WorldWideScience

Sample records for tgfbi gene caused

  1. Molecular Screening of Keratoconus Susceptibility Sequence Variants in VSX1, TGFBI, DOCK9, STK24, and IPO5 Genes in Polish Patients and Novel TGFBI Variant Identification.

    Science.gov (United States)

    Karolak, Justyna A; Polakowski, Piotr; Szaflik, Jerzy; Szaflik, Jacek P; Gajecka, Marzena

    2016-01-01

    Keratoconus (KTCN) is a degenerative disorder of the eye that results in the conical shape and thinning of the cornea and is a leading cause for corneal transplantations. A number of studies suggest that genetic factors play a role in KTCN etiology. Some candidate gene variants have recently been shown to be associated with KTCN. The purpose of our study was to verify the role of VSX1, TGFBI, DOCK9, IPO5, and STK24 sequence variants in Polish KTCN patients. Forty-two Polish patients with sporadic KTCN and 50 control individuals were enrolled into this study. Both affected and unaffected individuals underwent detailed ophthalmic examination. The mutations screening in the candidate genes was performed by the direct sequencing method. Analysis of VSX1, TGFBI, DOCK9, IPO5, and STK24 genes identified numerous sequence variants. Variants c.-264_-255delGGGGTGGGGT, c.627 + 23G > A, c.809-6_809-5insT, and c.*200G > T in the VSX1 gene, and heterozygous c.1598G > A mutation (Arg533Gln) in exon 12 of TGFBI were detected for the first time in KTCN patients. Two known sequence variants of TGFBI c.1620T > C (Phe540Phe) and c.1678 + 23G > A were observed in KTCN patients and control individuals. The newly reported c.717 + 43A > G substitution in intron 7 of DOCK9 was identified in both KTCN patients and healthy individuals. Our investigation showed that KTCN-related sequence variants of analyzed genes were found in a very small proportion of the studied patients indicating that genes other than VSX1, TGFBI, DOCK9, IPO5, and STK24 are involved in the development and progression of KTCN in Polish patients. Our results support the hypothesis about the genetic heterogeneity of KTCN.

  2. [Analyses of coding sequence point mutation and polymorphism of TGFBI gene in Chinese patients with keratoconus].

    Science.gov (United States)

    GUAN, Tao; MA, Zhang-wei; DING, Shi-ping

    2011-04-01

    To investigate the point mutations and polymorphisms of transforming growth factor beta-induced gene (TGFBI) in Chinese patients with keratoconus and discuss the relationship between the feature of gene mutations and single nucleotide polymorphisms of TGFBI gene and keratoconus. Polymerase chain reaction single strand conformation polymorphism and DNA direct sequencing were performed in 30 keratoconus cases and 30 healthy controls. All 17 exons of the TGFBI gene were analyzed for point mutations and single nucleotide polymorphisms. Totally two heterozygous nucleotide changes were identified in exon 12 of the TGFBI gene. The codon 535 is changed from GGA to TGA in 1 patient, leading to a substitution of glycine to a stop codon at the protein level (G535X). The codon 540 is changed from TTT to TTC in 2 patients and 1 control individual, resulting in a nonsense mutation (F54F), and is a single nucleotide polymorphism of the gene. Mutation and polymorphisms of the TGFBI gene were detected in Chinese patients with keratoconus in this study. The results suggest that TGFBI gene might play an important role in the pathogenesis of keratoconus.

  3. The TGFBI A546D mutation causes an atypical type of lattice corneal dystrophy.

    Science.gov (United States)

    Correa-Gomez, Vicente; Villalvazo-Cordero, Leonardo; Zenteno, Juan Carlos

    2007-09-17

    To report the clinical, molecular, and histopathological features of a distinct transforming growth factor-beta-induced (TGFBI) gene-linked amyloidotic corneal dystrophy exhibiting an unusual lattice pattern. A complete ophthalmologic examination was performed in 10 individuals of a Mexican family in which autosomal dominant transmission of the disease was observed. DNA was obtained from peripheral blood leukocytes of each participating subject. Genetic analyses included TGFBI polymerase chain reaction (PCR) amplification and automated nucleotidic sequencing of exons 4, 11, 12, 13, and 14 from genomic DNA. Histological analysis of corneal tissue from an affected individual who underwent a penetrating keratoplasty was also performed. The corneal phenotype in this pedigree was characterized by multiple bilateral round opacities in the central part of the cornea combined with a conspicuous central and peripheral lattice pattern. TGFBI analysis revealed a heterozygous point mutation at exon 12 (1637 C>A) in all affected individuals, predicting an A546D missense change. The lattice phenotype resulting from the TGFBI A546D mutation in this family is distinct from that observed in a previously described pedigree carrying the A546D mutation and exhibiting a phenotype designated "polymorphic corneal amyloidosis". We propose this particular disorder to be classified as an atypical type of lattice stromal corneal dystrophy.

  4. TGFBI, CHST6, and GSN gene analysis in Mexican patients with stromal corneal dystrophies.

    Science.gov (United States)

    Gonzalez-Rodriguez, Johanna; Ramirez-Miranda, Arturo; Hernandez-Da Mota, Sergio E; Zenteno, Juan C

    2014-08-01

    The purpose of our study was to describe the results of molecular screening of TGFBI, CHST6, and GSN genes in a group of Mexican patients with different stromal corneal dystrophies (CD). A total of 16 CD Mexican patients pertaining to nine different pedigrees were subjected to a complete ophthalmological investigation. A clinical diagnosis of lattice CD was performed in 10 patients from five pedigrees. Three patients from two pedigrees were diagnosed with granular CD type 2, two patients with unrelated probands had Finnish-type corneal amyloidosis, and one patient had macular CD. Genetic analysis included DNA isolation from blood leukocytes and polymerase chain reaction (PCR) amplification and direct nucleotide sequencing of TGFBI, CHST6, and GSN genes. Seven lattice CD patients from four unrelated families had an identical p.H626R mutation in TGFBI, three patients from a single lattice CD family carried a p.R124C substitution in TGFBI, and a granular type 2 CD pedigree was demonstrated to carry a heterozygous TGFBI p.M619K substitution. A patient having Finnish-type corneal amyloidosis had a p.D187N mutation in GSN. Finally, molecular analysis of CHST6 in a patient with macular CD disclosed the presence of a homozygous p.Y110C change. This study improves the knowledge of the genetic features of Mexican patients with corneal stromal dystrophies by identifying mutations in the TGFBI, CHST6, and GSN genes. Genetic screening of larger samples of patients from distinct ethnic groups would be of great importance for a better understanding of the mutational spectrum of stromal CD.

  5. The point mutation and polymorphism in keratoconus candidate gene TGFBI in Chinese population.

    Science.gov (United States)

    Guan, Tao; Liu, Chibo; Ma, Zhangwei; Ding, Shiping

    2012-07-15

    To understand the region point mutations and single nucleotide polymorphisms characteristic of keratoconus candidate gene in Chinese population, the TGFBI. Polymerase chain reaction-single strand conformation polymorphism and DNA direct sequencing were performed on blood samples from 30 cases of keratoconus patients and 30 normal controls. 17 exons from the coding region of TGFBI gene were examined for point mutations and single nucleotide polymorphisms. Two types of base mutation were found in exon 12, which were both heterozygous. In 1 patient the site 535 showed GGA→TGA substitution, which was the change from glycine to stop codon (G535X). This was not found in all control cases. In 2 patients and 1 control case the site 540 showed TTT→TTC substitutions without changing of the coding for phenylalanine (F540F), suggesting for the polymorphism. The candidate keratoconus gene TGFB1 showed genetic variation and mutation in keratoconus population. The gene might play a role in the development of keratoconus in Chinese population. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Clinical and genetic features of TGFBI-linked corneal dystrophies in Mexican population: description of novel mutations and novel genotype-phenotype correlations.

    Science.gov (United States)

    Zenteno, Juan Carlos; Correa-Gomez, Vicente; Santacruz-Valdez, Concepción; Suarez-Sanchez, Raul; Villanueva-Mendoza, Cristina

    2009-08-01

    Corneal dystrophies (CDS) are inherited disorders characterized by an altered corneal transparency and refractive index which may be caused by a progressive accumulation of deposits within the different corneal layers. Most CDs are inherited in an autosomal dominant fashion and mutations in the TGFBI gene at chromosome 5q31 cause the majority of CDs affecting the stromal layer. A genotype-phenotype correlation has been identified in most analyzed populations as specific amino acid changes in TGFBI protein cause specific stromal phenotypes. However, analysis of additional populations will help to broaden the mutational spectrum ultimately allowing a better clinical-molecular classification of patients with this group of diseases. In this work, eighteen unrelated Mexican probands suffering from stromal CDs were clinically assessed and their TGFBI gene status investigated. Complete ophthalmologic evaluation, including biomicroscopic inspection and dilated fundus examination, was performed. In addition, detailed genealogical analyses as well as automated DNA sequencing of the entire TGFBI gene were done in all probands. Mutation-carrying exons were examined in 50 first and second degree relatives. Phenotypic analysis disclosed the occurrence of 6 cases of lattice CD, 6 of granular CD, 2 of granular type 2 (Avellino CD), 2 of polymorphic corneal amyloidosis, 1 of Reis-Bucklers CD, and 1 of an unclassifiable phenotype. TGFBI mutations were identified in all 18 probands. A total of six different mutations were observed: p.V113I, p.M502V, p.A546D, p.L550P, p.R555W, and p.H626R. Of these, mutations p.L550P (originated by the change c.1649T>C at exon 12), p.M502V (c.1504A>G, at exon 11), and p.V113I (c.337G>A, at exon 4), are novel TGFBI mutations. All subjects with lattice CD in our sample carried the p.H626R mutation. No instances of defects at codon 124, one of the two most frequently mutated sites in TGFBI-linked CDs, were detected. A distinct TGFBI mutational pattern

  7. Proteomic profiling of TGFBI-null mouse corneas reveals only minor changes in matrix composition supportive of TGFBI knockdown as therapy against TGFBI-linked corneal dystrophies

    DEFF Research Database (Denmark)

    Poulsen, Ebbe Toftgaard; Runager, Kasper; Nielsen, Nadia Sukusu

    2017-01-01

    role in maintaining structural integrity and possibly corneal transparency as well. Significantly, more than 60 point mutations within the TGFBI gene have been reported to result in aberrant TGFBIp folding and aggregation in the cornea, resulting in severe visual impairment and blindness. Several...... studies have focused on targeting TGFBIp in the cornea as a therapeutic approach to treat TGFBI-linked corneal dystrophies, but the effect of this approach on corneal homeostasis and matrix integrity remained unknown. In the current study, we evaluated the histological and proteomic profiles of corneas...

  8. The role of TGFBI in mesothelioma and breast cancer: association with tumor suppression

    Directory of Open Access Journals (Sweden)

    Li Bingyan

    2012-06-01

    Full Text Available Abstract Background Transforming growth factor β induced (TGFBI product, an extracellular matrix (ECM protein, has been implicated as a putative tumor suppressor in recent studies. Our previous findings revealed that expression of TGFBI gene is down-regulated in a variety of cancer cell lines and clinical tissue samples. In this study, ectopic expression of TGFBI was used to ascertain its role as a tumor suppressor and to determine the underlying mechanism of mesothelioma and breast cancer. Methods Cells were stably transfected with pRc/CMV2-TGFBI and pRc/CMV2-empty vector with Lipofectamine Plus. Ectopic expression of TGFBI was quantified by using quantitative PCR and Western-blotting. Characterization of cell viability was assessed using growth curve, clonogenic survival and soft agar growth. The potential of tumor formation was evaluated by an in vivo mouse model. Cell cycle was analyzed via flow cytometry. Expressions of p21, p53, p16 and p14 were examined using Western-blotting. Senescent cells were sorted by using a Senescence β-Galactosidase Staining Kit. Telomerase activity was measured using quantitative telomerase detection kit. Results In this study, an ectopic expression of TGFBI in two types of cancer cell lines, a mesothelioma cell line NCI-H28 and a breast cancer cell line MDA-MB-231 was found to have reduced the cellular growth, plating efficiency, and anchorage-independent growth. The tumorigenicity of these cancer cell lines as determined by subcutaneous inoculation in nude mice was similarly suppressed by TGFBI expression. Likewise, TGFBI expression reduced the proportion of S-phase while increased the proportion of G1 phase in these cells. The redistribution of cell cycle phase after re-expression of TGFBI was correspondent with transiently elevated expression of p21 and p53. The activities of senescence-associated β-galactosidase and telomerase were enhanced in TGFBI-transfected cells. Conclusion Collectively, these

  9. Genotype-phenotype correlation of TGFBI corneal dystrophies in Polish patients.

    Science.gov (United States)

    Nowińska, Anna K; Wylegala, Edward; Janiszewska, Dominika A; Dobrowolski, Dariusz; Aragona, Pasquale; Roszkowska, Anna M; Puzzolo, Domenico

    2011-01-01

    To analyze genotype-phenotype correlation in patients originating from Polish population with the transforming growth factor beta induced (TGFBI) corneal dystrophies. Sixty affected and 31 unaffected individuals from 15 unrelated Polish families were included in the study. The clinical diagnosis was based on the slit-lamp exam, 1310 nm time domain and 1310 nm swept source spectral domain optical coherence tomography (OCT). Histopathologic analysis was performed on 10 available corneal buttons. Exons of the TGFBI gene were screened for mutations with polymerase chain reaction (PCR) and direct DNA sequencing. We found the lattice phenotype dominant compared to the granular one in the Polish population (41:16 patients; lattice:granular). We identified five distinct mutations responsible for TGFBI corneal dystrophies (R124R, R124H, R555W, R555Q, and H626R). There was a strong genotype-phenotype correlation in the case of R124R and R555W mutations, while there was a distinct phenotypic heterogeneity in the case of the H626R mutation. OCT analysis revealed that the reflectivity, location and pattern of the corneal deposits were different among the TGFBI corneal dystrophies. The advantage of spectral swept source OCT over time-domain OCT scans is a more distinct visualization of the Bowman's layer area and deposits located under the epithelium. This study underlines the role of comprehensive phenotype-genotype analysis in TGFBI corneal dystrophies, describes for the first time the TGFBI mutation spectrum in a Polish population and reveals phenotypic heterogeneity in the case of the H626R mutation.

  10. Surgical outcome after phototherapeutic keratectomy in patients with TGFBI-linked corneal dystrophies in relation to molecular genetic findings.

    Science.gov (United States)

    Gruenauer-Kloevekorn, Claudia; Braeutigam, Saskia; Froster, Ursula G; Duncker, Gernot I W

    2009-01-01

    To evaluate the correlation between surgical outcome after phototherapeutic keratectomy in patients with autosomal dominant transforming growth factor, beta-induced (TGFBI)-linked corneal dystrophies (CD) and molecular genetic findings regarding the TGFBI gene. Twelve patients were examined to investigate genotype by direct sequencing of the TGFBI gene. Twenty eyes of 12 patients were treated with phototherapeutic keratektomy (PTK) to remove superficial corneal opacifications and to decrease recurrent erosions. Surgical outcome, including visual improvement, recurrence of opacifications, postoperative complications, and additional therapeutic proceedings were reported and compared with the molecular genetic results. Four different missense mutations were identified within the coding region of the TGFBI gene: Arg124Cys in one eye, Arg555Trp in nine eyes, Arg124His in four eyes and Gly623Arg in six eyes. In all eyes the PTK was successful without clinically significant recurrent opacifications after a mean follow-up time of 17.6 months (min 3 months, max 42 months). The best corrected visual acuity (BCVA) improved with an average increase of 3.1 lines (minimum 2 lines, maximum 5 lines). In one eye (Arg124Cys), we observed delayed wound healing and a delayed increase in BCVA, in two eyes we performed an Epilasik to correct remaining hyperopia, and in four eyes we fitted rigid gas-permeable tricurve contact lenses to correct the remaining irregular astigmatism. The variable genotypes in patients with TGFBI-linked corneal dystrophies lead to significantly different results after surgical treatment. The Gly623Arg mutation seems to be an optimum genotype on which to perform PTK even in older patients. It is essential to determine the genotype in order to standardize the PTK treatment and to evaluate the success in TGFBI-linked corneal dystrophies.

  11. Massively parallel signature sequencing and bioinformatics analysis identifies up-regulation of TGFBI and SOX4 in human glioblastoma.

    Directory of Open Access Journals (Sweden)

    Biaoyang Lin

    Full Text Available BACKGROUND: A comprehensive network-based understanding of molecular pathways abnormally altered in glioblastoma multiforme (GBM is essential for developing effective therapeutic approaches for this deadly disease. METHODOLOGY/PRINCIPAL FINDINGS: Applying a next generation sequencing technology, massively parallel signature sequencing (MPSS, we identified a total of 4535 genes that are differentially expressed between normal brain and GBM tissue. The expression changes of three up-regulated genes, CHI3L1, CHI3L2, and FOXM1, and two down-regulated genes, neurogranin and L1CAM, were confirmed by quantitative PCR. Pathway analysis revealed that TGF- beta pathway related genes were significantly up-regulated in GBM tumor samples. An integrative pathway analysis of the TGF beta signaling network identified two alternative TGF-beta signaling pathways mediated by SOX4 (sex determining region Y-box 4 and TGFBI (Transforming growth factor beta induced. Quantitative RT-PCR and immunohistochemistry staining demonstrated that SOX4 and TGFBI expression is elevated in GBM tissues compared with normal brain tissues at both the RNA and protein levels. In vitro functional studies confirmed that TGFBI and SOX4 expression is increased by TGF-beta stimulation and decreased by a specific inhibitor of TGF-beta receptor 1 kinase. CONCLUSIONS/SIGNIFICANCE: Our MPSS database for GBM and normal brain tissues provides a useful resource for the scientific community. The identification of non-SMAD mediated TGF-beta signaling pathways acting through SOX4 and TGFBI (GENE ID:7045 in GBM indicates that these alternative pathways should be considered, in addition to the canonical SMAD mediated pathway, in the development of new therapeutic strategies targeting TGF-beta signaling in GBM. Finally, the construction of an extended TGF-beta signaling network with overlaid gene expression changes between GBM and normal brain extends our understanding of the biology of GBM.

  12. TGFBI functions similar to periostin but is uniquely dispensable during cardiac injury

    OpenAIRE

    Schwanekamp, Jennifer A.; Lorts, Angela; Sargent, Michelle A.; York, Allen J.; Grimes, Kelly M.; Fischesser, Demetria M.; Gokey, Jason J.; Whitsett, Jeffrey A.; Conway, Simon J.; Molkentin, Jeffery D

    2017-01-01

    Extracellular matrix production and accumulation stabilize the heart under normal conditions as well as form a protective scar after myocardial infarction injury, although excessive extracellular matrix accumulation with long-standing heart disease is pathological. In the current study we investigate the role of the matricellular protein, transforming growth factor beta-induced (TGFBI), which is induced in various forms of heart disease. Additionally, we sought to understand whether TGFBI is ...

  13. Development of a Transgenic Mouse with R124H Human TGFBI Mutation Associated with Granular Corneal Dystrophy Type 2.

    Science.gov (United States)

    Yamazoe, Katsuya; Yoshida, Satoru; Yasuda, Miyuki; Hatou, Shin; Inagaki, Emi; Ogawa, Yoko; Tsubota, Kazuo; Shimmura, Shigeto

    2015-01-01

    To investigate the phenotype and predisposing factors of a granular corneal dystrophy type 2 transgenic mouse model. Human TGFBI cDNA with R124H mutation was used to make a transgenic mouse expressing human protein (TGFBIR124H mouse). Reverse transcription PCR (RT-PCR) was performed to analyze TGFBIR124H expression. A total of 226 mice including 23 homozygotes, 106 heterozygotes and 97 wild-type mice were examined for phenotype. Affected mice were also examined by histology, immunohistochemistry and electron microcopy. RT-PCR confirmed the expression of TGFBIR124H in transgenic mice. Corneal opacity defined as granular and lattice deposits was observed in 45.0% of homozygotes, 19.4% of heterozygotes. The incidence of corneal opacity was significantly higher in homozygotes than in heterozygotes (p = 0.02). Histology of affected mice was similar to histology of human disease. Lesions were Congo red and Masson Trichrome positive, and were observed as a deposit of amorphous material by electron microscopy. Subepithelial stroma was also stained with thioflavin T and LC3, a marker of autophagy activation. The incidence of corneal opacity was higher in aged mice in each group. Homozygotes were not necessarily more severe than heterozygotes, which deffers from human cases. We established a granular corneal dystrophy type 2 mouse model caused by R124H mutation of human TGFBI. Although the phenotype of this mouse model is not equivalent to that in humans, further studies using this model may help elucidate the pathophysiology of this disease.

  14. A single gene defect causing claustrophobia

    OpenAIRE

    El-Kordi, Ahmed; Kästner, Anne; Grube, Sabrina; Klugmann, M.; Begemann, Martin; Sperling, Swetlana; Hammerschmidt, K.; Hammer, Christian; Stepniak, Beata; Patzig, J.; Monasterio-Schrader, Patricia; Strenzke, N.; Flügge, G.; Werner, Hauke B.; Pawlak, R.

    2013-01-01

    Claustrophobia, the well-known fear of being trapped in narrow/closed spaces, is often considered a conditioned response to traumatic experience. Surprisingly, we found that mutations affecting a single gene, encoding a stress-regulated neuronal protein, can cause claustrophobia. Gpm6a-deficient mice develop normally and lack obvious behavioral abnormalities. However, when mildly stressed by single-housing, these mice develop a striking claustrophobia-like phenotype, which is not inducible in...

  15. A single gene defect causing claustrophobia.

    Science.gov (United States)

    El-Kordi, A; Kästner, A; Grube, S; Klugmann, M; Begemann, M; Sperling, S; Hammerschmidt, K; Hammer, C; Stepniak, B; Patzig, J; de Monasterio-Schrader, P; Strenzke, N; Flügge, G; Werner, H B; Pawlak, R; Nave, K-A; Ehrenreich, H

    2013-04-30

    Claustrophobia, the well-known fear of being trapped in narrow/closed spaces, is often considered a conditioned response to traumatic experience. Surprisingly, we found that mutations affecting a single gene, encoding a stress-regulated neuronal protein, can cause claustrophobia. Gpm6a-deficient mice develop normally and lack obvious behavioral abnormalities. However, when mildly stressed by single-housing, these mice develop a striking claustrophobia-like phenotype, which is not inducible in wild-type controls, even by severe stress. The human GPM6A gene is located on chromosome 4q32-q34, a region linked to panic disorder. Sequence analysis of 115 claustrophobic and non-claustrophobic subjects identified nine variants in the noncoding region of the gene that are more frequent in affected individuals (P=0.028). One variant in the 3'untranslated region was linked to claustrophobia in two small pedigrees. This mutant mRNA is functional but cannot be silenced by neuronal miR124 derived itself from a stress-regulated transcript. We suggest that loosing dynamic regulation of neuronal GPM6A expression poses a genetic risk for claustrophobia.

  16. Rogue Genes May Cause Some ALS Cases

    Science.gov (United States)

    ... discover other possible genetic triggers and to further define possible non-genetic factors that may play a ... Services. More Health News on Amyotrophic Lateral Sclerosis Genes and Gene Therapy Recent Health News Related MedlinePlus ...

  17. Childhood Cancer Radiation May Cause Unwanted Gene Mutation in Some

    Science.gov (United States)

    ... 167614.html Childhood Cancer Radiation May Cause Unwanted Gene Mutation in Some That flaw seems to increase risk ... and now researchers say they've found a gene mutation that seems to increase that risk. The researchers ...

  18. Revertant mosaicism in epidermolysis bullosa caused by mitotic gene conversion

    NARCIS (Netherlands)

    Jonkman, MF; Scheffer, H; Stulp, R; Pas, HH; Nijenhuis, Albertine; Heeres, K; Owaribe, K; Pulkkinen, L; Uitto, J

    1997-01-01

    Mitotic gene conversion acting as reverse mutation has not been previously demonstrated in human. We report here that the revertant mosaicism of a compound heterozygous proband with an autosomal recessive genodermatosis, generalized atrophic benign epidermolysis bullosa, is caused by mitotic gene

  19. Cilia gene mutations cause atrioventricular septal defects by multiple mechanisms.

    Science.gov (United States)

    Burnicka-Turek, Ozanna; Steimle, Jeffrey D; Huang, Wenhui; Felker, Lindsay; Kamp, Anna; Kweon, Junghun; Peterson, Michael; Reeves, Roger H; Maslen, Cheryl L; Gruber, Peter J; Yang, Xinan H; Shendure, Jay; Moskowitz, Ivan P

    2016-07-15

    Atrioventricular septal defects (AVSDs) are a common severe form of congenital heart disease (CHD). In this study we identified deleterious non-synonymous mutations in two cilia genes, Dnah11 and Mks1, in independent N-ethyl-N-nitrosourea-induced mouse mutant lines with heritable recessive AVSDs by whole-exome sequencing. Cilia are required for left/right body axis determination and second heart field (SHF) Hedgehog (Hh) signaling, and we find that cilia mutations affect these requirements differentially. Dnah11avc4 did not disrupt SHF Hh signaling and caused AVSDs only concurrently with heterotaxy, a left/right axis abnormality. In contrast, Mks1avc6 disrupted SHF Hh signaling and caused AVSDs without heterotaxy. We performed unbiased whole-genome SHF transcriptional profiling and found that cilia motility genes were not expressed in the SHF whereas cilia structural and signaling genes were highly expressed. SHF cilia gene expression predicted the phenotypic concordance between AVSDs and heterotaxy in mice and humans with cilia gene mutations. A two-step model of cilia action accurately predicted the AVSD/heterotaxyu phenotypic expression pattern caused by cilia gene mutations. We speculate that cilia gene mutations contribute to both syndromic and non-syndromic AVSDs in humans and provide a model that predicts the phenotypic consequences of specific cilia gene mutations. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  20. Splicing aberrations caused by constitutional RB1 gene mutations in ...

    Indian Academy of Sciences (India)

    Skipping of an exon might confer an advantage as this might lead to a protein with residual function rather than an inactive protein. This situation is depicted in. Duchenne muscular dystrophy (DMD) and its milder variant, Becker muscular dystrophy (BMD), caused by mutations in the dystrophin gene (DMD) (Ahn and Kunkel.

  1. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism.

    NARCIS (Netherlands)

    Rauch, A.; Thiel, C.T.; Schindler, D.; Wick, U.; Crow, Y.J.; Ekici, A.B.; Essen, A.J. van; Goecke, T.O.; Al-Gazali, L.; Chrzanowska, K.H.; Zweier, C.; Brunner, H.G.; Becker, K.; Curry, C.J.; Dallapiccola, B.; Devriendt, K.; Dorfler, A.; Kinning, E.; Megarbane, A.; Meinecke, P.; Semple, R.K.; Spranger, S.; Toutain, A.; Trembath, R.C.; Voss, E.; Wilson, L.; Hennekam, R.C.M.; Zegher, F. de; Dorr, H.G.; Reis, A.

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss-of-function mutations in the centrosomal pericentrin (PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial dwarfism

  2. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism

    NARCIS (Netherlands)

    Rauch, Anita; Thiel, Christian T.; Schindler, Detlev; Wick, Ursula; Crow, Yanick J.; Ekici, Arif B.; van Essen, Anthonie J.; Goecke, Timm O.; Al-Gazali, Lihadh; Chrzanowska, Krystyna H.; Zweier, Christiane; Brunner, Han G.; Becker, Kristin; Curry, Cynthia J.; Dallapiccola, Bruno; Devriendt, Koenraad; Doerfler, Arnd; Kinning, Esther; Megarbane, Andre; Meinecke, Peter; Semple, Robert K.; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C.; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Doerr, Helmuth-Guenther; Reis, Andre

    2008-01-01

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss- of- function mutations in the centrosomal pericentrin ( PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial

  3. Gene copy-number polymorphism caused by retrotransposition in humans.

    Directory of Open Access Journals (Sweden)

    Daniel R Schrider

    Full Text Available The era of whole-genome sequencing has revealed that gene copy-number changes caused by duplication and deletion events have important evolutionary, functional, and phenotypic consequences. Recent studies have therefore focused on revealing the extent of variation in copy-number within natural populations of humans and other species. These studies have found a large number of copy-number variants (CNVs in humans, many of which have been shown to have clinical or evolutionary importance. For the most part, these studies have failed to detect an important class of gene copy-number polymorphism: gene duplications caused by retrotransposition, which result in a new intron-less copy of the parental gene being inserted into a random location in the genome. Here we describe a computational approach leveraging next-generation sequence data to detect gene copy-number variants caused by retrotransposition (retroCNVs, and we report the first genome-wide analysis of these variants in humans. We find that retroCNVs account for a substantial fraction of gene copy-number differences between any two individuals. Moreover, we show that these variants may often result in expressed chimeric transcripts, underscoring their potential for the evolution of novel gene functions. By locating the insertion sites of these duplicates, we are able to show that retroCNVs have had an important role in recent human adaptation, and we also uncover evidence that positive selection may currently be driving multiple retroCNVs toward fixation. Together these findings imply that retroCNVs are an especially important class of polymorphism, and that future studies of copy-number variation should search for these variants in order to illuminate their potential evolutionary and functional relevance.

  4. Contemporary Approaches for Identifying Rare Bone Disease Causing Genes.

    Science.gov (United States)

    Farber, Charles R; Clemens, Thomas L

    Recent improvements in the speed and accuracy of DNA sequencing, together with increasingly sophisticated mathematical approaches for annotating gene networks, have revolutionized the field of human genetics and made these once time consuming approaches assessable to most investigators. In the field of bone research, a particularly active area of gene discovery has occurred in patients with rare bone disorders such as osteogenesis imperfecta (OI) that are caused by mutations in single genes. In this perspective, we highlight some of these technological advances and describe how they have been used to identify the genetic determinants underlying two previously unexplained cases of OI. The widespread availability of advanced methods for DNA sequencing and bioinformatics analysis can be expected to greatly facilitate identification of novel gene networks that normally function to control bone formation and maintenance.

  5. Novel genetic variants in the TPO gene cause congenital hypothyroidism.

    Science.gov (United States)

    Ma, Shao-Gang; Qiu, Ya-Li; Zhu, Hong; Liu, Hong; Li, Qing; Ji, Chun-Mei

    2015-01-01

    Mutations in the dual oxidase maturation factor 2 (DUOXA2) and thyroid peroxidase (TPO) genes have been reported to cause goitrous congenital hypothyroidism (GCH). The aim of this study was to determine the genetic basis of GCH in affected children. Thirty children with GCH were enrolled for molecular analysis of the DUOXA2 and TPO genes. All subjects underwent clinical examination and laboratory testing. Genomic DNA was extracted from peripheral blood leukocytes, and Sanger sequencing was used to screen for DUOXA2 and TPO gene mutations in the exon fragments amplified from the extracted DNA. Family members of those patients with mutations were also enrolled and evaluated. Analysis of the TPO gene revealed six genetic variants, including two novel heterozygous mutations, c.1970T> C (p.I657T) and c.2665G> T (p.G889X), and four mutations that have been reported previously (c.670_672del, c.2268dup, c.2266T> C and c.2647C> T). Three patients harbored the same mutation c.2268dup. The germline mutations from four unrelated families were consistent with an autosomal recessive inheritance pattern. Conversely, no mutations in the DUOXA2 gene were detected. Two novel inactivating mutations (c.1970T> C and c.2665G> T) in the TPO gene were identified. The c.2268dup mutation occurred frequently. No mutations in the DUOXA2 gene were detected in this study.

  6. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    Directory of Open Access Journals (Sweden)

    Maryam Taghdiri

    2017-08-01

    Full Text Available Cockayne syndrome (CS is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C in our patient. Another gene (ERCC6, which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  7. Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

    Science.gov (United States)

    Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

    2015-01-01

    Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

  8. Mutations within the MGC4607 gene cause cerebral cavernous malformations.

    Science.gov (United States)

    Denier, C; Goutagny, S; Labauge, P; Krivosic, V; Arnoult, M; Cousin, A; Benabid, A L; Comoy, J; Frerebeau, P; Gilbert, B; Houtteville, J P; Jan, M; Lapierre, F; Loiseau, H; Menei, P; Mercier, P; Moreau, J J; Nivelon-Chevallier, A; Parker, F; Redondo, A M; Scarabin, J M; Tremoulet, M; Zerah, M; Maciazek, J; Tournier-Lasserve, E

    2004-02-01

    Cerebral cavernous malformations (CCM) are hamartomatous vascular malformations characterized by abnormally enlarged capillary cavities without intervening brain parenchyma. They cause seizures and focal neurological deficits due to cerebral hemorrhages. CCM loci have already been assigned to chromosomes 7q (CCM1), 7p (CCM2), and 3q (CCM3) and have been identified in 40%, 20%, and 40%, respectively, of families with CCM. Loss-of-function mutations have been identified in CCM1/KRIT1, the sole CCM gene identified to date. We report here the identification of MGC4607 as the CCM2 gene. We first reduced the size of the CCM2 interval from 22 cM to 7.5 cM by genetic linkage analysis. We then hypothesized that large deletions might be involved in the disorder, as already reported in other hamartomatous conditions, such as tuberous sclerosis or neurofibromatosis. We performed a high-density microsatellite genotyping of this 7.5-cM interval to search for putative null alleles in 30 unrelated families, and we identified, in 2 unrelated families, null alleles that were the result of deletions within a 350-kb interval flanked by markers D7S478 and D7S621. Additional microsatellite and single-nucleotide polymorphism genotyping showed that these two distinct deletions overlapped and that both of the two deleted the first exon of MGC4607, a known gene of unknown function. In both families, one of the two MGC4607 transcripts was not detected. We then identified eight additional point mutations within MGC4607 in eight of the remaining families. One of them led to the alteration of the initiation codon and five of them to a premature termination codon, including one nonsense, one frameshift, and three splice-site mutations. All these mutations cosegregated with the disease in the families and were not observed in 192 control chromosomes. MGC4607 is so far unrelated to any known gene family. Its implication in CCMs strongly suggests that it is a new player in vascular morphogenesis.

  9. Potassium channel gene mutations rarely cause atrial fibrillation

    Directory of Open Access Journals (Sweden)

    Nam Edwin G

    2006-08-01

    Full Text Available Abstract Background Mutations in several potassium channel subunits have been associated with rare forms of atrial fibrillation. In order to explore the role of potassium channels in inherited typical forms of the arrhythmia, we have screened a cohort of patients from a referral clinic for mutations in the channel subunit genes implicated in the arrhythmia. We sought to determine if mutations in KCNJ2 and KCNE1-5 are a common cause of atrial fibrillation. Methods Serial patients with lone atrial fibrillation or atrial fibrillation with hypertension were enrolled between June 1, 2001 and January 6, 2005. Each patient underwent a standardized interview and physical examination. An electrocardiogram, echocardiogram and blood sample for genetic analysis were also obtained. Patients with a family history of AF were screened for mutations in KCNJ2 and KCNE1-5 using automated sequencing. Results 96 patients with familial atrial fibrillation were enrolled. Eighty-three patients had lone atrial fibrillation and 13 had atrial fibrillation and hypertension. Patients had a mean age of 56 years at enrollment and 46 years at onset of atrial fibrillation. Eighty-one percent of patients had paroxysmal atrial fibrillation at enrollment. Unlike patients with an activating mutation in KCNQ1, the patients had a normal QTc interval with a mean of 412 ± 42 ms. Echocardiography revealed a normal mean ejection fraction of 62.0 ± 7.2 % and mean left atrial dimension of 39.9 ± 7.0 mm. A number of common polymorphisms in KCNJ2 and KCNE1-5 were identified, but no mutations were detected. Conclusion Mutations in KCNJ2 and KCNE1-5 rarely cause typical atrial fibrillation in a referral clinic population.

  10. PTRH2 gene mutation causes progressive congenital skeletal muscle pathology.

    Science.gov (United States)

    Doe, Jinger; Kaindl, Angela M; Jijiwa, Mayumi; de la Vega, Michelle; Hu, Hao; Griffiths, Genevieve S; Fontelonga, Tatiana M; Barraza, Pamela; Cruz, Vivian; Van Ry, Pam; Ramos, Joe W; Burkin, Dean J; Matter, Michelle L

    2017-04-15

    Peptidyl-tRNA hydrolase 2 (PTRH2) regulates integrin-mediated pro-survival and apoptotic signaling. PTRH2 is critical in muscle development and regulates myogenic differentiation. In humans a biallelic mutation in the PTRH2 gene causes infantile-onset multisystem disease with progressive muscle weakness. We report here that the Ptrh2 knockout mouse model recapitulates the progressive congenital muscle pathology observed in patients. Ptrh2 null mice demonstrate multiple degenerating and regenerating muscle fibers, increased central nuclei, elevated creatine kinase activity and endomysial fibrosis. This progressive muscle pathology resembles the muscular dystrophy phenotype in humans and mice lacking the α7 integrin. We demonstrate that in normal muscle Ptrh2 associates in a complex with the α7β1 integrin at the sarcolemma and Ptrh2 expression is decreased in α7 integrin null muscle. Furthermore, Ptrh2 expression is altered in skeletal muscle of classical congenital muscular dystrophy mouse models. Ptrh2 levels were up-regulated in dystrophin deficient mdx muscle, which correlates with the elevated levels of the α7β1 integrin observed in mdx muscle and Duchenne muscular dystrophy patients. Similar to the α7 integrin, Ptrh2 expression was decreased in laminin-α2 dyW null gastrocnemius muscle. Our data establishes a PTRH2 mutation as a novel driver of congenital muscle degeneration and identifies a potential novel target to treat muscle myopathies. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Short tandem repeats in CdLS-causing genes: distribution and ...

    Indian Academy of Sciences (India)

    2Birthright Genetic Clinic, Karve Road, Pune 411 007, India. [Bajaj S., Gambhir P. and Ranade S. 2014 Short tandem repeats in CdLS-causing genes: distribution ... (nipped B like) or SMC (structural maintenance of chromo- some) genes (Gillis et al. 2004; Krantz et al. 2004). The major genes involved in causing CdLS are ...

  12. Mutations in the AGXT2L2 gene cause phosphohydroxylysinuria

    NARCIS (Netherlands)

    Veiga-da-Cunha, Maria; Verhoeven-Duif, Nanda M; de Koning, Tom J; Duran, Marinus; Dorland, Bert; Van Schaftingen, Emile

    2013-01-01

    Phosphohydroxylysinuria has been described in two patients with neurological symptoms, but the deficient enzyme or mutated gene has never been identified. In the present work, we tested the hypothesis that this condition is due to mutations in the AGXT2L2 gene, recently shown to encode

  13. Disease-Causing Variants in the ATL1 Gene Are a Rare Cause of Hereditary Spastic Paraplegia among Czech Patients.

    Science.gov (United States)

    Mészárosová, Anna Uhrová; Grečmalová, Dagmar; Brázdilová, Michaela; Dvořáčková, Nina; Kalina, Zdeněk; Čermáková, Marie; Vávrová, Dagmar; Smetanová, Irena; Staněk, David; Seeman, Pavel

    2017-11-01

    Variants in the ATL1 gene have been repeatedly described as the second most frequent cause of hereditary spastic paraplegia (HSP), a motor neuron disease manifested by progressive lower limb spasticity and weakness. Variants in ATL1 have been described mainly in patients with early onset HSP. We performed Sanger sequencing of all coding exons and adjacent intron regions of the ALT1 gene in 111 Czech patients with pure form of HSP and additional Multiplex-Ligation Probe Analysis (MLPA) testing targeting the ATL1 gene in 56 of them. All patients except seven were previously tested by Sanger sequencing of the SPAST gene with negative results. ATL1 diagnostic testing revealed only five missense variants in the ATL1 gene. Four of them are novel, but we suppose only two of them to be pathogenic and causal. The remaining variants are assumed to be benign. MLPA testing in 56 of sequence variant negative patients revealed no gross deletion in the ATL1 gene. Variants in the ATL1 gene are more frequent in patients with early onset HSP, but in general the occurrence of pathogenic variants in the ATL1 gene is low in our cohort, less than 4.5% and less than 11.1% in patients with onset before the age of ten. Variants in the ATL1 gene are a less frequent cause of HSP among Czech patients than has been previously reported among other populations. © 2017 John Wiley & Sons Ltd/University College London.

  14. NDRC: A Disease-Causing Genes Prioritized Method Based on Network Diffusion and Rank Concordance.

    Science.gov (United States)

    Fang, Minghong; Hu, Xiaohua; Wang, Yan; Zhao, Junmin; Shen, Xianjun; He, Tingting

    2015-07-01

    Disease-causing genes prioritization is very important to understand disease mechanisms and biomedical applications, such as design of drugs. Previous studies have shown that promising candidate genes are mostly ranked according to their relatedness to known disease genes or closely related disease genes. Therefore, a dangling gene (isolated gene) with no edges in the network can not be effectively prioritized. These approaches tend to prioritize those genes that are highly connected in the PPI network while perform poorly when they are applied to loosely connected disease genes. To address these problems, we propose a new disease-causing genes prioritization method that based on network diffusion and rank concordance (NDRC). The method is evaluated by leave-one-out cross validation on 1931 diseases in which at least one gene is known to be involved, and it is able to rank the true causal gene first in 849 of all 2542 cases. The experimental results suggest that NDRC significantly outperforms other existing methods such as RWR, VAVIEN, DADA and PRINCE on identifying loosely connected disease genes and successfully put dangling genes as potential candidate disease genes. Furthermore, we apply NDRC method to study three representative diseases, Meckel syndrome 1, Protein C deficiency and Peroxisome biogenesis disorder 1A (Zellweger). Our study has also found that certain complex disease-causing genes can be divided into several modules that are closely associated with different disease phenotype.

  15. Two novel mutations in ILDR1 gene cause autosomal recessive ...

    Indian Academy of Sciences (India)

    In a recent screening programme on hearing loss (HL), we examined 17 common autosomal recessive nonsyndromic hearing loss (ARNSHL) genes in every consanguineous Ira- nian family with ARNSHL that was referred to our centre. We first screened GJB2 mutations and then utilized a panel of three to four short ...

  16. Homozygous mutation in the NPHP3 gene causing foetal nephronophthisis

    DEFF Research Database (Denmark)

    Abdullah, Uzma; Farooq, Muhammad; Fatima, Ambrin

    2017-01-01

    We present a case of a foetal sonographic finding of hyper-echogenic kidneys, which led to a strategic series of genetic tests and identified a homozygous mutation (c.424C > T, p. R142*) in the NPHP3 gene. Our study provides a rare presentation of NPHP3-related ciliopathy and adds to the mutation...

  17. Resolution of gene regulatory conflicts caused by combinations of antibiotics.

    Science.gov (United States)

    Bollenbach, Tobias; Kishony, Roy

    2011-05-20

    Regulatory conflicts occur when two signals that individually trigger opposite cellular responses are present simultaneously. Here, we investigate regulatory conflicts in the bacterial response to antibiotic combinations. We use an Escherichia coli promoter-GFP library to study the transcriptional response of many promoters to either additive or antagonistic drug pairs at fine two-dimensional (2D) resolution of drug concentration. Surprisingly, we find that this data set can be characterized as a linear sum of only two principal components. Component one, accounting for over 70% of the response, represents the response to growth inhibition by the drugs. Component two describes how regulatory conflicts are resolved. For the additive drug pair, conflicts are resolved by linearly interpolating the single drug responses, while for the antagonistic drug pair, the growth-limiting drug dominates the response. Importantly, for a given drug pair, the same conflict resolution strategy applies to almost all genes. These results provide a recipe for predicting gene expression responses to antibiotic combinations. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Iris phenotypes and pigment dispersion caused by genes influencing pigmentation.

    Science.gov (United States)

    Anderson, Michael G; Hawes, Norman L; Trantow, Colleen M; Chang, Bo; John, Simon W M

    2008-10-01

    Spontaneous mutations altering mouse coat colors have been a classic resource for discovery of numerous molecular pathways. Although often overlooked, the mouse iris is also densely pigmented and easily observed, thus representing a similarly powerful opportunity for studying pigment cell biology. Here, we present an analysis of iris phenotypes among 16 mouse strains with mutations influencing melanosomes. Many of these strains exhibit biologically and medically relevant phenotypes, including pigment dispersion, a common feature of several human ocular diseases. Pigment dispersion was identified in several strains with mutant alleles known to influence melanosomes, including beige, light, and vitiligo. Pigment dispersion was also detected in the recently arising spontaneous coat color variant, nm2798. We have identified the nm2798 mutation as a missense mutation in the Dct gene, an identical re-occurrence of the slaty light mutation. These results suggest that dysregulated events of melanosomes can be potent contributors to the pigment dispersion phenotype. Combined, these findings illustrate the utility of studying iris phenotypes as a means of discovering new pathways, and re-linking old ones, to processes of pigmented cells in health and disease.

  19. Genetic syndromes caused by mutations in epigenetic genes.

    Science.gov (United States)

    Berdasco, María; Esteller, Manel

    2013-04-01

    The orchestrated organization of epigenetic factors that control chromatin dynamism, including DNA methylation, histone marks, non-coding RNAs (ncRNAs) and chromatin-remodeling proteins, is essential for the proper function of tissue homeostasis, cell identity and development. Indeed, deregulation of epigenetic profiles has been described in several human pathologies, including complex diseases (such as cancer, cardiovascular and neurological diseases), metabolic pathologies (type 2 diabetes and obesity) and imprinting disorders. Over the last decade it has become increasingly clear that mutations of genes involved in epigenetic mechanism, such as DNA methyltransferases, methyl-binding domain proteins, histone deacetylases, histone methylases and members of the SWI/SNF family of chromatin remodelers are linked to human disorders, including Immunodeficiency Centromeric instability Facial syndrome 1, Rett syndrome, Rubinstein-Taybi syndrome, Sotos syndrome or alpha-thalassemia/mental retardation X-linked syndrome, among others. As new members of the epigenetic machinery are described, the number of human syndromes associated with epigenetic alterations increases. As recent examples, mutations of histone demethylases and members of the non-coding RNA machinery have recently been associated with Kabuki syndrome, Claes-Jensen X-linked mental retardation syndrome and Goiter syndrome. In this review, we describe the variety of germline mutations of epigenetic modifiers that are known to be associated with human disorders, and discuss the therapeutic potential of epigenetic drugs as palliative care strategies in the treatment of such disorders.

  20. Mutations in the netrin-1 gene cause congenital mirror movements.

    Science.gov (United States)

    Méneret, Aurélie; Franz, Elizabeth A; Trouillard, Oriane; Oliver, Thomas C; Zagar, Yvrick; Robertson, Stephen P; Welniarz, Quentin; Gardner, R J MacKinlay; Gallea, Cécile; Srour, Myriam; Depienne, Christel; Jasoni, Christine L; Dubacq, Caroline; Riant, Florence; Lamy, Jean-Charles; Morel, Marie-Pierre; Guérois, Raphael; Andreani, Jessica; Fouquet, Coralie; Doulazmi, Mohamed; Vidailhet, Marie; Rouleau, Guy A; Brice, Alexis; Chédotal, Alain; Dusart, Isabelle; Roze, Emmanuel; Markie, David

    2017-09-25

    Netrin-1 is a secreted protein that was first identified 20 years ago as an axon guidance molecule that regulates midline crossing in the CNS. It plays critical roles in various tissues throughout development and is implicated in tumorigenesis and inflammation in adulthood. Despite extensive studies, no inherited human disease has been directly associated with mutations in NTN1, the gene coding for netrin-1. Here, we have identified 3 mutations in exon 7 of NTN1 in 2 unrelated families and 1 sporadic case with isolated congenital mirror movements (CMM), a disorder characterized by involuntary movements of one hand that mirror intentional movements of the opposite hand. Given the diverse roles of netrin-1, the absence of manifestations other than CMM in NTN1 mutation carriers was unexpected. Using multimodal approaches, we discovered that the anatomy of the corticospinal tract (CST) is abnormal in patients with NTN1-mutant CMM. When expressed in HEK293 or stable HeLa cells, the 3 mutated netrin-1 proteins were almost exclusively detected in the intracellular compartment, contrary to WT netrin-1, which is detected in both intracellular and extracellular compartments. Since netrin-1 is a diffusible extracellular cue, the pathophysiology likely involves its loss of function and subsequent disruption of axon guidance, resulting in abnormal decussation of the CST.

  1. Differential gene expression patterns between smokers and non‐smokers: cause or consequence?

    Science.gov (United States)

    Jansen, Rick; Brooks, Andy; Willemsen, Gonneke; van Grootheest, Gerard; de Geus, Eco; Smit, Jan H.; Penninx, Brenda W.; Boomsma, Dorret I.

    2015-01-01

    Abstract The molecular mechanisms causing smoking‐induced health decline are largely unknown. To elucidate the molecular pathways involved in cause and consequences of smoking behavior, we conducted a genome‐wide gene expression study in peripheral blood samples targeting 18 238 genes. Data of 743 smokers, 1686 never smokers and 890 ex‐smokers were available from two population‐based cohorts from the Netherlands. In addition, data of 56 monozygotic twin pairs discordant for ever smoking were used. One hundred thirty‐two genes were differentially expressed between current smokers and never smokers (P expression of these 132 genes was classified into reversible (94 genes), slowly reversible (31 genes), irreversible (6 genes) or inconclusive (1 gene). Expression of 6 of the 132 genes (three reversible and three slowly reversible) was confirmed to be reactive to smoking as they were differentially expressed in monozygotic pairs discordant for smoking. Cis‐expression quantitative trait loci for GPR56 and RARRES3 (downregulated in smokers) were associated with increased number of cigarettes smoked per day in a large genome‐wide association meta‐analysis, suggesting a causative effect of GPR56 and RARRES3 expression on smoking behavior. In conclusion, differential gene expression patterns in smokers are extensive and cluster in several underlying disease pathways. Gene expression differences seem mainly direct consequences of smoking, and largely reversible after smoking cessation. However, we also identified DNA variants that may influence smoking behavior via the mediating gene expression. PMID:26594007

  2. Gene expression profiles of the cochlea and vestibular endorgans: localization and function of genes causing deafness.

    Science.gov (United States)

    Nishio, Shin-Ya; Hattori, Mitsuru; Moteki, Hideaki; Tsukada, Keita; Miyagawa, Maiko; Naito, Takehiko; Yoshimura, Hidekane; Iwasa, Yoh-Ichiro; Mori, Kentaro; Shima, Yutaka; Sakuma, Naoko; Usami, Shin-Ichi

    2015-05-01

    We sought to elucidate the gene expression profiles of the causative genes as well as the localization of the encoded proteins involved in hereditary hearing loss. Relevant articles (as of September 2014) were searched in PubMed databases, and the gene symbols of the genes reported to be associated with deafness were located on the Hereditary Hearing Loss Homepage using localization, expression, and distribution as keywords. Our review of the literature allowed us to systematize the gene expression profiles for genetic deafness in the inner ear, clarifying the unique functions and specific expression patterns of these genes in the cochlea and vestibular endorgans. The coordinated actions of various encoded molecules are essential for the normal development and maintenance of auditory and vestibular function. © The Author(s) 2015.

  3. Clinical course of cone dystrophy caused by mutations in the RPGR gene

    NARCIS (Netherlands)

    A.A.H.J. Thiadens (Alberta); G.G. Soerjoesing (Gyan); R.J. Florijn; A.G. Tjiam; A.I. Hollander (Anneke); L.I. van den Born (Ingeborgh); F.C.C. Riemslag (Frans); A.A.B. Bergen (Arthur); C.C.W. Klaver (Caroline)

    2011-01-01

    textabstractBackground: Mutations in the RPGR gene predominantly cause rod photoreceptor disorders with a large variability in clinical course. In this report, we describe two families with mutations in this gene and cone involvement. Methods: We investigated an X-linked cone dystrophy family (1)

  4. Clinical course of cone dystrophy caused by mutations in the RPGR gene

    NARCIS (Netherlands)

    Thiadens, A.A.H.J.; Soerjoesing, G.G.; Florijn, R.J.; Tjiam, A.G.; Hollander, A.I. den; Born, L.I. van den; Riemslag, F.C.; Bergen, A.A.B.; Klaver, C.C.

    2011-01-01

    BACKGROUND: Mutations in the RPGR gene predominantly cause rod photoreceptor disorders with a large variability in clinical course. In this report, we describe two families with mutations in this gene and cone involvement. METHODS: We investigated an X-linked cone dystrophy family (1) with 25

  5. VIP Gene Deletion in Mice Causes Cardiomyopathy Associated with Upregulation of Heart Failure Genes

    Energy Technology Data Exchange (ETDEWEB)

    Szema, Anthony M.; Hamidi, Sayyed A.; Smith, S. David; Benveniste, Helene; Katare, Rajesh Gopalrao

    2013-05-20

    Vasoactive Intestinal Peptide (VIP), a pulmonary vasodilator and inhibitor of vascular smooth muscle proliferation, is absent in pulmonary arteries of patients with idiopathic pulmonary arterial hypertension (PAH). We previously determined that targeted deletion of the VIP gene in mice leads to PAH with pulmonary vascular remodeling and right ventricular (RV) dilatation. Whether the left ventricle is also affected by VIP gene deletion is unknown. In the current study, we examined if VIP knockout mice (VIP-/-) develop both right (RV) and left ventricular (LV) cardiomyopathy, manifested by LV dilatation and systolic dysfunction, as well as overexpression of genes conducive to heart failure.

  6. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira

    2014-07-01

    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  7. A novel splicing mutation in GALT gene causing Galactosemia in Ecuadorian family.

    Science.gov (United States)

    De Lucca, M; Barba, C; Casique, L

    2017-07-01

    Classic Galactosemia (OMIM 230400) is an autosomal recessive disorder of galactose metabolism caused by mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. This disease caused by the inability to metabolize galactose is potentially life-threatening but its pathophysiology has not been clearly defined. GALT gene presents high allelic heterogeneity and around 336 variations have been identified. Here, we report the case of a patient with Classic Galactosemia who was detected during a neonatal screening in Ecuador. Molecular study revealed a mutation in GALT gene intron 1, c.82+3A>G in homozygous condition, this mutation has not been previously reported. This gene variation was not found in any of the 119 healthy Ecuadorian individuals used as control. Furthermore, the mutation was the only alteration detected in the propositus's GALT after sequencing all exons and introns of this gene. In silico modeling predicted that the mutation was pathogenic. Copyright © 2017. Published by Elsevier B.V.

  8. Deletions of recessive disease genes: CNV contribution to carrier states and disease-causing alleles

    Science.gov (United States)

    Boone, Philip M.; Campbell, Ian M.; Baggett, Brett C.; Soens, Zachry T.; Rao, Mitchell M.; Hixson, Patricia M.; Patel, Ankita; Bi, Weimin; Cheung, Sau Wai; Lalani, Seema R.; Beaudet, Arthur L.; Stankiewicz, Pawel; Shaw, Chad A.; Lupski, James R.

    2013-01-01

    Over 1200 recessive disease genes have been described in humans. The prevalence, allelic architecture, and per-genome load of pathogenic alleles in these genes remain to be fully elucidated, as does the contribution of DNA copy-number variants (CNVs) to carrier status and recessive disease. We mined CNV data from 21,470 individuals obtained by array-comparative genomic hybridization in a clinical diagnostic setting to identify deletions encompassing or disrupting recessive disease genes. We identified 3212 heterozygous potential carrier deletions affecting 419 unique recessive disease genes. Deletion frequency of these genes ranged from one occurrence to 1.5%. When compared with recessive disease genes never deleted in our cohort, the 419 recessive disease genes affected by at least one carrier deletion were longer and located farther from known dominant disease genes, suggesting that the formation and/or prevalence of carrier CNVs may be affected by both local and adjacent genomic features and by selection. Some subjects had multiple carrier CNVs (307 subjects) and/or carrier deletions encompassing more than one recessive disease gene (206 deletions). Heterozygous deletions spanning multiple recessive disease genes may confer carrier status for multiple single-gene disorders, for complex syndromes resulting from the combination of two or more recessive conditions, or may potentially cause clinical phenotypes due to a multiply heterozygous state. In addition to carrier mutations, we identified homozygous and hemizygous deletions potentially causative for recessive disease. We provide further evidence that CNVs contribute to the allelic architecture of both carrier and recessive disease-causing mutations. Thus, a complete recessive carrier screening method or diagnostic test should detect CNV alleles. PMID:23685542

  9. Congenital Hypothyroidism Caused by a PAX8 Gene Mutation Manifested as Sodium/Iodide Symporter Gene Defect

    Directory of Open Access Journals (Sweden)

    Wakako Jo

    2010-01-01

    Full Text Available Loss-of-function mutations of the PAX8 gene are considered to mainly cause congenital hypothyroidism (CH due to thyroid hypoplasia. However, some patients with PAX8 mutation have demonstrated a normal-sized thyroid gland. Here we report a CH patient caused by a PAX8 mutation, which manifested as iodide transport defect (ITD. Hypothyroidism was detected by neonatal screening and L-thyroxine replacement was started immediately. Although 123I scintigraphy at 5 years of age showed that the thyroid gland was in the normal position and of small size, his iodide trapping was low. The ratio of the saliva/plasma radioactive iodide was low. He did not have goiter; however laboratory findings suggested that he had partial ITD. Gene analyses showed that the sodium/iodide symporter (NIS gene was normal; instead, a mutation in the PAX8 gene causing R31H substitution was identified. The present report demonstrates that individuals with defective PAX8 can have partial ITD, and thus genetic analysis is useful for differential diagnosis.

  10. dBRWD3 Regulates Tissue Overgrowth and Ectopic Gene Expression Caused by Polycomb Group Mutations.

    Directory of Open Access Journals (Sweden)

    Hsueh-Tzu Shih

    2016-09-01

    Full Text Available To maintain a particular cell fate, a unique set of genes should be expressed while another set is repressed. One way to repress gene expression is through Polycomb group (PcG proteins that compact chromatin into a silent configuration. In addition to cell fate maintenance, PcG proteins also maintain normal cell physiology, for example cell cycle. In the absence of PcG, ectopic activation of the PcG-repressed genes leads to developmental defects and malignant tumors. Little is known about the molecular nature of ectopic gene expression; especially what differentiates expression of a given gene in the orthotopic tissue (orthotopic expression and the ectopic expression of the same gene due to PcG mutations. Here we present that ectopic gene expression in PcG mutant cells specifically requires dBRWD3, a negative regulator of HIRA/Yemanuclein (YEM-mediated histone variant H3.3 deposition. dBRWD3 mutations suppress both the ectopic gene expression and aberrant tissue overgrowth in PcG mutants through a YEM-dependent mechanism. Our findings identified dBRWD3 as a critical regulator that is uniquely required for ectopic gene expression and aberrant tissue overgrowth caused by PcG mutations.

  11. Network analysis of differential expression for the identification of disease-causing genes.

    Directory of Open Access Journals (Sweden)

    Daniela Nitsch

    Full Text Available Genetic studies (in particular linkage and association studies identify chromosomal regions involved in a disease or phenotype of interest, but those regions often contain many candidate genes, only a few of which can be followed-up for biological validation. Recently, computational methods to identify (prioritize the most promising candidates within a region have been proposed, but they are usually not applicable to cases where little is known about the phenotype (no or few confirmed disease genes, fragmentary understanding of the biological cascades involved. We seek to overcome this limitation by replacing knowledge about the biological process by experimental data on differential gene expression between affected and healthy individuals. Considering the problem from the perspective of a gene/protein network, we assess a candidate gene by considering the level of differential expression in its neighborhood under the assumption that strong candidates will tend to be surrounded by differentially expressed neighbors. We define a notion of soft neighborhood where each gene is given a contributing weight, which decreases with the distance from the candidate gene on the protein network. To account for multiple paths between genes, we define the distance using the Laplacian exponential diffusion kernel. We score candidates by aggregating the differential expression of neighbors weighted as a function of distance. Through a randomization procedure, we rank candidates by p-values. We illustrate our approach on four monogenic diseases and successfully prioritize the known disease causing genes.

  12. Candidate gene associated with a mutation causing recessive polycystic kidney disease in mice

    Energy Technology Data Exchange (ETDEWEB)

    Moyer, J.H.; Lee-Tischler, M.J.; Kwon, H.Y.; Schrick, J.J. (Univ. of Tennessee Graduate School of Biomedical Sciences, Oak Ridge, TN (United States)); Avner, E.D.; Sweeney, W.E. (Univ. of Washington, Seattle, WA (United States)); Godfrey, V.L.; Cacheiro, N.L.A.; Woychik, R.P. (Oak Ridge National Lab., TN (United States)); Wilkinson, J.E. (Univ. of Tennessee, Knoxville, TN (United States))

    1994-05-27

    A line of transgenic mice was generated that contains an insertional mutation causing a phenotype similar to human autosomal recessive polycystic kidney disease. Homozygotes displayed a complex phenotype that included bilateral polycystic kidneys and an unusual liver lesion. The mutant locus was cloned and characterized through use of the transgene as a molecular marker. Additionally, a candidate polycystic kidney disease (PKD) gene was identified whose structure and expression are directly associated with the mutant locus. A complementary DNA derived from this gene predicted a peptide containing a motif that was originally identified in several genes involved in cell cycle control.

  13. Multi-exon deletion in the XDH gene as a cause of classical xanthinuria.

    Science.gov (United States)

    Eggermann, Thomas; Spengler, Sabrina; Denecke, Bernd; Zerres, Klaus; Mache, Christoph J

    2013-01-01

    Xanthinuria Type I is caused by mutations in the xanthine dehydrogenase gene (XDH). We report on a patient suffering from xanthinuria. Genomic DNA was screened for point mutations and imbalances in the XDH gene by sequencing and microarray typing. We could identify homozygosity of a multiexon deletion in the XDH gene; large genomic imbalances have not yet been reported in this disease. As our case and other studies on genetic alterations in kidney diseases show, large deletions (and duplications) significantly contribute to the etiology of these entities, specific assays to discover these imbalances should therefore be included in genetic testing approaches.

  14. Analysis of gene expression changes associated with human carcinoma-associated fibroblasts in non-small cell lung carcinoma.

    Science.gov (United States)

    Wu, Xiaofen; Ruan, Lei; Yang, Yi; Mei, Qi

    2017-02-23

    This study aimed to investigate the gene expression changes associated with carcinoma-associated fibroblasts (CAFs) involving in non-small cell lung carcinoma (NSCLC). We downloaded the GEO series GSE22862, which contained matched gene expression values for 15 CAF and normal fibroblasts samples, and series GSE27289 containing SNP genotyping for four matched NSCLC samples. The differentially expressed genes in CAF samples were identified using the limma package in R. Then we performed gene ontology (GO) and pathway enrichment analysis and protein-protein interaction (PPI) network construction using the identified DEGs. Moreover, aberrant cell fraction, ploidy, allele-specific copy number, and loss of heterozygosity (LOH) within CAF cells were analyzed using the allele-specific copy number analysis. We obtained 545 differentially expressed genes between CAF and normal fibroblasts samples. The up-regulated genes are mainly involved in GO terms such as positive regulation of cell migration and extracellular region, while the down-regulated genes participate in the lung development and extracellular region. Multiple genes including bone morphogenetic protein 4 (BMP4) and transforming growth factor, beta 3 (TGFB3) are involved in the TGF-β signaling pathway. Genes including BMP4, TGFBI and matrix Gla protein (MGP) were hub genes. Moreover, no LOH event for BMP4 and MGP was found, that for sphingosine kinase 1 (SPHK1) was 70%, and for TGFBI was 40%. Our data suggested that BMP4, MGP, TGFBI, and SPHK1 may be important in CAFs-associated NSCLC, and the abnormal expression and high LOH frequency of them may be used as the diagnosis targets of CAFs in NSCLC.

  15. Dysregulation of gene expression as a cause of Cockayne syndrome neurological disease.

    Science.gov (United States)

    Wang, Yuming; Chakravarty, Probir; Ranes, Michael; Kelly, Gavin; Brooks, Philip J; Neilan, Edward; Stewart, Aengus; Schiavo, Giampietro; Svejstrup, Jesper Q

    2014-10-07

    Cockayne syndrome (CS) is a multisystem disorder with severe neurological symptoms. The majority of CS patients carry mutations in Cockayne syndrome group B (CSB), best known for its role in transcription-coupled nucleotide excision repair. Indeed, because various repair pathways are compromised in patient cells, CS is widely considered a genome instability syndrome. Here, we investigate the connection between the neuropathology of CS and dysregulation of gene expression. Transcriptome analysis of human fibroblasts revealed that even in the absence of DNA damage, CSB affects the expression of thousands of genes, many of which are neuronal genes. CSB is present in a significant subset of these genes, suggesting that regulation is direct, at the level of transcription. Importantly, reprogramming of CS fibroblasts to neuron-like cells is defective unless an exogenous CSB gene is introduced. Moreover, neuroblastoma cells from which CSB is depleted show defects in gene expression programs required for neuronal differentiation, and fail to differentiate and extend neurites. Likewise, neuron-like cells cannot be maintained without CSB. Finally, a number of disease symptoms may be explained by marked gene expression changes in the brain of patients with CS. Together, these data point to dysregulation of gene regulatory networks as a cause of the neurological symptoms in CS.

  16. Mining tissue specificity, gene connectivity and disease association to reveal a set of genes that modify the action of disease causing genes

    Directory of Open Access Journals (Sweden)

    Reverter Antonio

    2008-09-01

    Full Text Available Abstract Background The tissue specificity of gene expression has been linked to a number of significant outcomes including level of expression, and differential rates of polymorphism, evolution and disease association. Recent studies have also shown the importance of exploring differential gene connectivity and sequence conservation in the identification of disease-associated genes. However, no study relates gene interactions with tissue specificity and disease association. Methods We adopted an a priori approach making as few assumptions as possible to analyse the interplay among gene-gene interactions with tissue specificity and its subsequent likelihood of association with disease. We mined three large datasets comprising expression data drawn from massively parallel signature sequencing across 32 tissues, describing a set of 55,606 true positive interactions for 7,197 genes, and microarray expression results generated during the profiling of systemic inflammation, from which 126,543 interactions among 7,090 genes were reported. Results Amongst the myriad of complex relationships identified between expression, disease, connectivity and tissue specificity, some interesting patterns emerged. These include elevated rates of expression and network connectivity in housekeeping and disease-associated tissue-specific genes. We found that disease-associated genes are more likely to show tissue specific expression and most frequently interact with other disease genes. Using the thresholds defined in these observations, we develop a guilt-by-association algorithm and discover a group of 112 non-disease annotated genes that predominantly interact with disease-associated genes, impacting on disease outcomes. Conclusion We conclude that parameters such as tissue specificity and network connectivity can be used in combination to identify a group of genes, not previously confirmed as disease causing, that are involved in interactions with disease causing

  17. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  18. Bioinformatic analysis of Rp1 gene causing visual disparity in humans

    African Journals Online (AJOL)

    Retinitis pigmentosa (RP) is a group of inherited diseases that damage rod and cone cells located in human retina. A nonsense mutation R677X has been identified in RP1 gene which not only causes mRNA degradation but also results in truncated protein production leading towards visual disparity in humans. Secondary ...

  19. Bioinformatic analysis of Rp1 gene causing visual disparity in humans

    African Journals Online (AJOL)

    user

    Bioinformatic analysis of Rp1 gene causing visual disparity in humans. Sana Zahra and Hamid Rashid*. Department of Bioinformatics, Mohammad Ali Jinnah University, Islamabad, Pakistan. Accepted 5 November, 2010. Retinitis pigmentosa (RP) is a group of inherited diseases that damage rod and cone cells located in.

  20. Characterization of V71M mutation in the aquaporin-2 gene causing ...

    Indian Academy of Sciences (India)

    ... Discussion Meetings · Public Lectures · Lecture Workshops · Refresher Courses · Symposia. Home; Journals; Journal of Genetics; Volume 87; Issue 3. Characterization of V71M mutation in the aquaporin-2 gene causing nephrogenic diabetes insipidus. N. Bougacha-Elleuch M. Ben Lassoued N. Miled S. Zouari H. Ayadi.

  1. Congenital isolated adrenocorticotropin deficiency: an underestimated cause of neonatal death, explained by TPIT gene mutations.

    NARCIS (Netherlands)

    Vallette-Kasic, S.; Brue, T.; Pulichino, A.M.; Gueydan, M.; Barlier, A.; David, M.; Nicolino, M.; Malpuech, G.; Dechelotte, P.; Deal, C.; Vliet, G. van; Vroede, M.A. de; Riepe, F.G.; Partsch, C.J.; Sippell, W.G.; Berberoglu, M.; Atasay, B.; Zegher, F. de; Beckers, D.; Kyllo, J.; Donohoue, P.; Fassnacht, M.; Hahner, S.; Allolio, B.; Noordam, C.; Dunkel, L.; Hero, M.; Pigeon, B.; Weill, J.; Yigit, S.; Brauner, R.; Heinrich, J.J.; Cummings, E.; Riddell, C.; Enjalbert, A.; Drouin, J.

    2005-01-01

    Tpit is a T box transcription factor important for terminal differentiation of pituitary proopiomelanocortin-expressing cells. We demonstrated that human and mouse mutations of the TPIT gene cause a neonatal-onset form of congenital isolated ACTH deficiency (IAD). In the absence of glucocorticoid

  2. An exonic insertion within Tex14 gene causes spermatogenic arrest in pigs

    Directory of Open Access Journals (Sweden)

    Sironen Anu

    2011-12-01

    Full Text Available Abstract Background Male infertility is an increasing problem in all domestic species including man. Localization and identification of genes involved in defects causing male infertility provide valuable information of specific events in sperm development. Sperm development is a complex process, where diploid spermatogonia develop into haploid, highly specialized spermatozoa. Correct expression and function of various genes and their protein products are required for production of fertile sperm. We have identified an infertility defect in Finnish Yorkshire boars caused by spermatogenic arrest. The aim of this study was to locate the disease associated region using genome wide screen with the PorcineSNP60 Beadchip and identify the causal mutation by candidate gene approach. Results In the Finnish Yorkshire pig population the spermatogenic arrest (SA defect appears to be of genetic origin and causes severe degeneration of germ cells and total absence of spermatozoa. Genome wide scan with the PorcineSNP60 Beadchip localized the SA defect to porcine chromosome 12 in a 2 Mbp region. Sequencing of a candidate gene Tex14 revealed a 51 bp insertion within exon 27, which caused differential splicing of the exon and created a premature translation stop codon. The expression of Tex14 was markedly down regulated in the testis of a SA affected boar compared to control boars and no protein product was identified by Western blotting. The SA insertion sequence was also found within intron 27 in all analyzed animals, thus the insertion appears to be a possible duplication event. Conclusion In this study we report the identification of a causal mutation for infertility caused by spermatogenic arrest at an early meiotic phase. Our results highlight the role of TEX14 specifically in spermatogenesis and the importance of specific genomic remodeling events as causes for inherited defects.

  3. Staphylococcal food poisoning caused by Staphylococcus argenteus harboring staphylococcal enterotoxin genes.

    Science.gov (United States)

    Wakabayashi, Yuki; Umeda, Kaoru; Yonogi, Shinya; Nakamura, Hiromi; Yamamoto, Kaori; Kumeda, Yuko; Kawatsu, Kentaro

    2018-01-16

    Staphylococcal food poisoning (SFP) is caused by staphylococcal enterotoxins (SEs) preformed in food materials. SE genes are encoded on mobile genetic elements and are widely found across Staphylococcus species including S. argenteus, although most SFP cases are caused by S. aureus. S. argenteus, recently discriminated from S. aureus as a novel species, are non-pigmented staphylococci phenotypically related to S. aureus. In 2014 and 2015, two independent food poisoning cases occurred in Osaka, Japan, in which non-pigmented staphylococci were predominantly isolated. Several enterotoxin genes (seb, seg, sei, sem, sen, seo, and selu2) were found in their genome and the production of SEB was confirmed by reverse passive agglutination tests. The non-pigmented isolates from patients, food handlers, food, and cooking utensils all produced the same pulsed-field gel electrophoresis pattern. These non-pigmented isolates were coagulase-positive and biochemically identical to S. aureus. We performed further genetic analysis using nucA sequencing and multi-locus sequence typing, and identified these isolates as S. argenteus. We also found that seb was encoded on the Staphylococcus aureus pathogenicity island, while seg, sei, sem, sen, seo, and selu2 were encoded on the enterotoxin gene cluster. From these results, we concluded that the two food poisoning outbreaks were SFP cases caused by S. argenteus harboring SE genes. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. One Base Deletion (c.2422delT) in the TPO Gene Causes Severe Congenital Hypothyroidism.

    Science.gov (United States)

    Cangül, Hakan; Doğan, Murat; Sağlam, Yaman; Kendall, Michaela; Boelaert, Kristien; Barrett, Timothy G; Maher, Eamonn R

    2014-09-01

    Congenital hypothyroidism (CH) is the most common neonatal endocrine disorder and mutations in the TPO gene have been reported to cause CH. Our aim in this study was to determine the genetic basis of CH in two affected individuals coming from a consanguineous family. Since CH is usually inherited in autosomal recessive manner in consanguineous/multi-case families, we adopted a two-stage strategy of genetic linkage studies and targeted sequencing of the candidate genes. First, we investigated the potential genetic linkage of the family to any known CH locus using microsatellite markers and then screened for mutations in linked-gene by Sanger sequencing. The family showed potential linkage to the TPO gene and we detected a deletion (c.2422delT) in both cases. The mutation segregated with disease status in the family. This study demonstrates that a single base deletion in the carboxyl-terminal coding region of the TPO gene could cause CH and helps to establish a genotype/phenotype correlation associated with the mutation. The study also highlights the importance of molecular genetic studies in the definitive diagnosis and accurate classification of CH.

  5. Mutations in Three Genes Encoding Proteins Involved in Hair Shaft Formation Cause Uncombable Hair Syndrome

    DEFF Research Database (Denmark)

    Ü Basmanav, F Buket; Cau, Laura; Tafazzoli, Aylar

    2016-01-01

    to being combed flat. Until now, both simplex and familial UHS-affected case subjects with autosomal-dominant as well as -recessive inheritance have been reported. However, none of these case subjects were linked to a molecular genetic cause. Here, we report the identification of UHS-causative mutations...... located in the three genes PADI3 (peptidylarginine deiminase 3), TGM3 (transglutaminase 3), and TCHH (trichohyalin) in a total of 11 children. All of these individuals carry homozygous or compound heterozygous mutations in one of these three genes, indicating an autosomal-recessive inheritance pattern...

