalassemic and SCD patients indicates that clinical trials could benefit from a simple test to predict the relationship between the number of vector copies integrated and the total amount of hemoglobin produced in the erythroid cells of prospective patients. This approach would provide vital information to select the best candidates for these

Imaging features of thalassemia

Energy Technology Data Exchange (ETDEWEB)

Tunaci, M.; Tunaci, A.; Engin, G.; Oezkorkmaz, B.; Acunas, G.; Acunas, B. [Dept. of Radiology, Istanbul Univ. (Turkey); Dincol, G. [Dept. of Internal Medicine, Istanbul Univ. (Turkey)

1999-07-01

Thalassemia is a kind of chronic, inherited, microcytic anemia characterized by defective hemoglobin synthesis and ineffective erythropoiesis. In all thalassemias clinical features that result from anemia, transfusional, and absorptive iron overload are similar but vary in severity. The radiographic features of {beta}-thalassemia are due in large part to marrow hyperplasia. Markedly expanded marrow space lead to various skeletal manifestations including spine, skull, facial bones, and ribs. Extramedullary hematopoiesis (ExmH), hemosiderosis, and cholelithiasis are among the non-skeletal manifestations of thalassemia. The skeletal X-ray findings show characteristics of chronic overactivity of the marrow. In this article both skeletal and non-skeletal manifestations of thalassemia are discussed with an overview of X-ray findings, including MRI and CT findings. (orig.)

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

Science.gov (United States)

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

COAGULOPATHY IN BETA-THALASSEMIA: CURRENT UNDERSTANDING AND FUTURE PERSPECTIVES

Directory of Open Access Journals (Sweden)

M. Domenica Cappellini

2009-12-01

Full Text Available As the life expectancy of β-thalassemia patients has markedly improved over the last decade, several new complications are being recognized. The presence of a high incidence of thromboembolic events, mainly in thalassemia intermedia patients, has led to the identification of a hypercoagulable state in thalassemia. In this review, the molecular and cellular mechanisms leading to hypercoagulability in thalassemia are highlighted, and the current clinical experience is summarized. Recommendations for thrombosis prophylaxis are also discussed.

Position-independent high level expression of the human β-globin gene in transgenic mice.

NARCIS (Netherlands)

F.G. Grosveld (Frank); G. Blom van Assendelft (Greet); D.R. Greaves (David); G. Kollias (George)

1987-01-01

textabstractWe have constructed a "minilocus" that contains the 5' and 3' flanking regions of the human beta-globin locus and the beta-globin gene. These regions are characterized by erythroid-specific DNAase I-superhypersensitive sites and are normally located approximately 50 kb 5' and 20 kb 3' of

Increased expression of alpha- and beta-globin mRNAs at the pituitary following exposure to estrogen during the critical period of neonatal sex differentiation in the rat

DEFF Research Database (Denmark)

Leffers, H; Navarro, V M; Nielsen, John E

2006-01-01

Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element in the neuroe......Deterioration of reproductive health in human and wildlife species during the past decades has drawn considerable attention to the potential adverse effects of exposure to xenosteroids during sensitive periods of sex development. The hypothalamic-pituitary (HP) unit is a key element......, we screened for differentially expressed genes at the pituitary and hypothalamus of rats after neonatal exposure to estradiol benzoate. Our analyses identified persistent up-regulation of alpha- and beta-globin mRNAs at the pituitary following neonatal estrogenization. This finding was confirmed...... by combination of RT-PCR analyses and in situ hybridization. Induction of alpha- and beta-globin mRNA expression at the pituitary by neonatal exposure to estrogen was demonstrated as dose-dependent and it was persistently detected up to puberty. In contrast, durable up-regulation of alpha- and beta-globin genes...

Characterization of Hb Bart's Hydrops Fetalis Caused by - -SEA and a Large Novel α0-Thalassemia Deletion.

Science.gov (United States)

He, Sheng; Li, Jihui; Huang, Peng; Zhang, Shujie; Lin, Li; Zuo, Yangjin; Tian, Xiaoxian; Zheng, Chenguang; Qiu, Xiaoxia; Chen, Biyan

2018-01-01

Hb Bart's hydrops fetalis is the most severe and generally fatal clinical phenotype of α-thalassemia (α-thal), which is due to the deletion of all four functional α-globin genes of hemoglobin (Hb), resulting in no α-globin chain production (- -/- -). Homozygosity for the - - SEA (Southeast Asian) α-globin gene deletion is the main cause of the Hb Bart's hydrops fetalis in Asia, especially South China. Occasionally, other α 0 -thal deletions can also be found. In this study, we report a case with an atypical form of Hb Bart's hydrops fetalis that was caused by - - SEA and a large novel α 0 -thal deletion (- - GX ) (Guangxi). The fetus with Hb Bart's in our study presented fetal hydrops features in early gestation which was different from that of traditional Hb Bart's hydrops fetalis with a homozygous - - SEA deletion. The early onset of fetal hydrops is attributed to the decreased formation of embryonic Hb Portland (ζ2γ2), which is proposed as a candidate for reactivation in cases of severe α-thal. Our findings indicated that it was important to characterize new or rare mutations, and highlighted the significance of using ultrasonography to identify signs of Hb Bart's hydrops fetalis.

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

Science.gov (United States)

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Beta thalassemia major: The effect of age on glomerular filtration rate

Directory of Open Access Journals (Sweden)

Majid Malaki

2011-01-01

Full Text Available Thalassemia is a common hereditary hemoglobinopathy disorder that affects many organs in the body. Estimation of kidney function is important, as it is the vital organ that plays the major role in the elimination of accumulated iron as well as the chelating drugs that have to be used as therapy. Sixty- three patients aged 1-29 years, with a mean ± SD of 14 ± 6.7 years, affected with beta- thalassemia major in Tabriz Children′s Hospital were evaluated for their renal function on the basis of their age, serum iron, serum ferritin and serum creatinine levels along with two methods of estimating glomerular filtration rate (GFR; by Schwartz method for those under 18 years old and using Modification of Diet in Renal Disease (MDRD formula for those who were 18 years and above. Elevation of serum creatinine denoting renal dysfunction was not seen in our patients, but hyperfiltration was a common finding. An increasing GFR was observed, which corresponded to age, but no relationships were seen between serum iron, serum ferritin, regular blood transfusion, chelating therapy to GFR.

Human γ-globin genes silenced independently of other genes in the β-globin locus.

NARCIS (Netherlands)

N.O. Dillon (Niall); F.G. Grosveld (Frank)

1991-01-01

textabstractErythropoiesis during human development is characterized by switches in expression of beta-like globin genes during the transition from the embryonic through fetal to adult stages. Activation and high-level expression of the genes is directed by the locus control region (LCR), located 5'

Hemoglobinopathies and thalassemia screening among Senoi Orang Asli in Peninsular Malaysia

Science.gov (United States)

Rong, Danny Koh Xuan; Ismail, Endom; Sabudin, Raja Zahratul Azma Raja; Hussin, Noor Hamidah; Othman, Ainoon

2015-09-01

Orang Asli are the minority indigenous people in Peninsular Malaysia and can be divided into 3 main groups (Negrito, Senoi and Proto Malay) with different six sub-ethnics under each group. Within the Senoi group, the six sub-ethnics are sub-ethnic Mah Meri, Semoq Beri, Che Wong, Jah Hut, Semai and Temiar. This study was aimed to investigate the current prevalence of α- and β-thalassemia and hemoglobinopathies and their mutation types among all six sub-ethnics of Senoi Orang Asli. Blood samples from 685 Senoi participants were collected and sent immediately for routine full blood count analysis and hemoglobin sub-typing. Of 378 subjects screened, 7 subjects were found to be Hemoglobin E (HbE) beta thalassemia carriers, 13 beta thalassaemic, 35 Hemoglobin Constant Spring (HbCS) carriers, 6 compound HbE and HbCS carriers, 32 with HbE disease and 163 HbE heterozygote carriers. The findings of high HbE among Temiars and Jah Huts and high HbCS exclusively in Jah Huts in this study suggest distinct differences across sub-ethnics under Senoi group. Understanding of prevalence and wide spectrum of thalassemia and hemoglobinopathies among Senoi and Orang Asli is essential for national thalassaemia awareness and prevention program, especially in Orang Asli communities.

Extraosseous radiotracer uptake on bone scan in beta-thalassemia: report of one case

International Nuclear Information System (INIS)

Guezguez, M.; Nouira, M.; Sfar, R.; Chatti, K.; Ben Fradj, M.; Ben Ali, K.; Ajmi, S.; Essabbah, H.; Zrour, S.

2009-01-01

Red blood cell transfusion, main therapeutic modality of beta-thalassemia, leads to iron overload which may perturb several metabolic ways. The aim of this paper is to illustrate the uptake abnormalities observed on bone scan of thalassaemic patients and to discuss mechanisms of extraosseous accumulation of the radiopharmaceutical in this pathology. We report a 16-year-old child suffering from beta-thalassemia major undergoing transfusion therapy. A bone scan was indicated to look for osseous infection. This study revealed a little skeletal uptake and abnormal liver, splenic and renal accumulation. A repeat bone scan, performed three weeks later showed a better skeletal uptake which enabled the discovery of focal abnormalities and made the diagnostic easier. The effect of iron overload on radiopharmaceuticals uptake in bone scan is known since 1975. Dissociation of 99m Tc from the carrier ligand due to the presence of iron excess seems the most plausible hypothesis. Free 99m Tc can be bound to other tissular substrates which can explain extraosseous uptake. The normally available pool for bone is reduced and then the skeletal uptake decreased. This report limits considerably the sensitivity of the bone scan. A well-led iron chelation and eventually the use of diuretic drug may guarantee a better quality of bone scan images. (authors)

[Molecular characterization of heterozygous beta-thalassemia in Lanzarote, Spain].

Science.gov (United States)

Calvo-Villas, José Manuel; de la Iglesia Iñigo, Silvia; Ropero Gradilla, Paloma; Zapata Ramos, María Francisca; Cuesta Tovar, Jorge; Sicilia Guillén, Francisco

2008-04-05

The aim of this study was to determine the molecular defects of heterozygous beta thalassaemia and to ascertain their distribution in Lanzarote. Molecular characterization was achieved by real time polymerase chain reaction (RT-PCR LightCycler, Roche), PCR-ARMS (PCR-amplification reaction mutations system) and DNA sequencing on an automated DNA sequencer. Two hundred forty-three heterozygous beta thalassaemia carriers were included between July 1991 and February 2007. RT-PCR detected the molecular defect in 81% of the beta thalassaemia chromosomes analyzed [113 codon CD 39 (C --> T); 41 IVS-1-nt-110 (G --> A), 25 IVS 1-nt-1 (G --> A) and 19 IVS 1-nt-6 (T --> C)]. The remaining 12 molecular defects included the deletion 619 bp (7.8%) and the mutations -28 (A --> G), IVS1-nt-2 (T --> G), CD 41/42 (-TTCT), CD 8/9 (+G), CD 51 (-C), CD 22 (G --> T) and CD 24 (T --> A), CD 67 (-TG) and the novel mutation CD 20/21-TGGA. The distribution of the mutations is similar to that found in the Mediterranean area. The increasing migratory flow received in the Canary Islands may explain the emergence of new mutations not reported before in our area.

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

Science.gov (United States)

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

Community genetics and health approaches for bringing awareness in tribals for the prevention of beta-thalassemia in India

Directory of Open Access Journals (Sweden)

Ranbir S. Balgir

2011-08-01

Full Text Available Beta (β thalassemia syndromes are a group of hereditary disorders characterized by a genetic deficiency in the synthesis of β-globin chains. In the homozygous state, β-thalassemia (i.e., thalassemia major causes severe transfusion-dependent anemia. Inherited β-thalassemia syndromes cause high degree of hemolytic anemia, recurrent fever, clinical jaundice, frequent infections, bossing of cheek bones, growth retardation, splenomegaly, etc. and are responsible for high infant morbidity, mortality and fetal wastage in India. The victims include the infants, growing children, adolescent girls, pregnant women and a large chunk of ignorant people. In view of heavy genetic load, frequent requirement of blood transfusions, high cost of treatment and management, physical trauma, and mental and psychological harassment to the patients and their families, it has been realized that preventive community health and genetics approach is the most suitable for India. After carrier detection, prenatal diagnosis, and genetic couselling are the important options for couples at high risk for β-thalassemia. A prerequisite for successful prevention and intervention approach in India is the health education, bringing public awareness, sensitization, and community screening for the identification of heterozygotes or carriers in the concerned community. Some suggestions for the prevention of β-thalassemia in the vulnerable communities of India have been over emphasized for amelioration.β地中海贫血综合症是一簇遗传性异常，其特点是β球蛋白链接合处基因缺失。β地贫（或重型地贫）在纯和状态下导致严重的输液依赖型贫血症。遗传性的β地贫综合症引起严重的溶血�

Non-transfusion-dependent thalassemias

Science.gov (United States)

Musallam, Khaled M.; Rivella, Stefano; Vichinsky, Elliott; Rachmilewitz, Eliezer A.

2013-01-01

Non-transfusion-dependent thalassemias include a variety of phenotypes that, unlike patients with beta (β)-thalassemia major, do not require regular transfusion therapy for survival. The most commonly investigated forms are β-thalassemia intermedia, hemoglobin E/β-thalassemia, and α-thalassemia intermedia (hemoglobin H disease). However, transfusion-independence in such patients is not without side effects. Ineffective erythropoiesis and peripheral hemolysis, the hallmarks of disease process, lead to a variety of subsequent pathophysiologies including iron overload and hypercoagulability that ultimately lead to a number of serious clinical morbidities. Thus, prompt and accurate diagnosis of non-transfusion-dependent thalassemia is essential to ensure early intervention. Although several management options are currently available, the need to develop more novel therapeutics is justified by recent advances in our understanding of the mechanisms of disease. Such efforts require wide international collaboration, especially since non-transfusion-dependent thalassemias are no longer bound to low- and middle-income countries but have spread to large multiethnic cities in Europe and the Americas due to continued migration. PMID:23729725

Noninvasive analysis of skin iron and zinc levels in beta-thalassemia major and intermedia

International Nuclear Information System (INIS)

Gorodetsky, R.; Goldfarb, A.; Dagan, I.; Rachmilewitz, E.A.

1985-01-01

Diagnostic x-ray spectrometry, a method based on x-ray fluorescence analysis, was used for noninvasive determination of iron and zinc in two distinct skin areas, representing predominantly dermal and epidermal tissues, in 56 patients with beta-thalassemia major and intermedia. The mean iron levels in the skin of patients with beta-thalassemia major and intermedia were elevated by greater than 200% and greater than 50%, respectively, compared with control values. The zinc levels of both skin areas examined were within the normal range. The data indicate that the rate and number of blood transfusions, which correlated well with serum ferritin levels (r . 0.8), are not the only factors that determine the amount of iron deposition in the skin (r less than 0.6). Other sources of iron intake contribute to the total iron load in the tissues, particularly in patients who are not given multiple transfusions. The noninvasive quantitation of skin levels may reflect the extent of iron deposition in major parenchymal organs. Repeated DXS examinations of the skin could monitor the clearance of iron from the tissues of patients with iron overload in the course of therapy with chelating agents

VNTR alleles associated with the {alpha}-globin locus are haplotype and population related

Energy Technology Data Exchange (ETDEWEB)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J. [Univ. of Oxford (United Kingdom)

1994-09-01

The human {alpha}-globin complex contains several polymorphic restriction-enzyme sites (i.e., RFLPs) linked to form haplotypes and is flanked by two hypervariable VNTR loci, the 5{prime} hypervariable region (HVR) and the more highly polymorphic 3{prime}HVR. Using a combination of RFLP analysis and PCR, the authors have characterized the 5{prime}HVR and 3{prime}HVR alleles associated with the {alpha}-globin haplotypes of 133 chromosomes, and they here show that specific {alpha}-globin haplotypes are each associated with discrete subsets of the alleles observed at these two VNTR loci. This statistically highly significant association is observed over a region spanning {approximately} 100 kb. With the exception of closely related haplotypes, different haplotypes do not share identically sized 3{prime}HVR alleles. Earlier studies have shown that {alpha}-globin haplotype distributions differ between populations; the current findings also reveal extensive population substructure in the repertoire of {alpha}-globin VNTRs. If similar features are characteristic of other VNTR loci, this will have important implications for forensic and anthropological studies. 42 refs., 5 figs., 5 tabs.

Expression of human gamma-globin genes in human erythroleukemia (K562) cells.

Science.gov (United States)

Donovan-Peluso, M; Acuto, S; Swanson, M; Dobkin, C; Bank, A

1987-12-15

K562 cells express embryonic (epsilon) and fetal (gamma) globins and hemoglobins but not adult (beta) globin. To define the cis acting regulatory elements involved in the discrimination between gamma and beta genes, we have constructed chimeric genes composed of portions of gamma and beta and evaluated their expression in stable K562 transfectants. A gamma beta fusion gene containing gamma 5' sequences to the EcoRI site in exon 3 and beta sequences 3' is expressed at 10-40% that of the endogenous gamma level. In 50% of the lines, this fusion gene appropriately increases its expression in response to hemin, an inducer of endogenous globin gene expression in K562 cells. In contrast, a beta gamma fusion gene, containing beta sequences 5' to the EcoRI site in exon 3 and gamma sequences 3', is neither expressed nor correctly initiated. A beta gene containing gamma-intervening sequence (IVS) 2 accumulates an mRNA transcript when analyzed with a 3' beta probe. However, no correctly initiated beta mRNA is observed. A gamma gene with beta-IVS 2 is only inducible in one of six expressing clones. All the results are consistent with the presence of stage-specific trans acting factors in K562 cells that stimulate expression of gamma genes and suggest a significant role for gamma-IVS 2 in gamma gene expression.

Future prospects for treatment of hemoglobinopathies.

OpenAIRE

Stamatoyannopoulos, J A

1992-01-01

Strategies for the treatment of sickle cell anemia and beta-thalassemia are founded on the knowledge that these disorders result from structural or functional defects in an adult gene for which an intact fetal counterpart exists. During the past decade, several pharmacologic agents have been investigated for their potential to ameliorate sickle cell anemia and beta-thalassemia by increasing the synthesis of fetal hemoglobin in adults. Progress in understanding globin gene regulation is now be...

Expression of the benign HEXA mutations, Arg247Trp and Arg249Trp, associated with beta-hexosaminidase A pseudodeficiency

Energy Technology Data Exchange (ETDEWEB)

Cao, Z.; Petroulakis, E.; Salo, T. [Univ. of Manitoba (Canada)] [and others

1994-09-01

{beta}-Hexosaminidase (Hex A) is a heterodimer of {alpha} and {beta} subunits encoded by the HEXA and HEXB genes, respectively. Mutations in the HEXA gene typically cause Tay-Sachs disease or less severe forms of G{sub M2} gangliosidosis. However, two benign mutations (Arg247Trp and Arg249Trp) in the {alpha}-subunit of Hex A account for Hex A deficiency in {approximately}36% of non-Jewish enzyme-defined Tay-Sachs disease carriers. These mutations do not result in any apparent clinical phenotype in individuals who are genetic compounds with a second disease-causing mutation. We expressed the {alpha}-subunit harboring each of the benign mutations separately to study activity toward the synthetic substrate, 4-MUGS, for comparison to activity from enzymes containing mutations associated with other forms of G{sub M2} gangliosidosis. The C739T (Arg247Trp;benign), C745T (Arg 249Trp; benign), G805A (Gly269Ser; adult-onset), G749A (Gly250Asp; juvenile), and C508T (Arg170Trp; infantile) mutations were introduced into the {alpha}-subunit cDNA. These were transfected alone, or with the {beta}-subunit cDNA, to generate Hex S ({alpha}{alpha}) or Hex A ({alpha}{beta}), respectively. The activities were monitored using 4-MUGS, and the levels of {alpha}-subunit protein were assessed by Western blotting. Repeated experiments show that the benign mutations produce approximately 35% of normal Hex S and 40% of normal Hex A activity. This level is much higher than that of Hex A harbouring the Gly169Ser adult-onset mutation (12%). A sequential decrease in expressed Hex A activity is observed as mutations associated with more severe phenotypes are expressed. The benign mutations also result in lower levels of mature {alpha}-subunit protein compared to normal, and slightly reduced levels of {alpha}-subunit precursor protein. The Hex A deficiency resulting from benign mutations is not as great as that associated with disease-causing mutations.

Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province

Directory of Open Access Journals (Sweden)

Reza Zamani

2015-05-01

Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.

A common signaling pathway is activated in erythroid cells expressing high levels of fetal hemoglobin: a potential role for cAMP-elevating agents in β-globin disorders

Directory of Open Access Journals (Sweden)

Ikuta T

2013-12-01

Full Text Available Tohru Ikuta,1 Yuichi Kuroyanagi,1 Nadine Odo,1 Siyang Liu21Department of Anesthesiology and Perioperative Medicine, 2Department of Physiology, Medical College of Georgia, Georgia Regents University, Augusta, GA, USABackground: Although erythroid cells prepared from fetal liver, cord blood, or blood from β-thalassemia patients are known to express fetal hemoglobin at high levels, the underlying mechanisms remain elusive. We previously showed that cyclic nucleotides such as cAMP and cGMP induce fetal hemoglobin expression in primary erythroid cells. Here we report that cAMP signaling contributes to high-level fetal hemoglobin expression in erythroid cells prepared from cord blood and β-thalassemia.Methods: The status of the cAMP signaling pathway was investigated using primary erythroid cells prepared from cord blood and the mononuclear cells of patients with β-thalassemia; erythroid cells from adult bone marrow mononuclear cells served as the control.Results: We found that intracellular cAMP levels were higher in erythroid cells from cord blood and β-thalassemia than from adult bone marrow. Protein kinase A activity levels and cAMP-response element binding protein phosphorylation were higher in erythroid cells from cord blood or β-thalassemia than in adult bone marrow progenitors. Mitogen-activated protein kinase pathways, which play a role in fetal hemoglobin expression, were not consistently activated in cord blood or β-thalassemia erythroid cells. When cAMP signaling was activated in adult erythroid cells, fetal hemoglobin was induced at high levels and associated with reduced expression of BCL11A, a silencer of the β-globin gene.Conclusion: These results suggest that activated cAMP signaling may be a common mechanism among erythroid cells with high fetal hemoglobin levels, in part because of downregulation of BCL11A. Activation of the cAMP signaling pathway with cAMP-elevating agents may prove to be an important signaling mechanism to

Brain alpha- and beta-globin expression after intracerebral hemorrhage

OpenAIRE

He, Yangdong; Hua, Ya; Lee, Jin-Yul; Liu, Wenquan; Keep, Richard F; Wang, Michael M.; Xi, Guohua

2010-01-01

Our recent study has demonstrated that hemoglobin (Hb) is present in cerebral neurons and neuronal Hb is inducible after cerebral ischemia. In the present study, we examined the effects of intracerebral hemorrhage (ICH) on the mRNA levels of the α-globin (HbA) and the β-globin (HbB) components of Hb and Hb protein in the brain in vivo and in vitro. In vivo, male Sprague-Dawley rats received either a needle insertion (sham) or an infusion of autologous whole blood into the basal ganglia and we...