  6. Gene Augmentation for X-Linked Retinitis Pigmentosa Caused by Mutations in RPGR

    Science.gov (United States)

    Beltran, William A.; Cideciyan, Artur V.; Lewin, Alfred S.; Hauswirth, William W.; Jacobson, Samuel G.; Aguirre, Gustavo D.

    2015-01-01

    X-linked retinitis pigmentosa (XLRP) caused by mutations in the RPGR gene is a severe and early onset form of retinal degeneration, and no treatment is currently available. Recent evidence in two clinically relevant canine models shows that adeno-associated viral (AAV)-mediated RPGR gene transfer to rods and cones can prevent disease onset and rescue photoreceptors at early- and mid-stages of degeneration. There is thus a strong incentive for conducting long-term, preclinical efficacy and safety studies, while concomitantly pursuing the detailed phenotypic characterization of XLRP disease in patients that may benefit from such corrective therapy. PMID:25301933

  7. Gene Therapy for the Retinal Degeneration of Usher Syndrome Caused by Mutations in MYO7A.

    Science.gov (United States)

    Lopes, Vanda S; Williams, David S

    2015-01-20

    Usher syndrome is a deaf-blindness disorder. One of the subtypes, Usher 1B, is caused by loss of function of the gene encoding the unconventional myosin, MYO7A. A variety of different viral-based delivery approaches have been tested for retinal gene therapy to prevent the blindness of Usher 1B, and a clinical trial based on one of these approaches has begun. This review evaluates the different approaches. Copyright © 2015 Cold Spring Harbor Laboratory Press; all rights reserved.

  8. Host-induced gene silencing inhibits the biotrophic pathogen causing downy mildew of lettuce.

    Science.gov (United States)

    Govindarajulu, Manjula; Epstein, Lynn; Wroblewski, Tadeusz; Michelmore, Richard W

    2015-09-01

    Host-induced gene silencing (HIGS) is an RNA interference-based approach in which small interfering RNAs (siRNAs) are produced in the host plant and subsequently move into the pathogen to silence pathogen genes. As a proof-of-concept, we generated stable transgenic lettuce plants expressing siRNAs targeting potentially vital genes of Bremia lactucae, a biotrophic oomycete that causes downy mildew, the most important disease of lettuce worldwide. Transgenic plants, expressing inverted repeats of fragments of either the Highly Abundant Message #34 (HAM34) or Cellulose Synthase (CES1) genes of B. lactucae, specifically suppressed expression of these genes, resulting in greatly reduced growth and inhibition of sporulation of B. lactucae. This demonstrates that HIGS can provide effective control of B. lactucae in lettuce; such control does not rely on ephemeral resistance conferred by major resistance genes and therefore offers new opportunities for durable control of diverse diseases in numerous crops. © 2014 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. Genes and Gut Bacteria Involved in Luminal Butyrate Reduction Caused by Diet and Loperamide

    Directory of Open Access Journals (Sweden)

    Nakwon Hwang

    2017-11-01

    Full Text Available Unbalanced dietary habits and gut dysmotility are causative factors in metabolic and functional gut disorders, including obesity, diabetes, and constipation. Reduction in luminal butyrate synthesis is known to be associated with gut dysbioses, and studies have suggested that restoring butyrate formation in the colon may improve gut health. In contrast, shifts in different types of gut microbiota may inhibit luminal butyrate synthesis, requiring different treatments to restore colonic bacterial butyrate synthesis. We investigated the influence of high-fat diets (HFD and low-fiber diets (LFD, and loperamide (LPM administration, on key bacteria and genes involved in reduction of butyrate synthesis in mice. MiSeq-based microbiota analysis and HiSeq-based differential gene analysis indicated that different types of bacteria and genes were involved in butyrate metabolism in each treatment. Dietary modulation depleted butyrate kinase and phosphate butyryl transferase by decreasing members of the Bacteroidales and Parabacteroides. The HFD also depleted genes involved in succinate synthesis by decreasing Lactobacillus. The LFD and LPM treatments depleted genes involved in crotonoyl-CoA synthesis by decreasing Roseburia and Oscilllibacter. Taken together, our results suggest that different types of bacteria and genes were involved in gut dysbiosis, and that selected treatments may be needed depending on the cause of gut dysfunction.

  10. Mutation in the Prothrombin Gene G20210A as a Cause of Cerebral Venous Thrombosis

    Directory of Open Access Journals (Sweden)

    Jorge A. Arroyave

    2012-01-01

    Full Text Available Introduction. Cerebral venous sinus thrombosis (CVST is a rare form of cerebrovascular disease, which may manifest clinically by a wide variety of signs and symptoms. It has been associated with multiple risk factors including genetic or acquired blood disorders, infections, and trauma. Case Report. Man of 17 years who presented with 10 days of intense global headache with nausea and vomiting and subsequent onset of mild hemiparesis and hypoesthesia in right hemibody. Studies show venous thrombosis of the superior longitudinal sinus. It was identified a gene mutation in prothrombin G20210A as a probable cause of the thrombosis. Conclusions. Substitution of guanine for adenine at nucleotide 20210 in the coding region of the prothrombin gene is the second most common primary thrombophilia. Multiple cases of CVST have been associated with this mutation. In the presence of CVST must be considered the primary studies for thrombophilia gene mutations, including prothrombin G20210A.

  11. A novel mutation in the SH3BP2 gene causes cherubism: case report

    Directory of Open Access Journals (Sweden)

    Yu Shi-Feng

    2006-12-01

    Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

  12. A novel mutation in the SH3BP2 gene causes cherubism: case report.

    Science.gov (United States)

    Li, Cui-Ying; Yu, Shi-Feng

    2006-12-05

    Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2) may be involved. We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

  13. Identification of two novel mutations in the ATP7B gene that cause Wilson's disease

    Institute of Scientific and Technical Information of China (English)

    Hong-Wen Zhu; Yu-Min Li; Zhong-Bin Tao; Gang Su; Qiao-Ying Jin; Liang-Tao Zhao; Jia-Rui Zhu; Jun Yan; Tian-Yu Yu; Jie-Xian Ding

    2017-01-01

    Background:Wilson's disease is an autosomal recessive disorder characterized by liver disease and/or neurologic deficits due to copper accumulation and is caused by pathogenic mutations in the ATP7B gene.Methods:Two unrelated Chinese patients born to nonconsanguineous parents who were diagnosed with earlyonset Wiison's disease.DNA sequencing and bioinformation analysis were conducted.Results:We have identified four mutations in two family trios,of which two were novel,namely,c.3028A>G(p.K1010E) and c3992T>G (p.Y1331X),in each patient.Conclusions:Gene testing is playing an important role in diagnosis of Wilson's disease.The early-onset of Wilson's disease is apparently not associated with P-ATPase domain in the ATP7B protein.Our findings further widen the spectrum of mutations involving the ATP7B gene.

  14. First contiguous gene deletion causing biotinidase deficiency: The enzyme deficiency in three Sri Lankan children

    Directory of Open Access Journals (Sweden)

    Danika Nadeen Senanayake

    2015-03-01

    Full Text Available We report three symptomatic children with profound biotinidase deficiency from Sri Lanka. All three children presented with typical clinical features of the disorder. The first is homozygous for a missense mutation in the BTD gene (c.98_104 del7insTCC; p.Cys33PhefsX36 that is commonly seen in the western countries, the second is homozygous for a novel missense mutation (p.Ala439Asp, and the third is the first reported instance of a contiguous gene deletion causing the enzyme deficiency. In addition, this latter finding exemplifies the importance of considering a deletion within the BTD gene for reconciling enzymatic activity with genotype, which can occur in asymptomatic children who are identified by newborn screening.

  15. Congenital goitrous primary hypothyroidism in two German families caused by novel thyroid peroxidase (TPO) gene mutations.

    Science.gov (United States)

    Altmann, K; Hermanns, P; Mühlenberg, R; Fricke-Otto, S; Wentzell, R; Pohlenz, J

    2013-06-01

    Congenital hypothyroidism occurs with a prevalence of approximately 1:3 500. Defects in thyroid hormone synthesis which lead to goitrous hypothyroidism account for 10-15% of these cases. Several genetic defects have been characterized and mutations in the thyroid peroxidase (TPO) gene are the most common cause for dyshormonogenesis.So far, more than 80 mutations in the TPO gene have been described, resulting in a variable decrease in TPO bioactivity. Clinically TPO defects manifest with congenital primary goitrous hypothyroidism.We here present 2 children with congenital primary hypothyroidism, who were identified to have compound heterozygous TPO mutations. They both shared the same novel mutation in the TPO gene (C756R) in exon 13. One case presented with an apparently dominant inheritance of thyroid dyshormonogenesis. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.

  16. Alpharetroviral Vectors: From a Cancer-Causing Agent to a Useful Tool for Human Gene Therapy

    Directory of Open Access Journals (Sweden)

    Julia D. Suerth

    2014-12-01

    Full Text Available Gene therapy using integrating retroviral vectors has proven its effectiveness in several clinical trials for the treatment of inherited diseases and cancer. However, vector-mediated adverse events related to insertional mutagenesis were also observed, emphasizing the need for safer therapeutic vectors. Paradoxically, alpharetroviruses, originally discovered as cancer-causing agents, have a more random and potentially safer integration pattern compared to gammaretro- and lentiviruses. In this review, we provide a short overview of the history of alpharetroviruses and explain how they can be converted into state-of-the-art gene delivery tools with improved safety features. We discuss development of alpharetroviral vectors in compliance with regulatory requirements for clinical translation, and provide an outlook on possible future gene therapy applications. Taken together, this review is a broad overview of alpharetroviral vectors spanning the bridge from their parental virus discovery to their potential applicability in clinical settings.

  17. Venezuelan equine encephalitis virus infection causes modulation of inflammatory and immune response genes in mouse brain

    OpenAIRE

    Sharma, Anuj; Bhattacharya, Bhaskar; Puri, Raj K; Maheshwari, Radha K

    2008-01-01

    Abstract Background Neurovirulent Venezuelan equine encephalitis virus (VEEV) causes lethal encephalitis in equines and is transmitted to humans by mosquitoes. VEEV is highly infectious when transmitted by aerosol and has been developed as a bio-warfare agent, making it an important pathogen to study from a military and civilian standpoint. Molecular mechanisms of VEE pathogenesis are poorly understood. To study these, the gene expression profile of VEEV infected mouse brains was investigated...

  18. Absence of functional TolC protein causes increased stress response gene expression in Sinorhizobium meliloti

    Directory of Open Access Journals (Sweden)

    Moreira Leonilde M

    2010-06-01

    Full Text Available Abstract Background The TolC protein from Sinorhizobium meliloti has previously been demonstrated to be required for establishing successful biological nitrogen fixation symbiosis with Medicago sativa. It is also needed in protein and exopolysaccharide secretion and for protection against osmotic and oxidative stresses. Here, the transcriptional profile of free-living S. meliloti 1021 tolC mutant is described as a step toward understanding its role in the physiology of the cell. Results Comparison of tolC mutant and wild-type strains transcriptomes showed 1177 genes with significantly increased expression while 325 had significantly decreased expression levels. The genes with an increased expression suggest the activation of a cytoplasmic and extracytoplasmic stress responses possibly mediated by the sigma factor RpoH1 and protein homologues of the CpxRA two-component regulatory system of Enterobacteria, respectively. Stress conditions are probably caused by perturbation of the cell envelope. Consistent with gene expression data, biochemical analysis indicates that the tolC mutant suffers from oxidative stress. This is illustrated by the elevated enzyme activity levels detected for catalase, superoxide dismutase and glutathione reductase. The observed increase in the expression of genes encoding products involved in central metabolism and transporters for nutrient uptake suggests a higher metabolic rate of the tolC mutant. We also demonstrated increased swarming motility in the tolC mutant strain. Absence of functional TolC caused decreased expression mainly of genes encoding products involved in nitrogen metabolism and transport. Conclusion This work shows how a mutation in the outer membrane protein TolC, common to many bacterial transport systems, affects expression of a large number of genes that act in concert to restore cell homeostasis. This finding further underlines the fundamental role of this protein in Sinorhizobium meliloti biology.

  19. Sudden infant death syndrome caused by cardiac arrhythmias: only a matter of genes encoding ion channels?

    Science.gov (United States)

    Sarquella-Brugada, Georgia; Campuzano, Oscar; Cesar, Sergi; Iglesias, Anna; Fernandez, Anna; Brugada, Josep; Brugada, Ramon

    2016-03-01

    Sudden infant death syndrome is the unexpected demise of a child younger than 1 year of age which remains unexplained after a complete autopsy investigation. Usually, it occurs during sleep, in males, and during the first 12 weeks of life. The pathophysiological mechanism underlying the death is unknown, and the lethal episode is considered multifactorial. However, in cases without a conclusive post-mortem diagnosis, suspicious of cardiac arrhythmias may also be considered as a cause of death, especially in families suffering from any cardiac disease associated with sudden cardiac death. Here, we review current understanding of sudden infant death, focusing on genetic causes leading to lethal cardiac arrhythmias, considering both genes encoding ion channels as well as structural proteins due to recent association of channelopathies and desmosomal genes. We support a comprehensive analysis of all genes associated with sudden cardiac death in families suffering of infant death. It allows the identification of the most plausible cause of death but also of family members at risk, providing cardiologists with essential data to adopt therapeutic preventive measures in families affected with this lethal entity.

  20. HIV-1 infection causes a down-regulation of genes involved in ribosome biogenesis.

    Directory of Open Access Journals (Sweden)

    Claudia L Kleinman

    Full Text Available HIV-1 preferentially infects CD4+ T cells, causing fundamental changes that eventually lead to the release of new viral particles and cell death. To investigate in detail alterations in the transcriptome of the CD4+ T cells upon viral infection, we sequenced polyadenylated RNA isolated from Jurkat cells infected or not with HIV-1. We found a marked global alteration of gene expression following infection, with an overall trend toward induction of genes, indicating widespread modification of the host biology. Annotation and pathway analysis of the most deregulated genes showed that viral infection produces a down-regulation of genes associated with the nucleolus, in particular those implicated in regulating the different steps of ribosome biogenesis, such as ribosomal RNA (rRNA transcription, pre-rRNA processing, and ribosome maturation. The impact of HIV-1 infection on genes involved in ribosome biogenesis was further validated in primary CD4+ T cells. Moreover, we provided evidence by Northern Blot experiments, that host pre-rRNA processing in Jurkat cells might be perturbed during HIV-1 infection, thus strengthening the hypothesis of a crosstalk between nucleolar functions and viral pathogenesis.

  1. Human case of bacteremia caused by Streptococcus canis sequence type 9 harboring the scm gene.

    Science.gov (United States)

    Taniyama, Daisuke; Abe, Yoshihiko; Sakai, Tetsuya; Kikuchi, Takahide; Takahashi, Takashi

    2017-01-01

    Streptococcus canis (Sc) is a zoonotic pathogen that is transferred mainly from companion animals to humans. One of the major virulence factors in Sc is the M-like protein encoded by the scm gene, which is involved in anti-phagocytic activities, as well as the recruitment of plasminogen to the bacterial surface in cooperation with enolase, and the consequent enhancement of bacterial transmigration and survival. This is the first reported human case of uncomplicated bacteremia following a dog bite, caused by Streptococcus canis harboring the scm gene. The similarity of the 16S rRNA from the infecting species to that of the Sc type strain, as well as the amplification of the species-specific cfg gene, encoding a co-hemolysin, was used to confirm the species identity. Furthermore, the isolate was confirmed as sequence type 9. The partial scm gene sequence harbored by the isolate was closely related to those of other two Sc strains. While this isolate did not possess the erm(A), erm(B), or mef(A), macrolide/lincosamide resistance genes, it was not susceptible to azithromycin: its susceptibility was intermediate. Even though human Sc bacteremia is rare, clinicians should be aware of this microorganism, as well as Pasteurella sp., Prevotella sp., and Capnocytophaga sp., when examining and treating patients with fever who maintain close contact with companion animals.

  2. Nocturnal frontal lobe epilepsy caused by a mutation in the GATOR1 complex gene NPRL3.

    Science.gov (United States)

    Korenke, Georg-Christoph; Eggert, Marlene; Thiele, Holger; Nürnberg, Peter; Sander, Thomas; Steinlein, Ortrud K

    2016-03-01

    Mutations in NPRL3, one of three genes that encode proteins of the mTORC1-regulating GATOR1 complex, have recently been reported to cause cortical dysplasia with focal epilepsy. We have now analyzed a multiplex epilepsy family by whole exome sequencing and identified a frameshift mutation (NM_001077350.2; c.1522delG; p.E508Rfs*46) within exon 13 of NPRL3. This truncating mutation causes an epilepsy phenotype characterized by early childhood onset of mainly nocturnal frontal lobe epilepsy. The penetrance in our family was low (three affected out of six mutation carriers), compared to families with either ion channel- or DEPDC5-associated familial nocturnal frontal lobe epilepsy. The absence of apparent structural brain abnormalities suggests that mutations in NPRL3 are not necessarily associated with focal cortical dysplasia but might be able to cause epilepsy by different, yet unknown pathomechanisms. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  3. A Novel Mutation inERCC8Gene Causing Cockayne Syndrome.

    Science.gov (United States)

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  4. Biallelic germline mutations of mismatch-repair genes: a possible cause for multiple pediatric malignancies.

    Science.gov (United States)

    Poley, Jan-Werner; Wagner, Anja; Hoogmans, Monique M C P; Menko, Fred H; Tops, Carli; Kros, Johan M; Reddingius, Roel E; Meijers-Heijboer, Hanne; Kuipers, Ernst J; Dinjens, Winand N M

    2007-06-01

    Heterozygous defects in mismatch-repair (MMR) genes cause hereditary nonpolyposis colorectal cancer (HNPCC). In this syndrome, tumors typically arise from age 25 years onward. Case reports have shown that homozygosity or compound heterozygosity for MMR gene mutations can cause multiple tumors in childhood, sometimes combined with neurofibromatosis type I (NF1)-like features. Therefore, the authors studied the role of homozygosity or compound heterozygosity (CZ) for MMR gene defects in children with multiple primary tumors. A database that contained all pediatric oncology patients who were seen between 1982 and 2003 at the author's institution was queried to identify patients aged Saccharomyces cerevisiae 2 [PMS2] expression) and a Wilms tumor (high MSI; no MLH1 or PMS2 expression). Apart from >6 cafe-au-lait spots, he had no other signs of NF1. The patient had CZ identified for a pathogenic MLH1 mutation (593delAG frameshift) and an unclassified MLH1 variant (Met35Asn). There was strong evidence that this unclassified variant was a pathogenic mutation. The second patient was diagnosed with a non-Hodgkin lymphoma (no tissue available) and an anaplastic oligodendroglioma (low MSI; no MSH6 expression) at age 4 years and 6 years, respectively. His brother had died of a medulloblastoma at age 6 years (low MSI, no MSH6 expression). Both boys had cafe-au-lait spots. Further genetic testing was not possible. Carriage of biallelic MMR gene defects can be associated with multiple malignancies in childhood that may differ from the standard spectrum of HNPCC tumor types. In 15 pediatric patients with multiple malignancies, the authors identified 1 clear case and 1 possible case of biallelic MMR gene defect. Recognition of the inherited nature of the tumors in these patients is important for counseling these patients and their families. (c) 2007 American Cancer Society.

  5. Molecular analysis of the genes causing recessive demyelinating Charcot-Marie-Tooth disease in Japan.

    Science.gov (United States)

    Hayashi, Makiko; Abe, Akiko; Murakami, Tatsufumi; Yamao, Satoshi; Arai, Hidee; Hattori, Hideji; Iai, Mizue; Watanabe, Kyoko; Oka, Nobuyuki; Chida, Keiji; Kishikawa, Yumiko; Hayasaka, Kiyoshi

    2013-05-01

    Charcot-Marie-Tooth disease (CMT), the most common hereditary neuropathy, has been classified into two types, demyelinating and axonal types. We previously analyzed the genes causing dominant demyelinating CMT in 227 Japanese patients to identify the genetic background, but could not find any mutations in 110 patients. To investigate the frequency of patients with autosomal recessive demyelinating CMT (CMT4) mutations, we analyzed the coding sequence of known causative genes of CMT4 in 103 demyelinating CMT patients, excluding seven patients owing to lack of specimens. We found one patient with a GDAP1 mutation, one patient with an MTMR2 mutation, two patients with SH3TC2/KIAA1985 mutations and three patients with FGD4 mutations. Twelve patients, including five previously detected patients with PRX mutations, were diagnosed as CMT4, accounting for 5.5% of demyelinating CMT. In the patient with GDAP1 mutation, only one mutation inherited from his mother was detected by genomic sequencing. Analysis by reverse transcription polymerase chain reaction using messenger RNA (mRNA) from the patient's leukocytes revealed the absence of transcription from the allele inherited from his father, suggesting the existence of one more mutation leading to a lack or destabilization of mRNA. Most patients carrying CMT4 gene mutations present with early-onset and slowly progressive symptoms, which may be associated with the function of mutants. We could not identify the disease-causing gene in 96 patients (about 45%). Further studies including studies with next-generation sequencers will be required to identify the causative gene in Japanese CMT.

  6. A new mutation site in the AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Science.gov (United States)

    Zhu, Wufei; Hu, Zhen; Liao, Xiangyu; Chen, Xing; Huang, Wenrong; Zhong, Yu; Zeng, Zhaoyang

    2017-10-01

    Autoimmune polyendocrine syndrome type 1 (APS-1, OMIM 2403000) is a rare autosomal recessive disease that is caused by autoimmune regulator (AIRE). The main symptoms of APS-1 are chronic mucocutaneous candidiasis, autoimmune adrenocortical insufficiency (Addison's disease) and hypoparathyroidism. We collected APS-1 cases and analysed them. The AIRE genes of the patient and his family members were sequenced to identify whether the APS-1 patient had an AIRE mutation. We discovered a mutation site (c.206A>C) that had never before been reported in the AIRE gene located in exon 2 of the AIRE gene. This homogyzous mutation caused a substitution of the 69th amino acid of the AIRE protein from glutamine to proline (p.Q69P). A yeast two-hybrid assay, which was used to analyse the homodimerization properties of the mutant AIRE protein, showed that the mutant AIRE protein could not interact with the normal AIRE protein. Flow cytometry and RT-qPCR analyses indicated that the new mutation site could decrease the expression levels of the AIRE, glutamic acid decarboxylase 65 (GAD65) and tryptophan hydroxylase-1 (TPH1) proteins to affect central immune tolerance. In conclusion, our research has shown that the new mutation site (c.206A>C) may influence the homodimerization and expression levels and other aspects of the AIRE protein. It may also impact the expression levels of tissue-restricted antigens (TRAs), leading to a series of autoimmune diseases.

  7. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  8. Hepatoerythropoietic Porphyria Caused by a Novel Homoallelic Mutation in Uroporphyrinogen Decarboxylase Gene in Egyptian Patients.

    Science.gov (United States)

    Farrag, M S; Mikula, I; Richard, E; Saudek, V; De Verneuil, H; Martásek, P

    2015-01-01

    Porphyrias are metabolic disorders resulting from mutations in haem biosynthetic pathway genes. Hepatoerythropoietic porphyria (HEP) is a rare type of porphyria caused by the deficiency of the fifth enzyme (uroporphyrinogen decarboxylase, UROD) in this pathway. The defect in the enzymatic activity is due to biallelic mutations in the UROD gene. Currently, 109 UROD mutations are known. The human disease has an early onset, manifesting in infancy or early childhood with red urine, skin photosensitivity in sun-exposed areas, and hypertrichosis. Similar defects and links to photosensitivity and hepatopathy exist in several animal models, including zebrafish and mice. In the present study, we report a new mutation in the UROD gene in Egyptian patients with HEP. We show that the homozygous c.T163A missense mutation leads to a substitution of a conserved phenylalanine (amino acid 55) for isoleucine in the enzyme active site, causing a dramatic decrease in the enzyme activity (19 % of activity of wild-type enzyme). Inspection of the UROD crystal structure shows that Phe-55 contacts the substrate and is located in the loop that connects helices 2 and 3. Phe-55 is strictly conserved in both prokaryotic and eukaryotic UROD. The F55I substitution likely interferes with the enzyme-substrate interaction.

  9. XDH gene mutation is the underlying cause of classical xanthinuria: a second report.

    Science.gov (United States)

    Levartovsky, D; Lagziel, A; Sperling, O; Liberman, U; Yaron, M; Hosoya, T; Ichida, K; Peretz, H

    2000-06-01

    Classical xanthinuria is a rare autosomal recessive disorder characterized by excessive excretion of xanthine in urine. Type I disease results from the isolated deficiency of xanthine dehydrogenase (XDH), and type II results from dual deficiency of XDH and aldehyde oxidase. The XDH gene has been cloned and localized to chromosome 2p22-23. The aim of this study was to characterize the molecular basis of classical xanthinuria in an Iranian-Jewish family. The apparently unrelated parents originated from a community in which consanguineous marriages are common. Subtyping xanthinuria was attempted by homozygosity mapping using microsatellite markers D2S352, D2S367, and D2S2374 in the vicinity of the XDH gene. Mutation detection was accomplished by PCR-SSCP screening of all 36 exons and exon-intron junctions of the XDH gene, followed by direct sequencing and confirmation of sequence alteration by restriction analysis. The index case was homozygous for all three microsatellite markers analyzed. The expected frequency of this genotype in a control population was 0. 0002. These results suggested that xanthinuria in the patient is linked to the XDH gene. Consequently, a 1658insC mutation in exon 16 of the XDH gene was identified. The 1658insC mutation was not detected in 65 control DNA samples. A molecular approach to the diagnosis of classical xanthinuria type I in a female patient with profound hypouricemia is described. Linkage of xanthinuria to the XDH locus was demonstrated by homozygosity mapping, and a 1658insC mutation, predicting a truncated inactive XDH protein, was identified. These results reinforce the notion that mutations in the XDH gene are the underlying cause of classical xanthinuria type I.

  10. MASA syndrome is caused by mutations in the neural cell adhesion gene, L1CAM

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, C.E.; Wang, Y.; Schroer, R.J.; Stevenson, R.E. [Greenwood Genetic Center, SC (United States)

    1994-09-01

    The MASA syndrome is a recessive X-linked disorder characterized by Mental retardation, Adducted thumbs, Shuffling gait and Aphasia. Recently we found that MASA in one family was likely caused by a point mutation in exon 6 of the L1CAM gene. This gene has also been shown to be involved in X-linked hydrocephalus (HSAS). We have screened 60 patients with either sporadic HSAS or MASA as well as two additional families with MASA. For the screening, we initially utilized 3 cDNA probes for the L1CAM gene. In one of the MASA families, K8310, two affected males were found to have an altered BglII band. The band was present in their carrier mother but not in their normal brothers. This band was detected by the entire cDNA probe as well as the cDNA probe for 3{prime} end of the gene. Analysis of the L1CAM sequence indicated the altered BglII site is distal to the exon 28 but proximal to the punative poly A signal site. It is hypothesized that this point mutation alters the stability of the L1CAM mRNA. This is being tested using cell lines established from the two affected males.

  11. Novel heterozygous tissue-nonspecific alkaline phosphatase (TNAP) gene mutations causing lethal perinatal hypophosphatasia.

    Science.gov (United States)

    Chang, Kai-Chi; Lin, Po-Han; Su, Yi-Ning; Peng, Steven Shinn-Forng; Lee, Ni-Chung; Chou, Hung-Chieh; Chen, Chien-Yi; Hsieh, Wu-Shiun; Tsao, Po-Nien

    2012-01-01

    Hypophosphatasia is a rare inherited disorder characterized by poor bone mineralization and deficiency of alkaline phosphatase activity. It is caused by mutations in the liver/bone/kidney alkaline phosphatase gene encoding the tissue-nonspecific isoenzyme of alkaline phosphatase (TNAP), which displays many allelic heterogeneities, leading to different clinical phenotypes. This study reports the case of a patient diagnosed with lethal perinatal hypophosphatasia. His gene analysis showed compound heterozygocity of two novel mutations: c.650delTinsCTAA and c.984_986delCTT, which led to p.217delVinsAK and p.328delF, respectively. The two mutations originated separately from his parents, consistent with autosomal recessive perinatal hypophosphatasia. For these two novel mutations, we analyzed their functions through three-dimensional structural analysis. This revealed that V217 is located in the β-sheet area, V217 is deleted, and insertion of alanine and lysine alter the secondary structure, causing instability in the hydrophobic region, which may influence the metal-binding vicinity. This mutant structure loses its catalytic activity. Deletion of 328F also results in protein structural alteration and affects TNAP functions. These results may provide an explanation of the two novel mutated alleles correlating with the lethal phenotype of our patient. In conclusion, we demonstrated the case of a patient with lethal perinatal hypophosphatasia caused by two novel heterozygous mutations.

  12. Cardiac gene defects can cause sudden cardiac death in young people.

    Science.gov (United States)

    Kauferstein, Silke; Kiehne, Nadine; Neumann, Thomas; Pitschner, Heinz-Friedrich; Bratzke, Hansjürgen

    2009-01-01

    In Europe, sudden cardiac death (SCD) is one of the most common causes of death. Although sudden cardiac death usually happens in older people, 5% to 10% of the affected individuals are young and apparently healthy. Sudden death in infants, children, and young adults is relatively rare, with an incidence of 1 to 5 per 100 000 persons per year. Nonetheless, up to 7000 asymptomatic children die in the USA each year, almost half of them without any warning signs or symptoms. Selective literature review. Although structural cardiovascular abnormalities explain most cases of sudden cardiac death in young people, the cause of death remains unexplained after autopsy in 10% to 30% of cases. Potentially lethal ion channel disorders (channelopathies) such as the long QT syndromes (LQTS), catecholaminergic polymorphic ventricular tachycardia (CPVT), and the Brugada syndrome (BrS) may account for at least one-third of these unexplained cases. Most of these diseases are hereditary with autosomal-dominant transmission, i.e., there is a 50% chance that the children of affected individuals will be affected themselves. Post-mortem genetic screening for sequence variations in cardiac ion channel genes has become an important forensic tool for elucidating the cause of sudden cardiac death. Moreover, it allows the identification of other family members bearing the previously undiagnosed gene defect, who can then undergo a cardiological evaluation if indicated by their clinical history.

  13. Mutations in Three Genes Encoding Proteins Involved in Hair Shaft Formation Cause Uncombable Hair Syndrome

    DEFF Research Database (Denmark)

    Ü Basmanav, F Buket; Cau, Laura; Tafazzoli, Aylar

    2016-01-01

    to being combed flat. Until now, both simplex and familial UHS-affected case subjects with autosomal-dominant as well as -recessive inheritance have been reported. However, none of these case subjects were linked to a molecular genetic cause. Here, we report the identification of UHS-causative mutations......Uncombable hair syndrome (UHS), also known as "spun glass hair syndrome," "pili trianguli et canaliculi," or "cheveux incoiffables" is a rare anomaly of the hair shaft that occurs in children and improves with age. UHS is characterized by dry, frizzy, spangly, and often fair hair that is resistant...... located in the three genes PADI3 (peptidylarginine deiminase 3), TGM3 (transglutaminase 3), and TCHH (trichohyalin) in a total of 11 children. All of these individuals carry homozygous or compound heterozygous mutations in one of these three genes, indicating an autosomal-recessive inheritance pattern...

  14. Germline heterozygous variants in genes associated with familial hemophagocytic lymphohistiocytosis as a cause of increased bleeding

    DEFF Research Database (Denmark)

    Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria

    2017-01-01

    Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...... platelet function. Therefore, we aimed to investigate platelet degranulation in patients heterozygous for variants in UNC13D, STX11 and STXBP2. During the work-up of patients referred to the Coagulation Unit, Skåne University Hospital, Malmö, Sweden and the Department of Hematology, Rigshospitalet......, Copenhagen, Denmark due to bleeding tendencies, 12 patients harboring heterozygous variants in UNC13D, STX11 or STXBP2 were identified using targeted whole exome sequencing. Transmission electron microscopy (TEM) was used to assess the secretion of platelet dense granules following thrombin stimulation...

  15. Disrupted auto-regulation of the spliceosomal gene SNRPB causes cerebro–costo–mandibular syndrome

    Science.gov (United States)

    Lynch, Danielle C.; Revil, Timothée; Schwartzentruber, Jeremy; Bhoj, Elizabeth J.; Innes, A. Micheil; Lamont, Ryan E.; Lemire, Edmond G.; Chodirker, Bernard N.; Taylor, Juliet P.; Zackai, Elaine H.; McLeod, D. Ross; Kirk, Edwin P.; Hoover-Fong, Julie; Fleming, Leah; Savarirayan, Ravi; Boycott, Kym; MacKenzie, Alex; Brudno, Michael; Bulman, Dennis; Dyment, David; Majewski, Jacek; Jerome-Majewska, Loydie A.; Parboosingh, Jillian S.; Bernier, Francois P.

    2014-01-01

    Elucidating the function of highly conserved regulatory sequences is a significant challenge in genomics today. Certain intragenic highly conserved elements have been associated with regulating levels of core components of the spliceosome and alternative splicing of downstream genes. Here we identify mutations in one such element, a regulatory alternative exon of SNRPB as the cause of cerebro–costo–mandibular syndrome. This exon contains a premature termination codon that triggers nonsense-mediated mRNA decay when included in the transcript. These mutations cause increased inclusion of the alternative exon and decreased overall expression of SNRPB. We provide evidence for the functional importance of this conserved intragenic element in the regulation of alternative splicing and development, and suggest that the evolution of such a regulatory mechanism has contributed to the complexity of mammalian development. PMID:25047197

  16. Disrupted auto-regulation of the spliceosomal gene SNRPB causes cerebro-costo-mandibular syndrome.

    Science.gov (United States)

    Lynch, Danielle C; Revil, Timothée; Schwartzentruber, Jeremy; Bhoj, Elizabeth J; Innes, A Micheil; Lamont, Ryan E; Lemire, Edmond G; Chodirker, Bernard N; Taylor, Juliet P; Zackai, Elaine H; McLeod, D Ross; Kirk, Edwin P; Hoover-Fong, Julie; Fleming, Leah; Savarirayan, Ravi; Majewski, Jacek; Jerome-Majewska, Loydie A; Parboosingh, Jillian S; Bernier, Francois P

    2014-07-22

    Elucidating the function of highly conserved regulatory sequences is a significant challenge in genomics today. Certain intragenic highly conserved elements have been associated with regulating levels of core components of the spliceosome and alternative splicing of downstream genes. Here we identify mutations in one such element, a regulatory alternative exon of SNRPB as the cause of cerebro-costo-mandibular syndrome. This exon contains a premature termination codon that triggers nonsense-mediated mRNA decay when included in the transcript. These mutations cause increased inclusion of the alternative exon and decreased overall expression of SNRPB. We provide evidence for the functional importance of this conserved intragenic element in the regulation of alternative splicing and development, and suggest that the evolution of such a regulatory mechanism has contributed to the complexity of mammalian development.

  17. A new mutation of the fukutin gene causing late-onset limb girdle muscular dystrophy

    DEFF Research Database (Denmark)

    Riisager, Maria; Duno, M; Hansen, Flemming Juul

    2013-01-01

    to episodes of tachycardia caused by Wolff-Parkinson-White syndrome. On examination, she had rigid spine syndrome, a typical limb girdle dystrophy pattern of muscle weakness, cardiomyopathy, and serum CK levels >2000 IU/L (normal G; p.Y306C mutation in the FKTN gene was found. The case confirms FKTN mutations...... to aberrations of FKTN is rare, with only eight reported cases of limb girdle phenotype (LGMD2M). We describe the mildest affected patient outside Japan with genetically confirmed LGMD2M and onset of symptoms at age 14. She was brought to medical attention at age 12, not because of muscle weakness, but due...... as a cause of LGMD2M without mental retardation and expands the phenotypic spectrum for LGMD2M to include cardiomyopathy and rigid spine syndrome in the mildest affected non-Japanese patient reported so far....

  18. EPILEPSY CAUSED BY PCDH19 GENE MUTATION: A REVIEW OF LITERATURE AND THE AUTHORS’ OBSERVATIONS

    Directory of Open Access Journals (Sweden)

    K. Yu. Mukhin

    2016-01-01

    Full Text Available Mutation in the PCDH19 gene was first described by L.M. Dibbens et al. in 2008. Mutations in this gene are associated with epilepsy and mental retardation limited to females. The clinical manifestations that are observed in some patients with PCDH19 mutation and Dravet syndrome that is caused by mutation in the SCN1A gene include the onset of febrile and afebrile seizures in infancy, serial seizures during fever, and regression in development after the onset of seizures. Due to the fact that the two diseases have common clinical signs, it is best to test for PCDH19 mutation in patients with the clinical picture of Dravet syndrome and a negative test for SCN1A. In general, the number of scientific papers devoted to analysis and recommendations for the choice of therapy in patients with rare genetic pathology is small now. We analyzed the specific features of clinical signs and therapy in our two observed female patients aged 4 and 11 years with verified PCDH19 mutation. Both patients were noted to have severe epilepsy with febrile convulsions with the development of status epilepticus and to be unresponsive to antiepileptic therapy. The use of different antiepileptic drugs (valproate, oxcarbazepine, phenobarbital, topiramate, levetiracetam at different combinations failed to control the course of epilepsy in the 4-year-old patient whereas the 11-year-old patient who took a combination of valproic acid and benzodiazepines achieved a positive effect.

  19. Cutaneous Venous Malformations in Familial Cerebral Cavernomatosis Caused by KRIT1 Gene Mutations

    Science.gov (United States)

    Toll, Agustí; Parera, Elisabet; Giménez-Arnau, Ana M.; Pou, Alejandro; Lloreta, Josep; Limaye, Nisha; Vikkula, Miikka; Pujol, Ramon M.

    2009-01-01

    Background Cerebral cavernous malformations (CCMs) are vascular lesions characterized by abnormally enlarged capillary cavities without intervening brain parenchyma. Although often asymptomatic, seizures, cerebral haemorrhages and focal neurological deficits are well-documented complications. Mutations in the CCM1 (7q21–22), CCM2 (7p13–15) and CCM3 (3q25.2–27) genes have been identified in familial CCM. In rare instances, the association of congenital hyperkeratotic cutaneous capillary-venous malformations (HCCVMs) with CCM1 has been reported. Observations: We studied 6 members of a family with CCMs. Four members of the family developed late-onset multiple, tiny, bluish, soft, cutaneous papules, mainly located on the face, arm and abdominal area, corresponding histologically to venous malformations. A splice donor site mutation in intron 4 (c. 1146 + 1 G→A) in the CCM1 gene was identified. Conclusions Our findings suggest that mutations in the KRIT1 gene may cause phenotypically heterogeneous cutaneous vascular lesions other than those previously described as HCCVMs. PMID:19182478

  20. Mutations in the MESP2 Gene Cause Spondylothoracic Dysostosis/Jarcho-Levin Syndrome

    Science.gov (United States)

    Cornier, Alberto S.; Staehling-Hampton, Karen; Delventhal, Kym M.; Saga, Yumiko; Caubet, Jean-Francois; Sasaki, Nobuo; Ellard, Sian; Young, Elizabeth; Ramirez, Norman; Carlo, Simon E.; Torres, Jose; Emans, John B.; Turnpenny, Peter D.; Pourquié, Olivier

    2008-01-01

    Spondylothoracic dysostosis (STD), also known as Jarcho-Levin syndrome (JLS), is an autosomal-recessive disorder characterized by abnormal vertebral segmentation and defects affecting spine formation, with complete bilateral fusion of the ribs at the costovertebral junction producing a “crab-like” configuration of the thorax. The shortened spine and trunk can severely affect respiratory function during early childhood. The condition is prevalent in the Puerto Rican population, although it is a panethnic disorder. By sequencing a set of candidate genes involved in mouse segmentation, we identified a recessive E103X nonsense mutation in the mesoderm posterior 2 homolog (MESP2) gene in a patient, of Puerto Rican origin and from the Boston area, who had been diagnosed with STD/JLS. We then analyzed 12 Puerto Rican families with STD probands for the MESP2 E103X mutation. Ten patients were homozygous for the E103X mutation, three patients were compound heterozygous for a second nonsense mutation, E230X, or a missense mutation, L125V, which affects a conserved leucine residue within the bHLH region. Thus, all affected probands harbored the E103X mutation. Our findings suggest a founder-effect mutation in the MESP2 gene as a major cause of the classical Puerto Rican form of STD/JLS. PMID:18485326

  1. Two novel mutations in the PPIB gene cause a rare pedigree of osteogenesis imperfecta type IX.

    Science.gov (United States)

    Jiang, Yu; Pan, Jingxin; Guo, Dongwei; Zhang, Wei; Xie, Jie; Fang, Zishui; Guo, Chunmiao; Fang, Qun; Jiang, Weiying; Guo, Yibin

    2017-06-01

    Osteogenesis imperfecta (OI) is a rare genetic skeletal disorder characterized by increased bone fragility and vulnerability to fractures. PPIB is identified as a candidate gene for OI-IX, here we detect two pathogenic mutations in PPIB and analyze the genotype-phenotype correlation in a Chinese family with OI. Next-generation sequencing (NGS) was used to screen the whole exome of the parents of proband. Screening of variation frequency, evolutionary conservation comparisons, pathogenicity evaluation, and protein structure prediction were conducted to assess the pathogenicity of the novel mutations. Sanger sequencing was used to confirm the candidate variants. RTQ-PCR was used to analyze the PPIB gene expression. All mutant genes screened out by NGS were excluded except PPIB. Two novel heterozygous PPIB mutations (father, c.25A>G; mother, c.509G>A) were identified in relation to osteogenesis imperfecta type IX. Both mutations were predicted to be pathogenic by bioinformatics analysis and RTQ-PCR analysis revealed downregulated PPIB expression in the two carriers. We report a rare pedigree with an autosomal recessive osteogenesis imperfecta type IX (OI-IX) caused by two novel PPIB mutations identified for the first time in China. The current study expands our knowledge of PPIB mutations and their associated phenotypes, and provides new information on the genetic defects associated with this disease for clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Fetal and neonatal exposure to the endocrine disruptor methoxychlor causes epigenetic alterations in adult ovarian genes.

    Science.gov (United States)

    Zama, Aparna Mahakali; Uzumcu, Mehmet

    2009-10-01

    Exposure to endocrine-disrupting chemicals during development could alter the epigenetic programming of the genome and result in adult-onset disease. Methoxychlor (MXC) and its metabolites possess estrogenic, antiestrogenic, and antiandrogenic activities. Previous studies showed that fetal/neonatal exposure to MXC caused adult ovarian dysfunction due to altered expression of key ovarian genes including estrogen receptor (ER)-beta, which was down-regulated, whereas ERalpha was unaffected. The objective of the current study was to evaluate changes in global and gene-specific methylation patterns in adult ovaries associated with the observed defects. Rats were exposed to MXC (20 microg/kgxd or 100 mg/kg.d) between embryonic d 19 and postnatal d 7. We performed DNA methylation analysis of the known promoters of ERalpha and ERbeta genes in postnatal d 50-60 ovaries using bisulfite sequencing and methylation-specific PCRs. Developmental exposure to MXC led to significant hypermethylation in the ERbeta promoter regions (P fetal and neonatal development affects adult ovarian function via altered methylation patterns.

  3. A partial gene deletion of SLC45A2 causes oculocutaneous albinism in Doberman pinscher dogs.

    Directory of Open Access Journals (Sweden)

    Paige A Winkler

    Full Text Available The first white Doberman pinscher (WDP dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1 produce a detailed description of the ocular phenotype of WDPs, (2 objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3 determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs; cutaneous tumors were noted in 12/20 WDP (5 years of age: 8/8 and 1/20 SDPs (p<0.00001. Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051. This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.

  4. Conditional ablation of the choroideremia gene causes age-related changes in mouse retinal pigment epithelium.

    Directory of Open Access Journals (Sweden)

    Silène T Wavre-Shapton

    Full Text Available The retinal pigment epithelium (RPE is a pigmented monolayer of cells lying between the photoreceptors and a layer of fenestrated capillaries, the choriocapillaris. Choroideremia (CHM is an X-linked progressive degeneration of these three layers caused by the loss of function of Rab Escort protein-1 (REP1. REP1 is involved in the prenylation of Rab proteins, key regulators of membrane trafficking. To study the pathological consequences of chronic disruption of membrane traffic in the RPE we used a cell type-specific knock-out mouse model of the disease, where the Chm/Rep1 gene is deleted only in pigmented cells (Chm(Flox, Tyr-Cre+. Transmission electron microscopy (TEM was used to quantitate the melanosome distribution in the RPE and immunofluorescent staining of rhodopsin was used to quantitate phagocytosed rod outer segments in retinal sections. The ultrastructure of the RPE and Bruch's membrane at different ages was characterised by TEM to analyse age-related changes occurring as a result of defects in membrane traffic pathways. Chm/Rep1 gene knockout in RPE cells resulted in reduced numbers of melanosomes in the apical processes and delayed phagosome degradation. In addition, the RPE accumulated pathological changes at 5-6 months of age similar to those observed in 2-year old controls. These included the intracellular accumulation of lipofuscin-containing deposits, disorganised basal infoldings and the extracellular accumulation of basal laminar and basal linear deposits. The phenotype of the Chm(Flox, Tyr-Cre+ mice suggests that loss of the Chm/Rep1 gene causes premature accumulation of features of aging in the RPE. Furthermore, the striking similarities between the present observations and some of the phenotypes reported in age-related macular degeneration (AMD suggest that membrane traffic defects may contribute to the pathogenesis of AMD.

  5. Isolation of genes involved in biofilm formation of a Klebsiella pneumoniae strain causing pyogenic liver abscess.

    Directory of Open Access Journals (Sweden)

    Meng-Chuan Wu

    Full Text Available BACKGROUND: Community-acquired pyogenic liver abscess (PLA complicated with meningitis and endophthalmitis caused by Klebsiella pneumoniae is an emerging infectious disease. To investigate the mechanisms and effects of biofilm formation of K. pneumoniae causing PLA, microtiter plate assays were used to determine the levels of biofilm formed by K. pneumoniae clinical isolates and to screen for biofilm-altered mutants from a transposon mutant library of a K. pneumoniae PLA-associated strain. METHODOLOGY/PRINCIPAL FINDINGS: The biofilm formation of K. pneumoniae was examined by microtiter plate assay. Higher levels of biofilm formation were demonstrated by K. pneumoniae strains associated with PLA. A total of 23 biofilm-decreased mutants and 4 biofilm-increased mutants were identified. Among these mutants, a biofilm-decreased treC mutant displayed less mucoviscosity and produced less capsular polysaccharide (CPS, whereas a biofilm-increased sugE mutant displayed higher mucoviscosity and produced more CPS. The biofilm phenotypes of treC and sugE mutants also were confirmed by glass slide culture. Deletion of treC, which encodes trehalose-6-phosphate hydrolase, impaired bacterial trehalose utilization. Addition of glucose to the culture medium restored the capsule production and biofilm formation in the treC mutant. Transcriptional profile analysis suggested that the increase of CPS production in ΔsugE may reflect elevated cps gene expression (upregulated through rmpA in combination with increased treC expression. In vivo competition assays demonstrated that the treC mutant strain was attenuated in competitiveness during intragastric infection in mice. CONCLUSIONS/SIGNIFICANCE: Genes important for biofilm formation by K. pneumoniae PLA strain were identified using an in vitro assay. Among the identified genes, treC and sugE affect biofilm formation by modulating CPS production. The importance of treC in gastrointestinal tract colonization suggests

  6. Correlating gene expression with deformities caused by aryl hydrocarbon receptor agonists in zebrafish (Danio rerio)

    Energy Technology Data Exchange (ETDEWEB)

    Bugiak, B.; Weber, L. [Saskatchewan Univ., Saskatoon, SK (Canada)

    2009-07-01

    Exposure to aryl hydrocarbon receptor (AhR) agonists in fish causes lethal disturbances in fish development, but the effects of acute AhR agonist exposure on the cardiovascular system and deformities remain unclear. This study addressed this issue by performing a series of experiments on zebrafish (Danio rerio). The authors hypothesized that genes needed for cardiovascular regulation (PTGS) would exhibit a stronger link to deformities than detoxification enzymes (CYPs). Zebrafish eggs were exposed aqueously until 4 days post-fertilization (dpf) to the AhR agonists benzo(a)pyrene (BaP) or 2,3,7,8-tetrachlorodibenzop-dioxin (TCDD) alone and in combination with the putative AhR antagonists resveratrol or alpha-naphthoflavone (ANF). Gene expression was measured using real-time, reverse transcriptase PCR in zebrafish at 5 and 10 dpf. Although the mortalities did not differ considerably among groups at 10 dpf, the deformities increased significantly after BaP-ANF at 5 dpf and after BaP at 10 dpf, but not after TCDD treatment. CYP and PTGS isozymes exhibited small, but statistically significant changes at 5 dpf. By 10 dpf, the expression returned to control values. In general, CYP1A and PTGS-1 expression at 5 dpf were positively correlated with deformities, while all other genes were negatively correlated with deformities. It was concluded that changes in CYP1A, CYP1C2, and PTGS-1 gene expression at 5 dpf are associated with developmental deformities, but additional work is needed to determine which has the most important mechanistic link.

  7. MYH7 gene tail mutation causing myopathic profiles beyond Laing distal myopathy.

    Science.gov (United States)

    Muelas, N; Hackman, P; Luque, H; Garcés-Sánchez, M; Azorín, I; Suominen, T; Sevilla, T; Mayordomo, F; Gómez, L; Martí, P; María Millán, J; Udd, B; Vílchez, J J

    2010-08-24

    To describe a wide range of clinical and pathologic myopathic profiles associated with the p.K1729del mutation in the MYH7 gene, known to cause Laing distal myopathy. A study conducted in the Safor region (Spain), setting of a large cluster of patients. Clinical, neurophysiologic, muscle imaging, and muscle biopsy studies and MYH7 gene sequencing were investigated in 32 patients from 4 kindreds. Data from 36 deceased or nonexamined patients were collected from hospital records or relatives. Onset ranged from congenital to the 6th decade. All patients presented weakness of great toe/ankle dorsiflexors and many had associated neck flexor, finger extensor, and mild facial weakness. In most cases, involvement of proximal and axial muscles was observed either clinically or by muscle imaging, sometimes giving rise to scapuloperoneal and limb-girdle syndromes. Disabling myalgias, skeletal deformities, and dilated cardiomyopathy in one patient were associated features. Life expectancy was not reduced but the spectrum of disability ranged from asymptomatic to wheelchair confined. Electromyographic neurogenic features were frequently recorded. Muscle fiber type disproportion, core/minicore lesions, and mitochondrial abnormalities were the most relevant pathologic alterations. All patients carried the p.K1729del mutation in MYH7. The p.K1729del mutation in the MYH7 gene expresses notable clinical variability and electromyographic and pathologic features that can lead to the misdiagnosis of neurogenic atrophies, congenital myopathies, or mitochondrial myopathies. Mutations in genes encoding other sarcomeric and reticulo-sarcoplasmic proteins involved in calcium regulation share pathologic characteristics with our patients, suggesting a possible pathogenetic connection.

  8. SVA retrotransposition in exon 6 of the coagulation factor IX gene causing severe hemophilia B.

    Science.gov (United States)

    Nakamura, Yuki; Murata, Moe; Takagi, Yuki; Kozuka, Toshihiro; Nakata, Yukiko; Hasebe, Ryo; Takagi, Akira; Kitazawa, Jun-ichi; Shima, Midori; Kojima, Tetsuhito

    2015-07-01

    Hemophilia B is an X-linked recessive bleeding disorder caused by abnormalities of the coagulation factor IX gene (F9). Insertion mutations in F9 ranging from a few to more than 100 base pairs account for only a few percent of all hemophilia B cases. We investigated F9 to elucidate genetic abnormalities causing severe hemophilia B in a Japanese subject. We performed PCR-mediated analysis of F9 and identified a large insertion in exon 6. Next, we carried out direct sequencing of a PCR clone of the whole insert using nested deletion by exonuclease III and S1 nuclease. We identified an approximately 2.5-kb SINE-VNTR-Alu (SVA)-F element flanked by 15-bp duplications in the antisense orientation in exon 6. Additionally, we carried out exontrap analysis to assess the effect of this retrotransposition on mRNA splicing. We observed that regular splicing at exons 5 and 6 of F9 was disturbed by the SVA retrotransposition, suggesting that abnormal FIX mRNA may be reduced by nonsense-mediated mRNA decay. In conclusion, this is the first report of SVA retrotransposition causing severe hemophilia B; only five cases of LINE-1 or Alu retrotranspositions in F9 have been reported previously.

  9. The Arabidopsis thaliana homeobox gene ATHB12 is involved in symptom development caused by geminivirus infection.

    Directory of Open Access Journals (Sweden)

    Jungan Park

    Full Text Available BACKGROUND: Geminiviruses are single-stranded DNA viruses that infect a number of monocotyledonous and dicotyledonous plants. Arabidopsis is susceptible to infection with the Curtovirus, Beet severe curly top virus (BSCTV. Infection of Arabidopsis with BSCTV causes severe symptoms characterized by stunting, leaf curling, and the development of abnormal inflorescence and root structures. BSCTV-induced symptom development requires the virus-encoded C4 protein which is thought to interact with specific plant-host proteins and disrupt signaling pathways important for controlling cell division and development. Very little is known about the specific plant regulatory factors that participate in BSCTV-induced symptom development. This study was conducted to identify specific transcription factors that are induced by BSCTV infection. METHODOLOGY/PRINCIPAL FINDINGS: Arabidopsis plants were inoculated with BSCTV and the induction of specific transcription factors was monitored using quantitative real-time polymerase chain reaction assays. We found that the ATHB12 and ATHB7 genes, members of the homeodomain-leucine zipper family of transcription factors previously shown to be induced by abscisic acid and water stress, are induced in symptomatic tissues of Arabidopsis inoculated with BSCTV. ATHB12 expression is correlated with an array of morphological abnormalities including leaf curling, stunting, and callus-like structures in infected Arabidopsis. Inoculation of plants with a BSCTV mutant with a defective c4 gene failed to induce ATHB12. Transgenic plants expressing the BSCTV C4 gene exhibited increased ATHB12 expression whereas BSCTV-infected ATHB12 knock-down plants developed milder symptoms and had lower ATHB12 expression compared to the wild-type plants. Reporter gene studies demonstrated that the ATHB12 promoter was responsive to BSCTV infection and the highest expression levels were observed in symptomatic tissues where cell cycle genes also were

  10. Partial nephrogenic diabetes insipidus caused by a novel mutation in the AVPR2 gene

    DEFF Research Database (Denmark)

    Færch, Mia; Christensen, Jane H; Corydon, Thomas J

    2008-01-01

    Objective To identify the molecular basis and clinical characteristics of X-linked congenital nephrogenic diabetes insipidus (CNDI) presenting with an unusual phenotype characterized by partial resistance to AVP. Subjects The proband was admitted at the age of 4 years with a history of polydipsia...... and polyuria since infancy. Initial clinical testing confirmed a diagnosis of diabetes insipidus (DI). Urine osmolarity rose during fluid deprivation and after 20 microg of intranasal desmopressin [1-deamino-8-d-arginine-vasopressin (dDAVP)]. A similar DI phenotype was found in his brother. Methods The coding...... output. Discussion The affected members of this Belgian kindred have CNDI with partial resistance to AVP caused by a mutation in the AVPR2 gene that differs from any of the six mutations reported previously to produce this phenotype. Because the resistance to AVP is partial, this form of CNDI can...

  11. Targeted disruption of the spermatid-specific gene Spata31 causes male infertility.

    Science.gov (United States)

    Wu, Yuan-Yi; Yang, Yong; Xu, Yong-De; Yu, Hua-Liang

    2015-06-01

    Spata31, a novel testis-specific gene, was first isolated from the testis of a vitamin A-deficient rat model. To gain insight into its physiological function, Spata31-targeted knockout mice were generated by homologous recombination. Spata31-deficient (Spata31(flox/flox) ; Vasa-Cre) male mice exhibited low sperm count and premature shedding of germ cells into the lumen, ultimately causing azoospermia and male sterility. Mechanistically, the Spata31 deficiency resulted in reduced expression of the adhesion protein nectin-3 and cytoskeletal protein β-actin at the apical ectoplasmic specialization. Our findings demonstrate that the disruptions to the SPATA31 ortholog could be linked to human male infertility. © 2015 Wiley Periodicals, Inc.

  12. Conformational transition of DNA by dinuclear Pt(II) complexes causes cooperative inhibition of gene expression

    Science.gov (United States)

    Shimizu, Yuta; Yoshikawa, Yuko; Kenmotsu, Takahiro; Komeda, Seiji; Yoshikawa, Kenichi

    2017-06-01

    Recently, it was reported that a cationic tetrazolato-bridged dinuclear Pt(II) complex, 5-H-Y, is a promising anticancer drug candidate. Here, we investigated the effects of a series of tetrazolato-bridged dinuclear Pt(II) complexes on the higher-order structure of DNA by using fluorescence and atomic force microscopies. The results showed that these dinuclear Pt(II) complexes cause marked shrinkage on the conformation of genomic DNA. We also found highly cooperative inhibitory effects of these drugs on in vitro gene expression. The unique mechanism of action of these dinuclear Pt(II) complexes is discussed in terms of their bridging effect on DNA segments.

  13. Spontaneous Pancreatitis Caused by Tissue-Specific Gene Ablation of Hhex in MiceSummary

    Directory of Open Access Journals (Sweden)

    Mark J. Ferreira

    2015-09-01

    Full Text Available Background & Aims: Perturbations in pancreatic ductal bicarbonate secretion cause chronic pancreatitis. The physiologic mechanism of ductal secretion is known, but its transcriptional control is not. We determine the role of the transcription factor hematopoietically expressed homeobox protein (Hhex in ductal secretion and pancreatitis. Methods: We derived mice with pancreas-specific, Cre-mediated Hhex gene ablation to determine the requirement of Hhex in the pancreatic duct in early life and in adult stages. Histologic and immunostaining analyses were used to detect the presence of pathology. Pancreatic primary ductal cells were isolated to discover differentially expressed transcripts upon acute Hhex ablation on a cell autonomous level. Results: Hhex protein was detected throughout the embryonic and adult ductal trees. Ablation of Hhex in pancreatic progenitors resulted in postnatal ductal ectasia associated with acinar-to-ductal metaplasia, a progressive phenotype that ultimately resulted in chronic pancreatitis. Hhex ablation in adult mice, however, did not cause any detectable pathology. Ductal ectasia in young mice did not result from perturbation of expression of Hnf6, Hnf1β, or the primary cilia genes. RNA-seq analysis of Hhex-ablated pancreatic primary ductal cells showed mRNA levels of the G-protein coupled receptor natriuretic peptide receptor 3 (Npr3, implicated in paracrine signaling, up-regulated by 4.70-fold. Conclusions: Although Hhex is dispensable for ductal cell function in the adult, ablation of Hhex in pancreatic progenitors results in pancreatitis. Our data highlight the critical role of Hhex in maintaining ductal homeostasis in early life and support ductal hypersecretion as a novel etiology of pediatric chronic pancreatitis. Keywords: Npr3, Pancreatic Ducts, Primary Cilia

  14. Familial glucocorticoid resistance caused by a splice site deletion in the human glucocorticoid receptor gene

    Energy Technology Data Exchange (ETDEWEB)

    Karl, M.; Lamberts, S.W.J.; Detera-Wadleigh, S.D.; Encio, I.J.; Stratakis, C.A.; Hurley, D.M.; Accili, D.; Chrousos, G.P. (National Institutes of Health, Bethesda, MD (United States) Erasmus Univ. of Rotterdam (Netherlands))

    1993-03-01

    The clinical syndrome of generalized, compensated glucocorticoid resistance is characterized by increased cortisol secretion without clinical evidence of hyper- or hypocortisolism, and manifestations of androgen and/or mineralocorticoid excess. This condition results from partial failure of the glucocorticoid receptor (GR) to modulate transcription of its target genes. The authors studied the molecular mechanisms of this syndrome in a Dutch kindred, whose affected members had hypercortisolism and approximately half of normal GRs, and whose proband was a young woman with manifestations of hyperandrogenism. Using the polymerase chain reaction to amplify and sequence each of the nine exons of the GR gene [alpha], along with their 5[prime]- and 3[prime]-flanking regions, the authors identified a 4-base deletion at the 3[prime]-boundary of exon 6 in one GR allele ([Delta][sub 4]), which removed a donor splice site in all three affected members studied. In contrast, the sequence of exon 6 in the two unaffected siblings was normal. A single nucleotide substitution causing an amino acid substitution in the amino terminal domain of the GR (asparagine to serine, codon 363) was also discovered in exon 2 of the other allele (G[sub 1220]) in the proband, in one of her affected brothers and in her unaffected sister. This deletion in the glucocorticoid receptor gene was associated with the expression of only one allele and a decrease of GR protein by 50% in affected members of this glucocorticoid resistant family. The mutation identified in exon 2 did not segregate with the disease and appears to be of no functional significance. The presence of the null allele was apparently compensated for by increased cortisol production at the expense of concurrent hyperandrogenism. 40 refs., 3 figs.

  15. Mutations in c10orf11, a melanocyte-differentiation gene, cause autosomal-recessive albinism.

    Science.gov (United States)

    Grønskov, Karen; Dooley, Christopher M; Østergaard, Elsebet; Kelsh, Robert N; Hansen, Lars; Levesque, Mitchell P; Vilhelmsen, Kaj; Møllgård, Kjeld; Stemple, Derek L; Rosenberg, Thomas

    2013-03-07

    Autosomal-recessive albinism is a hypopigmentation disorder with a broad phenotypic range. A substantial fraction of individuals with albinism remain genetically unresolved, and it has been hypothesized that more genes are to be identified. By using homozygosity mapping of an inbred Faroese family, we identified a 3.5 Mb homozygous region (10q22.2-q22.3) on chromosome 10. The region contains five protein-coding genes, and sequencing of one of these, C10orf11, revealed a nonsense mutation that segregated with the disease and showed a recessive inheritance pattern. Investigation of additional albinism-affected individuals from the Faroe Islands revealed that five out of eight unrelated affected persons had the nonsense mutation in C10orf11. Screening of a cohort of autosomal-recessive-albinism-affected individuals residing in Denmark showed a homozygous 1 bp duplication in C10orf11 in an individual originating from Lithuania. Immunohistochemistry showed localization of C10orf11 in melanoblasts and melanocytes in human fetal tissue, but no localization was seen in retinal pigment epithelial cells. Knockdown of the zebrafish (Danio rerio) homolog with the use of morpholinos resulted in substantially decreased pigmentation and a reduction of the apparent number of pigmented melanocytes. The morphant phenotype was rescued by wild-type C10orf11, but not by mutant C10orf11. In conclusion, we have identified a melanocyte-differentiation gene, C10orf11, which when mutated causes autosomal-recessive albinism in humans. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  16. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome.

    Science.gov (United States)

    Frank, Valeska; den Hollander, Anneke I; Brüchle, Nadina Ortiz; Zonneveld, Marijke N; Nürnberg, Gudrun; Becker, Christian; Du Bois, Gabriele; Kendziorra, Heide; Roosing, Susanne; Senderek, Jan; Nürnberg, Peter; Cremers, Frans P M; Zerres, Klaus; Bergmann, Carsten

    2008-01-01

    Meckel-Gruber syndrome (MKS) is an autosomal recessive, lethal multisystemic disorder characterized by meningooccipital encephalocele, cystic kidney dysplasia, hepatobiliary ductal plate malformation, and postaxial polydactyly. Recently, genes for MKS1 and MKS3 were identified, putting MKS on the list of ciliary disorders (ciliopathies). By positional cloning in a distantly related multiplex family, we mapped a novel locus for MKS to a 3-Mb interval on 12q21. Sequencing of the CEP290 gene located in the minimal critical region showed a homozygous 1-bp deletion supposed to lead to loss of function of the encoded centrosomal protein CEP290/nephrocystin-6. CEP290 is thought to be involved in chromosome segregation and localizes to cilia, centrosomes, and the nucleus. Subsequent analysis of another consanguineous multiplex family revealed homozygous haplotypes and the same frameshift mutation. Our findings add to the increasing body of evidence that ciliopathies can cause a broad spectrum of disease phenotypes, and pleiotropic effects of CEP290 mutations range from single organ involvement with isolated Leber congenital amaurosis to Joubert syndrome and lethal early embryonic multisystemic malformations in Meckel-Gruber syndrome. We compiled clinical and genetic data of all patients with CEP290 mutations described so far. No clear-cut genotype-phenotype correlations were apparent as almost all mutations are nonsense, frameshift, or splice-site changes and scattered throughout the gene irrespective of the patients' phenotypes. Conclusively, other factors than the type and location of CEP290 mutations may underlie phenotypic variability. (c) 2007 Wiley-Liss, Inc.

  17. A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Science.gov (United States)

    Zhang, Junyu; Liu, Hongbin; Liu, Zhiyuan; Liao, Yong; Guo, Luo; Wang, Honglian; He, Lin; Zhang, Xiaodong; Xing, Qinghe

    2013-01-01

    Autoimmune polyendocrine syndrome type 1 (APS-1) is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE) gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser) in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203) containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

  18. An inactivating mutation in the SOD 1 gene causes familial amyotrophic lateral sclerosis

    Energy Technology Data Exchange (ETDEWEB)

    Pramatarova, A.; Rouleau, G.A. [Montreal General Hospital Research Institute (Canada); Goto, J. [Univ. of Tokyo (Japan)] [and others

    1994-09-01

    Amyotrophic lateral sclerosis (ALS) is characterized by highly selective death of large motor neurons in the cerebral cortex and spinal cord. The familial form of ALS (FALS) accounts for approximately 10% of the cases and is transmitted in an autosomal dominant manner. Recently the defective gene causing chromosome 21-linked FALS was shown to be the Cu/Zn superoxide dismutase (SOD 1). However, the precise mechanism of neurotoxicity seen in FALS with SOD 1 mutations is still unknown. Until now all SOD 1 mutations reported were single base pair substitutions (missense). We have identified a nonsense mutation in exon 5 of the SOD 1 gene in a FALS kindred. This two base pair deletion provokes a frameshift and a predicted premature truncation of the protein. The region affected has a very important structural and functional role: it contains part of the active loop and is involved in dimer contact. We would predict that the loss of these structures would impair the functioning of the enzyme.

  19. A novel heterozygous deletion in the EVC2 gene causes Weyers acrofacial dysostosis.

    Science.gov (United States)

    Ye, Xiaoqian; Song, Guangtai; Fan, Mingwen; Shi, Lisong; Jabs, Ethylin Wang; Huang, Shangzhi; Guo, Ruiqiang; Bian, Zhuan

    2006-03-01

    Weyers acrofacial dysostosis (MIM 193530) is an autosomal dominant disorder clinically characterized by mild short stature, postaxial polydactyly, nail dystrophy and dysplastic teeth. Ellis-van Creveld syndrome (EvC, MIM 225500) is an autosomal recessive disorder with a similar, but more severe phenotype. Mutations in the EVC have been identified in both syndromes. However, the EVC mutations only occur in a small proportion of EvC patients. Recently, mutations in a new gene, EVC2, were found to be associated with other EvC cases. The EVC and EVC2 are located close to each other in a head-to-head configuration and may be functionally related. In this study, we report identification of a novel heterozygous deletion in the EVC2 that is responsible for autosomal dominant Weyers acrofacial dysostosis in a large Chinese family. This constitutes the first report of Weyers acrofacial dysostosis caused by this gene. Hence, the spectrum of malformation syndromes due to EVC2 mutations is further extended. Our data provides conclusive evidence that Weyers acrofacial dysostosis and EvC syndrome are allelic and genetically heterogeneous conditions.

  20. Multiple Genes Cause Postmating Prezygotic Reproductive Isolation in the Drosophila virilis Group

    Directory of Open Access Journals (Sweden)

    Yasir H. Ahmed-Braimah

    2016-12-01

    Full Text Available Understanding the genetic basis of speciation is a central problem in evolutionary biology. Studies of reproductive isolation have provided several insights into the genetic causes of speciation, especially in taxa that lend themselves to detailed genetic scrutiny. Reproductive barriers have usually been divided into those that occur before zygote formation (prezygotic and after (postzygotic, with the latter receiving a great deal of attention over several decades. Reproductive barriers that occur after mating but before zygote formation [postmating prezygotic (PMPZ] are especially understudied at the genetic level. Here, I present a phenotypic and genetic analysis of a PMPZ reproductive barrier between two species of the Drosophila virilis group: D. americana and D. virilis. This species pair shows strong PMPZ isolation, especially when D. americana males mate with D. virilis females: ∼99% of eggs laid after these heterospecific copulations are not fertilized. Previous work has shown that the paternal loci contributing to this incompatibility reside on two chromosomes, one of which (chromosome 5 likely carries multiple factors. The other (chromosome 2 is fixed for a paracentric inversion that encompasses nearly half the chromosome. Here, I present two results. First, I show that PMPZ in this species cross is largely due to defective sperm storage in heterospecific copulations. Second, using advanced intercross and backcross mapping approaches, I identify genomic regions that carry genes capable of rescuing heterospecific fertilization. I conclude that paternal incompatibility between D. americana males and D. virilis females is underlain by four or more genes on chromosomes 2 and 5.

  1. A functional alternative splicing mutation in AIRE gene causes autoimmune polyendocrine syndrome type 1.

    Directory of Open Access Journals (Sweden)

    Junyu Zhang

    Full Text Available Autoimmune polyendocrine syndrome type 1 (APS-1 is a rare autosomal recessive disease defined by the presence of two of the three conditions: mucocutaneous candidiasis, hypoparathyroidism, and Addison's disease. Loss-of-function mutations of the autoimmune regulator (AIRE gene have been linked to APS-1. Here we report mutational analysis and functional characterization of an AIRE mutation in a consanguineous Chinese family with APS-1. All exons of the AIRE gene and adjacent exon-intron sequences were amplified by PCR and subsequently sequenced. We identified a homozygous missense AIRE mutation c.463G>A (p.Gly155Ser in two siblings with different clinical features of APS-1. In silico splice-site prediction and minigene analysis were carried out to study the potential pathological consequence. Minigene splicing analysis and subsequent cDNA sequencing revealed that the AIRE mutation potentially compromised the recognition of the splice donor of intron 3, causing alternative pre-mRNA splicing by intron 3 retention. Furthermore, the aberrant AIRE transcript was identified in a heterozygous carrier of the c.463G>A mutation. The aberrant intron 3-retaining transcript generated a truncated protein (p.G155fsX203 containing the first 154 AIRE amino acids and followed by 48 aberrant amino acids. Therefore, our study represents the first functional characterization of the alternatively spliced AIRE mutation that may explain the pathogenetic role in APS-1.

  2. Mutations in c10orf11, a melanocyte-differentiation gene, cause autosomal-recessive albinism

    DEFF Research Database (Denmark)

    Grønskov, Karen; Dooley, Christopher M; Østergaard, Elsebet

    2013-01-01

    , we identified a 3.5 Mb homozygous region (10q22.2-q22.3) on chromosome 10. The region contains five protein-coding genes, and sequencing of one of these, C10orf11, revealed a nonsense mutation that segregated with the disease and showed a recessive inheritance pattern. Investigation of additional...... albinism-affected individuals from the Faroe Islands revealed that five out of eight unrelated affected persons had the nonsense mutation in C10orf11. Screening of a cohort of autosomal-recessive-albinism-affected individuals residing in Denmark showed a homozygous 1 bp duplication in C10orf11...... in substantially decreased pigmentation and a reduction of the apparent number of pigmented melanocytes. The morphant phenotype was rescued by wild-type C10orf11, but not by mutant C10orf11. In conclusion, we have identified a melanocyte-differentiation gene, C10orf11, which when mutated causes autosomal...

  3. Differences in acidity of apples are probably mainly caused by a malic acid transporter gene on LG16

    NARCIS (Netherlands)

    Khan, S.A.; Beekwilder, J.; Schaart, J.G.; Mumm, R.; Soriano, J.M.; Jacobsen, E.; Schouten, H.J.

    2013-01-01

    Acidity has profound effects on the taste of apples (Malus × domestica). Malic acid is the predominant organic acid in apples. Differences in malic acid content are caused by differences in accumulation of malic acid in the vacuole. This accumulation may be caused by a gene that is responsible for

  4. Mutations in the Human Ca{sup 2+}-sensing-receptor gene that cause familial hypocalciuric hypercalcemia

    Energy Technology Data Exchange (ETDEWEB)

    Yah-Huei Wu Chou [Chang Gung Memorial Hospital, Taoyuan (Taiwan, Province of China); Pollak, M.R.; Brown, E.M.; Seidman, J.G.; Seidman, C.E. [Harvard Univ., Boston, MA (United States); Brandi, M.L. [Univ. Florence (Italy); Toss, G.; Arnqvist, H. [Linkoping Univ. (Sweden)

    1995-05-01

    We report five novel mutations in the human Ca{sup 2+}-sensing-receptor gene that cause familial hypocalciuric hypercalcemia (FHH) or neonatal severe hyperparathyroidism. Each gene defect is a missense mutation that encodes a nonconservative amino acid alteration. These mutations are each predicted to be in the Ca{sup 2+}-sensing receptor`s large extracellular domain. In three families with FHH linked to the Ca{sup 2+}-sensing-receptor gene on chromosome 3 and in unrelated individuals probands with FHH, mutations were not detected in protein-coding sequences. On the basis of these data and previous analyses, we suggest that there are a wide range of mutations that cause FHH. Mutations that perturb the structure and function of the extracellular or transmembrane domains of the receptor and those that affect noncoding sequences of the Ca{sup 2+}-sensing-receptor gene can cause FHH. 23 refs., 2 figs., 1 tab.