Frequency of Thalassemia in Iran and Khorasan Razavi

Directory of Open Access Journals (Sweden)

Gholam Hasan Khodaei

2013-12-01

Full Text Available Introduction: Beta-thalassemia is the most common hereditary disease in Iran. More than two million carriers of beta-thalassemia live in Iran. Since the Iranian population is a mixture of different ethnic groups, it is necessary to determine the frequency  in the different parts of the country. Materials and Methods: This descriptive study is a cross sectional study with helping by professional groups fighting diseases in Khorasan Razavi province.   Results: In Iran, according to World Health Organization, about 4 percent of the population, are carriers of the thalassemia gene. In other words, about 2-3 million people are suffering from thalassemia minor.Now, more than 18 thousand cases of thalassemia are scattered across the country in different provinces, are different. Mazandaran, Gilan, Hormozgan, Khuzestan, kohgiloyeh, Fars, Bushehr, Sistan and Baluchestan, Kerman and Isfahan, are 10 provinces with high prevalence in our country. We have 342 cases of thalassemia major in Khorasan Razavi province.   Conclusion: Prevalence  of thalassemia in our country is 3.6%  and Iran is located on the belt of thalassemia and due to a history of consanguinity, this disease has a prevalence of 0.6% among in the provinces of Khorasan Razavi.

Disease-associated mutations that alter the RNA structural ensemble.

Directory of Open Access Journals (Sweden)

Matthew Halvorsen

2010-08-01

Full Text Available Genome-wide association studies (GWAS often identify disease-associated mutations in intergenic and non-coding regions of the genome. Given the high percentage of the human genome that is transcribed, we postulate that for some observed associations the disease phenotype is caused by a structural rearrangement in a regulatory region of the RNA transcript. To identify such mutations, we have performed a genome-wide analysis of all known disease-associated Single Nucleotide Polymorphisms (SNPs from the Human Gene Mutation Database (HGMD that map to the untranslated regions (UTRs of a gene. Rather than using minimum free energy approaches (e.g. mFold, we use a partition function calculation that takes into consideration the ensemble of possible RNA conformations for a given sequence. We identified in the human genome disease-associated SNPs that significantly alter the global conformation of the UTR to which they map. For six disease-states (Hyperferritinemia Cataract Syndrome, beta-Thalassemia, Cartilage-Hair Hypoplasia, Retinoblastoma, Chronic Obstructive Pulmonary Disease (COPD, and Hypertension, we identified multiple SNPs in UTRs that alter the mRNA structural ensemble of the associated genes. Using a Boltzmann sampling procedure for sub-optimal RNA structures, we are able to characterize and visualize the nature of the conformational changes induced by the disease-associated mutations in the structural ensemble. We observe in several cases (specifically the 5' UTRs of FTL and RB1 SNP-induced conformational changes analogous to those observed in bacterial regulatory Riboswitches when specific ligands bind. We propose that the UTR and SNP combinations we identify constitute a "RiboSNitch," that is a regulatory RNA in which a specific SNP has a structural consequence that results in a disease phenotype. Our SNPfold algorithm can help identify RiboSNitches by leveraging GWAS data and an analysis of the mRNA structural ensemble.

Nuclear topography of beta-like globin gene cluster in IL-3-stimulated human leukemic K-562 cells

Czech Academy of Sciences Publication Activity Database

Galiová-Šustáčková, Gabriela; Bártová, Eva; Kozubek, Stanislav

2004-01-01

Roč. 33, č. 1 (2004), s. 4-14 ISSN 1079-9796 R&D Projects: GA ČR GA301/01/0186; GA AV ČR KSK5052113; GA AV ČR IAA5004306; GA ČR GA202/04/0907; GA MŠk ME 565 Institutional research plan: CEZ:AV0Z5004920 Keywords : beta-like globin gene cluster * K-562 cells * nuclear topography Subject RIV: BO - Biophysics Impact factor: 2.549, year: 2004

A membrane-bound vertebrate globin.

Directory of Open Access Journals (Sweden)

Miriam Blank

Full Text Available The family of vertebrate globins includes hemoglobin, myoglobin, and other O(2-binding proteins of yet unclear functions. Among these, globin X is restricted to fish and amphibians. Zebrafish (Danio rerio globin X is expressed at low levels in neurons of the central nervous system and appears to be associated with the sensory system. The protein harbors a unique N-terminal extension with putative N-myristoylation and S-palmitoylation sites, suggesting membrane-association. Intracellular localization and transport of globin X was studied in 3T3 cells employing green fluorescence protein fusion constructs. Both myristoylation and palmitoylation sites are required for correct targeting and membrane localization of globin X. To the best of our knowledge, this is the first time that a vertebrate globin has been identified as component of the cell membrane. Globin X has a hexacoordinate binding scheme and displays cooperative O(2 binding with a variable affinity (P(50∼1.3-12.5 torr, depending on buffer conditions. A respiratory function of globin X is unlikely, but analogous to some prokaryotic membrane-globins it may either protect the lipids in cell membrane from oxidation or may act as a redox-sensing or signaling protein.

Hematological and Molecular Characterization of a Novel Hb A2 Variant with Homozygous α-Thalassemia-2 in a Southern Thai Individual.

Science.gov (United States)

Nuinoon, Manit; Jeenduang, Nutjaree; Kesornsit, Aumpika; Horpet, Dararat; Plyduang, Thunyaluk

2017-05-01

We report here the hematological and molecular features of a novel δ-globin chain variant found in a Southern Thai woman. Her complete blood count was as follows: red blood cell (RBC) count 5.90 × 10 12 /L, hemoglobin concentration (Hb) 12.6 g/dL, packed cell volume (PCV) 0.41 L/L, mean corpuscular volume (MCV) 69.5 fL, mean corpuscular Hb (MCH) 21.4 pg, mean corpuscular Hb concentration (MCHC) 30.7 g/dL and RBC distribution width (RDW) 13.1%. The blood smear demonstrated microcytic hypochromic RBCs suggestive of thalassemia trait. Hemoglobin analysis identified Hb A 2  + Hb A 2 -Kiriwong (2.4%) and Hb F (0.1%) on high performance liquid chromatography (HPLC). To characterize the α-thalassemia (α-thal) genotype, common α-thal-1 and α-thal-2 alleles were characterized by multiplex gap-polymerase chain reaction (gap-PCR). The results revealed homozygous α-thal-2 (-α 3.7 /-α 3.7 ) in this case. DNA sequencing showed the presence of a novel δ-globin gene mutation [δ77(EF1)His→Arg; HBD: c.233A>G] that we named Hb A 2 -Kiriwong for the village from where the proband lived. In summary, the presence of microcytic hypochromic RBCs in this case was likely the result of the homozygous -α 3.7 (rightward) deletion and was not affected by this Hb A 2 variant.

A Novel High-Content Immunofluorescence Assay as a Tool to Identify at the Single Cell Level γ-Globin Inducing Compounds.

Directory of Open Access Journals (Sweden)

Marta Durlak

Full Text Available The identification of drugs capable of reactivating γ-globin to ameliorate β-thalassemia and Sickle Cell anemia is still a challenge, as available γ-globin inducers still have limited clinical indications. High-throughput screenings (HTS aimed to identify new potentially therapeutic drugs require suitable first-step-screening methods combining the possibility to detect variation in the γ/β globin ratio with the robustness of a cell line. We took advantage of a K562 cell line variant expressing β-globin (β-K562 to set up a new multiplexed high-content immunofluorescence assay for the quantification of γ- and β-globin content at single-cell level. The assay was validated by using the known globin inducers hemin, hydroxyurea and butyric acid and further tested in a pilot screening that confirmed HDACs as targets for γ-globin induction (as proved by siRNA-mediated HDAC3 knockdown and by treatment with HDACs inhibitors entinostat and dacinostat and identified Heme-oxygenases as novel candidate targets for γ-globin induction. Indeed, Heme-oxygenase2 siRNA knockdown as well as its inhibition by Tin protoporphyrin-IX (TinPPIX greatly increased γ-globin expression. This result is particularly interesting as several metalloporphyrins have already been developed for clinical uses and could be tested (alone or in combination with other drugs to improve pharmacological γ-globin reactivation for the treatment of β-hemoglobinopathies.

Hydroxyurea responsiveness in β-thalassemic patients is determined by the stress response adaptation of erythroid progenitors and their differentiation propensity

NARCIS (Netherlands)

F. Pourfarzad, F. (Farzin); M.M. von Lindern (Marieke); A. Azarkeivan (Azita); J. Hou (Jun); S.K. Kia; F. Esteghamat (Fatemehsadat); W.F.J. van IJcken (Wilfred); J.N.J. Philipsen (Sjaak); H. Najmabadi (Hossein); F.G. Grosveld (Frank)

2013-01-01

textabstractβ-thalassemia is caused by mutations in the β-globin locus resulting in loss of, or reduced, hemoglobin A (adult hemoglobin, HbA, α2β2) production. Hydroxyurea treatment increases fetal γ-globin (fetal hemoglobin, HbF, α2γ2) expression in postnatal life substituting for the missing adult

The survival analysis of beta thalassemia major patients in South East of Iran

International Nuclear Information System (INIS)

Roudbari, M.; Soltani-Rad, M.; Roudbari, S.

2008-01-01

The objective was to determine the survival of beta-thalassemia major patients with transfusion, and its related factors in Southeast of Iran. This cross-sectional study was performed in Zahedan, Iran in 2007. The sample included patients who were referred from all over the Zahedan Thalassemia Center from 1998 to 2006. The data were collected using the patient's records, which were recorded by the staff during transfusion. The data included demographic and medical information blood group, blood RH, the kind of transfused blood [KTB], annual number of transfusions [ANOT], accompanied disease [AD], Hemoglobin [Hb] and ferritin level. For data analysis, the Kaplan-Meyer method, and Long Rank test together with Cox Regression were used. Forty-six of 578 patients died and 99% survived for the first year. The ages survival proportions were 5 (97.9%), 10 (97%), 15 (92.1%), and 20 (81.2%) years. The survival time showed significant relationships with the ANOT p=0.0053, KTB p=0.003, Hb=0.002 and ferritin level p=0.0087, and AD p=0.00. Using regular transfusion, paying attention to screening of transfused blood, increasing the families knowledge on the disease to prevent the bearing of thalassemia fetus, are recommended; finally, the detection and treating of the AD, are of great importance to extend the lifetime of the patients. (author)

β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.

Science.gov (United States)

Patel, Ashwin P; Patel, Rupesh B; Patel, Saumyaa A; Vaniawala, Salil N; Patel, Dipika S; Shrivastava, Naina S; Sharma, Narmadeshwar P; Zala, Jayendrasinh V; Parmar, Prakash H; Naik, Madhuben R

2014-01-01

Prenatal diagnosis (PND) is one of the most cost effective preventive methods, but it is available only in the large cities of India. Therefore, we initiated a program that offers PND and allows us to determine the prevalence of various mutations. Pregnant females (n = 111,426) were screened for hemoglobinopathies using complete blood count (CBC) and high performance liquid chromatography (HPLC). If the female had a hemoglobinopathy, her husband was then tested. If hemoglobinopathies were seen in both partners, a genetic mutation study was performed on the couple. Fetal samples were obtained by either chorionic villus sampling (CVS) in 70.6% or amniocentesis in 29.4%. The study included 282 couples. IVS-I-5 (G > C) was the most common mutation in all castes except in the Sindhis and Lohanas, where the 619 bp deletion was the most common. Prenatal testing was informative in 97.9% of the couples. A significant number of couples (41.0%) underwent PND during their first pregnancy. Seven patients with β-thalassemia (β-thal) trait had normal Hb A2 levels. The Hb A2 and Hb F values varied significantly (p  T or G > A), were present in 81.0% of the couples tested. β-Thalassemia mutation frequency varied among the different castes, underlining the need for evolving a testing strategy that considers the caste system. Targeting antenatal clinics could also prove to be a most cost effective way of preventing hemoglobinopathies.

Non-transfusion dependent thalassemia: translating evidence to guidelines

Directory of Open Access Journals (Sweden)

Afif R. Harb

2014-12-01

Full Text Available The thalassemias are a group of inherited disorders of hemoglobin synthesis characterized by various degrees of defective production of the α- or β-globin chains of adult hemoglobin A. Non-transfusion- dependent thalassemia (NTDT includes a group of thalassemia patients who do not require regular RBC transfusions for survival, but may require occasional transfusions due to infection or pregnancy or may require more regular transfusions later in life due to splenomegaly or other complications. Due to the rising phenomenon of global migration, this previously well-localized entity is currently spreading more and more worldwide reaching Northern America and Northern Europe. The clinical picture of NTDT is governed by the severity of the ineffective erythropoiesis and the chronic hemolytic anemia, which, in turn, lead to iron overload, hypercoagulability, and an array of clinical complications involving almost every organ system. Patients with NTDT suffer from complications that are distinct from those encountered in patients with transfusion- dependent thalassemia (TDT in addition to the complications shared by both TDT and NTDT. As a consequence, patients with NTDT deserve a care specifically tailored to their needs. In the care of patients with NTDT, aiming at a standardized yet personalized care is not an easy task especially that NTDT patients lie on a heterogeneous spectrum with a wide variability in their clinical presentation and response to therapy. Therefore, guidelines emerge as a necessity to answer the specific needs of NTDT patients and the clinicians caring for them. In this article, we summarize the complications most commonly associated with NTDT and the recommendations of the guidelines for the management of patients with NTDT, based on the best available evidence.

Evaluation of cognition in children with beta-thalassemia major and healthy counterparts in terms of abstract thinking and visual organization

Directory of Open Access Journals (Sweden)

Samaneh Homayouni-Meymandi

2014-04-01

Conclusion: The results show the potential impact of the disease on children›s cognitive levels and suggest that children with beta-thalassemia major need more attention in the field of education to promote their understanding.

β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis.

Science.gov (United States)

Crielaard, Bart J; Rivella, Stefano

2014-06-01

β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.

Successful application of preimplantation genetic diagnosis for beta-thalassaemia and sickle cell anaemia in Italy.

Science.gov (United States)

Chamayou, S; Alecci, C; Ragolia, C; Giambona, A; Siciliano, S; Maggio, A; Fichera, M; Guglielmino, A

2002-05-01

In Italy, the autosomal recessive diseases beta-thalassaemia and sickle cell anaemia are so widespread that in some regions they can be defined as 'social diseases'. In this study, nine clinical applications of preimplantation genetic diagnosis (PGD) were performed for beta-thalassaemia and sickle cell anaemia on seven Sicilian couples and carriers of beta-globin gene mutations. The studied mutations were: Cd39, HbS, IVS1 nt1, IVS1 nt6 and IVS1 nt110. ICSI was performed with partner's sperm on 131 out of 147 retrieved oocytes, and this resulted in 72 zygotes; 32 embryos were successfully biopsied on day 3. The biopsied blastomeres were lysed and the beta-globin alleles amplified by nested PCR. The mutation diagnosis was performed by restriction enzyme digestion and reverse dot-blot. The amplification efficacy was 97.2%. The genotype study of non-transferred and surplus embryos showed that the allele drop-out rate was 8.6%. Seventeen embryos were transferred in utero on day 4. All couples received an embryo transfer; of the four pregnancies obtained, three resulted in live births and one miscarried at 11 weeks. Prenatal diagnosis at the 11th week and miscarriage material analysis confirmed the PGD results. These studies represent the first successful application of PGD for beta-thalassaemia and sickle cell anaemia in Italy.

[beta]-hexosaminidase isozymes from cells cotransfected with [alpha] and [beta] cDNA constructs: Analysis of the [alpha]-subunit missense mutation associated with the adult form of Tay-Sachs disease

Energy Technology Data Exchange (ETDEWEB)

Brown, C.A.; Mahuran, D.J. (Univ. of Toronto (Canada))

1993-08-01

In vitro mutagenesis and transient expression in COS cells has been used to associate a missense mutation with a clinical or biochemical phenotype. Mutations affecting the [alpha]-subunit of [beta]-hexosaminidase A ([alpha][beta]) (E.C.3.2.1.52) result in Tay-Sachs disease. Because hexosaminidase A is heterodimeric, analysis of [alpha]-chain mutations is not straightforward. The authors examine three approaches utilizing previously identified mutations affecting [alpha]-chain folding. These involve transfection of (1) the [alpha] cDNA alone; (2) a [beta] cDNA construct encoding a [beta]-subunit substituted at a position homologous to that of the [alpha]-subunit, and (3) both [alpha] and [beta] cDNAs. The latter two procedures amplified residual activity levels over that of patient samples, an effect not previously found with mutations affecting an [open quotes]active[close quotes] [alpha]Arg residue. This effect may help to discriminate between protein-folding and active-site mutations. The authors conclude that, with proper controls, the latter method of cotransfection can be used to evaluate the effects and perhaps to predict the clinical course of some [alpha]-chain mutations. Using this technique, they demonstrate that the adult-onset Tay-Sachs mutation, [alpha]Gly[yields]Ser[sup 269], does not directly affect [alpha][beta] dimerization but exerts an indirect effect on the dimer through destabilizing the folded [alpha]-subunit at physiological temperatures. Two other [alpha] mutations linked to more severe phenotypes appear to inhibit the initial folding of the subunit. 36 refs., 2 figs., 5 tabs.

Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

Directory of Open Access Journals (Sweden)

Nikhil Moorchung

2013-01-01

Full Text Available Introduction: Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. Materials and Methods: 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR-based allele-specific Amplification Refractory Mutation System (ARMS. Molecular analysis for the sickle cell mutation was done by standard methods. Results: The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23% of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Discussion and Conclusion: Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

Post-transfusion hypertension, convulsion and intracranial haemorrhage in beta-thalassemia major

International Nuclear Information System (INIS)

Masood, S.A.; Zaidi, A.

2012-01-01

The haematologic disorder b-thalassemia major is common in Pakistan. We describe a patient with undiagnosed thalassemia presenting with hypertension and convulsions and found to have cerebral haemorrhage on neuro-imaging. He had been transfused 2 weeks before this illness. Our experience is similar to a few case reports described in literature that were found to have cerebral haemorrhages post-mortem after a similar clinical presentation. All patients had a blood transfusion within 2 weeks prior to the presentation so association with transfusion has been proposed. We have reviewed the several mechanisms presented and discussed the findings. (author)

Diagnostic Value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP in Cardiac Involvement in Patients with Beta- Thalassemia

Directory of Open Access Journals (Sweden)

Noor Mohammad Noori

2017-04-01

Full Text Available Background Heart failure is a major cause of death in thalassemia. The study aimed to determine the diagnostic value of N Terminal Pro B Type Natriuretic Peptide (NT-pro BNP, to early diagnose the cardiac involvement in beta- thalassemia major patients. Materials and Methods  80 thalassemia patients aged 7 to 18 years old (patients group, and 80 healthy age and gender matched controls were enrolled in the case-control study. Patients were selected from those attending to the clinic of Aliasghar hospital, Zahedan-Iran. They were subjected to echo-Doppler tissue and conventional examination for both right and left heart function. Data were analysis using SPSS 18.0 software. Results  NT-pro BNP increased in patients compared the controls (P

Diabetes mellitus complicating β-thalassemia: a case report

African Journals Online (AJOL)

A case of beta-thalassemia major complicated by diabetes mellitus in a Fiji national is presented. The mechanisms involved in the pathogenesis of this complication are highlighted. Keywords: β-thalassemia, diabetes mellitus, iron overload. Annals of African Medicine Vol.2(1) 2003: 36-38 ...

In silico analysis of single nucleotide polymorphism (SNPs in human β-globin gene.

Directory of Open Access Journals (Sweden)

Mohammed Alanazi

Full Text Available Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies--the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB gene mutations, such as that producing sickle cell hemoglobin (HbS, HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT server we have searched for the SNPs, which showed that 200 (80% non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40% non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K, HbD (E→Q, HbE (E→K and HbS (E→V. Atomic Non-Local Environment Assessment (ANOLEA, Yet Another Scientific Artificial Reality Application (YASARA, CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid

Mutation Screening of the Krüppel-like Factor 1 Gene in Individuals With Increased Fetal Hemoglobin Referred for Hemoglobinopathy Investigation in South of Iran.

Science.gov (United States)

Hamid, Mohammad; Ershadi Oskouei, Sanaz; Shariati, Gholamreza; Babaei, Esmaeil; Galehdari, Hamid; Saberi, Alihossein; Sedaghat, Alireza

2018-04-01

Any mutation in the Krüppel-like factor 1 (KLF1) gene may interfere with its proper related function in the erythropoiesis process and lead to alterations in proper activation of its downstream protein through globin switching, which results in an increase in fetal hemoglobin (HbF). This study aimed to investigate whether KLF1 mutation can associate with high level of HbF in individuals with increased fetal hemoglobin referred for screening of hemoglobinopathies in south of Iran. The human KLF1 gene was amplified via the polymerase chain reaction procedure, and sequencing was used to determine any mutation in these patients. Moreover, XmnI polymorphisms in the position of -158 of γ-globin gene promoter were analyzed in all patients by polymerase chain reaction restriction fragment length polymorphism. Analysis of sequencing revealed a missense mutation in the KLF1 gene, p.Ser102Pro (c.304T>C), which was detectable in 10 of 23 cases with elevated HbF level. This mutation was only detected in individuals who had a HbF level between 3.1% and 25.6%. Statistical analysis showed that the frequency of C allele is significantly correlated with a high level of HbF (PC) in the KLF1 gene in β-thalassemia patients with increased level of fetal hemoglobin. According to statistical results of p.Ser102Pro mutation and XmnI polymorphism, it has been strongly suggested that both polymorphisms have an association with increased HbF samples. These nucleotide changes alone may not be the only elements raising the level of HbF, and other regulatory and modifying factors also play a role in HbF production.

Prevalence of renal tubular dysfunction in beta thalassemia minor in shiraz

Directory of Open Access Journals (Sweden)

Ali Moradi Nakhodcheri

2012-02-01

Full Text Available  Background & objective: β-Thalassemia minor is an asymptomatic hereditary disease. The first study on the relation of renal tubular dysfunction and β-thalassemia minor was performed in 2002 but those studies seem inadequate.The main goal of this study is through evaluation of renal tubular function in 100 patients with thalassemia minor. Materials & Methods: 100 patients with β- thalassemia which confirmed by hemoglobin electrophoresis and CBC as well as RBC indices were studied.14 out of 100 cases exit because of Urinary Tract Infection, diabetes mellitus or hypertension.Complete chemistry profile was performed on serum and urine of all reminder 86 patients (46 female and 40 male. Patients classified into two groups: β-thalassemia minor with anemia and without anemia. Another control group include 50 healthy individuals also considered.Then data analyzed by proper statistical methods. Results: 20 out of 86 reminder cases e.g. 24% showed at least one index of renal tubular dysfunction.58% of patients was been anemic and 42% non anemic. The most prominent tubular dysfunction was seen in a 29 years old lady with glucosuria and without anemia. conclusion: β-Thalassemia minor is common in Iran specially in Fars province. This study revealed significant renal tubular dysfunction in patient with β-thalassemia minor. So it is necessary to check out thalassemic patients for renal function tests periodically. Key words: β-thalassemia, minor,renal tubular dysfunction

The Correlation of Cardiac and Hepatic Hemosiderosis as Measured by T2*MRI Technique with Ferritin Levels and Hemochromatosis Gene Mutations in Iranian Patients with Beta Thalassemia Major

Directory of Open Access Journals (Sweden)

Mohammad Soleiman Soltanpour

2018-01-01

Full Text Available Objectives: Organ-specific hemosiderosis and iron overload complications are more serious and more frequent in some patients with beta thalassemia major (BTM compared with others. We investigated whether coinheritance of HFE H63D or C282Y gene mutations in patients with BTM contributes to the phenotypic variation of iron overload complications and assessed the correlation of cardiac and hepatic hemosiderosis with plasma ferritin levels. Methods: We studied 60 patients with BTM with a mean age of 17.5±9.1 years from the Northwest of Iran. HFE gene mutations were analyzed using the polymerase chain reaction-restriction fragment length polymorphism method. Cardiac and hepatic hemosiderosis was assessed using T2*magnetic resonance imaging (MRI. Ferritin levels were measured using the enzyme immunoassay method. Results: Ferritin levels showed a strong inverse correlation with hepatic T2*MRI values (r = -0.631, p = 0.001 but a poor correlation with cardiac T2*MRI values (r = -0.297, p = 0.044. The correlation between cardiac T2*MRI values and hepatic T2*MRI values was poor and insignificant (r = 0.287, p = 0.058. Genotype and allele distribution of HFE H63D and C282Y mutation did not differ significantly between patients with and without hepatic or cardiac hemosiderosis (p > 0.050. However, carriers of HFE 63D allele had significantly higher ferritin levels compared with non-carriers (1 903±993 vs. 992±683, p < 0.001. Conclusions: Cardiac T2*MRI values showed a poor correlation with hepatic T2*MRI values and ferritin levels. Accurate assessment of cardiac iron overload in patients with BTM can only be done using the T2*MRI technique. Additionally, HFE H63D is a significant determinant factor for elevated ferritin levels in BTM patients.