  5. Recurring dominant-negative mutations in the AVP-NPII gene cause neurohypophyseal diabetes insipidus

    Energy Technology Data Exchange (ETDEWEB)

    Repaske, D.R. [Children`s Hospital Medical Center, Cincinnati, OH (United States); Phillips, J.A.; Krishnamani, M.R.S. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Autosomal dominant neurohypophyseal diabetes insipidus (ADNDI) is a familial form of arginine vasopressin (or antidiuretic hormone) deficiency that is usually manifest in early childhood with polyuria, polydipsia and an antidiuretic response to exogenous vasopressin or its analogs. The phenotype is postulated to arise from gliosis and depletion of the magnocellular neurons that produce vasopressin in the supraoptic and paraventricular nuclei of the hypothalamus. ADNDI is caused by heterozygosity for a variety of mutations in the AVP-NPII gene which encodes vasopressin, its carrier protein (NPII) and a glycoprotein (copeptin) of unknown function. These mutations include: (1) Ala 19{r_arrow}Thr (G279A) in AVP`s signal peptide, (2) Gly 17{r_arrow}Val (G1740T), (3) Pro 24{r_arrow}Leu (C1761T), (4) Gly 57{r_arrow}Ser (G1859A) and (5) del Glu 47({delta}AGG 1824-26), all of which occur in NPII. In characterizing the AVP-NPII mutations in five non-related ADNDI kindreds, we have detected two kindreds having mutation 1 (G279A), two having mutation 3 (C1761T) and one having mutation 4 (G1859A) without any other allelic changes being detected. Two of these recurring mutations (G279A and G1859A) are transitions that occur at CpG dinucleotides while the third (C1761T) does not. Interestingly, families with the same mutations differed in their ethnicity or in their affected AVP-NPII allele`s associated haplotype of closely linked DNA polymorphisms. Our data indicated that at least three of five known AVP-NPII mutations causing ADNDI tend to recur but the mechanisms by which these dominant-negative mutations cause variable or progressive expression of the ADNDI phenotype remain unclear.

  6. Familial chylomicronemia caused by a novel type of mutation in the APOE-CI-CIV-CII gene cluster encompassing both the APOCII gene and the first APOCIV gene mutation: APOCII-CIV(Nijmegen).

    Science.gov (United States)

    de Graaf, J; Hoffer, M J; Stuyt, P M; Frants, R R; Stalenhoef, A F

    2000-07-14

    Apolipoprotein CII (ApoCII) deficiency is a relatively rare cause of the chylomicronemia syndrome, a disorder characterized by severe fasting hypertriglyceridemia and massive accumulation of chylomicrons in plasma. Here we present a case which is the first example of apoCII deficiency caused by a major rearrangement in the APOCII gene. Southern blot analysis revealed an approximately 7.5-kb deletion disrupting the APOCII gene including the promotor region and first exon. Interestingly, the deletion also encompasses the APOCIV gene, a recently discovered novel gene upstream of APOCII. This deletion is the first mutation to be reported in the APOCIV gene. Copyright 2000 Academic Press.

  7. A single point-mutation within the melanophilin gene causes the lavender plumage colour dilution phenotype in the chicken

    Directory of Open Access Journals (Sweden)

    Tixier-Boichard Michèle

    2008-01-01

    Full Text Available Abstract Background The lavender phenotype in the chicken causes the dilution of both black (eumelanin and red/brown (phaeomelanin pigments. Defects in three genes involved in intracellular melanosomal transport, previously described in mammals, give rise to similar diluted pigmentation phenotypes as those seen in lavender chickens. Results We have used a candidate-gene approach based on an expectation of homology with mammals to isolate a gene involved in pigmentation in chicken. Comparative sequence analysis of candidate genes in the chicken identified a strong association between a mutation in the MLPH gene and the diluted pigmentation phenotype. This mutation results in the amino acid change R35W, at a site also associated with similar phenotypes in mice, humans and cats. Conclusion This is the first time that an avian species with a mutation in the MLPH gene has been reported.

  8. Multiple Genes Cause Postmating Prezygotic Reproductive Isolation in the Drosophila virilis Group.

    Science.gov (United States)

    Ahmed-Braimah, Yasir H

    2016-12-07

    Understanding the genetic basis of speciation is a central problem in evolutionary biology. Studies of reproductive isolation have provided several insights into the genetic causes of speciation, especially in taxa that lend themselves to detailed genetic scrutiny. Reproductive barriers have usually been divided into those that occur before zygote formation (prezygotic) and after (postzygotic), with the latter receiving a great deal of attention over several decades. Reproductive barriers that occur after mating but before zygote formation [postmating prezygotic (PMPZ)] are especially understudied at the genetic level. Here, I present a phenotypic and genetic analysis of a PMPZ reproductive barrier between two species of the Drosophila virilis group: D. americana and D. virilis This species pair shows strong PMPZ isolation, especially when D. americana males mate with D. virilis females: ∼99% of eggs laid after these heterospecific copulations are not fertilized. Previous work has shown that the paternal loci contributing to this incompatibility reside on two chromosomes, one of which (chromosome 5) likely carries multiple factors. The other (chromosome 2) is fixed for a paracentric inversion that encompasses nearly half the chromosome. Here, I present two results. First, I show that PMPZ in this species cross is largely due to defective sperm storage in heterospecific copulations. Second, using advanced intercross and backcross mapping approaches, I identify genomic regions that carry genes capable of rescuing heterospecific fertilization. I conclude that paternal incompatibility between D. americana males and D. virilis females is underlain by four or more genes on chromosomes 2 and 5. Copyright © 2016 Ahmed-Braimah.

  9. Two α1-Globin Gene Point Mutations Causing Severe Hb H Disease.

    Science.gov (United States)

    Jiang, Hua; Huang, Lv-Yin; Zhen, Li; Jiang, Fan; Li, Dong-Zhi

    2017-11-08

    Hb H disease is generally a moderate form of α-thalassemia (α-thal) that rarely requires regular blood transfusions. In this study, two Chinese families with members carrying transfusion-dependent Hb H disease were investigated for rare mutations on the α-globin genes (HBA1, HBA2). In one family, Hb Zürich-Albisrieden [α59(E8)Gly→Arg; HBA1: c.178G>C] in combination with the Southeast Asian (- -(SEA)) deletion was the defect responsible for the severe phenotype. In another family, a novel hemoglobin (Hb) variant named Hb Sichuan (HBA1: c.393_394insT), causes α-thal and a severe phenotype when associated with the - -(SEA) deletion. As these two HBA1 mutations can present as continuous blood transfusion-dependent α-thal, it is important to take this point into account for detecting the carriers, especially in couples in which one partner is already a known α(0)-thal carrier.

  10. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  11. A novel splice-site mutation in the GJB2 gene causing mild postlingual hearing impairment.

    Directory of Open Access Journals (Sweden)

    Marta Gandía

    Full Text Available The DFNB1 subtype of autosomal recessive, nonsyndromic hearing impairment, caused by mutations affecting the GJB2 (connexin-26 [corrected] gene, is highly prevalent in most populations worldwide. DFNB1 hearing impairment is mostly severe or profound and usually appears before the acquisition of speech (prelingual onset, though a small number of hypomorphic missense mutations result in mild or moderate deafness of postlingual onset. We identified a novel GJB2 splice-site mutation, c. -22-2A>C, in three siblings with mild postlingual hearing impairment that were compound heterozygous for c. -22-2A>C and c.35delG. Reverse transcriptase-PCR experiments performed on total RNA extracted from saliva samples from one of these siblings confirmed that c. -22-2A>C abolished the acceptor splice site of the single GJB2 intron, resulting in the absence of normally processed transcripts from this allele. However, we did isolate transcripts from the c. -22-2A>C allele that keep an intact GJB2 coding region and that were generated by use of an alternative acceptor splice site previously unknown. The residual expression of wild-type connexin-26 [corrected] encoded by these transcripts probably underlies the mild severity and late onset of the hearing impairment of these subjects.

  12. Tapetum-specific expression of a cytoplasmic orf507 gene causes semi-male sterility in transgenic peppers

    OpenAIRE

    Ji, Jiao-Jiao; Huang, Wei; Li, Zheng; Chai, Wei-Guo; Yin, Yan-Xu; Li, Da-Wei; Gong, Zhen-Hui

    2015-01-01

    Though cytoplasmic male sterility (CMS) in peppers is associated with the orf507 gene, definitive and direct evidence that it directly causes male sterility is still lacking. In this study, differences in histochemical localization of anther cytochrome c oxidase between the pepper CMS line and maintainer line were observed mainly in the tapetal cells and tapetal membrane. Inducible and specific expression of the orf507 gene in the pepper maintainer line found that transformants were morpholog...

  13. Testing for Sufficient-Cause Gene-Environment Interactions Under the Assumptions of Independence and Hardy-Weinberg Equilibrium.

    Science.gov (United States)

    Lee, Wen-Chung

    2015-07-01

    To detect gene-environment interactions, a logistic regression model is typically fitted to a set of case-control data, and the focus is on testing of the cross-product terms (gene × environment) in the model. A significant result is indicative of a gene-environment interaction under a multiplicative model for disease odds. Based on the sufficient-cause model for rates, in this paper we put forward a general approach to testing for sufficient-cause gene-environment interactions in case-control studies. The proposed tests can be tailored to detect a particular type of sufficient-cause gene-environment interaction with greater sensitivity. These tests include testing for autosomal dominant, autosomal recessive, and gene-dosage interactions. The tests can also detect trend interactions (e.g., a larger gene-environment interaction with a higher level of environmental exposure) and threshold interactions (e.g., gene-environment interaction occurs only when environmental exposure reaches a certain threshold level). Two assumptions are necessary for the validity of the tests: 1) the rare-disease assumption and 2) the no-redundancy assumption. Another 2 assumptions are optional but, if imposed correctly, can boost the statistical powers of the tests: 3) the gene-environment independence assumption and 4) the Hardy-Weinberg equilibrium assumption. SAS code (SAS Institute, Inc., Cary, North Carolina) for implementing the methods is provided. © The Author 2015. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Normalization of Overexpressed α-Synuclein Causing Parkinson's Disease By a Moderate Gene Silencing With RNA Interference

    Directory of Open Access Journals (Sweden)

    Masaki Takahashi

    2015-01-01

    Full Text Available The α-synuclein (SNCA gene is a responsible gene for Parkinson's disease (PD; and not only nucleotide variations but also overexpression of SNCA appears to be involved in the pathogenesis of PD. A specific inhibition against mutant SNCA genes carrying nucleotide variations may be feasible by a specific silencing such as an allele-specific RNA interference (RNAi; however, there is no method for restoring the SNCA overexpression to a normal level. Here, we show that an atypical RNAi using small interfering RNAs (siRNAs that confer a moderate level of gene silencing is capable of controlling overexpressed SNCA genes to return to a normal level; named “expression-control RNAi” (ExCont-RNAi. ExCont-RNAi exhibited little or no significant off-target effects in its treated PD patient's fibroblasts that carry SNCA triplication. To further assess the therapeutic effect of ExCont-RNAi, PD-model flies that carried the human SNCA gene underwent an ExCont-RNAi treatment. The treated PD-flies demonstrated a significant improvement in their motor function. Our current findings suggested that ExCont-RNAi might be capable of becoming a novel therapeutic procedure for PD with the SNCA overexpression, and that siRNAs conferring a moderate level of gene silencing to target genes, which have been abandoned as useless siRNAs so far, might be available for controlling abnormally expressed disease-causing genes without producing adverse effects.

  15. Mutations in the MORC2 gene cause axonal Charcot-Marie-Tooth disease.

    Science.gov (United States)

    Sevilla, Teresa; Lupo, Vincenzo; Martínez-Rubio, Dolores; Sancho, Paula; Sivera, Rafael; Chumillas, María J; García-Romero, Mar; Pascual-Pascual, Samuel I; Muelas, Nuria; Dopazo, Joaquín; Vílchez, Juan J; Palau, Francesc; Espinós, Carmen

    2016-01-01

    Charcot-Marie-Tooth disease (CMT) is a complex disorder with wide genetic heterogeneity. Here we present a new axonal Charcot-Marie-Tooth disease form, associated with the gene microrchidia family CW-type zinc finger 2 (MORC2). Whole-exome sequencing in a family with autosomal dominant segregation identified the novel MORC2 p.R190W change in four patients. Further mutational screening in our axonal Charcot-Marie-Tooth disease clinical series detected two additional sporadic cases, one patient who also carried the same MORC2 p.R190W mutation and another patient that harboured a MORC2 p.S25L mutation. Genetic and in silico studies strongly supported the pathogenicity of these sequence variants. The phenotype was variable and included patients with congenital or infantile onset, as well as others whose symptoms started in the second decade. The patients with early onset developed a spinal muscular atrophy-like picture, whereas in the later onset cases, the initial symptoms were cramps, distal weakness and sensory impairment. Weakness and atrophy progressed in a random and asymmetric fashion and involved limb girdle muscles, leading to a severe incapacity in adulthood. Sensory loss was always prominent and proportional to disease severity. Electrophysiological studies were consistent with an asymmetric axonal motor and sensory neuropathy, while fasciculations and myokymia were recorded rather frequently by needle electromyography. Sural nerve biopsy revealed pronounced multifocal depletion of myelinated fibres with some regenerative clusters and occasional small onion bulbs. Morc2 is expressed in both axons and Schwann cells of mouse peripheral nerve. Different roles in biological processes have been described for MORC2. As the silencing of Charcot-Marie-Tooth disease genes have been associated with DNA damage response, it is tempting to speculate that a deregulation of this pathway may be linked to the axonal degeneration observed in MORC2 neuropathy, thus adding a

  16. Alarm pheromone habituation in Myzus persicae has fitness consequences and causes extensive gene expression changes.

    Science.gov (United States)

    de Vos, Martin; Cheng, Wing Yin; Summers, Holly E; Raguso, Robert A; Jander, Georg

    2010-08-17

    In most aphid species, facultative parthenogenetic reproduction allows rapid growth and formation of large single-genotype colonies. Upon predator attack, individual aphids emit an alarm pheromone to warn the colony of this danger. (E)-beta-farnesene (EBF) is the predominant constituent of the alarm pheromone in Myzus persicae (green peach aphid) and many other aphid species. Continuous exposure to alarm pheromone in aphid colonies raised on transgenic Arabidopsis thaliana plants that produce EBF leads to habituation within three generations. Whereas naive aphids are repelled by EBF, habituated aphids show no avoidance response. Similarly, individual aphids from the habituated colony can revert back to being EBF-sensitive in three generations, indicating that this behavioral change is not caused by a genetic mutation. Instead, DNA microarray experiments comparing gene expression in naive and habituated aphids treated with EBF demonstrate an almost complete desensitization in the transcriptional response to EBF. Furthermore, EBF-habituated aphids show increased progeny production relative to EBF-responsive aphids, with or without EBF treatment. Although both naive and habituated aphids emit EBF upon damage, EBF-responsive aphids have a higher survival rate in the presence of a coccinellid predator (Hippodamia convergens), and thus outperform habituated aphids that do not show an avoidance response. These results provide evidence that aphid perception of conspecific alarm pheromone aids in predator avoidance and thereby bestows fitness benefits in survivorship and fecundity. Therefore, although habituated M. persicae produce more progeny, EBF-emitting transgenic plants may have practical applications in agriculture as a result of increased predation of habituated aphids.

  17. A mutation in the MATP gene causes the cream coat colour in the horse

    OpenAIRE

    Guérin Gérard; Taourit Sead; Mariat Denis

    2003-01-01

    Abstract In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our d...

  18. Mutations in two nonhomologous genes in a head-to-head configuration cause Ellis-van Creveld syndrome.

    NARCIS (Netherlands)

    Ruiz-Perez, V.L.; Tompson, S.W.; Blair, H.J.; Espinoza-Valdez, C.; Lapunzina, P.; Silva, E.O.; Hamel, B.C.J.; Gibbs, J.L.; Young, I.D.; Wright, M.J.; Goodship, J.A.

    2003-01-01

    Ellis-van Creveld syndrome (EvC) is an autosomal recessive skeletal dysplasia. Elsewhere, we described mutations in EVC in patients with this condition (Ruiz-Perez et al. 2000). We now report that mutations in EVC2 also cause EvC. These two genes lie in a head-to-head configuration that is conserved

  19. Early-Onset Severe Encephalopathy with Epilepsy: The BRAT1 Gene Should Be Added to the List of Causes

    NARCIS (Netherlands)

    van de Pol, L.A.; Wolf, N.I.; van Weissenbruch, M.M.; Stam, C.J.; Weiss, M.M.; Waisfisz, Q.; Kevelam, S.H.; Bugiani, M.; van de Kamp, J.M.; Knaap, M.

    2015-01-01

    A variety of pathologies can underlie early-onset severe encephalopathy with epilepsy. To aid the diagnostic process in such patients we present an overview of causes, including the rapidly expanding list of genes involved. When no explanation is found, whole-exome sequencing (WES) can be used in an

  20. NK cells are intrinsically functional in pigs with Severe Combined Immunodeficiency (SCID) caused by spontaneous mutations in the Artemis gene

    Science.gov (United States)

    We have identified Severe Combined Immunodeficiency (SCID) in a line of Yorkshire pigs at Iowa State University. These SCID pigs lack B-cells and T-cells, but possess Natural Killer (NK) cells. This SCID phenotype is caused by recessive mutations in the Artemis gene. Interestingly, two human tumor c...

  1. A novel splicing mutation in COL1A1 gene caused type I osteogenesis imperfecta in a Chinese family.

    Science.gov (United States)

    Peng, Hao; Zhang, Yuhui; Long, Zhigao; Zhao, Ding; Guo, Zhenxin; Xue, Jinjie; Xie, Zhiguo; Xiong, Zhimin; Xu, Xiaojuan; Su, Wei; Wang, Bing; Xia, Kun; Hu, Zhengmao

    2012-07-10

    Osteogenesis imperfect (OI) is a heritable connective tissue disorder with bone fragility as a cardinal manifestation, accompanied by short stature, dentinogenesis imperfecta, hyperlaxity of ligaments and skin, blue sclerae and hearing loss. Dominant form of OI is caused by mutations in the type I procollagen genes, COL1A1/A2. Here we identified a novel splicing mutation c.3207+1G>A (GenBank ID: JQ236861) in the COL1A1 gene that caused type I OI in a Chinese family. RNA splicing analysis proved that this mutation created a new splicing site at c.3200, and then led to frameshift. This result further enriched the mutation spectrum of type I procollagen genes. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Contrasting invertebrate immune defense behaviors caused by a single gene, the Caenorhabditis elegans neuropeptide receptor gene npr-1.

    Science.gov (United States)

    Nakad, Rania; Snoek, L Basten; Yang, Wentao; Ellendt, Sunna; Schneider, Franziska; Mohr, Timm G; Rösingh, Lone; Masche, Anna C; Rosenstiel, Philip C; Dierking, Katja; Kammenga, Jan E; Schulenburg, Hinrich

    2016-04-11

    The invertebrate immune system comprises physiological mechanisms, physical barriers and also behavioral responses. It is generally related to the vertebrate innate immune system and widely believed to provide nonspecific defense against pathogens, whereby the response to different pathogen types is usually mediated by distinct signalling cascades. Recent work suggests that invertebrate immune defense can be more specific at least at the phenotypic level. The underlying genetic mechanisms are as yet poorly understood. We demonstrate in the model invertebrate Caenorhabditis elegans that a single gene, a homolog of the mammalian neuropeptide Y receptor gene, npr-1, mediates contrasting defense phenotypes towards two distinct pathogens, the Gram-positive Bacillus thuringiensis and the Gram-negative Pseudomonas aeruginosa. Our findings are based on combining quantitative trait loci (QTLs) analysis with functional genetic analysis and RNAseq-based transcriptomics. The QTL analysis focused on behavioral immune defense against B. thuringiensis, using recombinant inbred lines (RILs) and introgression lines (ILs). It revealed several defense QTLs, including one on chromosome X comprising the npr-1 gene. The wildtype N2 allele for the latter QTL was associated with reduced defense against B. thuringiensis and thus produced an opposite phenotype to that previously reported for the N2 npr-1 allele against P. aeruginosa. Analysis of npr-1 mutants confirmed these contrasting immune phenotypes for both avoidance behavior and nematode survival. Subsequent transcriptional profiling of C. elegans wildtype and npr-1 mutant suggested that npr-1 mediates defense against both pathogens through p38 MAPK signaling, insulin-like signaling, and C-type lectins. Importantly, increased defense towards P. aeruginosa seems to be additionally influenced through the induction of oxidative stress genes and activation of GATA transcription factors, while the repression of oxidative stress genes

  3. Digital gene expression analysis of corky split vein caused by boron deficiency in 'Newhall' Navel Orange (Citrus sinensis Osbeck for selecting differentially expressed genes related to vascular hypertrophy.

    Directory of Open Access Journals (Sweden)

    Cheng-Quan Yang

    Full Text Available Corky split vein caused by boron (B deficiency in 'Newhall' Navel Orange was studied in the present research. The boron-deficient citrus exhibited a symptom of corky split vein in mature leaves. Morphologic and anatomical surveys at four representative phases of corky split veins showed that the symptom was the result of vascular hypertrophy. Digital gene expression (DGE analysis was performed based on the Illumina HiSeq™ 2000 platform, which was applied to analyze the gene expression profilings of corky split veins at four morphologic phases. Over 5.3 million clean reads per library were successfully mapped to the reference database and more than 22897 mapped genes per library were simultaneously obtained. Analysis of the differentially expressed genes (DEGs revealed that the expressions of genes associated with cytokinin signal transduction, cell division, vascular development, lignin biosynthesis and photosynthesis in corky split veins were all affected. The expressions of WOL and ARR12 involved in the cytokinin signal transduction pathway were up-regulated at 1(st phase of corky split vein development. Furthermore, the expressions of some cell cycle genes, CYCs and CDKB, and vascular development genes, WOX4 and VND7, were up-regulated at the following 2(nd and 3(rd phases. These findings indicated that the cytokinin signal transduction pathway may play a role in initiating symptom observed in our study.

  4. Prevalence of coagulase gene polymorphism in Staphylococcus aureus isolates causing bovine mastitis

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Dangler, C. A.; Sordillo, L. M.

    1995-01-01

    for restriction fragment length polymorphism (RFLP) of the coagulase gene. A variable region of the coagulase gene was amplified using the polymerase chain reaction (PCR) followed by AluI restriction enzyme digestion. A total of 15 different RFLP patterns were observed. The predominant pattern was found in 35...

  5. Mutations in the beta-tropomyosin (TPM2) gene - a rare cause of nemaline myopathy

    NARCIS (Netherlands)

    Donner, Kati; Ollikainen, Miina; Ridanpää, Maaret; Christen, Hans-Jürgen; Goebel, Hans H.; de Visser, Marianne; Pelin, Katarina; Wallgren-Pettersson, Carina

    2002-01-01

    Nemaline myopathy is a clinically and genetically heterogeneous muscle disorder. In the nebulin gene we have detected a number of autosomal recessive mutations. Both autosomal dominant and recessive mutations have been detected in the genes for alpha -actin and alpha -tropomyosin 3. A recessive

  6. Accelerated alcoholic fermentation caused by defective gene expression related to glucose derepression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Watanabe, Daisuke; Hashimoto, Naoya; Mizuno, Megumi; Zhou, Yan; Akao, Takeshi; Shimoi, Hitoshi

    2013-01-01

    Sake yeast strains maintain high fermentation rates, even after the stationary growth phase begins. To determine the molecular mechanisms underlying this advantageous brewing property, we compared the gene expression profiles of sake and laboratory yeast strains of Saccharomyces cerevisiae during the stationary growth phase. DNA microarray analysis revealed that the sake yeast strain examined had defects in expression of the genes related to glucose derepression mediated by transcription factors Adr1p and Cat8p. Furthermore, deletion of the ADR1 and CAT8 genes slightly but statistically significantly improved the fermentation rate of a laboratory yeast strain. We also identified two loss-of-function mutations in the ADR1 gene of existing sake yeast strains. Taken together, these results indicate that the gene expression program associated with glucose derepression for yeast acts as an impediment to effective alcoholic fermentation under glucose-rich fermentative conditions.

  7. [Advances in molecular mechanisms of bacterial resistance caused by stress-induced transfer of resistance genes--a review].

    Science.gov (United States)

    Sun, Dongchang; Wang, Bing; Zhu, Lihong

    2013-07-04

    The transfer of resistance gene is one of the most important causes of bacterial resistance. Recent studies reveal that stresses induce the transfer of antibiotic resistance gene through multiple mechanisms. DNA damage stresses trigger bacterial SOS response and induce the transfer of resistance gene mediated by conjugative DNA. Antibiotic stresses induce natural bacterial competence for transformation in some bacteria which lack the SOS system. In addition, our latest studies show that the general stress response regulator RpoS regulates a novel type of resistance gene transfer which is mediated by double-stranded plasmid DNA and occurs exclusively on the solid surface. In this review, we summarized recent advances in SOS dependent and independent stress-induced DNA transfer which is mediated by conjugation and transformation respectively, and the transfer of double-stranded plasmid DNA on the solid surface which is regulated by RpoS. We propose that future work should address how stresses activate the key regulators and how these regulators control the expression of gene transfer related genes. Answers to the above questions would pave the way for searching for candidate targets for controlling bacterial resistance resulted from the transfer of antibiotic genes.

  8. Retinal Diseases Caused by Mutations in Genes Not Specifically Associated with the Clinical Diagnosis.

    Directory of Open Access Journals (Sweden)

    Xia Wang

    Full Text Available When seeking a confirmed molecular diagnosis in the research setting, patients with one descriptive diagnosis of retinal disease could carry pathogenic variants in genes not specifically associated with that description. However, this event has not been evaluated systematically in clinical diagnostic laboratories that validate fully all target genes to minimize false negatives/positives.We performed targeted next-generation sequencing analysis on 207 ocular disease-related genes for 42 patients whose DNA had been tested negative for disease-specific panels of genes known to be associated with retinitis pigmentosa, Leber congenital amaurosis, or exudative vitreoretinopathy.Pathogenic variants, including single nucleotide variations and copy number variations, were identified in 9 patients, including 6 with variants in syndromic retinal disease genes and 3 whose molecular diagnosis could not be distinguished easily from their submitted clinical diagnosis, accounting for 21% (9/42 of the unsolved cases.Our study underscores the clinical and genetic heterogeneity of retinal disorders and provides valuable reference to estimate the fraction of clinical samples whose retinal disorders could be explained by genes not specifically associated with the corresponding clinical diagnosis. Our data suggest that sequencing a larger set of retinal disorder related genes can increase the molecular diagnostic yield, especially for clinically hard-to-distinguish cases.

  9. A mutation in the MATP gene causes the cream coat colour in the horse

    Directory of Open Access Journals (Sweden)

    Guérin Gérard

    2003-01-01

    Full Text Available Abstract In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka.

  10. A mutation in the MATP gene causes the cream coat colour in the horse.

    Science.gov (United States)

    Mariat, Denis; Taourit, Sead; Guérin, Gérard

    2003-01-01

    In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka.

  11. Mutations of the CEP290 gene encoding a centrosomal protein cause Meckel-Gruber syndrome.

    NARCIS (Netherlands)

    Frank, V.; Hollander, A.I. den; Bruchle, N.O.; Zonneveld, M.N.; Nurnberg, G.; Becker, C.; Bois, G. Du; Kendziorra, H.; Roosing, S.; Senderek, J.; Nurnberg, P.; Cremers, F.P.M.; Zerres, K.; Bergmann, C.

    2008-01-01

    Meckel-Gruber syndrome (MKS) is an autosomal recessive, lethal multisystemic disorder characterized by meningooccipital encephalocele, cystic kidney dysplasia, hepatobiliary ductal plate malformation, and postaxial polydactyly. Recently, genes for MKS1 and MKS3 were identified, putting MKS on the

  12. [DNA damage caused by suicide gene therapy system under Tet-On regulation in breast cancer cells].

    Science.gov (United States)

    Li, Hongde; Xiang, Shengguang; Ma, Nan; Hu, Weixin; Zeng, Zhaojun

    2011-09-01

    To determine the effect and molecular mechanism of DNA damage caused by suicide gene therapy system HSV-TK/GCV under Tet-On regulation in human breast cancer cell line MCF-7 infected by recombinant adeno-associated virus (rAAV). We used comet assay to detect the effect of HSV-TK/GCV suicide gene regulation system on MCF-7 DNA damage, and analyzed the expression change of relative DNA damage response active genes and proteins with RT-PCR and Western blot. Compared with other control groups, the comet assay showed that MCF-7 cells with HSV-TK/GCV treatment had obvious comet tails, and the expression level of DNA damage response active genes and proteins changed obviously in the HSV-TK/GCV treatment group,such as ATM, p53 and p27,but CyclinE and CDK2 did not change. DNA damage on MCF-7 cells is resulted from HSV-TK/GCV in suicide gene therapy system through a p53-dependent signal pathway, causing cell cycle arrest and cell death.

  13. Evaluation of the gene encoding the enzyme βHPMEH for the bacterial wilt inhibition caused by Ralstonia solanacearum

    Directory of Open Access Journals (Sweden)

    Elizabeth Fernandez

    2015-10-01

    Full Text Available Ralstonia solanacearum is the causal agent of the devastating bacterial wilt disease that attacks important agricultural crops such as potato, tomato, banana, among others, causing serious yield losses. Control of R. solanacearum is difficult because of its wide range of alternate hosts, its long survival in soil, its biological and genetic variation, the lack of natural resistance sources and the insufficiency of the appropriate chemical control measures. Quorum sensing is the term that describes the phenomenon whereby the accumulation of molecules allows bacteria to know the number of bacteria found in the environment (population density. R. solanacearum has a quorum sensing system for the regulation of the expression of virulence genes; the molecule 3-OH-PAME is the self-regulatory signal. The molecule ΒHPMEH hydrolyzes 3-OH-PAME nullifying the signal of virulence, and thus, the quorum sensing communication in R. solanacearum. In order to evaluate the βhpmeh gene we designed two vectors that express this gene under the control of two different promoters. Both vectors were verified by restriction analysis and sequencing. Agroinfiltration assays were used to analyze gene expression and the effect against R. solanacearum in potato (Solanum tuberosum leaves. The results of the transient expression experiments showed that the expression of gene βhpmeh caused a delay in the appearance of symptoms of bacterial wilt and thus is a good candidate for whole genetic plant transformation.

  14. Gene-Expression Changes Caused by Inbreeding Protect Against Inbreeding Depression in Drosophila

    OpenAIRE

    García, Carlos; Ávila, Victoria; Quesada, Humberto; Caballero, Armando

    2012-01-01

    We present a transcriptomic analysis aimed at investigating whether the changes in gene expression that occur under inbreeding generally reduce or enhance inbreeding depression. Discerning between these two alternatives can be addressed only when both changes in expression due to inbreeding and to inbreeding depression are estimated simultaneously. We used Affymetrix 2.0 arrays to study the changes in gene expression associated with both inbreeding and inbreeding depression for fitness in fou...

  15. Deletion of exons 1-5 of the STS gene causing X-linked ichthyosis.

    Science.gov (United States)

    Valdes-Flores, M; Kofman-Alfaro, S H; Vaca, A L; Cuevas-Covarrubias, S A

    2001-03-01

    X-linked ichthyosis is an inherited disorder due to steroid sulfatase deficiency. It is clinically characterized by dark, adhesive, and regular scales of the skin. Most X-linked ichthyosis patients present large deletions of the STS gene and flanking markers; a minority show a point mutation or partial deletion of the STS gene. In this study we analyzed the STS gene in a family with simultaneous occurrence of X-linked ichthyosis and ichthyosis vulgaris. X-linked ichthyosis diagnosis was confirmed through steroid sulfatase assay in leukocytes using 7-[3H]-dehydroepiandrosterone sulfate as a substrate. Exons 1, 2, 5, and 6-10, and the 5' flanking markers DXS1130, DXS1139, and DXS996 of the STS gene were analyzed by polymerase chain reaction. X-linked ichthyosis patients of the family (n = 4 males) had undetectable levels of STS activity (0.00 pmol per mg protein per h). The DNA analysis showed that only exons 6-10 and the 5' flanking markers of the STS gene were present. We report the first partial deletion of the STS gene spanning exons 1-5 in X-linked ichthyosis patients.

  16. Gene Therapy for Retinitis Pigmentosa Caused by MFRP Mutations: Human Phenotype and Preliminary Proof of Concept

    Science.gov (United States)

    Dinculescu, Astra; Estreicher, Jackie; Zenteno, Juan C.; Aleman, Tomas S.; Schwartz, Sharon B.; Huang, Wei Chieh; Roman, Alejandro J.; Sumaroka, Alexander; Li, Qiuhong; Deng, Wen-Tao; Min, Seok-Hong; Chiodo, Vince A.; Neeley, Andy; Liu, Xuan; Shu, Xinhua; Matias-Florentino, Margarita; Buentello-Volante, Beatriz; Boye, Sanford L.; Cideciyan, Artur V.

    2011-01-01

    Abstract Autosomal recessive retinitis pigmentosa (RP), a heterogeneous group of degenerations of the retina, can be due to mutations in the MFRP (membrane-type frizzled-related protein) gene. A patient with RP with MFRP mutations, one of which is novel and the first splice site mutation reported, was characterized by noninvasive retinal and visual studies. The phenotype, albeit complex, suggested that this retinal degeneration may be a candidate for gene-based therapy. Proof-of-concept studies were performed in the rd6 Mfrp mutant mouse model. The fast-acting tyrosine-capsid mutant AAV8 (Y733F) vector containing the small chicken β-actin promoter driving the wild-type mouse Mfrp gene was used. Subretinal vector delivery on postnatal day 14 prevented retinal degeneration. Treatment rescued rod and cone photoreceptors, as assessed by electroretinography and retinal histology at 2 months of age. This AAV-mediated gene delivery also resulted in robust MFRP expression predominantly in its normal location within the retinal pigment epithelium apical membrane and its microvilli. The clinical features of MFRP-RP and our preliminary data indicating a response to gene therapy in the rd6 mouse suggest that this form of RP is a potential target for gene-based therapy. PMID:22142163

  17. Single nucleotide polymorphisms in obesity-related genes and all-cause and cause-specific mortality: a prospective cohort study

    Directory of Open Access Journals (Sweden)

    Ruczinski Ingo

    2009-10-01

    Full Text Available Abstract Background The aim of this study was to examine the associations between 16 specific single nucleotide polymorphisms (SNPs in 8 obesity-related genes and overall and cause-specific mortality. We also examined the associations between the SNPs and body mass index (BMI and change in BMI over time. Methods Data were analyzed from 9,919 individuals who participated in two large community-based cohort studies conducted in Washington County, Maryland in 1974 (CLUE I and 1989 (CLUE II. DNA from blood collected in 1989 was genotyped for 16 SNPs in 8 obesity-related genes: monoamine oxidase A (MAOA, lipoprotein lipase (LPL, paraoxonase 1 and 2 (PON1 and PON2, leptin receptor (LEPR, tumor necrosis factor-α (TNFα, and peroxisome proliferative activated receptor-γ and -δ (PPARG and PPARD. Data on height and weight in 1989 (CLUE II baseline and at age 21 were collected from participants at the time of blood collection. All participants were followed from 1989 to the date of death or the end of follow-up in 2005. Cox proportional hazards regression was used to obtain the relative risk (RR estimates and 95% confidence intervals (CI for each SNP and mortality outcomes. Results The results showed no patterns of association for the selected SNPs and the all-cause and cause-specific mortality outcomes, although statistically significant associations (p PPARG rs4684847 and all-cause mortality (CC: reference; CT: RR 0.99, 95% CI 0.89, 1.11; TT: RR 0.60, 95% CI 0.39, 0.93 and cancer-related mortality (CC: reference; CT: RR 1.01, 95% CI 0.82, 1.25; TT: RR 0.22, 95% CI 0.06, 0.90 and TNFα rs1799964 and cancer-related mortality (TT: reference; CT: RR 1.23, 95% CI 1.03, 1.47; CC: RR 0.83, 95% CI 0.54, 1.28. Additional analyses showed significant associations between SNPs in LEPR with BMI (rs1137101 and change in BMI over time (rs1045895 and rs1137101. Conclusion Findings from this cohort study suggest that the selected SNPs are not associated with overall

  18. A Novel Mutation in the BCKDHB Gene Causes in an Iranian Child Classic Maple Syrup Urine Disease

    Directory of Open Access Journals (Sweden)

    Esmat Safdarian

    2016-09-01

    Full Text Available Background Maple syrup urine disease (MSUD is a rare metabolic disorder caused by deficiency in branched chain alpha-keto acid dehydrogenase complex (BCKD. Methods In this study, the coding regions and flanking splice sites of the BCKDHA, BCKDHB, DBT and DLD genes have been sequenced in an Iranian 3 years old girl. Results A novel homozygous mutation (p.Glu330Lys was detected in the BCKDHB gene. In silico analysis showed significant change in the 3-D protein Structure. Conclusions This alteration probably affects the structure and function of the E1β subunit of BCKD complex.

  19. Spectrum of LDLR gene mutations, including a novel mutation causing familial hypercholesterolaemia, in North-western Greece.

    Science.gov (United States)

    Diakou, Maria; Miltiadous, George; Xenophontos, Stavroulla L; Manoli, Panayiotis; Cariolou, Marios A; Elisaf, Moses

    2011-10-01

    Familial Hypercholesterolaemia (FH) is a clinical syndrome characterised by elevated serum low-density lipoprotein (LDL) cholesterol, by tendon xanthomata and clinical manifestations of ischaemic heart disease in early life. Typically, it results from mutations in the low-density lipoprotein receptor (LDLR) gene. Furthermore, there are 3 additional genetic disorders that cause clinical syndromes that mimic FH. These are: 1) familial ligand-defective apolipoprotein (apo)-B (FLDH), 2) familial hypercholesterolaemia type 3 (FH3) and 3) autosomal recessive hypercholesterolaemia (ARH). The aim of this study was to elaborate the impact of the above genetic disorders in Greek patients with a clinical diagnosis of FH. In this study, we assessed the contribution of the LDLR, Apo B, ARH and PCSK9 genes in the expression of FH in North-western Greece. Two hundred and fifty-four (254) probands with a clinical diagnosis of FH were included in the study. One hundred and sixty-nine (169) patients had one of the following LDLR gene mutations: 81T>G, 1775G>A, 517T>C, 858C>A, 1352T>C, 1285G>A, 761A>C, 1195G>A, 1646G>A and a deletion mutation g.387-410del24 in exon 4. We sequenced the Apo B, ARH and PCSK9 genes in 40, randomly selected patients, from the 85 patients with no identified LDLR gene defects. In these 40, randomly selected patients, with the exception of benign single nucleotide polymorphisms, no functional mutations were identified for all the above mentioned sequenced genes. Our results reveal substantial genetic heterogeneity for FH in North-western Greece with at least ten LDLR gene mutations present in the study population. One of these mutations although quite rare is reported here for the first time in the scientific literature. The detection of these mutations is important as they may be used to design multiplex detection assays for large scale population screening programmes to facilitate primary and secondary prevention of cardiovascular disease in the region

  20. Methamphetamine causes differential alterations in gene expression and patterns of histone acetylation/hypoacetylation in the rat nucleus accumbens.

    Directory of Open Access Journals (Sweden)

    Tracey A Martin

    Full Text Available Methamphetamine (METH addiction is associated with several neuropsychiatric symptoms. Little is known about the effects of METH on gene expression and epigenetic modifications in the rat nucleus accumbens (NAC. Our study investigated the effects of a non-toxic METH injection (20 mg/kg on gene expression, histone acetylation, and the expression of the histone acetyltransferase (HAT, ATF2, and of the histone deacetylases (HDACs, HDAC1 and HDAC2, in that structure. Microarray analyses done at 1, 8, 16 and 24 hrs after the METH injection identified METH-induced changes in the expression of genes previously implicated in the acute and longterm effects of psychostimulants, including immediate early genes and corticotropin-releasing factor (Crf. In contrast, the METH injection caused time-dependent decreases in the expression of other genes including Npas4 and cholecystokinin (Cck. Pathway analyses showed that genes with altered expression participated in behavioral performance, cell-to-cell signaling, and regulation of gene expression. PCR analyses confirmed the changes in the expression of c-fos, fosB, Crf, Cck, and Npas4 transcripts. To determine if the METH injection caused post-translational changes in histone markers, we used western blot analyses and identified METH-mediated decreases in histone H3 acetylated at lysine 9 (H3K9ac and lysine 18 (H3K18ac in nuclear sub-fractions. In contrast, the METH injection caused time-dependent increases in acetylated H4K5 and H4K8. The changes in histone acetylation were accompanied by decreased expression of HDAC1 but increased expression of HDAC2 protein levels. The histone acetyltransferase, ATF2, showed significant METH-induced increased in protein expression. These results suggest that METH-induced alterations in global gene expression seen in rat NAC might be related, in part, to METH-induced changes in histone acetylation secondary to changes in HAT and HDAC expression. The causal role that HATs and

  1. Transcriptional regulation of PRPF31 gene expression by MSR1 repeat elements causes incomplete penetrance in retinitis pigmentosa.

    Science.gov (United States)

    Rose, Anna M; Shah, Amna Z; Venturini, Giulia; Krishna, Abhay; Chakravarti, Aravinda; Rivolta, Carlo; Bhattacharya, Shomi S

    2016-01-19

    PRPF31-associated retinitis pigmentosa presents a fascinating enigma: some mutation carriers are blind, while others are asymptomatic. We identify the major molecular cause of this incomplete penetrance through three cardinal features: (1) there is population variation in the number (3 or 4) of a minisatellite repeat element (MSR1) adjacent to the PRPF31 core promoter; (2) in vitro, 3-copies of the MSR1 element can repress gene transcription by 50 to 115-fold; (3) the higher-expressing 4-copy allele is not observed among symptomatic PRPF31 mutation carriers and correlates with the rate of asymptomatic carriers in different populations. Thus, a linked transcriptional modifier decreases PRPF31 gene expression that leads to haploinsufficiency. This result, taken with other identified risk alleles, allows precise genetic counseling for the first time. We also demonstrate that across the human genome, the presence of MSR1 repeats in the promoters or first introns of genes is associated with greater population variability in gene expression indicating that copy number variation of MSR1s is a generic controller of gene expression and promises to provide new insights into our understanding of gene expression regulation.

  2. Gene conversion-like events cause steroid 21-hydroxylase deficiency in congenital adrenal hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Harada, F.; Kimura, A.; Iwanaga, T.; Shimozawa, K.; Yata, J.; Sasazuki,T.

    1987-11-01

    Genomic DNAs from twelve Japanese patients with steroid 21-hydroxylase deficiency were analyzed by Southern blot hybridization. A 3.7-kilobase (kb) Taq I and a 1.7-kb Pvu II restriction endonuclease fragment that correspond to a 21-OHase B gene were absent from the DNA of two unrelated patients with the salt-wasting form of the disease. However, a 10.5-kb Bgl II fragment corresponding to the region encompassing the 21-OHase B gene was still present in these two patients. The genes encoding 21-OHase were cloned from one of these two patients, who was homozygous by descent for HLA-A26;B39;C4A3;C4B1;DR4. Restriction endonuclease mapping as well as partial nucleotide sequencing analysis revealed that the 21-OHase B gene of the patient has been converted to the pseudogene, 21-OHase A, as far as the critical 0.5-kb sequence was concerned. Thus, the defect was due to both chromosomes each carrying two copies of 21-OHase A pseudogene and lacking functional 21-OHase B gene.

  3. Autosomal recessive cerebellar ataxia caused by mutations in the PEX2 gene

    NARCIS (Netherlands)

    Sevin, C.; Ferdinandusse, S.; Waterham, H.R.; Wanders, R.J.; Aubourg, P.

    2011-01-01

    ABSTRACT: OBJECTIVE: To expand the spectrum of genetic causes of autosomal recessive cerebellar ataxia (ARCA). Case report: Two brothers are described who developed progressive cerebellar ataxia at 3 1/2 and 18 years, respectively. After ruling out known common genetic causes of ARCA, analysis of

  4. Mitochondrially-targeted expression of a cytoplasmic male sterility-associated orf220 gene causes male sterility in Brassica juncea

    Directory of Open Access Journals (Sweden)

    Liu Xunyan

    2010-10-01

    Full Text Available Abstract Background The novel chimeric open reading frame (orf resulting from the rearrangement of a mitochondrial genome is generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS. Both positive and negative correlations have been found between CMS-associated orfs and the occurrence of CMS when CMS-associated orfs were expressed and targeted at mitochondria. Some orfs cause male sterility or semi-sterility, while some do not. Little is currently known about how mitochondrial factor regulates the expression of the nuclear genes involved in male sterility. The purpose of this study was to investigate the biological function of a candidate CMS-associated orf220 gene, newly isolated from cytoplasmic male-sterile stem mustard, and show how mitochondrial retrograde regulated nuclear gene expression is related to male sterility. Results It was shown that the ORF220 protein can be guided to the mitochondria using the mitochondrial-targeting sequence of the β subunit of F1-ATPase (atp2-1. Transgenic stem mustard plants expressed the chimeric gene containing the orf220 gene and a mitochondrial-targeting sequence of the β subunit of F1-ATPase (atp2-1. Transgenic plants were male-sterile, most being unable to produce pollen while some could only produce non-vigorous pollen. The transgenic stem mustard plants also showed aberrant floral development identical to that observed in the CMS stem mustard phenotype. Results obtained from oligooarray analysis showed that some genes related to mitochondrial energy metabolism were down-regulated, indicating a weakening of mitochondrial function in transgenic stem mustard. Some genes related to pollen development were shown to be down-regulated in transgenic stem mustard and the expression of some transcription factor genes was also altered. Conclusion The work presented furthers our understanding of how the mitochondrially-targeted expression of CMS-associated orf220 gene causes

  5. Modulation of gene expression in a human cell line caused by poliovirus, vaccinia virus and interferon

    Directory of Open Access Journals (Sweden)

    Hoddevik Gunnar

    2007-03-01

    Full Text Available Abstract Background The project was initiated to describe the response of a human embryonic fibroblast cell line to the replication of two different viruses, and, more specifically, to look for candidate genes involved in viral defense. For this purpose, the cells were synchronously infected with poliovirus in the absence or presence of interferon-alpha, or with vaccinia virus, a virus that is not inhibited by interferon. By comparing the changes in transcriptosome due to these different challenges, it should be possible to suggest genes that might be involved in defense. Results The viral titers were sufficient to yield productive infection in a majority of the cells. The cells were harvested in triplicate at various time-points, and the transcriptosome compared with mock infected cells using oligo-based, global 35 k microarrays. While there was very limited similarities in the response to the different viruses, a large proportion of the genes up-regulated by interferon-alpha were also up-regulated by poliovirus. Interferon-alpha inhibited poliovirus replication, but there were no signs of any interferons being induced by poliovirus. The observations suggest that the cells do launch an antiviral response to poliovirus in the absence of interferon. Analyses of the data led to a list of candidate antiviral genes. Functional information was limited, or absent, for most of the candidate genes. Conclusion The data are relevant for our understanding of how the cells respond to poliovirus and vaccinia virus infection. More annotations, and more microarray studies with related viruses, are required in order to narrow the list of putative defence-related genes.

  6. Sporadic in utero generalized edema caused by mutations in the lymphangiogenic genes VEGFR3 and FOXC2.

    Science.gov (United States)

    Ghalamkarpour, Arash; Debauche, Christian; Haan, Eric; Van Regemorter, Nicole; Sznajer, Yves; Thomas, Dominique; Revencu, Nicole; Gillerot, Yves; Boon, Laurence M; Vikkula, Miikka

    2009-07-01

    To investigate the genetic causes of idiopathic sporadic prenatal generalized edema. In a series of 12 patients, in whom in utero generalized skin edema or hydrops fetalis had been diagnosed, we screened 3 lymphangiogenic genes, VEGFR3, FOXC2, and SOX18. In 3 of the patients, we identified a mutation: 2 in VEGFR3 and 1 in FOXC2. Two of the mutations were de novo and one was either de novo or nonpenetrant inherited. In these patients, the generalized edema resorbed spontaneously, either in utero or after birth. In the 2 individuals with a VEGFR3 mutation, edema remained limited to lower limbs. Mutations in the VEGFR3 and FOXC2 genes account for a subset of patients with unexplained in utero generalized subcutaneous edema and hydrops fetalis without family history of lymphedema. Lymphangiogenic genes should be screened for mutations in sporadic patients diagnosed with fetal edema.

  7. Differential Gene Expression of Three Mastitis-Causing Escherichia coli Strains Grown under Planktonic, Swimming, and Swarming Culture Conditions.

    Science.gov (United States)

    Lippolis, John D; Brunelle, Brian W; Reinhardt, Timothy A; Sacco, Randy E; Thacker, Tyler C; Looft, Torey P; Casey, Thomas A

    2016-01-01

    Bacterial motility is thought to play an important role in virulence. We have previously shown that proficient bacterial swimming and swarming in vitro is correlated with the persistent intramammary infection phenotype observed in cattle. However, little is known about the gene regulation differences important for different motility phenotypes in Escherichia coli. In this work, three E. coli strains that cause persistent bovine mastitis infections were grown in three media that promote different types of motility (planktonic, swimming, and swarming). Using whole-transcriptome RNA sequencing, we identified a total of 935 genes (~21% of the total genome) that were differentially expressed in comparisons of the various motility-promoting conditions. We found that approximately 7% of the differentially expressed genes were associated with iron regulation. We show that motility assays using iron or iron chelators confirmed the importance of iron regulation to the observed motility phenotypes. Because of the observation that E. coli strains that cause persistent infections are more motile, we contend that better understanding of the genes that are differentially expressed due to the type of motility will yield important information about how bacteria can become established within a host. Elucidating the mechanisms that regulate bacterial motility may provide new approaches in the development of intervention strategies as well as facilitate the discovery of novel diagnostics and therapeutics. IMPORTANCE Bacteria can exhibit various types of motility. It is known that different types of motilities can be associated with virulence. In this work, we compare gene expression levels in bacteria that were grown under conditions that promoted three different types of E. coli motility. Better understanding of the mechanisms of how bacteria can cause an infection is an important first step to better diagnostics and therapeutics.

  8. Body fat distribution in women with familial partial lipodystrophy caused by mutation in the lamin A/C gene

    Directory of Open Access Journals (Sweden)

    Luciana Z Monteiro

    2012-01-01

    Full Text Available Familial partial lipodystrophy (FPLD, Dunnigan variety, is an autosomal dominant disorder caused due to missense mutations in the lamin A/C (LMNA gene encoding nuclear lamina proteins. Patients with FPLD are predisposed to metabolic complications of insulin resistance such as diabetes. We sought to evaluate and compare body fat distribution with dual-emission X-ray absorptiometry in women with and without FPLD and identify densitometric, clinical and metabolic features.

  9. Exclusion of the APC gene as the cause of a variant form of familial adenomatous polyposis (FAP)

    Energy Technology Data Exchange (ETDEWEB)

    Stella, A.; Resta, N.; Susca, F.; Guanti, G.; Gentile, M. (Universita di Bari (Italy)); Mareni, C.; Montera, P. (Universita di Genova (Italy))

    1993-11-01

    Familial adenomatous polyposis (FAP) is a premalignant disease inherited as an autosomal dominant trait, characterized by hundreds to thousands of polyps in the colorectal tract. Recently, the syndrome has been shown to be caused by mutations in the APC (adenomatous polyposis coli) gene located on chromosome 5q21. The authors studied two families that both presented a phenotype different from that of the classical form of FAP. The most important findings observed in these two kindreds are (a) low and variable number of colonic polyps (from 5 to 100) and (b) a slower evolution of the disease, with colon cancer occurring at a more advanced age than in FAP in spite of the early onset of intestinal manifestations. To determine whether mutations of the APC gene are also responsible for this variant syndrome, linkage studies were performed by using a series of markers both intragenic and tightly linked to the APC gene. The results provide evidence for exclusion of the APC gene as the cause of the variant form of polyposis present in the two families described. 30 refs., 1 fig., 1 tab.

  10. Hereditary spastic paraplegia caused by compound heterozygous mutations outside the motor domain of the KIF1A gene.

    Science.gov (United States)

    Krenn, M; Zulehner, G; Hotzy, C; Rath, J; Stogmann, E; Wagner, M; Haack, T B; Strom, T M; Zimprich, A; Zimprich, F

    2017-05-01

    Hereditary spastic paraplegia is a clinically and genetically heterogeneous group of rare, inherited disorders causing an upper motor neuron syndrome with (complex) or without (pure) additional neurological symptoms. Mutations in the KIF1A gene have already been associated with recessive and dominant forms of hereditary spastic paraplegia (SPG30) in a few cases. All family members included in the study were examined neurologically. Whole-exome sequencing was used in affected individuals to identify the responsible candidate gene. Conventional Sanger sequencing was conducted to validate familial segregation. A family of Macedonian origin with two affected siblings, one with slowly progressive and the other one with a more complex and rapidly progressing hereditary spastic paraplegia is reported. In both affected individuals, two novel pathogenic mutations outside the motor domain of the KIF1A gene were found (NM_001244008.1:c.2909G>A, p.Arg970His and c.1214dup, p.Asn405Lysfs*40) that segregate with the disease within the family establishing the diagnosis of autosomal recessive SPG30. This report provides the first evidence that mutations outside the motor domain of the gene can cause (recessive) SPG30 and extends the genotype-phenotype association for KIF1A-related diseases. © 2017 EAN.

  11. Childhood trauma as a cause of psychosis: linking genes, psychology, and biology.

    Science.gov (United States)

    van Winkel, Ruud; van Nierop, Martine; Myin-Germeys, Inez; van Os, Jim

    2013-01-01

    Recent studies have provided robust evidence for an association between childhood trauma (CT) and psychosis. Meta-analyses have quantified the association, pointing to odds ratios in the order of around 3, and prospective studies have shown that reverse causation is unlikely to explain the association. However, more work is needed to address the possibility of a gene-environment correlation, that is, whether genetic risk for psychosis predicts exposure to CT. Nevertheless, multiple studies have convincingly shown that the association between CT and psychosis remains strong and significant when controlling for genetic risk, in agreement with a possible causal association. In addition, several studies have shown plausible psychological and neurobiological mechanisms linking adverse experiences to psychosis, including induction of social defeat and reduced self-value, sensitization of the mesolimbic dopamine system, changes in the stress and immune system, and concomitant changes in stress-related brain structures, such as the hippocampus and the amygdala, findings that should be integrated, however, in more complex models of vulnerability. It is currently unclear whether genetic vulnerability plays a role in conferring the mental consequences of adversity, and which genes are likely to be involved. The current, limited evidence points to genes that are not specifically involved in psychosis but more generally in regulating mood (serotonin transporter gene), neuroplasticity (brain-derived neurotrophic factor), and the stress-response system (FKBP5), in line with a general effect of CT on a range of mental disorders, rather than suggesting specificity for psychosis.

  12. Mutations in the histone methyltransferase gene KMT2B cause complex early-onset dystonia

    NARCIS (Netherlands)

    Meyer, Esther; Carss, Keren J.; Rankin, Julia; Nichols, John M. E.; Grozeva, Detelina; Joseph, Agnel P.; Mencacci, Niccolo E.; Papandreou, Apostolos; Ng, Joanne; Barra, Serena; Ngoh, Adeline; Ben-Pazi, Hilla; Willemsen, Michel A.; Arkadir, David; Barnicoat, Angela; Bergman, Hagai; Bhate, Sanjay; Boys, Amber; Darin, Niklas; Foulds, Nicola; Gutowski, Nicholas; Hills, Alison; Houlden, Henry; Hurst, Jane A.; Israe, Zvi; Kaminska, Margaret; Limousin, Patricia; Lumsden, Daniel; Mckee, Shane; Misra, Shibalik; Mohammed, Shekeeb S.; Nakou, Vasiliki; Nicolai, Joost; Nilsson, Magnus; Pall, Hardev; Peall, Kathryn J.; Peters, Gregory B.; Prabhakar, Prab; Reuter, Miriam S.; Rump, Patrick; Sege, Reeval; Sinnema, Margje; Smith, Martin; Turnpenny, Peter; White, Susan M.; Wieczorek, Dagmar; Wiethoff, Sarah; Wilson, Brian T.; Winter, Gidon; Wragg, Christopher; Pope, Simon; Heales, Simon J. H.; Morrogh, Deborah; Pittman, Alan; Carr, Lucinda J.; Perez-Duenas, Belen; Lin, Jean-Pierre; Reis, Andre; Gahl, William A.; Toro, Camilo; Bhatia, Kailash P.; Wood, Nicholas W.; Kamsteeg, Erik-Jan; Chong, Wui K.; Gissen, Paul; Topf, Maya; Dale, Russell C.; Chubby, Jonathan R.; Raymond, F. Lucy; Kurian, Manju A.

    Histone lysine methylation, mediated by mixed-lineage leukemia (MLL) proteins, is now known to be critical in the regulation of gene expression, genomic stability, cell cycle and nuclear architecture. Despite MLL proteins being postulated as essential for normal development, little is known about

  13. Comparison of Proinflammatory Gene Expression in Lesions Caused by either Burn Injuries or Cutaneous Leishmaniasis

    OpenAIRE

    Akhzari; Rezvan; Zolhavarieh; Moafi

    2016-01-01

    Background Leishmaniasis is a worldwide disease prevalent in tropical and sub-tropical countries in the world. Characterization of inflammatory responses produced in cutaneous Leishmaniasis has not yet been completed. The current study aims to assess and compare pro-inflammatory cytokines between burning injuries and Leishmania infection. Methods the specific primers were designed for 10 proinflammatory genes including CCL4, CCL3,...

  14. Calcitonin gene-related peptide does not cause the familial hemiplegic migraine phenotype

    DEFF Research Database (Denmark)

    Hansen, J.M.; Thomsen, L.L.; Olesen, J.

    2008-01-01

    with aura associated with several gene mutations. FHM shares many phenotypical similarities with common types of migraine, indicating common neurobiological pathways. We tested the hypothesis that the FHM genotype confers a CGRP hypersensitive phenotype. Methods: We included 9 FHM patients with known...

  15. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene

    DEFF Research Database (Denmark)

    Xu, H; Wu, X R; Wewer, U M

    1994-01-01

    The classic murine muscular dystrophy strain, dy, was first described almost 40 years ago. We have identified the molecular basis of an allele of dy, called dy2J, by detecting a mutation in the laminin alpha 2 chain gene--the first identified mutation in laminin-2. The G to A mutation in a splice...

  16. Point mutations throughout the GLI3 gene cause Greig cephalopolysyndactyly syndrome

    NARCIS (Netherlands)

    Kalff-Suske, M.; Wild, A.; Topp, J.; Wessling, M.; Jacobsen, E. M.; Bornholdt, D.; Engel, H.; Heuer, H.; Aalfs, C. M.; Ausems, M. G.; Barone, R.; Herzog, A.; Heutink, P.; Homfray, T.; Gillessen-Kaesbach, G.; König, R.; Kunze, J.; Meinecke, P.; Müller, D.; Rizzo, R.; Strenge, S.; Superti-Furga, A.; Grzeschik, K. H.

    1999-01-01

    Greig cephalopolysyndactyly syndrome, characterized by craniofacial and limb anomalies (GCPS; MIM 175700), previously has been demonstrated to be associated with translocations as well as point mutations affecting one allele of the zinc finger gene GLI3. In addition to GCPS, Pallister-Hall syndrome

  17. A novel RNA-splicing mutation in TRAPPC2 gene causing X-linked ...

    Indian Academy of Sciences (India)

    large Chinese family with SEDT and identified a novel RNA- splicing mutation in the TRAPPC2 gene. Materials and methods. Patients. The proband of this family is 38-year-old man who sought medical attention because of chronic pain in weight-bearing joints. The proband's height is 135 cm and his arm span is 155 cm.

  18. A mutation in the rice chalcone isomerase gene causes the golden hull and internode 1 phenotype.

    Science.gov (United States)

    Hong, Lilan; Qian, Qian; Tang, Ding; Wang, Kejian; Li, Ming; Cheng, Zhukuan

    2012-07-01

    The biosynthesis of flavonoids, important secondary plant metabolites, has been investigated extensively, but few mutants of genes in this pathway have been identified in rice (Oryza sativa). The rice gold hull and internode (gh) mutants exhibit a reddish-brown pigmentation in the hull and internode and their phenotype has long been used as a morphological marker trait for breeding and genetic study. Here, we characterized that the gh1 mutant was a mutant of the rice chalcone isomerase gene (OsCHI). The result showed that gh1 had a Dasheng retrotransposon inserted in the 5′ UTR of the OsCHI gene, which resulted in the complete loss of OsCHI expression. gh1 exhibited golden pigmentation in hulls and internodes once the panicles were exposed to light. The total flavonoid content in gh1 hulls was increased threefold compared to wild type. Consistent with the gh1 phenotype, OsCHI transcripts were expressed in most tissues of rice and most abundantly in internodes. It was also expressed at high levels in panicles before heading, distributed mainly in lemmas and paleae, but its expression decreased substantially after the panicles emerged from the sheath. OsCHI encodes a protein functionally and structurally conserved to chalcone isomerases in other species. Our findings demonstrated that the OsCHI gene was indispensable for flux of the flavonoid pathway in rice.

  19. Mutations in genes encoding subunits of RNA polymerases I and III cause Treacher Collins syndrome.

    NARCIS (Netherlands)

    Dauwerse, J.G.; Dixon, J.; Seland, S.; Ruivenkamp, C.A.; Haeringen, A. van; Hoefsloot, L.H.; Peters, D.J.; Boers, A.C.; Daumer-Haas, C.; Maiwald, R.; Zweier, C.; Kerr, B.; Cobo, A.M.; Toral, J.F.; Hoogeboom, A.J.M.; Lohmann, D.R.; Hehr, U.; Dixon, M.J.; Breuning, M.H.; Wieczorek, D.

    2011-01-01

    We identified a deletion of a gene encoding a subunit of RNA polymerases I and III, POLR1D, in an individual with Treacher Collins syndrome (TCS). Subsequently, we detected 20 additional heterozygous mutations of POLR1D in 252 individuals with TCS. Furthermore, we discovered mutations in both

  20. Mutations in the Gene PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

    NARCIS (Netherlands)

    Lee, Hsien-Yang; Huang, Yong; Bruneau, Nadine; Roll, Patrice; Roberson, Elisha D. O.; Hermann, Mark; Quinn, Emily; Maas, James; Edwards, Robert; Ashizawa, Tetsuo; Baykan, Betul; Bhatia, Kailash; Bressman, Susan; Bruno, Michiko K.; Brunt, Ewout R.; Caraballo, Roberto; Echenne, Bernard; Fejerman, Natalio; Frucht, Steve; Gurnett, Christina A.; Hirsch, Edouard; Houlden, Henry; Jankovic, Joseph; Lee, Wei-Ling; Lynch, David R.; Mohammed, Shehla; Mueller, Ulrich; Nespeca, Mark P.; Renner, David; Rochette, Jacques; Rudolf, Gabrielle; Saiki, Shinji; Soong, Bing-Wen; Swoboda, Kathryn J.; Tucker, Sam; Wood, Nicholas; Hanna, Michael; Bowcock, Anne M.; Szepetowski, Pierre; Fu, Ying-Hui; Ptacek, Louis J.

    Paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC) is an episodic movement disorder with autosomal-dominant inheritance and high penetrance, but the causative genetic mutation is unknown. We have now identified four truncating mutations involving the gene PRRT2 in the vast

  1. Mutations in the polyglutamine binding protein 1 gene cause X-linked mental retardation

    DEFF Research Database (Denmark)

    Kalscheuer, Vera M; Freude, Kristine; Musante, Luciana

    2003-01-01

    We found mutations in the gene PQBP1 in 5 of 29 families with nonsyndromic (MRX) and syndromic (MRXS) forms of X-linked mental retardation (XLMR). Clinical features in affected males include mental retardation, microcephaly, short stature, spastic paraplegia and midline defects. PQBP1 has previou...

  2. Environmental and chemotherapeutic agents induce breakage at genes involved in leukemia-causing gene rearrangements in human hematopoietic stem/progenitor cells

    Energy Technology Data Exchange (ETDEWEB)

    Thys, Ryan G., E-mail: rthys@wakehealth.edu [Department of Cancer Biology, Wake Forest School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1016 (United States); Lehman, Christine E., E-mail: clehman@wakehealth.edu [Department of Cancer Biology, Wake Forest School of Medicine, Medical Center Boulevard, Winston-Salem, NC 27157-1016 (United States); Pierce, Levi C.T., E-mail: Levipierce@gmail.com [Human Longevity, Inc., San Diego, California 92121 (United States); Wang, Yuh-Hwa, E-mail: yw4b@virginia.edu [Department of Biochemistry and Molecular Genetics, University of Virginia, 1340 Jefferson Park Avenue, Charlottesville, VA 22908-0733 (United States)

    2015-09-15

    Highlights: • Environmental/chemotherapeutic agents cause DNA breakage in MLL and CBFB in HSPCs. • Diethylnitrosamine-induced DNA breakage at MLL and CBFB shown for the first time. • Chemical-induced DNA breakage occurs at topoisomerase II cleavage sites. • Chemical-induced DNA breaks display a pattern similar to those in leukemia patients. • Long-term exposures suggested to generate DNA breakage at leukemia-related genes. - Abstract: Hematopoietic stem and progenitor cells (HSPCs) give rise to all of the cells that make up the hematopoietic system in the human body, making their stability and resilience especially important. Damage to these cells can severely impact cell development and has the potential to cause diseases, such as leukemia. Leukemia-causing chromosomal rearrangements have largely been studied in the context of radiation exposure and are formed by a multi-step process, including an initial DNA breakage and fusion of the free DNA ends. However, the mechanism for DNA breakage in patients without previous radiation exposure is unclear. Here, we investigate the role of non-cytotoxic levels of environmental factors, benzene, and diethylnitrosamine (DEN), and chemotherapeutic agents, etoposide, and doxorubicin, in generating DNA breakage at the patient breakpoint hotspots of the MLL and CBFB genes in human HSPCs. These conditions represent exposure to chemicals encountered daily or residual doses from chemotherapeutic drugs. Exposure of HSPCs to non-cytotoxic levels of environmental chemicals or chemotherapeutic agents causes DNA breakage at preferential sites in the human genome, including the leukemia-related genes MLL and CBFB. Though benzene, etoposide, and doxorubicin have previously been linked to leukemia formation, this is the first study to demonstrate a role for DEN in the generation of DNA breakage at leukemia-specific sites. These chemical-induced DNA breakpoints coincide with sites of predicted topoisomerase II cleavage. The

  3. Clinical and Prognostic Profiles of Cardiomyopathies Caused by Mutations in the Troponin T Gene.

    Science.gov (United States)

    Ripoll-Vera, Tomás; Gámez, José María; Govea, Nancy; Gómez, Yolanda; Núñez, Juana; Socías, Lorenzo; Escandell, Ángela; Rosell, Jorge

    2016-02-01

    Mutations in the troponin T gene (TTNT2) have been associated in small studies with the development of hypertrophic cardiomyopathy characterized by a high risk of sudden death and mild hypertrophy. We describe the clinical course of patients carrying mutations in this gene. We analyzed the clinical characteristics and prognosis of patients with mutations in the TNNT2 gene who were seen in an inherited cardiac disease unit. Of 180 families with genetically studied cardiomyopathies, 21 families (11.7%) were identified as having mutations in TNNT2: 10 families had Arg92Gln, 5 had Arg286His, 3 had Arg278Cys, 1 had Arg92Trp, 1 had Arg94His, and 1 had Ile221Thr. Thirty-three additional genetic carriers were identified through family assessment. The study included 54 genetic carriers: 56% were male, and the mean average age was 41 ± 17 years. There were 33 cases of hypertrophic cardiomyopathy, 9 of dilated cardiomyopathy, and 1 of noncompaction cardiomyopathy, and maximal myocardial thickness was 18.5 ± 6mm. Ventricular dysfunction was present in 30% of individuals and a history of sudden death in 62%. During follow-up, 4 patients died and 14 (33%) received a defibrillator (8 probands, 6 relatives). Mean survival was 54 years. Carriers of Arg92Gln had early disease development, high penetrance, a high risk of sudden death, a high rate of defibrillator implantation, and a high frequency of mixed phenotype. Mutations in the TNNT2 gene were more common in this series than in previous studies. The clinical and prognostic profiles depended on the mutation present. Carriers of the Arg92Gln mutation developed hypertrophic or dilated cardiomyopathy and had a significantly worse prognosis than those with other mutations in TNNT2 or other sarcomeric genes. Copyright © 2015 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  4. MYT1L mutations cause intellectual disability and variable obesity by dysregulating gene expression and development of the neuroendocrine hypothalamus.

    Science.gov (United States)

    Blanchet, Patricia; Bebin, Martina; Bruet, Shaam; Cooper, Gregory M; Thompson, Michelle L; Duban-Bedu, Benedicte; Gerard, Benedicte; Piton, Amelie; Suckno, Sylvie; Deshpande, Charu; Clowes, Virginia; Vogt, Julie; Turnpenny, Peter; Williamson, Michael P; Alembik, Yves; Glasgow, Eric; McNeill, Alisdair

    2017-08-01

    Deletions at chromosome 2p25.3 are associated with a syndrome consisting of intellectual disability and obesity. The smallest region of overlap for deletions at 2p25.3 contains PXDN and MYT1L. MYT1L is expressed only within the brain in humans. We hypothesized that single nucleotide variants (SNVs) in MYT1L would cause a phenotype resembling deletion at 2p25.3. To examine this we sought MYT1L SNVs in exome sequencing data from 4, 296 parent-child trios. Further variants were identified through a genematcher-facilitated collaboration. We report 9 patients with MYT1L SNVs (4 loss of function and 5 missense). The phenotype of SNV carriers overlapped with that of 2p25.3 deletion carriers. To identify the transcriptomic consequences of MYT1L loss of function we used CRISPR-Cas9 to create a knockout cell line. Gene Ontology analysis in knockout cells demonstrated altered expression of genes that regulate gene expression and that are localized to the nucleus. These differentially expressed genes were enriched for OMIM disease ontology terms "mental retardation". To study the developmental effects of MYT1L loss of function we created a zebrafish knockdown using morpholinos. Knockdown zebrafish manifested loss of oxytocin expression in the preoptic neuroendocrine area. This study demonstrates that MYT1L variants are associated with syndromic obesity in humans. The mechanism is related to dysregulated expression of neurodevelopmental genes and altered development of the neuroendocrine hypothalamus.

  5. Mutation in the human homeobox gene NKX5-3 causes an oculo-auricular syndrome.

    Science.gov (United States)

    Schorderet, Daniel F; Nichini, Olivia; Boisset, Gaëlle; Polok, Bozena; Tiab, Leila; Mayeur, Hélène; Raji, Bahija; de la Houssaye, Gauillaume; Abitbol, Marc M; Munier, Francis L

    2008-05-01

    Several dysmorphic syndromes affect the development of both the eye and the ear, but only a few are restricted to the eye and the external ear. We describe a developmental defect affecting the eye and the external ear in three members of a consanguineous family. This syndrome is characterized by ophthalmic anomalies (microcornea, microphthalmia, anterior-segment dysgenesis, cataract, coloboma of various parts of the eye, abnormalities of the retinal pigment epithelium, and rod-cone dystrophy) and a particular cleft ear lobule. Linkage analysis and mutation screening revealed in the first exon of the NKX5-3 gene a homozygous 26 nucleotide deletion, generating a truncating protein that lacked the complete homeodomain. Morpholino knockdown expression of the zebrafish nkx5-3 induced microphthalmia and disorganization of the developing retina, thus confirming that this gene represents an additional member implicated in axial patterning of the retina.

  6. Segmental neurofibromatosis is caused by somatic mutation of the neurofibromatosis type 1 (NF1) gene.

    Science.gov (United States)

    Tinschert, S; Naumann, I; Stegmann, E; Buske, A; Kaufmann, D; Thiel, G; Jenne, D E

    2000-06-01

    Segmental neurofibromatosis (NF) is generally thought to result from a postzygotic NF1 (neurofibromatosis type 1) gene mutation. However, this has not yet been demonstrated at the molecular level. Using fluorescence in situ hybridisation (FISH) we identified an NF1 microdeletion in a patient with segmental NF in whom café-au-lait spots and freckles are limited to a single body region. The mutant allele was present in a mosaic pattern in cultured fibroblasts from a café-au-lait spot lesion, but was absent in fibroblasts from normal skin as well as in peripheral blood leukocytes. These findings prove the hypothesis that the molecular basis of segmental cutaneous NF is a mutation in the NF1 gene and that the regional distribution of manifestations reflects different cell clones, commensurate with the concept of somatic mosaicism.

  7. A Hybrid CFHR3-1 Gene Causes Familial C3 Glomerulopathy.

    LENUS (Irish Health Repository)

    Malik, Talat H

    2012-07-01

    Controlled activation of the complement system, a key component of innate immunity, enables destruction of pathogens with minimal damage to host tissue. Complement factor H (CFH), which inhibits complement activation, and five CFH-related proteins (CFHR1-5) compose a family of structurally related molecules. Combined deletion of CFHR3 and CFHR1 is common and confers a protective effect in IgA nephropathy. Here, we report an autosomal dominant complement-mediated GN associated with abnormal increases in copy number across the CFHR3 and CFHR1 loci. In addition to normal copies of these genes, affected individuals carry a unique hybrid CFHR3-1 gene. In addition to identifying an association between these genetic observations and complement-mediated kidney disease, these results provide insight into the protective role of the combined deletion of CFHR3 and CFHR1 in IgA nephropathy.

  8. Hereditary spastic paraplegia with recessive trait caused by mutation in KLC4 gene.

    Science.gov (United States)

    Bayrakli, Fatih; Poyrazoglu, Hatice Gamze; Yuksel, Sirin; Yakicier, Cengiz; Erguner, Bekir; Sagiroglu, Mahmut Samil; Yuceturk, Betul; Ozer, Bugra; Doganay, Selim; Tanrikulu, Bahattin; Seker, Askin; Akbulut, Fatih; Ozen, Ali; Per, Huseyin; Kumandas, Sefer; Altuner Torun, Yasemin; Bayri, Yasar; Sakar, Mustafa; Dagcinar, Adnan; Ziyal, Ibrahim

    2015-12-01

    We report an association between a new causative gene and spastic paraplegia, which is a genetically heterogeneous disorder. Clinical phenotyping of one consanguineous family followed by combined homozygosity mapping and whole-exome sequencing analysis. Three patients from the same family shared common features of progressive complicated spastic paraplegia. They shared a single homozygous stretch area on chromosome 6. Whole-exome sequencing revealed a homozygous mutation (c.853_871del19) in the gene coding the kinesin light chain 4 protein (KLC4). Meanwhile, the unaffected parents and two siblings were heterozygous and one sibling was homozygous wild type. The 19 bp deletion in exon 6 generates a stop codon and thus a truncated messenger RNA and protein. The association of a KLC4 mutation with spastic paraplegia identifies a new locus for the disease.

  9. Cellular defects caused by hypomorphic variants of the Bloom syndrome helicase gene BLM.

    Science.gov (United States)

    Shastri, Vivek M; Schmidt, Kristina H

    2016-01-01

    Bloom syndrome is an autosomal recessive disorder characterized by extraordinary cancer incidence early in life and an average life expectancy of ~27 years. Premature stop codons in BLM, which encodes a DNA helicase that functions in DNA double-strand-break repair, make up the vast majority of Bloom syndrome mutations, with only 13 single amino acid changes identified in the syndrome. Sequencing projects have identified nearly one hundred single nucleotide variants in BLM that cause amino acid changes of uncertain significance. Here, in addition to identifying five BLM variants incapable of complementing certain defects of Bloom syndrome cells, making them candidates for new Bloom syndrome causing mutations, we characterize a new class of BLM variants that cause some, but not all, cellular defects of Bloom syndrome. We find elevated sister-chromatid exchanges, a delayed DNA damage response and inefficient DNA repair. Conversely, hydroxyurea sensitivity and quadriradial chromosome accumulation, both characteristic of Bloom syndrome cells, are absent. These intermediate variants affect sites in BLM that function in ATP hydrolysis and in contacting double-stranded DNA. Allele frequency and cellular defects suggest candidates for new Bloom syndrome causing mutations, and intermediate BLM variants that are hypomorphic which, instead of causing Bloom syndrome, may increase a person's risk for cancer or possibly other Bloom-syndrome-associated disorders, such as type-2 diabetes.

  10. Autism gene variant causes hyperserotonemia, serotonin receptor hypersensitivity, social impairment and repetitive behavior

    OpenAIRE

    Veenstra-VanderWeele, Jeremy; Muller, Christopher L.; Iwamoto, Hideki; Sauer, Jennifer E.; Owens, W. Anthony; Shah, Charisma R.; Cohen, Jordan; Mannangatti, Padmanabhan; Jessen, Tammy; Thompson, Brent J.; Ye, Ran; Kerr, Travis M.; Carneiro, Ana M.; Crawley, Jacqueline N.; Sanders-Bush, Elaine

    2012-01-01

    Fifty years ago, increased whole-blood serotonin levels, or hyperserotonemia, first linked disrupted 5-HT homeostasis to Autism Spectrum Disorders (ASDs). The 5-HT transporter (SERT) gene (SLC6A4) has been associated with whole blood 5-HT levels and ASD susceptibility. Previously, we identified multiple gain-of-function SERT coding variants in children with ASD. Here we establish that transgenic mice expressing the most common of these variants, SERT Ala56, exhibit elevated, p38 MAPK-dependen...

  11. A missense mutation in the Ca-sensing receptor gene causes familial autosomal dominant hypoparathyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Perry, Y.M.; Finegold, D.N.; Armitage, M.M. [Univ. of Pittsburgh, PA (United States)] [and others

    1994-09-01

    A large family was identified in which hypoparathyroidism was observed to segregate as an autosomal dominant trait in 3 generations. Linkage analysis using short tandem repeat polymorphisms linked the disease phenotype to chromosomal region 3q13. This region contains a newly identified Ca-sensing receptor (PCAR1) gene. This receptor regulates the secretion of parathyroid hormone from parathyroid cells in response to extracellular ionized Ca concentration ([Ca{sup +2}]). PCR-based single stranded conformational analysis of exonic sequences of the PCAR1 gene revealed an abnormal conformer in exon 3 in affected individuals. Direct sequencing of the amplification product from an affected and an unaffected family member showed an A {yields} G transition at nucleotide 770 of the PCAR1 gene [numbering based on the bovine sequence (Genbank accession number S67307)]. This substitution created a Msp1 restriction site which cosegregated with hypoparathyroidism in this family. This substitution was not observed in unaffected family members, unrelated spouses, or unrelated population controls. This substitution is predicted to result in the replacement of a glutamine residue at amino acid 246 by an arginine residue. The Ca-sensing receptor appears to be a member of the family of seven membrane spanning G-protein linked receptors. The extracellular location of this amino acid substitution appears to produce a gain of function mutation increasing the receptor sensitivity to [Ca{sup +2}] and decreasing the calcium {open_quotes}set point{close_quotes}. This is in contrast to the loss of function mutations observed in the PCAR1 gene in pedigrees with familial hypercalcemic hypocalciuria.

  12. Calcitonin gene-related peptide does not cause migraine attacks in patients with familial hemiplegic migraine

    DEFF Research Database (Denmark)

    Hansen, Jakob M; Thomsen, Lise L; Olesen, Jes

    2011-01-01

    Calcitonin gene-related peptide (CGRP) is a key molecule in migraine pathogenesis. Intravenous CGRP triggers migraine-like attacks in patients with migraine with aura and without aura. In contrast, patients with familial hemiplegic migraine (FHM) with known mutations did not report more migraine......-like attacks compared to controls. Whether CGRP triggers migraine-like attacks in FHM patients without known mutations is unknown....

  13. Autosomal dominant eccentric core disease caused by a heterozygous mutation in the MYH7 gene.

    Science.gov (United States)

    Romero, Norma B; Xie, Ting; Malfatti, Edoardo; Schaeffer, Ursula; Böhm, Johann; Wu, Bin; Xu, Fengping; Boucebci, Samy; Mathis, Stéphane; Neau, Jean-Philippe; Monnier, Nicole; Fardeau, Michel; Laporte, Jocelyn

    2014-10-01

    Autosomal dominant (AD) central core disease (CCD) is a congenital myopathy characterised by the presence of cores in the muscle fibres which correspond to broad areas of myofibrils disorganisation, Z-line streaming and lack of mitochondria. Heterozygous mutations in the RYR1 gene were observed in the large majority of AD-CCD families; however, this gene was excluded in some of AD-CCD families. To enlarge the genetic spectrum of AD-CCD demonstrating mutations in an additional gene. Four affected AD family members over three generations, three of whom were alive and participate in the study: the mother and two of three siblings. The symptoms began during the early childhood with mild delayed motor development. Later they developed mainly tibialis anterior weakness, hypertrophy of calves and significant weakness (amyotrophic) of quadriceps. No cardiac or ocular involvement was noted. The muscle biopsies sections showed a particular pattern: eccentric cores in type 1 fibres, associated with type 1 predominance. Most cores have abrupt borders. Electron microscopy confirmed the presence of both unstructured and structured cores. Exome sequencing analysis identified a novel heterozygous missense mutation p.Leu1723Pro in MYH7 segregating with the disease and affecting a conserved residue in the myosin tail domain. We describe MYH7 as an additional causative gene for AD-CCD. These findings have important implications for diagnosis and future investigations of AD-congenital myopathies with cores, without cardiomyopathy, but presenting a particular involvement of distal and quadriceps muscles. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  14. Knockout of Lysosomal Enzyme-Targeting Gene Causes Abnormalities in Mouse Pup Isolation Calls

    Science.gov (United States)

    Barnes, Terra D.; Holy, Timothy E.

    2017-01-01

    Humans lacking a working copy of the GNPTAB gene suffer from the metabolic disease Mucolipidosis type II (MLII). MLII symptoms include mental retardation, skeletal deformities and cartilage defects as well as a speech delay with most subjects unable to utter single words (Otomo et al., 2009; Cathey et al., 2010; Leroy et al., 2012). Here we asked whether mice lacking a copy of Gnptab gene exhibited vocal abnormities. We recorded ultrasonic vocalizations from 5 to 8 day old mice separated from their mother and littermates. Although Gnptab−/− pups emitted a similar number of calls, several features of the calls were different from their wild type littermates. Gnptab−/− mice showed a decrease in the length of calls, an increase in the intra-bout pause duration, significantly fewer pitch jumps with smaller mean size, and an increase in the number of isolated calls. In addition, Gnptab−/− mice vocalizations had less power, particularly in the higher frequencies. Gnptab+/− mouse vocalizations did not appear to be affected. We then attempted to classify these recordings using these features to determine the genotype of the animal. We were able to correctly identify 87% of the recordings as either Gnptab−/− or Gnptab+/+ pup, significantly better than chance, demonstrating that genotype is a strong predictor of vocalization phenotype. These data show that deletion of genes in the lysosomal enzyme targeting pathway affect mouse pup isolation calls. PMID:28101008

  15. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD

    2016-08-01

    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  16. A mutation in the pericentrin gene causes abnormal interneuron migration to the olfactory bulb in mice.

    Science.gov (United States)

    Endoh-Yamagami, Setsu; Karkar, Kameel M; May, Scott R; Cobos, Inma; Thwin, Myo T; Long, Jason E; Ashique, Amir M; Zarbalis, Konstantinos; Rubenstein, John L R; Peterson, Andrew S

    2010-04-01

    Precise control of neuronal migration is essential for proper function of the brain. Taking a forward genetic screen, we isolated a mutant mouse with defects in interneuron migration. By genetic mapping, we identified a frame shift mutation in the pericentrin (Pcnt) gene. The Pcnt gene encodes a large centrosomal coiled-coil protein that has been implicated in schizophrenia. Recently, frame shift and premature termination mutations in the pericentrin (PCNT) gene were identified in individuals with Seckel syndrome and microcephalic osteodysplastic primordial dwarfism (MOPD II), both of which are characterized by greatly reduced body and brain sizes. The mouse Pcnt mutant shares features with the human syndromes in its overall growth retardation and reduced brain size. We found that dorsal lateral ganglionic eminence (dLGE)-derived olfactory bulb interneurons are severely affected and distributed abnormally in the rostral forebrain in the mutant. Furthermore, mutant interneurons exhibit abnormal migration behavior and RNA interference knockdown of Pcnt impairs cell migration along the rostal migratory stream (RMS) into the olfactory bulb. These findings indicate that pericentrin is required for proper migration of olfactory bulb interneurons and provide a developmental basis for association of pericentrin function with interneuron defects in human schizophrenia. Copyright 2009 Elsevier Inc. All rights reserved.

  17. Mfsd14a (Hiat1) gene disruption causes globozoospermia and infertility in male mice.

    Science.gov (United States)

    Doran, Joanne; Walters, Cara; Kyle, Victoria; Wooding, Peter; Hammett-Burke, Rebecca; Colledge, William Henry

    2016-07-01

    The Mfsd14a gene, previously called Hiat1, encodes a transmembrane protein of unknown function with homology to the solute carrier protein family. To study the function of the MFSD14A protein, mutant mice (Mus musculus, strain 129S6Sv/Ev) were generated with the Mfsd14a gene disrupted with a LacZ reporter gene. Homozygous mutant mice are viable and healthy, but males are sterile due to a 100-fold reduction in the number of spermatozoa in the vas deferens. Male mice have adequate levels of testosterone and show normal copulatory behaviour. The few spermatozoa that are formed show rounded head defects similar to those found in humans with globozoospermia. Spermatogenesis proceeds normally up to the round spermatid stage, but the subsequent structural changes associated with spermiogenesis are severely disrupted with failure of acrosome formation, sperm head condensation and mitochondrial localization to the mid-piece of the sperm. Staining for β-galactosidase activity as a surrogate for Mfsd14a expression indicates expression in Sertoli cells, suggesting that MFSD14A may transport a solute from the bloodstream that is required for spermiogenesis. © 2016 Society for Reproduction and Fertility.

  18. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene

    DEFF Research Database (Denmark)

    Toustrup, Lise Bols; Zhou, Yan; Kvistgaard, Helene

    2017-01-01

    Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI) is caused by variants in the arginine vasopressin (AVP) gene. Here we report the generation of induced pluripotent stem cells (iPSCs) from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using...

  19. Expression of kenaf mitochondrial chimeric genes HM184 causes male sterility in transgenic tobacco plants.

    Science.gov (United States)

    Zhao, Yanhong; Liao, Xiaofang; Huang, Zhipeng; Chen, Peng; Zhou, Bujin; Liu, Dongmei; Kong, Xiangjun; Zhou, Ruiyang

    2015-08-01

    Chimeric genes resulting from the rearrangement of a mitochondrial genome were generally thought to be a causal factor in the occurrence of cytoplasmic male sterility (CMS). In the study, earlier we reported that identifying a 47 bp deletion at 3'- flanking of atp9 that was linked to male sterile cytoplasm in kenaf. The truncated fragment was fused with atp9, a mitochondrial transit signal (MTS) and/or GFP, comprised two chimeric genes MTS-HM184-GFP and MTS-HM184. The plant expression vector pBI121 containing chimeric genes were then introduced to tobacco plants by Agrobacterium-mediated T-DNA transformation. The result showed that certain transgenic plants were male sterility or semi-sterility, while some were not. The expression analysis further demonstrated that higher level of expression were showed in the sterility plants, while no expression or less expression in fertility plants, the levels of expression of semi-sterility were in between. And the sterile plant (containing MTS-HM184-GFP) had abnormal anther produced malformed/shriveled pollen grains stained negative that failed to germinate (0%), the corresponding fruits was shrunken, the semi-sterile plants having normal anther shape produced about 10-50% normal pollen grains, the corresponding fruits were not full, and the germination rate was 58%. Meanwhile these transgenic plants which altered on fertility were further analyzed in phenotype. As a result, the metamorphosis leaves were observed in the seedling stage, the plant height of transgenic plants was shorter than wild type. The growth duration of transgenic tobacco was delayed 30-45 days compared to the wild type. The copy numbers of target genes of transgenic tobacco were analyzed using the real-time quantitative method. The results showed that these transgenic plants targeting-expression in mitochondrial containing MTS-HM184-GFP had 1 copy and 2 copies, the other two plants containing MTS-HM184 both had 3 copies, but 0 copy in wild type. In

  20. Epilepsy-causing sequence variations in SIK1 disrupt synaptic activity response gene expression and affect neuronal morphology.

    Science.gov (United States)

    Pröschel, Christoph; Hansen, Jeanne N; Ali, Adil; Tuttle, Emily; Lacagnina, Michelle; Buscaglia, Georgia; Halterman, Marc W; Paciorkowski, Alex R

    2017-02-01

    SIK1 syndrome is a newly described developmental epilepsy disorder caused by heterozygous mutations in the salt-inducible kinase SIK1. To better understand the pathophysiology of SIK1 syndrome, we studied the effects of SIK1 pathogenic sequence variations in human neurons. Primary human fetal cortical neurons were transfected with a lentiviral vector to overexpress wild-type and mutant SIK1 protein. We evaluated the transcriptional activity of known downstream gene targets in neurons expressing mutant SIK1 compared with wild type. We then assayed neuronal morphology by measuring neurite length, number and branching. Truncating SIK1 sequence variations were associated with abnormal MEF2C transcriptional activity and decreased MEF2C protein levels. Epilepsy-causing SIK1 sequence variations were associated with significantly decreased expression of ARC (activity-regulated cytoskeletal-associated) and other synaptic activity response element genes. Assay of mRNA levels for other MEF2C target genes NR4A1 (Nur77) and NRG1, found significantly, decreased the expression of these genes as well. The missense p.(Pro287Thr) SIK1 sequence variation was associated with abnormal neuronal morphology, with significant decreases in mean neurite length, mean number of neurites and a significant increase in proximal branches compared with wild type. Epilepsy-causing SIK1 sequence variations resulted in abnormalities in the MEF2C-ARC pathway of neuronal development and synapse activity response. This work provides the first insights into the mechanisms of pathogenesis in SIK1 syndrome, and extends the ARX-MEF2C pathway in the pathogenesis of developmental epilepsy.

  1. De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome

    NARCIS (Netherlands)

    Riviere, Jean-Baptiste; van Bon, Bregje W. M.; Hoischen, Alexander; Kholmanskikh, Stanislav S.; O'Roak, Brian J.; Gilissen, Christian; Gijsen, Sabine; Sullivan, Christopher T.; Christian, Susan L.; Abdul-Rahman, Omar A.; Atkin, Joan F.; Chassaing, Nicolas; Drouin-Garraud, Valerie; Fry, Andrew E.; Fryns, Jean-Pierre; Gripp, Karen W.; Kempers, Marlies; Kleefstra, Tjitske; Mancini, Grazia M. S.; Nowaczyk, Malgorzata J. M.; van Ravenswaaij-Arts, Conny M. A.; Roscioli, Tony; Marble, Michael; Rosenfeld, Jill A.; Siu, Victoria M.; de Vries, Bert B. A.; Shendure, Jay; Verloes, Alain; Veltman, Joris A.; Brunner, Han G.; Ross, M. Elizabeth; Pilz, Daniela T.; Dobyns, William B.

    Brain malformations are individually rare but collectively common causes of developmental disabilities(1-3). Many forms of malformation occur sporadically and are associated with reduced reproductive fitness, pointing to a causative role for de novo mutations(4,5). Here, we report a study of

  2. De novo mutations in the actin genes ACTB and ACTG1 cause Baraitser-Winter syndrome

    NARCIS (Netherlands)

    Riviere, J.B.; Bon, B.W. van; Hoischen, A.; Kholmanskikh, S.S.; O'Roak, B.J.; Gilissen, C.; Gijsen, S.; Sullivan, C.T.; Christian, S.L.; Abdul-Rahman, O.A.; Atkin, J.F.; Chassaing, N.; Drouin-Garraud, V.; Fry, A.E.; Fryns, J.P.; Gripp, K.W.; Kempers, M.; Kleefstra, T.; Mancini, G.M.; Nowaczyk, M.J.; Ravenswaaij-Arts, C.M. van; Roscioli, T.; Marble, M.; Rosenfeld, J.A.; Siu, V.M.; Vries, B.B. de; Shendure, J.; Verloes, A.; Veltman, J.A.; Brunner, H.G.; Ross, M.E.; Pilz, D.T.; Dobyns, W.B.

    2012-01-01

    Brain malformations are individually rare but collectively common causes of developmental disabilities. Many forms of malformation occur sporadically and are associated with reduced reproductive fitness, pointing to a causative role for de novo mutations. Here, we report a study of Baraitser-Winter

  3. Mutations in the SLC2A9 gene cause hyperuricosuria and hyperuricemia in the dog.

    Directory of Open Access Journals (Sweden)

    Danika Bannasch

    2008-11-01

    Full Text Available Allantoin is the end product of purine catabolism in all mammals except humans, great apes, and one breed of dog, the Dalmatian. Humans and Dalmatian dogs produce uric acid during purine degradation, which leads to elevated levels of uric acid in blood and urine and can result in significant diseases in both species. The defect in Dalmatians results from inefficient transport of uric acid in both the liver and renal proximal tubules. Hyperuricosuria and hyperuricemia (huu is a simple autosomal recessive trait for which all Dalmatian dogs are homozygous. Therefore, in order to map the locus, an interbreed backcross was used. Linkage mapping localized the huu trait to CFA03, which excluded the obvious urate transporter 1 gene, SLC22A12. Positional cloning placed the locus in a minimal interval of 2.5 Mb with a LOD score of 17.45. A critical interval of 333 kb containing only four genes was homozygous in all Dalmatians. Sequence and expression analyses of the SLC2A9 gene indicated three possible mutations, a missense mutation (G616T;C188F and two promoter mutations that together appear to reduce the expression levels of one of the isoforms. The missense mutation is associated with hyperuricosuria in the Dalmatian, while the promoter SNPs occur in other unaffected breeds of dog. Verification of the causative nature of these changes was obtained when hyperuricosuric dogs from several other breeds were found to possess the same combination of mutations as found in the Dalmatian. The Dalmatian dog model of hyperuricosuria and hyperuricemia underscores the importance of SLC2A9 for uric acid transport in mammals.

  4. Mosaic mutations of the LIS1 gene cause subcortical band heterotopia.

    Science.gov (United States)

    Sicca, F; Kelemen, A; Genton, P; Das, S; Mei, D; Moro, F; Dobyns, W B; Guerrini, R

    2003-10-28

    Subcortical band heterotopia (SBH) is a neuronal migration disorder. DCX mutations are responsible for almost all familial cases, 80% of sporadic female cases, and 25% of sporadic male cases of SBH, and are associated with more severe gyral and migration abnormality over the anterior brain regions. Somatic mosaicism has previously been hypothesized in a patient with posteriorly predominant SBH and a mutation of the LIS1 gene, which is usually mutated in patients with severe lissencephaly. The authors identified mosaic mutations of LIS1 in two patients (Patients 1 and 2) with predominantly posterior SBH. After ruling out DCX mutations, the authors performed sequencing of the LIS1 gene in lymphocyte DNA. Because sequence peaks in both patients were suggestive of mosaic mutations, they followed up with denaturing high-pressure liquid chromatography analysis on blood and hair root DNA and compared the areas of heteroduplex and homoduplex peaks. A third patient showing the same mutation as Patient 2 but with no evidence of mosaicism was used for comparing the phenotype of mosaic vs full mutation. The two patients with posterior SBH harbored a missense (Arg241Pro) and a nonsense (R8X) mosaic mutation of LIS1. The rate of mosaicism in Patient 1 was 18% in the blood and 21% in the hair roots, whereas in Patient 2 it was 24% and 31% in the same tissues. The patient with a full R8X mutation of LIS1 had severe lissencephaly. Subcortical band heterotopia can occur with mosaic mutations of the LIS1 gene. Mutation analysis of LIS1, using highly sensitive techniques such as denaturing high-pressure liquid chromatography, should be considered for patients with posteriorly predominant subcortical band heterotopia and pachygyria.

  5. Ebstein's anomaly may be caused by mutations in the sarcomere protein gene MYH7.

    Science.gov (United States)

    van Engelen, K; Postma, A V; van de Meerakker, J B A; Roos-Hesselink, J W; Helderman-van den Enden, A T J M; Vliegen, H W; Rahman, T; Baars, M J H; Sels, J-W; Bauer, U; Pickardt, T; Sperling, S R; Moorman, A F M; Keavney, B; Goodship, J; Klaassen, S; Mulder, B J M

    2013-03-01

    Ebstein's anomaly is a rare congenital heart malformation characterised by adherence of the septal and posterior leaflets of the tricuspid valve to the underlying myocardium. Associated abnormalities of left ventricular morphology and function including left ventricular noncompaction (LVNC) have been observed. An association between Ebstein's anomaly with LVNC and mutations in the sarcomeric protein gene MYH7, encoding β-myosin heavy chain, has been shown by recent studies. This might represent a specific subtype of Ebstein's anomaly with a Mendelian inheritance pattern. In this review we discuss the association of MYH7 mutations with Ebstein's anomaly and LVNC and its implications for the clinical care for patients and their family members.

  6. The Tourette International Collaborative Genetics (TIC Genetics) study, finding the genes causing Tourette syndrome

    DEFF Research Database (Denmark)

    Dietrich, Andrea; Fernandez, Thomas V; King, Robert A

    2015-01-01

    ) are part of a sharing repository located within the National Institute for Mental Health Center for Collaborative Genomics Research on Mental Disorders, USA, and will be made available to the broad scientific community. This resource will ultimately facilitate better understanding of the pathophysiology......, it is clear that large patient cohorts and open-access repositories will be essential to further advance the field. To that end, the large multicenter Tourette International Collaborative Genetics (TIC Genetics) study was established. The goal of the TIC Genetics study is to undertake a comprehensive gene...

  7. Transcriptional regulation of the ABCC6 gene and the background of impaired function of missense disease-causing mutations

    Directory of Open Access Journals (Sweden)

    Tamás eArányi

    2013-03-01

    Full Text Available The human ABCC6 gene encodes an ABC transporter protein expressed primarily in the liver and to a lesser extent in the kidneys and the intestines. We review here the mechanisms of this restricted tissue-specific expression and the role of hepatocyte nuclear factor 4α which is responsible for the expression pattern. Detailed analyses uncovered further regulators of the expression of the gene pointing to an intronic primate-specific regulator region, an activator of the expression of the gene by binding C/EBPbeta, which interacts with other proteins acting in the proximal promoter. This regulatory network is affected by various environmental stimuli including oxidative stress and the ERK1/2 pathway. We also review here the structural and functional consequences of disease-causing missense mutations of ABCC6. A significant clustering of the missense disease-causing mutations was found at the domain-domain interfaces. This clustering means that the domain contacts are much less permissive to amino acid replacements than the rest of the protein. We summarize the experimental methods resulting in the identification of mutants with preserved transport activity but failure in intracellular targeting. These mutants are candidates for functional rescue by chemical chaperons. The results of such research can provide the basis of future allele-specific therapy of ABCC6-mediated disorders like pseudoxanthoma elasticum or the generalized arterial calcification in infancy.

  8. Hepatocellular carcinoma cells cause different responses in expressions of cancer-promoting genes in different cancer-associated fibroblasts

    Directory of Open Access Journals (Sweden)

    Zu-Yau Lin

    2013-06-01

    was consistently down-regulated caused by both HCC cell lines in F26/KMUH CAFs. Besides PGK1 gene, HCC38/KMUH cancer cells only up-regulated APLN, LOXL2, and VEGFA genes and HCC24/KMUH cancer cells only up-regulated FGF2 gene in F26/KMUH CAFs. In conclusion, HCC cells can promote proliferation and migration of CAFs. However, the impact of HCC cells on differential expressions of cancer-promoting genes in CAFs is influenced by the characteristics of CAFs. This implies that blocking single or several particular cancer-promoting genes in CAFs is unable to become a common stratagem for the treatment of HCC.

  9. The Relationship between the Expression of Ethylene-Related Genes and Papaya Fruit Ripening Disorder Caused by Chilling Injury

    Science.gov (United States)

    Zou, Yuan; Zhang, Lin; Rao, Shen; Zhu, Xiaoyang; Ye, Lanlan; Chen, Weixin; Li, Xueping

    2014-01-01

    Papaya (Carica papaya L.) is sensitive to low temperature and easy to be subjected to chilling injury, which causes fruit ripening disorder. This study aimed to investigate the relationship between the expression of genes related to ethylene and fruit ripening disorder caused by chilling injury. Papaya fruits were firstly stored at 7°C and 12°C for 25 and 30 days, respectively, then treated with exogenous ethylene and followed by ripening at 25°C for 5 days. Chilling injury symptoms such as pulp water soaking were observed in fruit stored at 7°C on 20 days, whereas the coloration and softening were completely blocked after 25 days, Large differences in the changes in the expression levels of twenty two genes involved in ethylene were seen during 7°C-storage with chilling injury. Those genes with altered expression could be divided into three groups: the group of genes that were up-regulated, including ACS1/2/3, EIN2, EIN3s/EIL1, CTR1/2/3, and ERF1/3/4; the group of genes that were down-regulated, including ACO3, ETR1, CTR4, EBF2, and ERF2; and the group of genes that were un-regulated, including ACO1/2, ERS, and EBF1. The results also showed that pulp firmness had a significantly positive correlation with the expression of ACS2, ACO1, CTR1/4, EIN3a/b, and EBF1/2 in fruit without chilling injury. This positive correlation was changed to negative one in fruit after storage at 7°C for 25 days with chilling injury. The coloring index displayed significantly negative correlations with the expression levels of ACS2, ACO1/2, CTR4, EIN3a/b, ERF3 in fruit without chilling injury, but these correlations were changed into the positive ones in fruit after storage at 7°C for 25 days with chilling injury. All together, these results indicate that these genes may play important roles in the abnormal softening and coloration with chilling injury in papaya. PMID:25542021

  10. The relationship between the expression of ethylene-related genes and papaya fruit ripening disorder caused by chilling injury.

    Science.gov (United States)

    Zou, Yuan; Zhang, Lin; Rao, Shen; Zhu, Xiaoyang; Ye, Lanlan; Chen, Weixin; Li, Xueping

    2014-01-01

    Papaya (Carica papaya L.) is sensitive to low temperature and easy to be subjected to chilling injury, which causes fruit ripening disorder. This study aimed to investigate the relationship between the expression of genes related to ethylene and fruit ripening disorder caused by chilling injury. Papaya fruits were firstly stored at 7°C and 12°C for 25 and 30 days, respectively, then treated with exogenous ethylene and followed by ripening at 25°C for 5 days. Chilling injury symptoms such as pulp water soaking were observed in fruit stored at 7°C on 20 days, whereas the coloration and softening were completely blocked after 25 days, Large differences in the changes in the expression levels of twenty two genes involved in ethylene were seen during 7°C-storage with chilling injury. Those genes with altered expression could be divided into three groups: the group of genes that were up-regulated, including ACS1/2/3, EIN2, EIN3s/EIL1, CTR1/2/3, and ERF1/3/4; the group of genes that were down-regulated, including ACO3, ETR1, CTR4, EBF2, and ERF2; and the group of genes that were un-regulated, including ACO1/2, ERS, and EBF1. The results also showed that pulp firmness had a significantly positive correlation with the expression of ACS2, ACO1, CTR1/4, EIN3a/b, and EBF1/2 in fruit without chilling injury. This positive correlation was changed to negative one in fruit after storage at 7°C for 25 days with chilling injury. The coloring index displayed significantly negative correlations with the expression levels of ACS2, ACO1/2, CTR4, EIN3a/b, ERF3 in fruit without chilling injury, but these correlations were changed into the positive ones in fruit after storage at 7°C for 25 days with chilling injury. All together, these results indicate that these genes may play important roles in the abnormal softening and coloration with chilling injury in papaya.

  11. Disruption of a Plasmodium falciparum cyclic nucleotide phosphodiesterase gene causes aberrant gametogenesis

    Science.gov (United States)

    Taylor, Cathy J; McRobert, Louisa; Baker, David A

    2008-01-01

    Phosphodiesterase (PDE) and guanylyl cyclase (GC) enzymes are key components of the cGMP signalling pathway and are encoded in the genome of Plasmodium falciparum. Here we investigate the role of specific GC and PDE isoforms in gamete formation – a process that is essential for malaria transmission and occurs in the Anopheles mosquito midgut following feeding on an infected individual. Details of the intracellular signalling events controlling development of the male and female gametes from their precursors (gametocytes) remain sparse in P. falciparum. Previous work involving the addition of pharmacological agents to gametocytes implicated cGMP in exflagellation – the emergence of highly motile, flagellated male gametes from the host red blood cell. In this study we show that decreased GC activity in parasites having undergone disruption of the PfGCβ gene had no significant effect on gametogenesis. By contrast, decreased cGMP-PDE activity during gametocyte development owing to disruption of the PfPDEδ gene, led to a severely reduced ability to undergo gametogenesis. This suggests that the concentration of cGMP must be maintained below a threshold in the developing gametocyte to allow subsequent differentiation to proceed normally. The data indicate that PfPDEδ plays a crucial role in regulating cGMP levels during sexual development. PMID:18452584

  12. Deletion in the EVC2 gene causes chondrodysplastic dwarfism in Tyrolean Grey cattle.

    Science.gov (United States)

    Murgiano, Leonardo; Jagannathan, Vidhya; Benazzi, Cinzia; Bolcato, Marilena; Brunetti, Barbara; Muscatello, Luisa Vera; Dittmer, Keren; Piffer, Christian; Gentile, Arcangelo; Drögemüller, Cord

    2014-01-01

    During the summer of 2013 seven Italian Tyrolean Grey calves were born with abnormally short limbs. Detailed clinical and pathological examination revealed similarities to chondrodysplastic dwarfism. Pedigree analysis showed a common founder, assuming autosomal monogenic recessive transmission of the defective allele. A positional cloning approach combining genome wide association and homozygosity mapping identified a single 1.6 Mb genomic region on BTA 6 that was associated with the disease. Whole genome re-sequencing of an affected calf revealed a single candidate causal mutation in the Ellis van Creveld syndrome 2 (EVC2) gene. This gene is known to be associated with chondrodysplastic dwarfism in Japanese Brown cattle, and dwarfism, abnormal nails and teeth, and dysostosis in humans with Ellis-van Creveld syndrome. Sanger sequencing confirmed the presence of a 2 bp deletion in exon 19 (c.2993_2994ACdel) that led to a premature stop codon in the coding sequence of bovine EVC2, and was concordant with the recessive pattern of inheritance in affected and carrier animals. This loss of function mutation confirms the important role of EVC2 in bone development. Genetic testing can now be used to eliminate this form of chondrodysplastic dwarfism from Tyrolean Grey cattle.

  13. Deletion in the EVC2 gene causes chondrodysplastic dwarfism in Tyrolean Grey cattle.

    Directory of Open Access Journals (Sweden)

    Leonardo Murgiano

    Full Text Available During the summer of 2013 seven Italian Tyrolean Grey calves were born with abnormally short limbs. Detailed clinical and pathological examination revealed similarities to chondrodysplastic dwarfism. Pedigree analysis showed a common founder, assuming autosomal monogenic recessive transmission of the defective allele. A positional cloning approach combining genome wide association and homozygosity mapping identified a single 1.6 Mb genomic region on BTA 6 that was associated with the disease. Whole genome re-sequencing of an affected calf revealed a single candidate causal mutation in the Ellis van Creveld syndrome 2 (EVC2 gene. This gene is known to be associated with chondrodysplastic dwarfism in Japanese Brown cattle, and dwarfism, abnormal nails and teeth, and dysostosis in humans with Ellis-van Creveld syndrome. Sanger sequencing confirmed the presence of a 2 bp deletion in exon 19 (c.2993_2994ACdel that led to a premature stop codon in the coding sequence of bovine EVC2, and was concordant with the recessive pattern of inheritance in affected and carrier animals. This loss of function mutation confirms the important role of EVC2 in bone development. Genetic testing can now be used to eliminate this form of chondrodysplastic dwarfism from Tyrolean Grey cattle.

  14. Inadequate Dietary Phosphorus Levels Cause Skeletal Anomalies and Alter Osteocalcin Gene Expression in Zebrafish

    Directory of Open Access Journals (Sweden)

    Juliana M. Costa

    2018-01-01

    Full Text Available Phosphorus (P is an essential mineral for the development and maintenance of the vertebrate skeletal system. Modulation of P levels is believed to influence metabolism and the physiological responses of gene expression. In this study, we investigated the influence of dietary P on skeletal deformities and osteocalcin gene expression in zebrafish (Danio rerio, and sought to determine appropriate levels in a diet. We analyzed a total of 450 zebrafish within 31 days of hatching. Animals were distributed in a completely randomized experimental design that consisted of five replications. After an eight-week experiment, fish were diaphanized to evaluate cranial and spinal bone deformities. Increases in dietary phosphorus were inversely proportional to the occurrence of partial spine fusions, the absence of spine fusions, absence of parallelism between spines, intervertebral spacing, vertebral compression, scoliosis, lordosis, ankylosis, fin caudal insertion, and craniofacial deformities. Additionally, osteocalcin expression was inversely correlated to P levels, suggesting a physiological recovery response for bone mineralization deficiency. Our data showed that dietary P concentration was a critical factor in the occurrence of zebrafish skeletal abnormalities. We concluded that 1.55% P in the diet significantly reduces the appearance of skeletal deformities and favors adequate bone mineralization through the adjustment of osteocalcin expression.

  15. Refined mapping of a gene (NPH1) causing familial juvenile nephronophthisis and evidence for genetic heterogeneity

    Energy Technology Data Exchange (ETDEWEB)

    Medhioub, M.; Cherif, D.; Benessy, F. [Hopital Necker-Enfants, Paris (France)] [and others

    1994-07-15

    Familial juvenile nephronophthisis (NPH) is an autosomal recessive progressive tubulo-interstitial kidney disorder, responsible for 6-10% of end-stage renal failure in children, and is frequently associated with Leber amaurosis (termed Senior-Loken syndrome). The biochemical basis of NPH is unknown. The authors recently reported linkage of the purely renal form of NPH to three markers on chromosome 2. The results also suggested the existence of genetic heterogeneity between NPH and SLS. To map this NPH gene more precisely, the authors have now tested the segregation of six new microsatellite markers and five additional families. Haplotype analyses show unequivocally that four NPH families are not linked to the chromosome 2 markers, although there are no clinical or pathological features discernible in these families that could separate them from the families linked to the chromosome 2 NPH locus (NPH1). This reveals genetic heterogeneity in the purely renal form of NPH. In situ hybridization of YAC clones isolated with two closely linked markers assigned the NPH1 region to 2q13. Furthermore, based on haplotype analysis and specific recombination events, the NPH1 gene has been placed between D2S293/D2S340 and D2S121, a genetic interval of about 5-7 cM. 23 refs., 2 figs., 1 tab.

  16. Molecular Diagnosis of Analbuminemia: A New Case Caused by a Nonsense Mutation in the Albumin Gene

    Directory of Open Access Journals (Sweden)

    Lorenzo Minchiotti

    2011-10-01

    Full Text Available Analbuminemia is a rare autosomal recessive disorder manifested by the absence, or severe reduction, of circulating serum albumin (ALB. We report here a new case diagnosed in a 45 years old man of Southwestern Asian origin, living in Switzerland, on the basis of his low ALB concentration (0.9 g/L in the absence of renal or gastrointestinal protein loss, or liver dysfunction. The clinical diagnosis was confirmed by a mutational analysis of the albumin (ALB gene, carried out by single-strand conformational polymorphism (SSCP, heteroduplex analysis (HA, and DNA sequencing. This screening of the ALB gene revealed that the proband is homozygous for two mutations: the insertion of a T in a stretch of eight Ts spanning positions c.1289 + 23–c.1289 + 30 of intron 10 and a c.802 G > T transversion in exon 7. Whereas the presence of an additional T in the poly-T tract has no direct deleterious effect, the latter nonsense mutation changes the codon GAA for Glu244 to the stop codon TAA, resulting in a premature termination of the polypeptide chain. The putative protein product would have a length of only 243 amino acid residues instead of the normal 585 found in the mature serum albumin, but no evidence for the presence in serum of such a truncated polypeptide chain could be obtained by two dimensional electrophoresis and western blotting analysis.

  17. Terbinafine Resistance of Trichophyton Clinical Isolates Caused by Specific Point Mutations in the Squalene Epoxidase Gene.

    Science.gov (United States)

    Yamada, Tsuyoshi; Maeda, Mari; Alshahni, Mohamed Mahdi; Tanaka, Reiko; Yaguchi, Takashi; Bontems, Olympia; Salamin, Karine; Fratti, Marina; Monod, Michel

    2017-07-01

    Terbinafine is one of the allylamine antifungal agents whose target is squalene epoxidase (SQLE). This agent has been extensively used in the therapy of dermatophyte infections. The incidence of patients with tinea pedis or unguium tolerant to terbinafine treatment prompted us to screen the terbinafine resistance of all Trichophyton clinical isolates from the laboratory of the Centre Hospitalier Universitaire Vaudois collected over a 3-year period and to identify their mechanism of resistance. Among 2,056 tested isolates, 17 (≈1%) showed reduced terbinafine susceptibility, and all of these were found to harbor SQLE gene alleles with different single point mutations, leading to single amino acid substitutions at one of four positions (Leu393, Phe397, Phe415, and His440) of the SQLE protein. Point mutations leading to the corresponding amino acid substitutions were introduced into the endogenous SQLE gene of a terbinafine-sensitive Arthroderma vanbreuseghemii (formerly Trichophyton mentagrophytes) strain. All of the generated A. vanbreuseghemii transformants expressing mutated SQLE proteins exhibited obvious terbinafine-resistant phenotypes compared to the phenotypes of the parent strain and of transformants expressing wild-type SQLE proteins. Nearly identical phenotypes were also observed in A. vanbreuseghemii transformants expressing mutant forms of Trichophyton rubrum SQLE proteins. Considering that the genome size of dermatophytes is about 22 Mb, the frequency of terbinafine-resistant clinical isolates was strikingly high. Increased exposure to antifungal drugs could favor the generation of resistant strains. Copyright © 2017 American Society for Microbiology.

  18. Mutations in the DNA methyltransferase gene DNMT3A cause an overgrowth syndrome with intellectual disability

    DEFF Research Database (Denmark)

    Tatton-Brown, Katrina; Seal, Sheila; Ruark, Elise

    2014-01-01

    Overgrowth disorders are a heterogeneous group of conditions characterized by increased growth parameters and other variable clinical features such as intellectual disability and facial dysmorphism. To identify new causes of human overgrowth, we performed exome sequencing in ten proband...... and histone binding. Similar mutations were not present in 1,000 UK population controls (13/152 cases versus 0/1,000 controls; P intellectual disability and greater height. DNMT3A encodes a DNA methyltransferase essential for establishing...

  19. The A395T mutation in ERG11 gene confers fluconazole resistance in Candida tropicalis causing candidemia.

    Science.gov (United States)

    Tan, Jingwen; Zhang, Jinqing; Chen, Wei; Sun, Yi; Wan, Zhe; Li, Ruoyu; Liu, Wei

    2015-04-01

    The mechanism of fluconazole resistance in Candida tropicalis is still unclear. Recently, we isolated a fluconazole-resistant strain of C. tropicalis from the blood specimen of a patient with candidemia in China. In vitro antifungal susceptibility of the isolate was determined by using CLSI M27-A3 and E-test methods. The sequence of ERG11 gene was then analyzed, and the three-dimensional model of Erg11p encoded by ERG11 gene was also investigated. The sequencing of ERG11 gene revealed the mutation of A395T in this fluconazole-resistant isolate of C. tropicalis, resulting in the Y132F substitution in Erg11p. Sequence alignment and three-dimensional model comparison of Erg11ps showed high similarity between fluconazole-susceptible isolates of C. tropicalis and Candida albicans. The comparison of the three-dimensional models of Erg11ps demonstrated that the position of the Y132F substitution in this isolate of C. tropicalis is identical to the isolate of C. albicans with fluconazole resistance resulting from Y132F substitution in Erg11p. Hence, we ascertain that the Y132F substitution of Erg11p caused by A395T mutation in ERG11 gene confers the fluconazole resistance in C. tropicalis.

  20. Reduced levels of two modifiers of epigenetic gene silencing, Dnmt3a and Trim28, cause increased phenotypic noise.

    Science.gov (United States)

    Whitelaw, Nadia C; Chong, Suyinn; Morgan, Daniel K; Nestor, Colm; Bruxner, Timothy J; Ashe, Alyson; Lambley, Eleanore; Meehan, Richard; Whitelaw, Emma

    2010-01-01

    Inbred individuals reared in controlled environments display considerable variance in many complex traits but the underlying cause of this intangible variation has been an enigma. Here we show that two modifiers of epigenetic gene silencing play a critical role in the process. Inbred mice heterozygous for a null mutation in DNA methyltransferase 3a (Dnmt3a) or tripartite motif protein 28 (Trim28) show greater coefficients of variance in body weight than their wild-type littermates. Trim28 mutants additionally develop metabolic syndrome and abnormal behavior with incomplete penetrance. Genome-wide gene expression analyses identified 284 significantly dysregulated genes in Trim28 heterozygote mutants compared to wild-type mice, with Mas1, which encodes a G-protein coupled receptor implicated in lipid metabolism, showing the greatest average change in expression (7.8-fold higher in mutants). This gene also showed highly variable expression between mutant individuals. These studies provide a molecular explanation of developmental noise in whole organisms and suggest that faithful epigenetic control of transcription is central to suppressing deleterious levels of phenotypic variation. These findings have broad implications for understanding the mechanisms underlying sporadic and complex disease in humans. © 2010 Whitelaw et al.; licensee BioMed Central Ltd.

  1. Physical forces may cause Hox gene collinearity in the primary and secondary axes of the developing vertebrates.

    Science.gov (United States)

    Papageorgiou, Spyros

    2011-01-01

    The features of spatial and temporal Hox gene collinearity along the anteroposterior and secondary axes of vertebrate development have been extensively studied. However, the understanding of these features remains problematic. Some genetic engineering experiments were performed and the consequent modifications of the Hoxd gene expressions in the vertebrate limb and trunk were presented. A two-phases model was proposed to describe the above results but still many data cannot be explained. In the present work a different mechanism is put forward in order to deal with the above experiments. This alternative mechanism (coined biophysical model), is based on the hypothesis that physical forces decondense and 'loop out' the chromatin fiber causing the observed Hox gene collinearity phenomena at the early stages of axonal development. The two models are compared in detail. The biophysical model adequately explains the data even in cases where the results are characterized as unexpected. Furthermore, the biophysical model predicts that the Hox gene expressions are entangled in space and time and this coupling is compatible with the data of the early developmental stages. Additional experiments are proposed for a direct test of this model. © 2011 The Author. Journal compilation © 2011 Japanese Society of Developmental Biologists.

  2. Natural disease course and genotype-phenotype correlations in Complex I deficiency caused by nuclear gene defects

    DEFF Research Database (Denmark)

    Koene, S; Rodenburg, R J; van der Knaap, M S

    2012-01-01

    Mitochondrial complex I is the largest multi-protein enzyme complex of the oxidative phosphorylation system. Seven subunits of this complex are encoded by the mitochondrial and the remainder by the nuclear genome. We review the natural disease course and signs and symptoms of 130 patients (four new...... cases and 126 from literature) with mutations in nuclear genes encoding structural complex I proteins or those involved in its assembly. Complex I deficiency caused by a nuclear gene defect is usually a non-dysmorphic syndrome, characterized by severe multi-system organ involvement and a poor prognosis....... Age at presentation may vary, but is generally within the first year of life. The most prevalent symptoms include hypotonia, nystagmus, respiratory abnormalities, pyramidal signs, dystonia, psychomotor retardation or regression, failure to thrive, and feeding problems. Characteristic symptoms include...

  3. Multiple sulfatase deficiency is caused by mutations in the gene encoding the human C(alpha)-formylglycine generating enzyme.

    Science.gov (United States)

    Dierks, Thomas; Schmidt, Bernhard; Borissenko, Ljudmila V; Peng, Jianhe; Preusser, Andrea; Mariappan, Malaiyalam; von Figura, Kurt

    2003-05-16

    C(alpha)-formylglycine (FGly) is the catalytic residue in the active site of eukaryotic sulfatases. It is posttranslationally generated from a cysteine in the endoplasmic reticulum. The genetic defect of FGly formation causes multiple sulfatase deficiency (MSD), a lysosomal storage disorder. We purified the FGly generating enzyme (FGE) and identified its gene and nine mutations in seven MSD patients. In patient fibroblasts, the activity of sulfatases is partially restored by transduction of FGE encoding cDNA, but not by cDNA carrying an MSD mutation. The gene encoding FGE is highly conserved among pro- and eukaryotes and has a paralog of unknown function in vertebrates. FGE is localized in the endoplasmic reticulum and is predicted to have a tripartite domain structure.

  4. Mutations in the Gene PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions

    Directory of Open Access Journals (Sweden)

    Hsien-Yang Lee

    2012-01-01

    Full Text Available Paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC is an episodic movement disorder with autosomal-dominant inheritance and high penetrance, but the causative genetic mutation is unknown. We have now identified four truncating mutations involving the gene PRRT2 in the vast majority (24/25 of well-characterized families with PKD/IC. PRRT2 truncating mutations were also detected in 28 of 78 additional families. PRRT2 encodes a proline-rich transmembrane protein of unknown function that has been reported to interact with the t-SNARE, SNAP25. PRRT2 localizes to axons but not to dendritic processes in primary neuronal culture, and mutants associated with PKD/IC lead to dramatically reduced PRRT2 levels, leading ultimately to neuronal hyperexcitability that manifests in vivo as PKD/IC.

  5. Characterization of Novel Missense Variants of SERPINA1 Gene Causing Alpha-1 Antitrypsin Deficiency.

    Science.gov (United States)

    Matamala, Nerea; Lara, Beatriz; Gomez-Mariano, Gema; Martínez, Selene; Retana, Diana; Fernandez, Taiomara; Silvestre, Ramona Angeles; Belmonte, Irene; Rodriguez-Frias, Francisco; Vilar, Marçal; Sáez, Raquel; Iturbe, Igor; Castillo, Silvia; Molina-Molina, María; Texido, Anna; Tirado-Conde, Gema; Lopez-Campos, Jose Luis; Posada, Manuel; Blanco, Ignacio; Janciauskiene, Sabina; Martinez-Delgado, Beatriz

    2017-12-12

    SERPINA1 gene is highly polymorphic, with more than one hundred variants described in databases. The SERPINA1 encodes alpha-1 antitrypsin (AAT) protein, and the severe deficiency of AAT is a major contributor to pulmonary emphysema and liver diseases. We report seven new variants in Spanish patients with AAT deficiency. All variants involved amino acid substitutions in different exons: PiSDonosti (S+Ser14Phe), PiTijarafe (Ile50Asn), PiSevilla (Ala58Asp), PiCadiz (Glu151Lys), PiTarragona (Phe227Cys), PiPuerto Real (Thr249Ala) and PiValencia (Lys328Glu). The effect of these variants was analyzed to investigate their contribution to the disease. Mutant proteins were overexpressed in HEK293T cells and AAT expression, polymerization, degradation and secretion as well as anti-elastase activity were analyzed by PAS staining, western blot, pulse-chase and elastase inhibition assays. When overexpressed, S+S14F, I50N, A58D, F227C and T249A mutants formed intracellular polymers and did not secrete AAT protein. Two variants (E151K and K328E) did not form polymers and secreted AAT protein. However, K328E showed intracellular retention and reduced anti-elastase activity. In conclusion, we demonstrate that deficient variants may be more frequent than previously thought, and their discovery can only be possible by the complete sequencing of the gene and subsequent functional characterization. Better knowledge of SERPINA1 variants would improve diagnosis and care of AAT deficiency carriers.

  6. Functional characterization of novel loss-of-function mutations in the vasopressin type 2 receptor gene causing nephrogenic diabetes insipidus.

    Science.gov (United States)

    Böselt, Iris; Tramma, Despoina; Kalamitsou, Serafia; Niemeyer, Thomas; Nykänen, Päivi; Gräf, Klaus-Jürgen; Krude, Heiko; Marenzi, Karen Sabrina; Di Candia, Stefania; Schöneberg, Torsten; Schulz, Angela

    2012-04-01

    X-linked nephrogenic diabetes insipidus (NDI) is a rare polyuric disorder caused by inactivating mutations in the arginine vasopressin receptor Type 2 (AVPR2) gene. NDI patients from six unrelated families were subjected to mutational analysis of the AVPR2 gene. In-depth in vitro characterization of novel AVPR2 mutants by a combination of functional and immunological techniques provided further insight into molecular mechanisms causing receptor dysfunction. Mutational analysis revealed four novel (A89P, G107R, Q174R, W208X) and three recurrent (V277A, R337X, ΔR247-G250) mutations within the AVPR2 gene. One family carried the missense mutation R337X and a 12-bp deletion (ΔR247-G250), corresponding to a fragment in the third intracellular loop (ICL3), which was not genetically linked to R337X. The functionally tested missense mutations A89P, G107R and Q174R led to reduced receptor cell surface expression in transfected COS-7 cells, most probably due to misfolding and intracellular retention, and consequently to reduction or loss of agonist-mediated cyclic adenosine monophosphate formation. Deletion of R247-G250 had no effect on receptor function in vitro. Comparison with other mammalian AVPR2 orthologs showed that this part of the ICL3 is structurally not conserved and, therefore, less relevant for receptor function. In contrast, all missense mutations (A89P, G107R, Q174R, V277A) affect receptor positions that were fully preserved during mammalian evolution. Our results provide valuable information about residues critical for AVPR2 folding, trafficking and function and proof that these mutations are responsible for causing NDI in the affected subjects.

  7. Novel CHST6 gene mutations in 2 unrelated cases of macular corneal dystrophy.

    Science.gov (United States)

    Patel, Dhara A; Harocopos, George J; Chang, Shu-Hong; Vora, Smita C; Lubniewski, Anthony J; Huang, Andrew Jw

    2011-06-01

    To investigate the possible mutations in the carbohydrate sulfotransferase 6 (CHST6) gene of 2 unrelated cases of macular corneal dystrophy (MCD) and to report atypical stromal deposits in one of them. Corneal tissues were stained with antisulfated keratan sulfate (KS), antitransforming growth factor beta 1-induced protein (TGFBIp), thioflavin-T, alcian blue, and Masson trichrome. Sequencing was performed to identify potential mutations in the CHST6 gene and the fourth and twelfth exons of the TGFBI gene. Alcian blue staining revealed the presence of multiple subepithelial and intrastromal mucopolysaccharide deposits, confirming the diagnosis of MCD in both cases. Immunofluorescence staining in case 1 revealed the presence of sulfated KS only in the keratocytes and select endothelial cells, consistent with MCD type IA. Preferential expression of sulfated KS was observed in keratocytes and extracellular stromal matrix in case 2, consistent with MCD type II. Atypical subepithelial and superficial stromal deposits were observed in case 1, which stained positively with alcian blue, eosin, Masson trichrome, and thioflavin-T indicating the presence of hyaline and amyloid materials. CHST6 gene sequencing revealed 2 heterozygous mutations in case 1 (a p.Arg211Gln and a novel mutation of p.Arg177Gly) and a novel homozygous mutation of p.Pro186Arg in case 2. No mutations were found in exons 4 or 12 of the TGFBI gene in case 1. Secondary hyalinosis and amyloidosis occur in a case of MCD type IA with a novel p.Arg177Gly mutation in CHST6. A novel p.Pro186Arg mutation in CHST6 is associated with MCD type II in an African American.

  8. Congenital thrombotic thrombocytopenic purpura caused by new compound heterozygous mutations of the ADAMTS13 gene

    DEFF Research Database (Denmark)

    Rank, Cecilie Utke; Kremer Hovinga, Johanna; Taleghani, Magnus Mansouri

    2014-01-01

    Upshaw-Schulman syndrome (USS) is due to severe congenital deficiency of von Willebrand factor (VWF)-cleaving protease ADAMTS13 (a disintegrin and metalloprotease with thrombospondin type 1 domains, nr 13) activity resulting in the presence of unusually large forms of VWF in the circulation, caus...... of A) leading to p.R1123H. This case report confirms the importance of the analysis of the ADAMTS13 activity and its inhibitor in patients who have episodes of TTP, with a very low platelet count and sometimes without the classic biochemical signs of hemolysis....

  9. Mutations in the gene encoding the low-density lipoprotein receptor LRP4 cause abnormal limb development in the mouse.

    Science.gov (United States)

    Simon-Chazottes, Dominique; Tutois, Sylvie; Kuehn, Michael; Evans, Martin; Bourgade, Franck; Cook, Sue; Davisson, Muriel T; Guénet, Jean-Louis

    2006-05-01

    Positional cloning of two recessive mutations of the mouse that cause polysyndactyly (dan and mdig-Chr 2) confirmed that the gene encoding MEGF7/LRP4, a member of the low-density lipoprotein receptor family, plays an essential role in the process of digit differentiation. Pathologies observed in the mutant mice provide insight into understanding the function(s) of LRP4 as a negative regulator of the Wnt-beta-catenin signaling pathway and may help identify the genetic basis for common human disorders with similar phenotypes.

  10. Structural Basis for a Human Glycosylation Disorder Caused by Mutation of the COG4 Gene

    Energy Technology Data Exchange (ETDEWEB)

    Richardson, B.; Smith, R; Ungar, D; Nakamura, A; Jeffrey, P; Lupashin, V; Hughson, F

    2009-01-01

    The proper glycosylation of proteins trafficking through the Golgi apparatus depends upon the conserved oligomeric Golgi (COG) complex. Defects in COG can cause fatal congenital disorders of glycosylation (CDGs) in humans. The recent discovery of a form of CDG, caused in part by a COG4 missense mutation changing Arg 729 to Trp, prompted us to determine the 1.9 A crystal structure of a Cog4 C-terminal fragment. Arg 729 is found to occupy a key position at the center of a salt bridge network, thereby stabilizing Cog4's small C-terminal domain. Studies in HeLa cells reveal that this C-terminal domain, while not needed for the incorporation of Cog4 into COG complexes, is essential for the proper glycosylation of cell surface proteins. We also find that Cog4 bears a strong structural resemblance to exocyst and Dsl1p complex subunits. These complexes and others have been proposed to function by mediating the initial tethering between transport vesicles and their membrane targets; the emerging structural similarities provide strong evidence of a common evolutionary origin and may reflect shared mechanisms of action.

  11. Neurotoxicity and gene-expressed profile in brain-injured mice caused by exposure to titanium dioxide nanoparticles.

    Science.gov (United States)

    Ze, Yuguan; Hu, Renping; Wang, Xiaochun; Sang, Xuezi; Ze, Xiao; Li, Bi; Su, Junju; Wang, Yuan; Guan, Ning; Zhao, Xiaoyang; Gui, Suxin; Zhu, Liyuan; Cheng, Zhe; Cheng, Jie; Sheng, Lei; Sun, Qingqing; Wang, Ling; Hong, Fashui

    2014-02-01

    Titanium dioxide nanoparticles (TiO2 NPs) are widely used in toothpastes, sunscreens, and products for cosmetic purpose that the human use daily. Although the neurotoxicity induced by TiO2 NPs has been demonstrated, very little is known about the molecular mechanisms underlying the brain cognition and behavioral injury. In this study, mice were exposed to 2.5, 5, and 10 mg/kg body weight (BW) TiO2 NPs by nasal administration for 90 consecutive days, respectively, and their brains' injuries and brain gene-expressed profile were investigated. Our findings showed that TiO2 NPs could be translocated and accumulated in brain, led to oxidative stress, overproliferation of all glial cells, tissue necrosis as well as hippocampal cell apoptosis. Furthermore, microarray data showed significant alterations in the expression of 249 known function genes, including 113 genes upregulation and 136 genes downregulation following exposure to 10 mg/kg BW TiO2 NPs, which were associated with oxidative stress, immune response, apoptosis, memory and learning, brain development, signal transduction, metabolic process, DNA repair, response to stimulus, and cellular process. Especially, significant increases in Col1a1, serine/threonine-protein kinase 1, Ctnnb1, cysteine-serine-rich nuclear protein-1, Ddit4, Cyp2e1, and Krev interaction trapped protein 1 (Krit1) expressions and great decreases in DA receptor D2, Neu1, Fc receptor-like molecules, and Dhcr7 expressions following long-term exposure to TiO2 NPs resulted in neurogenic disease states in mice. Therefore, these genes may be potential biomarkers of brain toxicity caused by TiO2 NPs exposure, and the application of TiO2 NPs should be carried out cautiously. © 2013 Society of Plastics Engineers.

  12. MYT1L mutations cause intellectual disability and variable obesity by dysregulating gene expression and development of the neuroendocrine hypothalamus.

    Directory of Open Access Journals (Sweden)

    Patricia Blanchet

    2017-08-01

    Full Text Available Deletions at chromosome 2p25.3 are associated with a syndrome consisting of intellectual disability and obesity. The smallest region of overlap for deletions at 2p25.3 contains PXDN and MYT1L. MYT1L is expressed only within the brain in humans. We hypothesized that single nucleotide variants (SNVs in MYT1L would cause a phenotype resembling deletion at 2p25.3. To examine this we sought MYT1L SNVs in exome sequencing data from 4, 296 parent-child trios. Further variants were identified through a genematcher-facilitated collaboration. We report 9 patients with MYT1L SNVs (4 loss of function and 5 missense. The phenotype of SNV carriers overlapped with that of 2p25.3 deletion carriers. To identify the transcriptomic consequences of MYT1L loss of function we used CRISPR-Cas9 to create a knockout cell line. Gene Ontology analysis in knockout cells demonstrated altered expression of genes that regulate gene expression and that are localized to the nucleus. These differentially expressed genes were enriched for OMIM disease ontology terms "mental retardation". To study the developmental effects of MYT1L loss of function we created a zebrafish knockdown using morpholinos. Knockdown zebrafish manifested loss of oxytocin expression in the preoptic neuroendocrine area. This study demonstrates that MYT1L variants are associated with syndromic obesity in humans. The mechanism is related to dysregulated expression of neurodevelopmental genes and altered development of the neuroendocrine hypothalamus.

  13. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    Science.gov (United States)

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  14. Is the adiposity-associated FTO gene variant related to all-cause mortality independent of adiposity?

    DEFF Research Database (Denmark)

    Zimmermann, E; Ängquist, L H; Mirza, S S

    2015-01-01

    Previously, a single nucleotide polymorphism (SNP), rs9939609, in the FTO gene showed a much stronger association with all-cause mortality than expected from its association with body mass index (BMI), body fat mass index (FMI) and waist circumference (WC). This finding implies that the SNP has...... strong pleiotropic effects on adiposity and adiposity-independent pathological pathways that leads to increased mortality. To investigate this further, we conducted a meta-analysis of similar data from 34 longitudinal studies including 169,551 adult Caucasians among whom 27,100 died during follow.......932). In conclusion, this study does not support that the FTO SNP is associated with all-cause mortality independently of the adiposity phenotypes....

  15. Microarray-based detection and expression analysis of new genes associated with drug resistance in ovarian cancer cell lines

    Science.gov (United States)

    Januchowski, Radosław; Sterzyńska, Karolina; Zawierucha, Piotr; Ruciński, Marcin; Świerczewska, Monika; Partyka, Małgorzata; Bednarek-Rajewska, Katarzyna; Brązert, Maciej; Nowicki, Michał; Zabel, Maciej; Klejewski, Andrzej

    2017-01-01

    Purpose The present study is to discover a new genes associated with drug resistance development in ovarian cancer. Methods We used microarray analysis to determine alterations in the level of expression of genes in cisplatin- (CisPt), doxorubicin- (Dox), topotecan- (Top), and paclitaxel- (Pac) resistant variants of W1 and A2780 ovarian cancer cell lines. Immunohistochemistry assay was used to determine protein expression in ovarian cancer patients. Results We observed alterations in the expression of 22 genes that were common to all three cell lines that were resistant to the same cytostatic drug. The level of expression of 13 genes was upregulated and that of nine genes was downregulated. In the CisPt-resistant cell line, we observed downregulated expression of ABCC6, BST2, ERAP2 and MCTP1; in the Pac-resistant cell line, we observe upregulated expression of ABCB1, EPHA7 and RUNDC3B and downregulated expression of LIPG, MCTP1, NSBP1, PCDH9, PTPRK and SEMA3A. The expression levels of three genes, ABCB1, ABCB4 and IFI16, were upregulated in the Dox-resistant cell lines. In the Top-resistant cell lines, we observed increased expression levels of ABCG2, HERC5, IFIH1, MYOT, S100A3, SAMD4A, SPP1 and TGFBI and decreased expression levels of MCTP1 and PTPRK. The expression of EPHA7, IFI16, SPP1 and TGFBI was confirmed at protein level in analyzed ovarian cancer patients.. Conclusions The expression profiles of the investigated cell lines indicated that new candidate genes are related to the development of resistance to the cytostatic drugs that are used in first- and second-line chemotherapy of ovarian cancer. PMID:28611294

  16. MILK PRODUCTION AND REPRODUCTIVE TRAIT CAUSED BY LOC514211 GENE MUTATION IN DAIRY COWS

    Directory of Open Access Journals (Sweden)

    A. S. Anggraeni

    2016-03-01

    Full Text Available The SNP (rs 42688595 in LOC514211 is uncharacterized gene and located in chromosome 13 in Bos taurus, had significant effects on milk yield and milk quality that have been identified from Chinese and British dairy cows using GWAS (Genome-wide Association Study based on 60k SNP-Chip in the previous study. The objective of this study was to confirm the effects of the SNP in LOC514211 on productive traits in another population of Chinese Holstein dairy cow. Four hundred and seventy dairy cows were use in this study, genomic DNA was extracted from the blood of dairy cow, PCR-RFLP was applied to genotype of these DNA samples. Analysis of Variance (ANOVA was performed by the General Linear Model (GLM procedure of SAS 9.13 to identify the association of SNP with milk and reproductive traits. Results showed that SNP in LOC514211 was polymorphic in this herd of dairy cow and was in Hardy-Weinberg disequilibrium, and had significant differences among genotype in milk yield, milk quality and reproductive traits, which were similar with the results of previous GWAS study based SNP-Chips. Inconclusion, indicated that this SNP in LOC514211 might be potential markers for both milk and reproductive traits.

  17. No muscle involvement in myoclonus-dystonia caused by epsilon-sarcoglycan gene mutations1

    DEFF Research Database (Denmark)

    Hjermind, L.E.; Vissing, J.; Asmus, F.

    2008-01-01

    homologous and may substitute for one-another in different tissues. We therefore investigated whether mutations in SGCE also cause abnormalities of skeletal and myocardial muscle. Six patients with clinically and genetically verified M-D and no signs of limb-girdle muscular dystrophy were included. Skeletal...... muscle biopsies were obtained from all patients, and endomyocardial muscle biopsy from one of the patients. Morphological and immunohistological investigations were performed and compared with controls. Histological and immunohistological investigations of muscle and clinical assessment of muscle...... strength and mass showed no difference between M-D patients and controls. Our findings indicate that patients with M-D have no signs or symptoms of muscle disease. This suggests a different role of the sarcoglycan complex epsilonbetagammadelta versus alphabetagammadelta complex in humans, as earlier...

  18. A new class of regulatory genes underlying the cause of pear-shaped tomato fruit.

    Science.gov (United States)

    Liu, Jiping; Van Eck, Joyce; Cong, Bin; Tanksley, Steven D

    2002-10-01

    A common, recurring theme in domesticated plants is the occurrence of pear-shaped fruit. A major quantitative trait locus (termed ovate) controlling the transition from round to pear-shaped fruit has been cloned from tomato. OVATE is expressed early in flower and fruit development and encodes a previously uncharacterized, hydrophilic protein with a putative bipartite nuclear localization signal, Von Willebrand factor type C domains, and an approximately equal 70-aa C-terminal domain conserved in tomato, Arabidopsis, and rice. A single mutation, leading to a premature stop codon, causes the transition of tomato fruit from round- to pear-shaped. Moreover, ectopic, transgenic expression of OVATE unevenly reduces the size of floral organs and leaflets, suggesting that OVATE represents a previously uncharacterized class of negative regulatory proteins important in plant development.

  19. KCNJ10 gene mutations causing EAST syndrome (epilepsy, ataxia, sensorineural deafness, and tubulopathy) disrupt channel function.

    Science.gov (United States)

    Reichold, Markus; Zdebik, Anselm A; Lieberer, Evelyn; Rapedius, Markus; Schmidt, Katharina; Bandulik, Sascha; Sterner, Christina; Tegtmeier, Ines; Penton, David; Baukrowitz, Thomas; Hulton, Sally-Anne; Witzgall, Ralph; Ben-Zeev, Bruria; Howie, Alexander J; Kleta, Robert; Bockenhauer, Detlef; Warth, Richard

    2010-08-10

    Mutations of the KCNJ10 (Kir4.1) K(+) channel underlie autosomal recessive epilepsy, ataxia, sensorineural deafness, and (a salt-wasting) renal tubulopathy (EAST) syndrome. We investigated the localization of KCNJ10 and the homologous KCNJ16 in kidney and the functional consequences of KCNJ10 mutations found in our patients with EAST syndrome. Kcnj10 and Kcnj16 were found in the basolateral membrane of mouse distal convoluted tubules, connecting tubules, and cortical collecting ducts. In the human kidney, KCNJ10 staining was additionally observed in the basolateral membrane of the cortical thick ascending limb of Henle's loop. EM of distal tubular cells of a patient with EAST syndrome showed reduced basal infoldings in this nephron segment, which likely reflects the morphological consequences of the impaired salt reabsorption capacity. When expressed in CHO and HEK293 cells, the KCNJ10 mutations R65P, G77R, and R175Q caused a marked impairment of channel function. R199X showed complete loss of function. Single-channel analysis revealed a strongly reduced mean open time. Qualitatively similar results were obtained with coexpression of KCNJ10/KCNJ16, suggesting a dominance of KCNJ10 function in native renal KCNJ10/KCNJ16 heteromers. The decrease in the current of R65P and R175Q was mainly caused by a remarkable shift of pH sensitivity to the alkaline range. In summary, EAST mutations of KCNJ10 lead to impaired channel function and structural changes in distal convoluted tubules. Intriguingly, the metabolic alkalosis present in patients carrying the R65P mutation possibly improves residual function of KCNJ10, which shows higher activity at alkaline pH.

  20. Identify potential drugs for cardiovascular diseases caused by stress-induced genes in vascular smooth muscle cells

    Directory of Open Access Journals (Sweden)

    Chien-Hung Huang

    2016-09-01

    Full Text Available Background Abnormal proliferation of vascular smooth muscle cells (VSMC is a major cause of cardiovascular diseases (CVDs. Many studies suggest that vascular injury triggers VSMC dedifferentiation, which results in VSMC changes from a contractile to a synthetic phenotype; however, the underlying molecular mechanisms are still unclear. Methods In this study, we examined how VSMC responds under mechanical stress by using time-course microarray data. A three-phase study was proposed to investigate the stress-induced differentially expressed genes (DEGs in VSMC. First, DEGs were identified by using the moderated t-statistics test. Second, more DEGs were inferred by using the Gaussian Graphical Model (GGM. Finally, the topological parameters-based method and cluster analysis approach were employed to predict the last batch of DEGs. To identify the potential drugs for vascular diseases involve VSMC proliferation, the drug-gene interaction database, Connectivity Map (cMap was employed. Success of the predictions were determined using in-vitro data, i.e. MTT and clonogenic assay. Results Based on the differential expression calculation, at least 23 DEGs were found, and the findings were qualified by previous studies on VSMC. The results of gene set enrichment analysis indicated that the most often found enriched biological processes are cell-cycle-related processes. Furthermore, more stress-induced genes, well supported by literature, were found by applying graph theory to the gene association network (GAN. Finally, we showed that by processing the cMap input queries with a cluster algorithm, we achieved a substantial increase in the number of potential drugs with experimental IC50 measurements. With this novel approach, we have not only successfully identified the DEGs, but also improved the DEGs prediction by performing the topological and cluster analysis. Moreover, the findings are remarkably validated and in line with the literature. Furthermore

  1. Cocaine withdrawal causes delayed dysregulation of stress genes in the hippocampus.

    Directory of Open Access Journals (Sweden)

    M Julia García-Fuster

    Full Text Available Relapse, even following an extended period of withdrawal, is a major challenge in substance abuse management. Delayed neurobiological effects of the drug during prolonged withdrawal likely contribute to sustained vulnerability to relapse. Stress is a major trigger of relapse, and the hippocampus regulates the magnitude and duration of stress responses. Recent work has implicated hippocampal plasticity in various aspects of substance abuse. We asked whether changes in stress regulatory mechanisms in the hippocampus may participate in the neuroadaptations that occur during prolonged withdrawal. We therefore examined changes in the rat stress system during the course of withdrawal from extended daily access (5-hours of cocaine self-administration, an animal model of addiction. Tissue was collected at 1, 14 and 28 days of withdrawal. Plasma corticosterone levels were determined and corticosteroid receptors (GR, MR, MR/GR mRNA ratios and expression of other stress-related molecules (HSP90AA1 and HSP90AB1 mRNA were measured in hippocampal subfields using in situ hybridization. Results showed a delayed emergence of dysregulation of stress genes in the posterior hippocampus following 28 days of cocaine withdrawal. This included increased GR mRNA in DG and CA3, increased MR and HSP90AA1 mRNA in DG, and decreased MR/GR mRNA ratio in DG and CA1. Corticosterone levels progressively decreased during the course of withdrawal, were normalized following 28 days of withdrawal, and were correlated negatively with GR and positively with MR/GR mRNA ratio in DG. These results suggest a role for the posterior hippocampus in the neuroadaptations that occur during prolonged withdrawal, and point to a signaling partner of GR, HSP90AA1, as a novel dysregulated target during cocaine withdrawal. These delayed neurobiological effects of extended cocaine exposure likely contribute to sustained vulnerability to relapse.

  2. Mutations in the lysosomal [beta]-galactosidase gene that cause the adult form of GMI gangliosidosis

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, S.; Rafi, M.A.; Wenger, D.A. (Thomas Jefferson Univ., Philadelphia, PA (United States))

    1994-06-01

    Three adult patients with acid-galactosidase deficiency/GM1 gangliosidosis who were from two unrelated families of Scandinavian descent were found to share a common point mutation in the coding region of the corresponding gene. The patients share common clinical features, including early dysarthria, mild ataxia, and bone abnormalities. When cDNA from the two patients in family 1 was PCR amplified and sequenced, most (39/41) of the clones showed a C-to-T transition (C[yields]T) at nucleotide 245 (counting from the initiation codon). This mutation changes the codon for the Thr(ACG) to Met(ATG). Mutant and normal sequences were also found in that position in genomic DNA, indicating the presence of another mutant allele. Genomic DNA from the patient in family 2 revealed the same point mutation in one allele. It was determined that in each family only the father carried the C[yields]T mutation. Expression studies showed that this mutation produced 3%-4% of [beta]-galactosidase activity, confirming its deleterious effects. The cDNA clones from the patients in family 1 that did not contain the C[yields]T revealed a 20-bp insertion of intronic sequence between nucleotides 75 and 76, the location of the first intron. Further analysis showed the insertion of a T near the 5[prime] splice donor site which led to the use of a cryptic splice site. It appears that the C[yields]T mutation results in enough functional enzyme to produce a mild adult form of the disease, even in the presence of a second mutation that likely produces nonfunctional enzyme. 31 refs., 7 figs., 1 tab.

  3. A de-novo large deletion of 2.8 kb produced in the ABCD1 gene causing adrenoleukodystrophy disease.

    Science.gov (United States)

    Kallabi, Fakhri; Ben Salah, Ghada; Ben Chehida, Amel; Tabebi, Mouna; Felhi, Rahma; Ben Turkia, Hadhami; Tebib, Neji; Keskes, Leila; Kamoun, Hassen

    2016-06-01

    X-linked adrenoleukodystrophy (X-ALD) is a neurodegenerative disorder caused by mutations in the ABCD1 gene, which encodes an ATP-binding cassette transporter protein, ALDP. The disease is characterized by increased concentrations of very long chain fatty acids (VLCFAs) in plasma, adrenal, testicular, and nerve tissues. For this study, our objective was to conduct clinical, molecular, and genetic studies of a Tunisian patient with X-ALD. The diagnosis was based on clinical indications, biochemical analyses, typical brain-scan patterns, and molecular biology; the molecular analyses were based on PCR, long-range PCR, and sequencing. The molecular analysis by long-range PCR and direct sequencing of the ABCD1 gene showed the presence of a de-novo 2794 bp deletion covering the whole of exon 2. Using bioinformatics tools, we demonstrate that the large deletion is located in a region rich with Alu sequences. Furthermore, we suggest that the AluJb sequence could be the cause of the large deletion of intron 1, exon 2, and intron 2, and the creation of a premature stop codon within exon 3. This report is the first report in which we demonstrate the breakpoints and the size of a large deletion in a Tunisian with X-ALD.