Prevalence and Intensity of Depression in Mothers of Children with Beta-Thalassemia Major In Talghani Hospital of Gorgan, Iran

Directory of Open Access Journals (Sweden)

Nargesbeygom Mirbehbahani

2014-01-01

Full Text Available Background: Thalassemia is a chronic disease that it leads to psychological and social problems for parents. Mothers are at markedly increased risk of suffering from psychological distress and depression because they usually take on a considerable part of extra care that their children need.This study was designed to determine prevalence and intensity of depression in mothers with a thalassemic child. Material and Methods: In this cross – sectional study, 65 mothers of children with thalassemia major (case group and 65 mothers of children without thalassemia major (control group were assessed using the Beck Depression Inventory (BDI. Data were analyzed by using SPSS (v 16.0 for windows. Results: Prevalence of depression was significantly higher in case group than that in control group (84.6%vs. 56.9%, p <0.05. Moderate depression had a highest prevalence in the both groups (33.4% in case group and 30.8% in control group. Prevalence of severe depression in case group was markedly higher than that in control group (29.2% vs. 3.1% p<0.05. There was a significant difference between intensity of depression in mothers of case group that had another child with beta-thalassemia major (p<0.05. Conclusion: Mothers of children with thalassemia major are vulnerable to depression. They need psychosocial support to promote their health.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

Science.gov (United States)

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Insulin-like growth factor-1 levels in children with Beta-thalassemia minor

Directory of Open Access Journals (Sweden)

Mehran Karimi

2008-09-01

Full Text Available Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH / insulin growth factor-1 (IGF-1 axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in healthy children. Material and Methods: Fifty children aged 6 months to 15 years with b-thalassemia minor (32 males, 18 females and 50 age- and sex-matched normal healthy children were selected. Medical history was taken and complete physical examination was done in each case; IGF-1 level was checked in all cases. This study was done in Shiraz, southern Iran, during 2005.Results: IGF-1 levels were significantly lower in b-thalassemia minor children than normal children (P = 0.015. This result demonstrates that some etiologies of growth failure in b-thalassemia major other than those described to date can exist, which may be shared with b-thalassemia minor in feature or may be transformed by genes that are either expressed or not.Conclusion: We conclude that in addition to that observed in b-thalassemia major, IGF-1 level is also decreased in b-thalassemia minor, and these two may have similar etiologies.

Methemoglobinemia and ascorbate deficiency in hemoglobin E β thalassemia: metabolic and clinical implications

Science.gov (United States)

Allen, Angela; Fisher, Christopher; Premawardhena, Anuja; Bandara, Dayananda; Perera, Ashok; Allen, Stephen; St Pierre, Timothy; Olivieri, Nancy

2012-01-01

During investigations of the phenotypic diversity of hemoglobin (Hb) E β thalassemia, a patient was encountered with persistently high levels of methemoglobin associated with a left-shift in the oxygen dissociation curve, profound ascorbate deficiency, and clinical features of scurvy; these abnormalities were corrected by treatment with vitamin C. Studies of erythropoietin production before and after treatment suggested that, as in an ascorbate-deficient murine model, the human hypoxia induction factor pathway is not totally dependent on ascorbate levels. A follow-up study of 45 patients with HbE β thalassemia showed that methemoglobin levels were significantly increased and that there was also a significant reduction in plasma ascorbate levels. Haptoglobin levels were significantly reduced, and the high frequency of the 2.2 haptoglobin genotype may place an additional pressure on ascorbate as a free-radical scavenger in this population. There was, in addition, a highly significant correlation between methemoglobin levels, splenectomy, and factors that modify the degree of globin-chain imbalance. Because methemoglobin levels are modified by several mechanisms and may play a role in both adaptation to anemia and vascular damage, there is a strong case for its further study in other forms of thalassemia and sickle-cell anemia, particularly when splenic function is defective. PMID:22885163

thalassemia induced hypercoagulability

African Journals Online (AJOL)

Subjects and methods: Venous blood samples were collected from ten normal control subjects and thirty patients with beta-thalassemia major (divided into two groups, splenectomized and unsplenectomized). To all studied individuals, plasma substance P and sP-selectin were assayed by an enzyme linked Immunosorbent ...

Coinheritance of Β-Thalassemia and Sickle Cell Anaemia

African Journals Online (AJOL)

GB

2016-11-06

Nov 6, 2016 ... ABSTRACT. BACKGROUND: Genes for haemoglobin S are found in high frequencies in Nigeria. However, there is little information on beta thalassemia in sickle cell anaemia in this population. The clinical presentation of HbS- β thalassemia is enormously variable, ranging from an asymptomatic state to a ...

Thermogravimetric analysis coupled with chemometrics as a powerful predictive tool for ß-thalassemia screening.

Science.gov (United States)

Risoluti, Roberta; Materazzi, Stefano; Sorrentino, Francesco; Maffei, Laura; Caprari, Patrizia

2016-10-01

β-Thalassemia is a hemoglobin genetic disorder characterized by the absence or reduced β-globin chain synthesis, one of the constituents of the adult hemoglobin tetramer. In this study the possibility of using thermogravimetric analysis (TGA) followed by chemometrics as a new approach for β-thalassemia detection is proposed. Blood samples from patients with β-thalassemia were analyzed by the TG7 thermobalance and the resulting curves were compared to those typical of healthy individuals. Principal Component Analysis (PCA) was used to evaluate the correlation between the hematological parameters and the thermogravimetric results. The thermogravimetric profiles of blood samples from β-thalassemia patients were clearly distinct from those of healthy individuals as result of the different quantities of water content and corpuscular fraction. The hematological overview showed significant decreases in the values of red blood cell indices and an increase in red cell distribution width value in thalassemia subjects when compared with those of healthy subjects. The implementation of a predictive model based on Partial Least Square Discriminant Analysis (PLS-DA) for β-thalassemia diagnosis, was performed and validated. This model permitted the discrimination of anemic patients and healthy individuals and was able to detect thalassemia in clinically heterogeneous patients as in the presence of δβ-thalassemia and β-thalassemia combined with Hb Lepore. TGA and Chemometrics are capable of predicting ß-thalassemia syndromes using only a few microliters of blood without any pretreatment and with an hour of analysis time. A fast, rapid and cost-effective diagnostic tool for the β-thalassemia screening is proposed. Copyright © 2016 Elsevier B.V. All rights reserved.

HbE/β-Thalassemia and Oxidative Stress: The Key to Pathophysiological Mechanisms and Novel Therapeutics

Science.gov (United States)

Sibmooh, Nathawut; Fucharoen, Suthat

2017-01-01

Abstract Significance: Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The βE-globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected. Critical Issues: While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events. Future Directions: Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794–813. PMID:27650096

HbE/β-Thalassemia and Oxidative Stress: The Key to Pathophysiological Mechanisms and Novel Therapeutics.

Science.gov (United States)

Hirsch, Rhoda Elison; Sibmooh, Nathawut; Fucharoen, Suthat; Friedman, Joel M

2017-05-10

Oxidative stress and generation of free radicals are fundamental in initiating pathophysiological mechanisms leading to an inflammatory cascade resulting in high rates of morbidity and death from many inherited point mutation-derived hemoglobinopathies. Hemoglobin (Hb)E is the most common point mutation worldwide. The β E -globin gene is found in greatest frequency in Southeast Asia, including Thailand, Malaysia, Indonesia, Vietnam, Cambodia, and Laos. With the wave of worldwide migration, it is entering the gene pool of diverse populations with greater consequences than expected. While HbE by itself presents as a mild anemia and a single gene for β-thalassemia is not serious, it remains unexplained why HbE/β-thalassemia (HbE/β-thal) is a grave disease with high morbidity and mortality. Patients often exhibit defective physical development, severe chronic anemia, and often die of cardiovascular disease and severe infections. Recent Advances: This article presents an overview of HbE/β-thal disease with an emphasis on new findings pointing to pathophysiological mechanisms derived from and initiated by the dysfunctional property of HbE as a reduced nitrite reductase concomitant with excess α-chains exacerbating unstable HbE, leading to a combination of nitric oxide imbalance, oxidative stress, and proinflammatory events. Additionally, we present new therapeutic strategies that are based on the emerging molecular-level understanding of the pathophysiology of this and other hemoglobinopathies. These strategies are designed to short-circuit the inflammatory cascade leading to devastating chronic morbidity and fatal consequences. Antioxid. Redox Signal. 26, 794-813.

[Molecular epidemiological survey of hemoglobinopathies in Yongzhou area of Hunan province].

Science.gov (United States)

Tian, Jie; Tang, Deguo; Yang, Shaohui; Wang, Ju; Ai, Yanmin; Zhang, Miao

2017-10-10

To summarize the molecular epidemiology of hemoglobinopathies in Yongzhou area of Hunan province in order to provide a basis for making the guidelines of local thalassemia prevention program. Two thousand and two samples (1001 couples) were randomly recruited based on demographic data and distribution of ethnic groups. All samples were subjected to full blood count and analysis of hemoglobin and 6 common alpha-thalassemia mutations. Known beta-thalassemia mutations were screened in samples with beta-thalassemia trait. The remaining samples with positive phenotype and unknown mutations were subjected to DNA sequence analysis. Two hundred and forty individuals were found to be carriers of hemoglobinopathic mutations, which included 6 common alpha-thalassemia deletions, 9 common beta-thalassemia mutations and 3 common structural hemoglobin variants. One hundred and seventy-four mutant alleles for alpha-thalassemia were detected, which gave a carrier rate of 8.69%, of which 0.1% was due to HbH disease. Seventy mutant alleles for beta-thalassemia were detected, which gave a carrier rate of 3.50%. Seven subjects (0.35%) were identified as carriers of hemoglobin variants. The overall carrier rate for hemoglobinopathic mutations was 12.54% based on detection of 251 hemoglobinopathy mutant alleles. The overall carrier rate for alpha- and beta-thalassemia among ethnic Yaos was 25.00%, which was significantly higher than that of ethnic Han Chinese (11.14%, Phemoglobinopathies in Yongzhou area has been delineated for the first time.

Parathyroid hormone in pediatric patients with β-thalassemia major ...

African Journals Online (AJOL)

Mostafa El-Nashar

2016-04-09

Apr 9, 2016 ... 1. Introduction. Beta-thalassemia is an inherited anemia caused by unbalanced ... The work has been carried out in accordance with the World ... The life expectancy of patients with b-thalassemia has greatly improved with ...

Hb H Hydrops Fetalis Syndrome Caused by Association of the - -(SEA) Deletion and Hb Constant Spring (HBA2: c.427T > C) Mutation in a Chinese Family.

Science.gov (United States)

He, Sheng; Zheng, Chenguang; Meng, Dahua; Chen, Rongyu; Zhang, Qiang; Tian, Xiaoxian; Chen, Shaoke

2015-01-01

Hb Constant Spring (Hb CS; HBA2: c.427T > C) is an unstable hemoglobin (Hb) variant that results from a nucleotide substitution at the termination codon of the α2-globin gene. Compound heterozygosity for α(0)-thalassemia (α(0)-thal) and Hb CS (- -(SEA)/α(CS)α) results in Hb H/Hb CS disease, which is generally characterized with mild hemolytic anemia, jaundice, and splenomegaly. Here, we describe one case with Hb H/Hb CS disease that presented with fetal anemia and fetal hydrops, known as Hb H (β4) hydrops fetalis. This is the first report of fetal hydrops caused by association of the - -(SEA) deletion and the α(CS)α mutation. Our study highlights the significance of watchful observation using a serial ultrasound method and care of pregnant women who have fetuses found to carry Hb H/Hb CS disease during pregnancy, to guard against the occurrence of fetal hydrops.

Sox6 directly silences epsilon globin expression in definitive erythropoiesis.

Directory of Open Access Journals (Sweden)

2006-02-01

Full Text Available Sox6 is a member of the Sox transcription factor family that is defined by the conserved high mobility group (HMG DNA binding domain, first described in the testis determining gene, Sry. Previous studies have suggested that Sox6 plays a role in the development of the central nervous system, cartilage, and muscle. In the Sox6-deficient mouse, p100H, epsilony globin is persistently expressed, and increased numbers of nucleated red cells are present in the fetal circulation. Transfection assays in GM979 (erythroleukemic cells define a 36-base pair region of the epsilony proximal promoter that is critical for Sox6 mediated repression. Electrophoretic mobility shift assay (EMSA and chromatin immunoprecipitation (ChIP assays demonstrate that Sox6 acts as a repressor by directly binding to the epsilony promoter. The normal expression of Sox6 in wild-type fetal liver and the ectopic expression of epsilony in p100H homozygous fetal liver demonstrate that Sox6 functions in definitive erythropoiesis. The present study shows that Sox6 is required for silencing of epsilony globin in definitive erythropoiesis and suggests a role for Sox6 in erythroid cell maturation. Thus, Sox6 regulation of epsilony globin might provide a novel therapeutical target in the treatment of hemoglobinopathies such as sickle cell anemia and thalassemia.

Assessment of cognitive function in children with beta-thalassemia major: a cross-sectional study.

Science.gov (United States)

Raafat, Nelly; El Safy, Usama; Khater, Nahed; Hassan, Tamer; Hassan, Basheir; Siam, Ahmed; Youssef, Amira; El Shabrawy, Amany

2015-03-01

Multiple risk factors contribute to cognitive impairment in children with β-thalassemia major. For a more refined understanding of this issue, we attempted to evaluate cognitive function in β-thalassemia major patients and identify the relationship between possible cognitive dysfunction and the following: demography, transfusion and chelation characteristics, iron overload, and disease complications. We studied 100 β-thalassemia major children and 100 healthy controls who matched well in terms of age, sex, and socioeconomic status. All participants underwent psychometric assessment using Wechsler Intelligence Scale for Children-Third Edition, Arabic version. The mean Full-Scale IQ and Performance IQ of patients were significantly lower than those of controls, whereas no significant difference was found for Verbal IQ. No significant relationship existed between IQ and any of the assessed parameters. We concluded that Performance IQ, not Verbal IQ, was significantly affected in β-thalassemia major patients, but there was no clear association between IQ and any of the parameters. © The Author(s) 2014.

Closely linked polymorphic marker: successful application in preimplantation genetic diagnosis for beta-thalassemia%紧密连锁的多态性位点在β地中海贫血植入前遗传学诊断中的应用

Institute of Scientific and Technical Information of China (English)

邓捷; 庄广伦; 彭文林; 周灿权; 李洁; 方丛; 李穗萍; 陈勇; 童大跃

2005-01-01

目的探讨与β珠蛋白基因紧密连锁的多态性位点 HumTH01在β地中海贫血(β地贫)植入前遗传学诊断(preimplantation genetic diagnosis,PGD)中的作用.方法对4例已出生重型β地贫患儿的、双方均为β地贫基因携带者的夫妇进行了6个周期的PGD治疗,应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因,选择健康的胚胎移植入子宫.结果 6个周期共活检44个胚胎,获得44个卵裂球,其中41个卵裂球扩增成功,35个胚胎经PCR分析后获得明确诊断,移植了14个胚胎,获得1例临床妊娠.孕17周时经脐带血穿刺,证实为完全正常胚胎,现已出生一正常女婴.单个卵裂球平均扩增效率为89.7%,等位基因脱扣(allele drop-out, ADO)率为14.4%. HumTH01基因可以帮助检测出ADO及污染的发生.结论本研究为国内首次报道应用多重巢式PCR同时检测β珠蛋白基因及 HumTH01基因对β地贫进行植入前遗传学诊断并成功获得临床妊娠.在PGD中同时检测与β珠蛋白基因紧密连锁的多态性位点可以降低PGD中由于ADO及污染造成的误诊的风险.%Objective To evaluate the applicability of the polymorphic marker closely linked with beta-globin gene for the preimplantati on genetic diagnosis (PGD) in couples at risk of having child with beta-thalassemia. Methods Single cell multiplex nested PCR which coamplifies the beta-globin gene and the closely linked polymorphic marker, HumTHO1 gene, was applied in six clinical PGD cycles for four couples with beta-thalassemia. Results In six clinical PGD cycles, a total of 44 embryos were biopsied and 44 blastomeres were obtained. Forty-one blastomeres were amplified and thirty-five embryos were given definite diagnoses. Fourteen embryos were transferred back to the uterus of the patients and one pregnancy went on well and ended with one live healthy birth, which confirmed the results of PGD. The average amplification efficiency of single blastomere was 89.7% and

Diffuse Hepatic Calcifications in a Transfusion-Dependent Patient with Beta-Thalassemia: A Case Report

Directory of Open Access Journals (Sweden)

Forough Saki

2013-09-01

Full Text Available Hepatic calcification is usually associated with infectious, vascular, or neoplastic processes in the liver. We report the first case of beta-thalassemia major with isolated diffuse hepatic calcification in a 23 year old woman, who had been transfusion-dependent since the age of 6 months. She was referred to our center with a chief complaint of abdominal pain. Computed tomography scan of the abdomen revealed diffuse hepatic calcification in the right, left, and caudate lobes of the liver. Her medical history disclosed hypoparathyroidism as well as chronic hepatitis C virus infection, which was successfully treated but led to early micronodular cirrhosis on liver biopsy. Other studies done to search for the cause of hepatic calcification failed to reveal any abnormalities. We suspect that hypoparathyroidism caused liver calcification, and should be, therefore, considered in the differential diagnosis of hepatic calcification if other causative factors have been ruled out.

Attitudes and beliefs among high- and low-risk population groups towards β-thalassemia prevention: a cross-sectional descriptive study from India.

Science.gov (United States)

Chawla, Swati; Singh, Rajnish Kumar; Lakkakula, Bhaskar V K S; Vadlamudi, Raghavendra Rao

2017-07-01

β-thalassemia is an autosomal recessive blood disorder caused by gene mutations that affect all aspects of β-globin production. In majority of Asian countries including India, the frequency of β-thalassemia is closely intertwined with social, cultural, and religious issues of the respective country. Several national level screening programs imparted education regarding β-thalassemia, but follow-up evaluation revealed that education was not effective. It has been hypothesized that the beliefs and attitudes, carrier screening, and education among "high risk communities" will have far-reaching implications towards β-thalassemia prevention in the country. The present study is aimed to investigate attitudes, intention, and behavior of β-thalassemia high- and low-risk ethnic groups towards carrier screening and education. A structured questionnaire on knowledge, attitude, and practice regarding β-thalassemia was administered on 926 individuals belong to Arora, a high-risk ethnic group for β-thalassemia (347 rural (AR) and 202 urban (AU)) and 377 cosmopolitan commoners (CC) aged above 18 years of both sexes. To understand the relationship between various questions, Pearson's correlation test and factor analysis was performed. The responses were further categorized into the theory of planned behavior (TPB) constructs with the measures of the main constructs reported as a mean. Various dimensions of knowledge, attitude, and practice reveal that the urban groups (AU and CC) are better aware of the disease "β-thalassemia" than the rural group (AR) who witness suffering at close quarters. The AR group is more positive for preventive measures than the urban groups. Significant correlations and factor analysis show "intentions" for premarital and prenatal screening highly loaded as outcome behaviors. The Ajzen's "Theory of planned behavior" support that the "intention" and "perceived behavior control" are better predictors of "outcome behavior" compared to "attitude

Parathyroid hormone in pediatric patients with β-thalassemia major ...

African Journals Online (AJOL)

The aim of the study is to estimate the level of serum parathyroid hormone and its relation to bone mineral density in transfusion dependent beta-thalassemia major children. Subjects and methods: We measured serum calcium, phosphorus and parathyroid hormone in a sample of pediatric patients with thalassemia, ...

The co-inheritance of alpha-thalassemia and sickle cell anemia is associated with better hematological indices and lower consultations rate in Cameroonian patients and could improve their survival.

Directory of Open Access Journals (Sweden)

Maryam Bibi Rumaney

Full Text Available BACKGROUND: Co-inheritance of α-thalassemia was reported to be associated with a delayed age of disease onset among Cameroonian Sickle Cell Anemia (SCA patients. The present study aimed to explore the correlation between α-thalassemia, hematological indices, and clinical events in these patients. METHODS AND FINDINGS: We studied 161 Cameroonian SCA patients and 103 controls (59.1% HbAA with median ages of 17.5 and 23 years. RFLP-PCR was used to confirm SCA genotype and to describe haplotypes in the HBB-like genes cluster. Multiplex Gap-PCR was performed to investigate the 3.7 kb α-globin gene deletions. SNaPshot PCR, capillary electrophoresis and cycle sequencing were used for the genotyping of 10 SNPs in BCL11A, HMIP1/2, OR51B5/6 and HBG loci, known to influence HbF levels. Generalised linear regression models adjusted for age, sex and SNPs genotypes was used to investigate effects of α-thalassemia on clinical and hematological indices. The median rate of vaso-occlusive painful crisis and hospitalisations was two and one per year, respectively. Stroke was reported in eight cases (7.4%. Benin haplotype was the most prevalent (66.3%; n = 208 chromosomes. Among patients, 37.3% (n = 60 had at least one 3.7 kb deletion, compared to 10.9% (n = 6 among HbAA controls (p<0.001. Among patients, the median RBC count increased with the number of 3.7 kb deletions [2.6, 3.0 and 3.4 million/dl, with no, one and two deletions (p = 0.01]. The median MCV decreased with the number of 3.7 kb deletion [86, 80, and 68fl, with no, one and two deletions (p<0.0001], as well as median WBC counts [13.2, 10.5 and 9.8×109/L (p<0.0001. The co-inheritance of α-thalassemia was associated with lower consultations rate (p = 0.038. CONCLUSION: The co-inheritance of α-thalassemia and SCA is associated with improved hematological indices, and lower consultations rate in this group of patients. This could possibly improve their survival and explain the

The Co-Inheritance of Alpha-Thalassemia and Sickle Cell Anemia Is Associated with Better Hematological Indices and Lower Consultations Rate in Cameroonian Patients and Could Improve Their Survival

Science.gov (United States)

Rumaney, Maryam Bibi; Ngo Bitoungui, Valentina Josiane; Vorster, Anna Alvera; Ramesar, Raj; Kengne, Andre Pascal; Ngogang, Jeanne; Wonkam, Ambroise

2014-01-01

Background Co-inheritance of α-thalassemia was reported to be associated with a delayed age of disease onset among Cameroonian Sickle Cell Anemia (SCA) patients. The present study aimed to explore the correlation between α-thalassemia, hematological indices, and clinical events in these patients. Methods and Findings We studied 161 Cameroonian SCA patients and 103 controls (59.1% HbAA) with median ages of 17.5 and 23 years. RFLP-PCR was used to confirm SCA genotype and to describe haplotypes in the HBB-like genes cluster. Multiplex Gap-PCR was performed to investigate the 3.7 kb α-globin gene deletions. SNaPshot PCR, capillary electrophoresis and cycle sequencing were used for the genotyping of 10 SNPs in BCL11A, HMIP1/2, OR51B5/6 and HBG loci, known to influence HbF levels. Generalised linear regression models adjusted for age, sex and SNPs genotypes was used to investigate effects of α-thalassemia on clinical and hematological indices. The median rate of vaso-occlusive painful crisis and hospitalisations was two and one per year, respectively. Stroke was reported in eight cases (7.4%). Benin haplotype was the most prevalent (66.3%; n = 208 chromosomes). Among patients, 37.3% (n = 60) had at least one 3.7 kb deletion, compared to 10.9% (n = 6) among HbAA controls (p<0.001). Among patients, the median RBC count increased with the number of 3.7 kb deletions [2.6, 3.0 and 3.4 million/dl, with no, one and two deletions (p = 0.01)]. The median MCV decreased with the number of 3.7 kb deletion [86, 80, and 68fl, with no, one and two deletions (p<0.0001)], as well as median WBC counts [13.2, 10.5 and 9.8×109/L (p<0.0001. The co-inheritance of α-thalassemia was associated with lower consultations rate (p = 0.038). Conclusion The co-inheritance of α-thalassemia and SCA is associated with improved hematological indices, and lower consultations rate in this group of patients. This could possibly improve their survival and explain the higher

Hemoglobin Constant Spring among Southeast Asian Populations: Haplotypic Heterogeneities and Phylogenetic Analysis.

Directory of Open Access Journals (Sweden)

Wittaya Jomoui

Full Text Available Hemoglobin Constant Spring (Hb CS is an abnormal Hb caused by a mutation at the termination codon of α2-globin gene found commonly among Southeast Asian and Chinese people. Association of Hb CS with α°-thalassemia leads to a thalassemia intermedia syndrome commonly encountered in the region. We report chromosome background and addressed genetic origins of Hb CS observed in a large cohort of Hb CS among Southeast Asian populations.A study was done on 102 Vietnamese (aged 15-49 year-old and 40 Laotian (aged 18-39 year-old subjects with Hb CS and results compared with 120 Hb CS genes in Thailand. Hematological parameters were recorded and Hb analysis was performed using capillary electrophoresis. Hb CS mutation and thalassemia genotypes were defined by DNA analysis. Six DNA polymorphisms within α-globin gene cluster including 5'Xba I, Bgl I, Inter-zeta HVR, AccI, RsaI and αPstI 3', were determined using PCR-RFLP assay.Nine different genotypes of Hb CS were observed. In contrast to the Thai Hb CS alleles which are mostly linked to haplotype (+-S + + -, most of the Vietnamese and the Laotian Hb CS genes were associated with haplotype (+-M + + -, both of which are different from that of the European Hb CS.Hb CS is commonly found in combination with other thalassemias among Southeast Asian populations. Accurate genotyping of the cases requires both hematologic and DNA analyses. At least two independent origins are associated with the Hb CS gene which could indirectly explain the high prevalence of this Hb variant in the region.

Thalassemias

Science.gov (United States)

... Intramural Research Home / Thalassemias Thalassemias Also known as What Is Thalassemias (thal-a- ... of thalassemia, go to "What Causes Thalassemias?" ) Alpha Thalassemias Alpha thalassemia silent carrier Alpha thalassemia minor, also ...

A mutation in the {beta}-myosin rod associated with hypertrophic cardiomyopathy has an unexpected molecular phenotype

Energy Technology Data Exchange (ETDEWEB)

Armel, Thomas Z. [Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309 (United States); Leinwand, Leslie A., E-mail: leslie.leinwand@colorado.edu [Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309 (United States)

2010-01-01

Hypertrophic cardiomyopathy (HCM) is a common, autosomal dominant disorder primarily characterized by left ventricular hypertrophy and is the leading cause of sudden cardiac death in youth. HCM is caused by mutations in several sarcomeric proteins, with mutations in MYH7, encoding {beta}-MyHC, being the most common. While many mutations in the globular head region of the protein have been reported and studied, analysis of HCM-causing mutations in the {beta}-MyHC rod domain has not yet been reported. To address this question, we performed an array of biochemical and biophysical assays to determine how the HCM-causing E1356K mutation affects the structure, stability, and function of the {beta}-MyHC rod. Surprisingly, the E1356K mutation appears to thermodynamically destabilize the protein, rather than alter the charge profile know to be essential for muscle filament assembly. This thermodynamic instability appears to be responsible for the decreased ability of the protein to form filaments and may be responsible for the HCM phenotype seen in patients.

X-ray scattering signatures of β-thalassemia

International Nuclear Information System (INIS)

Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.

2009-01-01

X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1 , respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1 , in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

X-ray scattering signatures of β-thalassemia

Science.gov (United States)

Desouky, Omar S.; Elshemey, Wael M.; Selim, Nabila S.

2009-08-01

X-ray scattering from lyophilized proteins or protein-rich samples is characterized by the presence of two characteristic broad peaks at scattering angles equivalent to momentum transfer values of 0.27 and 0.6 nm -1, respectively. These peaks arise from the interference of coherently scattered photons. Once the conformation of a protein is changed, these two peaks reflect such change with considerable sensitivity. The present work examines the possibility of characterizing the most common cause of hemolytic anaemia in Egypt and many Mediterranean countries; β-thalassemia, from its X-ray scattering profile. This disease emerges from a genetic defect causing reduced rate in the synthesis of one of the globin chains that make up hemoglobin. As a result, structurally abnormal hemoglobin molecules are formed. In order to detect such molecular disorder, hemoglobin samples of β-thalassemia patients are collected, lyophilized and measured using a conventional X-ray diffractometer. Results show significant differences in the X-ray scattering profiles of most of the diseased samples compared to control. The shape of the first scattering peak at 0.27 nm -1, in addition to the relative intensity of the first to the second scattering peaks, provides the most reliable signs of abnormality in diseased samples. The results are interpreted and confirmed with the aid of Fourier Transform Infrared (FTIR) spectroscopy of normal and thalassemia samples.

Thalassemia intermedia: An overview

African Journals Online (AJOL)

Rabah M. Shawky

2012-04-25

Apr 25, 2012 ... abnormalities occur due to massive expansion of erythroid bone marrow activity ..... [3] Savage D, Wood NAP, Bidwell JL, Fitches A, Old JM, Hui KM. Detection of b-thalassemia mutations using DNA heteroduplex generator ...

Iron metabolism in heterozygotes for hemoglobin E (HbE), alpha-thalassemia1, or beta-thalassemia and in compound heterozygotes for HbE/ beta-thalassemia

NARCIS (Netherlands)

Zimmermann, M.B.; Fucharoen, S.; Winichagoon, P.; Sirankapracha, P.; Zeder, C.; Gowachirapant, S.; Judprasong, K.; Tanno, T.; Miller, J.L.; Hurrell, R.F.

2008-01-01

BACKGROUND: Despite large populations carrying traits for thalassemia in countries implementing universal iron fortification, there are few data on the absorption and utilization of iron in these persons. OBJECTIVE: We aimed to determine whether iron absorption or utilization (or both) in women

Side effects of Deferasirox Iron Chelation in Patients with Beta Thalassemia Major or Intermedia

Directory of Open Access Journals (Sweden)

Murtadha Al-Khabori

2013-03-01

Full Text Available Objectives: Chelating agents remain the mainstay in reducing the iron burden and extending patient survival in homozygous beta-thalassemia but adverse and toxic effects may increase with the institution and long term use of this essential therapy. This study aimed to estimate the incidence of deferasirox (DFX side effects in patients with thalassemia major or intermedia.Methods: A retrospective study of 72 patients (mean age: 20.3±0.9 yrs; 36 male, 36 female with thalassemia major or intermedia treated at Sultan Qaboos University Hospital, Oman, was performed to assess the incidence of side effects related to deferasirox over a mean of 16.7 month follow-up period.Results: Six patients experienced rashes and 6 had gastro-intestinal upset. DFX was discontinued in 18 patients for the following reasons: persistent progressive rise(s in serum creatinine (7 patients; 40% mean serum creatinine rise from baseline, feeling unwell (2, severe diarrhea (1, pregnancy (1, death unrelated to chelator (2 and rise in serum transaminases (2. Three patients were reverted to desferoxamine and deferiprone combination therapy as DFX was no longer biochemically effective after 18 months of therapy. There was no correlation between baseline serum ferritin and serum creatinine or a rise in serum creatinine. Cardiac MRI T2* did not change with DFX therapy. However, there was an improvement in liver MRI T2* (p=0.013.Conclusion: Renal side effects related to deferasirox appear to be higher than those reported in published clinical trials. Further larger studies are required to confirm these findings.

Molecular Epidemiology of Hemoglobinopathies in Cambodia.

Science.gov (United States)

Munkongdee, Thongperm; Tanakulmas, Jatuporn; Butthep, Punnee; Winichagoon, Pranee; Main, Barbara; Yiannakis, Miriam; George, Joby; Devenish, Robyn; Fucharoen, Suthat; Svasti, Saovaros

2016-06-01

Determining the magnitude of the thalassemia problem in a country is important for implementing a national prevention and control program. In order to acquire accurate thalassemia prevalence data, the gene frequency of α- and β-thalassemia (α- and β-thal) in different regions of a country should be determined. The molecular basis of thalassemia in Cambodia was performed by polymerase chain reaction (PCR)-based techniques in a community-based cross-sectional survey of 1631 unrelated individuals from three regions, Battambang, Preah Vihear and Phnom Penh. Thalassemia mutations were detected in 62.7% of the three studied population of Cambodia. Hb E (HBB: c.79G > A) was the most common β-globin gene mutation with a frequency ranging from 0.139 to 0.331, while the most frequent α-globin gene mutation was the -α(3.7) (rightward) deletion (0.098-0.255). The other frequencies were 0.001-0.003 for β-thal, 0.008-0.011 for α-thal-1 (- -(SEA)), 0.003-0.008 for α-thal-2 [-α(4.2) (leftward deletion)], 0.021-0.044 for Hb Constant Spring (Hb CS, HBA2: c.427T > C) and 0.009-0.036 for Hb Paksé (HBA2: c.429A > T). A regional specific thalassemia gene frequency was observed. Preah Vihear had the highest prevalence of Hb E (55.9%), α-thal-2 (24.0%) and nondeletional α-thal (15.1%), whereas Phnom Penh had the lowest frequency of thalassemia genes. Interestingly, in Preah Vihear, the frequency of Hb Paksé was extremely high (0.036), almost equivalent to that of Hb CS (0.044). Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Cambodia.

[Neonatal screening of hemoglobinopathies and G6PD deficiency in Catalonia (Spain). Molecular study of sickle cell disease associated with alpha thalassemia and G6PD deficiency].

Science.gov (United States)

Mañú Pereira, María Del Mar; Cabot, Anna; Martínez González, Ana; Sitjà Navarro, Eulalia; Cararach, Vicent; Sabrià, Josep; Boixaderas, Jordi; Teixidor, Roser; Bosch, Albert; López Vílchez, M Angeles; Martín Ibáñez, Itziar; Carrión, Teresa; Plaja, Pere; Sánchez, Mario; Vives Corrons, José Luis

2007-06-30

The prevalence of hemoglobinopathies and glucose-6-phosphate dehidrogenase (G6PD) deficiency in the Catalan neonatal population is increasing due to immigration. Coinheritance of more than a single RBC genetic defect is becoming more frequent and diagnostic pitfalls are also increasing. We intended to demonstrate the need to perform an early diagnosis of sickle cell disease (SCD) by means of neonatal screening, to establish the prevalence of SCD associated with alpha thalassemia and G6PD deficiency and to identify genotypes associated with sickle cell disease and G6PD deficiency. 4,020 blood samples from newborns were screened. For the screening of hemoglobinopathies the high performance liquid chromatography method was used and for G6PD deficiency the fluorescent spot test was employed. We studied the association between betaS gene and alpha thalassaemia del-3.7 Kb. SCD and G6PD deficiency genotypes were established. Prevalence of SCD in population at risk was 1/475 newborns. Prevalence of G6PD deficiency in population at risk was 1/43, and in autochthonous population was 1/527 newborns. In all the cases, sickle hemoglobin was confirmed by ARMS (amplification refractory mutation system). Association between betaS gene and alpha thalassaemia del-3.7 Kb was found in 32.2% of the samples, and an association between betaS gene and G6PD deficiency was observed in 7% of the samples. This study confirms the high prevalence of SCD and G6PD deficiency in population at risk as well as their genetic and clinical heterogeneity. The study of genotype/phenotype relationships allows a better knowledge of molecular mechanism and is useful to establish suitable criteria of diagnosis.

Hydroxyurea for hemoglobin E/β-thalassemia: a systematic review and meta-analysis.

Science.gov (United States)

Algiraigri, Ali H; Kassam, Aliya

2017-12-01

Hemoglobin E-beta thalassemia (Hb E/β-thalassemia) is a distinct, yet common, type of β-thalassemia, in which the patient co-inherits a β-thalassemia allele from one parent, and a structural variant, Hb E, from the other parent. This co-inheritance leads to remarkable clinical heterogeneity, varying degrees of chronic anemia, and a wide spectrum of complications due to ineffective erythropoiesis and iron overload. Hydroxyurea (HU), an oral chemotherapeutic drug, is expected to decrease disease severity. To assess the clinical efficacy and safety of HU in Hb E/β-thalassemia patients. We searched MEDLINE, EMBASE, Cochrane databases, and major preceding conferences for studies that assessed HU in Hb E/β-thalassemias patients. The effect size was estimated as a proportion (responder/sample size). Qualities of eligible studies were assessed using NIH tools. A total of five [one randomized clinical trial (RCT) and four observational] studies involving 106 patients were included. HU was associated with a significant RR of 46% with no statistical heterogeneity. No serious adverse effects were reported. Patients with Hb E/β-thalassemia may benefit from a trial of HU, though large RCTs assessing efficacy should be conducted to confirm the findings of this meta-analysis and to assess long-term toxicity and response sustainability.

Fate of a redundant gamma-globin gene in the atelid clade of New World monkeys: implications concerning fetal globin gene expression.

Science.gov (United States)

Meireles, C M; Schneider, M P; Sampaio, M I; Schneider, H; Slightom, J L; Chiu, C H; Neiswanger, K; Gumucio, D L; Czelusniak, J; Goodman, M

1995-01-01

Conclusive evidence was provided that gamma 1, the upstream of the two linked simian gamma-globin loci (5'-gamma 1-gamma 2-3'), is a pseudogene in a major group of New World monkeys. Sequence analysis of PCR-amplified genomic fragments of predicted sizes revealed that all extant genera of the platyrrhine family Atelidae [Lagothrix (woolly monkeys), Brachyteles (woolly spider monkeys), Ateles (spider monkeys), and Alouatta (howler monkeys)] share a large deletion that removed most of exon 2, all of intron 2 and exon 3, and much of the 3' flanking sequence of gamma 1. The fact that two functional gamma-globin genes were not present in early ancestors of the Atelidae (and that gamma 1 was the dispensible gene) suggests that for much or even all of their evolution, platyrrhines have had gamma 2 as the primary fetally expressed gamma-globin gene, in contrast to catarrhines (e.g., humans and chimpanzees) that have gamma 1 as the primary fetally expressed gamma-globin gene. Results from promoter sequences further suggest that all three platyrrhine families (Atelidae, Cebidae, and Pitheciidae) have gamma 2 rather than gamma 1 as their primary fetally expressed gamma-globin gene. The implications of this suggestion were explored in terms of how gene redundancy, regulatory mutations, and distance of each gamma-globin gene from the locus control region were possibly involved in the acquisition and maintenance of fetal, rather than embryonic, expression. Images Fig. 2 PMID:7535927

Improved treatment satisfaction and convenience with deferasirox in iron-overloaded patients with beta-Thalassemia: Results from the ESCALATOR Trial.

Science.gov (United States)

Taher, Ali; Al Jefri, Abdullah; Elalfy, Mohsen Saleh; Al Zir, Kusai; Daar, Shahina; Rofail, Diana; Baladi, Jean François; Habr, Dany; Kriemler-Krahn, Ulrike; El-Beshlawy, Amal

2010-01-01

Patient-reported outcomes of once-daily oral deferasirox (Exjade) in iron-overloaded patients with beta-thalassemia not achieving successful chelation with prior deferoxamine and/or deferiprone were investigated in a prospective, open-label, 1-year, multicenter study in the Middle East (ESCALATOR). The initial dose of deferasirox was 20 mg/kg/day, with subsequent dose adjustments. At baseline and the end of study (EOS), patients (n = 237) completed a 5-point rating scale for treatment satisfaction and convenience, and recorded time lost to treatment. At EOS, 90.7% of patients were 'satisfied'/'very satisfied' with their iron chelation therapy (ICT) versus 23.2% at baseline. 92.8% (EOS) versus 21.5% (baseline) of patients considered their therapy to be 'convenient'/'very convenient'. Time lost to therapy for daily activities was substantially reduced (3.2 +/- 8.6 [mean +/- SD; EOS] vs. 30.1 +/- 44.2 [baseline] h/month). Patients reported greater satisfaction and convenience, and lower impact on daily activities, with deferasirox than with previous ICT. This may help improve adherence to lifelong ICT in iron-overloaded beta-thalassemia patients. 2010 S. Karger AG, Basel.

Genetic recombination as a major cause of mutagenesis in the human globin gene clusters.

Science.gov (United States)

Borg, Joseph; Georgitsi, Marianthi; Aleporou-Marinou, Vassiliki; Kollia, Panagoula; Patrinos, George P

2009-12-01

Homologous recombination is a frequent phenomenon in multigene families and as such it occurs several times in both the alpha- and beta-like globin gene families. In numerous occasions, genetic recombination has been previously implicated as a major mechanism that drives mutagenesis in the human globin gene clusters, either in the form of unequal crossover or gene conversion. Unequal crossover results in the increase or decrease of the human globin gene copies, accompanied in the majority of cases with minor phenotypic consequences, while gene conversion contributes either to maintaining sequence homogeneity or generating sequence diversity. The role of genetic recombination, particularly gene conversion in the evolution of the human globin gene families has been discussed elsewhere. Here, we summarize our current knowledge and review existing experimental evidence outlining the role of genetic recombination in the mutagenic process in the human globin gene families.

Towards a prevention program for β-thalassemia. The molecular spectrum in East Java, Indonesia.

Science.gov (United States)

Hernanda, Pratika Yuhyi; Tursilowati, Luluk; Arkesteijn, Sandra G J; Ugrasena, I Dewa Gede; Larasati, Marian C Shanty; Soeatmadji, Sentot Mustajab; Giordano, Piero C; Harteveld, Cornelis L

2012-01-01

Defining the spectrum of specific thalassemia mutations is an important issue when planning prevention programs in large multi ethnic countries as is Indonesia. In a first attempt to define the prevalence of the common mutations in East Java we selected a cohort of 17 transfusion-dependent patients attending the Dr. Soetomo Hospital, Surabaya, Indonesia. After basic diagnostics we performed direct DNA sequencing for all β-globin genes. The results obtained on 34 independent chromosomes revealed the following prevalence rates: c.79 G>A p. Glu27Lys (Hb E) 47.0%; c.92+5G>C (IVS-I-5 G>C) 20.6%; c.109_110 delC p.Pro37Leu fs X7 [codon 35 (-C)] 17.6%; c.46del T p.Trp16Gly fsX4 [codon 15 (-T)] 5.9%; c.126_129delCTTT p. Phe42Leu fs X19 (codons 41/42) 2.9%; c.316-197 C>T [IVS-II-654 (C>T)] 2.9%; c*112 A>G (PolyA) 2.9%. Our preliminary results show that the distribution of the prevalent mutations in our cohort is quite homogeneous but with different forms than previously reported. This indicates that more studies on a larger scale and in different geographical areas are needed to refine our provisional results and to characterize the molecular background of the disease in the whole country.

A phylogenomic profile of globins

Directory of Open Access Journals (Sweden)

Dewilde Sylvia

2006-04-01

Full Text Available Abstract Background Globins occur in all three kingdoms of life: they can be classified into single-domain globins and chimeric globins. The latter comprise the flavohemoglobins with a C-terminal FAD-binding domain and the gene-regulating globin coupled sensors, with variable C-terminal domains. The single-domain globins encompass sequences related to chimeric globins and «truncated» hemoglobins with a 2-over-2 instead of the canonical 3-over-3 α-helical fold. Results A census of globins in 26 archaeal, 245 bacterial and 49 eukaryote genomes was carried out. Only ~25% of archaea have globins, including globin coupled sensors, related single domain globins and 2-over-2 globins. From one to seven globins per genome were found in ~65% of the bacterial genomes: the presence and number of globins are positively correlated with genome size. Globins appear to be mostly absent in Bacteroidetes/Chlorobi, Chlamydia, Lactobacillales, Mollicutes, Rickettsiales, Pastorellales and Spirochaetes. Single domain globins occur in metazoans and flavohemoglobins are found in fungi, diplomonads and mycetozoans. Although red algae have single domain globins, including 2-over-2 globins, the green algae and ciliates have only 2-over-2 globins. Plants have symbiotic and nonsymbiotic single domain hemoglobins and 2-over-2 hemoglobins. Over 90% of eukaryotes have globins: the nematode Caenorhabditis has the most putative globins, ~33. No globins occur in the parasitic, unicellular eukaryotes such as Encephalitozoon, Entamoeba, Plasmodium and Trypanosoma. Conclusion Although Bacteria have all three types of globins, Archaeado not have flavohemoglobins and Eukaryotes lack globin coupled sensors. Since the hemoglobins in organisms other than animals are enzymes or sensors, it is likely that the evolution of an oxygen transport function accompanied the emergence of multicellular animals.

Pituitary gland height evaluated by MR in patients with {beta}-thalassemia major: a marker of pituitary gland function

Energy Technology Data Exchange (ETDEWEB)

Argyropoulou, M.I.; Metafratzi, Z.; Efremidis, S.C. [Dept. of Radiology, Univ. of Ioannina (Greece); Kiortsis, D.N. [Dept. of Physiology, Univ. of Ioannina (Greece); Bitsis, S.; Tsatoulis, A. [Dept. of Internal Medicine, Univ. of Ioannina (Greece)

2001-12-01

In transfusion-dependent {beta}-thalassemia major, increased iron deposition in the pituitary gland has a cytotoxic effect leading mainly to hypogonadotropic hypogonadism. Our purpose was to assess in these patients the height of the pituitary gland and to evaluate whether it represents a marker of pituitary gland function. In 29 patients with {beta}-thalassemia major and 35 age- and gender-matched controls the pituitary gland height was evaluated in a midline sagittal scan using a spin echo T1-weighted (500/20 TR/TE) sequence. In all patients, an extensive endocrine evaluation was performed, including measurements of spontaneous and stimulated levels of gonadotropins, thyroid hormones, growth hormone, insulin-like growth factor, and adrenal hormones. The pituitary gland height was lower in thalassemic patients with hypogonadotropic hypogonadism (n=15) (mean 3.48; SD 0.46) than in the age- and gender-matched controls (mean 6.29; SD 0.77), (P<0.001). No statistically significant difference was found between thalassemic patients without hormone dysfunction (n=14) (mean 5.34; SD 1.52) and age- and gender-matched controls (mean 5.91; SD 1.06). We conclude that in thalassemic patients the pituitary gland height is an additional marker of pituitary gland function and might be useful in clinical management. (orig.)