  4. Autosomal recessive posterior column ataxia with retinitis pigmentosa caused by novel mutations in the FLVCR1 gene.

    Science.gov (United States)

    Shaibani, Aziz; Wong, Lee-Jun; Wei Zhang, Victor; Lewis, Richard Alan; Shinawi, Marwan

    2015-01-01

    Posterior column ataxia with retinitis pigmentosa (PCARP) is an autosomal recessive disorder characterized by severe sensory ataxia, muscle weakness and atrophy, and progressive pigmentary retinopathy. Recently, mutations in the FLVCR1 gene were described in four families with this condition. We investigated the molecular basis and studied the phenotype of PCARP in a new family. The proband is a 33-year-old woman presented with sensory polyneuropathy and retinitis pigmentosa (RP). The constellation of clinical findings with normal metabolic and genetic evaluation, including mitochondrial DNA (mtDNA) analysis and normal levels of phytanic acid and vitamin E, prompted us to seek other causes of our patient's condition. Sequencing of FLVCR1 in the proband and targeted mutation testing in her two affected siblings revealed two novel variants, c.1547G > A (p.R516Q) and c.1593+5_+8delGTAA predicted, respectively, to be highly conserved throughout evolution and affecting the normal splicing, therefore, deleterious. This study supports the pathogenic role of FLVCR1 in PCARP and expands the molecular and clinical spectra of PCARP. We show for the first time that nontransmembrane domain (TMD) mutations in the FLVCR1 can cause PCARP, suggesting different mechanisms for pathogenicity. Our clinical data reveal that impaired sensation can be part of the phenotypic spectrum of PCARP. This study along with previously reported cases suggests that targeted sequencing of the FLVCR1 gene should be considered in patients with severe sensory ataxia, RP, and peripheral sensory neuropathy.

  5. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Ana Gonçalves

    2017-10-01

    Full Text Available A broad mutational spectrum in the dystrophin (DMD gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD. Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR, and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1, disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD.

  6. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  7. A nonsense mutation in the acid α-glucosidase gene causes Pompe disease in Finnish and Swedish Lapphunds.

    Directory of Open Access Journals (Sweden)

    Eija H Seppälä

    Full Text Available Pompe disease is a recessively inherited and often fatal disorder caused by the deficiency of acid α-glucosidase, an enzyme encoded by the GAA gene and needed to break down glycogen in lysosomes. This glycogen storage disease type II has been reported also in Swedish Lapphund dogs. Here we describe the genetic defect in canine Pompe disease and show that three related breeds from Scandinavia carry the same mutation. The affected dogs are homozygous for the GAA c.2237G>A mutation leading to a premature stop codon at amino acid position 746. The corresponding mutation has previously been reported in humans and causes infantile Pompe disease in combination with a second fully deleterious mutation. The affected dogs from both the Finnish as well as the Swedish breed mimic infantile-onset Pompe disease genetically, but also clinico-pathologically. Therefore this canine model provides a valuable tool for preclinical studies aimed at the development of gene therapy in Pompe disease.

  8. Mutation of the Erwinia amylovora argD gene causes arginine auxotrophy, nonpathogenicity in apples, and reduced virulence in pears.

    Science.gov (United States)

    Ramos, Laura S; Lehman, Brian L; Peter, Kari A; McNellis, Timothy W

    2014-11-01

    Fire blight is caused by Erwinia amylovora and is the most destructive bacterial disease of apples and pears worldwide. In this study, we found that E. amylovora argD(1000)::Tn5, an argD Tn5 transposon mutant that has the Tn5 transposon inserted after nucleotide 999 in the argD gene-coding region, was an arginine auxotroph that did not cause fire blight in apple and had reduced virulence in immature pear fruits. The E. amylovora argD gene encodes a predicted N-acetylornithine aminotransferase enzyme, which is involved in the production of the amino acid arginine. A plasmid-borne copy of the wild-type argD gene complemented both the nonpathogenic and the arginine auxotrophic phenotypes of the argD(1000)::Tn5 mutant. However, even when mixed with virulent E. amylovora cells and inoculated onto immature apple fruit, the argD(1000)::Tn5 mutant still failed to grow, while the virulent strain grew and caused disease. Furthermore, the pCR2.1-argD complementation plasmid was stably maintained in the argD(1000)::Tn5 mutant growing in host tissues without any antibiotic selection. Therefore, the pCR2.1-argD complementation plasmid could be useful for the expression of genes, markers, and reporters in E. amylovora growing in planta, without concern about losing the plasmid over time. The ArgD protein cannot be considered an E. amylovora virulence factor because the argD(1000)::Tn5 mutant was auxotrophic and had a primary metabolism defect. Nevertheless, these results are informative about the parasitic nature of the fire blight disease interaction, since they indicate that E. amylovora cannot obtain sufficient arginine from apple and pear fruit tissues or from apple vegetative tissues, either at the beginning of the infection process or after the infection has progressed to an advanced state. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Two new large deletions of the AVPR2 gene causing nephrogenic diabetes insipidus and a review of previously published deletions.

    Science.gov (United States)

    Anesi, Laura; de Gemmis, Paola; Galla, Daniela; Hladnik, Uros

    2012-10-01

    In this paper, we report two new original deletions and present an extended review of the previously characterized AVPR2 gene deletions to better understand the underlying deletion mechanisms. The two novel deletions were defined using polymerase chain reaction mapping and junction fragment sequencing. Bioinformatic analysis was performed on both the previously mapped deletions and the novel ones through several web tools. In our two patients with nephrogenic diabetes insipidus, we found a 23 755 bp deletion and a 9264 bp deletion both comprising the entire AVPR2 gene and part of the ARHGAP4 gene. Through bioinformatic studies, the smallest overlapping region as well as several motifs and repeats that are known to promote rearrangements were confirmed. Through this study, it was determined that the deletion mechanisms in the AVPR2 region do not follow the rules of non-allelic homologous recombination. Two of the 13 deletions can be attributed to the fork stalling and template switching (FoSTeS) mechanism, whereas the remaining 11 deletions could be caused either by non-homologous end joining or by the FoSTeS mechanism. Although no recurrence was found, several groupings of deletion breakpoints were identified.

  10. A missense mutation (p.G274R) in gene ASPA causes Canavan disease in a Pakistani family.

    Science.gov (United States)

    Hussain, Rashida; Daud, Shakeela; Kakar, Naseebullah; Ahmad, Adeel; Baloch, Abdul Hameed; Tareen, Abdul Malik; Kakar, Muhammad Azam; Ahmad, Jamil

    2012-05-01

    Canavan disease (OMIM 271900) is an autosomal recessive lethal neurodegenerative disorder characterized by spongy degeneration of the brain. A highly consanguineous Pakistani family with Canavan disease was enrolled on the basis of diagnosis. All the affected individuals have mental retardation, megalocephaly and degradation of motor skills, poor head control, partial vision loss, weakness of the muscles and raised urinary concentration of N-acetyl aspartic acid in the urine. Blood samples were collected from affected as well as normal siblings and processed for DNA purification. Linkage analysis was performed by typing three short tandem repeat markers D17S1583 (7.19 cM), D17S1828 (10.02 cM) and D17S919 (14.69 cM) for an already-reported gene/locus ASPA at chromosome 17p13.2 causing Canavan disease. During linkage analysis, all the affected individuals were homozygous for short tandem repeat markers while the normal siblings were heterozygous showing co-segregation of the disease. Gene ASPA (NM_000049) was undertaken to sequence for mutation analysis. As a result of sequence analysis, we found missense substitution 740A→G (p.G274R) in exon 6 of gene ASPA. To our knowledge, this is the first report about Canavan disease on a Pakistani family.

  11. Identification of the first intragenic deletion of the PITX2 gene causing an Axenfeld-Rieger Syndrome: case report

    Directory of Open Access Journals (Sweden)

    Dufier Jean-Louis

    2006-11-01

    Full Text Available Abstract Background Axenfeld-Rieger syndrome (ARS is characterized by bilateral congenital abnormalities of the anterior segment of the eye associated with abnormalities of the teeth, midface, and umbilicus. Most cases of ARS are caused by mutations in the genes encoding PITX2 or FOXC1. Here we describe a family affected by a severe form of ARS. Case presentation Two members of this family (father and daughter presented with typical ARS and developed severe glaucoma. The ocular phenotype was much more severe in the daughter than in the father. Magnetic resonance imaging (MRI detected an aggressive form of meningioma in the father. There was no mutation in the PITX2 gene, determined by exon screening. We identified an intragenic deletion by quantitative genomic PCR analysis and characterized this deletion in detail. Conclusion Our findings implicate the first intragenic deletion of the PITX2 gene in the pathogenesis of a severe form of ARS in an affected family. This study stresses the importance of a systematic search for intragenic deletions in families affected by ARS and in sporadic cases for which no mutations in the exons or introns of PITX2 have been found. The molecular genetics of some ARS pedigrees should be re-examined with enzymes that can amplify medium and large genomic fragments.

  12. The deafness-causing mutation c.508_511dup in the GJB2 gene and a literature review.

    Science.gov (United States)

    Zhu, Yi-Ming; Li, Yong; Wang, Yan-Li; Bian, Pan-Pan; Xu, Bai-Cheng; Liu, Xiao-Wen; Chen, Xing-Jian; Liu, Feng; Guo, Yu-Fen; Wang, Qiu-Ju

    2015-09-01

    The mutation c.508_511dup in GJB2 gene has been incorrectly named as other mutations. It is essential to standardize mutation nomenclature to describe complex mutations. This paper aimed to verify a series of patients with the frame-shift mutation c.508_511dup in the GJB2 gene and review the literature on related mutations. All the included patients with non-syndromic hearing loss (NSHL) carried the 504insAACG or c.508_511dup mutation of the GJB2 gene in the present study. Their parents were encouraged to participate. After written informed consent and clinic data had been obtained, genomic DNA was extracted from venous blood of participants. The target fragments were amplified by polymerase chain reaction (PCR) and subjected to bidirectional sequencing to identify sequence variations. A total of 14 patients with prelingual NSHL and 6 normal parents were recruited. Genotyping revealed that one mutation, c.508_511dup (not 504insAACG), was homozygous in 1 patient, heterozygous in 2 patients and 3 parents, and compound heterozygous in 11 patients. Twelve patients had hearing loss caused by c.508_511dup in a homozygous or compound heterozygous form, and further study showed that it was wrongly named as 504insAACG. Additionally, according to the standard nomenclature, the previously reported mutations with distinct names from the literature review may be replaced by c.508_511dup.

  13. Altered Gene Expression in Three Plant Species in Response to Treatment with Nep1, a Fungal Protein That Causes Necrosis

    Science.gov (United States)

    Keates, Sarah E.; Kostman, Todd A.; Anderson, James D.; Bailey, Bryan A.

    2003-01-01

    Nep1 is an extracellular fungal protein that causes necrosis when applied to many dicotyledonous plants, including invasive weed species. Using transmission electron microscopy, it was determined that application of Nep1 (1.0 μg mL–1, 0.1% [v/v] Silwet-L77) to Arabidopsis and two invasive weed species, spotted knapweed (Centaurea maculosa) and dandelion (Taraxacum officinale), caused a reduction in the thickness of the cuticle and a breakdown of chloroplasts 1 to 4 h after treatment. Membrane breakdown was most severe in cells closest to the surface of application. Differential display was used to isolate cDNA clones from the three species showing differential expression in response to Nep1 treatment. Differential gene expression was observed for a putative serpin (CmSER-1) and a calmodulin-like (CmCAL-1) protein from spotted knapweed, and a putative protein phosphatase 2C (ToPP2C-1) and cytochrome P-450 (ToCYP-1) protein from dandelion. In addition, differential expression was observed for genes coding for a putative protein kinase (AtPK-1), a homolog (AtWI-12) of wound-induced WI12, a homolog (AtLEA-1) of late embryogenesis abundant LEA-5, a WRKY-18 DNA-binding protein (AtWRKY-18), and a phospholipase D (AtPLD-1) from Arabidopsis. Genes showing elevated mRNA levels in Nep1-treated (5 μg mL–1, 0.1% [v/v] Silwet-L77) leaves 15 min after Nep1 treatment included CmSER-1 and CmCAL-1 for spotted knapweed, ToCYP-1 and CmCAL-1 for dandelion, and AtPK-1, AtWRKY-18, AtWI-12, and AtLEA-1 for Arabidopsis. Levels of mRNA for AtPLD-1 (Arabidopsis) and ToPP2C-1 (dandelion) decreased rapidly in Silwet-l77-treated plants between 15 min and 4 h of treatment, but were maintained or decreased more slowly over time in Nep1-treated (5 μg mL–1, 0.1% [v/v] Silwet-L77) leaves. In general, increases in mRNA band intensities were in the range of two to five times, with only ToCYP-1 in dandelion exceeding an increase of 10 times. The identified genes have been shown to be involved

  14. Mutations of the aurora kinase C gene causing macrozoospermia are the most frequent genetic cause of male infertility in Algerian men

    Science.gov (United States)

    Ounis, Leyla; Zoghmar, Abdelali; Coutton, Charles; Rouabah, Leila; Hachemi, Maroua; Martinez, Delphine; Martinez, Guillaume; Bellil, Ines; Khelifi, Douadi; Arnoult, Christophe; Fauré, Julien; Benbouhedja, Sebti; Rouabah, Abdelkader; Ray, Pierre F

    2015-01-01

    Klinefelter syndrome and Y-chromosomal microdeletion analyses were once the only two genetic tests offered to infertile men. Analyses of aurora kinase C (AURKC) and DPY19L2 are now recommended for patients presenting macrozoospermia and globozoospermia, respectively, two rare forms of teratozoospermia particularly frequent among North African men. We carried out genetic analyses on Algerian patients, to evaluate the prevalence of these syndromes in this population and to compare it with the expected frequency of Klinefelter syndrome and Y-microdeletions. We carried out a retrospective study on 599 consecutive patients consulting for couple infertility at the assisted reproduction unit of the Ibn Rochd Clinique, Constantine, Algeria. Abnormal sperm parameters were observed in 404 men. Fourteen and seven men had typical macrozoospermia and globozoospermia profiles, respectively. Molecular diagnosis was carried out for these patients, for the AURKC and DPY19L2 genes. Eleven men with macrozoospermia had a homozygous AURKC mutation (79%), corresponding to 2.7% of all patients with abnormal spermograms. All the men with globozoospermia studied (n = 5), corresponding to 1.2% of all infertile men, presented a homozygous DPY19L2 deletion. By comparison, we would expect 1.6% of the patients in this cohort to have Klinefelter syndrome and 0.23% to have Y-microdeletion. Our findings thus indicate that AURKC mutations are more frequent than Klinefelter syndrome and constitute the leading genetic cause of infertility in North African men. Furthermore, we estimate that AURKC and DPY19L2 molecular defects are 10 and 5 times more frequent, respectively, than Y-microdeletions. PMID:25219909

  15. Tapetum-specific expression of a cytoplasmic orf507 gene causes semi-male sterility in transgenic peppers

    Directory of Open Access Journals (Sweden)

    Jiao-Jiao eJi

    2015-04-01

    Full Text Available Though cytoplasmic male sterility (CMS in peppers is associated with the orf507 gene, definitive and direct evidence that it directly causes male sterility is still lacking. In this study, differences in histochemical localization of anther cytochrome c oxidase between the pepper CMS line and maintainer line were observed mainly in the tapetal cells and tapetal membrane. Inducible and specific expression of the orf507 gene in the pepper maintainer line found that transformants were morphologically similar to untransformed and transformed control plants, but had shrunken anthers that showed little dehiscence and fewer pollen grains with lower germination rate and higher naturally damaged rate. These characters were different from those of CMS line which does not produce any pollen grains. Meanwhile a pollination test using transformants as the male parent set few fruit and there were few seeds in the limited number of fruits. At the tetrad stage, ablation of the tapetal cell induced by premature programmed cell death occurred in the transformants and the microspores were distorted and degraded at the mononuclear stage. Stable transmission of induced semi-male sterility was confirmed by a test cross. In addition, expression of orf507 in the maintainer lines seemed to inhibit expression of atp6-2 to a certain extent, and lead to the increase of the activity of cytochrome c oxidase and the ATP hydrolysis of the mitochondrial F1Fo-ATP synthase. These results introduce the premature programmed cell death caused by orf507 gene in tapetal cells and semi-male sterility, but not complete male sterility.

  16. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Directory of Open Access Journals (Sweden)

    Lee SH

    2016-04-01

    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  17. Tapetum-specific expression of a cytoplasmic orf507 gene causes semi-male sterility in transgenic peppers.

    Science.gov (United States)

    Ji, Jiao-Jiao; Huang, Wei; Li, Zheng; Chai, Wei-Guo; Yin, Yan-Xu; Li, Da-Wei; Gong, Zhen-Hui

    2015-01-01

    Though cytoplasmic male sterility (CMS) in peppers is associated with the orf507 gene, definitive and direct evidence that it directly causes male sterility is still lacking. In this study, differences in histochemical localization of anther cytochrome c oxidase between the pepper CMS line and maintainer line were observed mainly in the tapetal cells and tapetal membrane. Inducible and specific expression of the orf507 gene in the pepper maintainer line found that transformants were morphologically similar to untransformed and transformed control plants, but had shrunken anthers that showed little dehiscence and fewer pollen grains with lower germination rate and higher naturally damaged rate. These characters were different from those of CMS line which does not produce any pollen grains. Meanwhile a pollination test using transformants as the male parent set few fruit and there were few seeds in the limited number of fruits. At the tetrad stage, ablation of the tapetal cell induced by premature programmed cell death (PCD) occurred in the transformants and the microspores were distorted and degraded at the mononuclear stage. Stable transmission of induced semi-male sterility was confirmed by a test cross. In addition, expression of orf507 in the maintainer lines seemed to inhibit expression of atp6-2 to a certain extent, and lead to the increase of the activity of cytochrome c oxidase and the ATP hydrolysis of the mitochondrial F1Fo-ATP synthase. These results introduce the premature PCD caused by orf507 gene in tapetal cells and semi-male sterility, but not complete male sterility.

  18. Gene-environment interaction between lead and Apolipoprotein E4 causes cognitive behavior deficits in mice.

    Science.gov (United States)

    Engstrom, Anna K; Snyder, Jessica M; Maeda, Nobuyo; Xia, Zhengui

    2017-02-07

    Alzheimer's disease (AD) is characterized by progressive cognitive decline and memory loss. Environmental factors and gene-environment interactions (GXE) may increase AD risk, accelerate cognitive decline, and impair learning and memory. However, there is currently little direct evidence supporting this hypothesis. In this study, we assessed for a GXE between lead and ApoE4 on cognitive behavior using transgenic knock-in (KI) mice that express the human Apolipoprotein E4 allele (ApoE4-KI) or Apolipoprotein E3 allele (ApoE3-KI). We exposed 8-week-old male and female ApoE3-KI and ApoE4-KI mice to 0.2% lead acetate via drinking water for 12 weeks and assessed for cognitive behavior deficits during and after the lead exposure. In addition, we exposed a second (cellular) cohort of animals to lead and assessed for changes in adult hippocampal neurogenesis as a potential underlying mechanism for lead-induced learning and memory deficits. In the behavior cohort, we found that lead reduced contextual fear memory in all animals; however, this decrease was greatest and statistically significant only in lead-treated ApoE4-KI females. Similarly, only lead-treated ApoE4-KI females exhibited a significant decrease in spontaneous alternation in the T-maze. Furthermore, all lead-treated animals developed persistent spatial working memory deficits in the novel object location test, and this deficit manifested earlier in ApoE4-KI mice, with female ApoE4-KI mice exhibiting the earliest deficit onset. In the cellular cohort, we observed that the maturation, differentiation, and dendritic development of adult-born neurons in the hippocampus was selectively impaired in lead-treated female ApoE4-KI mice. These data suggest that GXE between ApoE4 and lead exposure may contribute to cognitive impairment and that impaired adult hippocampal neurogenesis may contribute to these deficits in cognitive behavior. Together, these data suggest a role for GXE and sex differences in AD risk.

  19. A novel mitochondrial tRNA(Ala) gene variant causes chronic progressive external ophthalmoplegia in a patient with Huntington disease.

    Science.gov (United States)

    Filosto, Massimiliano; Lanzi, Gaetana; Nesti, Claudia; Vielmi, Valentina; Marchina, Eleonora; Galvagni, Anna; Giliani, Silvia; Santorelli, Filippo M; Padovani, Alessandro

    2016-03-01

    Chronic progressive external ophthalmoplegia is a mitochondrial disorder usually caused by single or multiple mitochondrial DNA (mtDNA) deletions and, more rarely, by maternally inherited mtDNA point mutations, most frequently in tRNA genes (MTT). We report on a patient presenting with a progressive eyelid ptosis with bilateral ophthalmoparesis, dysphagia, dysphonia and mild proximal limb weakness associate with a mild movement disorder characterized by abnormal involuntary movements involving head and limbs, imbalance and gait instability. Muscle biopsy demonstrated the presence of ragged red fibers and several cytochrome-C-oxidase negative fibers. Molecular analysis showed the novel m.5613T > C heteroplasmic mutation in the mitochondrial tRNA(Ala) gene (MTTA) which disrupts a conserved site and fulfills the accepted criteria of pathogenicity. Moreover, a 38 CAG trinucleotide repeat expansion was found on the huntingtin gene, thus configuring a singular CPEO/"reduced penetrance" Huntington disease "double trouble". With this novel MTTA point mutation, we extend the spectrum of provisional pathogenic changes in this gene, which is a very rare site of pathogenic mutation, and confirm that clinical expression of these mutations is hardly ever heterogeneous, including myopathy and CPEO. Mitochondrial involvement is an emerging key determinant in the pathogenesis of Huntington disease and it is well known that mutant huntingtin influences the mitochondrial respiratory complexes II and III. A synergist effect of the HTT and MTTA mutations on respiratory chain function may be hypothesized in our patient and should be regarded as a spur for further studies on the mtDNA/HTT reciprocal interactions.

  20. A novel mitochondrial tRNAAla gene variant causes chronic progressive external ophthalmoplegia in a patient with Huntington disease

    Science.gov (United States)

    Filosto, Massimiliano; Lanzi, Gaetana; Nesti, Claudia; Vielmi, Valentina; Marchina, Eleonora; Galvagni, Anna; Giliani, Silvia; Santorelli, Filippo M.; Padovani, Alessandro

    2016-01-01

    Chronic progressive external ophthalmoplegia is a mitochondrial disorder usually caused by single or multiple mitochondrial DNA (mtDNA) deletions and, more rarely, by maternally inherited mtDNA point mutations, most frequently in tRNA genes (MTT). We report on a patient presenting with a progressive eyelid ptosis with bilateral ophthalmoparesis, dysphagia, dysphonia and mild proximal limb weakness associate with a mild movement disorder characterized by abnormal involuntary movements involving head and limbs, imbalance and gait instability. Muscle biopsy demonstrated the presence of ragged red fibers and several cytochrome-C-oxidase negative fibers. Molecular analysis showed the novel m.5613T > C heteroplasmic mutation in the mitochondrial tRNAAla gene (MTTA) which disrupts a conserved site and fulfills the accepted criteria of pathogenicity. Moreover, a 38 CAG trinucleotide repeat expansion was found on the huntingtin gene, thus configuring a singular CPEO/“reduced penetrance” Huntington disease “double trouble”. With this novel MTTA point mutation, we extend the spectrum of provisional pathogenic changes in this gene, which is a very rare site of pathogenic mutation, and confirm that clinical expression of these mutations is hardly ever heterogeneous, including myopathy and CPEO. Mitochondrial involvement is an emerging key determinant in the pathogenesis of Huntington disease and it is well known that mutant huntingtin influences the mitochondrial respiratory complexes II and III. A synergist effect of the HTT and MTTA mutations on respiratory chain function may be hypothesized in our patient and should be regarded as a spur for further studies on the mtDNA/HTT reciprocal interactions. PMID:27014581

  1. Molecular detection and characterization through analysis of the hexon and fiber genes of Adenoviruses causing conjunctivitis in Tunisia, North Africa.

    Science.gov (United States)

    Fedaoui, Nadia; Ben Ayed, Narjess; Ben Yahia, Ahlem; Hammami, Walid; Matri, Leila; Nacef, Leila; Triki, Henda

    2017-02-01

    Human adenoviruses (HAdVs) are common causes of conjunctivitis. This study describes the epidemiological features and characterizes by phylogenetic analysis HAdVs isolated from patients with conjunctivitis in Tunisia, North Africa. Data on out-patients presenting with conjunctivitis during 2 years (2012-2013) were analyzed. Conjunctival swabs obtained from 240 patients were assessed for the presence of HAdVs by PCR amplification on the fiber and hexon genes. Positive PCR products, together with those of nine viral isolates from previous years, were sequenced and analyzed phylogenetically. Conjunctivitis represented 11.5% of all reasons of consultations with a slight increase between mid-March and mid-June. Sixty-five percent of samples (n = 156) revealed positive by at least one PCR test. PCR amplification in the hexon gene was slightly more sensitive as compared to the fiber gene. Genotyping in the two genomic regions gave concordant results for almost all isolates. HAdV-D8 was the most predominant genotype (87.6%) and was detected continuously from 2000 to 2013. Minor co-circulating genotypes including HAdV-E4, HAdV-B3, HAdV-B55, and HAdV-D37 were identified; most of them were detected by amplification in the hexon gene. In conclusion, this work reports molecular data on adenoviral conjunctivitis from a region where such information is scarce and contributes to a better knowledge of the worldwide distribution of causative genotypes. It revealed a predominance and endemic circulation of HAdV-D8, a genotype that was mainly reported from epidemic keratoconjunctivitis. It shows that PCR amplification in two different genomic regions enhances the sensitivity of HAdV detection in clinical samples and the identification of minor genotypes. J. Med. Virol. 89:304-312, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. A mutation in the nuclear pore complex gene Tmem48 causes gametogenesis defects in skeletal fusions with sterility (sks) mice.

    Science.gov (United States)

    Akiyama, Kouyou; Noguchi, Junko; Hirose, Michiko; Kajita, Shimpei; Katayama, Kentaro; Khalaj, Maryam; Tsuji, Takehito; Fairfield, Heather; Byers, Candice; Reinholdt, Laura; Ogura, Atsuo; Kunieda, Tetsuo

    2013-11-01

    Skeletal fusions with sterility (sks) is an autosomal recessive mutation of mouse that results in male and female sterility because of defects in gametogenesis. The mutants also have skeletal malformations with fused vertebrae and ribs. We examined testicular phenotypes of sks/sks mice to investigate the defects in spermatogenesis. Histological and immunocytochemical analyses and expression analyses of the marker genes demonstrated that spermatogenesis is arrested at mid to late pachytene stage of meiotic prophase with defective synapsis of the homologous chromosomes. Next, we determined the precise chromosomal localization of the sks locus on a 0.3-Mb region of mouse chromosome 4 by linkage analysis. By sequencing the positional candidate genes in this region and whole exome sequencing, we found a GG to TT nucleotide substitution in exon 6 of the Tmem48 gene that encodes a putative transmembrane protein with six transmembrane domains. The nucleotide substitution causes aberrant splicing, which deletes exon 6 of the Tmem48 transcript. Specific expression of TMEM48 was observed in germ cells of males and females. Furthermore, the phenotypes of the sks mutant were completely rescued by the transgenesis of a genomic fragment containing the wild-type Tmem48 gene. These findings indicate that the Tmem48 mutation is responsible for the gametogenesis defects and skeletal malformations in the sks mice. The TMEM48 protein is a nuclear membrane protein comprising the nuclear pore complex; its exact function in the nuclear pore complex is still unknown. Our finding suggested that the nuclear pore complex plays an important role in mammalian gametogenesis and skeletal development.

  3. Selective ablation of Ppp1cc gene in testicular germ cells causes oligo-teratozoospermia and infertility in mice.

    Science.gov (United States)

    Sinha, Nilam; Puri, Pawan; Nairn, Angus C; Vijayaraghavan, Srinivasan

    2013-11-01

    The four isoforms of serine/threonine phosphoprotein phosphatase 1 (PP1), derived from three genes, are among the most conserved proteins known. The Ppp1cc gene encodes two alternatively spliced variants, PP1 gamma1 (PPP1CC1) and PP1 gamma2 (PPP1CC2). Global deletion of the Ppp1cc gene, which causes loss of both isoforms, results in male infertility due to impaired spermatogenesis. This phenotype was assumed to be due to the loss of PPP1CC2, which is abundant in testis. While PPP1CC2 is predominant, other PP1 isoforms are also expressed in testis. Given the significant homology between the four PP1 isoforms, the lack of compensation by the other PP1 isoforms for loss of one, only in testis, is surprising. Here we document, for the first time, expression patterns of the PP1 isoforms in postnatal developing and adult mouse testis. The timing and sites of testis expression of PPP1CC1 and PPP1CC2 in testis are nonoverlapping. PPP1CC2 is the only one of the four PP1 isoforms not detected in sertoli cells and spermatogonia. Conversely, PPP1CC2 may be the only PP1 isoform expressed in postmeiotic germ cells. Deletion of the Ppp1cc gene in germ cells at the differentiated spermatogonia stage of development and beyond in Stra8 promoter-driven Cre transgenic mice results in oligo-terato-asthenozoospermia and male infertility, thus phenocopying global Ppp1cc null (-/-) mice. Taken together, these results confirm that spermatogenic defects observed in the global Ppp1cc knockout mice and in mice expressing low levels of PPP1CC2 in testis are due to compromised functions of PPP1CC2 in meiotic and postmeiotic germ cells.

  4. Epilepsy caused by an abnormal alternative splicing with dosage effect of the SV2A gene in a chicken model.

    Directory of Open Access Journals (Sweden)

    Marine Douaud

    Full Text Available Photosensitive reflex epilepsy is caused by the combination of an individual's enhanced sensitivity with relevant light stimuli, such as stroboscopic lights or video games. This is the most common reflex epilepsy in humans; it is characterized by the photoparoxysmal response, which is an abnormal electroencephalographic reaction, and seizures triggered by intermittent light stimulation. Here, by using genetic mapping, sequencing and functional analyses, we report that a mutation in the acceptor site of the second intron of SV2A (the gene encoding synaptic vesicle glycoprotein 2A is causing photosensitive reflex epilepsy in a unique vertebrate model, the Fepi chicken strain, a spontaneous model where the neurological disorder is inherited as an autosomal recessive mutation. This mutation causes an aberrant splicing event and significantly reduces the level of SV2A mRNA in homozygous carriers. Levetiracetam, a second generation antiepileptic drug, is known to bind SV2A, and SV2A knock-out mice develop seizures soon after birth and usually die within three weeks. The Fepi chicken survives to adulthood and responds to levetiracetam, suggesting that the low-level expression of SV2A in these animals is sufficient to allow survival, but does not protect against seizures. Thus, the Fepi chicken model shows that the role of the SV2A pathway in the brain is conserved between birds and mammals, in spite of a large phylogenetic distance. The Fepi model appears particularly useful for further studies of physiopathology of reflex epilepsy, in comparison with induced models of epilepsy in rodents. Consequently, SV2A is a very attractive candidate gene for analysis in the context of both mono- and polygenic generalized epilepsies in humans.

  5. Two Tightly Linked Genes at the hsa1 Locus Cause Both F1 and F2 Hybrid Sterility in Rice.

    Science.gov (United States)

    Kubo, Takahiko; Takashi, Tomonori; Ashikari, Motoyuki; Yoshimura, Atsushi; Kurata, Nori

    2016-02-01

    Molecular mechanisms of hybrid breakdown associated with sterility (F2 sterility) are poorly understood as compared with those of F1 hybrid sterility. Previously, we characterized three unlinked epistatic loci, hybrid sterility-a1 (hsa1), hsa2, and hsa3, responsible for the F2 sterility in a cross between Oryza sativa ssp. indica and japonica. In this study, we identified that the hsa1 locus contains two interacting genes, HSA1a and HSA1b, within a 30-kb region. HSA1a-j (japonica allele) encodes a highly conserved plant-specific domain of unknown function protein (DUF1618), whereas the indica allele (HSA1a-i(s)) has two deletion mutations that cause disruption of domain structure. The second gene, HSA1b-i(s), encodes an uncharacterized protein with some similarity to a nucleotide-binding protein. Homozygous introgression of indica HSA1a-i(s)-HSA1b-i(s) alleles into japonica showed female gamete abortion at an early mitotic stage. The fact that the recombinant haplotype HSA1a-j-HSA1b-i(s) caused semi-sterility in the heterozygous state with the HSA1a-i(s)-HSA1b-i(s) haplotype suggests that variation in the hsa1 locus is a possible cause of the wide-spectrum sterility barriers seen in F1 hybrids and successive generations in rice. We propose a simple genetic model to explain how a single causal mechanism can drive both F1 and F2 hybrid sterility. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  6. Second-site mutation in the Wiskott-Aldrich syndrome (WAS) protein gene causes somatic mosaicism in two WAS siblings

    Science.gov (United States)

    Wada, Taizo; Konno, Akihiro; Schurman, Shepherd H.; Garabedian, Elizabeth K.; Anderson, Stacie M.; Kirby, Martha; Nelson, David L.; Candotti, Fabio

    2003-01-01

    Revertant mosaicism due to true back mutations or second-site mutations has been identified in several inherited disorders. The occurrence of revertants is considered rare, and the underlying genetic mechanisms remain mostly unknown. Here we describe somatic mosaicism in two brothers affected with Wiskott-Aldrich syndrome (WAS). The original mutation causing disease in this family is a single base insertion (1305insG) in the WAS protein (WASP) gene, which results in frameshift and abrogates protein expression. Both patients, however, showed expression of WASP in a fraction of their T cells that were demonstrated to carry a second-site mutation causing the deletion of 19 nucleotides from nucleotide 1299 to 1316. This deletion abrogated the effects of the original mutation and restored the WASP reading frame. In vitro expression studies indicated that mutant protein encoded by the second-site mutation was expressed and functional, since it was able to bind to cellular partners and mediate T cell receptor/CD3 downregulation. These observations were consistent with evidence of in vivo selective advantage of WASP-expressing lymphocytes. Molecular analysis revealed that the sequence surrounding the deletion contained two 4-bp direct repeats and that a hairpin structure could be formed by five GC pairs within the deleted fragment. These findings strongly suggest that slipped mispairing was the cause of this second-site mutation and that selective accumulation of WASP-expressing T lymphocytes led to revertant mosaicism in these patients. PMID:12727931

  7. PREVALENCE OF POLYMORPHISM OF THE TLR 9 TYPE GENE IN PATIENTS WITH INFECTIOUS MONONUCLEOSIS CAUSED BY EPSTEIN-BARR VIRUS

    Directory of Open Access Journals (Sweden)

    Popov M.M.

    2017-10-01

    Full Text Available Introduction. The prevalence of polymorphism -1486 T/C of TLR-9 gene in 52 patients with infectious mononucleosis (IM caused by the Epstein-Barr virus was studied. Based on the results obtained, three main genotypes -1486 T/C of the gene TLR-9-TT, TC, CC, were identified. The study of the frequency of occurrence of individual genotypes in patients with IV revealed dominance of CC and TT genotypes in comparison with the control group. The study of the frequency distribution of the -1486 T/C polymorphism of the TLR-9 gene for different genotypes showed the specificity of the changes for the CC genotype in patients with IM and the absence of such changes for the TT and TC genotypes. Aim of research. To establish the frequency of the polymorphism -1486 T/C of the TLR-9 gene in patients with IM caused by the Epstein-Barr virus. Materials and methods. A study to determine the polymorphism -1486 T/C of the TLR-9 gene was conducted in 52 patients with IM. Among them, women - 31 (59,6%, men - 21 (40,4% at the age of 18 to 34 years. The control group for studying the prevalence of the polymorphism -1486 T/C of the TLR-9 gene was 40 healthy donors. The mean age was 24,2±2,4 years, with a range from 18 to 44 years. To detect DNA VEB using the reverse transcription PCR method with hybridization-fluorescent detection of amplification products, Amplisens (Russia reagent kits were used. The polymorphic region -1486 T/ C, rs187084 of the TLR9 gene was studied by real-time PCR amplification by determining the length of the restriction fragments-PCR using Ncol restriction enzyme and oligonucleotide primers. Results. An analysis of the results of polymorphism -1486 T/C of the TLR-9 gene made it possible to identify three main genotypes - TT, TC, CC. The allotment frequency of the discovered -1486Т/С SNP genotypes of the gene TLR-9 in patients with ІМ was the following: ТТ genotype – 17 % (9 patients, ТС – 46 % (24 patients and СС – 37 % (19

  8. Gene expression profiling: cell cycle deregulation and aneuploidy do not cause breast cancer formation in WAP-SVT/t transgenic animals.

    Science.gov (United States)

    Klein, Andreas; Guhl, Eva; Zollinger, Raphael; Tzeng, Yin-Jeh; Wessel, Ralf; Hummel, Michael; Graessmann, Monika; Graessmann, Adolf

    2005-05-01

    Microarray studies revealed that as a first hit the SV40 T/t antigen causes deregulation of 462 genes in mammary gland cells (ME cells) of WAP-SVT/t transgenic animals. The majority of deregulated genes are cell proliferation specific and Rb-E2F dependent, causing ME cell proliferation and gland hyperplasia but not breast cancer formation. In the breast tumor cells a further 207 genes are differentially expressed, most of them belonging to the cell communication category. In tissue culture breast tumor cells frequently switch off WAP-SVT/t transgene expression and regain the morphology and growth characteristics of normal ME cells, although the tumor-revertant cells are aneuploid and only 114 genes regain the expression level of normal ME cells. The profile of retransformants shows that only 38 deregulated genes are tumor-specific, and that none of them is considered to be a typical breast cancer gene.

  9. Single-nucleotide variations in the genes encoding the mitochondrial Hsp60/Hsp10 chaperone system and their disease-causing potential

    NARCIS (Netherlands)

    Bross, Peter; Li, Zhijie; Hansen, Jakob; Hansen, Jens Jacob; Nielsen, Marit Nyholm; Corydon, Thomas Juhl; Georgopoulos, Costa; Ang, Debbie; Lundemose, Jytte Banner; Niezen-Koning, Klary; Eiberg, Hans; Yang, Huanming; Kolvraa, Steen; Bolund, Lars; Gregersen, Niels

    Molecular chaperones assist protein folding, and variations in their encoding genes may be disease-causing in themselves or influence the phenotypic expression of disease-associated or susceptibility-conferring variations in many different genes. We have screened three candidate patient groups for

  10. A point mutation affecting an SP1 binding site in the promoter of the ferrochelatase gene impairs gene transcription and causes erythropoietic protoporphyria.

    Science.gov (United States)

    Di Pierro, Elena; Cappellini, Maria Domenica; Mazzucchelli, Renata; Moriondo, Valeria; Mologni, Daniela; Zanone Poma, Barbara; Riva, Agostino

    2005-05-01

    Clinical manifestation of erythropoietic protoporphyria (EPP) results from coinheritance of a mutated allele and a wild-type low-expressed allele of the ferrochelatase (FECH) gene. Currently, up to 90 different mutations affecting the coding region or splicing junctions of the FECH gene have been identified. Despite the high molecular heterogeneity, no functional mutations have been previously reported in the promoter region. The weaker allele expression has been controversially associated to the presence of different intragenic polymorphisms. We applied a two-step screening strategy using denaturing gradient gel electrophoresis followed by direct sequencing in order to rapidly identify FECH gene mutations in Italian EPP patients. We identified two unrelated subjects showing a normal FECH coding region but a single G>C base substitution at position -250 in the FECH promoter and the -251G, IVS1-23T, and IVS3-48C polymorphisms in trans to the substitution. To investigate the effect of the -250G>C mutation on protein binding to the FECH promoter, we conducted electro mobility shift assay (EMSA) and supershift analysis. To determine its effect on the transcriptional activity, K562 and Jurkat cell lines were transiently transfected. EMSA showed that the -250G>C mutation results in the loss of an SP1 binding site, and transient transfection assays demonstrated that such mutation strongly impairs promoter activity. Moreover, we showed that the -251A>G polymorphism, although unable to affect SP1 binding, displays a significant reduction in the transcriptional activity of the promoter. This is the first report of a mutation in the FECH promoter affecting binding of a transcription factor and causing EPP phenotype.

  11. Diarrheagenic Escherichia coli carrying supplementary virulence genes are an important cause of moderate to severe diarrhoeal disease in Mexico.

    Directory of Open Access Journals (Sweden)

    Sandra Patzi-Vargas

    2015-03-01

    Full Text Available Diarrheagenic Escherichia coli (DEC cause acute and persistent diarrhoea worldwide, but little is known about their epidemiology in Mexico. We determined the prevalence of bacterial enteropathogens in 831 children with acute diarrhoea over a four-year period in Yucatan, Mexico. Six DEC supplementary virulence genes (SVG, mainly associated with enteroaggregative E. coli (EAEC, were sought in 3100 E. coli isolates. DEC was the most common bacterial enteropathogen (28%, surpassing Salmonella (12% and Shigella (9%. Predominant DEC groups were diffusely adherent E. coli (DAEC (35%, EAEC (24%, and enteropathogenic E. coli (EPEC (19%. Among children with DEC infections, 14% had severe illness mainly caused by EPEC (26% and DAEC (18%; 30% had moderate diarrhoea mainly caused by DAEC (36%, mixed DEC infections (33% and EAEC (32%. DAEC was most prevalent during spring, while ETEC, EAEC and EPEC predominated in summer. EAEC was more frequent in children 6-24 months old than in those younger than 6 months of age (P = 0.008, OR = 4.2, 95% CI, 1.3-13.9. The presence of SVG dispersin, (aatA, dispersin-translocator (aatA, enteroaggregative heat-stable toxin 1 (astA, plasmid encoded toxin (pet, cytolethal distending toxin (cdt was higher in DEC than non-DEC strains, (36% vs 26%, P <0.0001, OR = 1.5, 95% CI, 1.3-1.8. 98% of EAEC-infected children harboured strains with SVG; 85% carried the aap-aatA gene combination, and 33% of these also carried astA. 28% of both EPEC and ETEC, and 6% of DAEC patients had strains with SVG. 54% of EPEC patients carried pet-positive strains alone or in combination with astA; only this DEC group harboured cdt-positive isolates. All ETEC patients carried astA- or astA-aap-positive strains. astA and aap were the most common SVG in DAEC (3% and 2% and non-DEC strains (21% and 13%. DEC carrying SVG are an important cause of moderate to severe bacterial diarrhoea in Mexican children.

  12. RAB39B gene mutations are not a common cause of Parkinson's disease or dementia with Lewy bodies.

    Science.gov (United States)

    Hodges, Kyndall; Brewer, Sheridan S; Labbé, Catherine; Soto-Ortolaza, Alexandra I; Walton, Ronald L; Strongosky, Audrey J; Uitti, Ryan J; van Gerpen, Jay A; Ertekin-Taner, Nilüfer; Kantarci, Kejal; Lowe, Val J; Parisi, Joseph E; Savica, Rodolfo; Graff-Radford, Jonathan; Jones, David T; Knopman, David S; Petersen, Ronald C; Murray, Melissa E; Graff-Radford, Neill R; Ferman, Tanis J; Dickson, Dennis W; Wszolek, Zbigniew K; Boeve, Bradley F; Ross, Owen A; Lorenzo-Betancor, Oswaldo

    2016-09-01

    Mutations in Ras-related protein Rab-39B (RAB39B) gene have been linked to X-linked early-onset Parkinsonism with intellectual disabilities. The aim of this study was to address the genetic contribution of RAB39B to Parkinson's disease (PD), dementia with Lewy bodies (DLB), and pathologically confirmed Lewy body dementia (pLBD) cases. A cohort of 884 PD, 399 DLB, and 379 pLBD patients were screened for RAB39B mutations, but no coding variants were found, suggesting RAB39B mutations are not a common cause of PD, DLB, or pLBD in Caucasian population. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. A homozygous mutation in the SCO2 gene causes a spinal muscular atrophy like presentation with stridor and respiratory insufficiency.

    Science.gov (United States)

    Pronicki, Maciej; Kowalski, Paweł; Piekutowska-Abramczuk, Dorota; Taybert, Joanna; Karkucinska-Wieckowska, Agnieszka; Szymanska-Debinska, Tamara; Karczmarewicz, Elzbieta; Pajdowska, Magdalena; Migdal, Marek; Milewska-Bobula, Bogumila; Sykut-Cegielska, Jolanta; Popowska, Ewa

    2010-05-01

    Infants with deficiency of cytochrome c oxidase (COX) due to SCO2 mutations observed so far usually demonstrated early cardiomyopathy, encephalopathy and lactic acidosis. Milder spinal muscular atrophy-like (SMA-like) phenotype was also rarely reported. The aim is to present 18 Polish patients with SCO2 mutations. Molecular study revealed p.E140K mutation in all cases (on 32 alleles); p.Q53X mutation and novel p.M177T change were identified in single patients. In three families no second mutation was found. Thirteen p.E140K homozygotes presented in infancy with floppiness and remarkable stridor. Survival motor neuron (SMN) gene deletion was excluded. Mild to moderate lactic academia was found. Neurological involvement manifested as spasticity and psychomotor retardation. In some patients strabismus, ptosis and episodes of seizures were seen. During second half of the year chronic respiratory failure with artificial respiration dependency appeared in all homozygotes. Heart involvement was never present at the beginning. Rapidly progressive hypertrophic cardiomyopathy developed in several patients at the terminal stage. The stridor was constant and striking feature. Skeletal muscle biopsy was performed in 16 patients including 11 homozygotes. Four pathological patterns were discerned - from neurogenic muscle changes, including spinal muscular atrophy (SMA) to unspecific findings. Histochemical cytochrome c oxidase (COX) deficit was not a constant feature. Significant decrease in respiratory chain complex IV activity was detected in muscle homogenate by spectrophotometric method only in 7 out of 12 examined cases. 1/Mutations of SCO2 gene should be considered as a possible cause of neurogenic skeletal muscle features (including SMA-like) in infants with encephalomyopathy even in the absence of heart involvement and COX deficit; 2/Inspiratory stridor may be symptomatic of SCO2 gene mutation(s). Copyright 2009 European Paediatric Neurology Society. Published by Elsevier

  14. Polymorphisms in the TOLLIP Gene Influence Susceptibility to Cutaneous Leishmaniasis Caused by Leishmania guyanensis in the Amazonas State of Brazil.

    Science.gov (United States)

    de Araujo, Felipe Jules; da Silva, Luan Diego Oliveira; Mesquita, Tirza Gabrielle; Pinheiro, Suzana Kanawati; Vital, Wonei de Seixas; Chrusciak-Talhari, Anette; Guerra, Jorge Augusto de Oliveira; Talhari, Sinésio; Ramasawmy, Rajendranath

    2015-01-01

    The clinical outcome to Leishmania-infection is determined by the individual adaptive immune T helper cell responses and their interactions with parasitized host cells. An early development of a proinflammatory immune response (Th1 response) is necessary for Leishmania-infection resolution. The Toll-interacting protein (TOLLIP) regulates human Toll-like receptors signaling pathways by down regulating the proinflammatory cytokines interleukin-6 (IL-6) and tumor necrosis factor alpha (TNF-α) and inducing the ant-inflammatory cytokine interleukin-10 (IL-10). Polymorphisms in the TOLLIP gene are associated with infectious diseases. The polymorphisms rs5743899 and rs3750920 in the TOLLIP gene were genotyped by polymerase chain reaction and restriction fragment length polymorphism (RFLP) analysis in 631 patients with cutaneous leishmaniasis (CL) caused by L. guyanensis and 530 individuals with no history of leishmaniasis. The G and T alleles of the rs5743899 and rs3750920 were more common in patients with CL than in healthy individuals (P = 2.6 x10(-8) ; odds ratio [OR], 1.7 [ 95% confidence interval (CI) 1.4-2.0] and P = 1.9 x10(-8) ; OR, 1.6 [95% CI 1.4-1.9] respectively). The r2 and D' linkage disequilibrium between the two polymorphisms are 0.05 and 0.473 with a confidence bounds of 0.37 to 0.57 respectively. The two polymorphisms are independently associated with an increased risk of developing CL.

  15. Two mutational hotspots in the interleukin-2 receptor {gamma} chain gene causing human X-linked severe combined immunodeficiency

    Energy Technology Data Exchange (ETDEWEB)

    Pepper, A.E.; Puck, J.M. [National Institutes of Health, Bethesda, MD (United States); Buckley, R.H. [and others

    1995-09-01

    Human severe combined immunodeficiency (SCID), a syndrome of profoundly impaired cellular and humoral immunity, is most commonly caused by mutations in the X-linked gene for interleukin-2 (IL-2) receptor {gamma} chain (IL2RG). For mutational analysis of IL2RG in males with SCID, SSCP screening was followed by DNA sequencing. Of 40 IL2RG mutations found in unrelated SCID patients, 6 were point mutations at the CpG dinucleotide at cDNA 690-691, encoding amino acid R226. This residue lies in the extracellular domain of the protein in a region not previously recognized to be significantly conserved in the cytokine receptor gene family, 11 amino acids upstream from the highly conserved WSXWS motif. Three additional instances of mutation at another CpG dinucleotide at cDNA 879 produced a premature termination signal in the intracellular domain of IL2RG, resulting in loss of the SH2-homologous intracellular domain known to be essential for signaling from the IL-2 receptor complex. Mutations at these two hotspots constitute >20% of the X-linked SCID mutations found by our group and a similar proportion of all reported IL2RG mutations. 41 refs., 5 figs., 1 tab.

  16. FGFR3-TACC3 cancer gene fusions cause mitotic defects by removal of endogenous TACC3 from the mitotic spindle.

    Science.gov (United States)

    Sarkar, Sourav; Ryan, Ellis L; Royle, Stephen J

    2017-08-01

    Fibroblast growth factor receptor 3-transforming acidic coiled-coil containing protein 3 (FGFR3-TACC3; FT3) is a gene fusion resulting from rearrangement of chromosome 4 that has been identified in many cancers including those of the urinary bladder. Altered FGFR3 signalling in FT3-positive cells is thought to contribute to cancer progression. However, potential changes in TACC3 function in these cells have not been explored. TACC3 is a mitotic spindle protein required for accurate chromosome segregation. Errors in segregation lead to aneuploidy, which can contribute to cancer progression. Here we show that FT3-positive bladder cancer cells have lower levels of endogenous TACC3 on the mitotic spindle, and that this is sufficient to cause mitotic defects. FT3 is not localized to the mitotic spindle, and by virtue of its TACC domain, recruits endogenous TACC3 away from the spindle. Knockdown of the fusion gene or low-level overexpression of TACC3 partially rescues the chromosome segregation defects in FT3-positive bladder cancer cells. This function of FT3 is specific to TACC3 as inhibition of FGFR3 signalling does not rescue the TACC3 level on the spindle in these cancer cells. Models of FT3-mediated carcinogenesis should, therefore, include altered mitotic functions of TACC3 as well as altered FGFR3 signalling. © 2017 The Authors.

  17. Charcot-Marie-Tooth disease type 2 caused by homozygous MME gene mutation superimposed by chronic inflammatory demyelinating polyneuropathy.

    Science.gov (United States)

    Fujisawa, Miwako; Sano, Yasuteru; Omoto, Masatoshi; Ogasawara, Jyun-Ichi; Koga, Michiaki; Takashima, Hiroshi; Kanda, Takashi

    2017-09-30

    We report a 59-year-old Japanese male who developed gradually worsening weakness and numbness of distal four extremities since age 50. His parents were first cousins, and blood and cerebral spinal examinations were unremarkable. Homozygous mutation of MME gene was detected and thus he was diagnosed as autosomal-recessive Charcot-Marie-Tooth disease 2T (AR-CMT2T); however, electrophysiological examinations revealed scattered demyelinative changes including elongated terminal latency in several peripheral nerve trunks. Sural nerve biopsy showed endoneurial edema and a lot of thinly myelinated nerve fibers with uneven distribution of remnant myelinated fibers within and between fascicles. Immunoglobulin treatment was initiated considering the possibility of superimposed inflammation and demyelination, and immediate clinical as well as electrophysiological improvements were noted. Our findings indicate that AR-CMT2T caused by MME mutation predisposes to a superimposed inflammatory demyelinating neuropathy. This is the first report which documented the co-existence of CMT2 and chronic inflammatory demyelinating polyneuropathy (CIDP); however, in the peripheral nervous system, neprilysin, a product of MME gene, is more abundant in myelin sheath than in axonal component. The fragility of myelin sheath due to mutated neprilysin may trigger the detrimental immune response against peripheral myelin in this patient.

  18. Restriction fragment length polymorphism caused by a deletion involving Alu sequences within the human. alpha. sub 2 -plasmin inhibitor gene

    Energy Technology Data Exchange (ETDEWEB)

    Miura, Osamu; Sugahara, Yuichi; Nakamura, Yuichi; Hirosawa, Shinsaku; Aoki, Nobuo (Tokyo Medical and Dental Univ. (Japan))

    1989-06-13

    A restriction fragment length polymorphism within the human {alpha}{sub 2}-plasmin inhibitor gene has been detected by Southern blot hybridization using an {alpha}{sub 2}-plasmin inhibitor cDNA probe. This restriction fragment length polymorphism can be attributed to the presence of two alleles, A and B, that are distributed in Hardy-Weinberg equilibrium with frequencies of 73.5% and 2.65%, respectively, in 66 unrelated Caucasian individuals or with frequencies of 51.0% and 49.0%, respectively, in 50 unrelated Japanese individuals. The minor allele, B, is due to a deletion of about 720 base pairs in intron 8 of the {alpha}{sub 2}-plasmin inhibitor gene. Sequence analysis of the deletion junction in allele B and the corresponding regions of allele A demonstrated the presence of oppositely oriented Alu sequences at the 5{prime} and 3{prime} deletion boundaries. These data suggest that this restriction fragment length polymorphism was caused by intrastrand recombination between Alu sequences.

  19. Lactobacillus zeae Protects Caenorhabditis elegans from Enterotoxigenic Escherichia coli-Caused Death by Inhibiting Enterotoxin Gene Expression of the Pathogen

    Science.gov (United States)

    Zhou, Mengzhou; Yu, Hai; Yin, Xianhua; Sabour, Parviz M.; Chen, Wei; Gong, Joshua

    2014-01-01

    Background The nematode Caenorhabditis elegans has become increasingly used for screening antimicrobials and probiotics for pathogen control. It also provides a useful tool for studying microbe-host interactions. This study has established a C. elegans life-span assay to preselect probiotic bacteria for controlling K88+ enterotoxigenic Escherichia coli (ETEC), a pathogen causing pig diarrhea, and has determined a potential mechanism underlying the protection provided by Lactobacillus. Methodology/Principal Findings Life-span of C. elegans was used to measure the response of worms to ETEC infection and protection provided by lactic acid-producing bacteria (LAB). Among 13 LAB isolates that varied in their ability to protect C. elegans from death induced by ETEC strain JG280, Lactobacillus zeae LB1 offered the highest level of protection (86%). The treatment with Lactobacillus did not reduce ETEC JG280 colonization in the nematode intestine. Feeding E. coli strain JFF4 (K88+ but lacking enterotoxin genes of estA, estB, and elt) did not cause death of worms. There was a significant increase in gene expression of estA, estB, and elt during ETEC JG280 infection, which was remarkably inhibited by isolate LB1. The clone with either estA or estB expressed in E. coli DH5α was as effective as ETEC JG280 in killing the nematode. However, the elt clone killed only approximately 40% of worms. The killing by the clones could also be prevented by isolate LB1. The same isolate only partially inhibited the gene expression of enterotoxins in both ETEC JG280 and E. coli DH5α in-vitro. Conclusions/Significance The established life-span assay can be used for studies of probiotics to control ETEC (for effective selection and mechanistic studies). Heat-stable enterotoxins appeared to be the main factors responsible for the death of C. elegans. Inhibition of ETEC enterotoxin production, rather than interference of its intestinal colonization, appears to be the mechanism of protection

  20. A Single-Nucleotide Deletion in the Transcription Factor Gene bcsmr1 Causes Sclerotial-Melanogenesis Deficiency in Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Yingjun Zhou

    2017-12-01

    Full Text Available Botrytis cinerea is an important plant pathogenic fungus with a wide range of host. It usually produces black-colored sclerotia (BS due to deposition of 1,8-dihydroxynaphthalene melanin in sclerotial melanogenesis. Our previous study (Zhou et al., 2018 reported six B. cinerea isolates producing orange-colored sclerotia (OS with deficiency in sclerotial melanogenesis. Comparison of ecological fitness (conidia, mycelia, sclerotia, natural distribution, and melanogenesis of selected BS and OS isolates suggests that sclerotia play an important role in the disease cycle caused by B. cinerea. However, the molecular mechanism for formation of the OS B. cinerea remains unknown. This study was done to unravel the molecular mechanism for the sclerotial melanogenesis deficiency in the OS isolates. We found that all the five sclerotial melanogenesis genes (bcpks12, bcygh1, bcbrn1/2, bcscd1 were down-regulated in OS isolates, compared to the genes in the BS isolates. However, the sclerotial melanogenesis-regulatory gene bcsmr1 had similar expression in both types of sclerotia, suggesting the sclerotial melanogenesis deficiency is due to loss-of-function of bcsmr1, rather than lack of expression of bcsmr1. Therefore, we cloned bcsmr1 from OS (bcsmr1OS and BS (bcsmr1BS isolates, and found a single-nucleotide deletion in bcsmr1OS. The single-nucleotide deletion caused formation of a premature stop codon in the open reading frame of bcsmr1OS, resulting in production of a 465-aa truncated protein. The transcription activity of the truncated protein was greatly reduced, compared to that of the 935-aa full-length protein encoded by bcsmr1BS in the BS isolates. The function of bcsmr1OS was partially complemented by bcsmr1BS. This study not only elucidated the molecular mechanism for formation of orange-colored sclerotia by the spontaneous mutant XN-1 of B. cinerea, but also confirmed the regulatory function of bcsmr1 in sclerotial melanogenesis of B. cinerea.

  1. The Ter Mutation In The Dead End Gene Causes Germ Cell Loss And Testicular Germ Cell Tumours

    Energy Technology Data Exchange (ETDEWEB)

    Youngren, Kirsten K.; Coveney, Douglas; Peng, Xiaoning; Bhattacharya, Chitralekha; Schmidt, Laura S.; Nickerson, Michael L.; Lamb, Bruce T.; Deng Jian Min; Behringer, Richard R.; Capel, Blanche; Rubin, Edward M.; Nadeau, Joseph H.; Matin, Angabin

    2005-01-01

    In mice, the Ter mutation causes primordial germ cell (PGC) loss in all genetic backgrounds1. Ter is also a potent modifier of spontaneous testicular germ cell tumour (TGCT) susceptibility in the 129 family of inbred strains, and markedly increases TGCT incidence in 129-Ter/Ter males2 4. In 129-Ter/Ter mice, some of the remaining PGCs transform into undifferentiated pluripotent embryonal carcinoma cells2 6, and after birth differentiate into various cells and tissues that compose TGCTs. Here, we report the positional cloning of Ter, revealing a point mutation that introduces a termination codon in the mouse orthologue (Dnd1) of the zebrafish dead end (dnd) gene. PGC deficiency is corrected both with bacterial artificial chromosomes that contain Dnd1 and with a Dnd1-encoding transgene. Dnd1 is expressed in fetal gonads during the critical period when TGCTs originate. DND1 has an RNA recognition motif and is most similar to the apobec complementation factor, a component of the cytidine t o uridine RNA-editing complex. These results suggest that Ter may adversely affect essential aspects of RNA biology during PGC development. DND1 is the first protein known to have an RNA recognition motif directly implicated as a heritable cause of spontaneous tumorigenesis. TGCT development in the 129-Ter mouse strain models paediatric TGCT in humans. This work will have important implications for our understanding of the genetic control of TGCT pathogenesis and PGC biology.

  2. A splice site mutation in the PAX6 gene which induces exon skipping causes autosomal dominant inherited aniridia

    Science.gov (United States)

    Wissinger, Bernd; Gramer, Eugen

    2012-01-01

    Purpose To identify the underlying genetic cause in a two generation German family diagnosed with isolated aniridia. Methods All patients underwent full ophthalmic examination. Mutation screening of the paired box gene 6 (PAX6) was performed by bidirectional Sanger sequencing. A minigene assay was applied to analyze transcript processing of mutant and wildtype PAX6 variants in HEK293 cells. Results We identified a PAX6 sequence variant at the splice donor site (+5) of intron 12. This variant has been described before in another family with aniridia but has not been characterized at the transcript level. We could demonstrate that the mutant allele causes the skipping of exon 12 during transcript processing. The mutation is predicted to result in a ‘run on’ translation past the normal translational stop codon. Conclusions A splice site mutation resulting in exon skipping was found in a family with autosomal dominant aniridia. The mutation is predicted to result in an enlarged protein with an extra COOH-terminal domain. This very likely affects the transactivation properties of the PAX6 protein. PMID:22509105

  3. Myelination Delay and Allan-Herndon-Dudley Syndrome Caused by a Novel Mutation in the SLC16A2 Gene.

    Science.gov (United States)

    La Piana, Roberta; Vanasse, Michel; Brais, Bernard; Bernard, Genevieve

    2015-09-01

    Allan-Herndon-Dudley syndrome is an X-linked disease caused by mutations in the solute carrier family 16 member 2 (SLC16A2) gene. As SLC16A2 encodes the monocarboxylate transporter 8 (MCT8), a thyroid hormone transporter, patients with Allan-Herndon-Dudley syndrome present a specific altered thyroid hormone profile. Allan-Herndon-Dudley syndrome has been associated with myelination delay on the brain magnetic resonance imaging (MRI) of affected subjects. We report a patient with Allan-Herndon-Dudley syndrome characterized by developmental delay, hypotonia, and delayed myelination caused by a novel SLC16A2 mutation (p.L291R). The thyroid hormones profile in our patient was atypical for Allan-Herndon-Dudley syndrome. The follow-up examinations showed that the progression of the myelination was not accompanied by a clinical improvement. Our paper suggests that SLC16A2 mutations should be investigated in patients with myelination delay even when the thyroid function is not conclusively altered. © The Author(s) 2014.

  4. Postretinal Structure and Function in Severe Congenital Photoreceptor Blindness Caused by Mutations in the GUCY2D Gene

    Science.gov (United States)

    Aguirre, Geoffrey K.; Butt, Omar H.; Datta, Ritobrato; Roman, Alejandro J.; Sumaroka, Alexander; Schwartz, Sharon B.; Cideciyan, Artur V.; Jacobson, Samuel G.

    2017-01-01

    Purpose To examine how severe congenital blindness resulting from mutations of the GUCY2D gene alters brain structure and function, and to relate these findings to the notable preservation of retinal architecture in this form of Leber congenital amaurosis (LCA). Methods Six GUCY2D-LCA patients (ages 20–46) were studied with optical coherence tomography of the retina and multimodal magnetic resonance imaging (MRI) of the brain. Measurements from this group were compared to those obtained from populations of normally sighted controls and people with congenital blindness of a variety of causes. Results Patients with GUCY2D-LCA had preservation of the photoreceptors, ganglion cells, and nerve fiber layer. Despite this, visual function in these patients ranged from 20/160 acuity to no light perception, and functional MRI responses to light stimulation were attenuated and restricted. This severe visual impairment was reflected in substantial thickening of the gray matter layer of area V1, accompanied by an alteration of resting-state correlations within the occipital lobe, similar to a comparison group of congenitally blind people with structural damage to the retina. In contrast to the comparison blind population, however, the GUCY2D-LCA group had preservation of the size of the optic chiasm, and the fractional anisotropy of the optic radiations as measured with diffusion tensor imaging was also normal. Conclusions These results identify dissociable effects of blindness upon the visual pathway. Further, the relatively intact postgeniculate white matter pathway in GUCY2D-LCA is encouraging for the prospect of recovery of visual function with gene augmentation therapy. PMID:28403437

  5. Postretinal Structure and Function in Severe Congenital Photoreceptor Blindness Caused by Mutations in the GUCY2D Gene.

    Science.gov (United States)

    Aguirre, Geoffrey K; Butt, Omar H; Datta, Ritobrato; Roman, Alejandro J; Sumaroka, Alexander; Schwartz, Sharon B; Cideciyan, Artur V; Jacobson, Samuel G

    2017-02-01

    To examine how severe congenital blindness resulting from mutations of the GUCY2D gene alters brain structure and function, and to relate these findings to the notable preservation of retinal architecture in this form of Leber congenital amaurosis (LCA). Six GUCY2D-LCA patients (ages 20-46) were studied with optical coherence tomography of the retina and multimodal magnetic resonance imaging (MRI) of the brain. Measurements from this group were compared to those obtained from populations of normally sighted controls and people with congenital blindness of a variety of causes. Patients with GUCY2D-LCA had preservation of the photoreceptors, ganglion cells, and nerve fiber layer. Despite this, visual function in these patients ranged from 20/160 acuity to no light perception, and functional MRI responses to light stimulation were attenuated and restricted. This severe visual impairment was reflected in substantial thickening of the gray matter layer of area V1, accompanied by an alteration of resting-state correlations within the occipital lobe, similar to a comparison group of congenitally blind people with structural damage to the retina. In contrast to the comparison blind population, however, the GUCY2D-LCA group had preservation of the size of the optic chiasm, and the fractional anisotropy of the optic radiations as measured with diffusion tensor imaging was also normal. These results identify dissociable effects of blindness upon the visual pathway. Further, the relatively intact postgeniculate white matter pathway in GUCY2D-LCA is encouraging for the prospect of recovery of visual function with gene augmentation therapy.

  6. Experimental heart failure causes depression-like behavior together with differential regulation of inflammatory and structural genes in the brain

    Directory of Open Access Journals (Sweden)

    Anna eFrey

    2014-10-01

    Full Text Available Background-Depression and anxiety are common and independent outcome predictors in patients with chronic heart failure (CHF. However, it is unclear whether CHF causes depression. Thus, we investigated whether mice develop anxiety- and depression-like behavior after induction of ischemic CHF by myocardial infarction (MI.Methods and Results- In order to assess depression-like behavior, anhedonia was investigated by repeatedly testing sucrose preference for 8 weeks after coronary artery ligation or sham operation. Mice with large MI and increased left ventricular dimensions on echocardiography (termed CHF mice showed reduced preference for sucrose, indicating depression-like behavior. 6 weeks after MI, mice were tested for exploratory activity, anxiety-like behavior and cognitive function using the elevated plus maze (EPM, light-dark box (LDB, open field (OF and object recognition (OR tests. In the EPM and OF, CHF mice exhibited diminished exploratory behavior and motivation despite similar movement capability. In the OR, CHF mice had reduced preference for novelty and impaired short-term memory. On histology, CHF mice had unaltered overall cerebral morphology. However, analysis of gene expression by RNA-sequencing in prefrontal cortical, hippocampal, and left ventricular tissue revealed changes in genes related to inflammation and cofactors of neuronal signal transduction in CHF mice, with Nr4a1 being dysregulated both in prefrontal cortex and myocardium after MI. Conclusions-After induction of ischemic CHF, mice exhibited anhedonic behavior, decreased exploratory activity and interest in novelty, and cognitive impairment. Thus, ischemic CHF leads to distinct behavioral changes in mice analogous to symptoms observed in humans with CHF and comorbid depression.

  7. Identification of Two Disease-causing Genes TJP2 and GJB2 in a Chinese Family with Unconditional Autosomal Dominant Nonsyndromic Hereditary Hearing Impairment

    Directory of Open Access Journals (Sweden)

    Hong-Yang Wang

    2015-01-01

    Full Text Available Background: There are more than 300 genetic loci that have been found to be related to hereditary hearing impairment (HHI, including 92 causative genes for nonsyndromic hearing loss, among which 34 genes are related to autosomal dominant nonsyndromic HHI (ADNSHHI. Traditional linkage analysis and candidate gene sequencing are not effective at detecting the ADNSHHI, especially for the unconditional families that may have more than one pathogenic cause. This study identified two disease-causing genes TJP2 and GJB2 in a Chinese family with unconditional ADNSHHI. Methods: To decipher the genetic code of a Chinese family (family 686 with ADNSHHI, different gene screening techniques have been performed, including linkage analysis, candidate genes screening, high-throughput sequencing and Sanger sequencing. These techniques were done on samples obtained from this family over a period of 10 years. Results: We identified a pathogenic missense mutation, c. 2081G>A (p.G694E, in TJP2, a gene that plays a crucial role in apoptosis and age-related hearing loss (ARHL. The mutation was co-segregated in this pedigree in all, but not in the two patients who presented with different phenotypes from the other affected family members. In one of the two patients, we confirmed that the compound heterozygosity for p.Y136FNx01 and p.G45E in the GJB2 gene may account for the phenotype shown in this patient. Conclusions: We identified the co-occurrence of two genetic causes in family 686. The possible disease-causing missense mutation of TJP2 in family 686 presents an opportunity for further investigation into ARHL. It is necessary to combine various genes screening methods, especially for some unconventional cases.

  8. Mutation Spectrum of Common Deafness-Causing Genes in Patients with Non-Syndromic Deafness in the Xiamen Area, China.

    Directory of Open Access Journals (Sweden)

    Yi Jiang

    Full Text Available In China, approximately 30,000 babies are born with hearing impairment each year. However, the molecular factors causing congenital hearing impairment in the Xiamen area of Fujian province have not been evaluated. To provide accurate genetic testing and counseling in the Xiamen area, we investigated the molecular etiology of non-syndromic deafness in a deaf population from Xiamen. Unrelated students with hearing impairment (n = 155 who attended Xiamen Special Education School in Fujian Province were recruited for this study. Three common deafness-related genes, GJB2, SLC26A4, and mtDNA12SrRNA, were analyzed using all-exon sequencing. GJB2 mutations were detected in 27.1% (42/155 of the entire cohort. The non-syndromic hearing loss (NSHL hotspot mutations c.109G>A (p.V37I and c.235delC were found in this population, whereas the Caucasian hotspot mutation c.35delG was not. The allelic frequency of the c.109G>A mutation was 9.03% (28/310, slightly higher than that of c.235delC (8.39%, 26/310, which is the most common GJB2 mutation in most areas of China. The allelic frequency of the c.109G>A mutation was significantly higher in this Xiamen's deaf population than that in previously reported cohorts (P = 0.00. The SLC26A4 mutations were found in 16.77% (26/155 of this cohort. The most common pathogenic allele was c.IVS7-2A>G (6.13%, 19/310, and the second most common was the c.1079C>T (p.A360V mutation (1.94%, 6/310 which has rarely been reported as a hotspot mutation in other studies. The mutation rate of mtDNA12SrRNA in this group was 3.87% (6/155, all being the m.A1555G mutation. These findings show the specificity of the common deaf gene-mutation spectrum in this area. According to this study, there were specific hotspot mutations in Xiamen deaf patients. Comprehensive sequencing analysis of the three common deaf genes can help portray the mutation spectrum and develop optimal testing strategies for deaf patients in this area.

  9. Molecular evolution of the human SRPX2 gene that causes brain disorders of the Rolandic and Sylvian speech areas

    Directory of Open Access Journals (Sweden)

    Levasseur Anthony

    2007-10-01

    Full Text Available Abstract Background The X-linked SRPX2 gene encodes a Sushi Repeat-containing Protein of unknown function and is mutated in two disorders of the Rolandic/Sylvian speech areas. Since it is linked to defects in the functioning and the development of brain areas for speech production, SRPX2 may thus have participated in the adaptive organization of such brain regions. To address this issue, we have examined the recent molecular evolution of the SRPX2 gene. Results The complete coding region was sequenced in 24 human X chromosomes from worldwide populations and in six representative nonhuman primate species. One single, fixed amino acid change (R75K has been specifically incorporated in human SRPX2 since the human-chimpanzee split. The R75K substitution occurred in the first sushi domain of SRPX2, only three amino acid residues away from a previously reported disease-causing mutation (Y72S. Three-dimensional structural modeling of the first sushi domain revealed that Y72 and K75 are both situated in the hypervariable loop that is usually implicated in protein-protein interactions. The side-chain of residue 75 is exposed, and is located within an unusual and SRPX-specific protruding extension to the hypervariable loop. The analysis of non-synonymous/synonymous substitution rate (Ka/Ks ratio in primates was performed in order to test for positive selection during recent evolution. Using the branch models, the Ka/Ks ratio for the human branch was significantly different (p = 0.027 from that of the other branches. In contrast, the branch-site tests did not reach significance. Genetic analysis was also performed by sequencing 9,908 kilobases (kb of intronic SRPX2 sequences. Despite low nucleotide diversity, neither the HKA (Hudson-Kreitman-Aguadé test nor the Tajima's D test reached significance. Conclusion The R75K human-specific variation occurred in an important functional loop of the first sushi domain of SRPX2, indicating that this evolutionary

  10. Targeted disruption of the PME-1 gene causes loss of demethylated PP2A and perinatal lethality in mice.

    Directory of Open Access Journals (Sweden)

    Silvia Ortega-Gutiérrez

    2008-07-01

    Full Text Available Phosphoprotein phosphatase 2A (PP2A, a major serine-threonine protein phosphatase in eukaryotes, is an oligomeric protein comprised of structural (A and catalytic (C subunits to which a variable regulatory subunit (B can associate. The C subunit contains a methyl ester post-translational modification on its C-terminal leucine residue, which is removed by a specific methylesterase (PME-1. Methylesterification is thought to control the binding of different B subunits to AC dimers, but little is known about its physiological significance in vivo.Here, we show that targeted disruption of the PME-1 gene causes perinatal lethality in mice, a phenotype that correlates with a virtually complete loss of the demethylated form of PP2A in the nervous system and peripheral tissues. Interestingly, PP2A catalytic activity over a peptide substrate was dramatically reduced in PME-1(-/- tissues, which also displayed alterations in phosphoproteome content.These findings suggest a role for the demethylated form of PP2A in maintenance of enzyme function and phosphorylation networks in vivo.