Insulin-like growth factor-1 levels in children with Beta-thalassemia minor

OpenAIRE

Mehran Karimi; Hamdollah Karamifar; Nargrs Sobhani

2008-01-01

Objective: Growth retardation in children with b-thalassemia major is multifactorial. Some etiologies described for this condition are hemochromatosis, disturbed growth hormone (GH) / insulin growth factor-1 (IGF-1) axis, undernutrition and hypermetabolism. It has also been proven that growth retardation is present in b-thalassemia major children despite regular transfusion and chelation. Our aim was to evaluate the level of IGF-1 in b-thalassemia minor subjects and compare it with that in he...

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

Science.gov (United States)

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

Impact of beta thalassemia on maxillary sinuses and sino-nasal passages: A case control study.

Science.gov (United States)

Ragab, Ahmed; Ragab, Seham Mohammed; Shawki, Mohammed

2015-12-01

Skeletal changes among beta (β) thalassemia children are well documented, but without available data regarding sino-nasal passages alterations. The authors investigated the maxillary sinuses and sino-nasal passages changes in β-thalassemia children and correlated such changes with the amount of transfused red cells and the erythroid marrow activity. Clinical analyses including otorhinolaryngical examination (ORL) were obtained in twenty β-thalassemia children and 20 matched healthy controls. Hemoglobin (Hb), serum ferritin, soluble transferrin receptor (sTfR) levels and bone mineral density of the lumbar spine (BMD ls) were assayed. The two groups were analyzed for the CT image parameters: bone thickness, anterior and posterior choanae diameters, extramedullary hematopoiesis and chronic rhinosinusitis (CRS) RESULTS: Nasal congestion/obstruction was identified in 14 (70%) children. Eight patients (40%) had criteria of chronic rhinosinusitis. In comparison with the normal controls, the increase in the roof, floor, medial, anterior, lateral and posterior maxillary bony walls thickness was significantly higher (1.26, 2.46, 2.6, 2.9, 3.23 and 5.34-folds, respectively). The mean posterior choanae horizontal, vertical diameters and their surface area were significantly reduced in the patients compared to the controls. The mean anterior maxillary wall bone thickness directly correlated with sTfR (P=0.047) while that of the posterior wall correlated inversely with Hb level (P=0.013). The mean vertical posterior choanae diameter had positive correlation with the amount of transfused red cells (P=0.001) and negative correlation with sTfR (P=0.001). The Hounsfield unit of maxillary sinus wall had direct relation with BMDls (P=0.003) CONCLUSIONS: Thalassemia children are at risk of different folds increase of maxillary sinuses walls thicknesses utmost at posterior and lateral walls. Other sino-nasal morbidities include diminished posterior choanal diameter, nasal obstruction

Association of Xmn I Polymorphism and Hemoglobin E Haplotypes on Postnatal Gamma Globin Gene Expression in Homozygous Hemoglobin E

Directory of Open Access Journals (Sweden)

Supachai Ekwattanakit

2012-01-01

Full Text Available Background and Objectives. To explore the role of cis-regulatory sequences within the β globin gene cluster at chromosome 11 on human γ globin gene expression related to Hb E allele, we analyze baseline hematological data and Hb F values together with β globin haplotypes in homozygous Hb E. Patients and Methods. 80 individuals with molecularly confirmed homozygous Hb E were analyzed for the β globin haplotypes and Xmn I polymorphism using PCR-RFLPs. 74 individuals with complete laboratory data were further studied for association analyses. Results. Eight different β globin haplotypes were found linked to Hb E alleles; three major haplotypes were (a (III, (b (V, and (c (IV accounting for 94% of Hb E chromosomes. A new haplotype (Th-1 was identified and most likely converted from the major ones. The majority of individuals had Hb F < 5%; only 10.8% of homozygous Hb E had high Hb F (average 10.5%, range 5.8–14.3%. No association was found on a specific haplotype or Xmn I in these individuals with high Hb F, measured by alkaline denaturation. Conclusion. The cis-regulation of γ globin gene expression might not be apparent under a milder condition with lesser globin imbalance such as homozygous Hb E.

Anti-Toxoplasma gondii antibodies in patients with beta-hemoglobinopathies: the first report in the Americas.

Science.gov (United States)

Ferreira, Marina Neves; Bonini-Domingos, Claudia Regina; Fonseca Estevão, Isabeth; de Castro Lobo, Clarice Lopes; Souza Carrocini, Gisele Cristina; Silveira-Carvalho, Aparecida Perpétuo; Ricci, Octávio; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

2017-06-14

In Brazil, there have been no previous studies of Toxoplasma gondii infection in sickle cell anemia patients and carriers of severe forms of beta-thalassemia. This study evaluated T. gondii infection in patients with beta-hemoglobinopathies. A total of 158 samples, 77 (48.7%) men and 81 (51.3%) women, were evaluated. Three groups were formed: G1 (85 patients with sickle cell disease); G2 (11 patients with homozygous beta-thalassemia; G3 (62 patients with heterozygous beta-thalassemia). ELISA was employed to identify anti-T. gondii IgM and IgG antibodies, and molecular analysis was performed to determine beta-hemoglobin mutations. Fisher's exact test was used to compare frequencies of anti-T. gondii IgM and IgG antibodies in respect to gender and age. Anti-T. gondii IgG antibodies were found in 43.5% of individuals in G1, 18.1% in G2 and 50% in G3. All samples from G1 and G2 were seronegative for anti-T. gondii IgM antibodies, but 3.2% from G3 were seropositive. Considering anti-T. gondii IgG antibodies, no statistical significant differences were found between these groups nor in seroprevalence between genders within each group. Despite this, comparisons of the mean ages between G1, G2 and G3 were statistically significant (G2 vs. G1: p value = 0.0001; G3 vs. G1: p-value <0.0001; G3 vs. G2: p-value = 0.0001). A comparison by age of patients with sickle cell anemia showed a trend of lower risk of infection among younger individuals. Therefore, this study demonstrates that T. gondii infection occurs in patients with beta-thalassemia and sickle cell anemia in Brazil as seen by the presence of anti-T. gondii IgM and IgG antibodies.

Co-inheritance of α0 -thalassemia elevates Hb A2 level in homozygous Hb E: Diagnostic implications.

Science.gov (United States)

Singha, K; Srivorakun, H; Fucharoen, G; Fucharoen, S

2017-10-01

Differentiation of homozygous hemoglobin (Hb) E with and without α 0 -thalassemia is subtle on routine hematological ground. We examined in a large cohort of homozygous Hb E if the level of Hb A 2 is helpful. A total of 592 subjects with homozygous Hb E were recruited from ongoing thalassemia screening program. Additionally, five couples at risk of having fetuses with Hb Bart's hydrops fetalis who were homozygous Hb E were also investigated. Hb analysis was performed using capillary electrophoresis system. Globin genotypes were defined by DNA analysis. Subjects were classified into four groups including pure homozygous Hb E (n=532), homozygous Hb E/α 0 -thalassemia (n=48), Hb Constant Spring EE Bart's disease (n=8), and Hb EE Bart's disease (n=4). The levels of Hb A 2 were found, respectively, to be 4.97±0.69, 6.64±1.02, 4.86±0.87, and 7.60±1.04%. Among five couples at risk, α 0 -thalassemia was identified in three subjects with Hb A 2 >6.0%. Increased Hb A 2 level is a useful marker for differentiation of homozygous Hb E with and without α 0 -thalassemia. This should lead to a significant reduction in number of referral cases of homozygous Hb E for molecular testing of α 0 -thalassemia in routine practice. © 2017 John Wiley & Sons Ltd.

Low and fixed dose of hydroxyurea is effective and safe in patients with HbSβ(+) thalassemia with IVS1-5(G→C) mutation.

Science.gov (United States)

Dehury, Snehadhini; Purohit, Prasanta; Patel, Siris; Meher, Satyabrata; Kullu, Bipin Kishore; Sahoo, Lulup Kumar; Patel, Nayan Kumar; Mohapatra, Alok Kumar; Das, Kishalaya; Patel, Dilip Kumar

2015-06-01

Despite compelling evidence that hydroxyurea is safe and effective in sickle cell disease, it is prescribed sparingly due to several barriers like knowledge gaps in certain genotypes, apprehension about its safety and toxicity, and limited resources. We undertook this study to find out the efficacy and safety of HU in patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. We registered 318 patients with HbSβ(+) -thalassemia with IVS1-5(G→C) mutation. Of these, 203 were enrolled for hydroxyurea treatment at a low and fixed dose of 10 mg/kg/day. One hundred four patients (Group-I: 37 children and Group-II: 67 adults) with ≥2 years of hydroxyurea treatment were studied. The rate of vaso-occlusive crises, requirement of blood transfusion and rate of hospitalization reduced from 3 to 0.5, 1 to 0 and 1 to 0 in Group-I and 3 to 0, 1 to 0 and 0.5 to 0 in Group-II respectively after HU therapy (P hydroxyurea is suitable for treatment of patients with HbSβ(+) -thalassemia in resource poor setting. © 2014 Wiley Periodicals, Inc.

Health related quality of life in Middle Eastern children with beta-thalassemia.

Science.gov (United States)

Caocci, Giovanni; Efficace, Fabio; Ciotti, Francesca; Roncarolo, Maria Grazia; Vacca, Adriana; Piras, Eugenia; Littera, Roberto; Markous, Raji Suleiman Dawood; Collins, Gary Stephen; Ciceri, Fabio; Mandelli, Franco; Marktel, Sarah; La Nasa, Giorgio

2012-06-22

Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL) in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years). HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL) 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002), Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015) and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047). HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046) and their parents (p = 0.007). The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children's HRQoL.

Disease: H00228 [KEGG MEDICUS

Lifescience Database Archive (English)

Full Text Available H00228 Thalassemia, including: Alpha thalassemia; Beta thalassemia; Alpha thalasse...mia, X-linked (ATRX) [DS:H01752] Thalassemia is the most common hereditary blood disease caused by mutation

Molecular characterization and phenotypical study of β-thalassemia in Tucumán, Argentina.

Science.gov (United States)

Lazarte, Sandra S; Mónaco, María E; Haro, Ana C; Jiménez, Cecilia L; Ledesma Achem, Myriam E; Issé, Blanca A

2014-01-01

The main hereditary hemoglobin (Hb) disorder in Argentina is β-thalassemia (β-thal). Molecular studies performed in the center of the country exhibited a marked prevalence of the codon 39 (C > T) and IVS-I-110 (G > A) mutations. The northwest region of Argentina has a different demographic history characterized by an important Spanish influx. Seventy-one β-thal carriers attending the Instituto de Bioquímica Aplicada, Tucumán, Argentina, were investigated for β-globin gene mutations by real-time polymerase chain reaction (RT-PCR). To examine the genotype-phenotype relationship, mean corpuscular volume (MCV), mean corpuscular Hb (MCH) and Hb A2 were measured. In order to recognize β-thal, Mentzer Index, Shine & Lal and Red Cell Distribution Width Index (RDWI), were calculated. The ethnic background of subjects revealed that 82.0% of the population was of Italian, Spanish and Arab origin. Seven mutations were detected: codon 39 (45.0%), IVS-I-1 (G > A) (22.5%), IVS-I-110 (16.3%), IVS-II-1 (G > A) (4.1%), IVS-I-1 (G > T) (2.0%), IVS-I-6 (T > C) (2.0%) and IVS-II-745 (G > C) (2.0%). In three families (6.1%), β-thal mutations were not determined. These results differed from other Argentinian studies because at present codon 39 and IVS-I-1 are the most prevalent; MCV, MCH and Hb A2 did not correlate with the type of mutation (β(0)/β(+)). Values of MCV (67.0 fL) and Hb A2 (4.85%) were unable to discriminate between them. Significant differences (p Argentina. Differences might represent the influence of Spanish immigration.

A brief review on newborn screening methods for hemoglobinopathies and preliminary results selecting beta thalassemia carriers at birth by quantitative estimation of the HbA fraction.

Science.gov (United States)

Mantikou, Eleni; Arkesteijn, Sandra G; Beckhoven van, Jaqueline M; Kerkhoffs, Jean-Louis; Harteveld, Cornelis L; Giordano, Piero Carlo

2009-12-01

We present in a brief summary the basic aspects of the most rational technologies used for new born screening (NBS) of the hemoglobinopathies and we report the preliminary results for the identification of beta-thalassemia carriers at birth by measuring the expression of the HbA fraction. Separation and measurement of the Hb fractions in 1.500 cord blood samples collected among the multi-ethnic Dutch population using different methods. By using a cut of thalassemia can be preselected at birth with a reasonable degree of sensitivity and be confirmed by parent analysis.

Immunodeficiency associated with a nonsense mutation of IKBKB

DEFF Research Database (Denmark)

Nielsen, Christian; Jakobsen, Marianne A; Larsen, Martin Jakob

2014-01-01

We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory insufficie......We report an infant of consanguineous parents of Turkish decent with a novel immunodeficiency associated with homozygosity for a nonsense mutation of the gene encoding Inhibitor of nuclear factor kappa-B (NF-κB) kinase subunit beta (IKKβ). At five months, she presented with respiratory...... no explanation before whole exome sequencing revealed a novel mutation abrogating signaling through the canonical NF-κB pathway....

Health related quality of life in Middle Eastern children with beta-thalassemia

Directory of Open Access Journals (Sweden)

Caocci Giovanni

2012-06-01

Full Text Available Abstract Background Thalassemia is a common disorder worldwide with a predominant incidence in Mediterranean countries, North Africa, the Middle East, India, Central Asia, and Southeast Asia. Whilst substantial progress has been made towards the improvement of Health related quality of life (HRQoL in western countries, scarce evidence-based data exists on HRQol of thalassemia children and adolescents living in developing countries. Methods We studied 60 thalassemia children from Middle Eastern countries with a median age of 10 years (range 5 to 17 years. HRQoL was assessed with the Pediatric Quality of Life Inventory (PedsQL 4.0. The Questionnaire was completed at baseline by all patients and their parents. The agreement between child-self and parent-proxy HRQoL reports and the relationship between HRQoL profiles and socio-demographic and clinical factors were investigated. Results The scores of parents were generally lower than those of their children for Emotional Functioning (mean 75 vs 85; p = 0.002, Psychosocial Health Summary (mean 70.3 vs 79.1; p = 0.015 and the Total Summary Score (mean 74.3 vs 77.7 p = 0.047. HRQoL was not associated with ferritin levels, hepatomegaly or frequency of transfusions or iron chelation therapy. Multivariate analysis showed that a delayed start of iron chelation had a negative impact on total PedsQL scores of both children (p = 0.046 and their parents (p = 0.007. Conclusions The PedsQL 4.0 is a useful tool for the measurement of HRQoL in pediatric thalassemia patients. This study shows that delayed start of iron chelation has a negative impact on children’s HRQoL.

Nitroblue tetrazolium test in patients with beta-thalassemia major

International Nuclear Information System (INIS)

Ghaffari, J.; Vahidshahi, K.; Kosaryan, M.; Karami, H.; Mahdavi, M.; Parvinnejad, N.

2008-01-01

Objective to assess the neutrophil function in thalassemia major (TM)patients and compare it with the control group and to recognize its relevantfactors. This was a retrospective cohort study, which was carried out fromOctober 2007 to February 2008 in the Thalassemia research Center in Boo AliSina Hospital in Sari, Mazandaran, North of Iran. The study populationconsisted of TM patients in Boo Ali Sina Teaching Hospital. The method ofsampling in the case group was systematic and it was target based in thecontrol group. The sample size determined was based on previous studies.Thalassemia major was diagnosed based on hemoglobin electrophoresis (casegroup). The control group was their brothers and sisters, who had +-5 yearsof age difference and were of the same gender as the patients. Datacollection was based on interview, investigating demographic characteristicsand also obtaining medical information from medical records of the patients.The neutrophil function was by performing nitroblue tetrazolium (NBT)reduction test. The test was carried out on both groups and the data wereanalyzed by software using SPSS version 13.0. In this study, 39 patients and39 healthy controls were compared. The average age of the patients was21.6+-5.3 years and it was 22.4+-5.1 years in healthy controls (p=0.7). Therewas a significant correlation between the test's results and the patients age(p=0.008). The rate of impaired NBT results in the patients was 36%, while itwas 10% in controls, which were significantly different. The neutrophilactivity based on NBT test was 89.9+-11.6% in the case group and 93.7+-2.51%in the control group (p=0.025). This study indicates that neutrophil activityin thalassemia patients was significantly lower, compared to the normalcontrol group, especially in young patients. Based on the results, evaluationof neutrophil function and pyogenic infections in TM patients seemsnecessary. (author)

Thalassemia and hemoglobinopathies in an ethnic minority group in Central Vietnam: implications to health burden and relationship between two ethnic minority groups.

Science.gov (United States)

Nguyen, Nga Thi; Sanchaisuriya, Kanokwan; Sanchaisuriya, Pattara; Van Nguyen, Hoa; Phan, Hoa Thi Thuy; Fucharoen, Goonnapa; Fucharoen, Supan

2017-07-01

Thalassemia is a genetic condition that can result in long and expensive treatments, and severe thalassemia may lead to death if left untreated. Couples contributing two genes for thalassemia place their children at particular risk for severe thalassemia. Gene frequency of thalassemia varies in Vietnam, but presents remarkably high levels among some ethnic minority groups. Limited information about thalassemia frequency makes prevention and control of thalassemia difficult. This study aimed to determine gene frequency of certain types of thalassemia among 390 women of reproductive age of the Ta-Oi ethnic minority. Hemoglobin and DNA analyses were carried out to diagnose thalassemia and hemoglobinopathies. Of the total participants, 56.1% (95% CI = 51.1-61.1) carried thalassemia genes. A remarkably high frequency of hemoglobin Constant Spring (Hb CS) of 23.8% (95% CI = 19.7-28.4) was noted. The frequency of α + -thalassemia (-3.7 kb deletion) was 26.4% (95% CI = 22.1-31.1), while hemoglobin E (Hb E) and hemoglobin Paksé (Hb Ps) were identified at frequencies of 14.6 (95% CI = 11.2-18.5) and 2.6% (95% CI = 1.4-5.0), respectively. Further analysis of α-globin gene haplotype revealed the same Hb CS haplotype (+ - M + + -) as of the Co-Tu minority, a neighboring minority of the Ta-Oi, indicating that these two minorities may share the same ancestors. This information will be helpful for further studies in population genetics, as well as the development prevention and control program in the region.

Association of erythrocyte deformability with red blood cell distribution width in metabolic diseases and thalassemia trait.

Science.gov (United States)

Vayá, Amparo; Alis, Rafael; Suescún, Marta; Rivera, Leonor; Murado, Julian; Romagnoli, Marco; Solá, Eva; Hernandez-Mijares, Antonio

2015-01-01

Increased red blood distribution width (RDW) in anemia is related to disturbances in the cellular surface/volume ratio, usually accompanied by morphological alterations, while it has been shown in inflammatory diseases that the activity of pro-inflammatory cytokines disturbing erythropoiesis increases RDW. Recently it has been reported that higher RDW is related with decreased erythrocyte deformability, and that it could be related with the association of RDW and increased risk of cardiovascular diseases. In order to analyze the influence of morphological alterations and proinflammatory status on the relationship between RDW and erythrocyte deformability, we analyzed erythrocyte deformability along with RDW and other hematological and biochemical parameters in 36 α-thalassemia, 20 β-thalassemia, 20 δβ-thalassemia trait carriers, 61 metabolic syndrome patients and 76 morbidly obese patients. RDW correlated inversely with erythrocyte deformability in minor β-thalassemia (r =-0.530, p thalassemia is often accompanied by more marked cell-shaped perturbations than other thalassemia traits. This could be the reason for this negative association only in this setting. Higher anisocytosis seems to be associated with greater morphologic alterations (shape/volume), which reduce erythrocyte deformability. The proinflammatory profile in metabolic patients can be related to the positive association of RDW with erythrocyte deformability found in these patients. However, further research is needed to explain the mechanisms underlying this association.

A second mutation associated with apparent [beta]-hexosaminidase A pseudodeficiency: Identification and frequency estimation

Energy Technology Data Exchange (ETDEWEB)

Cao, Z.; Chabot, T.; Triggs-Raine, B.L. (Univ. of Manitoba, Winnepeg (Canada)); Natowicz, M.R.; Prence, E.M. (Shriver Center for Mental Retardation, Waltham, MA (United States) Harvard Medical School, Boston, MA (United States)); Kaback, M.M.; Lim-Steele, S.T.; Brown, D. (Children' s Hospital, San Diego, CA (United States) Univ. of California, San Diego, CA (United States))

1993-12-01

Deficient activity of [beta]-hexosaminidase A (Hex A), resulting from mutations in the HEXA gene, typically causes Tay-Sachs disease. However, healthy individuals lacking Hex A activity against synthetic substrates (i.e., individuals who are pseudodeficient) have been described. Recently, an apparently benign C[sub 739]-to-T (Arg247Trp) mutation was found among individuals with Hex A levels indistinguishable from those of carriers of Tay-Sachs disease. This allele, when in compound heterozygosity with a second [open quotes]disease-causing[close quotes] allele, results in Hex A pseudodeficiency. The authors examined the HEXA gene of a healthy 42-year-old who was Hex A deficient but did not have the C[sub 739]-to-T mutation. The HEXA exons were PCR amplified, and the products were analyzed for mutations by using restriction-enzyme digestion or single-strand gel electrophoresis. A G[sub 805]-to-A (Gly269Ser) mutation associated with adult-onset G[sub m2] gangliosidosis was found on one chromosome. A new mutation, C[sub 745]-to-T (Arg 249Trp), was identified on the second chromosome. This mutation was detected in an additional 4/63 (6%) non-Jewish and 0/218 Ashkenazi Jewish enzyme-defined carriers. Although the Arg249Trp change may result in a late-onset form of G[sub M2] gangliosidosis, any phenotype must be very mild. This new mutation and the benign C[sub 739]-to-T mutation together account for [approximately]38% of non-Jewish enzyme-defined carriers. Because carriers of the C[sub 739]-to-T and C[sub 745]-to-T mutations cannot be differentiated from carriers of disease-causing alleles by using the classical biochemical screening approaches, DNA-based analyses for these mutations should be offered for non-Jewish enzyme-defined heterozygotes, before definitive counseling is provided. 46 refs., 5 figs., 2 tabs.

Guidelines for the Standard Monitoring of Patients With Thalassemia: Report of the Thalassemia Longitudinal Cohort.

Science.gov (United States)

Tubman, Venée N; Fung, Ellen B; Vogiatzi, Maria; Thompson, Alexis A; Rogers, Zora R; Neufeld, Ellis J; Kwiatkowski, Janet L

2015-04-01

Chronic transfusion therapy has played a central role in extending life expectancy for patients with hemoglobinopathies such as thalassemia. However, this life-saving therapy is associated with numerous complications that now comprise the bulk of management considerations for patients with thalassemia. This review reports on the experience of the Thalassemia Longitudinal Cohort and reviews available literature to establish guidelines for the management of patients with thalassemia.

beta-thalassaemia major hos børn og unge i Danmark

DEFF Research Database (Denmark)

Jung, Anne; Main, Katharina Maria; Scheibel, Elma

2002-01-01

INTRODUCTION: Beta-thalassemia major occurs with increasing frequency among Danish children as a result of immigration. The aim of the study was to estimate the occurrence of beta-thalassemia major in Denmark, analyse the treatment and organ functions, and identify areas for an improved treatment...... strategy. MATERIAL AND METHODS: During 1998-99 all Danish pediatric departments were contacted for identification of children aged 0-18 years with beta-thalassemia major. Blood transfusions and chelation therapy were registered, and for Eastern Denmark clinical, endocrine, cardiac, and serologic parameters...... were performed. RESULTS: Twenty-six children had beta-thalassemia major. Out of these, 20 received blood transfusions, and 17 patients were chelated. Eight patients were not chelated owing to previous bone marrow transplantation, treatment with hydroxyurea or ferritin

Beta-thalassaemia major hos børn og unge i Danmark

DEFF Research Database (Denmark)

Jung, A.; Main, K.M.; Scheibel, E.

2002-01-01

INTRODUCTION: Beta-thalassemia major occurs with increasing frequency among Danish children as a result of immigration. The aim of the study was to estimate the occurrence of beta-thalassemia major in Denmark, analyse the treatment and organ functions, and identify areas for an improved treatment...... strategy. MATERIAL AND METHODS: During 1998-99 all Danish pediatric departments were contacted for identification of children aged 0-18 years with beta-thalassemia major. Blood transfusions and chelation therapy were registered, and for Eastern Denmark clinical, endocrine, cardiac, and serologic parameters...... were performed. RESULTS: Twenty-six children had beta-thalassemia major. Out of these, 20 received blood transfusions, and 17 patients were chelated. Eight patients were not chelated owing to previous bone marrow transplantation, treatment with hydroxyurea or ferritin

Posterior transverse interarch discrepancy on HbE β thalassemia patients

Directory of Open Access Journals (Sweden)

Yuniar Zen

2011-03-01

Full Text Available Background: One of the symptoms that often arises on thalassemia patients is disharmony dentofacial, class II skeletal malocclusion, as a result of the malrelation of maxilla and mandible. This malrelation can be affected by either maxillary bone position, dentoalveolar maxillary position, mandibular bone position, dentoalveolar mandibular position, or combinations of those components. Purpose: The study was aimed to examine whether there is posterior transverse interarch discrepancy on the HbE β thalassemia patients or not. Methods: This study is an observational research with cross-sectional design. The sample consisted of 33 HbE β thalassemia patients and 33 non-thalassemia patients as a control group aged 12–14 years. Lateral cephalogram was carried out and dental casts of maxillary and mandibular dental arches were also taken in all of those patients. Results: There was no difference between the maxillary intermolar width of the HbE β thalassemia patients and that of the normal ones, but the mandibular intermolar width of the HbE β thalassemia patients was significantly smaller than that of the normal ones. Beside that, posterior transverse interarch discrepancy of of the HbE β thalassemia patients was significantly greater than that of the normal ones, which showed great difference between maxillary and mandibular intermolar widths. Conclusion: Posterior transverse interarch discrepancy of the HbE β thalassemia patients was different from that of the normal ones. The dentofacial abnormalities on the HbE β thalassemia patients aged 12–14 years primarily was due to disporposional dentofacial growth in the vertical, sagittal, and transversal directions, especially in the posterior region.Latar belakang: Salah satu akibat yang sering timbul pada penderita talasemia adalah disharmoni dentofasial berupa maloklusi skeletal kelas II yang merupakan kelainan hubungan maksila dan mandibula. Malrelasi ini dapat dipengaruhi oleh posisi

Diagnosis of Compound Heterozygous Hb Tak/β-Thalassemia and HbD-Punjab/β-Thalassemia by HbA2 Levels on Capillary Electrophoresis.

Science.gov (United States)

Panyasai, Sitthichai; Sakkhachornphop, Supachai; Pornprasert, Sakorn

2018-01-01

A misdiagnosis of β-thalassemia carrier in samples with Hb Tak and HbD-Punjab, the β-variants, can be a cause of inappropriate genetic counseling thus having a new case of β-thalassemia major. A capillary electrophoresis (CE) is very efficient in separating and quantifying HbA 2 . In this study, HbA 2 levels of samples which were doubted for compound heterozygous Hb Tak/β-thalassemia or heterozygous HbD-Punjab/β-thalassemia were measured and compared between CE and high performance liquid chromatography (HPLC). The molecular confirmation for Hb Tak, HbD-Punjab and β-thalassemia codons 17 (A > T), 41/42 (-TCTT), 71/72 (+A) and IVSI-nt1 (G > T) mutations and 3.4 kb deletion were also performed. Based on DNA analysis, 3 cases were diagnosed as compound heterozygous Hb Tak/β-thalassemia and one for HbD-Punjab/β-thalassemia. The elevated HbA 2 levels were found in all 4 samples with rages of 4.6-7.3% on CE while those were not found on HPLC. Thus, the elevated HbA 2 measured by CE can be used as a screening parameter for differentiating the homozygote of Hb Tak and HbD-Punjab from the compound heterozygote of these hemoglobinopathies and β-thalassemia.

Chromosome 11-linked determinant controls fetal globin expression and the fetal-to-adult globin switch

International Nuclear Information System (INIS)

Melis, M.; Demopulos, G.; Najfeld, V.; Zhang, J.W.; Brice, M.; Papayannopoulou, T.; Stamatoyannopoulos, G.

1987-01-01

Hybrids formed by fusing mouse erythroleukemia (MEL) cells with human fetal erythroid cells produce human fetal globin, but they switch to adult globin production as culture time advances. To obtain information on the chromosomal assignment of the elements that control γ-to-β switching, the authors analyzed the chromosomal composition of hybrids producing exclusively or predominantly human fetal globin and hybrids producing only adult human globin. No human chromosome was consistently present in hybrids expressing fetal globin and consistently absent in hybrids expressing adult globin. Subcloning experiments demonstrated identical chromosomal compositions in subclones displaying the fetal globin program and those that had switched to expression of the adult globin program. These data indicate that retention of only one human chromosome -- i.e., chromosome 11 -- is sufficient for expression of human fetal globin and the subsequent γ-to-β switch. The results suggest that the γ-to-β switch is controlled either cis to the β-globin locus of by a trans-acting mechanism, the genes of which reside on human chromosome 11

Hepcidin is suppressed by erythropoiesis in hemoglobin E β-thalassemia and β-thalassemia trait

Science.gov (United States)

Jones, Emma; Pasricha, Sant-Rayn; Allen, Angela; Evans, Patricia; Fisher, Chris A.; Wray, Katherine; Premawardhena, Anuja; Bandara, Dyananda; Perera, Ashok; Webster, Craig; Sturges, Pamela; Olivieri, Nancy F.; St. Pierre, Timothy; Armitage, Andrew E.; Porter, John B.; Weatherall, David J.

2015-01-01

Hemoglobin E (HbE) β-thalassemia is the most common severe thalassemia syndrome across Asia, and millions of people are carriers. Clinical heterogeneity in HbE β-thalassemia is incompletely explained by genotype, and the interaction of phenotypic variation with hepcidin is unknown. The effect of thalassemia carriage on hepcidin is also unknown, but it could be relevant for iron supplementation programs aimed at combating anemia. In 62 of 69 Sri Lankan patients with HbE β-thalassemia with moderate or severe phenotype, hepcidin was suppressed, and overall hepcidin inversely correlated with iron accumulation. On segregating by phenotype, there were no differences in hepcidin, erythropoiesis, or hemoglobin between severe or moderate disease, but multiple linear regression showed that erythropoiesis inversely correlated with hepcidin only in severe phenotypes. In moderate disease, no independent predictors of hepcidin were identifiable; nevertheless, the low hepcidin levels indicate a significant risk for iron overload. In a population survey of Sri Lankan schoolchildren, β-thalassemia (but not HbE) trait was associated with increased erythropoiesis and mildly suppressed hepcidin, suggesting an enhanced propensity to accumulate iron. In summary, the influence of erythropoiesis on hepcidin suppression associates with phenotypic disease variation and pathogenesis in HbE β-thalassemia and indicates that the epidemiology of β-thalassemia trait requires consideration when planning public health iron interventions. PMID:25519750

Role of XmnIgG Polymorphism in Hydroxyurea Treatment and Fetal Hemoglobin Level at Isfahanian Intermediate β-Thalassemia Patients.

Science.gov (United States)

Motovali-Bashi, Majid; Ghasemi, Tayyebeh

2015-01-01

β-thalassemia is the most common monogenic disorder in human. The (C-->T) polymorphism at -158 upstream region of the γG-globin gene and pharmacological factors such as hydroxyurea have been reported to influence γ-globin gene expression and the severity of clinical symptoms of β-thalassemia. In the present study, 51 β-thalassemia intermediate patients were studied. Xmn1γG polymorphism genotype was determined using Tetra-Primer ARMS-PCR technique. Hemoglobin (Hb) and fetal hemoglobin (HbF) levels were determined by gel electrophoresis. Of 51 patients, 35 (68.6%) patients were heterozygous (CT) and 16 (31.4%) patients were homozygous (CC). Of 30 patients under treatment by hydroxyurea, 20 (66.7%) patients were heterozygous (CT) and 10 (33.3%) patients were homozygous (CC). Our results demonstrated that in the heterozygous (CT) genotype, the Hb (9.58 ± 1.25 gm/dl) and HbF (89.30 ± 21.87) levels were significantly higher in comparison with homozygous (CC) genotype (7.94 ± 1.34 gm/dl and 70.32 ± 40.56, respectively). Furthermore, we observed that after drug usage, the Hb and HbF levels in patients with heterozygous (CT) genotype (0.7 ± 1.26 gm/dl and 5.95 ± 14.8, respectively) raised more in comparison with homozygous (CC) genotype (0.26 ± 1.43 gm/dl and 0.8 ± 1.31, respectively). Hb and HbF levels in the patients carrying T allele are increased significantly, and they also response to hydroxyurea treatment.

The diagnosis and molecular analysis of a novel 21.9kb deletion (Qinzhou type deletion) causing α+ thalassemia.

Science.gov (United States)

Long, Ju; Yan, Shanhuo; Lao, Kegan; Pang, Wanrong; Ye, Xuehe; Sun, Lei

2014-04-01

α-Thalassemia is a common single-gene genetic disease that can cause Hb Bart's hydrops fetalis and Hb H disease in tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --(SEA) genotype sample needs further analysis. In doing so, we found a novel 21.9kb deletion (Qinzhou type deletion). The deletion position of the novel 21.9kb deletion is from 14373bp to 36299bp of the α-globin gene cluster (NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After sequence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype. Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The genotype of this propositus is --(SEA)/-α(21.9) and its phenotype conforms to the characteristics of Hb H disease, establishing that the combination between -α(21.9) genotype and α(0) genotype can lead to Hb H disease. By molecular analysis, we established that this case fits the characteristic of an α(+) thalassemia genotype. © 2013.

Recent patents and technology transfer for molecular diagnosis of β-thalassemia and other hemoglobinopathies.

Science.gov (United States)

Breveglieri, Giulia; Finotti, Alessia; Borgatti, Monica; Gambari, Roberto

2015-01-01

Biological tests and genetic analyses for diagnosis and characterization of hematological diseases in health laboratories are designed with the aim of meeting the major medical needs of hospitals and pharmaceutical companies involved in this field of applied biomedicine. Genetic testing approaches to perform diagnosis consist of molecular techniques, which should be absolutely reproducible, fast, sensitive, cheap, and portable. Biological tests analyzed involve adult/newborn subjects, whereas genetic analyses involve adult thalassemia patients, newborns, embryos/fetuses (including non-invasive prenatal diagnosis), pre-implantation embryos, and pre-fertilization oocytes. The most recent findings in the diagnostic approach for β-thalassemias are related to three major fields of investigation: moving towards ultrasensitive methodologies for effective detection of the primary causative mutation of β-thalassemia, including the development of polymerase chain reaction-free approaches and non-invasive prenatal diagnosis; comparing analyses of the genotype of β-thalassemia patients to high-HbF-associated polymorphisms; introducing whole genome association assays and next-generation sequencing. All these issues should be considered and discussed in the context of several aspects, including regulatory, ethical and social issues. DNA sequence data aligned with the identification of genes central to the induction, development, progression, and outcome of β-thalassemia will be a key point for directing personalized therapy.

Splenic uptake of both technetium-99m diphosphonate and technetium-99m sulfur colloid in sickle cell beta degrees thalassemia

International Nuclear Information System (INIS)

Heck, L.L.; Brittin, G.M.

1989-01-01

A 19-year-old black woman with sickle cell beta degrees thalassemia had experienced more than 100 hospital admissions for sickle cell crisis and aseptic necrosis of both femoral heads. Her spleen was enlarged threefold and accumulated both radiocolloid and bone-seeking agent on two occasions, demonstrating an exception to the rule in sickle cell anemia that spleens that take up bone-seeking agents demonstrate functional asplenia. In the context of fever, left upper quadrant pain, and splenomegaly, the pattern of calcification in the patient's spleen as revealed in ultrasound and CT studies suggested possible abscess and led to unnecessary splenectomy. The nuclear medicine studies did not support this diagnosis. Nuclear medicine physicians should not be misled by splenic findings of sickle cell thalassemia (and possibly of other heterozygous sickle cell disorders) that differ from those of the more familiar homozygous sickle cell anemia

PRENATAL DIAGNOSIS OF β-THALASSEMIAS AND HEMOGLOBINOPATHIES

Directory of Open Access Journals (Sweden)

Luisella Saba

2009-06-01

Full Text Available

Prenatal diagnosis of β-thalassemia was accomplished for the first time in the 1970s by globin chain synthesis analysis on fetal blood obtained by placental aspiration at 18-22 weeks gestation. Since then, the molecular definition of the β- globin gene pathology, the development of procedures of DNA analysis, and the introduction of chorionic villous sampling have dramatically improved prenatal diagnosis of this  disease and of related disorders.  Much information is now available about the molecular mechanisms of the diseases and the molecular testing is widespread.

As prenatal diagnosis has to provide an accurate, safe and early result, an efficient screening of the population and a rapid molecular characterization of the couple at risk, are necessary prerequisites. In the last decades  earlier and less invasive approaches for prenatal diagnosis were developed . A overview of the most promising procedure will be done.

Moreover, in order to reduce the choice of   interrupting  the pregnancy in case of affected fetus, Preimplantation or Preconceptional Genetic Diagnosis (PGD has been setting up for several diseases including thalassemias.

Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus

Directory of Open Access Journals (Sweden)

Weiqun Lu

2011-01-01

Full Text Available In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW- than in seawater- (SW-adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW.

Mental health status in patients with Thalassemia major in Iran

Directory of Open Access Journals (Sweden)

Mahdieh Nasiri

2014-02-01

Full Text Available Thalassemia major is a genetic blood disorder that is detected by the symptoms of chronic and severe anemia, enlarged liver and spleen, failure to thrive and bone deformities in particular deformed face and bulging forehead. Due to changes in physical appearance, the disease can influence on other aspects of the patient's life, so the disease can have a strong impact on the mental health of these patients and their families. Previous studies showed that 80% of patients with thalassemia major have at least one psychiatric disorder. The aim of this paper was to review the mental health status of patients with Beta-thalassemia major in Iran.

Prospects and future of conservative management of beta thalassemia major in a developing country

International Nuclear Information System (INIS)

Rahman, M.; Lodhi, Y.

2004-01-01

Objective: To assess the efficacy, prospects and future of conservative management of beta thalassemia major patients in a developing country. Design: Patients registered at IHBTS were studied over a period of three years. They consented to being managed on moderate transfusion regimen, aiming to maintain a pre-transfusion haemoglobin(Hgb) level of 9.0 plus minus 1.0 g per dL. We studied their transfusion requirements, status for transfusion transmitted infections (TTls), serum ferritin levels and complications developing as a result of iron overload. Subjects: Initially all registered patients were included in this study. Sporadic patients as well as dropouts occurring due to any reason, (patients concurrently seeking treatment at other centres as well, or complying poorly to advised chelation therapy) were excluded from the study. The data presented here conforms to a cohort of 60 regular patients who adhered best to our selection criteria. Main Outcome Measures: 1) The study highlights the deficiencies and problems of conservative management for beta thalassemia major. 2) The major impact of our study is the message that conservative management in a poor country, like ours, is a no-win situation. 3) There is an urgent need to immediately start a prevention programme. Results: In the younger patients, blood consumption even on the moderate transfusion regimen is 120ml/kg/year, however with ascending age the consumption increases to 240ml/kg/year. A substantive number of the patients are either Hep C (35%) or Hep B (1.7%) positive. There are no HIV positive patients. Serum ferritin levels vary widely and could not be controlled due to poor compliance to chelation. 50% of the patients developed one or other complications of iron overload. The cost of treatment depending on the quality of care, is tremendous and beyond the reach of the common man. Conclusions: Conservative management may be the best alternative and at times the only hope for patients in our country

'Rakter dosh'--corrupting blood: The challenges of preventing thalassemia in Bengal, India.

Science.gov (United States)

Chattopadhyay, Sreeparna

2006-11-01

Thalassemia is an inherited blood disorder that has been receiving increasing attention in India. However, prevention of thalassemia in India continues to be difficult despite efforts of public health professionals and the government. Using West Bengal as a case study, this paper attempts to unravel some of the barriers to the prevention campaign and the consequent under utilization of the program. Lack of access, low awareness, low-risk perception and poverty are all important proximate constraints; however, one of the greatest barriers to the program is rooted in cultural notions of blood, marriage, identity, personhood and kinship in Bengali society. Blood is so deeply valued in the Bengali kinship system that this genetic mutation is perceived to be corrupting the blood (rakter dosh). Being a thalassemia carrier (i.e., having thalassemia minor) renders an individual unfit as a suitable marriage partner because of beliefs related to purity of blood, its association with the continuity of the lineage, and subsequent transmission of desirable traits to future generations. The risk of non-marriage affects women disproportionately, and parents are not inclined to test their daughters because of the possibility of not being able to marry them off to eligible suitors. The stigma associated with having thalassemia minor (TMI) is a deterrent to the disclosure of thalassemia status as well as to testing. Using anthropological theories and ethnographic methods, this paper focuses on the gendered process by which the diagnosis of a thalassemia carrier 'spoils' identities, thereby creating a disjuncture between the goals of the prevention program and people's need for social conformity, and ultimately between medical desirability and social desirability. The paper also suggests policies for enhancing the utilization of the program. Finally the conclusions from this study have potential applications for public health prevention programs that confront problems of stigma in

Co-inheritance of the rare β hemoglobin variants Hb Yaounde, Hb Görwihl and Hb City of Hope with other alterations in globin genes: impact in genetic counseling.

Science.gov (United States)

Vinciguerra, Margherita; Passarello, Cristina; Leto, Filippo; Cassarà, Filippo; Cannata, Monica; Maggio, Aurelio; Giambona, Antonino

2015-04-01

Nearly 1183 different molecular defects of the globin genes leading to hemoglobin variants have been identified (http://globin.bx.psu.edu) over the past decades. The purpose of this study was to report three cases, never described in the literature, of co-inheritance of three β hemoglobin variants with other alterations in globin genes and to evaluate the clinical significance to conduct an appropriate genetic counseling. We report the molecular study performed in three probands and their families, sampling during the screening program conducted at the Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at Villa Sofia-Cervello Hospital in Palermo, Italy. This work allowed us to describe the co-inheritance of three rare β hemoglobin variants with other alterations in globin genes: the β hemoglobin variant Hb Yaounde [β134(H12)Val>Ala], found for the first time in combination with ααα(anti3.7) arrangement, and the β hemoglobin variants Hb Görwihl [β5(A2)Pro>Ala] and Hb City of Hope [β69(E13)Gly>Ser], found both in association with β(0) -thalassemia. The present work emphasizes the importance of a careful evaluation of the hematological data, especially in cases of atypical hematological parameters, to carry out an adequate and complete molecular study and to formulate an appropriate genetic counseling for couples at risk. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Cellular promoters incorporated into the adenovirus genome: effects of viral regulatory elements on transcription rates and cell specificity of albumin and beta-globin promoters.

OpenAIRE

Babiss, L E; Friedman, J M; Darnell, J E

1986-01-01

In the accompanying paper (Friedman et al., Mol. Cell. Biol. 6:3791-3797, 1986), hepatoma-specific expression of the rat albumin promoter within the adenovirus genome was demonstrated. However, the rate of transcription was very low compared with that of the endogenous chromosomal albumin gene. Here we show that in hepatoma cells the adenovirus E1A enhancer, especially in the presence of E1A protein, greatly stimulates transcription from the albumin promoter but not the mouse beta-globin prom...

Correction of β-thalassemia mutant by base editor in human embryos

Directory of Open Access Journals (Sweden)

Puping Liang

2017-09-01

Full Text Available Abstract β-Thalassemia is a global health issue, caused by mutations in the HBB gene. Among these mutations, HBB −28 (A>G mutations is one of the three most common mutations in China and Southeast Asia patients with β-thalassemia. Correcting this mutation in human embryos may prevent the disease being passed onto future generations and cure anemia. Here we report the first study using base editor (BE system to correct disease mutant in human embryos. Firstly, we produced a 293T cell line with an exogenous HBB −28 (A>G mutant fragment for gRNAs and targeting efficiency evaluation. Then we collected primary skin fibroblast cells from a β-thalassemia patient with HBB −28 (A>G homozygous mutation. Data showed that base editor could precisely correct HBB −28 (A>G mutation in the patient’s primary cells. To model homozygous mutation disease embryos, we constructed nuclear transfer embryos by fusing the lymphocyte or skin fibroblast cells with enucleated in vitro matured (IVM oocytes. Notably, the gene correction efficiency was over 23.0% in these embryos by base editor. Although these embryos were still mosaic, the percentage of repaired blastomeres was over 20.0%. In addition, we found that base editor variants, with narrowed deamination window, could promote G-to-A conversion at HBB −28 site precisely in human embryos. Collectively, this study demonstrated the feasibility of curing genetic disease in human somatic cells and embryos by base editor system.

Oxygen Association-Dissociation and Stability Analysis on Mouse Hemoglobins with Mutant α- and β-Globins

Science.gov (United States)

D'Surney, S. J.; Popp, R. A.

1992-01-01

Oxygen association-dissociation and hemoglobin stability analysis were performed on mouse hemoglobins with amino acid substitutions in an α-globin (α89, His to Leu) and a β-globin (β59, Lys to Ile). The variant α-globin, designated chain 5(m) in the Hba(g2) haplotype, had a high oxygen affinity and was stable. The variant β-globin, (β(s2)) of the Hbb(s2) haplotype, also had an elevated oxygen affinity and in addition was moderately unstable in 19% isopropanol. Hemoglobins from the expected nine (Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) X Hba(a)/Hba(a);Hbb(s2)/Hbb(s2)) F(2) genotypes can be grouped into five classes of P(50) values characterized by strict additivity and dependency on mutant globin gene dosage; physiologically, both globin variants gave indistinguishable effects on oxygen affinity. The hemoglobin of normal mice (Hba(a)/Hba(a);Hbb(s)/Hbb(s)) had a P(50) = 40 mm Hg and the hemoglobin of Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) F(2) mice had a P(50) = 25 mm Hg (human P(50) = 26 mm Hg). Peripheral blood from Hba(g2)/Hba(g2);Hbb(s)/Hbb(s), Hba(a)/Hba(a);Hbb(s2)/Hbb(s2) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice exhibited normal hematological values except for a slightly higher hematocrit for Hba(g2)/Hba(g2);Hbb(s)/Hbb(s) and Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice, slightly elevated red cell counts for mice of the three mutant genotypes, and significantly lower values for the mean corpuscular volume and mean corpuscular hemoglobin for Hba(g2)/Hba(g2);Hbb(s2)/Hbb(s2) mice. PMID:1427042

Echocardiographic evaluation of thalassemia intermedia patients in Duhok, Iraq.