  11. Isolation and characterization of a floral homeotic gene in Fraxinus nigra causing earlier flowering and homeotic alterations in transgenic Arabidopsis

    Science.gov (United States)

    Jun Hyung Lee; Paula M. Pijut

    2017-01-01

    Reproductive sterility, which can be obtained by manipulating floral organ identity genes, is an important tool for gene containment of genetically engineered trees. In Arabidopsis, AGAMOUS (AG) is the only C-class gene responsible for both floral meristem determinacy and floral organ identity, and its mutations produce...

  12. Mutations in ZMYND10, a gene essential for proper axonemal assembly of inner and outer dynein arms in humans and flies, cause primary ciliary dyskinesia

    DEFF Research Database (Denmark)

    Moore, Daniel J; Onoufriadis, Alexandros; Shoemark, Amelia

    2013-01-01

    Primary ciliary dyskinesia (PCD) is a ciliopathy characterized by airway disease, infertility, and laterality defects, often caused by dual loss of the inner dynein arms (IDAs) and outer dynein arms (ODAs), which power cilia and flagella beating. Using whole-exome and candidate-gene Sanger...... neurons and sperm. In these cells, P-element-mediated gene silencing caused IDA and ODA defects, proprioception deficits, and sterility due to immotile sperm. Drosophila Zmynd10 with an equivalent c.47T>G (p.Val16Gly) missense change rescued mutant male sterility less than the wild-type did. Tagged...

  13. Autosomal dominant familial neurohypophyseal diabetes insipidus caused by a mutation in the arginine-vasopressin II gene in four generations of a Korean family.

    Science.gov (United States)

    Kim, Myo-Jing; Kim, Young-Eun; Ki, Chang-Seok; Yoo, Jae-Ho

    2014-12-01

    Autosomal dominant neurohypophyseal diabetes insipidus is a rare form of central diabetes insipidus that is caused by mutations in the vasopressin-neurophysin II (AVP-NPII) gene. It is characterized by persistent polydipsia and polyuria induced by deficient or absent secretion of arginine vasopressin (AVP). Here we report a case of familial neurohypophyseal diabetes insipidus in four generations of a Korean family, caused by heterozygous missense mutation in exon 2 of the AVP-NPII gene (c.286G>T). This is the first report of such a case in Korea.

  14. Associations of Biochemical Changes and Maternal Traits with Mutation 1843 (C>T) in the RYR1 Gene as a Common Cause for Porcine Stress Syndrome

    OpenAIRE

    Popovski, ZT; Tanaskovska, B; Miskoska-Milevska, E; Andonov, S; Domazetovska, S

    2016-01-01

    Abstract Stress syndrome is usually caused by a mutation in the ryanodine receptor gene (ryr1) and it is widely studied in humans and swine populations. The protein product of this gene plays a crucial role in the regulation of calcium transport in muscle cells. A G>T mutation in the human ryr1 gene, which results in the replacement of a conserved arginine at position 614 where a leucine occurs at the same position as the previously identified Arg?Cys mutation reported in all cases of porcine...

  15. A novel point mutation within the EDA gene causes an exon dropping in mature RNA in Holstein Friesian cattle breed affected by X-linked anhidrotic ectodermal dysplasia

    Directory of Open Access Journals (Sweden)

    Pariset Lorraine

    2011-07-01

    Full Text Available Abstract Background X-linked anhidrotic ectodermal dysplasia is a disorder characterized by abnormal development of tissues and organs of ectodermal origin caused by mutations in the EDA gene. The bovine EDA gene encodes the ectodysplasin A, a membrane protein expressed in keratinocytes, hair follicles and sweat glands, which is involved in the interactions between cell and cell and/or cell and matrix. Four mutations causing ectodermal dysplasia in cattle have been described so far. Results We identified a new single nucleotide polymorphism (SNP at the 9th base of exon 8 in the EDA gene in two calves of Holstein Friesian cattle breed affected by ectodermal dysplasia. This SNP is located in the exonic splicing enhancer (ESEs recognized by SRp40 protein. As a consequence, the spliceosome machinery is no longer able to recognize the sequence as exonic and causes exon skipping. The mutation determines the deletion of the entire exon (131 bp in the RNA processing, causing a severe alteration of the protein structure and thus the disease. Conclusion We identified a mutation, never described before, that changes the regulation of alternative splicing in the EDA gene and causes ectodermal dysplasia in cattle. The analysis of the SNP allows the identification of carriers that can transmit the disease to the offspring. This mutation can thus be exploited for a rational and efficient selection of unequivocally healthy cows for breeding.

  16. Pol II-expressed shRNA knocks down Sod2 gene expression and causes phenotypes of the gene knockout in mice.

    Directory of Open Access Journals (Sweden)

    Xu-Gang Xia

    2006-01-01

    Full Text Available RNA interference (RNAi has been used increasingly for reverse genetics in invertebrates and mammalian cells, and has the potential to become an alternative to gene knockout technology in mammals. Thus far, only RNA polymerase III (Pol III-expressed short hairpin RNA (shRNA has been used to make shRNA-expressing transgenic mice. However, widespread knockdown and induction of phenotypes of gene knockout in postnatal mice have not been demonstrated. Previous studies have shown that Pol II synthesizes micro RNAs (miRNAs-the endogenous shRNAs that carry out gene silencing function. To achieve efficient gene knockdown in mammals and to generate phenotypes of gene knockout, we designed a construct in which a Pol II (ubiquitin C promoter drove the expression of an shRNA with a structure that mimics human miRNA miR-30a. Two transgenic lines showed widespread and sustained shRNA expression, and efficient knockdown of the target gene Sod2. These mice were viable but with phenotypes of SOD2 deficiency. Bigenic heterozygous mice generated by crossing these two lines showed nearly undetectable target gene expression and phenotypes consistent with the target gene knockout, including slow growth, fatty liver, dilated cardiomyopathy, and premature death. This approach opens the door of RNAi to a wide array of well-established Pol II transgenic strategies and offers a technically simpler, cheaper, and quicker alternative to gene knockout by homologous recombination for reverse genetics in mice and other mammalian species.

  17. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes.

    Science.gov (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R

    2007-01-01

    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  18. Factor-induced Reprogramming and Zinc Finger Nuclease-aided Gene Targeting Cause Different Genome Instability in β-Thalassemia Induced Pluripotent Stem Cells (iPSCs)*

    Science.gov (United States)

    Ma, Ning; Shan, Yongli; Liao, Baojian; Kong, Guanyi; Wang, Cheng; Huang, Ke; Zhang, Hui; Cai, Xiujuan; Chen, Shubin; Pei, Duanqing; Chen, Nansheng; Pan, Guangjin

    2015-01-01

    The generation of personalized induced pluripotent stem cells (iPSCs) followed by targeted genome editing provides an opportunity for developing customized effective cellular therapies for genetic disorders. However, it is critical to ascertain whether edited iPSCs harbor unfavorable genomic variations before their clinical application. To examine the mutation status of the edited iPSC genome and trace the origin of possible mutations at different steps, we have generated virus-free iPSCs from amniotic cells carrying homozygous point mutations in β-hemoglobin gene (HBB) that cause severe β-thalassemia (β-Thal), corrected the mutations in both HBB alleles by zinc finger nuclease-aided gene targeting, and obtained the final HBB gene-corrected iPSCs by excising the exogenous drug resistance gene with Cre recombinase. Through comparative genomic hybridization and whole-exome sequencing, we uncovered seven copy number variations, five small insertions/deletions, and 64 single nucleotide variations (SNVs) in β-Thal iPSCs before the gene targeting step and found a single small copy number variation, 19 insertions/deletions, and 340 single nucleotide variations in the final gene-corrected β-Thal iPSCs. Our data revealed that substantial but different genomic variations occurred at factor-induced somatic cell reprogramming and zinc finger nuclease-aided gene targeting steps, suggesting that stringent genomic monitoring and selection are needed both at the time of iPSC derivation and after gene targeting. PMID:25795783

  19. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    NARCIS (Netherlands)

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA

  20. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance.

    Science.gov (United States)

    Gaby, John Christian; Buckley, Daniel H

    2017-10-01

    The measurement of functional gene abundance in diverse microbial communities often employs quantitative PCR (qPCR) with highly degenerate oligonucleotide primers. While degenerate PCR primers have been demonstrated to cause template-specific bias in PCR applications, the effect of such bias on qPCR has been less well explored. We used a set of diverse, full-length nifH gene standards to test the performance of several universal nifH primer sets in qPCR. We found significant template-specific bias in all but the PolF/PolR primer set. Template-specific bias caused more than 1000-fold mis-estimation of nifH gene copy number for three of the primer sets and one primer set resulted in more than 10,000-fold mis-estimation. Furthermore, such template-specific bias will cause qPCR estimates to vary in response to beta-diversity, thereby causing mis-estimation of changes in gene copy number. A reduction in bias was achieved by increasing the primer concentration. We conclude that degenerate primers should be evaluated across a range of templates, annealing temperatures, and primer concentrations to evaluate the potential for template-specific bias prior to their use in qPCR.

  1. Recurrent and founder mutations in the Netherlands : cardiac Troponin I (TNNI3) gene mutations as a cause of severe forms of hypertrophic and restrictive cardiomyopathy

    NARCIS (Netherlands)

    van den Wijngaard, A.; Volders, P.; Van Tintelen, J. P.; Jongbloed, J. D. H.; van den Berg, M. P.; Deprez, R. H. Lekanne; Mannens, M. M. A. M.; Hofmann, N.; Slegtenhorst, M.; Dooijes, D.; Michels, M.; Arens, Y.; Jongbloed, R.; Smeets, B. J. M.

    Background About 2-7% of familial cardiomyopathy cases are caused by a mutation in the gene encoding cardiac troponin 1 (TNNI3). The related clinical phenotype is usually severe with early onset. Here we report on all currently known mutations in the Dutch population and compared these with those

  2. Subinhibitory concentrations of antibiotics affect stress and virulence gene expression in Listeria monocytogenes and cause enhanced stress sensitivity but do not affect Caco‐2 cell invasion

    DEFF Research Database (Denmark)

    Knudsen, Gitte Maegaard; Holch, Anne; Gram, Lone

    2012-01-01

    with promoter fusions, 14 of 16 antibiotics induced or repressed expression of one or more stress and/or virulence genes. Despite ampicillin‐induced up‐regulation of PinlA‐lacZ expression, Caco‐2 cell invasion was not affected. Subinhibitory concentrations of ampicillin and tetracycline caused up‐ and down...

  3. Recurrent and founder mutations in the Netherlands: cardiac Troponin I (TNNI3) gene mutations as a cause of severe forms of hypertrophic and restrictive cardiomyopathy

    NARCIS (Netherlands)

    van den Wijngaard, A.; Volders, P.; van Tintelen, J. P.; Jongbloed, J. D. H.; van den Berg, M. P.; Lekanne Deprez, R. H.; Mannens, M. M. A. M.; Hofmann, N.; Slegtenhorst, M.; Dooijes, D.; Michels, M.; Arens, Y.; Jongbloed, R.; Smeets, B. J. M.

    2011-01-01

    Background About 2-7% of familial cardiomyopathy cases are caused by a mutation in the gene encoding cardiac troponin 1 (TNNI3). The related clinical phenotype is usually severe with early onset. Here we report on all currently known mutations in the Dutch population and compared these with those

  4. Flavonoids induce Rhizobium leguminosarum to produce nodDABC gene-related factors that cause thick, short roots and root hair responses on common vetch

    NARCIS (Netherlands)

    Zaat, S. A.; van Brussel, A. A.; Tak, T.; Pees, E.; Lugtenberg, B. J.

    1987-01-01

    Rhizobium leguminosarum produced a factor(s) that caused thick, short roots (Tsr phenotype) as well as root hair induction (Hai phenotype) and deformation (Had phenotype) in Vicia sativa plants upon incubation with root exudate or with one of the nod gene inducers naringenin or apigenin; this was a

  5. Hypomethylation of the H19 gene causes not only Silver-Russell syndrome (SRS) but also isolated asymmetry or an SRS-like phenotype.

    NARCIS (Netherlands)

    Bliek, J.; Terhal, P.; Bogaard, M.J. van den; Maas, S.; Hamel, B.C.J.; Salieb-Beugelaar, G.; Simon, M.; Letteboer, T.; Smagt, J. van der; Kroes, H.Y.; Mannens, M.

    2006-01-01

    The H19 differentially methylated region (DMR) controls the allele-specific expression of both the imprinted H19 tumor-suppressor gene and the IGF2 growth factor. Hypermethylation of this DMR--and subsequently of the H19 promoter region--is a major cause of the clinical features of gigantism and/or

  6. Repression of c-Myc responsive genes in cycling cells causes G1 arrest through reduction of cyclin E/CDK2 kinase activity

    NARCIS (Netherlands)

    Berns, K.; Hijmans, E.M.; Bernards, R.A.

    1997-01-01

    The c-myc gene encodes a sequence-specific DNA binding protein involved in proliferation and oncogenesis. Activation of c-myc expression in quiescent cells is sufficient to mediate cell cycle entry, whereas inhibition of c-myc expression causes cycling cells to withdraw from the cell cycle. To

  7. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene.

    Science.gov (United States)

    Toustrup, Lise Bols; Zhou, Yan; Kvistgaard, Helene; Gregersen, Niels; Rittig, Søren; Aagaard, Lars; Corydon, Thomas Juhl; Luo, Yonglun; Christensen, Jane H

    2017-03-01

    Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI) is caused by variants in the arginine vasopressin (AVP) gene. Here we report the generation of induced pluripotent stem cells (iPSCs) from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using lentivirus-mediated nuclear reprogramming. The iPSCs carried the expected variant in the AVP gene. Furthermore, the iPSCs expressed pluripotency markers; displayed in vitro differentiation potential to the three germ layers and had a normal karyotype consistent with the original fibroblasts. This iPSC line is useful in future studies focusing on the pathogenesis of adFNDI. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  8. Induced pluripotent stem cells derived from a patient with autosomal dominant familial neurohypophyseal diabetes insipidus caused by a variant in the AVP gene

    Directory of Open Access Journals (Sweden)

    Lise Bols Toustrup

    2017-03-01

    Full Text Available Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI is caused by variants in the arginine vasopressin (AVP gene. Here we report the generation of induced pluripotent stem cells (iPSCs from a 42-year-old man carrying an adFNDI causing variant in exon 1 of the AVP gene using lentivirus-mediated nuclear reprogramming. The iPSCs carried the expected variant in the AVP gene. Furthermore, the iPSCs expressed pluripotency markers; displayed in vitro differentiation potential to the three germ layers and had a normal karyotype consistent with the original fibroblasts. This iPSC line is useful in future studies focusing on the pathogenesis of adFNDI.

  9. BESTROPHINOPATHY: A Spectrum of Ocular Abnormalities Caused by the c.614T>C Mutation in the BEST1 Gene

    NARCIS (Netherlands)

    Toto, L.; Boon, C.J.F.; Antonio, L. Di; Parodi, M. Battaglia; Mastropasqua, R.; Antonucci, I.; Stuppia, L.; Mastropasqua, L.

    2016-01-01

    PURPOSE: To describe the variable ocular phenotype associated with a heterozygous mutation in the BEST1 gene. METHODS: Clinical and genetic assessment was performed in five members of the same family. Molecular genetic analysis of the BEST1 gene was performed by direct sequencing. Extensive

  10. Two novel missense mutations in the myelin protein zero gene causes Charcot-Marie-Tooth type 2 and Déjérine-Sottas syndrome

    Directory of Open Access Journals (Sweden)

    Sand Jette C

    2010-04-01

    Full Text Available Abstract Background The Charcot-Marie-Tooth (CMT phenotype caused by mutation in the myelin protein zero (MPZ gene varies considerably, from early onset and severe forms to late onset and milder forms. The mechanism is not well understood. The myelin protein zero (P0 mediates adhesion in the spiral wraps of the Schwann cell's myelin sheath. The crystalline structure of the extracellular domain of the myelin protein zero (P0ex is known, while the transmembrane and intracellular structure is unknown. Findings One novel missense mutation caused a milder late onset CMT type 2, while the second missense mutation caused a severe early onset phenotype compatible with Déjérine-Sottas syndrome. Conclusions The phenotypic variation caused by different missense mutations in the MPZ gene is likely caused by different conformational changes of the MPZ protein which affects the functional tetramers. Severe changes of the MPZ protein cause dysfunctional tetramers and predominantly uncompacted myelin, i.e. the severe phenotypes congenital hypomyelinating neuropathy and Déjérine-Sottas syndrome, while milder changes cause the phenotypes CMT type 1 and 2.

  11. The Xanthomonas campestris gumD gene required for synthesis of xanthan gum is involved in normal pigmentation and virulence in causing black rot.

    Science.gov (United States)

    Chou, F L; Chou, H C; Lin, Y S; Yang, B Y; Lin, N T; Weng, S F; Tseng, Y H

    1997-04-07

    A cloned 4.1-kb EcoRI fragment from Xanthomonas campestris pv. campestris was previously shown to complement the non-mucoid mutant P22 and increase xanthan gum production after being transformed into the wild-type strain Xc17. The gene responsible for these effects was identified, sequenced, and shown to be the gumD gene which has previously been proposed to encode glucose transferase activity, an enzyme required for adding the first glucose residue to the isoprenoid glycosyl carrier lipid during xanthan synthesis. A gumD mutant, isolated from Xc17 by gene replacement, was shown to possess altered pigment xanthomonadin profiles and exhibit reduced virulence in causing black rot in broccoli. This study appears to be the first to demonstrate that interruption of a gene required for xanthan synthesis can lead to reduced virulence of X. campestris.

  12. Identification of a novel nemaline myopathy-causing mutation in the troponin T1 (TNNT1) gene: a case outside of the old order Amish.

    Science.gov (United States)

    Marra, Jonathan D; Engelstad, Kristin E; Ankala, Arunkanth; Tanji, Kurenai; Dastgir, Jahannaz; De Vivo, Darryl C; Coffee, Bradford; Chiriboga, Claudia A

    2015-05-01

    Nemaline myopathy (NM) is a congenital neuromuscular disorder often characterized by hypotonia, facial weakness, skeletal muscle weakness, and the presence of rods on muscle biopsy. A rare form of nemaline myopathy known as Amish Nemaline Myopathy has only been seen in a genetically isolated cohort of Old Order Amish patients who may additionally present with tremors in the first 2-3 months of life. We describe an Hispanic male diagnosed with nemaline myopathy histopathologically and subsequently confirmed by next generation gene sequencing. Direct sequencing revealed that he is homozygous for a pathogenic nonsense variant c.323C>G (p.S108X) in exon 9 of the TNNT1 gene. This report describes a novel pathogenic variant in the TNNT1 gene and represents a nemaline myopathy-causing variant in the TNNT1 gene outside of the Old Order Amish and Dutch ancestry. © 2014 Wiley Periodicals, Inc.

  13. Identification of a novel frameshift mutation in the DMD gene as the cause of muscular dystrophy in a Norfolk terrier dog.

    Science.gov (United States)

    Jenkins, Christopher A; Forman, Oliver P

    2015-01-01

    A Norfolk terrier was referred to the Animal Health Trust neurology department with suspected dystrophin-deficient muscular dystrophy (DD-MD), which was confirmed by clinical workup and immunohistochemistry. Exon resequencing of the canine Duchenne Muscular Dystrophy (DMD) gene was undertaken to screen for potential disease causing mutations. The sequence data generated from all coding DMD exons revealed a 1 bp deletion in exon 22, causing a frameshift and premature termination of the coding sequence. Gene expression analysis indicated reduced levels of dystrophin transcript in the DD-MD case and western blot confirmed the absence of full length protein. The finding represents a novel mutation causing DD-MD in the dog.

  14. Translational read-through as an alternative approach for ocular gene therapy of retinal dystrophies caused by in-frame nonsense mutations.

    Science.gov (United States)

    Nagel-Wolfrum, Kerstin; Möller, Fabian; Penner, Inessa; Wolfrum, Uwe

    2014-09-01

    The eye has become an excellent target for gene therapy, and gene augmentation therapy of inherited retinal disorders has made major progress in recent years. Nevertheless, a recent study indicated that gene augmentation intervention might not stop the progression of retinal degeneration in patients. In addition, for many genes, viral-mediated gene augmentation is currently not feasible due to gene size and limited packaging capacity of viral vectors as well as expression of various heterogeneous isoforms of the target gene. Thus, alternative gene-based strategies to stop or delay the retinal degeneration are necessary. This review focuses on an alternative pharmacologic treatment strategy based on the usage of translational read-through inducing drugs (TRIDs) such as PTC124, aminoglycoside antibiotics, and designer aminoglycosides for overreading in-frame nonsense mutations. This strategy has emerged as an option for up to 30-50% of all cases of recessive hereditary retinal dystrophies. In-frame nonsense mutations are single-nucleotide alterations within the gene coding sequence resulting in a premature stop codon. Consequently, translation of such mutated genes leads to the synthesis of truncated proteins, which are unable to fulfill their physiologic functions. In this context, application of TRIDs facilitates the recoding of the premature termination codon into a sense codon, thus restoring syntheses of full-length proteins. So far, clinical trials for non-ocular diseases have been initiated for diverse TRIDs. Although the clinical outcome is not analyzed in detail, an excellent safety profile, namely for PTC124, was clearly demonstrated. Moreover, recent data demonstrated sustained read-through efficacies of nonsense mutations causing retinal degeneration, as manifested in the human Usher syndrome. In addition, a strong retinal biocompatibility for PTC124 and designer aminoglycosides has been demonstrated. In conclusion, recent progress emphasizes the

  15. Functional characteristics of three new germline mutations of the thyrotropin receptor gene causing autosomal dominant toxic thyroid hyperplasia

    Energy Technology Data Exchange (ETDEWEB)

    Tonacchera, M.; Van Sande, J.; Cetani, F. [Universite Libre de Bruxelles, Brussels (Belgium)] [and others

    1996-02-01

    We report three unrelated families in which hyperthyroidism associated with thyroid hyperplasia was transmitted in an autosomal dominant fashion, in the absence of signs of autoimmunity. Exon 10 of the TSH receptor gene was directly sequenced after PCR amplification from DNA of peripheral leukocytes. In one family, a C to A transversion resulted in an S505R substitution in the third transmembrane segment; in the second, an A to T transversion caused an N650Y substitution in the sixth transmembrane segment; and in the third family, an A to G transition resulted in an N670S substitution in the seventh transmembrane segment. When expressed by transfection in COS-7 cells, each mutated receptor displayed an increase in constitutive stimulation of cAMP production; no effect on basal accumulation of inositol phosphates (IP) could be detected. In binding studies, cells transfected with wild-type of mutated receptors showed similar levels of expression, with the mutated receptors displaying similar or slightly increased affinity for bovine TSH (bTSH) binding. Cells transfected with S505R and N650Y mutants showed a similar cAMP maximal TSH-stimulated accumulation over the cells transfected with the wild type, whereas N670S transfectants showed a blunted response with an increase in EC{sub 50}. A higher IP response to 100 mU/mL bTSH over that obtained with the wild-type receptor was obtained in cells transfected with N650Y; in contrast, cells transfected with S505R showed a blunted IP production (50% less), and the N670S mutant completely lost the ability to stimulate IP accumulation in response to bTSH. The differential effects of individual mutations on stimulation by bTSH of cAMP or IP accumulation suggest that individual mutant receptors may achieve different active conformations with selective abilities to couple to G{sub s}{alpha} and to G{sub q}{alpha}. 17 refs., 8 figs.

  16. Duplication in the microtubule-actin cross-linking factor 1 gene causes a novel neuromuscular condition

    DEFF Research Database (Denmark)

    Jørgensen, Louise H; Mosbech, Mai-Britt; Færgeman, Nils J

    2014-01-01

    . These findings suggest that changes in the MACF1 gene is implicated in this neuromuscular condition, which is an important observation since MACF1 has not previously been associated with any human disease and thus presents a key to understanding the essential nature of this gene....... is associated with developmental retardation and embryonic lethality. Here we present a family with a novel neuromuscular condition. Genetic analyses show a heterozygous duplication resulting in reduced MACF1 gene product. The functional consequence is affected motility observed as periodic hypotonia, lax...

  17. Transient overexpression of exogenous APOBEC3A causes C-to-U RNA editing of thousands of genes.

    Science.gov (United States)

    Sharma, Shraddha; Patnaik, Santosh K; Kemer, Zeynep; Baysal, Bora E

    2017-05-04

    APOBEC3A cytidine deaminase induces site-specific C-to-U RNA editing of hundreds of genes in monocytes exposed to hypoxia and/or interferons and in pro-inflammatory macrophages. To examine the impact of APOBEC3A overexpression, we transiently expressed APOBEC3A in HEK293T cell line and performed RNA sequencing. APOBEC3A overexpression induces C-to-U editing at more than 4,200 sites in transcripts of 3,078 genes resulting in protein recoding of 1,110 genes. We validate recoding RNA editing of genes associated with breast cancer, hematologic neoplasms, amyotrophic lateral sclerosis, Alzheimer disease and primary pulmonary hypertension. These results highlight the fundamental impact of APOBEC3A overexpression on human transcriptome by widespread RNA editing.

  18. Hearing loss caused by progressive degeneration of cochlear hair cells in mice deficient for the Barhl1 homeobox gene

    National Research Council Canada - National Science Library

    Shengguo Li; Sandy M. Price; Hugh Cahill; David K. Ryugo; Michael M. Shen; Mengqing Xiang

    2002-01-01

    .... We report that targeted disruption of Barhl1 , a mouse homolog of the Drosophila BarH homeobox genes, results in severe to profound hearing loss, providing a unique model for the study of age-related...

  19. A pdf Neuropeptide Gene Mutation and Ablation of PDF Neurons Each Cause Severe Abnormalities of Behavioral Circadian Rhythms in Drosophila

    National Research Council Canada - National Science Library

    Renn, Susan C.P; Park, Jae H; Rosbash, Michael; Hall, Jeffrey C; Taghert, Paul H

    1999-01-01

    .... Here, we define two critical features of that mechanism in Drosophila. We first describe animals mutant for the pdf neuropeptide gene, which is expressed by most of the candidate pacemakers (LNv neurons...

  20. Inactivation of the tumor suppressor genes causing the hereditary syndromes predisposing to head and neck cancer via promoter hypermethylation in sporadic head and neck cancers.

    Science.gov (United States)

    Smith, Ian M; Mithani, Suhail K; Mydlarz, Wojciech K; Chang, Steven S; Califano, Joseph A

    2010-01-01

    Fanconi anemia (FA) and dyskeratosis congenita (DC) are rare inherited syndromes that cause head and neck squamous cell cancer (HNSCC). Prior studies of inherited forms of cancer have been extremely important in elucidating tumor suppressor genes inactivated in sporadic tumors. Here, we studied whether sporadic tumors have epigenetic silencing of the genes causing the inherited forms of HNSCC. Using bisulfite sequencing, we investigated the incidence of promoter hypermethylation of the 17 Fanconi- and DC-associated genes in sporadic HNSCC. Genes that only showed methylation in the tumor patients were chosen for quantitative methylation-specific PCR (qMSP) in a set of 45 tumor and 16 normal patients. Three gene promoters showed differences in methylation: FancB (FAAP95, FA core complex), FancJ (BRIP1, DNA Helicase/ATPase), and DKC1 (dyskeratin). Bisulfite sequencing revealed that only FancB and DKC1 showed no methylation in normal patients, yet the presence of promoter hypermethylation in tumor patients. On qMSP, 1/16 (6.25%) of the normal mucosal samples from non-cancer patients and 14/45 (31.1%) of the tumor patients demonstrated hypermethylation of the FancB locus (p < 0.05). These results suggest that inactivation of FancB may play a role in the pathogenesis of sporadic HNSCC.

  1. Mutation in second exon of MYO15A gene cause of nonsyndromic hearing loss and its association in the Arab population in Iran

    Directory of Open Access Journals (Sweden)

    Asgharzade Samira

    2016-01-01

    Full Text Available Hearing loss is a genetically and clinically heterogeneous defect and more than 140 loci and 65 genes have been identified to cause autosomal recessive non-syndromic hearing loss (ARNSHL. According to the previous studies, mutations in GJB2 are estimated to be involved in 18.17% of ARNSHL cases in the Iranian population; as a result, the remaining 81.83% of this disorder is yet ambiguous. This study aimed to determine the contribution of DFNB3 in hearing loss as well as the frequency of gene mutations in a population (Arab tribal origin in the Southwest of Iran. In this descriptive laboratory study, we included 25 families from the Southwest of Iran and negative GJB2 gene. Linkage analysis was performed by DFNB3 (MYO15A molecular markers (STR. The families with hearing loss linked to this locus were further analyzed for mutation detection. MYO15A gene exons were amplified and analyzed using direct DNA sequencing. In studied families, one family displayed linkage to DFNB3 locus. Identified mutations include substitution and substitute C for A in 1047 location of coding region of MYO15A gene (c.1047 C>A in exon 2 which cause to change Tyrosin to stop codons (P.Y349X, results in the premature truncation at amino acid position 349.

  2. Oligonucleotide treatment causes flax β-glucanase up-regulation via changes in gene-body methylation.

    Science.gov (United States)

    Wojtasik, Wioleta; Kulma, Anna; Boba, Aleksandra; Szopa, Jan

    2014-10-05

    Nowadays, the challenge for biotechnology is to develop tools for agriculture and industry to provide plants characterized by productivity and quality that will satisfy the growing demand for different kinds of natural products. To meet the challenge, the generation and application of genetically modified plants is justified. However, the strong social resistance to genetically modified organisms and restrictive regulations in European Union countries necessitated the development of a new technology for new plant types generation which uses the knowledge resulting from analysis of genetically modified plants to generate favourably altered plants while omitting the introduction of heterologous genes to their genome. Four-year experiments led to the development of a technology inducing heritable epigenetic gene activation without transgenesis. The method comprises the induction of changes in methylation/demethylation of the endogenous gene by the plant's treatment with short oligodeoxynucleotides antisense to the coding region. In vitro cultured plants and F3 generation flax plants overproducing the β-1,3-glucanase gene (EMO-βGlu flax) were characterized by up-regulation of β-glucanase and chitinase genes, decreases in the methylation of CCGG sequences in the β-glucanase gene and in total DNA methylation and, more importantly, reasonable resistance against Fusarium infection. In addition, EMO-βGlu flax obtained by this technology showed similar features as those obtained by genetic engineering. To our best knowledge, this is the first report on plant gene activation by treatment with oligodeoxynucleotides homologous to the coding region of the gene. Apart from the evident effectiveness, the most important issue is that the EMO method allows generation of favourably altered plants, whose cultivation makes the plant producer independent from the complicated procedure of obtaining an agreement on GMO release into the environment and whose products might be more

  3. Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice.

    Science.gov (United States)

    Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D Woodrow; Ivy, Dunbar; Perryman, M B; Garrett-Sinha, Lee Ann; Grossfeld, Paul

    2010-02-15

    Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an approximately 7 Mb 'cardiac critical region' in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease.

  4. Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice

    Science.gov (United States)

    Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D. Woodrow; Ivy, Dunbar; Perryman, M.B.; Garrett-Sinha, Lee Ann; Grossfeld, Paul

    2010-01-01

    Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an ∼7 Mb ‘cardiac critical region’ in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease. PMID:19942620

  5. Cord blood gene expression supports that prenatal exposure to perfluoroalkyl substances causes depressed immune functionality in early childhood.

    Science.gov (United States)

    Pennings, Jeroen L A; Jennen, Danyel G J; Nygaard, Unni C; Namork, Ellen; Haug, Line S; van Loveren, Henk; Granum, Berit

    2016-01-01

    Perfluoroalkyl and polyfluoroalkyl substances (PFAS) are a class of synthetic compounds that have widespread use in consumer and industrial applications. PFAS are considered environmental pollutants that have various toxic properties, including effects on the immune system. Recent human studies indicate that prenatal exposure to PFAS leads to suppressed immune responses in early childhood. In this study, data from the Norwegian BraMat cohort was used to investigate transcriptomics profiles in neonatal cord blood and their association with maternal PFAS exposure, anti-rubella antibody levels at 3 years of age and the number of common cold episodes until 3 years. Genes associated with PFAS exposure showed enrichment for immunological and developmental functions. The analyses identified a toxicogenomics profile of 52 PFAS exposure-associated genes that were in common with genes associated with rubella titers and/or common cold episodes. This gene set contains several immunomodulatory genes (CYTL1, IL27) as well as other immune-associated genes (e.g. EMR4P, SHC4, ADORA2A). In addition, this study identified PPARD as a PFAS toxicogenomics marker. These markers can serve as the basis for further mechanistic or epidemiological studies. This study provides a transcriptomics connection between prenatal PFAS exposure and impaired immune function in early childhood and supports current views on PPAR- and NF-κB-mediated modes of action. The findings add to the available evidence that PFAS exposure is immunotoxic in humans and support regulatory policies to phase out these substances.

  6. Mapping the fitness landscape of gene expression uncovers the cause of antagonism and sign epistasis between adaptive mutations.

    Directory of Open Access Journals (Sweden)

    Hsin-Hung Chou

    2014-02-01

    Full Text Available How do adapting populations navigate the tensions between the costs of gene expression and the benefits of gene products to optimize the levels of many genes at once? Here we combined independently-arising beneficial mutations that altered enzyme levels in the central metabolism of Methylobacterium extorquens to uncover the fitness landscape defined by gene expression levels. We found strong antagonism and sign epistasis between these beneficial mutations. Mutations with the largest individual benefit interacted the most antagonistically with other mutations, a trend we also uncovered through analyses of datasets from other model systems. However, these beneficial mutations interacted multiplicatively (i.e., no epistasis at the level of enzyme expression. By generating a model that predicts fitness from enzyme levels we could explain the observed sign epistasis as a result of overshooting the optimum defined by a balance between enzyme catalysis benefits and fitness costs. Knowledge of the phenotypic landscape also illuminated that, although the fitness peak was phenotypically far from the ancestral state, it was not genetically distant. Single beneficial mutations jumped straight toward the global optimum rather than being constrained to change the expression phenotypes in the correlated fashion expected by the genetic architecture. Given that adaptation in nature often results from optimizing gene expression, these conclusions can be widely applicable to other organisms and selective conditions. Poor interactions between individually beneficial alleles affecting gene expression may thus compromise the benefit of sex during adaptation and promote genetic differentiation.

  7. Mapping the fitness landscape of gene expression uncovers the cause of antagonism and sign epistasis between adaptive mutations.

    Science.gov (United States)

    Chou, Hsin-Hung; Delaney, Nigel F; Draghi, Jeremy A; Marx, Christopher J

    2014-02-01

    How do adapting populations navigate the tensions between the costs of gene expression and the benefits of gene products to optimize the levels of many genes at once? Here we combined independently-arising beneficial mutations that altered enzyme levels in the central metabolism of Methylobacterium extorquens to uncover the fitness landscape defined by gene expression levels. We found strong antagonism and sign epistasis between these beneficial mutations. Mutations with the largest individual benefit interacted the most antagonistically with other mutations, a trend we also uncovered through analyses of datasets from other model systems. However, these beneficial mutations interacted multiplicatively (i.e., no epistasis) at the level of enzyme expression. By generating a model that predicts fitness from enzyme levels we could explain the observed sign epistasis as a result of overshooting the optimum defined by a balance between enzyme catalysis benefits and fitness costs. Knowledge of the phenotypic landscape also illuminated that, although the fitness peak was phenotypically far from the ancestral state, it was not genetically distant. Single beneficial mutations jumped straight toward the global optimum rather than being constrained to change the expression phenotypes in the correlated fashion expected by the genetic architecture. Given that adaptation in nature often results from optimizing gene expression, these conclusions can be widely applicable to other organisms and selective conditions. Poor interactions between individually beneficial alleles affecting gene expression may thus compromise the benefit of sex during adaptation and promote genetic differentiation.

  8. Phenotypical features of the p.R120W mutation in the GDAP1 gene causing autosomal dominant Charcot-Marie-Tooth disease.

    Science.gov (United States)

    Sivera, Rafael; Espinós, Carmen; Vílchez, Juan J; Mas, Fernando; Martínez-Rubio, Dolores; Chumillas, María José; Mayordomo, Fernando; Muelas, Nuria; Bataller, Luis; Palau, Francesc; Sevilla, Teresa

    2010-12-01

    Mutations in the ganglioside-induced-differentiation-associated protein 1 gene (GDAP1) can cause Charcot-Marie-Tooth (CMT) disease with demyelinating (CMT4A) or axonal forms (CMT2K and ARCMT2K). Most of these mutations present a recessive inheritance, but few autosomal dominant GDAP1 mutations have also been reported. We performed a GDAP1 gene screening in a clinically well-characterized series of 81 index cases with axonal CMT neuropathy, identifying 17 patients belonging to 4 unrelated families in whom the heterozygous p.R120W was found to be the only disease-causing mutation. The main objective was to fully characterize the neuropathy caused by this mutation. The clinical picture included a mild-moderate phenotype with onset around adolescence, but great variability. Consistently, ankle dorsiflexion and plantar flexion were impaired to a similar degree. Nerve conduction studies revealed an axonal neuropathy. Muscle magnetic resonance imaging studies demonstrated selective involvement of intrinsic foot muscles in all patients and a uniform pattern of fatty infiltration in the calf, with distal and superficial posterior predominance. Pathological abnormalities included depletion of myelinated fibers, regenerative clusters and features of axonal degeneration with mitochondrial aggregates. Our findings highlight the relevance of dominantly transmitted p.R120W GDAP1 gene mutations which can cause an axonal CMT with a wide clinical profile. © 2010 Peripheral Nerve Society.

  9. Rapid characterization of disease-causing mutations in the low density lipoprotein receptor (LDL-R) gene by overexpression in COS cells

    DEFF Research Database (Denmark)

    Jensen, T G; Andresen, B S; Jensen, H K

    1996-01-01

    To characterize disease-causing mutations in the low density lipoprotein receptor (LDL-R) gene, COS cells are transfected with the mutant gene in an EBV-based expression vector and characterized by flow cytometry. Using antibodies against the LDL-receptor the amount of receptor protein on the cell...... surface is quantitated. The receptor activity is measured by incubating the cells with fluorescence labeled LDL (Dil-labelled LDL) at 37 degrees C and 4 degrees C. The transfected cells stained with anti-LDL-R antibodies can also be analysed by immunofluorescence microscopy allowing the study...

  10. Comparative transcriptome investigation of global gene expression changes caused by miR156 overexpression in Medicago sativa.

    Science.gov (United States)

    Gao, Ruimin; Austin, Ryan S; Amyot, Lisa; Hannoufa, Abdelali

    2016-08-19

    Medicago sativa (alfalfa) is a low-input forage and potential bioenergy crop, and improving its yield and quality has always been a focus of the alfalfa breeding industry. Transgenic alfalfa plants overexpressing a precursor of alfalfa microRNA156 (MsmiR156) were recently generated by our group. These plants (miR156OE) showed enhanced biomass yield, reduced internodal length, increased shoot branching and trichome density, and a delay in flowering time. Transcripts of three SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL) genes (MsSPL6, MsSPL12, and MsSPL13) were found to be targeted for cleavage by MsmiR156 in alfalfa. To further illustrate the molecular mechanisms underlying the effects of miR156 in alfalfa, two miR156OE genotypes (A11a and A17) were subjected to Next Generation RNA Sequencing with Illumina HiSeq. More than 1.11 billion clean reads were obtained from our available sequenced samples. A total of 160,472 transcripts were generated using Trinity de novo assembly and 4,985 significantly differentially expressed genes were detected in miR156OE plants A11a and A17 using the Medicago truncatula genome as reference. A total of 17 genes (including upregulated, downregulated, and unchanged) were selected for quantitative real-time PCR (qRT-PCR) validation, which showed that gene expression levels were largely consistent between qRT-PCR and RNA-Seq data. In addition to the established SPL genes MsSPL6, MsSPL12 and MsSPL13, four new SPLs; MsSPL2, MsSPL3, MsSPL4 and MsSPL9 were also down-regulated significantly in both miR156OE plants. These seven SPL genes belong to genes phylogeny clades VI, IV, VIII, V and VII, which have been reported to be targeted by miR156 in Arabidopsis thaliana. The gene ontology terms characterized electron transporter, starch synthase activity, sucrose transport, sucrose-phosphate synthase activity, chitin binding, sexual reproduction, flavonoid biosynthesis and lignin catabolism correlate well to the phenotypes of miR156OE alfalfa

  11. A Putative Type III Secretion System Effector Encoded by the MA20_12780 Gene in Bradyrhizobium japonicum Is-34 Causes Incompatibility with Rj4 Genotype Soybeans.

    Science.gov (United States)

    Tsurumaru, Hirohito; Hashimoto, Syougo; Okizaki, Kouhei; Kanesaki, Yu; Yoshikawa, Hirofumi; Yamakawa, Takeo

    2015-09-01

    The nodulation of Bradyrhizobium japonicum Is-34 is restricted by Rj4 genotype soybeans (Glycine max). To identify the genes responsible for this incompatibility, Tn5 mutants of B. japonicum Is-34 that were able to overcome this nodulation restriction were obtained. Analysis of the Tn5 mutants revealed that Tn5 was inserted into a region containing the MA20_12780 gene. In addition, direct disruption of this gene using marker exchange overcame the nodulation restriction by Rj4 genotype soybeans. The MA20_12780 gene has a tts box motif in its upstream region, indicating a possibility that this gene encodes a type III secretion system (T3SS) effector protein. Bioinformatic characterization revealed that the MA20_12780 protein contains the small ubiquitin-like modifier (SUMO) protease domain of the C48 peptidase (ubiquitin-like protease 1 [Ulp1]) family. The results of the present study indicate that a putative T3SS effector encoded by the MA20_12780 gene causes the incompatibility with Rj4 genotype soybeans, and they suggest the possibility that the nodulation restriction of B. japonicum Is-34 may be due to Rj4 genotype soybeans recognizing the putative T3SS effector (MA20_12780 protein) as a virulence factor. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Novel mutations in CRB1 and ABCA4 genes cause Leber congenital amaurosis and Stargardt disease in a Swedish family.

    Science.gov (United States)

    Jonsson, Frida; Burstedt, Marie S; Sandgren, Ola; Norberg, Anna; Golovleva, Irina

    2013-11-01

    This study aimed to identify genetic mechanisms underlying severe retinal degeneration in one large family from northern Sweden, members of which presented with early-onset autosomal recessive retinitis pigmentosa and juvenile macular dystrophy. The clinical records of affected family members were analysed retrospectively and ophthalmological and electrophysiological examinations were performed in selected cases. Mutation screening was initially performed with microarrays, interrogating known mutations in the genes associated with recessive retinitis pigmentosa, Leber congenital amaurosis and Stargardt disease. Searching for homozygous regions with putative causative disease genes was done by high-density SNP-array genotyping, followed by segregation analysis of the family members. Two distinct phenotypes of retinal dystrophy, Leber congenital amaurosis and Stargardt disease were present in the family. In the family, four patients with Leber congenital amaurosis were homozygous for a novel c.2557C>T (p.Q853X) mutation in the CRB1 gene, while of two cases with Stargardt disease, one was homozygous for c.5461-10T>C in the ABCA4 gene and another was carrier of the same mutation and a novel ABCA4 mutation c.4773+3A>G. Sequence analysis of the entire ABCA4 gene in patients with Stargardt disease revealed complex alleles with additional sequence variants, which were evaluated by bioinformatics tools. In conclusion, presence of different genetic mechanisms resulting in variable phenotype within the family is not rare and can challenge molecular geneticists, ophthalmologists and genetic counsellors.

  13. Differential gene expression of three mastitis-causing Escherichia coli strains grown under planktonic, swimming, and swarming culture conditions

    Science.gov (United States)

    Escherichia coli is a leading cause of intramammary infections in dairy cattle and is typically transient in nature. However, in a minority of cases, E. coli can cause persistent infections. Although the mechanisms that allow for a persistent intramammary E. coli infection are not fully understood...

  14. Generation of an isogenic, gene-corrected iPSC line from a symptomatic 57-year-old female patient with frontotemporal dementia caused by a P301L mutation in the microtubule associated protein tau (MAPT) gene

    DEFF Research Database (Denmark)

    Nimsanor, Natakarn; Kitiyanant, Narisorn; Poulsen, Ulla

    2016-01-01

    pluripotent stem cells (iPSCs) hold great promise to model FTDP-17 as such cells can be differentiated in vitro to the required cell type. Furthermore, gene-editing approaches allow generating isogenic gene-corrected controls that can be used as a very specific control. Here, we report the generation......Frontotemporal dementia with parkinsonism linked to chromosome 17q21.2 (FTDP-17) is an autosomal-dominant neurodegenerative disorder. Mutations in the MAPT (microtubule-associated protein tau)-gene can cause FTDP-17, but the underlying pathomechanisms of the disease are still unknown. Induced...... of genetically corrected iPSCs from a 57-year-old female FTD-17 patient carrying an P301L mutation in the MAPT-gene....

  15. Generation of an isogenic, gene-corrected iPSC line from a symptomatic 59-year-old female patient with frontotemporal dementia caused by an R406W mutation in the microtubule associated protein tau (MAPT) gene

    DEFF Research Database (Denmark)

    Nimsanor, Natakarn; Poulsen, Ulla; Rasmussen, Mikkel A.

    2016-01-01

    pluripotent stem cells (iPSCs) hold great promise to model FTDP-17 as such cells can be differentiated in vitro to the required cell type. Furthermore, gene-editing approaches allow generating isogenic gene-corrected controls that can be used as a very specific control. Here, we report the generation......Frontotemporal dementia with parkinsonism linked to chromosome 17q21.2 (FTDP-17) is an autosomal-dominant neurodegenerative disorder. Mutations in the MAPT (microtubule-associated protein tau) gene can cause FTDP-17, but the underlying pathomechanisms of the disease are still unknown. Induced...... of genetically corrected iPSCs from a 59-year-old female FTD-17 patient carrying an R406W mutation in the MAPT-gene....

  16. Uncovering genomic causes of co-morbidity in epilepsy: gene-driven phenotypic characterization of rare microdeletions.

    Directory of Open Access Journals (Sweden)

    Dalia Kasperavičiūtė

    Full Text Available Patients with epilepsy often suffer from other important conditions. The existence of such co-morbidities is frequently not recognized and their relationship with epilepsy usually remains unexplained.We describe three patients with common, sporadic, non-syndromic epilepsies in whom large genomic microdeletions were found during a study of genetic susceptibility to epilepsy. We performed detailed gene-driven clinical investigations in each patient. Disruption of the function of genes in the deleted regions can explain co-morbidities in these patients.Co-morbidities in patients with epilepsy can be part of a genomic abnormality even in the absence of (known congenital malformations or intellectual disabilities. Gene-driven phenotype examination can also reveal clinically significant unsuspected condition.

  17. On the potential strength and consequences for nonrandom gene flow caused by local adaptation in flowering time.

    Science.gov (United States)

    Weis, A E

    2015-03-01

    Gene flow is generally considered a random process, that is the loci under consideration have no effect on dispersal success. Edelaar and Bolnick (Trends Ecol Evol, 27, 2012 659) recently argued that nonrandom gene flow could exert a significant evolutionary force. It can, for instance, ameliorate the maladaptive effects of immigration into locally adapted populations. I examined the potential strength for nonrandom gene flow for flowering time genes, a trait frequently found to be locally adapted. The idea is that plants that successfully export pollen into a locally adapted resident population will be a genetically biased subset of their natal population - they will have resident-like flowering times. Reciprocally, recipients will be more migrant-like than the resident population average. I quantified the potential for biased pollen exchange among three populations along a flowering time cline in Brassica rapa from southern California. A two-generation line cross experiment demonstrated genetic variance in flowering time, both within and among populations. Calculations based on the variation in individual flowering schedules showed that resident plants with the most migrant-like flowering times could expect to have up to 10 times more of the their flowers pollinated by immigrant pollen than the least migrant-like. Further, the mean flowering time of the pollen exporters that have access to resident mates differs by up to 4 weeks from the mean in the exporters' natal population. The data from these three populations suggest that the bias in gene flow for flowering time cuts the impact on the resident population by as much as half. This implies that when selection is divergent between populations, migrants with the highest mating success tend to be resident-like in their flowering times, and so, fewer maladaptive alleles will be introduced into the locally adapting gene pool. © 2015 European Society For Evolutionary Biology. Journal of Evolutionary Biology

  18. Human VRK1 is an early response gene and its loss causes a block in cell cycle progression.

    Directory of Open Access Journals (Sweden)

    Alberto Valbuena

    Full Text Available BACKGROUND: In mammalian cells regulatory proteins controlling the cell cycle are necessary due to the requirements of living in a heterogeneous environment of cell-interactions and growth factors. VRK1 is a novel serine-threonine kinase that phosphorylates several transcription factors and is associated with proliferation phenotypes. METHODOLOGY/PRINCIPAL FINDINGS: In this report VRK1 has been identified as regulated in the cell cycle. VRK1 gene expression is activated by the addition of serum to starved cells, indicating it is required for the exit of G0 phase and entry in G1; a response that parallels the re-expression of MYC, FOS and CCND1 (cyclin D1 genes, suggesting that VRK1 is an early-response gene. VRK1 gene expression is also shutdown by serum withdrawal. The human VRK1 gene promoter cloned in a luciferase reporter responds similarly to serum. In response to serum, the level of VRK1 protein expression has a positive correlation with cell proliferation markers such as phosphorylated-Rb or PCNA, and is inversely correlated with cell cycle inhibitors such as p27. The elimination of VRK1 by siRNA results in a G1 block in cell division, and in loss of phosphorylated-Rb, cyclin D1, and other proliferation markers. Elimination of VRK1 by siRNA induces a reduction of cell proliferation. VRK1 colocalizes with p63 in proliferating areas of squamous epithelium, and identifies a subpopulation in the basal layer. CONCLUSIONS/SIGNIFICANCE: VRK1 is an immediate early response gene required for entry in G1, and due to its implication in normal cell proliferation and division, might be a new target for development of inhibitors of cellular proliferation.

  19. Gene Silencing of BnTT10 Family Genes Causes Retarded Pigmentation and Lignin Reduction in the Seed Coat of Brassica napus

    Science.gov (United States)

    Zhang, Kai; Lu, Kun; Qu, Cunmin; Liang, Ying; Wang, Rui; Chai, Yourong; Li, Jiana

    2013-01-01

    Yellow-seed (i.e., yellow seed coat) is one of the most important agronomic traits of Brassica plants, which is correlated with seed oil and meal qualities. Previous studies on the Brassicaceae, including Arabidopsis and Brassica species, proposed that the seed-color trait is correlative to flavonoid and lignin biosynthesis, at the molecular level. In Arabidopsis thaliana, the oxidative polymerization of flavonoid and biosynthesis of lignin has been demonstrated to be catalyzed by laccase 15, a functional enzyme encoded by the AtTT10 gene. In this study, eight Brassica TT10 genes (three from B. napus, three from B. rapa and two from B. oleracea) were isolated and their roles in flavonoid oxidation/polymerization and lignin biosynthesis were investigated. Based on our phylogenetic analysis, these genes could be divided into two groups with obvious structural and functional differentiation. Expression studies showed that Brassica TT10 genes are active in developing seeds, but with differential expression patterns in yellow- and black-seeded near-isogenic lines. For functional analyses, three black-seeded B. napus cultivars were chosen for transgenic studies. Transgenic B. napus plants expressing antisense TT10 constructs exhibited retarded pigmentation in the seed coat. Chemical composition analysis revealed increased levels of soluble proanthocyanidins, and decreased extractable lignin in the seed coats of these transgenic plants compared with that of the controls. These findings indicate a role for the Brassica TT10 genes in proanthocyanidin polymerization and lignin biosynthesis, as well as seed coat pigmentation in B. napus. PMID:23613820

  20. Differential expression of var gene groups is associated with morbidity caused by Plasmodium falciparum infection in Tanzanian children

    DEFF Research Database (Denmark)

    Rottmann, Matthias; Lavstsen, Thomas; Mugasa, Joseph Paschal

    2006-01-01

    The var gene family of Plasmodium falciparum encodes the variant surface antigen Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1). PfEMP1 is considered an important pathogenicity factor in P. falciparum infection because it mediates cytoadherence to host cell endothelial receptors. var...... for children with clinical malaria than for children with asymptomatic infections. The var group C and var1-like transcript abundances were similar between the three sample groups. A transcript abundance pattern similar to that for var group A was observed for var2csa and var3-like genes. These results suggest...

  1. Illegitimate translation causes unexpected gene expression from on-target out-of-frame alleles created by CRISPR-Cas9.

    Science.gov (United States)

    Makino, Shigeru; Fukumura, Ryutaro; Gondo, Yoichi

    2016-12-21

    CRISPR-Cas9 is efficient enough to knock out both alleles directly by introducing out-of-frame mutations. We succeeded in making biallelic on-target frameshift mutations of the endogenous Gli3 gene; however, the GLI3 protein was expressed in all six of the established cell lines carrying homozygous out-of-frame mutations. We developed a dual-tagged expression vector and proved that illegitimate translation (ITL) was the cause of the unexpected Gli3 expression. Thus, gene expression must be examined even if designed on-target out-of-frame sequences are introduced by genome editing. In addition, it is highly recommended to pre-examine the occurrence of ITL in vitro prior to the design and construction of any genome-editing vectors. In vitro assay systems such as the dual-tagged ITL assay system developed in this study should aid the identification and elucidation of ITL-based human diseases and gene expression.

  2. Characterization of Resistance Genes and Plasmids from Outbreaks and Illness Clusters Caused by Salmonella Resistant to Ceftriaxone in the United States, 2011-2012.

    Science.gov (United States)

    Folster, Jason P; Grass, Julian E; Bicknese, Amelia; Taylor, Julia; Friedman, Cindy R; Whichard, Jean M

    2017-03-01

    Salmonella is an important cause of foodborne illness; however, quickly identifying the source of these infections can be difficult, and source identification is a crucial step in preventing additional illnesses. Although most infections are self-limited, invasive salmonellosis may require antimicrobial treatment. Ceftriaxone, an extended-spectrum cephalosporin, is commonly used for treatment of salmonellosis. Previous studies have identified a correlation between the food animal/retail meat source of ceftriaxone-resistant Salmonella and the type of resistance gene and plasmid it carries. In this study, we examined seven outbreaks of ceftriaxone-resistant Salmonella infections, caused by serotypes Typhimurium, Newport, Heidelberg, and Infantis. All isolates were positive for a plasmid-encoded bla CMY gene. Plasmid incompatibility typing identified five IncI1 and two IncA/C plasmids. Both outbreaks containing bla CMY -IncA/C plasmids were linked to consumption of cattle products. Three of five outbreaks with bla CMY -IncI1 (ST12) plasmids were linked to a poultry source. The remaining IncI1 outbreaks were associated with ground beef (ST20) and tomatoes (ST12). In addition, we examined isolates from five unsolved clusters of ceftriaxone-resistant Salmonella infections and used our plasmid-encoded gene findings to predict the source. Overall, we identified a likely association between the source of ceftriaxone-resistant Salmonella outbreaks and the type of resistance gene/plasmid it carries.

  3. Novel membrane frizzled-related protein gene mutation as cause of posterior microphthalmia resulting in high hyperopia with macular folds

    NARCIS (Netherlands)

    Wasmann, Rosemarie A.; Wassink-Ruiter, Jolien S. Klein; Sundin, Olof H.; Morales, Elisa; Verheij, Joke B. G. M.; Pott, Jan Willem R.

    Abstract. Purpose: We present a genetic and clinical analysis of two sisters, 3 and 4 years of age, with nanophthalmos and macular folds. Methods: Ophthalmological examination, general paediatric examination and molecular genetic analysis of the MFRP gene were performed in both affected siblings.

  4. Mutation in the RPE65 gene causing hereditary retinal dystrophy in the Briard dogs: application of a new detection method

    Czech Academy of Sciences Publication Activity Database

    Bechyňová, Renata; Dostál, Jaromír; Stratil, Antonín; Jílek, F.; Horák, Pavel

    2008-01-01

    Roč. 53, č. 4 (2008), s. 176-179 ISSN 1212-1819 R&D Projects: GA AV ČR 1QS500450578; GA ČR GD523/03/H076 Institutional research plan: CEZ:AV0Z50450515 Keywords : RPE65 gene * CSNB * dog Subject RIV: EG - Zoology Impact factor: 0.735, year: 2008

  5. Common variation in oxidative phosphorylation genes is not a major cause of insulin resistance or type 2 diabetes

    DEFF Research Database (Denmark)

    Snogdal, Lena Sønder; Wod, Mette; Grarup, Niels

    2012-01-01

    There is substantial evidence that mitochondrial dysfunction is linked to insulin resistance and is present in several tissues relevant to the pathogenesis of type 2 diabetes. Here, we examined whether common variation in genes involved in oxidative phosphorylation (OxPhos) contributes to type 2...

  6. Three or more copies of the proteolipid protein gene PLP1 cause severe Pelizaeus-Merzbacher disease.

    NARCIS (Netherlands)

    Wolf, N.I.; Sistermans, E.A.; Cundall, M.; Hobson, G.M.; Davis-Williams, A.P.; Palmer, R.; Stubbs, P.; Davies, S.; Endziniene, M.; Wu, Y.; Chong, W.K.; Malcolm, S.; Surtees, R.; Garbern, J.Y.; Woodward, K.J.

    2005-01-01

    We describe five boys from different families with an atypically severe form of Pelizaeus-Merzbacher disease (PMD) who have three, and in one case, five copies of the proteolipid protein (PLP1) gene. This is the first report of more than two copies of PLP1 in PMD patients and clearly demonstrates

  7. Three or more copies of the proteolipid protein gene PLP1 cause severe Pelizaeus-Merzbacher disease

    NARCIS (Netherlands)

    Wolf, NI; Sistermans, EA; Cundall, M; Hobson, GM; Davis-Williams, AP; Palmer, R; Stubbs, P; Davies, S; Endziniene, M; Wu, Y; Chong, WK; Malcolm, S; Surtees, R; Garbern, JY; Woodward, KJ

    We describe five boys from different families with an atypically severe form of Pelizaeus-Merzbacher disease (PMD) who have three, and in one case, five copies of the proteolipid protein (PLP1) gene. This is the first report of more than two copies of PLP1 in PMD patients and clearly demonstrates

  8. Peroxisome biogenesis in Hansenula polymorpha : different mutations in genes, essential for peroxisome biogenesis, cause different peroxisomal mutant phenotypes

    NARCIS (Netherlands)

    Titorenko, Vladimir I.; Waterham, Hans R.; Haima, Peter; Harder, Wim; Veenhuis, Marten

    1992-01-01

    In Hansenula polymorpha, different monogenic recessive mutations mapped in either of two previously identified genes, PER1 and PER3, produced different peroxisomal mutant phenotypes. Among five per1 mutants, four showed a Pim- phenotype: the cells contained few small peroxisomes while the bulk of

  9. DISRUPTION OF THE SACCHAROMYCES CEREVISIAE GENE FOR NADPH-CYTOCHROME P450-REDUCTASE CAUSES INCREASED SENSITIVITY TO KETOCONAZOLE

    Science.gov (United States)

    Strains of Saccharomyces cerevisiae deleted in the NADPH-cytochrome P450 reductase gene by transplacement are 200-fold more sensitive to ketoconazole, an inhibitor of the cytochrome P450 lanosterol 14-demethylase. Resistance is restored through complementation by the plasmid-born...

  10. A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

    Science.gov (United States)

    Zhao, Zi-Ye; Jiang, Yu-Liang; Li, Bai-Rong; Yang, Fu; Li, Jing; Jin, Xiao-Wei; Ning, Shou-Bin; Sun, Shu-Han

    2017-11-01

    Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

  11. Experimental heart failure causes depression-like behavior together with differential regulation of inflammatory and structural genes in the brain

    National Research Council Canada - National Science Library

    Frey, Anna; Popp, Sandy; Post, Antonia; Langer, Simon; Lehmann, Marc; Hofmann, Ulrich; Siren, Anna-Leena; Hommers, Leif; Schmitt, Angelika; Strekalova, Tatyana; Ertl, Georg; Lesch, Klaus-Peter; Frantz, Stefan

    2014-01-01

    ...). However, it is unclear whether CHF causes depression. Thus, we investigated whether mice develop anxiety- and depression-like behavior after induction of ischemic CHF by myocardial infarction (MI...

  12. Genes differentially expressed in Theobroma cacao associated with resistance to witches' broom disease caused by Crinipellis perniciosa.

    Science.gov (United States)

    Leal, Gildemberg Amorim; Albuquerque, Paulo S B; Figueira, Antonio

    2007-05-01

    SUMMARY The basidiomycete Crinipellis perniciosa is the causal agent of witches' broom disease of Theobroma cacao (cocoa). Hypertrophic growth of infected buds ('brooms') is the most dramatic symptom, but the main economic losses derive from pod infection. To identify cocoa genes differentially expressed during the early stages of infection, two cDNA libraries were constructed using the suppression subtractive hybridization (SSH) approach. Subtraction hybridization was conducted between cDNAs from infected shoot-tips of the susceptible genotype 'ICS 39' and the resistant 'CAB 214', in both directions. A total of 187 unique sequences were obtained, with 83 from the library enriched for the susceptible 'ICS 39' sequences, and 104 for the resistant 'CAB 214'. By homology search and ontology analyses, the identified sequences were mainly putatively categorized as belonging to 'signal transduction', 'response to biotic and abiotic stress', 'metabolism', 'RNA and DNA metabolism', 'protein metabolism' and 'cellular maintenance' classes. Quantitative reverse transcription amplification (RT-qPCR) of 23 transcripts identified as differentially expressed between genotypes revealed distinct kinetics of gene up-regulation at the asymptomatic stage of the disease. Expression induction in the susceptible 'ICS 39' in response to C. perniciosa was delayed and limited, while in 'CAB 214' there was a quicker and more intense reaction, with two peaks of gene induction at 48 and 120 h after inoculation, corresponding to morphological and biochemical changes previously described during colonization. Similar differences in gene induction were validated for another resistant genotype ('CAB 208') in an independent experiment. Validation of these genes corroborated similar hypothetical mechanisms of resistance described in other pathosystems.

  13. Steroidogenic factor-1 (SF-1 gene mutation as a frequent cause of primary amenorrhea in 46,XY female adolescents with low testosterone concentration

    Directory of Open Access Journals (Sweden)

    Servant Nadège

    2010-03-01

    Full Text Available Abstract Background Primary amenorrhea due to 46,XY disorders of sex differentiation (DSD is a frequent reason for consultation in endocrine and gynecology clinics. Among the genetic causes of low-testosterone primary amenorrhea due to 46,XY DSD, SRY gene is reported to be frequently involved, but other genes, such as SF1 and WT1, have never been studied for their prevalence. Methods We directly sequenced SRY, SF1 and WT1 genes in 15 adolescent girls with primary amenorrhea, low testosterone concentration, and XY karyotype, to determine the prevalence of mutations. We also analyzed the LH receptor gene in patients with high LH and normal FSH concentrations. Results Among the 15 adolescents with primary amenorrhea and low testosterone concentration, we identified two new SRY mutations, five new SF1 mutations and one new LH receptor gene mutation. Our study confirms the 10-15% prevalence of SRY mutations and shows the high prevalence (33% of SF1 abnormalities in primary amenorrhea due to 46,XY DSD with low plasma testosterone concentration. Conclusions The genetic analysis of low-testosterone primary amenorrhea is complex as several factors may be involved. This work underlines the need to systematically analyze the SF1 sequence in girls with primary amenorrhea due to 46,XY DSD and low testosterone, as well as in newborns with 46,XY DSD.

  14. Mutation update of transcription factor genes FOXE3, HSF4, MAF, and PITX3 causing cataracts and other developmental ocular defects.

    Science.gov (United States)

    Anand, Deepti; Agrawal, Smriti A; Slavotinek, Anne; Lachke, Salil A

    2018-01-04

    Mutations in the transcription factor genes FOXE3, HSF4, MAF, and PITX3 cause congenital lens defects including cataracts that may be accompanied by defects in other components of the eye or in nonocular tissues. We comprehensively describe here all the variants in FOXE3, HSF4, MAF, and PITX3 genes linked to human developmental defects. A total of 52 variants for FOXE3, 18 variants for HSF4, 20 variants for MAF, and 19 variants for PITX3 identified so far in isolated cases or within families are documented. This effort reveals FOXE3, HSF4, MAF, and PITX3 to have 33, 16, 18, and 7 unique causal mutations, respectively. Loss-of-function mutant animals for these genes have served to model the pathobiology of the associated human defects, and we discuss the currently known molecular function of these genes, particularly with emphasis on their role in ocular development. Finally, we make the detailed FOXE3, HSF4, MAF, and PITX3 variant information available in the Leiden Online Variation Database (LOVD) platform at https://www.LOVD.nl/FOXE3, https://www.LOVD.nl/HSF4, https://www.LOVD.nl/MAF, and https://www.LOVD.nl/PITX3. Thus, this article informs on key variants in transcription factor genes linked to cataract, aphakia, corneal opacity, glaucoma, microcornea, microphthalmia, anterior segment mesenchymal dysgenesis, and Ayme-Gripp syndrome, and facilitates their access through Web-based databases. © 2018 Wiley Periodicals, Inc.

  15. A Homozygous TPO Gene Duplication (c.1184_1187dup4) Causes Congenital Hypothyroidism in Three Siblings Born to a Consanguineous Family.

    Science.gov (United States)

    Cangul, Hakan; Aydin, Banu K; Bas, Firdevs

    2015-12-01

    Congenital hypothyroidism (CH) is the most common neonatal endocrine disease, and germ-line mutations in the TPO gene cause the inherited form of the disease. Our aim in this study was to determine the genetic basis of congenital hypothyroidism in three affected children coming from a consanguineous Turkish family. Because CH is usually inherited in autosomal recessive manner in consanguineous/multicase families, we adopted a two-stage strategy of genetic linkage studies and targeted sequencing of the candidate genes. First, we investigated the potential genetic linkage of the family to any known CH locus, using microsatellite markers, and then screened for mutations in linked-gene by conventional sequencing. The family showed potential linkage to the TPO gene and we detected a homozygous duplication (c.1184_1187dup4) in all cases. The mutation segregated with disease status in the family. This study confirms the pathogenicity of the c.1184_1187dup4 mutation in the TPO gene and helps establish a genotype/phenotype correlation associated with this mutation. It also highlights the importance of molecular genetic studies in the definitive diagnosis and accurate classification of CH.

  16. Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families.

    Science.gov (United States)

    Van Cauwenbergh, Caroline; Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy; Leroy, Bart P; De Baere, Elfride

    2017-01-01

    Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5-30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular spectrum of PRPH2, PRPF8, RHO, RP1, SNRNP

  17. Alpha-tocopherol transfer protein deficiency in mice causes multi-organ deregulation of gene networks and behavioral deficits with age.

    Science.gov (United States)

    Gohil, Kishorchandra; Godzdanker, Roy; O'Roark, Erin; Schock, Bettina C; Kaini, Ramesh R; Packer, Lester; Cross, Carroll E; Traber, Maret G

    2004-12-01

    Functions of alpha-tocopherol (alpha-T) in vivo, other than those for fertility in females, are intensely debated. The discovery of alpha-T deficiency in patients with ataxia (AVED) followed by the identification of mutations in the gene encoding alpha-tocopherol transfer protein (TTP) in AVED patients demonstrates an essential role of alpha-T and TTP for normal neurological function. alpha-T molecular targets that account for alpha-T-sensitive neurological dysfunction remain to be discovered. We have used high-density oligonucleotide arrays to search for putative alpha-T-sensitive genes in the CNS and other tissues in an in vivo model of alpha-T deficiency imposed at birth by the deletion of the TTP gene in mice. Repression of genes affecting synaptic function and myelination and induction of genes for neurodegeneration in the motor cortex of alpha-T-deficient mice were identified. The expression of retinoic acid-related orphan receptor alpha (ROR-alpha) was repressed in the cortex and adrenal glands of TTP-deficient mice. Deficiency of ROR-alpha causes ataxia in mice and may account for ataxia in AVED patients. These observations suggest that some of the actions of alpha-T are mediated by the transcription factor ROR-alpha. The behavior of young TTP-null mice was essentially normal, but older mice showed inactivity, ataxia, and memory dysfunction. mRNA profiles of old alpha-T-deficient cerebral cortices are compatible with repressed activity of oligodendrocytes and astrocytes. In conclusion, gene-expression profiling studies have identified novel alpha-T-modulated genes and cells in the CNS that may be causatively linked with delayed neurodegeneration and age-related decline in behavioral repertoires.

  18. Self-catalytic DNA depurination underlies human β-globin gene mutations at codon 6 that cause anemias and thalassemias.

    Science.gov (United States)

    Alvarez-Dominguez, Juan R; Amosova, Olga; Fresco, Jacques R

    2013-04-19

    The human β-globin gene contains an 18-nucleotide coding strand sequence centered at codon 6 and capable of forming a stem-loop structure that can self-catalyze depurination of the 5'G residue of that codon. The resultant apurinic lesion is subject to error-prone repair, consistent with the occurrence about this codon of mutations responsible for 6 anemias and β-thalassemias and additional substitutions without clinical consequences. The 4-residue loop of this stem-loop-forming sequence shows the highest incidence of mutation across the gene. The loop and first stem base pair-forming residues appeared early in the mammalian clade. The other stem-forming segments evolved more recently among primates, thereby conferring self-depurination capacity at codon 6. These observations indicate a conserved molecular mechanism leading to β-globin variants underlying phenotypic diversity and disease.

  19. Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers

    Science.gov (United States)

    Veigl, Martina L.; Kasturi, Lakshmi; Olechnowicz, Joseph; Ma, AiHong; Lutterbaugh, James D.; Periyasamy, Sumudra; Li, Guo-Min; Drummond, James; Modrich, Paul L.; Sedwick, W. David; Markowitz, Sanford D.

    1998-01-01

    Mutations of DNA mismatch repair genes, including the hMLH1 gene, have been linked to human colon and other cancers in which defective DNA repair is evidenced by the associated instability of DNA microsatellite sequences (MSI). Germ-line hMLH1 mutations are causally associated with inherited MSI colon cancer, and somatic mutations are causally associated with sporadic MSI colon cancer. Previously however, we demonstrated that in many sporadic MSI colon cancers hMLH1 and all other DNA mismatch repair genes are wild type. To investigate this class of tumors further, we examined a group of MSI cancer cell lines, most of which were documented as established from antecedent MSI-positive malignant tumors. In five of six such cases we found that hMLH1 protein was absent, even though hMLH1-coding sequences were wild type. In each such case, absence of hMLH1 protein was associated with the methylation of the hMLH1 gene promoter. Furthermore, in each case, treatment with the demethylating agent 5-azacytidine induced expression of the absent hMLH1 protein. Moreover, in single cell clones, hMLH1 expression could be turned on, off, and on again by 5-azacytidine exposure, washout, and reexposure. This epigenetic inactivation of hMLH1 additionally accounted for the silencing of both maternal and paternal tumor hMLH1 alleles, both of which could be reactivated by 5-azacytidine. In summary, substantial numbers of human MSI cancers appear to arise by hMLH1 silencing via an epigenetic mechanism that can inactivate both of the hMLH1 alleles. Promoter methylation is intimately associated with this epigenetic silencing mechanism. PMID:9671741

  20. RNAi-mediated disruption of neuropeptide genes, nlp-3 and nlp-12, cause multiple behavioral defects in Meloidogyne incognita.

    Science.gov (United States)

    Dash, Manoranjan; Dutta, Tushar K; Phani, Victor; Papolu, Pradeep K; Shivakumara, Tagginahalli N; Rao, Uma

    2017-08-26

    Owing to the current deficiencies in chemical control options and unavailability of novel management strategies, root-knot nematode (M. incognita) infections remain widespread with significant socio-economic impacts. Helminth nervous systems are peptide-rich and appear to be putative drug targets that could be exploited by antihelmintic chemotherapy. Herein, to characterize the novel peptidergic neurotransmitters, in silico mining of M. incognita genomic and transciptomic datasets revealed the presence of 16 neuropeptide-like protein (nlp) genes with structural hallmarks of neuropeptide preproproteins; among which 13 nlps were PCR-amplified and sequenced. Two key nlp genes (Mi-nlp-3 and Mi-nlp-12) were localized to the basal bulb and tail region of nematode body via in situ hybridization assay. Mi-nlp-3 and Mi-nlp-12 were greatly expressed (in qRT-PCR assay) in the pre-parasitic juveniles and adult females, suggesting the association of these genes in host recognition, development and reproduction of M. incognita. In vitro knockdown of Mi-nlp-3 and Mi-nlp-12 via RNAi demonstrated the significant reduction in attraction and penetration of M. incognita in tomato root in Pluronic gel medium. A pronounced perturbation in development and reproduction of NLP-silenced worms was also documented in adzuki beans in CYG growth pouches. The deleterious phenotypes obtained due to NLP knockdown suggests that transgenic plants engineered to express RNA constructs targeting nlp genes may emerge as an environmentally viable option to manage nematode problems in crop plants. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants

    OpenAIRE

    Sánchez K; de Mendonca E; Matute X; Chaustre I; Villalón M; Takiff H

    2016-01-01

    Karen Sánchez,1 Elizabeth de Mendonca,1 Xiorama Matute,2 Ismenia Chaustre,2 Marlene Villalón,3 Howard Takiff4 1Unit of Genetic and Forensic Studies, Venezuelan Institute for Scientific Research (IVIC), 2Hospital JM de los Ríos, 3Hospital José Ignacio Baldo, Algodonal, National Reference Unit, 4Laboratory of Molecular Genetics, Venezuelan Institute for Scientific Research (IVIC), Caracas, Venezuela. Abstract: The mutations in the CFTR gene found in ...