Science.gov (United States)

Mohammad, Ameen Mosa

2014-12-11

Cardiac complications are among the most serious problems of thalassemia intermedia patients. The current study was initiated to address the latter issue through the study of the echocardiographic findings and correlate it with clinical characteristics of thalassemia intermedia patients in Duhok, Kurdistan region, Iraq. An echocardiographic assessment of 61 beta-thalassemia intermedia cases was performed. It included 30 males and 31 females, with a mean age 19.6 ± 7.5 years. The standard echostudy of two-dimension and M-mode measurements of cardiac chambers were done. The continuous doppler regurgitant jet of tricuspid and pulmonary valves were recorded. Left ventricle diastolic function was assessed by pulsed doppler of mitral valve inflow. To correlate the clinical with echocardiographic findings, patients were divided, according to tricuspid regurgitant velocity, into three groups (intermedia patients. Therapeutic trails targeting these complications are indicated, and echocardiographic assessment is necessary to be offered early for thalassemia intermedia.

The importance of studying inherited hematological disorders in ancient Anatolian populations

Directory of Open Access Journals (Sweden)

Yeşim Doğan Alakoç

2011-12-01

Full Text Available Before analysis of DNA from ancient remains was possible, anthropologists studied evolution and migration patterns using data obtained from population genetic studies on modern populations combined with data obtained from morphological evaluations of ancient remains. Currently, DNA analysis of ancient populations is making a valuable contribution to these efforts. Researchers that perform ancient DNA analysis prefer to study polymorphisms on the Y chromosome or mitochondrial DNA because the results are easier to statistically evaluate. To evaluate polymorphisms on diploid genomes, which are more informative, only mutations that have been extensively examined in modern populations should be chosen. The most extensively evaluated mutations are those related to prevalent inherited disorders. As such, beta-thalassemia, sickle cell anemia, FVL mutation of globin and the factor V genes are good candidates for DNA studies in ancient populations. These mutations are common in Anatolia, host to many civilizations since the Paleolithic period. This history makes Anatolia a good place for conducting research that could enhance our understanding of human evolution and migration patterns.

Multiple transfused thalassemia major: Ocular manifestations in a hospital-based population

Directory of Open Access Journals (Sweden)

Taneja Rashi

2010-01-01

Full Text Available Purpose: To study the ocular manifestations in multiple transfused beta-thalassemia major patients and assess the ocular side-effects of iron chelating agents. Materials and Methods: In this prospective observational study, 45 multiple transfused beta-thalassemia major children between six months and 21 years of age were enrolled and assigned groups according to the treatment regimens suggested. Group A received only blood transfusions, Group B blood transfusions with subcutaneous desferrioxamine, Group C blood transfusions with desferrioxamine and oral deferriprone and Group D blood transfusions with deferriprone. Ocular status at the time of enrolment was documented. Subjects were observed quarterly for one year for changes in ocular status arising due to the disease process and due to iron chelation therapy. Children with hemoglobinopathies other than beta-thalassemia major, congenital ocular anomalies and anemia due to other causes were excluded. Results: Ocular involvement was observed in 58% of patients. Lenticular opacities were the most common ocular finding (44%, followed by decreased visual acuity (33%. An increased occurrence of ocular changes was observed with increase of serum ferritin and serum iron levels as well as with higher number of blood transfusions received. Desferrioxamine seemed to have a protective influence on retinal pigment epithelium (RPE mottling. Occurrence of lenticular opacities and RPE degeneration correlated positively with use of desferrioxamine and deferriprone respectively. Follow-up of patients for one year did not reveal any change in ocular status. Conclusion: Regular ocular examinations can aid in preventing, delaying or ameliorating the ocular complications of thalassemia.

A new valid formula in differentiating iron deficiency Anemia from beta-thalassemia trait

International Nuclear Information System (INIS)

Keikhaei, B.

2010-01-01

Objective: To compare the validity of a new index (Hb X RDW X 100/ (RBC)/sup 2/ X MCHC) with twelve discriminating functions (DFs) to differentiate iron deficiency anemia (IDA) and beta-thalassemia trait (beta-TT). Methodology: A total of 823 patients (317 IDA and 506 beta-TT) aged 15 to 35 year old were enrolled in this study. The diagnostic sensitivity, specificity and other validity parameters were calculated to assess the diagnostic reliability of the novel index [Keikhaei index (KI)] vis-a-vis the other published DFs [Mentzer Index (MI), Green and King Index (G and KI), red cell distribution width index (RDWI), England and Fraser Index (E and FI), Bessman and Feinstein index (B and FI), Telmissani et al index (TI), Srivastava and Bevington index (S and BI), Shine and Lal index (S and LI), Ricerca et al index (RI), Ehsani et al index (EI), Sirdah et al index (SI), and Red Blood Cell Count(RBC)] were calculated in all patients. Results: All thirteen DFs did not have the sensitivity and specificity of 100%. The KI, RDWI, Gand KI and E and FI showed the most sensitivity and specificity for both IDA and TT; moreover, the lowest reliable indices belonged to B and FI, SandLI and RI. Conclusion: According to Youden's index (YI), DFs in the order of highest to lowest were KI > G and KI > RDWI > E and FI > RBC> M I> EI > TI > SI > S and BI > RI> SandLI >B and FI. (author)

Hydroxyurea as a first-line treatment of extramedullary hematopoiesis in patients with beta thalassemia: Four case reports.

Science.gov (United States)

Karimi, Mehran; Cohan, Nader; Pishdad, Parisa

2015-01-01

Extramedullary hematopoiesis (EMH) is evidenced by erythropoietic masses, which occurs as a compensatory mechanism to overcome hypoxia during chronic anemia. EMH masses in spinal cord could lead to cord compression and neurological symptoms. Besides transfusion, radiotherapy, and surgery, hydroxyurea (HU) is also a treatment strategy in EMH. We described four cases of beta thalassemia with EMH who were treated with HU as a monotherapy. INTERVENTION (AND TECHNIQUE): HU therapy was done in all patients without any transfusion during therapy. HU is a good treatment option for patients with EMH and it could be a substitute for radiotherapy and invasive surgery or regular blood transfusion.

The pancreas in β-thalassemia major: MR imaging features and correlation with iron stores and glucose disturbunces

International Nuclear Information System (INIS)

Papakonstantinou, Olympia; Ladis, Vasilios; Kostaridou, Stavroula; Berdousi, Helen; Kattamis, Christos; Maris, Thomas; Gourtsoyiannis, Nicholas

2007-01-01

The study aims at describing the MR features of pancreas in beta-thalassemia major, investigating the relations between MR findings and glucose disturbances and between hepatic and pancreatic siderosis. Signal intensity ratios of the pancreas and liver to right paraspinous muscle (P/M, L/M) were retrospectively assessed on abdominal MR imaging studies of 31 transfusion-dependent patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 10 healthy controls, using T1- (120/4/90), intermediate in and out of phase - (120/2.7, 4/20), and T2*-(120/15/20) weighted GRE sequences. Using the signal drop of the liver and pancreas on opposed phase images, we recorded serum ferritin and results of oral glucose tolerance test (OGTT). Decreased L/M and P/M on at least the T2* sequence were noticed in 31/31 and 30/31 patients, respectively, but no correlation between P/M and L/M was found. Patients with pathologic OGTT displayed a higher degree of hepatic siderosis (p < 0.04) and signal drop of pancreas on opposed phase imaging (p < 0.025), implying fatty replacement of pancreas. P/M was neither correlated with glucose disturbances nor serum ferritin. Iron deposition in the pancreas cannot be predicted by the degree of hepatic siderosis in beta-thalassemia major. Fatty replacement of the pancreas is common and may be associated with glucose disturbances. (orig.)

Clinical and molecular genetic features of Hb H and AE Bart's diseases in central Thai children.

Science.gov (United States)

Traivaree, Chanchai; Boonyawat, Boonchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Photia, Apichat

2018-01-01

α-Thalassemia, one of the major thalassemia types in Thailand, is caused by either deletion or non-deletional mutation of one or both α-globin genes. Inactivation of three α-globin genes causes hemoglobin H (Hb H) disease, and the combination of Hb H disease with heterozygous hemoglobin E (Hb E) results in AE Bart's disease. This study aimed to characterize the clinical and hematological manifestations of 76 pediatric patients with Hb H and AE Bart's diseases treated at Phramongkutklao Hospital, a tertiary care center for thalassemia patients in central Thailand. Seventy-six unrelated pediatric patients, 58 patients with Hb H disease and 18 patients with AE Bart's disease, were enrolled in this study. Their clinical presentations, transfusion requirement, laboratory findings, and mutation analysis were retrospectively reviewed and analyzed. A total of 76 pediatric patients with Hb H and AE Bart's diseases who mainly lived in central Thailand were included in this study. The clinical severities of patients with non-deletional mutations were more severe than those with deletional mutations. Eighty-six percent of patients with non-deletional AE Bart's disease required more blood transfusion compared to 12.5% of patients with deletional AE Bart's disease. Non-deletional AE Bart's disease also had a history of urgent blood transfusion with the average of 6±0.9 times compared to 1±0.3 times in patients with deletional Hb H disease. The difference was statistically significant. This study revealed the differences in clinical spectrum between patients with Hb H disease and those with AE Bart's disease in central Thailand. The differentiation of α-thalassemia is essential for appropriate management of patients. The molecular diagnosis is useful for diagnostic confirmation and genotype-phenotype correlation.

Structural analysis of the 5' flanking region of the β-globin gene in African sickle cell anemia patients: Further evidence for three origins of the sickle cell mutation in Africa

International Nuclear Information System (INIS)

Chebloune, Y.; Pagnier, J.; Trabuchet, G.; Faure, C.; Verdier, G.; Labie, D.; Nigon, V.

1988-01-01

Haplotype analysis of the β-globin gene cluster shows two regions of DNA characterized by nonrandom association of restriction site polymorphisms. These regions are separated by a variable segment containing the repeated sequences (ATTTT) n and (AT) x T y , which might be involved in recombinational events. Studies of haplotypes linked to the sickle cell gene in Africa provide strong argument for three origins of the mutation: Benin, Senegal, and the Central African Republic. The structure of the variable segment in the three African populations was studied by S1 nuclease mapping of genomic DNA, which allows a comparison of several samples. A 1080-base-pair DNA segment was sequenced for one sample from each population. S1 nuclease mapping confirmed the homogeneity of each population with regard to both (ATTTT) n and (AT) x T y repeats. The authors found three additional structures for (AT) x T y correlating with the geographic origin of the patients. Ten other nucleotide positions, 5' and 3' to the (AT) x T y copies, were found to be variable when compared to homologous sequences from human and monkey DNAs. These results allow us to propose an evolutionary scheme for the polymorphisms in the 5' flanking region of the β-globin gene. The results strongly support the hypothesis of three origins for the sickle mutation in Africa

Study on molecular epidemiology of the alpha-thalassemias in Liuzhou City, Guangxi Autonomous Region, China.

Science.gov (United States)

Cai, Ren; Liu, Jingzhong; Wang, Lirong; Liang, Xin; Xiao, Bai; Su, Liu; Zhou, Yan; Pan, Lizhen

2004-01-01

Guangxi is one of the provinces of Southern China with the highest incidence of alpha-thalassemia (thal). Liuzhou is the second biggest city in Guangxi. To find out the incidence of the various alpha-thal genotypes, and their distribution in the Liuzhou area, an F820 Blood Cell Analysis System was used to measure the parameters of red blood cells. A SPIFE Rapid Auto-Electrophoresis System was used to analyze the normal and abnormal hemoglobins (Hbs). Multiplex polymerase chain reaction (mPCR) was used to detect the alpha-globin genotypes. Thirty-two (2.05%) out of 7805 young couples undergoing pre-marriage counseling, were diagnosed as having an Hb H (beta4) disease. The study of 1228 cord blood samples revealed 138 newborn children carrying an alpha-thal determinant with nine different genotypes, thus making the total incidence of alpha-thal 11.24%. Among 185 cases of Hb H, 119 (64.1%) were confirmed as being deletional, and 66 cases (35.7%) nondeletional types. The severity of the Hb H diseases could be classified in the following order: alphaCSalpha/--SEA (alphaConstant (Spring)alpha/--Southeast Asia); alpha(-4.2)/--SEA; alpha(-3.7)/--SEA. Ten cases of alpha-thal determinants were found in combination with beta-thal. The mPCR technique can detect all kinds of combinations of the three common large deletions (--SEA, alpha(-4.2) and alpha(-3.7)) accurately and conveniently.

Endocrine dysfunction and growth retardation assessment in children with beta -thalassemia major

International Nuclear Information System (INIS)

Noureldin, A.M.; Ahmed, A.M.

2002-01-01

Children suffering from beta-thalassemia major are reported to have endocrine abnormalities and growth retardation. This study was carried out to study the cause of their growth retardation and determine the extent and rate of endocrine complications. Twenty beta-thalassemic major pubertal children, with mean baemoglobin and ferritin concentration of 8.8±0.6 and 3.597± 1.931, respectively, and twenty pubertal control children were used in the study. The anthropometric measurements that carried out revealed significant low growth rate in patient groups in comparison with control. Patients divided into two groups; I) D-thal with delayed growth and II) S-thal with stunted growth. Basal serum thyoid hormones (T 3 and T 4 ) and thyroid stimulating hormone (TSH) were measured in patient groups and control group. T 3 showed highly significant decrease (P 4 showed non-significant change and TSH showed highly significant increase (P<0.001). Serum growth hormone showed significant lower concentrations in patient groups with values of 2.163±0.9 ng/ml, (P<0.01) and 1.832±1.9ng/ml, (P<0.01) for delayed growth thalassemic group (D-thal) and stunted growth thalassemic group (S-thal), respectively. Serum concentration of insulin growth factor-1 (IGF-1) hormone was studied. D-thal and S-thal had significant lower basal IGF-1 concentrationsof-58.44% (P<0.001) for D-thal and -64.37%, (P<0.001) for S-thal

The Prevention of Thalassemia

Science.gov (United States)

Cao, Antonio; Kan, Yuet Wai

2013-01-01

The thalassemias are among the most common inherited diseases worldwide, affecting individuals originating from the Mediterranean area, Middle East, Transcaucasia, Central Asia, Indian subcontinent, and Southeast Asia. As the diseases require long-term care, prevention of the homozygous state constitutes a major armament in the management. This article discusses the major prevention programs that are set up in many countries in Europe, Asia, and Australia, often drawing from the experience in Sardinia. These comprehensive programs involve carrier detections, molecular diagnostics, genetic counseling, and prenatal diagnosis. Variability of clinical severity can be attributable to interactions with α-thalassemia and mutations that increase fetal productions. Special methods taht are currently quite expensive and not widely applicable are preimplantation and preconception diagnosis. The recent successful studies of fetal DNA in maternal plasma may allow future prenatal diagnosis that is noninvasive for the fetus. PMID:23378598

Consanguinity Ratio in Beta-Thalassemia Major Patients in District Bannu

International Nuclear Information System (INIS)

Khan, M. S.; Ahmed, M.; Khan, R. A.; Mushtaq, N.; Shah, M. W. U.

2015-01-01

Objective: To assess the frequency of consanguinity in b-thalassemia major patients and its association with age, gender and hepatitis C virus antibody positivity. Methods: The cross-sectional study was conducted from June 2013 to July 2014 at various hospitals of district Bannu in the North Western Khyber Pakhtunkhwa province of Pakistan. Data was recorded on a predesigned questionnaire. Results: Out of 180 subjects, 133(74 percent) parents were cousins, while 47(26 percent) were unrelated. The frequency of anti-hepatitis C virus antibody positivity was 14(7.77 percent). Conclusion: High prevalence of the disease in the study region was due to consanguineous marriages. (author)

Molecular Diagnostics of ?-Thalassemia

OpenAIRE

Atanasovska, B; Bozhinovski, G; Chakalova, L; Kocheva, S; Karanfilski, O; Plaseska-Karanfiska, D

2012-01-01

A high-quality hemoglobinopathy diagnosis is based on the results of a number of tests including assays for molecular identification of causative mutations. We describe the current diagnostic strategy for the identification of ?-thalassemias and hemoglobin (Hb) variants at the International Reference Laboratory for Haemoglobinopathies, Research Centre for Genetic Engineering and Biotechnology (RCGEB) ?Georgi D. Efremov,? Skopje, Republic of Macedonia. Our overall approach and most of the meth...

Pathogenesis of chronic rhinosinusitis in patients affected by β-thalassemia major and sickle cell anaemia post allogenic bone marrow transplant.

Science.gov (United States)

Martino, F; Di Mauro, R; Paciaroni, K; Gaziev, J; Alfieri, C; Greco, L; Floris, R; Di Girolamo, S; Di Girolamo, M

2018-03-01

Sickle cell anemia (SCA) and β -thalassemia major are well-recognized beta-globin gene disorders of red blood cells associated to mortality and morbidity included bone morbidities due to ineffective erythropoiesis and bone marrow expansion, which affect every part of the skeleton. While there are an abundance of described disease manifestations of the head and neck, the manner of paranasal sinuses involvement and its relations to β-thalassemia and SCA process was not studied yet. Therefore, the aim of this study was to investigate a possible increased risk of rhinosinusitis and the real pathogenetic mechanism of it, comparing these two hematological diseases using msCT, gold standard for paranasal sinuses evaluation. A retrospective analysis of 90 patients affected by β-thalassemia major or SCA (respectively 59 and 31) underwent allogeneic bone marrow transplantation (BMT), and 44 control subjects was performed. Both patient categories and control group have been subjected to hematological and radiological evaluation using 64-multidetector-row CT scanner without contrast injection. Statistical analysis reveals that patients of the two study groups exhibit a significantly increased risk of sinusitis in comparison with the normal controls (RR: 3.55 for β-thalassemic pediatric subjects; RR: 3.35 for SCA pediatric subjects). A significant difference (p < 0,5) was found between the β -thalassemic patients on the one side, and SCA and control group on the other side, with regard to the evaluation of the typical anatomic alteration of maxillary sinus: β-thalassemic children had significant increase in the bone thickness of anterior and lateral sinus walls and significant reduction in volume and density compared to SCA patients and control group, with normal conditions of these parameters. In these hematological patients, there is an increased incidence of sinonasal infections due their therapy-induced immunosuppression post transplantation. In �

Factors associated with continuing emergence of β-thalassemia major despite prenatal testing: a cross-sectional survey

Directory of Open Access Journals (Sweden)

Al Sabbah H

2017-09-01

Full Text Available Haleama Al Sabbah,1 Sarah Khan,1 Abdallah Hamadna,2 Lamia Abu Ghazaleh,2 Anwar Dudin,2 Bashar Adnan Karmi3 1College of Natural and Health Sciences, Zayed University, Dubai, UAE; 2Faculty of Medicine, An-Najah National University, Nablus, Palestine; 3Thalassemia Patients’ Friends Society, Ramallah, Palestine Purpose: Health care initiatives focusing on prenatal testing and premarital genetic screening aiming to reduce the incidence of β-thalassemia have emerged during the last decade. In Palestine, 4% of the population are known thalassemia carriers with new cases continuing to appear despite the availability of prenatal testing. This study aims to identify factors that influence the decision to retain or abort fetuses affected by β-thalassemia in Palestine. Methods: Convenience sampling was used to select 32 women (72 fetuses who were at risk of having a baby with β-thalassemia. A questionnaire on prenatal testing, test results, pregnancy outcomes, and factors influencing the decision to terminate the pregnancy were used for this cross-sectional study. The data were analyzed using SPSS version 17. Results: Among the fetuses screened, 36 (50% were thalassemia carriers and 20 (28% had β-thalassemia; 17 (85% affected fetuses were aborted. Religious beliefs were the most cited reason for opposing abortion while prior experience with β-thalassemia patients and awareness programs promoted abortions. Mothers who opted to retain an affected fetus had modest educational attainment. Higher educational level was significantly associated with the decision to abort an affected fetus (p<0.05. Conclusion: A religious consensus is needed on the abortion of fetuses affected by β-thalassemia. Improving female education and increasing awareness on thalassemia could help reduce the incidence of β-thalassemia in Palestine and around the world. Keywords: abortion, Islam, fetus, awareness

Biochemical and Molecular Analysis of the Hb Lepore Boston Washington in a Syrian Homozygous Child

Directory of Open Access Journals (Sweden)

Monica Pirastru

2017-01-01

Full Text Available Hemoglobin (Hb Lepore is composed of two normal α chains and two δβ fusion globins that arise from unequal crossover events between the δ- and β-globin genes. The Hb Lepore is widespread all over the world and in many ethnic groups. It includes some of the few clinically significant Hb variants that are associated with a β-thalassemia phenotype. Here, we describe the first occurrence of Hb Lepore Boston Washington in a Syrian individual. The patient, a 10-year-old child, shows severe anemia with a Hb level of 6.85 g/dL and typical thalassemic red cell indices. The diagnostic procedure implies hematological, biochemical, and molecular analysis, including multiplex ligation-dependent probe amplification (MLPA assay, GAP-PCR, and DNA sequencing. This latter allowed us to define the correct structure of the hybrid δβ-globin gene. The knowledge of the spectrum of mutations associated with different geographical areas is the prerequisite to set up large-scale screening programs and be able to offer genetic counseling to couples at risk.

An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

International Nuclear Information System (INIS)

Evans, T.; Reitman, M.; Felsenfeld, G.

1988-01-01

The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

BENIGN EPITHELIAL NEOPLASIA ASSOCIATED WITH BETA-HUMAN PAPILLOMA VIRUS

Directory of Open Access Journals (Sweden)

V. A. Molochkov

2014-01-01

Full Text Available Aim: To study an association between acrochordon and human papilloma virus (HPV using quantitative analysis of viral desoxyribonucleic acid (DNA; to detect different phenotypes of beta-HPV. Materials and methods: We examined 52  patients (22 immuno-suppressed patients and 30 immunocompetent subjects in the Dermatovenereology and Dermato-Oncology Department and Chronic Dialysis and Kidney Transplantation Department of the Moscow Regional Research and Clinical Institute (MONIKI. Control group included 49 healthy donors. Burr biopsy samples (micro-samples of acrochordon and intact skin (apper arm were collected in sterile conditions. After sample procession and DNA isolation using DNK-sorb-C kit (Central Research Institute for Epidemiology – CRIE, polymerase chain reaction for HPV was performed with real-time fluorescent hybridization detection. For DNA amplification and detection we used RotorGene 3000 analyzer (Corbett Research, Australia. In the beta-HPV assay, recombinant plasmids were used as positive controls and control human beta-globin gene fragments (CRIE. 4 oligo-nucleotide systems (group-specific primers and probes were used for the detection of beta-HPV DNA. Results: Preliminary data indicated that acrochordons of open and covered skin regions were common in renal transplant recipients. Beta-HPV DNA was more frequent in acrochordons and intact skin (64% and 54% of renal transplant recipients compared to healthy donors (47%. 57% of renal transplant recipients demonstrated mixed infection in acrochordons. Conclusion: HPV DNA was frequently detected in acrochordons and intact skin of renal transplant recipients. In immunocompetent patients prevalence of HPV DNA in acrochordons was significantly higher compared to intact skin.