  2. RNA interference gene therapy in dominant retinitis pigmentosa and cone-rod dystrophy mouse models caused by GCAP1 mutations

    Directory of Open Access Journals (Sweden)

    Li eJiang

    2014-04-01

    Full Text Available RNA interference (RNAi knockdown is an efficacious therapeutic strategy for silencing genes causative for dominant retinal dystrophies. To test this, we used self-complementary (sc AAV2/8 vector to develop an RNAi-based therapy in two dominant retinal degeneration mouse models. The allele-specific model expresses transgenic bovine GCAP1(Y99C establishing a rapid RP-like phenotype, whereas the nonallele-specific model expresses mouse GCAP1(L151F producing a slowly progressing cone/rod dystrophy (CORD. The late onset GCAP1(L151F-CORD mimics the dystrophy observed in human GCAP1-CORD patients. Subretinal injection of scAAV2/8 carrying shRNA expression cassettes specific for bovine or mouse GCAP1 showed strong expression at one week post-injection. In both allele-specific (GCAP1(Y99C-RP and nonallele-specific (GCAP1(L151F-CORD models of dominant retinal dystrophy, RNAi-mediated gene silencing enhanced photoreceptor survival, delayed onset of degeneration and improved visual function. Such results provide a proof of concept toward effective RNAi-based gene therapy mediated by scAAV2/8 for dominant retinal disease based on GCAP1 mutation. Further, nonallele-specific RNAi knockdown of GCAP1 may prove generally applicable toward the rescue of any human GCAP1-based dominant cone-rod dystrophy.

  3. Overexpression of Medicago SVP genes causes floral defects and delayed flowering in Arabidopsis but only affects floral development in Medicago.

    Science.gov (United States)

    Jaudal, Mauren; Monash, Jacob; Zhang, Lulu; Wen, Jiangqi; Mysore, Kirankumar S; Macknight, Richard; Putterill, Joanna

    2014-02-01

    The MADS-domain transcription factor SHORT VEGETATIVE PHASE plays a key role as a repressor of the transition to flowering and as a regulator of early floral development in Arabidopsis thaliana (Arabidopsis). However, no flowering-time repressors have been functionally identified in the model legume Medicago truncatula (Medicago). In this study, phylogenetic analysis of two closely-related MtSVP-like sequences, MtSVP1 and MtSVP2, showed that their predicted proteins clustered together within the eudicot SVP clade. To determine if the MtSVP-like genes have a role in flowering, they were functionally characterized in Medicago and Arabidopsis. Transcripts of both MtSVP genes were abundant and broadly expressed in vegetative tissues but were detected at much lower levels in flowers in Medicago. Over-expression of the MtSVP genes in Arabidopsis resulted in delayed flowering and flowers with many abnormal phenotypes such as leafy sepals, changes to floral organ number and longer pedicels than the wild type. By contrast, in transgenic Medicago, over-expression of MtSVP1 resulted in alterations to flower development, but did not alter flowering time, suggesting that MtSVP1 may not function to repress the transition to flowering in Medicago.

  4. DNA as patentable subject matter and a narrow framework for addressing the perceived problems caused by gene patents.

    Science.gov (United States)

    Schilling, Stephen H

    2011-12-01

    Concerns about the alleged harmful effects of gene patents--including hindered research and innovation and impeded patient access to high-quality genetic diagnostic tests--have resulted in overreactions from the public and throughout the legal profession. These overreactions are exemplified by Association for Molecular Pathology v. U.S. Patent and Trademark Office, a 2010 case in the Southern District of New York that held that isolated DNA is unpatentable subject matter under 35 U.S.C. § 101. The problem with these responses is that they fail to adequately consider the role that gene patents and patents on similar biomolecules play in facilitating investment in the costly and risky developmental processes required to transform the underlying inventions into marketable products. Accordingly, a more precisely refined solution is advisable. This Note proposes a narrowly tailored set of solutions to address the concerns about gene patents without destroying the incentives for companies to create and commercialize inventions derived from these and similar patents.

  5. Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene.

    Science.gov (United States)

    Bhagavath, Bala; Layman, Lawrence C; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G; Kim, Hyung-Goo; Carr, Bruce R

    2014-08-05

    46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  6. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants

    Science.gov (United States)

    Sánchez, Karen; de Mendonca, Elizabeth; Matute, Xiorama; Chaustre, Ismenia; Villalón, Marlene; Takiff, Howard

    2016-01-01

    The mutations in the CFTR gene found in patients with cystic fibrosis (CF) have geographic differences, but there are scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in a group of Venezuelan patients with CF. The 27 exons of the CFTR gene from 110 Venezuelan patients in the National CF Program were amplified and sequenced. A total of 36 different mutations were identified, seven with frequencies greater than 1%: p.Phe508del (27.27%), p.Gly542* (3.18%), c.2988+1G>A (3.18%), p.Arg334Trp (1.36%), p.Arg1162* (1.36%), c.1-8G>C (1.36%), and p.[Gly628Arg;Ser1235Arg](1.36). In 40% of patients, all with a clinical diagnosis of CF, no mutations were found. This report represents the largest cohort of Venezuelan patients with CF ever examined, and includes a wider mutation panel than has been previously studied in this population. Mutations common in Southern European populations predominate, and several new mutations were discovered, but no mutations were found in 40% of the cohort. PMID:27022295

  7. Disease-causing mutations in exon 11 of the medium-chain acyl-CoA dehydrogenase gene

    DEFF Research Database (Denmark)

    Andresen, B S; Jensen, T G; Bross, P

    1994-01-01

    . Our results show that exon 11 is not especially mutation prone. We demonstrate that two of the identified disease-causing mutations can be detected by restriction enzyme digestion of the PCR product from the assay for the G985 mutation, a discovery that makes this assay even more useful than before......Medium-chain acyl-CoA dehydrogenase (MCAD) deficiency is the most commonly recognized defect of the mitochondrial beta-oxidation in humans. It is a potentially fatal, autosomal recessive inherited defect. Most patients with MCAD deficiency are homozygous for a single disease-causing mutation (G985....... On the basis of expression of wild-type and mutant MCAD protein in COS-7 cells, we show that the identified mutations abolish MCAD enzyme activity and that they therefore must be disease causing. The M301T, S311R, and K304E mutations are located in helix H, which makes up part of the dimer-dimer interface...

  8. A novel A792D mutation in the CSF1R gene causes hereditary diffuse leukoencephalopathy with axonal spheroids characterized by slow progression

    Directory of Open Access Journals (Sweden)

    Sakiho Ueda

    2015-03-01

    Full Text Available Hereditary diffuse leukoencephalopathy with spheroids (HDLS is an autosomal dominant white matter disease that causes adult-onset cognitive impairment. The clinical manifestations are a variable combination of personality and behavioral changes, cognitive decline, parkinsonism, spasticity, and epilepsy. In 2012, mutations in the gene encoding colony stimulating factor 1 receptor (CSF1R were identified as the cause of HDLS. As the numbers of reported mutations are limited, the understanding of whole pathogenesis needs accumulation of disease-causing mutations with detailed clinical descriptions. We describe a Japanese family with autosomal dominant adult-onset cognitive impairment and characteristic white matter lesions. Genetic testing revealed a novel p.A792D mutation in the tyrosine kinase domain of CSF1R in two affected family members. The symptom profile of the present cases mostly matched the previously reported cases, with the notable exceptions of late-onset and long disease duration.

  9. Mutations in the chromosome pairing gene FKBP6 are not a common cause of non-obstructive azoospermia

    NARCIS (Netherlands)

    Westerveld, G. H.; Repping, S.; Lombardi, M. P.; van der Veen, F.

    2005-01-01

    Although it is generally thought that spermatogenic failure has a genetic background, to date only a limited percentage of men with non-obstructive azoospermia (NOA) are diagnosed with a genetic defect. The only common and well-established genetic causes of NOA in humans are numerical and structural

  10. Mutations in the gene encoding B1 subunit of H+-ATPase cause renal tubular acidosis with sensorineural deafness

    NARCIS (Netherlands)

    Karet, FE; Finberg, KE; Nelson, RD; Nayir, A; Mocan, H; Sanjad, SA; Rodriguez-Soriano, J; Santos, F; Cremers, CWRJ; di Pietro, A; Hoffbrand, BI; Winiarski, J; Bakkaloglu, A; Ozen, S; Dusunsel, R; Goodyer, P; Hulton, SA; Wu, DK; Skvorak, AB; Morton, CC; Cunningham, MJ; Jha, [No Value; Lifton, RP

    H+-ATPases are ubiquitous in nature; V-ATPases pump protons against an electrochemical gradient, whereas F-ATPases reverse the process, synthesizing ATP. We demonstrate here that mutations in ATP6B1, encoding the B-subunit of the apical proton pump mediating distal nephron acid secretion, cause

  11. Gene conversion in the CYP11B2 gene encoding P450c11AS is associated with, but does not cause, the syndrome of corticosterone methyloxidase II deficiency

    Energy Technology Data Exchange (ETDEWEB)

    Fardella, C.E.; Hum, D.W.; Rodriguez, H. [Univ. of California, San Francisco, CA (United States)]|[Univ. of Colorado, Denver, CO (United States)] [and others

    1996-01-01

    Cytochrome P450c11AS (aldosterone synthase) has 11{beta}hydroxylase, 18-hydroxylase, and 18-oxidase activities and is expressed solely in the adrenal zona glomerulosa. Corticosterone methyloxidase II (CMOII) deficiency denotes a rare disorder of adrenal steroidogenesis in which only the 18-oxidase activity of P450c11AS is disrupted, while the 11{beta}-hydroxylase and 18-hydroxylase activities persist. Such patients have elevated serum concentrations of corticosterone and 18-hydroxycorticosterone and very low or unmeasurable concentrations of aldosterone, often resulting in a clinical salt-losing crisis in infancy. We have sought mutations causing CMOII deficiency in outbred populations. In three of four unrelated P450c11AS alleles from two unrelated patients with CMOII deficiency, we found a gene conversion event in which exons 3 and 4 of the CYP11B2 gene encoding P450c11AS were changed to the sequence of the nearby CYP11B1 gene, which encodes the related enzyme P450c11{beta}. This conversion resulted in a mutant P450c11AS protein carrying three changes. We built seven vectors expressing P450c11AS carrying each mutation singly, each of the three possible pairs of mutations, and the triple mutation as found in the proband. The activities in steroidogenic MA-10 and JEG-3 cells were 10- to 20-fold higher. In these systems all of the mutants retained normal 18-oxidase activity, indicating that the detected gene conversion event is associated with but does not cause CMOII deficiency. None of the four CPY11B2 alleles in these two patients bore other identifiable mutations. These patients might have mutations in the promoters or other noncoding regions, or mutations in genes other than CYP11B2 may cause the syndrome of CMOII deficiency. 37 refs., 2 figs., 2 tabs.

  12. Congenital lipoid adrenal hyperplasia caused by a novel splicing mutation in the gene for the steroidogenic acute regulatory protein.

    Science.gov (United States)

    González, Alexis A; Reyes, M Loreto; Carvajal, Cristian A; Tobar, Jaime A; Mosso, Lorena M; Baquedano, Paulina; Solar, Antonieta; Venegas, Alejandro; Fardella, Carlos E

    2004-02-01

    Steroidogenic acute regulatory protein (StAR) plays a crucial role in the transport of cholesterol from the cytoplasm to the inner mitochondrial membrane, facilitating its conversion to pregnenolone by cytochrome P450scc. Its essential role in steroidogenesis was demonstrated after observing that StAR gene mutations gave rise to a potentially lethal disease named congenital lipoid adrenal hyperplasia, in which virtually no steroids are produced. We report here a 2-month-old female patient, karyotype 46XY, who presented with growth failure, convulsions, dehydration, hypoglycemia, hyponatremia, hypotension, and severe hyperpigmentation suggestive of adrenal insufficiency. Serum cortisol, 17OH-progesterone, dehydroepiandrosterone sulfate, testosterone, 17OH-pregnenolone, and aldosterone levels were undetectable in the presence of high ACTH and plasma renin activity levels. Immunohistochemical analysis of testis tissues revealed the absence of StAR protein. Molecular analysis of StAR gene demonstrated a homozygous G to T mutation within the splice donor site of exon 1 (IVS1 + 1G>T). Her parents and one brother were heterozygous for this mutation. In vitro analysis of the mutation was performed in COS cells transfected with minigenes coding regions spanning exon-intron 1 to 3 carrying the mutant and the wild-type sequences. RT-PCR analyses of the mutant gene showed an abnormal mRNA transcript of 2430 bp (normal size 433 bp). Sequence analysis of the mutant mRNA demonstrated the retention of intron 1. Immunolocalization of the StAR minigene product detected the peptide in the mitochondria of COS cells transfected with the wild-type minigene but not in those transfected with the mutant minigene. We conclude that this mutation gives rise to a truncated StAR protein, which lacks an important N-terminal region and the entire lipid transfer domain.

  13. Identification of a Novel Gene on 10q22.1 Causing Autosomal Dominant Retinitis Pigmentosa (adRP).

    Science.gov (United States)

    Daiger, Stephen P; Sullivan, Lori S; Bowne, Sara J; Koboldt, Daniel C; Blanton, Susan H; Wheaton, Dianna K; Avery, Cheryl E; Cadena, Elizabeth D; Koenekoop, Robert K; Fulton, Robert S; Wilson, Richard K; Weinstock, George M; Lewis, Richard A; Birch, David G

    2016-01-01

    Whole-genome linkage mapping identified a region on chromosome 10q21.3-q22.1 with a maximum LOD score of 3.0 at 0 % recombination in a six-generation family with autosomal dominant retinitis pigmentosa (adRP). All known adRP genes and X-linked RP genes were excluded in the family by a combination of methods. Whole-exome next-generation sequencing revealed a missense mutation in hexokinase 1, HK1 c.2539G > A, p.Glu847Lys, tracking with disease in all affected family members. One severely-affected male is homozygous for this region by linkage analysis and has two copies of the mutation. No other potential mutations were detected in the linkage region nor were any candidates identified elsewhere in the genome. Subsequent testing detected the same mutation in four additional, unrelated adRP families, for a total of five mutations in 404 probands tested (1.2 %). Of the five families, three are from the Acadian population in Louisiana, one is French Canadian and one is Sicilian. Haplotype analysis of the affected chromosome in each family and the homozygous individual revealed a rare, shared haplotype of 450 kb, suggesting an ancient founder mutation. HK1 is a widely-expressed gene, with multiple, abundant retinal transcripts, coding for hexokinase 1. Hexokinase catalyzes phosphorylation of glucose to glusose-6-phospate, the first step in glycolysis. The Glu847Lys mutation is in a highly-conserved site, outside of the active site or known functional sites.

  14. Subacute activation of mGlu4 receptors causes the feedback inhibition of its gene expression in rat brain.

    Science.gov (United States)

    Pershina, E V; Arkhipov, V I

    2016-05-15

    The present study aimed to understand the relationship between pharmacological activation of mGlu4 receptors and regulation of its gene in the hippocampus. The expression level of the GRM4 gene, encoding mGluR4 receptors, was studied in the hippocampus and frontal cortex of rats after pharmacological activation of the receptor with positive allosteric modulator (E)-4-(2-Phenylethenyl)-2-pyrimidinamine (TCN 238). The drug was injected subcutaneously four times at a dose of 2mg/kg. The animals were previously trained with hippocampal-dependent task and after the treatment were tested for memory retrieval. The expression level of GRM4 was determined by qRT-PCR in control and experimental groups of animals one and five days post-treatment. We found that TCN 238 did not affect the performance of the learned task. However, the expression level of GRM4 in the hippocampus was reliable down-regulated five days after treatment with TCN 238. In addition, we showed that the expression level of GABRA1, encoding GABAA α-subunit was downregulated five days after the treatment in the frontal cortex. Subacute pharmacological intervention in mGluR activity by the selective positive modulator TCN 238 has led to adaptive rearrangements of transcription processes in the hippocampus. Moreover, this regulation affected GABA system, confirming importance of the brain excitation-inhibition balance. Since the pharmacological influence on mGluR activity can be regarded as a promising tool aimed to correct brain dysfunction, the properties of mGluR modulators should be studied in more detail, including the level of gene transcription. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. A gene defect causing a novel progressive epilepsy with mental retardation, EPMR, maps to chromosome 8p

    Energy Technology Data Exchange (ETDEWEB)

    Ranta, S.; Tahvanainen, E.; Karila, E. [Univ. of Helsinki (Finland)] [and others

    1994-09-01

    EPMR (progressive epilepsy with mental retardation) is a newly discovered autosomal recessively inherited disorder which occurs with high frequency in an isolated rural population in Finland. So far 25 patients have been identified, 21 of whom are alive. Twenty-three patients share a common ancestor from the 18th century. The main features of EPMR are: normal early development, tonic-clonic seizures with onset between ages 5 and 10, and mental retardation which begins approximately 2 years after the onset of epilepsy and soon leads to deepening mental retardation. Adult patients do not manage their daily life without help. The EEG is normal at the onset of epilepsy but later progressive slowing of the background activity occurs. The etiology and pathogenesis of EPMR remain known. As this is a novel disease entity without any definitive diagnostic marker we wished to begin its elucidation by first defining its gene locus. A random search for linkage in four multiplex families (only 20 individuals tested) resulted in the finding of linkage to marker D8S264 with a lod score of 4.45 at zero recombination. The EPMR gene resides in a 7 centimorgan interval between marker loci AFM185xb2 and D8S262 with a maximum multipoint lod score of 7.03 at 1.8 centimorgans proximal to D8S264. Physically this region is very distal on 8p. Of the sixteen EPMR chromosomes haplotyped 15 were identical or almost identical. One chromosome, however, had a distinctly different haplotype raising the possibility of there being two different mutations or one very old mutation. These findings are a starting point toward isolating and characterizing the gene and its protein product. Physical mapping has been initiated by isolating nine YACs from the region.

  16. Analysis of the CFTR gene in Venezuelan cystic fibrosis patients, identification of six novel cystic fibrosis-causing genetic variants

    Directory of Open Access Journals (Sweden)

    Sánchez K

    2016-03-01

    Full Text Available Karen Sánchez,1 Elizabeth de Mendonca,1 Xiorama Matute,2 Ismenia Chaustre,2 Marlene Villalón,3 Howard Takiff4 1Unit of Genetic and Forensic Studies, Venezuelan Institute for Scientific Research (IVIC, 2Hospital JM de los Ríos, 3Hospital José Ignacio Baldo, Algodonal, National Reference Unit, 4Laboratory of Molecular Genetics, Venezuelan Institute for Scientific Research (IVIC, Caracas, Venezuela. Abstract: The mutations in the CFTR gene found in patients with cystic fibrosis (CF have geographic differences, but there are scant data on their prevalence in Venezuelan patients. This study determined the frequency of common CFTR gene mutations in a group of Venezuelan patients with CF. The 27 exons of the CFTR gene from 110 Venezuelan patients in the National CF Program were amplified and sequenced. A total of 36 different mutations were identified, seven with frequencies greater than 1%: p.Phe508del (27.27%, p.Gly542* (3.18%, c.2988+1G.A (3.18%, p.Arg334Trp (1.36%, p.Arg1162* (1.36%, c.1-8G.C (1.36%, and p.[Gly628Arg;Ser1235Arg](1.36. In 40% of patients, all with a clinical diagnosis of CF, no mutations were found. This report represents the largest cohort of Venezuelan patients with CF ever examined, and includes a wider mutation panel than has been previously studied in this population. Mutations common in Southern European populations predominate, and several new mutations were discovered, but no mutations were found in 40% of the cohort. Keywords: c.49_50dupTT, c.3963+1G.A, p.Asp373Asn, p.Glu815*, p.Asn900Lys, p.Trp277*

  17. A novel mutation in ABCA1 gene causing Tangier Disease in an Italian family with uncommon neurological presentation

    Directory of Open Access Journals (Sweden)

    Marco Ceccanti

    2016-11-01

    Full Text Available Tangier disease is an autosomal recessive disorder characterized by severe reduction in HDL-cholesterol and peripheral lipid storage. We describe a family with c.5094C>A p.Tyr16980* mutation in the ABCA1 gene, clinically characterized by syringomyelic-like anesthesia, demyelinating multineuropathy and reduction in intraepidermal small fibers innervation. In the proband patient, cardiac involvement determined a myocardial infarction; lipid storage was demonstrated in gut, cornea and aortic wall. The reported ABCA1 mutation has never been described before in a Tangier family.

  18. Mutations in mitochondrial carrier family gene SLC25A38 cause nonsyndromic autosomal recessive congenital sideroblastic anemia.

    Science.gov (United States)

    Guernsey, Duane L; Jiang, Haiyan; Campagna, Dean R; Evans, Susan C; Ferguson, Meghan; Kellogg, Mark D; Lachance, Mathieu; Matsuoka, Makoto; Nightingale, Mathew; Rideout, Andrea; Saint-Amant, Louis; Schmidt, Paul J; Orr, Andrew; Bottomley, Sylvia S; Fleming, Mark D; Ludman, Mark; Dyack, Sarah; Fernandez, Conrad V; Samuels, Mark E

    2009-06-01

    The sideroblastic anemias are a heterogeneous group of congenital and acquired hematological disorders whose morphological hallmark is the presence of ringed sideroblasts--bone marrow erythroid precursors containing pathologic iron deposits within mitochondria. Here, by positional cloning, we define a previously unknown form of autosomal recessive nonsyndromic congenital sideroblastic anemia, associated with mutations in the gene encoding the erythroid specific mitochondrial carrier family protein SLC25A38, and demonstrate that SLC25A38 is important for the biosynthesis of heme in eukaryotes.

  19. Conditional beta1-integrin gene deletion in neural crest cells causes severe developmental alterations of the peripheral nervous system

    DEFF Research Database (Denmark)

    Pietri, Thomas; Eder, Olivier; Breau, Marie Anne

    2004-01-01

    Integrins are transmembrane receptors that are known to interact with the extracellular matrix and to be required for migration, proliferation, differentiation and apoptosis. We have generated mice with a neural crest cell-specific deletion of the beta1-integrin gene to analyse the role of beta1-....... There was an almost complete absence of Schwann cells and sensory axon segregation and defective maturation in neuromuscular synaptogenesis. Thus, beta1-integrins are important for the control of embryonic and postnatal peripheral nervous system development....

  20. Ectopic expression of the HAM59 gene causes homeotic transformations of reproductive organs in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Shulga, O A; Neskorodov, Ya B; Shchennikova, A V; Gaponenko, A K; Skryabin, K G

    2015-01-01

    The function of the HAM59 MADS-box gene in sunflower (Helianthus annuus L.) was studied to clarify homeotic C activity in the Asteraceae plant family. For the first time, transgenic sunflower plants with a modified pattern of HAM59 expression were obtained. It was shown that the HAM59 MADS-box transcription factor did mediate C activity in sunflower. In particular, it participated in termination of the floral meristem, repression of the cadastral function of A-activity, and together with other C-type sunflower protein HAM45-in the specification of the identity of stamens and pistils.

  1. Mutations in extracellular matrix genes NID1 and LAMC1 cause autosomal dominant Dandy-Walker malformation and occipital cephaloceles.

    Science.gov (United States)

    Darbro, Benjamin W; Mahajan, Vinit B; Gakhar, Lokesh; Skeie, Jessica M; Campbell, Elizabeth; Wu, Shu; Bing, Xinyu; Millen, Kathleen J; Dobyns, William B; Kessler, John A; Jalali, Ali; Cremer, James; Segre, Alberto; Manak, J Robert; Aldinger, Kimerbly A; Suzuki, Satoshi; Natsume, Nagato; Ono, Maya; Hai, Huynh Dai; Viet, Le Thi; Loddo, Sara; Valente, Enza M; Bernardini, Laura; Ghonge, Nitin; Ferguson, Polly J; Bassuk, Alexander G

    2013-08-01

    We performed whole-exome sequencing of a family with autosomal dominant Dandy-Walker malformation and occipital cephaloceles and detected a mutation in the extracellular matrix (ECM) protein-encoding gene NID1. In a second family, protein interaction network analysis identified a mutation in LAMC1, which encodes a NID1-binding partner. Structural modeling of the NID1-LAMC1 complex demonstrated that each mutation disrupts the interaction. These findings implicate the ECM in the pathogenesis of Dandy-Walker spectrum disorders. © 2013 WILEY PERIODICALS, INC.

  2. TMPRSS2-ERG Gene Fusion Causing ERG Overexpression Precedes Chromosome Copy Number Changes in Prostate Carcinomas, Paired HGPIN Lesions

    Directory of Open Access Journals (Sweden)

    Nuno Cerveira

    2006-10-01

    Full Text Available TMPRSS2-ETS gene fusions have been found recurrently in prostate carcinomas, but not in the presumed precursor lesion, high-grade prostatic intraepithelial neoplasia (HGPIN. However, HGPIN lesions may share chromosomal changes with prostate cancer. To determine the relative order of genetic events in prostate carcinogenesis, we have analyzed 34 prostate carcinomas, 19 paired HGPIN lesions, 14 benign prostate hyperplasias, 11 morphologically normal prostatic tissues for TMPRSS2-ERG, TMPRSS2-ETV1 rearrangements, genomic imbalances. TMPRSS2 exon 1 was fused in-frame with ERG exon 4 in 17 of 34 (50% prostate carcinomas, in 4 of 19 (21% HGPIN lesions, but in none of controls. The findings were further validated by sequencing analysis, by the real-time polymerase chain reaction quantification of TMPRSS2-ERG fusion transcript, the ERG exons 5/6:exons 1/2 expression ratio. Chromosome copy number changes were detected by comparative genomic hybridization in 42% of clinically confined carcinomas, in none of the 16 HGPIN lesions analyzed. We demonstrate for the first time that the TMPRSS2-ERG fusion gene can be detected in a proportion of HGPIN lesions, that this molecular rearrangement is an early event that may precede chromosome-level alterations in prostate carcinogenesis.

  3. Genome-wide search for CLN2, the gene causing late-infantile neuronal ceroid-lipofuscinosis (LNCL)

    Energy Technology Data Exchange (ETDEWEB)

    Haines, J.L.; Worster, T.; Ter-Minassian, M. [Massachusetts General Hospital, Charlestown, MA (United States)] [and others

    1995-06-05

    The loci for juvenile (CLN3) and infantile (CLN1) neuronal ceroid lipofuscinosis (NCL) types have been mapped by genetic linkage analysis to chromosome arms 16p and 1p, respectively. The late-infantile defect CLN2 has not yet been mapped, although linkage analysis with tightly linked markers excludes it from both the JNCL and INCL loci. We have initiated a genome-wide search for the LNCL gene, taking advantage of the large collection of highly polymorphic markers that has been developed through the Human Genome Initiative. The high degree of heterozygosity of these markers makes it possible to carry out successful linkage analysis in small nuclear families, such as found in LNCL. Our current collection of LNCL pedigrees includes 19 US families and 11 Costa Rican families. To date, we have completed typing with over 50 markers on chromosomes 2, 9, 13, and 18-22. The results of this analysis formally exclude about 10% of the human genome as the location of the LNCL gene. 14 refs., 3 tabs.

  4. Sensory ataxic neuropathy in golden retriever dogs is caused by a deletion in the mitochondrial tRNATyr gene.

    Science.gov (United States)

    Baranowska, Izabella; Jäderlund, Karin Hultin; Nennesmo, Inger; Holmqvist, Erik; Heidrich, Nadja; Larsson, Nils-Göran; Andersson, Göran; Wagner, E Gerhart H; Hedhammar, Ake; Wibom, Rolf; Andersson, Leif

    2009-05-01

    Sensory ataxic neuropathy (SAN) is a recently identified neurological disorder in golden retrievers. Pedigree analysis revealed that all affected dogs belong to one maternal lineage, and a statistical analysis showed that the disorder has a mitochondrial origin. A one base pair deletion in the mitochondrial tRNA(Tyr) gene was identified at position 5304 in affected dogs after re-sequencing the complete mitochondrial genome of seven individuals. The deletion was not found among dogs representing 18 different breeds or in six wolves, ruling out this as a common polymorphism. The mutation could be traced back to a common ancestor of all affected dogs that lived in the 1970s. We used a quantitative oligonucleotide ligation assay to establish the degree of heteroplasmy in blood and tissue samples from affected dogs and controls. Affected dogs and their first to fourth degree relatives had 0-11% wild-type (wt) sequence, while more distant relatives ranged between 5% and 60% wt sequence and all unrelated golden retrievers had 100% wt sequence. Northern blot analysis showed that tRNA(Tyr) had a 10-fold lower steady-state level in affected dogs compared with controls. Four out of five affected dogs showed decreases in mitochondrial ATP production rates and respiratory chain enzyme activities together with morphological alterations in muscle tissue, resembling the changes reported in human mitochondrial pathology. Altogether, these results provide conclusive evidence that the deletion in the mitochondrial tRNA(Tyr) gene is the causative mutation for SAN.

  5. Sensory ataxic neuropathy in golden retriever dogs is caused by a deletion in the mitochondrial tRNATyr gene.

    Directory of Open Access Journals (Sweden)

    Izabella Baranowska

    2009-05-01

    Full Text Available Sensory ataxic neuropathy (SAN is a recently identified neurological disorder in golden retrievers. Pedigree analysis revealed that all affected dogs belong to one maternal lineage, and a statistical analysis showed that the disorder has a mitochondrial origin. A one base pair deletion in the mitochondrial tRNA(Tyr gene was identified at position 5304 in affected dogs after re-sequencing the complete mitochondrial genome of seven individuals. The deletion was not found among dogs representing 18 different breeds or in six wolves, ruling out this as a common polymorphism. The mutation could be traced back to a common ancestor of all affected dogs that lived in the 1970s. We used a quantitative oligonucleotide ligation assay to establish the degree of heteroplasmy in blood and tissue samples from affected dogs and controls. Affected dogs and their first to fourth degree relatives had 0-11% wild-type (wt sequence, while more distant relatives ranged between 5% and 60% wt sequence and all unrelated golden retrievers had 100% wt sequence. Northern blot analysis showed that tRNA(Tyr had a 10-fold lower steady-state level in affected dogs compared with controls. Four out of five affected dogs showed decreases in mitochondrial ATP production rates and respiratory chain enzyme activities together with morphological alterations in muscle tissue, resembling the changes reported in human mitochondrial pathology. Altogether, these results provide conclusive evidence that the deletion in the mitochondrial tRNA(Tyr gene is the causative mutation for SAN.

  6. Characterization of Alu and recombination-associated motifs mediating a large homozygous SPG7 gene rearrangement causing hereditary spastic paraplegia.

    Science.gov (United States)

    López, Eva; Casasnovas, Carlos; Giménez, Javier; Matilla-Dueñas, Antoni; Sánchez, Ivelisse; Volpini, Víctor

    2015-04-01

    Spastic paraplegia type 7 (SPG7) is one of the most common forms of autosomal recessive hereditary spastic paraplegia (AR-HSP). Although over 77 different mutations have been identified in SPG7 patients, only 9 gross deletions have been reported with only a few of them being fully characterized. Here, we present a detailed description of a large homozygous intragenic SPG7 gene rearrangement involving a 5144-base pair (bp) genomic loss (c. 1450-446_1779 + 746 delinsAAAGTGCT) encompassing exons 11 to 13, identified in a Spanish AR-HSP family. Analysis of the deletion junction sequences revealed that the 5' breakpoint of this SPG7 gene deletion was located within highly homologous Alu sequences where the 3' breakpoint appears to be flanked by the core crossover hotspot instigator (chi)-like sequence (GCTGG). Furthermore, an 8-bp (AAAGTTGCT) conserved sequence at the breakpoint junction was identified, suggesting that the most likely mechanism for the occurrence of this rearrangement is by Alu microhomology and chi-like recombination-associated motif-mediated multiple exon deletion. Our results are consistent with non-allelic homologous recombination and non-homologous end joining in deletion mutagenesis for the generation of rearrangements. This study provides more evidence associating repeated elements as a genetic mechanism underlying neurodegenerative disorders, highlighting their importance in human diseases.

  7. Novel Hypomorphic Alleles of the Mouse Tyrosinase Gene Induced by CRISPR-Cas9 Nucleases Cause Non-Albino Pigmentation Phenotypes.

    Directory of Open Access Journals (Sweden)

    Anil K Challa

    Full Text Available Tyrosinase is a key enzyme in melanin biosynthesis. Mutations in the gene encoding tyrosinase (Tyr cause oculocutaneous albinism (OCA1 in humans. Alleles of the Tyr gene have been useful in studying pigment biology and coat color formation. Over 100 different Tyr alleles have been reported in mice, of which ≈24% are spontaneous mutations, ≈60% are radiation-induced, and the remaining alleles were obtained by chemical mutagenesis and gene targeting. Therefore, most mutations were random and could not be predicted a priori. Using the CRISPR-Cas9 system, we targeted two distinct regions of exon 1 to induce pigmentation changes and used an in vivo visual phenotype along with heteroduplex mobility assays (HMA as readouts of CRISPR-Cas9 activity. Most of the mutant alleles result in complete loss of tyrosinase activity leading to an albino phenotype. In this study, we describe two novel in-frame deletion alleles of Tyr, dhoosara (Sanskrit for gray and chandana (Sanskrit for sandalwood. These alleles are hypomorphic and show lighter pigmentation phenotypes of the body and eyes. This study demonstrates the utility of CRISPR-Cas9 system in generating domain-specific in-frame deletions and helps gain further insights into structure-function of Tyr gene.

  8. Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

    Science.gov (United States)

    Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

    2016-05-01

    Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

  9. Scarlet fever is caused by a limited number of Streptococcus pyogenes lineages and is associated with the exotoxin genes ssa, speA and speC.

    Science.gov (United States)

    Silva-Costa, Catarina; Carriço, Joao A; Ramirez, Mario; Melo-Cristino, Jose

    2014-03-01

    Several outbreaks of scarlet fever caused by Streptococcus pyogenes were recently reported. Scarlet fever is historically considered a toxin-mediated disease, dependent on the production of the exotoxins SpeA and SpeC, but a strict association between scarlet fever and these exotoxins is not always detected. The aims of this study were to characterize the scarlet fever bacterial isolates recovered from patients in a Lisbon hospital and to identify any distinctive characteristics of such isolates. We characterized a collection of 303 pharyngeal S. pyogenes collected between 2002 and 2008. One-hundred and one were isolated from scarlet fever patients and 202 were associated to a diagnosis of tonsillo-pharyngitis. Isolates were characterized by T and emm typing, pulsed field gel electrophoresis profiling and superantigen gene profiling. The diversity of the scarlet fever isolates was lower than that of the pharyngitis isolates. Specific lineages of emm87, emm4 and emm3 were overrepresented in scarlet fever isolates but only 1 pulsed field gel electrophoresis major lineage was significantly associated with scarlet fever. Multivariate analysis indicated associations of ssa, speA and speC with scarlet fever. In nonoutbreak conditions, scarlet fever is caused by a number of distinct genetic lineages. The lower diversity of these isolates and the association with specific exotoxin genes indicates that some lineages are more prone to cause this presentation than others even in nonoutbreak conditions.

  10. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  11. Long-term gene therapy causes transgene-specific changes in the morphology of regenerating retinal ganglion cells.

    Directory of Open Access Journals (Sweden)

    Jennifer Rodger

    Full Text Available Recombinant adeno-associated viral (rAAV vectors can be used to introduce neurotrophic genes into injured CNS neurons, promoting survival and axonal regeneration. Gene therapy holds much promise for the treatment of neurotrauma and neurodegenerative diseases; however, neurotrophic factors are known to alter dendritic architecture, and thus we set out to determine whether such transgenes also change the morphology of transduced neurons. We compared changes in dendritic morphology of regenerating adult rat retinal ganglion cells (RGCs after long-term transduction with rAAV2 encoding: (i green fluorescent protein (GFP, or (ii bi-cistronic vectors encoding GFP and ciliary neurotrophic factor (CNTF, brain-derived neurotrophic factor (BDNF or growth-associated protein-43 (GAP43. To enhance regeneration, rats received an autologous peripheral nerve graft onto the cut optic nerve of each rAAV2 injected eye. After 5-8 months, RGCs with regenerated axons were retrogradely labeled with fluorogold (FG. Live retinal wholemounts were prepared and GFP positive (transduced or GFP negative (non-transduced RGCs injected iontophoretically with 2% lucifer yellow. Dendritic morphology was analyzed using Neurolucida software. Significant changes in dendritic architecture were found, in both transduced and non-transduced populations. Multivariate analysis revealed that transgenic BDNF increased dendritic field area whereas GAP43 increased dendritic complexity. CNTF decreased complexity but only in a subset of RGCs. Sholl analysis showed changes in dendritic branching in rAAV2-BDNF-GFP and rAAV2-CNTF-GFP groups and the proportion of FG positive RGCs with aberrant morphology tripled in these groups compared to controls. RGCs in all transgene groups displayed abnormal stratification. Thus in addition to promoting cell survival and axonal regeneration, vector-mediated expression of neurotrophic factors has measurable, gene-specific effects on the morphology of injured

  12. A Single Point Mutation in the Gene Encoding Gb3/CD77 Synthase Causes a Rare Inherited Polyagglutination Syndrome*

    Science.gov (United States)

    Suchanowska, Anna; Kaczmarek, Radoslaw; Duk, Maria; Lukasiewicz, Jolanta; Smolarek, Dorota; Majorczyk, Edyta; Jaskiewicz, Ewa; Laskowska, Anna; Wasniowska, Kazimiera; Grodecka, Magdalena; Lisowska, Elwira; Czerwinski, Marcin

    2012-01-01

    Rare polyagglutinable NOR erythrocytes contain three unique globoside (Gb4Cer) derivatives, NOR1, NORint, and NOR2, in which Gal(α1–4), GalNAc(β1–3)Gal(α1–4), and Gal(α1–4)GalNAc(β1–3)Gal(α1–4), respectively, are linked to the terminal GalNAc residue of Gb4Cer. NOR1 and NOR2, which both terminate with a Gal(α1–4)GalNAc- sequence, react with anti-NOR antibodies commonly present in human sera. While searching for an enzyme responsible for the biosynthesis of Gal(α1–4)GalNAc, we identified a mutation in the A4GALT gene encoding Gb3/CD77 synthase (α1,4-galactosyltransferase). Fourteen NOR-positive donors were heterozygous for the C>G mutation at position 631 of the open reading frame of the A4GALT gene, whereas 495 NOR-negative donors were homozygous for C at this position. The enzyme encoded by the mutated gene contains glutamic acid instead of glutamine at position 211 (substitution Q211E). To determine whether this mutation could change the enzyme specificity, we transfected a teratocarcinoma cell line (2102Ep) with vectors encoding the consensus Gb3/CD77 synthase and Gb3/CD77 synthase with Glu at position 211. The cellular glycolipids produced by these cells were analyzed by flow cytometry, high-performance thin-layer chromatography, enzymatic degradation, and MALDI-TOF mass spectrometry. Cells transfected with either vector expressed the P1 blood group antigen, which was absent from untransfected cells. Cells transfected with the vector encoding the Gb3/CD77 synthase with Glu at position 211 expressed both P1 and NOR antigens. Collectively, these results suggest that the C631G mutation alters the acceptor specificity of Gb3/CD77 synthase, rendering it able to catalyze synthesis of the Gal(α1–4)Gal and Gal(α1–4)GalNAc moieties. PMID:22965229

  13. A single point mutation in the gene encoding Gb3/CD77 synthase causes a rare inherited polyagglutination syndrome.

    Science.gov (United States)

    Suchanowska, Anna; Kaczmarek, Radoslaw; Duk, Maria; Lukasiewicz, Jolanta; Smolarek, Dorota; Majorczyk, Edyta; Jaskiewicz, Ewa; Laskowska, Anna; Wasniowska, Kazimiera; Grodecka, Magdalena; Lisowska, Elwira; Czerwinski, Marcin

    2012-11-02

    Rare polyagglutinable NOR erythrocytes contain three unique globoside (Gb4Cer) derivatives, NOR1, NOR(int), and NOR2, in which Gal(α1-4), GalNAc(β1-3)Gal(α1-4), and Gal(α1-4)GalNAc(β1-3)Gal(α1-4), respectively, are linked to the terminal GalNAc residue of Gb4Cer. NOR1 and NOR2, which both terminate with a Gal(α1-4)GalNAc- sequence, react with anti-NOR antibodies commonly present in human sera. While searching for an enzyme responsible for the biosynthesis of Gal(α1-4)GalNAc, we identified a mutation in the A4GALT gene encoding Gb3/CD77 synthase (α1,4-galactosyltransferase). Fourteen NOR-positive donors were heterozygous for the C>G mutation at position 631 of the open reading frame of the A4GALT gene, whereas 495 NOR-negative donors were homozygous for C at this position. The enzyme encoded by the mutated gene contains glutamic acid instead of glutamine at position 211 (substitution Q211E). To determine whether this mutation could change the enzyme specificity, we transfected a teratocarcinoma cell line (2102Ep) with vectors encoding the consensus Gb3/CD77 synthase and Gb3/CD77 synthase with Glu at position 211. The cellular glycolipids produced by these cells were analyzed by flow cytometry, high-performance thin-layer chromatography, enzymatic degradation, and MALDI-TOF mass spectrometry. Cells transfected with either vector expressed the P1 blood group antigen, which was absent from untransfected cells. Cells transfected with the vector encoding the Gb3/CD77 synthase with Glu at position 211 expressed both P1 and NOR antigens. Collectively, these results suggest that the C631G mutation alters the acceptor specificity of Gb3/CD77 synthase, rendering it able to catalyze synthesis of the Gal(α1-4)Gal and Gal(α1-4)GalNAc moieties.

  14. A mutation in the LAMC2 gene causes the Herlitz junctional epidermolysis bullosa (H-JEB in two French draft horse breeds

    Directory of Open Access Journals (Sweden)

    Guérin Gérard

    2003-03-01

    Full Text Available Abstract Epidermolysis bullosa (EB is a heterogeneous group of inherited diseases characterised by skin blistering and fragility. In humans, one of the most severe forms of EB known as Herlitz-junctional EB (H-JEB, is caused by mutations in the laminin 5 genes. EB has been described in several species, like cattle, sheep, dogs, cats and horses where the mutation, a cytosine insertion in exon 10 of the LAMC2 gene, was very recently identified in Belgian horses as the mutation responsible for JEB. In this study, the same mutation was found to be totally associated with the JEB phenotype in two French draft horse breeds, Trait Breton and Trait Comtois. This result provides breeders a molecular test to better manage their breeding strategies by genetic counselling.

  15. A novel c.1255G>T (p.D419Y) mutation in SH3BP2 gene causes cherubism in a Turkish family.

    Science.gov (United States)

    Dinckan, Nuriye; Guven, Yeliz; Kayserili, Hulya; Aktoren, Oya; Uyguner, Oya Zehra

    2012-11-01

    Cherubism (MIM no. 118400) is a rare autosomal dominant disorder characterized by bilateral multilocular lesions of the upper and lower jaws. The lesions usually manifest clinically during early childhood, progress until puberty, and regress in adulthood. SH3BP2 is the only gene currently known to be associated with cherubism. This study began with an 8-year-old boy who was referred owing to overgrowth of mandible. A panoramic radiograph revealed multilocular radiolucent lesions of the upper/lower jaws, suggestive of cherubism. Sequence analysis of SH3BP2 revealed a novel c.G1255T change in exon 9 of the gene where 80% of the disease-causing mutations were observed. We report here the clinical and molecular findings of a family with 3 affected members in two generations showing variable clinical expressivity with the regression of symptoms with advancing age and the lack of penetrance. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Mutations in the slow skeletal muscle fiber myosin heavy chain gene (MYH7) cause laing early-onset distal myopathy (MPD1).

    Science.gov (United States)

    Meredith, Christopher; Herrmann, Ralf; Parry, Cheryl; Liyanage, Khema; Dye, Danielle E; Durling, Hayley J; Duff, Rachael M; Beckman, Kaye; de Visser, Marianne; van der Graaff, Maaike M; Hedera, Peter; Fink, John K; Petty, Elizabeth M; Lamont, Phillipa; Fabian, Vicki; Bridges, Leslie; Voit, Thomas; Mastaglia, Frank L; Laing, Nigel G

    2004-10-01

    We previously linked Laing-type early-onset autosomal dominant distal myopathy (MPD1) to a 22-cM region of chromosome 14. One candidate gene in the region, MYH7, which is mutated in cardiomyopathy and myosin storage myopathy, codes for the myosin heavy chain of type I skeletal muscle fibers and cardiac ventricles. We have identified five novel heterozygous mutations--Arg1500Pro, Lys1617del, Ala1663Pro, Leu1706Pro, and Lys1729del in exons 32, 34, 35, and 36 of MYH7--in six families with early-onset distal myopathy. All five mutations are predicted, by in silico analysis, to locally disrupt the ability of the myosin tail to form the coiled coil, which is its normal structure. These findings demonstrate that heterozygous mutations toward the 3' end of MYH7 cause Laing-type early-onset distal myopathy. MYH7 is the fourth distal-myopathy gene to have been identified.

  17. Mitochondrial myopathy, sideroblastic anemia, and lactic acidosis: an autosomal recessive syndrome in Persian Jews caused by a mutation in the PUS1 gene.

    Science.gov (United States)

    Zeharia, Avraham; Fischel-Ghodsian, Nathan; Casas, Kari; Bykhocskaya, Yelena; Tamari, Hana; Lev, Dorit; Mimouni, Marc; Lerman-Sagie, Tally

    2005-05-01

    We report the seventh case of autosomal recessive inherited mitochondrial myopathy, lactic acidosis, and sideroblastic anemia The patient, a product of consanguineous Persian Jews, had the association of mental retardation, dysmorphic features, lactic acidosis, myopathy, and sideroblastic anemia. Muscle biopsy demonstrated low activity of complexes 1 and 4 of the respiratory chain. Electron microscopy revealed paracrystalline inclusions in most mitochondria. Southern blot of the mitochondrial DNA did not show any large-scale rearrangements. The patient was found to be homozygous for the 656C-->T mutation in the pseudouridine synthase 1 gene (PUS1). Mitochondrial myopathy, lactic acidosis, and sideroblastic anemia is an oxidative phosphorylation disorder causing sideroblastic anemia, myopathy, and, in some cases, mental retardation that is due to mutations in the nuclear-encoded PUS1 gene. This finding provides additional evidence that mitochondrial ribonucleic acid modification impacts the phenotypic expression of oxidative phosphorylation disorders.

  18. Characterization of a disease-causing Glu119-Lys mutation in the low-density lipoprotein receptor gene in two Danish families with heterozygous familial hypercholesterolemia

    DEFF Research Database (Denmark)

    Jensen, H K; Jensen, T G; Jensen, L G

    1994-01-01

    Mutations in the gene for the low-density lipoprotein receptor (LDL receptor) cause the autosomal dominant inherited disease familial hypercholesterolemia (FH). In 15 Danish patients with heterozygous FH we have screened exon 4 of the LDL receptor gene for point mutations and small rearrangements...... employing genomic DNA amplification and bidirectional solid-phase sequencing. Two subjects were found to be heterozygous for a guanine to adenine base substitution at nucleotide position 418 of the LDL receptor cDNA. This point mutation results in an amino acid change from glutamic acid to lysine at amino...... acid residue 119 in the third repeat of the cysteine-rich ligand binding domain of the mature LDL receptor. Disruption of LDL receptor function by the Glu119-Lys mutation was confirmed by site-directed mutagenesis and expression in COS-7 cells. By Western blotting the mutation was found to affect...

  19. Phage exposure causes dynamic shifts in the expression states of specific phase-variable genes of Campylobacter jejuni

    DEFF Research Database (Denmark)

    Aidley, Jack; Holst Sørensen, Martine C.; Bayliss, Christopher D.

    2017-01-01

    Phase variation (PV) creates phenotypic heterogeneity at high frequencies and in a reversible manner. This phenomenon allows bacteria to adapt to a variety of different environments and selective pressures. In Campylobacter jejuni this reversible adaptive process is mediated by mutations...... in homopolymeric G/C tracts. Many C. jejuni-specific phages are dependent on phase-variable surface structures for successful infection. We previously identified the capsular polysaccharide (CPS) moiety, MeOPN-GalfNAc, as a receptor for phage F336 and showed that phase-variable expression of the transferase...... for this CPS modification, cj1421, and two other phase-variable CPS genes generated phage resistance in C. jejuni. Here we investigate the population dynamics of C. jejuni NCTC11168 when exposed to phage F336 in vitro using a newly described method - the 28-locus-CJ11168 PV analysis. Dynamic switching...

  20. Hearing impairment caused by mutations in two different genes responsible for nonsyndromic and syndromic hearing loss within a single family.

    Science.gov (United States)

    Niepokój, Katarzyna; Rygiel, Agnieszka M; Jurczak, Piotr; Kujko, Aleksandra A; Śniegórska, Dominika; Sawicka, Justyna; Grabarczyk, Alicja; Bal, Jerzy; Wertheim-Tysarowska, Katarzyna

    2017-11-18

    Usher syndrome is rare genetic disorder impairing two human senses, hearing and vision, with the characteristic late onset of vision loss. This syndrome is divided into three types. In all cases, the vision loss is postlingual, while loss of hearing is usually prelingual. The vestibular functions may also be disturbed in Usher type 1 and sometimes in type 3. Vestibular areflexia is helpful in making a proper diagnosis of the syndrome, but, often, the syndrome is misdiagnosed as a nonsyndromic hearing loss. Here, we present a Polish family with hearing loss, which was clinically classified as nonsyndromic. After excluding mutations in the DFNB1 locus, we implemented the next-generation sequencing method and revealed that hearing loss was syndromic and mutations in the USH2A gene indicate Usher syndrome. This research highlights the importance of molecular analysis in establishing a clinical diagnosis of congenital hearing loss.

  1. Biofilm formation capability of enterococcal strains causing urinary tract infection vis-a-vis colonisation and correlation with enterococcal surface protein gene.

    Science.gov (United States)

    Garg, Shubha; Mohan, Balvinder; Taneja, Neelam

    2017-01-01

    Data regarding differences in biofilm formation among urinary isolates of enterococci causing nosocomial infection versus asymptomatic colonisation is lacking. Conflicting data are available for the role of enterococcal surface protein (esp) gene in the development of enterococcal biofilms. A total of 50 (25 each of asymptomatic bacteriuria and urinary tract infection (UTI) isolates were collected from admitted patients who had nosocomial acquisition of enterococci in urine culture (≥105 cfu/ml). Biofilm assay was done by the quantitative adherence assay. Screening for esp gene was carried out by polymerase chain reaction, and confocal laser scanning microscopy was used to examine biofilms. Out of 25 enterococcal isolates from asymptomatic patients, 9 (36%) isolates were found to be biofilm producers (6 weak [optical densities [OD]595 0.2] and three medium [OD595≥0.2 to595>0.5]). The esp gene was present in 30 (12 biofilm+, 18 biofilm-) isolates. Seventeen esp positive isolates were from asymptomatic cases whereas 13 were from UTI. However, we found that 100% of medium and strong biofilm producers were esp positive (P biofilm producers as compared to only 35% of E. faecium isolates (P > 0.05). The esp positivity was observed more in E. faecium isolates (65%) as compared to 40% in E. faecalis. Vancomycin-sensitive enterococcal and vancomycin-resistant enterococcal isolates and catheter-related and unrelated isolates showed similarity in biofilm production and esp positivity. The esp gene is not compulsorily required to produce biofilm but when present may enhance the biofilm formation. We did not find any correlation between biofilm formation and the ability of the strain to cause symptomatic UTI be associated with catheters or vancomycin resistance.

  2. Emergence of trimethoprim resistance gene dfrG in Staphylococcus aureus causing human infection and colonization in sub-Saharan Africa and its import to Europe.

    Science.gov (United States)

    Nurjadi, Dennis; Olalekan, Adesola O; Layer, Franziska; Shittu, Adebayo O; Alabi, Abraham; Ghebremedhin, Beniam; Schaumburg, Frieder; Hofmann-Eifler, Jonas; Van Genderen, Perry J J; Caumes, Eric; Fleck, Ralf; Mockenhaupt, Frank P; Herrmann, Mathias; Kern, Winfried V; Abdulla, Salim; Grobusch, Martin P; Kremsner, Peter G; Wolz, Christiane; Zanger, Philipp

    2014-09-01

    Co-trimoxazole (trimethoprim/sulfamethoxazole) is clinically valuable in treating skin and soft tissue infections (SSTIs) caused by community-associated methicillin-resistant Staphylococcus aureus (MRSA). The genetic basis of emerging trimethoprim/sulfamethoxazole resistance in S. aureus from Africa is unknown. Such knowledge is essential to anticipate its further spread. We investigated the molecular epidemiology of trimethoprim resistance in S. aureus collected in and imported from Africa. Five hundred and ninety-eight human S. aureus isolates collected at five locations across sub-Saharan Africa [Gabon, Namibia, Nigeria (two) and Tanzania] and 47 isolates from travellers treated at six clinics in Europe because of SSTIs on return from Africa were tested for susceptibility to trimethoprim, sulfamethoxazole and trimethoprim/sulfamethoxazole, screened for genes mediating trimethoprim resistance in staphylococci [dfrA (dfrS1), dfrB, dfrG and dfrK] and assigned to spa genotypes and clonal complexes. In 313 clinical and 285 colonizing S. aureus from Africa, 54% of isolates were resistant to trimethoprim, 21% to sulfamethoxazole and 19% to trimethoprim/sulfamethoxazole. We found that 94% of trimethoprim resistance was mediated by the dfrG gene. Of the 47 S. aureus isolates from travellers with SSTIs, 27 (57%) were trimethoprim resistant and carried dfrG. Markers of trimethoprim resistance other than dfrG were rare. The presence of dfrG genes in S. aureus was neither geographically nor clonally restricted. dfrG, previously perceived to be an uncommon cause of trimethoprim resistance in human S. aureus, is widespread in Africa and abundant in imported S. aureus from ill returning travellers. These findings may foreshadow the loss of trimethoprim/sulfamethoxazole for the empirical treatment of SSTIs caused by community-associated MRSA. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  3. Mutations in the sodium channel gene SCN2A cause neonatal epilepsy with late-onset episodic ataxia.

    Science.gov (United States)

    Schwarz, N; Hahn, A; Bast, T; Müller, S; Löffler, H; Maljevic, S; Gaily, E; Prehl, I; Biskup, S; Joensuu, T; Lehesjoki, A-E; Neubauer, B A; Lerche, H; Hedrich, U B S

    2016-02-01

    Mutations in SCN2A cause epilepsy syndromes of variable severity including neonatal-infantile seizures. In one case, we previously described additional childhood-onset episodic ataxia. Here, we corroborate and detail the latter phenotype in three further cases. We describe the clinical characteristics, identify the causative SCN2A mutations and determine their functional consequences using whole-cell patch-clamping in mammalian cells. In total, four probands presented with neonatal-onset seizures remitting after five to 13 months. In early childhood, they started to experience repeated episodes of ataxia, accompanied in part by headache or back pain lasting minutes to several hours. In two of the new cases, we detected the novel mutation p.Arg1882Gly. While this mutation occurred de novo in both patients, one of them carries an additional known variant on the same SCN2A allele, inherited from the unaffected father (p.Gly1522Ala). Whereas p.Arg1882Gly alone shifted the activation curve by -4 mV, the combination of both variants did not affect activation, but caused a depolarizing shift of voltage-dependent inactivation, and a significant increase in Na(+) current density and protein production. p.Gly1522Ala alone did not change channel gating. The third new proband carries the same de novo SCN2A gain-of-function mutation as our first published case (p.Ala263Val). Our findings broaden the clinical spectrum observed with SCN2A gain-of-function mutations, showing that fairly different biophysical mechanisms can cause a convergent clinical phenotype of neonatal seizures and later onset episodic ataxia.

  4. Delayed-onset enzootic bovine leukosis possibly caused by superinfection with bovine leukemia virus mutated in the pol gene.

    Science.gov (United States)

    Watanabe, Tadaaki; Inoue, Emi; Mori, Hiroshi; Osawa, Yoshiaki; Okazaki, Katsunori

    2015-08-01

    Bovine leukemia virus (BLV) is the causative agent of enzootic bovine leucosis (EBL), to which animals are most susceptible at 4-8 years of age. In this study, we examined tumor cells associated with EBL in an 18-year-old cow to reveal that the cells carried at least two different copies of the virus, one of which was predicted to encode a reverse transcriptase (RT) lacking ribonuclease H activity and no integrase. Such a deficient enzyme may exhibit a dominant negative effect on the wild-type RT and cause insufficient viral replication, resulting in delayed tumor development in this cow.

  5. Gene Therapy

    Science.gov (United States)

    Gene therapy Overview Gene therapy involves altering the genes inside your body's cells in an effort to treat or stop disease. Genes contain your ... that don't work properly can cause disease. Gene therapy replaces a faulty gene or adds a new ...

  6. Kidney adysplasia and variable hydronephrosis, a new mutation affecting the odd-skipped related 1 gene in the mouse, causes variable defects in kidney development and hydronephrosis.

    Science.gov (United States)

    Davisson, Muriel T; Cook, Susan A; Akeson, Ellen C; Liu, Don; Heffner, Caleb; Gudis, Polyxeni; Fairfield, Heather; Murray, Stephen A

    2015-06-15

    Many genes, including odd-skipped related 1 (Osr1), are involved in regulation of mammalian kidney development. We describe here a new recessive mutation (kidney adysplasia and variable hydronephrosis, kavh) in the mouse that leads to downregulation of Osr1 transcript, causing several kidney defects: agenesis, hypoplasia, and hydronephrosis with variable age of onset. The mutation is closely associated with a reciprocal translocation, T(12;17)4Rk, whose Chromosome 12 breakpoint is upstream from Osr1. The kavh/kavh mutant provides a model to study kidney development and test therapies for hydronephrosis. Copyright © 2015 the American Physiological Society.

  7. Café-au-lait macules and pediatric malignancy caused by biallelic mutations in the DNA mismatch repair (MMR) gene PMS2.

    Science.gov (United States)

    Jackson, Carl-Christian; Holter, Spring; Pollett, Aaron; Clendenning, Mark; Chou, Shirley; Senter, Leigha; Ramphal, Raveena; Gallinger, Steven; Boycott, Kym

    2008-06-01

    A 14-year-old male presented with a T4 sigmoid adenocarcinoma, lait macules. Family history was not suggestive of a dominant hereditary form of colorectal cancer. Evaluation of the tumor revealed abnormal immunohistochemical staining of the PMS2 protein and high frequency microsatellite instability. Germline analysis identified biallelic PMS2 missense mutations. A new cancer syndrome caused by biallelic mutations in the mismatch repair genes, including PMS2, is now emerging and is characterized by café-au-lait macules, colonic polyps and a distinctive tumor spectrum. (c) 2007 Wiley-Liss, Inc.

  8. A case report of primary ciliary dyskinesia, laterality defects and developmental delay caused by the co-existence of a single gene and chromosome disorder.

    LENUS (Irish Health Repository)

    Casey, Jillian P

    2015-01-01

    Primary ciliary dyskinesia (PCD) is a rare autosomal recessive disorder characterised by abnormal ciliary motion and impaired mucociliary clearance, leading to recurrent respiratory infections, sinusitis, otitis media and male infertility. Some patients also have laterality defects. We recently reported the identification of three disease-causing PCD genes in the Irish Traveller population; RSPH4A, DYX1C1 and CCNO. We have since assessed an additional Irish Traveller family with a complex phenotype involving PCD who did not have any of the previously identified PCD mutations.

  9. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    Understanding the evolutionary forces that influence variation in gene regulatory regions in natural populations is an important challenge for evolutionary biology because natural selection for such variations could promote adaptive phenotypic evolution. Recently, whole-genome sequence analyses have identified regulatory regions subject to natural selection. However, these studies could not identify the relationship between sequence variation in the detected regions and change in gene expression levels. We analyzed sequence variations in core promoter regions, which are critical regions for gene regulation in higher eukaryotes, in a natural population of Drosophila melanogaster, and identified core promoter sequence variations associated with differences in gene expression levels subjected to natural selection. Among the core promoter regions whose sequence variation could change transcription factor binding sites and explain differences in expression levels, three core promoter regions were detected as candidates associated with purifying selection or selective sweep and seven as candidates associated with balancing selection, excluding the possibility of linkage between these regions and core promoter regions. CHKov1, which confers resistance to the sigma virus and related insecticides, was identified as core promoter regions that has been subject to selective sweep, although it could not be denied that selection for variation in core promoter regions was due to linked single nucleotide polymorphisms in the regulatory region outside core promoter regions. Nucleotide changes in core promoter regions of CHKov1 caused the loss of two basal transcription factor binding sites and acquisition of one transcription factor binding site, resulting in decreased gene expression levels. Of nine core promoter regions regions associated with balancing selection, brat, and CG9044 are associated with neuromuscular junction development, and Nmda1 are associated with learning

  10. Haplotype association and synergistic effect of human aldosterone synthase (CYP11B2) gene polymorphisms causing susceptibility to essential hypertension in Indian patients.

    Science.gov (United States)

    Vamsi, Uppuluri Mohana; Swapna, Nagalingam; Padma, Gunda; Vishnupriya, Satti; Padma, Tirunilai

    Aldosterone synthase (CYP11B2) is a key enzyme involved in the terminal steps of aldosterone biosynthesis. Genetic variability in CYP11B2 gene has been associated with heterogeneous aldosterone production, which can affect sodium homeostasis and thereby regulation of blood pressure. Hence, the present study was aimed to explore the single-locus variations, haplotype and epistasis patterns of CYP11B2 (C-344T, intron-2 gene conversion and Lys173Arg) gene polymorphisms, and the risk contributed by them to the development of essential hypertension (EHT). A total of 279 hypertensive patients and 200 normotensive controls were enrolled in this study. C-344T and Lys173Arg polymorphisms of CYP11B2 gene were genotyped by PCR-RFLP method and intron-2 gene conversion (IC) polymorphism by allele-specific PCR analysis. Single-locus analysis revealed significant association of CYP11B2 C-344T and Lys173Arg polymorphisms with EHT (p < 0.05). Considering the sexes, Lys173 allele was found to be at risk for hypertension in males (OR 1.40; 95% CI = 1.01-1.96). Unphased haplotype analysis revealed H1 (T-Conv-Lys; p = 0.0017) to have significant risk for EHT, while haplotype H4 (T-Wt-Arg) had a significant protective effect. Multifactor dimensionality reduction (MDR) interaction analysis found the overall best model with C-344T and IC polymorphisms exhibiting strong synergistic effect. The present study revealed a strong synergistic effect of CYP11B2 C-344T and IC polymorphisms causing susceptibility to EHT and haplotype H1 (-344T-Conv-Lys173) as the risk-conferring factor for hypertension predisposition.

  11. Alcohol Exposure Causes Overexpression of Heart Development-Related Genes by Affecting the Histone H3 Acetylation via BMP Signaling Pathway in Cardiomyoblast Cells.

    Science.gov (United States)

    Shi, Jin; Zhao, Weian; Pan, Bo; Zheng, Min; Si, Lina; Zhu, Jing; Liu, Lingjuan; Tian, Jie

    2017-01-01

    Abusive alcohol utilization of pregnant woman may cause congenital heart disease (CHD) of fetus, where alcohol ignites histone H3 hyperacetylation leading to abnormal development of heart morphogenesis and associated genes. Knowledge about the regularized upstream genes is little, but bone morphogenetic protein (BMP) signaling may actively and prominently take part in alteration in acetylation of histone H3. The supreme objective of this study was to unearth the involvement of BMP signaling pathway in alcohol-driven hyperacetylation of histone H3 in cardiomyoblast cells. Cardiomyoblast cells (H9c2 cells) were addicted with alcohol (100 mM) for 24 hours. Dorsomorphin (5 μM) was used for the inhibition of BMP signaling pathway. We detected the phosphorylation activity of SMAD1/5/8, mRNA expression, histone acetyltransferases (HAT)/histone deacetylase (HDAC) activity, and acetylation of histone H3. Following alcohol exposure, phosphorylation of SMAD1/5/8 and HAT activities was increased to a significant extent, while histone H3 acetylation and expression of heart development-related genes were also increased. The said phenomenon influenced by alcohol was reverted upon dorsomorphin treatment to the cells without effecting HDAC activity. The data clearly identified that BMP-mediated histone H3 acetylation of heart development-related genes might be one of the possible cellular mechanisms to control alcohol-induced expression of heart development-related genes. Dorsomorphin, on the other hand, may modulate alcohol-induced hyperacetylation of histone H3 through BMP targeting, which could be a potential way to block CHD. Copyright © 2016 by the Research Society on Alcoholism.

  12. A new autosomal recessive syndrome consisting of posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disc drusen is caused by a MFRP gene mutation.

    Science.gov (United States)

    Ayala-Ramirez, Raul; Graue-Wiechers, Federico; Robredo, Violeta; Amato-Almanza, Monica; Horta-Diez, Iliana; Zenteno, Juan Carlos

    2006-12-04

    To describe the clinical and genetic characteristics of a new ophthalmic syndrome, which consists of posterior microphthalmos, retinitis pigmentosa, foveoschisis, and optic disc drusen, that segregates as an autosomal recessive trait in a family with four affected siblings. The membrane-type frizzled-related protein (MFRP) and CEH10 homeodomain-containing homolog (CHX10) genes, previously implicated in autosomal recessive forms of nanophthalmos/microphthalmos, were analyzed as candidate genes for this novel disease. Complete ophthalmologic examinations were performed in four affected siblings and their parents. Ophthalmologic manifestations, fundus photographs, ultrasonographic (US) assessment, electroretinography (ERG), fluorescein retinal angiography (FA), Goldmann kinetic perimetry (GKP), and optical coherence tomography (OCT), as well as mutational status of MFRP and CHX10 genes in genomic DNA. In all affected siblings, ophthalmologic examination demonstrated normal horizontal corneal diameters and high hyperopia; funduscopy, ERG, and FA evidenced a progressive retinal dystrophy compatible with retinitis pigmentosa; A- and B-mode ultrasonography revealed decreased axial eye length and optic disc drusen; OCT showed localized macular retinoschisis. MFRP molecular analysis disclosed a one base pair insertion in exon 5 (c.498_499insC) in all affected individuals, a mutation that predicts a truncated protein (P165fsX198). Both parents were heterozygous for this mutation. A distinct autosomal recessive ophthalmic syndrome characterized by microphthalmos, retinitis pigmentosa, foveoschisis, and optic disc drusen is described. We demonstrated that this clinical association is caused by a mutation in MFRP, a gene previously implicated in isolated nanophthalmos. Our data indicate that defects in MFRP could be responsible for syndromic forms of microphthalmos/retinal degeneration and that this gene is necessary for photoreceptor maintenance.

  13. A missense mutation in the arginine-vasopressin neurophysin-II gene causes autosomal dominant neurohypophyseal diabetes insipidus in a Chinese family.

    Science.gov (United States)

    Ye, Dan; Dong, FengQin; Lu, WeiQin; Zhang, Zhe; Lu, XunLiang; Li, ChengJiang; Liu, YanNing

    2013-06-01

    Familial neurohypophyseal diabetes insipidus, an autosomal dominant disorder, is mostly caused by mutations in the genes that encode AVP or its intracellular binding protein, neurophysin-II. The mutations lead to aberrant preprohormone processing and progressive destruction of AVP-secreting cells, which gradually manifests a progressive polyuria and polydipsia during early childhood, and a disorder of water homeostasis. We characterized the clinical and biochemical features, and sequenced the AVP neurophysin-II(AVP-NPII) gene of the affected individuals with autosomal dominant neurohypophyseal diabetes insipidus(ADNDI)to determine whether this disease was genetically determined. We obtained the histories of eight affected and four unaffected family individuals. The diagnosis of ADNDI was established using a water deprivation test and exogenous AVP administration. For molecular analysis, genomic DNA was extracted and the AVP-NPII gene was amplified using polymerase chain reaction and sequenced. The eight affected individuals showed different spectra of age of onsets (7-15 years) and urine volumes (132-253 ml/kg/24 h). All affected individuals responded to vasopressin administration, with a resolution of symptoms and an increase in urine osmolality by more than 50%. The characteristic hyperintense signal in the posterior pituitary on T1-weighted magnetic resonance imaging was absent in six family members and present in one. Sequencing analysis revealed a missense heterozygous mutation 1516G > T (Gly17Val) in exon 2 of the AVP-NPII gene among the ADNDI individuals. We identified a missense mutation in the AVP-NPII gene and the same mutation showed different spectra of age of onsets and urine volumes in a new Chinese family with ADNDI. The mutation may provide a molecular basis for understanding the characteristics of NPII and add to our knowledge of the pathogenesis of ADNDI, which would allow the presymptomatic diagnosis of asymptomatic subjects. © 2012 John Wiley

  14. Two single-base-pair substitutions causing desensitization to tryptophan feedback inhibition of anthranilate synthase and enhanced expression of tryptophan genes of Brevibacterium lactofermentum.

    Science.gov (United States)

    Matsui, K; Miwa, K; Sano, K

    1987-01-01

    A 5-fluorotryptophan-resistant mutant, termed 1041, was isolated from Brevibacterium lactofermentum AJ12036. The anthranilate synthase of 1041 was insensitive to feedback inhibition by tryptophan, and the specific activities of the anthranilate synthase and anthranilate phosphoribosyltransferase of 1041 were 29- and 23-fold higher than those in parental strain AJ12036, respectively. A single-base change (adenine to cytosine) that resulted in a Ser-to-Arg substitution was found in the trpE structural gene of 1041. This substitution was identified as the cause of the desensitization to feedback inhibition by tryptophan of anthranilate synthase in 1041. Another substitution (guanine to adenine) was found at a position in which a mutation would destabilize the rho-independent terminator structure within the putative attenuator. The enhanced synthesis of tryptophan enzymes in 1041 could be caused by this substitution in the attenuator. PMID:3667535

  15. Two novel mutations in the EYS gene are possible major causes of autosomal recessive retinitis pigmentosa in the Japanese population.

    Directory of Open Access Journals (Sweden)

    Katsuhiro Hosono

    Full Text Available Retinitis pigmentosa (RP is a highly heterogeneous genetic disease including autosomal recessive (ar, autosomal dominant (ad, and X-linked inheritance. Recently, arRP has been associated with mutations in EYS (Eyes shut homolog, which is a major causative gene for this disease. This study was conducted to determine the spectrum and frequency of EYS mutations in 100 Japanese arRP patients. To determine the prevalence of EYS mutations, all EYS exons were screened for mutations by polymerase chain reaction amplification, and sequence analysis was performed. We detected 67 sequence alterations in EYS, of which 21 were novel. Of these, 7 were very likely pathogenic mutations, 6 were possible pathogenic mutations, and 54 were predicted non-pathogenic sequence alterations. The minimum observed prevalence of distinct EYS mutations in our study was 18% (18/100, comprising 9 patients with 2 very likely pathogenic mutations and the remaining 9 with only one such mutation. Among these mutations, 2 novel truncating mutations, c.4957_4958insA (p.S1653KfsX2 and c.8868C>A (p.Y2956X, were identified in 16 patients and accounted for 57.1% (20/35 alleles of the mutated alleles. Although these 2 truncating mutations were not detected in Japanese patients with adRP or Leber's congenital amaurosis, we detected them in Korean arRP patients. Similar to Japanese arRP results, the c.4957_4958insA mutation was more frequently detected than the c.8868C>A mutation. The 18% estimated prevalence of very likely pathogenic mutations in our study suggests a major involvement of EYS in the pathogenesis of arRP in the Japanese population. Mutation spectrum of EYS in 100 Japanese patients, including 13 distinct very likely and possible pathogenic mutations, was largely different from the previously reported spectrum in patients from non-Asian populations. Screening for c.4957_4958insA and c.8868C>A mutations in the EYS gene may therefore be very effective for the genetic testing

  16. Mutations in the Caenorhabditis elegans orthologs of human genes required for mitochondrial tRNA modification cause similar electron transport chain defects but different nuclear responses.

    Directory of Open Access Journals (Sweden)

    Carmen Navarro-González

    2017-07-01

    Full Text Available Several oxidative phosphorylation (OXPHOS diseases are caused by defects in the post-transcriptional modification of mitochondrial tRNAs (mt-tRNAs. Mutations in MTO1 or GTPBP3 impair the modification of the wobble uridine at position 5 of the pyrimidine ring and cause heart failure. Mutations in TRMU affect modification at position 2 and cause liver disease. Presently, the molecular basis of the diseases and why mutations in the different genes lead to such different clinical symptoms is poorly understood. Here we use Caenorhabditis elegans as a model organism to investigate how defects in the TRMU, GTPBP3 and MTO1 orthologues (designated as mttu-1, mtcu-1, and mtcu-2, respectively exert their effects. We found that whereas the inactivation of each C. elegans gene is associated with a mild OXPHOS dysfunction, mutations in mtcu-1 or mtcu-2 cause changes in the expression of metabolic and mitochondrial stress response genes that are quite different from those caused by mttu-1 mutations. Our data suggest that retrograde signaling promotes defect-specific metabolic reprogramming, which is able to rescue the OXPHOS dysfunction in the single mutants by stimulating the oxidative tricarboxylic acid cycle flux through complex II. This adaptive response, however, appears to be associated with a biological cost since the single mutant worms exhibit thermosensitivity and decreased fertility and, in the case of mttu-1, longer reproductive cycle. Notably, mttu-1 worms also exhibit increased lifespan. We further show that mtcu-1; mttu-1 and mtcu-2; mttu-1 double mutants display severe growth defects and sterility. The animal models presented here support the idea that the pathological states in humans may initially develop not as a direct consequence of a bioenergetic defect, but from the cell's maladaptive response to the hypomodification status of mt-tRNAs. Our work highlights the important association of the defect-specific metabolic rewiring with the

  17. Assessing the residual CFTR gene expression in human nasal epithelium cells bearing CFTR splicing mutations causing cystic fibrosis.

    Science.gov (United States)

    Masvidal, Laia; Igreja, Susana; Ramos, Maria D; Alvarez, Antoni; de Gracia, Javier; Ramalho, Anabela; Amaral, Margarida D; Larriba, Sara; Casals, Teresa

    2014-06-01

    The major purpose of the present study was to quantify correctly spliced CFTR transcripts in human nasal epithelial cells from cystic fibrosis (CF) patients carrying the splicing mutations c.580-1G>T (712-1G>T) and c.2657+5G>A (2789+5G>A) and to assess the applicability of this model in CFTR therapeutic approaches. We performed the relative quantification of CFTR mRNA by reverse transcription quantitative PCR (RT-qPCR) of these splicing mutations in four groups (wild type, CF-F508del controls, CF patients and CF carriers) of individuals. In addition, in vitro assays using minigene constructs were performed to evaluate the effect of a new CF complex allele c.[2657+5G>A; 2562T>G]. Ex vivo qPCR data show that the primary consequence of both mutations at the RNA level is the skipping of their neighboring exon (6 and 16, respectively). The CFTR minigenes results mimicked the ex vivo data, as exon 16 skipping is the main aberrant transcript, and the correctly spliced transcript level was observed in a similar proportion when the c.2657+5G>A mutation is present. In summary, we provide evidence that ex vivo quantitative transcripts analysis using RT/qPCR is a robust technology that could be useful for measuring the efficacy of therapeutic approaches that attempt to achieve an increase in CFTR gene expression.