Adrenal glands in beta-thalassemia major: magnetic resonance (MR) imaging features and correlation with iron stores

International Nuclear Information System (INIS)

Drakonaki, Eleni; Papakonstantinou, Olympia; Maris, Thomas; Gourtsoyiannis, Nicholas; Vasiliadou, Artemis; Papadakis, Alex

2005-01-01

This study aimed at describing the magnetic resonance (MR) imaging features of the adrenal glands in beta-thalassemic patients and at investigating the relation between adrenal and hepatic siderosis. Adrenal signal intensity (SI) was retrospectively assessed on abdominal MR studies of 35 patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 12 healthy controls, using T1- (120/4/90), intermediate - (120/4/20), and T2*- (120/15/20) weighted GRE sequences. Adrenal SI was graded as grade 0 (normal SI on all sequences), grade 1 (hypointensity on T2* alone), or grade 2 (hypointensity on at least T2*). Adrenal size was measured in the thalassemic patients and compared with normative data. Liver-to-muscle (L/M) SI ratios, expressing hepatic siderosis, were estimated on each sequence. Serum ferritin levels were recorded. Adrenal hypointensity (grades 1 and 2) was noted in 24/35 (68.6%) patients. L/M ratios correlated significantly with adrenal SI in all sequences. Patients with grade 1 and grade 2 adrenal SI had significantly decreased L/M ratios compared with grade 0. Serum ferritin correlated significantly with L/M values but not with adrenal SI. Adrenal size was within normal limits. Diffuse hypointensity in normal-sized adrenals is a common MR finding in beta-thalassemic patients and correlates with the degree of hepatic siderosis. (orig.)

Adrenal glands in beta-thalassemia major: magnetic resonance (MR) imaging features and correlation with iron stores

Energy Technology Data Exchange (ETDEWEB)

Drakonaki, Eleni; Papakonstantinou, Olympia; Maris, Thomas; Gourtsoyiannis, Nicholas [University Hospital of Heraklion, Department of Radiology, Heraklion (Greece); Vasiliadou, Artemis [Aghios Georgios Hospital of Chania, Thalassemia Unit, Chania (Greece); Papadakis, Alex [Venizelion Hospital of Heraklion, Thalassemia Unit, Heraklion (Greece)

2005-12-01

This study aimed at describing the magnetic resonance (MR) imaging features of the adrenal glands in beta-thalassemic patients and at investigating the relation between adrenal and hepatic siderosis. Adrenal signal intensity (SI) was retrospectively assessed on abdominal MR studies of 35 patients with beta-thalassemia major undergoing quantification of hepatic siderosis and 12 healthy controls, using T1- (120/4/90), intermediate - (120/4/20), and T2*- (120/15/20) weighted GRE sequences. Adrenal SI was graded as grade 0 (normal SI on all sequences), grade 1 (hypointensity on T2* alone), or grade 2 (hypointensity on at least T2*). Adrenal size was measured in the thalassemic patients and compared with normative data. Liver-to-muscle (L/M) SI ratios, expressing hepatic siderosis, were estimated on each sequence. Serum ferritin levels were recorded. Adrenal hypointensity (grades 1 and 2) was noted in 24/35 (68.6%) patients. L/M ratios correlated significantly with adrenal SI in all sequences. Patients with grade 1 and grade 2 adrenal SI had significantly decreased L/M ratios compared with grade 0. Serum ferritin correlated significantly with L/M values but not with adrenal SI. Adrenal size was within normal limits. Diffuse hypointensity in normal-sized adrenals is a common MR finding in beta-thalassemic patients and correlates with the degree of hepatic siderosis. (orig.)

Hemoglobin Q-Thailand and its combinations with other forms of thalassemia or hemoglobinopathies in northern Thailand.

Science.gov (United States)

Panyasai, Sitthichai; Pornprasert, Sakorn

2014-01-01

There have been no reports for the frequency of Hb Q-Thailand [alpha 74(EF3)Asp --> His, GAC > CAC] and its combinations either with other forms of thalassemia or hemoglobinopathies in Northern Thailand. The aims of this study were to search for Hb Q-Thailand and its combinations in Northern Thai population and to analyze fractions of hemoglobin in Hb Q-Thailand and its combinations on high performance liquid chromatography (HPLC) chromatograms and/or capillary electrophoresis (CE) electrophoregrams. Blood samples from public and private hospitals in 7 northern provinces of Thailand were analyzed for thalassemia and hemoglobinopathy diagnoses using HPLC and/or CE and DNA analysis techniques at the Thalassemia Laboratory, Associated Medical Sciences Clinical Service Center, Chiang Mai, Thailand. Hb Q-Thailand was found in 13 of 13,596 (0.10%) samples; 6 were heterozygous Hb Q-Thailand, 4 were compound Hb Q-Thailand/alpha-thalassemia-1 Southeast Asian (SEA) type deletion and 3 with combinations of Hb Q-Thailand/beta(0)-thalassemia, Hb Q-Thailand/Hb E and Hb Q-Thailand/Hb E/alpha-thalassemia-1 SEA type deletion. The fractions of hemoglobin on HPLC chromatograms and CE electrophoregrams were observed based on types of combinations. Hb Q-Thailand and its combinations could be found in northern Thai population with the frequency of 0.10%. Thus, the better understanding of HPLC chromatogram and/or CE electrophoregram patterns of Hb Q-Thailand and its combination is essential for diagnosis and genetic counseling of thalassemia and hemoglobinopathies in this area.

Distribuição das mutações da β-talassemia em Fortaleza, Ceará Distribution of β-thalassemia mutations in Fortaleza, Ceará

Directory of Open Access Journals (Sweden)

Lilianne Brito da Silva Rocha

2010-12-01

Full Text Available INTRODUÇÃO: As mutações IVS-I-1, IVS-I-6 e CD 39 foram estudadas em 14 pacientes portadores de β-talassemia, da população de Fortaleza, capital do Ceará. OBJETIVO: Fornecer informações sobre a caracterização molecular dos pacientes β-talassêmicos de Fortaleza, contribuindo para traçar o perfil das mutações desta hemoglobinopatia na região Nordeste e no Brasil. MÉTODOS: A β-talassemia foi diagnosticada pelo estudo hematológico realizado no contador automático de células sanguíneas, com revisão de lâminas, pelo teste de resistência globular osmótica em NaCl a 0,36% e pela eletroforese em pH alcalino em fitas de acetato de celulose. O DNA foi isolado de leucócitos a partir de amostras de sangue total. A análise das mutações foi realizada por meio da técnica da reação em cadeia mediada pela polimerase alelo-específica (PCR-AE, sendo analisadas as mutações CD 39, IVSI-1, IVSI-6 e IVSI-110 seguindo-se o protocolo do Laboratório de Hemoglobinas e Genética das Doenças Hematológicas (LHGDH da Universidade Estadual Paulista (UNESP. RESULTADOS: A distribuição das mutações identificadas foi: IVS-I-1 (14,3%, IVS-I-6 (35,7% e CD 39 (21,4%. Os demais talassêmicos (28,6% não apresentaram nenhuma das mutações estudadas. A maior frequência da mutação IVS-I-6 está conforme o esperado, uma vez que estudos demonstram que esta mutação está mais presente na região Nordeste, assim como a mutação IVS-I-1 na região Sul e a IVSI-110 e CD39 na região Sudeste do país. CONCLUSÃO: Esses resultados demonstram o perfil das mutações da β-talassemia na região Nordeste, contribuindo, assim, para o estudo da distribuição destas mutações no Brasil.INTRODUCTION: IVS-I-1, IVS-I-6 and CD 39 mutations were studied in 14 patients with β-thalassemia from the population of Fortaleza, capital of Ceará. OBJECTIVE: To provide information on the molecular characterization of β-thalassemia patients from Fortaleza, aiding

Gene Therapy Approaches to Hemoglobinopathies.

Science.gov (United States)

Ferrari, Giuliana; Cavazzana, Marina; Mavilio, Fulvio

2017-10-01

Gene therapy for hemoglobinopathies is currently based on transplantation of autologous hematopoietic stem cells genetically modified with a lentiviral vector expressing a globin gene under the control of globin transcriptional regulatory elements. Preclinical and early clinical studies showed the safety and potential efficacy of this therapeutic approach as well as the hurdles still limiting its general application. In addition, for both beta-thalassemia and sickle cell disease, an altered bone marrow microenvironment reduces the efficiency of stem cell harvesting as well as engraftment. These hurdles need be addressed for gene therapy for hemoglobinopathies to become a clinical reality. Copyright © 2017 Elsevier Inc. All rights reserved.

Orthodontic Consideration in Patients with Beta-Thalassemia Major: Case Report and Literature Review.

Science.gov (United States)

Einy, Shmuel; Hazan-Molina, Hagai; Ben-Barak, Ayelet; Aizenbud, Dror

Beta Thalassemia (βT) patients present a unique facial appearance and specific craniofacial, jaw and dental patterns. Although this anomaly often requires orthodontic management, βT patients have received scant attention in the orthodontic and dental literature over the past 50 years. The aim of this article is to review the characteristic craniofacial and dental manifestation pattern of βT patients and to emphasize their preferred orthodontic management protocol by presenting a βT orthodontic treated patient. A 10 year old patient presented with a complaint of severe esthetic and functional disorders due to her diagnosis of βT. We initiated orthodontic treatment including a combined orthopedic and functional treatment modality to improve facial appearance. Maxillary restraint and increased mandibular size during treatment along with an increase in the vertical dimension were achieved. The patient presented with Angle class I molar relationship, with reduction of the excessive overjet and deep overbite. Orthodontic treatment comprised of maxillary orthopedic treatment directed especially toward premaxilla with light forces, and mandibular modification by functional appliance along with fixed orthodontic treatment is recommended in βT patients.

Nonsense-mediated decay mechanism is a possible modifying factor of clinical outcome in nonsense cd39 beta thalassemia genotype

Directory of Open Access Journals (Sweden)

Maria Concetta Renda

2012-11-01

Full Text Available Nonsense-mediated mRNA decay (NMD is a surveillance system to prevent the synthesis of non-functional proteins. In β-thalassemia, NMD may have a role in clinical outcome. An example of premature translation stop codons appearing for the first time is the β-globin cd39 mutation; when homozygous, this results in a severe phenotype. The aim of this study was to determine whether the homozygous nonsense cd39 may have a milder phenotype in comparison with IVS1,nt110/cd39 genotype. Genotypes have been identified from a cohort of 568 patients affected by β-thalassemia. These genotypes were compared with those found in 577 affected fetuses detected among 2292 prenatal diagnoses. The nine most common genotypes, each with an incidence rate of 1.5% or over, and together accounting for 80% of genotype frequencies, underwent statistical analysis. Genotype prevalence was calculated within the overall group. Results are expressed as proportions with 95% confidence intervals; P≤0.05 was considered statistically significant. A binomial distribution was assumed for each group; z-tests were used to compare genotype frequencies observed in the patient group with frequencies in the affected fetus group. In the absence of selecting factors, prevalence of these two genotypes was compared between a cohort of 568 β-thalassemia patients (PTS and 577 affected fetuses (FOET detected during the same period. IVS1,nt110/cd39 was significantly more prevalent in FOET than PTS (P<0.0001, while there was no significant difference in prevalence of cd39/cd39 in FOET compared with PTS (P=0.524. These results suggest a cd39 genotype NMD mechanism may be associated with improved clinical outcomes in thalassemia major. 无义介导的mRNA 降解（NMD） 是一种预防非功能性蛋白质合成的监控系统。在β地中海贫血中，NMD可能对临床结果有影响。第一次出现的过早终止密码子（PTC）为β珠蛋白cd39�

S1 nuclease analysis of α-globin gene expression in preleukemic patients with acquired hemoglobin H disease after transfer to mouse erythroleukemia cells

International Nuclear Information System (INIS)

Helder, J.; Deisseroth, A.

1987-01-01

The loss of α-globin gene transcriptional activity rarely occurs as an acquired abnormality during the evolution of myeloproliferative disease or preleukemia. To test whether the mutation responsible for the loss of α-globin gene expression (hemoglobin H disease) in these patients is linked with the α-globin genes on chromosome 16, the authors transferred chromosome 16 from preleukemic patients with acquired hemoglobin H disease to mouse erythroleukemia cells and measured the transcriptional activity of the human α-globin genes. After transfer to mouse erythroleukemia cells, the expression of human α-globin genes from the peripheral blood or marrow cells of preleukemic patients with acquired hemoglobin H disease was similar to that of human α-globin genes transferred to mouse erythroleukemia cells from normal donors. These data showed that factor(s) in the mouse erythroleukemia cell can genetically complement the α-globin gene defect in these preleukemia patients with acquired hemoglobin H disease and suggest that altered expression of a gene in trans to the α-globin gene may be responsible for the acquisition of hemoglobin H disease in these patients

Thalassemia

Science.gov (United States)

... Mediterranean (Greek, Italian and Middle Eastern), Asian, or African descent. Diagnosis & Tests How is thalassemia diagnosed? If your doctor thinks you or your child might have thalassemia, he’ll do a physical ...

Risk of Erectile Dysfunction in Transfusion-naive Thalassemia Men

Science.gov (United States)

Chen, Yu-Guang; Lin, Te-Yu; Lin, Cheng-Li; Dai, Ming-Shen; Ho, Ching-Liang; Kao, Chia-Hung

2015-01-01

Abstract Based on the mechanism of pathophysiology, thalassemia major or transfusion-dependent thalassemia patients may have an increased risk of developing organic erectile dysfunction resulting from hypogonadism. However, there have been few studies investigating the association between erectile dysfunction and transfusion-naive thalassemia populations. We constructed a population-based cohort study to elucidate the association between transfusion-naive thalassemia populations and organic erectile dysfunction This nationwide population-based cohort study involved analyzing data from 1998 to 2010 obtained from the Taiwanese National Health Insurance Research Database, with a follow-up period extending to the end of 2011. We identified men with transfusion-naive thalassemia and selected a comparison cohort that was frequency-matched with these according to age, and year of diagnosis thalassemia at a ratio of 1 thalassemia man to 4 control men. We analyzed the risks for transfusion-naive thalassemia men and organic erectile dysfunction by using Cox proportional hazards regression models. In this study, 588 transfusion-naive thalassemia men and 2337 controls were included. Total 12 patients were identified within the thalassaemia group and 10 within the control group. The overall risks for developing organic erectile dysfunction were 4.56-fold in patients with transfusion-naive thalassemia men compared with the comparison cohort after we adjusted for age and comorbidities. Our long-term cohort study results showed that in transfusion-naive thalassemia men, there was a higher risk for the development of organic erectile dysfunction, particularly in those patients with comorbidities. PMID:25837766

Prevalence of anemia, iron deficiency, thalassemia and glucose-6-phosphate dehydrogenase deficiency among hill-tribe school children in Omkoi District, Chiang Mai Province, Thailand.

Science.gov (United States)

Yanola, Jintana; Kongpan, Chatpat; Pornprasert, Sakorn

2014-07-01

The prevalaence of anemia, iron deficiency, thalassemia and glucose-6-phosphate dehydrogenase (G-6-PD) deficiency were examined among 265 hill-tribe school children, 8-14 years of age, from Omkoi District, Chiang Mai Province, Thailand. Anemia was observed in 20 school children, of whom 3 had iron deficiency anemia. The prevalence of G-6-PD deficiency and β-thalassemia trait [codon 17 (A>T), IVSI-nt1 (G>T) and codons 71/72 (+A) mutations] was 4% and 8%, respectively. There was one Hb E trait, and no α-thalassemia-1 SEA or Thai type deletion. Furthermore, anemia was found to be associated with β-thalassemia trait in 11 children. These data can be useful for providing appropriate prevention and control of anemia in this region of Thailand.

SCREENING CORD BLOOD FOR HEMOGLOBINOPATHIES AND THALASSEMIA BY HPLC

NARCIS (Netherlands)

VANDERDIJS, FPL; VANDENBERG, GA; SCHERMER, JG; MUSKIET, FD; LANDMAN, H; MUSKIET, FAJ

We evaluated the use of an HPLC method for screening hemoglobins in cord blood. We studied the genotype frequencies of the structural hemoglobin variants HbS and HbC and the synthesis variants alpha- and beta+-thalassemia in babies born on Curacao. During three months, 67.2% of all (748) newborns

Oxidative status and serum PON1 activity in beta-thalassemia minor.

Science.gov (United States)

Selek, Sahbettin; Aslan, Mehmet; Horoz, Mehmet; Gur, Mustafa; Erel, Ozcan

2007-03-01

Paraoxonase-1 (PON1) deficiency is related to increased susceptibility to low density lipoprotein oxidation and development of atherosclerosis. The aim of this study was to investigate paraoxonase and arylesterase activities along with oxidative status parameters, and to find out if there is any increased susceptibility to atherogenesis, which might be reflected with increased oxidative stress and decreased serum PON1 activity in beta-thalassemia minor (BTM) subjects. Thirty-two subjects with BTM and 28 healthy subjects as control were enrolled in the study. Serum paraoxonase and arylesterase activities, lipid hydroperoxide (LOOH) levels, total antioxidant capacity (TAC), total oxidant status (TOS) and oxidative stress index (OSI) were determined. Serum TAC, paraoxonase and arylesterase activities were significantly lower in BTM subjects than controls (for all p<0.001), while TOS, LOOH levels and OSI were significantly higher (p<0.001, p<0.05 and p<0.001; respectively). In BTM subjects, OSI, TOS, LOOH levels and TAC were significantly correlated with serum paraoxonase (r=-0.245, p<0.05; r=-0.231, p<0.05; r=-0.264, p<0.05 and, r=0.342, p<0.05, respectively) and arylesterase activities (r=-0.332, p<0.05, r=-0.308, p<0.05; r=-0.320, p<0.05 and r=0.443, p<0.05). Additionally, hemoglobin level was also correlated with serum paraoxonase (r=0.501, p<0.001) and arylesterase activities (r=0.501, p<0.001), TAC (r=0.402, p<0.05), TOS (r=-0.274, p<0.05) and OSI (r=-0.352, p<0.05). Oxidative stress is increased, while serum PON1 activity is decreased in BTM subjects. Decrease in PON1 activity seems to be associated with both the degree of oxidative stress and anemia. BTM subjects may be more prone to development of atherogenesis due to low serum PON1 activity.

Thalassemia

Science.gov (United States)

Thalassemias are inherited blood disorders. If you have one, your body makes fewer healthy red blood cells ... oxygen to the body. That leads to anemia. Thalassemias occur most often among people of Italian, Greek, ...

Combining Single Strand Oligodeoxynucleotides and CRISPR/Cas9 to Correct Gene Mutations in β-Thalassemia-induced Pluripotent Stem Cells.

Science.gov (United States)

Niu, Xiaohua; He, Wenyin; Song, Bing; Ou, Zhanhui; Fan, Di; Chen, Yuchang; Fan, Yong; Sun, Xiaofang

2016-08-05

β-Thalassemia (β-Thal) is one of the most common genetic diseases in the world. The generation of patient-specific β-Thal-induced pluripotent stem cells (iPSCs), correction of the disease-causing mutations in those cells, and then differentiation into hematopoietic stem cells offers a new therapeutic strategy for this disease. Here, we designed a CRISPR/Cas9 to specifically target the Homo sapiens hemoglobin β (HBB) gene CD41/42(-CTTT) mutation. We demonstrated that the combination of single strand oligodeoxynucleotides with CRISPR/Cas9 was capable of correcting the HBB gene CD41/42 mutation in β-Thal iPSCs. After applying a correction-specific PCR assay to purify the corrected clones followed by sequencing to confirm mutation correction, we verified that the purified clones retained full pluripotency and exhibited normal karyotyping. Additionally, whole-exome sequencing showed that the mutation load to the exomes was minimal after CRISPR/Cas9 targeting. Furthermore, the corrected iPSCs were selected for erythroblast differentiation and restored the expression of HBB protein compared with the parental iPSCs. This method provides an efficient and safe strategy to correct the HBB gene mutation in β-Thal iPSCs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

A New Intergenic α-Globin Deletion (α-αΔ125) Found in a Kabyle Population.

Science.gov (United States)

Singh, Amrathlal Rabbind; Lacan, Philippe; Cadet, Estelle; Bignet, Patricia; Dumesnil, Cécile; Vannier, Jean-Pierre; Joly, Philippe; Rochette, Jacques

2016-01-01

We have identified a deletion of 125 bp (α-α(Δ125)) (NG_000006.1: g.37040_37164del) in the α-globin gene cluster in a Kabyle population. A combination of singlex and multiplex polymerase chain reaction (PCR)-based assays have been used to identify the molecular defect. Sequencing of the abnormal PCR amplification product revealed a novel α1-globin promoter deletion. The endpoints of the deletion were characterized by sequencing the deletion junctions of the mutated allele. The observed deletion was located 378 bp upstream of the α1-globin gene transcription initiation site and leaves the α2 gene intact. In some patients, the α-α(Δ125) deletion was shown to segregate with Hb S (HBB: c.20A>T) and/or Hb C (HBB: c.19G>A) or a β-thalassemic allele. The α-α(Δ125) deletion has no discernible effect on red cell indices when inherited with no other abnormal globin genes. The family study demonstrated that the deletion is heritable. This is the only example of an intergenic α2-α1 non coding DNA deletion, leaving the α2-globin gene and the α1 coding part intact.

Bone marrow changes in beta-thalassemia major: quantitative MR imaging findings and correlation with iron stores

Energy Technology Data Exchange (ETDEWEB)

Drakonaki, Eleni E.; Karantanas, Apostolos H. [University Hospital of Heraklion, Radiology Department, Heraklion, Crete (Greece); Maris, Thomas G. [University of Crete, Department of Medical Physics, Heraklion, Crete (Greece); Papadakis, Alex [Venizelion General Hospital, Heraklion, Crete (Greece)

2007-08-15

The purpose of this study is to describe the MR imaging features of bone marrow in beta-thalassemia major and investigate their relation to ferritin, liver and spleen siderosis. Spinal bone marrow was prospectively assessed on abdominal MR studies of 40 transfused beta-thalassemic patients and 15 controls using T1-w, Pd, T2*-w Gradient Echo (GRE) and T1-w turbo Spin Echo (TSE) sequences. Signal intensity (SI) ratios of liver, spleen and bone marrow to paraspinous muscles (L/M, S/M, B/M respectively) and the respective T2 relaxation rates (1/T2) were calculated. Serum ferritin levels were recorded. Bone marrow hypointensity in at least T2*-w GRE sequence was noted in 29/40 (72.5%) patients. Eleven/40 patients exhibited normal B/M on all MR sequences. Five/40 patients had normal B/M and low L/M. B/M correlated with L/M in T1-w TSE sequence only (r = 0.471, p = 0.05). B/M correlated with S/M and mean ferritin values in all sequences (r > 0.489, p < 0.01 and r > - 0.496, p < 0.03 respectively). Marrow 1/T2 did not correlate with ferritin values or liver and spleen 1/T2. B/M in transfused beta-thalassemic patients is related to splenic siderosis and ferritin levels. Although marrow is usually hypointense, it may occasionally display normal SI coexisting with liver hypointensity, a pattern typical of primary hemochromatosis. (orig.)

Bone marrow changes in beta-thalassemia major: quantitative MR imaging findings and correlation with iron stores

International Nuclear Information System (INIS)