  18. Hearing loss caused by progressive degeneration of cochlear hair cells in mice deficient for the Barhl1 homeobox gene.

    Science.gov (United States)

    Li, Shengguo; Price, Sandy M; Cahill, Hugh; Ryugo, David K; Shen, Michael M; Xiang, Mengqing

    2002-07-01

    The cochlea of the mammalian inner ear contains three rows of outer hair cells and a single row of inner hair cells. These hair cell receptors reside in the organ of Corti and function to transduce mechanical stimuli into electrical signals that mediate hearing. To date, the molecular mechanisms underlying the maintenance of these delicate sensory hair cells are unknown. We report that targeted disruption of Barhl1, a mouse homolog of the Drosophila BarH homeobox genes, results in severe to profound hearing loss, providing a unique model for the study of age-related human deafness disorders. Barhl1 is expressed in all sensory hair cells during inner ear development, 2 days after the onset of hair cell generation. Loss of Barhl1 function in mice results in age-related progressive degeneration of both outer and inner hair cells in the organ of Corti, following two reciprocal longitudinal gradients. Our data together indicate an essential role for Barhl1 in the long-term maintenance of cochlear hair cells, but not in the determination or differentiation of these cells.

  19. Ectopic expression of the agouti gene in transgenic mice causes obesity, features of type II diabetes, and yellow fur

    Energy Technology Data Exchange (ETDEWEB)

    Klebig, M.L.; Woychik, R.P. [Oak Ridge National Laboratory, Oak Ridge, TN (United States); Wilkinson, J.E. [Univ. of Tennessee, Knoxville, TN (United States); Geisler, J.G. [Oak Ridge National Laboratory, Oak Ridge, TN (United States)]|[Univ. of Tennessee, Knoxville, TN (United States)

    1995-05-23

    Mice that carry the lethal yellow (A{sup y}) or viable yellow (A{sup vy}) mutation, two dominant mutations of the agouti (a) gene in mouse chromosome 2, exhibit a phenotype that includes yellow fur, marked obesity, a form of type II diabetes associated with insulin resistance, and an increased susceptibility to tumor development. Molecular analyses of these and several other dominant {open_quotes}obese yellow{close_quotes} a-locus mutations suggested that ectopic expression of the normal agouti protein gives rise to this complex pleiotropic phenotype. We have now tested this hypothesis directly by generating transgenic mice that ectopically express an agouti cDNA clone encoding the normal agouti protein in all tissues examined. Transgenic mice of both sexes have yellow fur, become obese, and develop hyperinsulinemia. In addition, male transgenic mice develop hyperglycemia by 12-20 weeks of age. These results demonstrate conclusively that the ectopic agouti expression is responsible for most, if not all, of the phenotypic traits of the dominant, obese yellow mutants. 42 refs., 5 figs.

  20. De Novo Mutation of Paternal IGF2 Gene Causing Silver-Russell Syndrome in a Sporadic Patient.

    Science.gov (United States)

    Liu, Deguo; Wang, Yajian; Yang, Xiu-An; Liu, Deyun

    2017-01-01

    Silver-Russell syndrome (SRS) is a rare, but well-recognized disease characterized by growth disorder. To date, there are two reports arguing IGF2 mutation for the onset of SRS. Herein, we present another sporadic case harboring IGF2 mutation. The male proband was the first and only child of a non-consanguineous Chinese couple. He was small for gestational age, with relative macrocephaly at birth. Severe feeding difficulties, low feeding, and growth retardation were revealed during neonatal period. At 4.5 years old, obvious body asymmetry was noted. Whole exome sequencing identified a novel de novo c.101G > A (p.Gly34Asp, NM_000612) variant in IGF2 and Sanger sequencing validated the variant. Amplification refractory mutation system polymerase chain reaction demonstrated that the IGF2 variant was on the paternal allele. Alignment shows the variant is evolutionarily conserved. Structural modeling argues that the variant site might be important for the binding of IGF2 to its receptor. Our study provides further evidence that IGF2 mutation may be another mechanism of SRS, and we consider that IGF2 should be included in a disease specific gene panel in case it is designed for SRS routine diagnostics.

  1. IL-8 gene polymorphism in acute biliary and non biliary pancreatitis: probable cause of high level parameters?

    Science.gov (United States)

    Ozen, Filiz; Yildirim, Ibrahim Halil; Ozemir, Ibrahim Ali; Ozlu, Can; Alimoglu, Orhan

    2017-01-01

    Backgrounds/Aims Inflammatory mediators of the innate immune response play fundamental roles in the pathogenesis of acute pancreatitis. The correlation between interleukin-8 (IL-8) gene polymorphism with types of acute pancreatitis and severity of pancreatitis, was evaluated in this study. Methods According to the diagnostic criteria, 176 patients with acute pancreatitis were grouped into biliary (n=83) and nonbiliary pancreatitis (n=93). Healthy blood donors (n=100) served as controls. Serum alanine transaminase, aspartate transaminase, total and direct bilirubin, amylase, lypase, white blood cell count and c-reactive protein levels were evaluated to correlate with IL-8 rs4073 (-251T/A) polymorphism, which was analyzed using a real-time polymerase chain reaction method with melting point analysis. Results The IL-8 AA genotype was detected with a significantly higher frequency among the patients with acute biliary pancreatitis having higher alanine transaminase levels than the median range. Homozygote alleles were significantly higher among patients with acute biliary pancreatitis having amylase levels higher than the median range. Conclusions Determination of the frequency of IL-8 polymorphism in acute pancreatitis is informative and provides further evidence concerning the role of IL-8 in laboratory tests. PMID:28317043

  2. Outcome Measures for Clinical Trials of Leber Congenital Amaurosis Caused by the Intronic Mutation in the CEP290 Gene.

    Science.gov (United States)

    Jacobson, Samuel G; Cideciyan, Artur V; Sumaroka, Alexander; Roman, Alejandro J; Charng, Jason; Lu, Monica; Choi, Windy; Sheplock, Rebecca; Swider, Malgorzata; Kosyk, Mychajlo S; Schwartz, Sharon B; Stone, Edwin M; Fishman, Gerald A

    2017-05-01

    To determine efficacy outcome measures for clinical trials of Leber congenital amaurosis (LCA) associated with a common intronic mutation in the CEP290 gene. CEP290-LCA patients (ages 5-48) with the intronic mutation (c.2991+1655A>G) were studied as a retrospective observational case series using clinical methods and with full-field sensitivity testing (FST), optical coherence tomography (OCT), autofluorescence imaging (NIR-RAFI), transient pupillary light reflex (TPLR), oculomotor control and instability (OCI), a mobility course, and a questionnaire (NEI-VFQ). Patients were investigated cross-sectionally but a subset was able to be followed longitudinally. With FST, there was no rod function; cone sensitivities had a wide range from not detectable to near normal. OCT analyses indicated retained central photoreceptors with abnormal distal laminae. Based on OCT and FST, most patients had dissociation of structure and function. TPLR was nondetectable in the majority of patients, with responders demonstrating severe losses in light sensitivity. OCI was abnormal in most patients. NEI-VFQ scores had a similar range to those of other severe retinopathies. Mobility scores were consistent with FST sensitivities. In patients examined with FST, OCT, and NIR-RAFI over long-term intervals (7-10 years), there was limited but detectable disease progression. Efficacy would be a quantitative change in foveal cone function and possibly distal laminar structure. FST provides a subjective photoreceptor-based outcome; OCT and NIR-RAFI can assess photoreceptor and RPE structure. TPLR and OCI can provide objective measures of postretinal transmission. Minimal change over a decade indicates that there is no practical value in natural history studies.

  3. New T530C mutation in the aspartoacylase gene caused Canavan disease with no correlation between severity and N-acetylaspartate excretion.

    Science.gov (United States)

    Di Pietro, Valentina; Cavallari, Ugo; Amorini, Angela M; Lazzarino, Giacomo; Longo, Salvatore; Poggiani, Carlo; Cavalli, Pietro; Tavazzi, Barbara

    2013-12-01

    Canavan disease (OMIM 271900) is a severe autosomal recessive neurodegenerative disorder characterized by spongy degeneration of the brain and caused by mutations in the gene encoding for aspartoacylase (ASPA). The enzyme is responsible for the catalyses of the brain-specific compound N-acetylaspartate (NAA). We report the case of two Egyptian sibling patients suspected of Canavan disease (CD) showing clinical deterioration, white matter degeneration, megalencephaly and severe intellectual impairment. The patients underwent magnetic resonance imaging (MRI) and biochemical analysis of NAA in biological fluid samples (serum and urine). Subsequently, in order to determine the mutation responsible for CD in these two sibs, a molecular biological examination was performed. MRI findings and quantification of high NAA excretion (1378.5 and 680.1μmolNAA/mmolcreatinine in urine of 4months and 4years old patients, respectively) confirmed the diagnosis of CD and prompted a search for the responsible mutation. The molecular biological analysis revealed homozygosity for the substitution T530C (Ile177Thr) in the exon 4 of the ASPA gene in both sibs. A total loss of enzymatic activity was also recorded. The substitution T530C (Ile177Thr) results in a novel missense mutation causing a CD phenotype with severe clinical characteristics. This mutation was not previously described in the literature. In these two sibs, urinary concentration of NAA appears to correlate inversely to symptom severity and CD progression. © 2013.

  4. Novel missense mutation of the FAM83H gene causes retention of amelogenin and a mild clinical phenotype of hypocalcified enamel.

    Science.gov (United States)

    Urzúa, Blanca; Martínez, Carolina; Ortega-Pinto, Ana; Adorno, Daniela; Morales-Bozo, Irene; Riadi, Gonzalo; Jara, Lilian; Plaza, Anita; Lefimil, Claudia; Lozano, Carla; Reyes, Monserrat

    2015-09-01

    Amelogenesis imperfecta (AI) is a group of clinically and genetically heterogeneous inherited conditions, causing alterations in the structure of enamel and chemical composition of enamel matrix during development. The objective of this study was to compare the clinical, radiographic, histological and immunohistochemical phenotypes of subjects affected with hypocalcified AI from three Chilean families and identify causal mutations in the FAM83H gene. The diagnosis was made using clinical, radiographic, histological and genealogical data from the patients, who were evaluated according to the classification criteria by Witkop. PCR and Sanger sequencing of the complete coding sequence and surrounding intron regions of the FAM83H gene were conducted. The structural study of the affected teeth was performed with light microscopy, scanning electron microscopy and immunohistochemistry. The probands of the three families were diagnosed with hypocalcified AI, but in only one of them the missense variant p.Gly557Cys was identified. This variant was not present in the SNP database or in 100 healthy controls and segregated with the disease in the affected family. Using light microscopy, a normal prismatic structure was observed in all three cases. However, the ultrastructure was found to be affected in two of the cases, showing persistence of organic matter including amelogenins. These results suggest that FAM83H missense mutation reported in one of the families analyzed in this study might cause a phenotype of hypocalcified enamel more attenuated with retention of amelogenin. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. TDP-43 Loss-of-Function Causes Neuronal Loss Due to Defective Steroid Receptor-Mediated Gene Program Switching in Drosophila

    Directory of Open Access Journals (Sweden)

    Lies Vanden Broeck

    2013-01-01

    Full Text Available TDP-43 proteinopathy is strongly implicated in the pathogenesis of amyotrophic lateral sclerosis and related neurodegenerative disorders. Whether TDP-43 neurotoxicity is caused by a novel toxic gain-of-function mechanism of the aggregates or by a loss of its normal function is unknown. We increased and decreased expression of TDP-43 (dTDP-43 in Drosophila. Although upregulation of dTDP-43 induced neuronal ubiquitin and dTDP-43-positive inclusions, both up- and downregulated dTDP-43 resulted in selective apoptosis of bursicon neurons and highly similar transcriptome alterations at the pupal-adult transition. Gene network analysis and genetic validation showed that both up- and downregulated dTDP-43 directly and dramatically increased the expression of the neuronal microtubule-associated protein Map205, resulting in cytoplasmic accumulations of the ecdysteroid receptor (EcR and a failure to switch EcR-dependent gene programs from a pupal to adult pattern. We propose that dTDP-43 neurotoxicity is caused by a loss of its normal function.

  6. Growth retardation in untreated autosomal dominant familial neurohypophyseal diabetes insipidus caused by one recurring and two novel mutations in the vasopressin-neurophysin II gene.

    Science.gov (United States)

    Brachet, Cécile; Birk, Julia; Christophe, Catherine; Tenoutasse, Sylvie; Velkeniers, Brigitte; Heinrichs, Claudine; Rutishauser, Jonas

    2011-02-01

    Autosomal dominant familial neurohypophyseal diabetes insipidus (adFNDI), a disorder caused by mutations in the vasopressin (AVP)-neurophysin II (NPII) gene, manifests gradually during early childhood with progressive polyuria and polydipsia. Patients are usually treated with synthetic AVP analog. If unlimited access to water is provided, prognosis is usually good even in the absence of specific treatment. In this study, we describe three families with adFNDI, in which growth failure was a prominent complaint, on the clinical and molecular level. Histories from affected and unaffected family members were taken. Height and weight of index patients were recorded longitudinally. Patients underwent water deprivation tests, magnetic resonance imaging, and genetic analysis. One mutant was studied by heterologous expression in cell culture. A total of ten affected individuals were studied. In two of the three pedigrees, a novel mutation in the AVP-NPII gene was found. The index children in each pedigree showed growth retardation, which was the reason for referral in two. In these cases, water intake was tightly restricted by the parents in an attempt to overcome suspected psychogenic polydipsia and to improve appetite. Once the children were treated by hormone replacement, they rapidly caught up to normal weight and height. Genetic testing and appropriate parent counseling should be enforced in adFNDI families to ensure adequate treatment and avoid chronic water deprivation, which causes failure to thrive.

  7. Microsatellite instability markers for identifying early-onset colorectal cancers caused by germ-line mutations in DNA mismatch repair genes.

    Science.gov (United States)

    Mead, Leeanne J; Jenkins, Mark A; Young, Joanne; Royce, Simon G; Smith, Letitia; St John, D James B; Macrae, Finlay; Giles, Graham G; Hopper, John L; Southey, Melissa C

    2007-05-15

    Microsatellite instability (MSI) testing of colorectal cancer tumors is used as a screening tool to identify patients most likely to be mismatch repair (MMR) gene mutation carriers. We wanted to examine which microsatellite markers currently used to detect MSI best predict early-onset colorectal cancer caused by germ-line mutations in MMR genes. Invasive primary tumors from a population-based sample of 107 cases of colorectal cancer diagnosed before age 45 years and tested for germ-line mutations in MLH1, MSH2, MSH6, and PMS2 and MMR protein expression were screened for MSI using the National Cancer Institute panel and an expanded 10-microsatellite marker panel. The National Cancer Institute five-marker panel system scored 31 (29%) as (NCI)MSI-High, 13 (12%) as (NCI)MSI-Low, and 63 (59%) as (NCI)MS-Stable. The 10-marker panel classified 18 (17%) as (10)MSI-High, 17 (16%) as (10)MSI-Low, and 72 (67%) as (10)MS-Stable. Of the 26 cancers that lacked the expression of at least one MMR gene, 24 (92%) were positive for some level of MSI (using either microsatellite panel). The mononucleotide repeats Bat26, Bat40, and Myb were unstable in all (10)MSI-High cancers and all MLH1 and MSH2 mutation carriers (100% sensitive). Bat40 and Bat25 were unstable in all tumors of MSH6 mutation carriers (100% sensitive). Bat40 was unstable in all MMR gene mutation carriers (100% sensitive). By incorporating seven mononucleotide repeats markers into the 10-marker panel, we were able to distinguish the carriers of MSH6 mutations (all scored (10)MSI-Low) from the MLH1 and MSH2 mutation carriers (all scored (10)MSI-High). In early-onset colorectal cancer, a microsatellite panel containing a high proportion of mononuclear repeats can distinguish between tumors caused by MLH1 and MSH2 mutations from those caused by MSH6 mutations.

  8. Alteration of gene expression in Pisum sativum tissue cultures caused by the free radical-generating agent 2,2`-azobis (2-amidinipropane) dihydrochloride

    Energy Technology Data Exchange (ETDEWEB)

    Henkow, L. [Sveriges Lantbruksuniv., Inst. foer Vaextfoeraedling, Uppsala (Sweden); Strid, Aa.; Rydstroem, J. [Goeteborgs Univ. och Chalmers Tekniska Hoegskola, Inst. foer Biokemi och Biofysik, Goeteborg (Sweden); Berglund, T.; Ohlsson, A.B. [Kungliga Tekniska Hoegskolan, Inst. foer Biokemi och biokemisk Teknologi, Stockholm (Sweden)

    1996-04-01

    Root-differentiated tissue cultures (PS-R) from Pisum sativum (cv. Greenfeast) were exposed to a 5 mM solution of the free radical-generating compound 2,2`-azobis (2-amidinopropane) dihydrochloride (AAPH). The levels of mRNA transcripts for two genes were examined: chs2, encoding a chalcone synthase isozyme, and cab, encoding the chlorophyll a/b-binding protein of the light-harvesting antenna complex. In light-grown PS-R, cab mRNA transcript levels decreased to 14% of controls after 6 h of exposure, whereas chs2 mRNA levels increased 50-fold. In dark-grown PS-R, chs2 mRNA transcripts increased by 40-fold compared with the controls. Glutathione determination inlight-grown PS-R showed no substantial difference in total glutathione (GSH{sub tot}), whereas oxidized glutathione (GSSG) increased by 66% after 12 h of exposure. However, in dark-grown PS-R a decrease in both GSH{sub tot} and GSSG after 6 h was followed by an increase of about 70%, as compared with the controls, after 12 h of exposure. In conclusion AAPH generated oxidative stress, reflected in changed glutathione levels and induced expression of the chs2 gene of the flavonoid biosynthetic pathway and also caused a decreased level of mRNA for the photosynthetic cab gene. (au) 39 refs.

  9. Identification and characterization of a class III chitin synthase gene of Moniliophthora perniciosa, the fungus that causes witches' broom disease of cacao.

    Science.gov (United States)

    Souza, Catiane S; Oliveira, Bruno M; Costa, Gustavo G L; Schriefer, Albert; Selbach-Schnadelbach, Alessandra; Uetanabaro, Ana Paula T; Pirovani, Carlos P; Pereira, Gonçalo A G; Taranto, Alex G; Cascardo, Júlio Cézar de M; Góes-Neto, Aristóteles

    2009-08-01

    Chitin synthase (CHS) is a glucosyltransferase that converts UDP-N-acetylglucosamine into chitin, one of the main components of fungal cell wall. Class III chitin synthases act directly in the formation of the cell wall. They catalyze the conversion of the immediate precursor of chitin and are responsible for the majority of chitin synthesis in fungi. As such, they are highly specific molecular targets for drugs that can inhibit the growth and development of fungal pathogens. In this work, we have identified and characterized a chitin synthase gene of Moniliophthora perniciosa (Mopchs) by primer walking. The complete gene sequence is 3,443 bp, interrupted by 13 small introns, and comprises a cDNA with an ORF with 2,739 bp, whose terminal region was experimentally determined, encoding a protein with 913 aa that harbors all the motifs and domains typically found in class III chitin synthases. This is the first report on the characterization of a chitin synthase gene, its mature transcription product, and its putative protein in basidioma and secondary mycelium stages of M. perniciosa, a basidiomycotan fungus that causes witches' broom disease of cacao.

  10. Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout.

    Science.gov (United States)

    Kapahnke, Marcel; Banning, Antje; Tikkanen, Ritva

    2016-12-14

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated sequence 9 (CRISPR/Cas9) system is widely used for genome editing purposes as it facilitates an efficient knockout of a specific gene in, e.g. cultured cells. Targeted double-strand breaks are introduced to the target sequence of the guide RNAs, which activates the cellular DNA repair mechanism for non-homologous-end-joining, resulting in unprecise repair and introduction of small deletions or insertions. Due to this, sequence alterations in the coding region of the target gene frequently cause frame-shift mutations, facilitating degradation of the mRNA. We here show that such CRISPR/Cas9-mediated alterations in the target exon may also result in altered splicing of the respective pre-mRNA, most likely due to mutations of splice-regulatory sequences. Using the human FLOT-1 gene as an example, we demonstrate that such altered splicing products also give rise to aberrant protein products. These may potentially function as dominant-negative proteins and thus interfere with the interpretation of the data generated with these cell lines. Since most researchers only control the consequences of CRISPR knockout at genomic and protein level, our data should encourage to also check the alterations at the mRNA level.

  11. Random Splicing of Several Exons Caused by a Single Base Change in the Target Exon of CRISPR/Cas9 Mediated Gene Knockout

    Directory of Open Access Journals (Sweden)

    Marcel Kapahnke

    2016-12-01

    Full Text Available The clustered regularly interspaced short palindromic repeats (CRISPR-associated sequence 9 (CRISPR/Cas9 system is widely used for genome editing purposes as it facilitates an efficient knockout of a specific gene in, e.g. cultured cells. Targeted double-strand breaks are introduced to the target sequence of the guide RNAs, which activates the cellular DNA repair mechanism for non-homologous-end-joining, resulting in unprecise repair and introduction of small deletions or insertions. Due to this, sequence alterations in the coding region of the target gene frequently cause frame-shift mutations, facilitating degradation of the mRNA. We here show that such CRISPR/Cas9-mediated alterations in the target exon may also result in altered splicing of the respective pre-mRNA, most likely due to mutations of splice-regulatory sequences. Using the human FLOT-1 gene as an example, we demonstrate that such altered splicing products also give rise to aberrant protein products. These may potentially function as dominant-negative proteins and thus interfere with the interpretation of the data generated with these cell lines. Since most researchers only control the consequences of CRISPR knockout at genomic and protein level, our data should encourage to also check the alterations at the mRNA level.

  12. Coffin-Siris syndrome with café-au-lait spots, obesity and hyperinsulinism caused by a mutation in the ARID1B gene.

    Science.gov (United States)

    Sonmez, Fatma Mujgan; Uctepe, Eyyup; Gunduz, Mehmet; Gormez, Zeliha; Erpolat, Seval; Oznur, Murat; Sagiroglu, Mahmut Samil; Demirci, Huseyin; Gunduz, Esra

    2016-08-01

    Coffin-Siris syndrome (CSS) (MIM 135900) is characterized by developmental delay, severe speech impairment, distinctive facial features, hypertrichosis, aplasia or hypoplasia of the distal phalanx or nail of the fifth digit and agenesis of the corpus callosum. Recently, it was shown that mutations in the ARID1B gene are the main cause of CSS, accounting for 76% of identified mutations. Here, we report a 15 year-old female patient who was admitted to our clinic with seizures, speech problems, dysmorphic features, bilaterally big, large thumb, café-au-lait (CAL) spots, obesity and hyperinsulinism. First, the patient was thought to have an association of neurofibromatosis and Rubinstein Taybi syndrome. Because of the large size of the NF1 gene for neurofibromatosis and CREBBP gene for Rubinstein Taybi syndrome, whole exome sequence analysis (WES) was conducted and a novel ARID1B mutation was identified. The proband WES test identified a novel heterozygous frameshift mutation c.3394_3395insTA in exon 13 of ARID1B (NM_017519.2) predicting a premature stop codon p.(Tyr1132Leufs*67). Sanger sequencing confirmed the heterozygous c.3394_3395insTA mutation in the proband and that it was not present in her parents indicating de novo mutation. Further investigation and new cases will help to understand this phenomenon better.

  13. More signs of neurotoxicity of surfactants and flame retardants - Neonatal PFOS and PBDE 99 cause transcriptional alterations in cholinergic genes in the mouse CNS.

    Science.gov (United States)

    Hallgren, Stefan; Fredriksson, Anders; Viberg, Henrik

    2015-09-01

    Maternally and lactionally transferred persistent organic pollutants may interfere with CNS development. Here, 10-day-old male mice were exposed to single oral doses of PFOS (perflourooctanosulphonate) or PBDE 99 (2,2',4,4',5-penta-bromodiphenyl ether), and examined for changes in cholinergic gene transcription in the CNS 24h and 7 weeks later. 24h after exposure qPCR analyses revealed decreased transcription of nAChR-β2 and AChE in cortex, and increased mAChR-5 in hippocampus of PFOS treated mice. Neonatal PFOS treatment altered spontaneous behaviour at 2 months of age but did not affect gene transcription in adults. At 2 months of age neonatally PBDE 99 treated mice had altered spontaneous behaviour, and cortical transcription of AChE, nAChR-α4, nAChR-β2 and mAChR-5 were elevated. Our results indicate that PFOS and PBDE 99 affects the developing central cholinergic system by altering gene transcription in cortex and hippocampus, which may in part account for mechanisms causing changes in spontaneous behaviour. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Study on Environmental Causes and SNPs of MTHFR, MS and CBS Genes Related to Congenital Heart Disease.

    Science.gov (United States)

    Shi, Hui; Yang, Shiwei; Liu, Yan; Huang, Peng; Lin, Ning; Sun, Xiaoru; Yu, Rongbin; Zhang, Yuanyuan; Qin, Yuming; Wang, Lijuan

    2015-01-01

    Congenital heart diseases (CHD) are among the most common birth defects in China. Environmental causes and folate metabolism changes may alter susceptibility to CHD. The aim of this study is to evaluate the relevant risk-factors of children with CHD and their mothers. 138 children with CHD and 207 normal children for controls were recruited. Their mothers were also enlisted in this study and interviewed following a questionnaire about their pregnant history and early pregnancy situation. Five single nucleotide polymorphisms (SNPs) in methylenetetrahydrofolate reductase (MTHFR), methionine synthase (MS) and cystathionine β-synthase (CBS) of mothers and children were genotyped. There were significant differences in the gender of children, occupation of mothers, family history with CHD, history of abortion, history of adverse pregnancy, early pregnancy health, fetus during pregnancy, pesticide exposure and drug exposure in CHD group and control group ( P social and fertility characteristics, our results suggested that the genetic variants in folate metabolism pathway might be one of the most related risk-factors of CHD. MTHFR rs1801131 were identified as loci in Chinese population that were involved in CHD.

  15. De Novo Mutations in Protein Kinase Genes CAMK2A and CAMK2B Cause Intellectual Disability.

    Science.gov (United States)

    Küry, Sébastien; van Woerden, Geeske M; Besnard, Thomas; Proietti Onori, Martina; Latypova, Xénia; Towne, Meghan C; Cho, Megan T; Prescott, Trine E; Ploeg, Melissa A; Sanders, Stephan; Stessman, Holly A F; Pujol, Aurora; Distel, Ben; Robak, Laurie A; Bernstein, Jonathan A; Denommé-Pichon, Anne-Sophie; Lesca, Gaëtan; Sellars, Elizabeth A; Berg, Jonathan; Carré, Wilfrid; Busk, Øyvind Løvold; van Bon, Bregje W M; Waugh, Jeff L; Deardorff, Matthew; Hoganson, George E; Bosanko, Katherine B; Johnson, Diana S; Dabir, Tabib; Holla, Øystein Lunde; Sarkar, Ajoy; Tveten, Kristian; de Bellescize, Julitta; Braathen, Geir J; Terhal, Paulien A; Grange, Dorothy K; van Haeringen, Arie; Lam, Christina; Mirzaa, Ghayda; Burton, Jennifer; Bhoj, Elizabeth J; Douglas, Jessica; Santani, Avni B; Nesbitt, Addie I; Helbig, Katherine L; Andrews, Marisa V; Begtrup, Amber; Tang, Sha; van Gassen, Koen L I; Juusola, Jane; Foss, Kimberly; Enns, Gregory M; Moog, Ute; Hinderhofer, Katrin; Paramasivam, Nagarajan; Lincoln, Sharyn; Kusako, Brandon H; Lindenbaum, Pierre; Charpentier, Eric; Nowak, Catherine B; Cherot, Elouan; Simonet, Thomas; Ruivenkamp, Claudia A L; Hahn, Sihoun; Brownstein, Catherine A; Xia, Fan; Schmitt, Sébastien; Deb, Wallid; Bonneau, Dominique; Nizon, Mathilde; Quinquis, Delphine; Chelly, Jamel; Rudolf, Gabrielle; Sanlaville, Damien; Parent, Philippe; Gilbert-Dussardier, Brigitte; Toutain, Annick; Sutton, Vernon R; Thies, Jenny; Peart-Vissers, Lisenka E L M; Boisseau, Pierre; Vincent, Marie; Grabrucker, Andreas M; Dubourg, Christèle; Tan, Wen-Hann; Verbeek, Nienke E; Granzow, Martin; Santen, Gijs W E; Shendure, Jay; Isidor, Bertrand; Pasquier, Laurent; Redon, Richard; Yang, Yaping; State, Matthew W; Kleefstra, Tjitske; Cogné, Benjamin; Petrovski, Slavé; Retterer, Kyle; Eichler, Evan E; Rosenfeld, Jill A; Agrawal, Pankaj B; Bézieau, Stéphane; Odent, Sylvie; Elgersma, Ype; Mercier, Sandra

    2017-11-02

    Calcium/calmodulin-dependent protein kinase II (CAMK2) is one of the first proteins shown to be essential for normal learning and synaptic plasticity in mice, but its requirement for human brain development has not yet been established. Through a multi-center collaborative study based on a whole-exome sequencing approach, we identified 19 exceedingly rare de novo CAMK2A or CAMK2B variants in 24 unrelated individuals with intellectual disability. Variants were assessed for their effect on CAMK2 function and on neuronal migration. For both CAMK2A and CAMK2B, we identified mutations that decreased or increased CAMK2 auto-phosphorylation at Thr286/Thr287. We further found that all mutations affecting auto-phosphorylation also affected neuronal migration, highlighting the importance of tightly regulated CAMK2 auto-phosphorylation in neuronal function and neurodevelopment. Our data establish the importance of CAMK2A and CAMK2B and their auto-phosphorylation in human brain function and expand the phenotypic spectrum of the disorders caused by variants in key players of the glutamatergic signaling pathway. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  16. Mapping and exome sequencing identifies a mutation in the IARS gene as the cause of hereditary perinatal weak calf syndrome.

    Directory of Open Access Journals (Sweden)

    Takashi Hirano

    Full Text Available We identified an IARS (isoleucyl-tRNA synthetase c.235G>C (p.Val79Leu substitution as the causative mutation for neonatal weakness with intrauterine growth retardation (perinatal weak calf syndrome. In Japanese Black cattle, the syndrome was frequently found in calves sired by Bull A. Hence, we employed homozygosity mapping and linkage analysis. In order to identify the perinatal weak calf syndrome locus in a 4.04-Mb region of BTA 8, we analysed a paternal half-sibling family with a BovineSNP50 BeadChip and microsatellites. In this critical region, we performed exome sequencing to identify a causative mutation. Three variants were detected as possible candidates for causative mutations that were predicted to disrupt the protein function, including a G>C (p.Val79Leu mutation in IARS c.235. The IARS c.235G>C mutation was not a homozygous risk allele in the 36 healthy offspring of Bull A. Moreover, the IARS Val79 residue and its flanking regions were evolutionarily and highly conserved. The IARS mutant (Leu79 had decreased aminoacylation activity. Additionally, the homozygous mutation was not found in any of 1526 healthy cattle. Therefore, we concluded that the IARS c.235G>C mutation was the cause of hereditary perinatal weak calf syndrome.

  17. Heterozygous truncation mutations of the SMC1A gene cause a severe early onset epilepsy with cluster seizures in females: Detailed phenotyping of 10 new cases.

    Science.gov (United States)

    Symonds, Joseph D; Joss, Shelagh; Metcalfe, Kay A; Somarathi, Suresh; Cruden, Jamie; Devlin, Anita M; Donaldson, Alan; DiDonato, Nataliya; Fitzpatrick, David; Kaiser, Frank J; Lampe, Anne K; Lees, Melissa M; McLellan, Ailsa; Montgomery, Tara; Mundada, Vivek; Nairn, Lesley; Sarkar, Ajoy; Schallner, Jens; Pozojevic, Jelena; Parenti, Ilaria; Tan, Jeen; Turnpenny, Peter; Whitehouse, William P; Zuberi, Sameer M

    2017-04-01

    The phenotype of seizure clustering with febrile illnesses in infancy/early childhood is well recognized. To date the only genetic epilepsy consistently associated with this phenotype is PCDH19, an X-linked disorder restricted to females, and males with mosaicism. The SMC1A gene, which encodes a structural component of the cohesin complex is also located on the X chromosome. Missense variants and small in-frame deletions of SMC1A cause approximately 5% of Cornelia de Lange Syndrome (CdLS). Recently, protein truncating mutations in SMC1A have been reported in five females, all of whom have been affected by a drug-resistant epilepsy, and severe developmental impairment. Our objective was to further delineate the phenotype of SMC1A truncation. Female cases with de novo truncation mutations in SMC1A were identified from the Deciphering Developmental Disorders (DDD) study (n = 8), from postmortem testing of an affected twin (n = 1), and from clinical testing with an epilepsy gene panel (n = 1). Detailed information on the phenotype in each case was obtained. Ten cases with heterozygous de novo mutations in the SMC1A gene are presented. All 10 mutations identified are predicted to result in premature truncation of the SMC1A protein. All cases are female, and none had a clinical diagnosis of CdLS. They presented with onset of epileptic seizures between <4 weeks and 28 months of age. In the majority of cases, a marked preponderance for seizures to occur in clusters was noted. Seizure clusters were associated with developmental regression. Moderate or severe developmental impairment was apparent in all cases. Truncation mutations in SMC1A cause a severe epilepsy phenotype with cluster seizures in females. These mutations are likely to be nonviable in males. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.

  18. Differential Gene Expression of TRPM1, the Potential Cause of Congenital Stationary Night Blindness and Coat Spotting Patterns (LP) in the Appaloosa Horse (Equus caballus)

    Science.gov (United States)

    Bellone, Rebecca R.; Brooks, Samantha A.; Sandmeyer, Lynne; Murphy, Barbara A.; Forsyth, George; Archer, Sheila; Bailey, Ernest; Grahn, Bruce

    2008-01-01

    The appaloosa coat spotting pattern in horses is caused by a single incomplete dominant gene (LP). Homozygosity for LP (LP/LP) is directly associated with congenital stationary night blindness (CSNB) in Appaloosa horses. LP maps to a 6-cM region on ECA1. We investigated the relative expression of two functional candidate genes located in this LP candidate region (TRPM1 and OCA2), as well as three other linked loci (TJP1, MTMR10, and OTUD7A) by quantitative real-time RT–PCR. No large differences were found for expression levels of TJP1, MTMR10, OTUD7A, and OCA2. However, TRPM1 (Transient Receptor Potential Cation Channel, Subfamily M, Member 1) expression in the retina of homozygous appaloosa horses was 0.05% the level found in non-appaloosa horses (R = 0.0005). This constitutes a >1800-fold change (FC) decrease in TRPM1 gene expression in the retina (FC = −1870.637, P = 0.001) of CSNB-affected (LP/LP) horses. TRPM1 was also downregulated in LP/LP pigmented skin (R = 0.005, FC = −193.963, P = 0.001) and in LP/LP unpigmented skin (R = 0.003, FC = −288.686, P = 0.001) and was downregulated to a lesser extent in LP/lp unpigmented skin (R = 0.027, FC = −36.583, P = 0.001). TRP proteins are thought to have a role in controlling intracellular Ca2+ concentration. Decreased expression of TRPM1 in the eye and the skin may alter bipolar cell signaling as well as melanocyte function, thus causing both CSNB and LP in horses. PMID:18660533

  19. Novel mutations causing biotinidase deficiency in individuals identified by newborn screening in Michigan including an unique intronic mutation that alters mRNA expression of the biotinidase gene.

    Science.gov (United States)

    Li, H; Spencer, L; Nahhas, F; Miller, J; Fribley, A; Feldman, G; Conway, R; Wolf, B

    2014-07-01

    Biotinidase deficiency (BD) is an autosomal recessive disorder resulting in the inability to recycle the vitamin biotin. Individuals with biotinidase deficiency can develop neurological and cutaneous symptoms if they are not treated with biotin. To date, more than 165 mutations in the biotinidase gene (BTD) have been reported. Essentially all the mutations result in enzymatic activities with less than 10% of mean normal serum enzyme activity (profound biotinidase deficiency) with the exception of the c.1330G>C (p.D444H) mutation, which results in an enzyme having 50% of mean normal serum activity and causes partial biotinidase deficiency (10-30% of mean normal serum biotinidase activity) if there is a mutation for profound biotinidase deficiency on the second allele. We now reported eight novel mutations in ten children identified by newborn screening in Michigan from 1988 to the end of 2012. Interestingly, one intronic mutation, c.310-15delT, results in an approximately two-fold down-regulation of BTD mRNA expression by Quantitative real-time reverse-transcription PCR (qRT-PCR). This is the first report of an intronic mutation in the BTD gene with demonstration of its effect on enzymatic activity by altering mRNA expression. This study identified three other mutations likely to cause partial biotinidase deficiency. These results emphasize the importance of full gene sequencing of BTD on patients with biotinidase deficiency to better understand the genotype and phenotype correlation in the future. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Gene therapy for leber congenital amaurosis caused by RPE65 mutations: safety and efficacy in 15 children and adults followed up to 3 years.

    Science.gov (United States)

    Jacobson, Samuel G; Cideciyan, Artur V; Ratnakaram, Ramakrishna; Heon, Elise; Schwartz, Sharon B; Roman, Alejandro J; Peden, Marc C; Aleman, Tomas S; Boye, Sanford L; Sumaroka, Alexander; Conlon, Thomas J; Calcedo, Roberto; Pang, Ji-Jing; Erger, Kirsten E; Olivares, Melani B; Mullins, Cristina L; Swider, Malgorzata; Kaushal, Shalesh; Feuer, William J; Iannaccone, Alessandro; Fishman, Gerald A; Stone, Edwin M; Byrne, Barry J; Hauswirth, William W

    2012-01-01

    To determine the safety and efficacy of subretinal gene therapy in the RPE65 form of Leber congenital amaurosis using recombinant adeno-associated virus 2 (rAAV2) carrying the RPE65 gene. Open-label, dose-escalation phase I study of 15 patients (range, 11-30 years of age) evaluated after subretinal injection of the rAAV2- RPE65 vector into the worse-functioning eye. Five cohorts represented 4 dose levels and 2 different injection strategies. Primary outcomes were systemic and ocular safety. Secondary outcomes assayed visual function with dark-adapted full-field sensitivity testing and visual acuity with Early Treatment Diabetic Retinopathy Study charts. Further assays included immune responses to the vector, static visual fields, pupillometry, mobility performance, and optical coherence tomography. No systemic toxicity was detected; ocular adverse events were related to surgery. Visual function improved in all patients to different degrees; improvements were localized to treated areas. Cone and rod sensitivities increased significantly in the study eyes but not in the control eyes. Minor acuity improvements were recorded in many study and control eyes. Major acuity improvements occurred in study eyes with the lowest entry acuities and parafoveal fixation loci treated with subretinal injections. Other patients with better foveal structure lost retinal thickness and acuity after subfoveal injections. Gene therapy for Leber congenital amaurosis caused by RPE65 mutations is sufficiently safe and substantially efficacious in the extrafoveal retina. There is no benefit and some risk in treating the fovea. No evidence of age-dependent effects was found. Our results point to specific treatment strategies for subsequent phases. Gene therapy for inherited retinal disease has the potential to become a future part of clinical practice. clinicaltrials.gov Identifier: NCT00481546.

  1. Deletion of exon 20 of the Familial Dysautonomia gene Ikbkap in mice causes developmental delay, cardiovascular defects, and early embryonic lethality.

    Directory of Open Access Journals (Sweden)

    Paula Dietrich

    Full Text Available Familial Dysautonomia (FD is an autosomal recessive disorder that affects 1/3,600 live births in the Ashkenazi Jewish population, and leads to death before the age of 40. The disease is characterized by abnormal development and progressive degeneration of the sensory and autonomic nervous system. A single base pair substitution in intron 20 of the Ikbkap gene accounts for 98% of FD cases, and results in the expression of low levels of the full-length mRNA with simultaneous expression of an aberrantly spliced mRNA in which exon 20 is missing. To date, there is no animal model for the disease, and the essential cellular functions of IKAP--the protein encoded by Ikbkap--remain unknown. To better understand the normal function of IKAP and in an effort to generate a mouse model for FD, we have targeted the mouse Ikbkap gene by homologous recombination. We created two distinct alleles that result in either loss of Ikbkap expression, or expression of an mRNA lacking only exon 20. Homozygosity for either mutation leads to developmental delay, cardiovascular and brain malformations, accompanied with early embryonic lethality. Our analyses indicate that IKAP is essential for expression of specific genes involved in cardiac morphogenesis, and that cardiac failure is the likely cause of abnormal vascular development and embryonic lethality. Our results also indicate that deletion of exon 20 abolishes gene function. This implies that the truncated IKAP protein expressed in FD patients does not retain any significant biological function.

  2. Fanconi Bickel Syndrome: Novel Mutations in GLUT 2 Gene Causing a Distinguished Form of Renal Tubular Acidosis in Two Unrelated Egyptian Families

    Directory of Open Access Journals (Sweden)

    Mohammad Al-Haggar

    2011-01-01

    Full Text Available Background. Fanconi-Bickel syndrome (FBS is an autosomal recessive disorder caused by defects in facilitative glucose transporter 2 (GLUT2 or SLC2A2 gene mapped on chromosome 3q26.1-26.3, that codes for the glucose transporter protein 2. Methods. Two unrelated Egyptian families having suspected cases of FBS were enrolled after taking a written informed consent; both had positive consanguinity, and index cases had evidences of proximal renal tubular defects with hepatomegaly; they were subjected to history taking, signs of rickets as well as anthropometric measurements. Laboratory workup included urinalysis, renal and liver function tests including fasting and postprandial blood sugar; serum calcium, phosphorus, alkaline phosphatase, sodium and potassium, lipid profile, and detailed blood gas. Imaging including bone survey and abdominal ultrasound, and liver biopsy were done to confirm diagnosis. Molecular analysis of the GLUT2 gene was done for DNA samples extracted from peripheral blood leukocyte. All coding sequences, including flanking introns in GLUT2 gene, were amplified using PCR followed by direct sequencing. Results. Two new mutations had been detected, one in each family, in exon 3 two bases (GA were deleted (c.253 254delGA and in exon 6 in the second family, G-to-C substitution at position-1 of the splicing acceptor site (c.776-1G>C or IVS5-1G>A. Conclusion. FBS is a rare disease due to mutation in GLUT2 gene; many mutations were reported, about half were novel mutations; yet none of these mutations is more frequent. A more extensive survey for the most frequent mutations among FBS has to be contemplated to allow for use of molecular screening tests like ARMS.

  3. A Novel Mutation in the CYP11B1 Gene Causes Steroid 11β-Hydroxylase Deficient Congenital Adrenal Hyperplasia with Reversible Cardiomyopathy

    Directory of Open Access Journals (Sweden)

    Mohammad A. Alqahtani

    2015-01-01

    Full Text Available Congenital adrenal hyperplasia (CAH due to steroid 11β-hydroxylase deficiency is the second most common form of CAH, resulting from a mutation in the CYP11B1 gene. Steroid 11β-hydroxylase deficiency results in excessive mineralcorticoids and androgen production leading to hypertension, precocious puberty with acne, enlarged penis, and hyperpigmentation of scrotum of genetically male infants. In the present study, we reported 3 male cases from a Saudi family who presented with penile enlargement, progressive darkness of skin, hypertension, and cardiomyopathy. The elder patient died due to heart failure and his younger brothers were treated with hydrocortisone and antihypertensive medications. Six months following treatment, cardiomyopathy disappeared with normal blood pressure and improvement in the skin pigmentation. The underlying molecular defect was investigated by PCR-sequencing analysis of all coding exons and intron-exon boundary of the CYP11B1 gene. A novel biallelic mutation c.780 G>A in exon 4 of the CYP11B1 gene was found in the patients. The mutation created a premature stop codon at amino acid 260 (p.W260∗, resulting in a truncated protein devoid of 11β-hydroxylase activity. Interestingly, a somatic mutation at the same codon (c.779 G>A, p.W260∗ was reported in a patient with papillary thyroid cancer (COSMIC database. In conclusion, we have identified a novel nonsense mutation in the CYP11B1 gene that causes classic steroid 11β-hydroxylase deficient CAH. Cardiomyopathy and cardiac failure can be reversed by early diagnosis and treatment.

  4. A 556 kb deletion in the downstream region of the PAX6 gene causes familial aniridia and other eye anomalies in a Chinese family.

    Science.gov (United States)

    Cheng, Fang; Song, Wulian; Kang, Yang; Yu, Shihui; Yuan, Huiping

    2011-02-10

    The paired box gene 6 (PAX6) on human chromosome 11p13 is an essential transcription factor for eye formation in animals. Mutations in PAX6 can lead to varieties of autosomal-dominant ocular malformations with aniridia as the major clinical signs. Known genetic alterations causing haplo-insufficiency of PAX6 include nonsense mutations, frame-shift mutations, splicing errors, or genomic deletions. The purpose of this study was to identify genetic defects as the underlying cause of familial aniridia in a large Chinese family. All exons of PAX6 in the proband were sequenced by the Sanger sequencing technique. The genome of the proband was evaluated by a microarray-based comparative genomic hybridization (aCGH). Quantitative real-time PCR was applied to verify the abnormal aCGH findings in the proband and to test five other family members. There were no detectable pathogenic mutations in the exons of PAX6 in the proband. The aCGH analysis showed two copies of PAX6 but revealed a 566 kb hemizygous deletion of chromosome 11p13, including four annotated genes doublecortin domain containing 1 (DCDC1), DnaJ homolog subfamily C member 24 (DNAJC24), IMP1 inner mitochondrial membrane(IMMP1L), andelongation factor protein 4 (ELP4) downstream of PAX6. Quantitative real-time PCR verified the deletion in the proband and further identified the deletion in a blind fashion in four affected family members but not in the one with a normal phenotype. The 566 kb hemizygous deletion of chromosome 11p13 downstream of PAX6 should be the cause of the familial aniridia in this Chinese family, although two copies of PAX6 are intact. aCGH evaluation should be applied if there is a negative result for the mutation detection of PAX6 in patients with aniridia.

  5. Targeted and Untargeted Approaches Unravel Novel Candidate Genes and Diagnostic SNPs for Quantitative Resistance of the Potato (Solanum tuberosum L.) to Phytophthora infestans Causing the Late Blight Disease.

    Science.gov (United States)

    Mosquera, Teresa; Alvarez, Maria Fernanda; Jiménez-Gómez, José M; Muktar, Meki Shehabu; Paulo, Maria João; Steinemann, Sebastian; Li, Jinquan; Draffehn, Astrid; Hofmann, Andrea; Lübeck, Jens; Strahwald, Josef; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Walkemeier, Birgit; Gebhardt, Christiane

    2016-01-01

    The oomycete Phytophthora infestans causes late blight of potato, which can completely destroy the crop. Therefore, for the past 160 years, late blight has been the most important potato disease worldwide. The identification of cultivars with high and durable field resistance to P. infestans is an objective of most potato breeding programs. This type of resistance is polygenic and therefore quantitative. Its evaluation requires multi-year and location trials. Furthermore, quantitative resistance to late blight correlates with late plant maturity, a negative agricultural trait. Knowledge of the molecular genetic basis of quantitative resistance to late blight not compromised by late maturity is very limited. It is however essential for developing diagnostic DNA markers that facilitate the efficient combination of superior resistance alleles in improved cultivars. We used association genetics in a population of 184 tetraploid potato cultivars in order to identify single nucleotide polymorphisms (SNPs) that are associated with maturity corrected resistance (MCR) to late blight. The population was genotyped for almost 9000 SNPs from three different sources. The first source was candidate genes specifically selected for their function in the jasmonate pathway. The second source was novel candidate genes selected based on comparative transcript profiling (RNA-Seq) of groups of genotypes with contrasting levels of quantitative resistance to P. infestans. The third source was the first generation 8.3k SolCAP SNP genotyping array available in potato for genome wide association studies (GWAS). Twenty seven SNPs from all three sources showed robust association with MCR. Some of those were located in genes that are strong candidates for directly controlling quantitative resistance, based on functional annotation. Most important were: a lipoxygenase (jasmonate pathway), a 3-hydroxy-3-methylglutaryl coenzyme A reductase (mevalonate pathway), a P450 protein (terpene biosynthesis

  6. Gene Expression Profile of Extracellular Matrix and Adhesion Molecules in the Human Normal Corneal Stroma.

    Science.gov (United States)

    Liu, Ying; Huang, Hu; Sun, Guoying; Alwadani, Saeed; Semba, Richard D; Lutty, Gerard A; Yiu, Samuel; Edward, Deepak P

    2017-04-01

    There is limited information on region-specific gene expression in the human corneal stroma. In this study, we aimed to investigate the expression profile of the extracellular matrix and adhesion molecules in the normal corneal stroma using laser capture microdissection (LCM) and molecular techniques. Frozen sections of human cornea without ocular disease were used to isolate the central and peripheral corneal stromal keratocytes by LCM. RNA was extracted from LCM-captured tissues and the RT2 Profiler PCR Arrays were used to examine the expression profile of extracellular matrix and adhesion molecules in the central and peripheral stroma. Real-time quantitative PCR was used to quantify gene expression. Proteomic and western blotting (WB) analyses were performed to confirm gene expression at protein level. Function association network was generated via the web tools String and Cytoscape. The gene expression profiling demonstrated that 35 out of the 84 extracellular matrix and adhesion molecules represented in the array were expressed in stromal keratocytes. Among them, 24 genes were not previously described in the corneal stroma. Two genes were found more abundantly expressed in the central stroma than in the periphery: TGFBI, COL6A2 (p < 0.05). ADAMTS13 was detected only in the central stroma. Proteomics and WB analysis confirmed the expression of 10 genes. Functional analysis revealed that most identified genes were presented in a core cluster that had multiple and strong associations with other genes. This study identified genes not previously described in the corneal stroma, revealed regional differences in gene expression between central and peripheral stroma, and also detected some interesting candidate genes that may play important roles in corneal function. These observations serve as the foundation to further investigate the molecular and cellular mechanisms regulating the pathogenesis of regional corneal stromal disorders such as keratoconus.

  7. Mutation R96W in cytochrome P450c17 gene causes combined 17{alpha}-hydroxylase/17-20-lyase deficiency in two french canadian patients

    Energy Technology Data Exchange (ETDEWEB)

    LaFlamme, N.; Leblanc, J.F.; Mailloux, J. [Laval Univ., Quebec (Canada)

    1996-01-01

    Congenital adrenal hyperplasia (CAH) is the most frequent cause of adrenal insufficiency and ambiguous genitalia in newborn children. In contrast to CAH caused by 21{alpha}-hydroxylase and 11{beta}-hydroxylase deficiencies, which impairs steroid formation in the adrenal exclusively, 17{alpha}-hydroxylase/17,20-lyase deficiency impairs steroid biosynthesis in the adrenals and gonads. The sequence of CYP17 gene was determined by direct sequencing of asymmetric PCR products in two French-Canadian 46,XY pseudohermaphrodite siblings suffering from combined 17{alpha}-hydroxylase/17,20-lyase deficiency. The two patients are homozygous for the novel missense mutation R96W caused by a C to T transition converting codon Arg{sup 96} (CGG) into a Trp (TGG) in exon 1. Both parents are heterozygous for this missense mutation. We assessed the effect of the R96W mutation on 17{alpha}-hydroxylase/17,20-lyase activity by analysis of mutant enzyme, generated by site-directed mutagenesis, expressed in COS-1 cells. The presence of R96W substitution almost completely abolished the activity of the mutant protein. The present findings provide a molecular explanation for the signs and symptoms of combined 17 {alpha}-hydroxylase/17,20-lyase deficiency in these two patients and provide useful information on the structure-activity relationships of the P450c17 enzyme. 31 refs., 4 figs., 1 tab.

  8. The novel p.E89K mutation in the SRY gene inhibits DNA binding and causes the 46,XY disorder of sex development

    Directory of Open Access Journals (Sweden)

    J.L. Cunha

    2011-04-01

    Full Text Available Male sex determination in humans is controlled by the SRY gene, which encodes a transcriptional regulator containing a conserved high mobility group box domain (HMG-box required for DNA binding. Mutations in the SRY HMG-box affect protein function, causing sex reversal phenotypes. In the present study, we describe a 19-year-old female presenting 46,XY karyotype with hypogonadism and primary amenorrhea that led to the diagnosis of 46,XY complete gonadal dysgenesis. The novel p.E89K missense mutation in the SRY HMG-box was identified as a de novo mutation. Electrophoretic mobility shift assays showed that p.E89K almost completely abolished SRY DNA-binding activity, suggesting that it is the cause of SRY function impairment. In addition, we report the occurrence of the p.G95R mutation in a 46,XY female with complete gonadal dysgenesis. According to the three-dimensional structure of the human SRY HMG-box, the substitution of the conserved glutamic acid residue by the basic lysine at position 89 introduces an extra positive charge adjacent to and between the positively charged residues R86 and K92, important for stabilizing the HMG-box helix 2 with DNA. Thus, we propose that an electrostatic repulsion caused by the proximity of these positive charges could destabilize the tip of helix 2, abrogating DNA interaction.

  9. Polycystic kidney disease in the medaka (Oryzias latipes pc mutant caused by a mutation in the Gli-Similar3 (glis3 gene.

    Directory of Open Access Journals (Sweden)

    Hisashi Hashimoto

    Full Text Available Polycystic kidney disease (PKD is a common hereditary disease in humans. Recent studies have shown an increasing number of ciliary genes that are involved in the pathogenesis of PKD. In this study, the Gli-similar3 (glis3 gene was identified as the causal gene of the medaka pc mutant, a model of PKD. In the pc mutant, a transposon was found to be inserted into the fourth intron of the pc/glis3 gene, causing aberrant splicing of the pc/glis3 mRNA and thus a putatively truncated protein with a defective zinc finger domain. pc/glis3 mRNA is expressed in the epithelial cells of the renal tubules and ducts of the pronephros and mesonephros, and also in the pancreas. Antisense oligonucleotide-mediated knockdown of pc/glis3 resulted in cyst formation in the pronephric tubules of medaka fry. Although three other glis family members, glis1a, glis1b and glis2, were found in the medaka genome, none were expressed in the embryonic or larval kidney. In the pc mutant, the urine flow rate in the pronephros was significantly reduced, which was considered to be a direct cause of renal cyst formation. The cilia on the surface of the renal tubular epithelium were significantly shorter in the pc mutant than in wild-type, suggesting that shortened cilia resulted in a decrease in driving force and, in turn, a reduction in urine flow rate. Most importantly, EGFP-tagged pc/glis3 protein localized in primary cilia as well as in the nucleus when expressed in mouse renal epithelial cells, indicating a strong connection between pc/glis3 and ciliary function. Unlike human patients with GLIS3 mutations, the medaka pc mutant shows none of the symptoms of a pancreatic phenotype, such as impaired insulin expression and/or diabetes, suggesting that the pc mutant may be suitable for use as a kidney-specific model for human GLIS3 patients.

  10. The p.Ala510Val mutation in the SPG7 (paraplegin) gene is the most common mutation causing adult onset neurogenetic disease in patients of British ancestry.

    Science.gov (United States)

    Roxburgh, Richard H; Marquis-Nicholson, Renate; Ashton, Fern; George, Alice M; Lea, Rod A; Eccles, David; Mossman, Stuart; Bird, Thomas; van Gassen, Koen L; Kamsteeg, Erik-Jan; Love, Donald R

    2013-05-01

    The c.1529C >T change in the SPG7 gene, encoding the mutant p.Ala510Val paraplegin protein, was first described as a polymorphism in 1998. This was based on its frequency of 3 % and 4 % in two separate surveys of controls in the United Kingdom (UK) population. Subsequently, it has been found to co-segregate with disease in a number of different populations. Yeast expression studies support its having a deleterious effect. In this paper a consanguineous sibship is described in which four members who are homozygous for the p.Ala510Val variant present with a spectrum of disease. This spectrum encompasses moderately severe hereditary spastic paraparesis (HSP) with more minor ataxia in two siblings, moderately severe ataxia without spasticity in the third, and a very mild gait ataxia in the fourth. Two of the siblings also manifest vestibular failure. The remaining eight unaffected siblings are either heterozygous for the p.Ala510Val variant, or do not carry it at all. Homozygosity mapping using a high-density SNP array across the whole genome found just 11 genes (on two regions of chromosome 3) outside the SPG7 region on chromosome 16, which were homozygously shared by the affected siblings, but not shared by the unaffected siblings; none of them are likely to be causative. The weight of evidence is strongly in favour of the p.Ala510Val variant being a disease-causing mutation. We present additional data from the Auckland City Hospital neurogenetics clinic to show that the p.Ala510Val mutation is prevalent amongst HSP patients of UK extraction belying any suggestion that European p.Ala510Val haplotypes harbour a disease-causing mutation which the UK p.Ala510Val haplotypes do not. Taken together with previous findings of a carrier frequency of 3-4 % in the UK population (giving a homozygosity rate of 20-40/100,000), the data imply that the p.Ala510Val is the most common mutation causing neurogenetic disease in adults of UK ancestry, albeit the penetrance may be low or

  11. The most common mutation causing medium-chain acyl-CoA dehydrogenase deficiency is strongly associated with a particular haplotype in the region of the gene

    DEFF Research Database (Denmark)

    Kølvraa, S; Gregersen, N; Blakemore, A I

    1991-01-01

    RFLP haplotypes in the region containing the medium-chain acyl-CoA dehydrogenase (MCAD) gene on chromosome 1 have been determined in patients with MCAD deficiency. The RFLPs were detected after digestion of patient DNA with the enzymes BanII. PstI and TaqI and with an MCAD cDNA-clone as a probe....... Of 32 disease-causing alleles studied, 31 possessed the previously published A----G point-mutation at position 985 of the cDNA. This mutation has been shown to result in inactivity of the MCAD enzyme. In at least 30 of the 31 alleles carrying this G985 mutation a specific RFLP haplotype was present...

  12. Expression of human amyloid precursor protein in Drosophila melanogaster nerve cells causes a decrease in presynaptic gene mRNA levels.

    Science.gov (United States)

    Rodin, D I; Schwarzman, A L; Sarantseva, S V

    2015-08-10

    Amyloid precursor protein (APP) is a key player in Alzheimer's disease. The proteolytic cleavage of APP results in various short peptide fragments including the toxic amyloid-beta peptide, which is a main component of senile plaques. However, the functions of APP and its processed fragments are not yet well understood. Here, using real-time polymerase chain reaction, we demonstrate that exogenous expression of APP, its mutant form APP-Swedish, or two truncated forms in Drosophila melanogaster causes a significant (P ≤ 0.05) drop in the mRNA levels of the presynaptic proteins synaptotagmin-1 and neuronal synaptobrevin. The results obtained from this study suggest a potential role of APP or its fragments in the regulation of synaptic gene transcription.

  13. Brd2 gene disruption causes ‘metabolically healthy’ obesity: Epigenetic and chromatin-based mechanisms that uncouple obesity from Type 2 diabetes

    Science.gov (United States)

    Wang, Fangnian; Deeney, Jude T.; Denis, Gerald V.

    2014-01-01

    Disturbed body energy balance can lead to obesity and obesity-driven diseases such as Type 2 diabetes, which have reached an epidemic level. Evidence indicates that obesity induced inflammation is a major cause of insulin resistance and Type 2 diabetes. Environmental factors, such as nutrients, affect body energy balance through epigenetic or chromatin-based mechanisms. As a bromodomain and external domain family transcription regulator, Brd2 regulates expression of many genes through interpretation of chromatin codes, and participates in the regulation of body energy balance and immune function. In the severely obese state, Brd2 knockdown in mice prevented obesity-induced inflammatory responses, protected animals from Type 2 diabetes, and thus uncoupled obesity from diabetes. Brd2 provides an important model for investigation of the function of transcription regulators and the development of obesity and diabetes; it also provides a possible target to treat obesity and diabetes through modulation of the function of a chromatin code reader. PMID:23374712

  14. The frequency of a disease-causing point mutation in the gene coding for medium-chain acyl-CoA dehydrogenase in sudden infant death syndrome

    DEFF Research Database (Denmark)

    Banner, Jytte; Gregersen, N; Kølvraa, S

    1993-01-01

    A number of rare inherited metabolic disorders are known to lead to death in infancy. Deficiency of medium-chain acyl CoA dehydrogenase has, on clinical grounds, been related particularly to sudden infant death syndrome. The contribution of this disorder to the etiology of sudden infant death...... syndrome is still a matter of controversy. The present study investigated 120 well-defined cases of sudden infant death syndrome in order to detect the frequency of the most common disease-causing point mutation in the gene coding for medium-chain acyl-CoA dehydrogenase (G985) compared with the frequency...... presentations of inherited metabolic disorders and examine a wider range of sudden death in infancy....

  15. A single base insertion in the putative transmembrane domain of the tyrosinase gene as a cause for tyrosinase-negative oculocutaneous albinism

    Energy Technology Data Exchange (ETDEWEB)

    Chintamaneni, C.D.; Kobayashi, Y.; Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (United States)); Halaban, R. (Yale Univ. School of Medicine, New Haven, CT (United States)); Witkop, C.J. Jr. (Univ. of Minnesota, Minneapolis (United States))

    1991-06-15

    The authors have determined a molecular defect to be the likely basis for inactivity of the tyrosinase from a patient with tyrosinase-negative oculocutaneous albinism. A single base (thymine) was inserted in exon 5 of the tyrosinase gene following codon 471 in the putative transmembrane coding region. This insertion caused a shift in the reading frame of 19 amino acids at the 3{prime} end and introduced a premature termination signal that would be expected to truncate the protein by 21 amino acids at the carboxyl terminus. The albino tyrosinase was not recognized by antibodies directed to the carboxyl terminus of tyrosinase. Furthermore, as shown by gel electrophoresis of the immunoprecipitated protein, the tyrosinase was {approx} 3kDa smaller than normal. Similar immunoprecipitation data were obtained when cloned normal and mutant tyrosinases were expressed in COS-1 cells.

  16. Mutation G805R in the transmembrane domain of the LDL receptor gene causes familial hypercholesterolemia by inducing ectodomain cleavage of the LDL receptor in the endoplasmic reticulum

    Directory of Open Access Journals (Sweden)

    Thea Bismo Strøm

    2014-01-01

    Full Text Available More than 1700 mutations in the low density lipoprotein receptor (LDLR gene have been found to cause familial hypercholesterolemia (FH. These are commonly divided into five classes based upon their effects on the structure and function of the LDLR. However, little is known about the mechanism by which mutations in the transmembrane domain of the LDLR gene cause FH. We have studied how the transmembrane mutation G805R affects the function of the LDLR. Based upon Western blot analyses of transfected HepG2 cells, mutation G805R reduced the amounts of the 120 kDa precursor LDLR in the endoplasmic reticulum. This led to reduced amounts of the mature 160 kDa LDLR at the cell surface. However, significant amounts of a secreted 140 kDa G805R-LDLR ectodomain fragment was observed in the culture media. Treatment of the cells with the metalloproteinase inhibitor batimastat largely restored the amounts of the 120 and 160 kDa forms in cell lysates, and prevented secretion of the 140 kDa ectodomain fragment. Together, these data indicate that a metalloproteinase cleaved the ectodomain of the 120 kDa precursor G805R-LDLR in the endoplasmic reticulum. It was the presence of the polar Arg805 and not the lack of Gly805 which led to ectodomain cleavage. Arg805 also prevented γ-secretase cleavage within the transmembrane domain. It is conceivable that introducing a charged residue within the hydrophobic membrane lipid bilayer, results in less efficient incorporation of the 120 kDa G805R-LDLR in the endoplasmic reticulum membrane and makes it a substrate for metalloproteinase cleavage.

  17. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype.

    Science.gov (United States)

    Saleha, Shamim; Ajmal, Muhammad; Jamil, Muhammad; Nasir, Muhammad; Hameed, Abdul

    2016-01-01

    To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  18. Mutations in human homologue of chicken talpid3 gene (KIAA0586) cause a hybrid ciliopathy with overlapping features of Jeune and Joubert syndromes.

    Science.gov (United States)

    Malicdan, May Christine V; Vilboux, Thierry; Stephen, Joshi; Maglic, Dino; Mian, Luhe; Konzman, Daniel; Guo, Jennifer; Yildirimli, Deniz; Bryant, Joy; Fischer, Roxanne; Zein, Wadih M; Snow, Joseph; Vemulapalli, Meghana; Mullikin, James C; Toro, Camilo; Solomon, Benjamin D; Niederhuber, John E; Gahl, William A; Gunay-Aygun, Meral

    2015-12-01

    In chicken, loss of TALPID3 results in non-functional cilia and short-rib polydactyly syndrome. This phenotype is caused by a frameshift mutation in the chicken ortholog of the human KIAA0586 gene, which encodes a novel coiled-coil domain protein essential for primary ciliogenesis, suggesting that KIAA0586 can be associated with ciliopathy in human beings. In our patients with ciliopathy (http://www.clinicaltrials.gov: NCT00068224), we have collected extensive clinical and neuroimaging data from affected individuals, and performed whole exome sequencing on DNA from affected individuals and their parents. We analysed gene expression on fibroblast cell line, and determined the effect of gene mutation on ciliogenesis in cells derived from patients. We identified biallelic mutations in the human TALPID3 ortholog, KIAA0586, in six children with findings of overlapping Jeune and Joubert syndromes. Fibroblasts cultured from one of the patients with Jeune-Joubert syndrome exhibited more severe cilia defects than fibroblasts from patients with only Joubert syndrome; this difference was reflected in KIAA0586 RNA expression levels. Rescue of the cilia defect with full-length wild type KIAA0586 indicated a causal link between cilia formation and KIAA0586 function. Our results show that biallelic deleterious mutations in KIAA0586 lead to Joubert syndrome with or without Jeune asphyxiating thoracic dystrophy. Furthermore, our results confirm that KIAA0586/TALPID3 is essential in cilia formation in human beings, expand the KIAA0586 phenotype to include features of Jeune syndrome and provide a pathogenetic connection between Joubert and Jeune syndromes, based on aberrant ciliogenesis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  19. Lithium-Responsive Seizure-Like Hyperexcitability Is Caused by a Mutation in the Drosophila Voltage-Gated Sodium Channel Gene paralytic

    Science.gov (United States)

    Kasuya, Junko; Ueda, Atsushi; Iyengar, Atulya; Wu, Chun-Fang

    2016-01-01

    Abstract Shudderer (Shu) is an X-linked dominant mutation in Drosophila melanogaster identified more than 40 years ago. A previous study showed that Shu caused spontaneous tremors and defects in reactive climbing behavior, and that these phenotypes were significantly suppressed when mutants were fed food containing lithium, a mood stabilizer used in the treatment of bipolar disorder (Williamson, 1982). This unique observation suggested that the Shu mutation affects genes involved in lithium-responsive neurobiological processes. In the present study, we identified Shu as a novel mutant allele of the voltage-gated sodium (Nav) channel gene paralytic (para). Given that hypomorphic para alleles and RNA interference–mediated para knockdown reduced the severity of Shu phenotypes, Shu was classified as a para hypermorphic allele. We also demonstrated that lithium could improve the behavioral abnormalities displayed by other Nav mutants, including a fly model of the human generalized epilepsy with febrile seizures plus. Our electrophysiological analysis of Shu showed that lithium treatment did not acutely suppress Nav channel activity, indicating that the rescue effect of lithium resulted from chronic physiological adjustments to this drug. Microarray analysis revealed that lithium significantly alters the expression of various genes in Shu, including those involved in innate immune responses, amino acid metabolism, and oxidation-reduction processes, raising the interesting possibility that lithium-induced modulation of these biological pathways may contribute to such adjustments. Overall, our findings demonstrate that Nav channel mutants in Drosophila are valuable genetic tools for elucidating the effects of lithium on the nervous system in the context of neurophysiology and behavior. PMID:27844061

  20. Associations of biochemical changes and maternal traits with mutation 1843 (C>T) in the RYR1 gene as a common cause for porcine stress syndrome.

    Science.gov (United States)

    Popovski, Z T; Tanaskovska, B; Miskoska-Milevska, E; Andonov, S; Domazetovska, S

    2016-12-01

    Stress syndrome is usually caused by a mutation in the ryanodine receptor gene (ryr1) and it is widely studied in humans and swine populations. The protein product of this gene plays a crucial role in the regulation of calcium transport in muscle cells. A G>T mutation in the human ryr1 gene, which results in the replacement of a conserved arginine at position 614 where a leucine occurs at the same position as the previously identified Arg→Cys mutation reported in all cases of porcine stress syndrome (PSS). Porcine stress syndrome affects biochemical pathways in stress-susceptible individuals during a stress episode and some biochemical parameters that were used as markers for diagnostic purposes. Also, PSS has remarkable influence on the maternal characteristics of sows. This study dealt with different genotypes for PSS and its association with possible biochemical changes and maternal traits of sows. Seventy-three reproductive sows genotyped for PSS by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) were included in this survey. Sixty of them were stress-free (NN), 11 were heterozygous carriers (Nn) and two animals were homozygous (nn) for the 1843 (C>T) mutation. Significant differences in non stress induced animals with different PSS genotypes were found in the values of creatine phoshokinase (CPK), lactate dehydrogenase (LDH), alkaline phosphatase (AP) and aspartate aminotransferase (AST). Regarding the maternal traits, our study showed that stress susceptible animals (nn) have an increased number of stillborn piglets and a reduced number of newborn piglets compared with heterozygous and normal animals.

  1. Associations of biochemical changes and maternal traits with mutation 1843 (C>T in the RYR1 gene as a common cause for porcine stress syndrome

    Directory of Open Access Journals (Sweden)

    Popovski ZT

    2016-12-01

    Full Text Available Stress syndrome is usually caused by a mutation in the ryanodine receptor gene (ryr1 and it is widely studied in humans and swine populations. The protein product of this gene plays a crucial role in the regulation of calcium transport in muscle cells. A G>T mutation in the human ryr1 gene, which results in the replacement of a conserved arginine at position 614 where a leucine occurs at the same position as the previously identified Arg→Cys mutation reported in all cases of porcine stress syndrome (PSS. Porcine stress syndrome affects biochemical pathways in stress-susceptible individuals during a stress episode and some biochemical parameters that were used as markers for diagnostic purposes. Also, PSS has remarkable influence on the maternal characteristics of sows. This study dealt with different genotypes for PSS and its association with possible biochemical changes and maternal traits of sows. Seventy-three reproductive sows genotyped for PSS by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP were included in this survey. Sixty of them were stress-free (NN, 11 were heterozygous carriers (Nn and two animals were homozygous (nn for the 1843 (C>T mutation. Significant differences in non stress induced animals with different PSS genotypes were found in the values of creatine phoshokinase (CPK, lactate dehydrogenase (LDH, alkaline phosphatase (AP and aspartate aminotransferase (AST. Regarding the maternal traits, our study showed that stress susceptible animals (nn have an increased number of stillborn piglets and a reduced number of newborn piglets compared with heterozygous and normal animals.

  2. In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

    Directory of Open Access Journals (Sweden)

    Shamim Saleha

    2016-05-01

    Full Text Available AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH. To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

  3. Incomplete synthesis of N-glycans in congenital dyserythropoietic anemia type II caused by a defect in the gene encoding. alpha. -mannosidase II

    Energy Technology Data Exchange (ETDEWEB)

    Fukuda, M.N.; Masri, K.A. (La Jolla Cancer Research Foundation, CA (USA)); Dell, A. (Imperial College of Science Technology and Medicine, London (England)); Luzzatto, L. (Hammersmith Hospital, London (England)); Moremen, K.W. (Massachusetts Institute of Technology, Cambridge, MA (USA))

    1990-10-01

    Congenital dyserythropoietic anemia type II, or hereditary erythroblastic multinuclearity with a positive acidified-serum-lysis test (HEMPAS), is a genetic anemia in humans inherited by an autosomally recessive mode. The enzyme defect in most HEMPAS patients has previously been proposed as a lowered activity of N-acetylglucosaminyltransferase II, resulting in a lack of polylactosamine on proteins and leading to the accumulation of polylactosaminyl lipids. A recent HEMPAS case, G.C., has now been analyzed by cell-surface labeling, fast-atom-bombardment mass spectrometry of glycopeptides, and activity assay of glycosylation enzymes. Significantly decreased glycosylation of polylactosaminoglycan proteins and incompletely processed asparagine-linked oligosaccharides were detected in the erythrocyte membranes of G.C. These results suggest that G.C. cells contain a mutation in {alpha}-ManII-encoding gene that results in inefficient expression of {alpha}-ManII mRNA, either through reduced transcription or message instability. This report demonstrates that HEMPAS is caused by a defective gene encoding an enzyme necessary for the synthesis of asparagine-linked oligosaccharides.

  4. A novel nonsense mutation in KDM5C/JARID1C gene causing intellectual disability, short stature and speech delay.

    Science.gov (United States)

    Santos-Rebouças, Cíntia B; Fintelman-Rodrigues, Natalia; Jensen, Lars R; Kuss, Andreas W; Ribeiro, Márcia G; Campos, Mário; Santos, Jussara M; Pimentel, Márcia M G

    2011-07-01

    Mutations in the Jumonji AT-rich interactive domain 1C (JARID1C/SMCX/KDM5C) gene, located at Xp11.22, are emerging as frequent causes of X-linked intellectual disability (XLID). KDM5C encodes for a member of an ARID protein family that harbors conserved DNA-binding motifs and acts as a histone H3 lysine 4 demethylase, suggesting a potential role in epigenetic regulation during development, cell growth and differentiation. In this study, we describe clinical and genetic findings of a Brazilian family co-segregating a novel nonsense mutation (c.2172C>A) in exon 15 of KDM5C gene with the intellectual disability phenotype. The transition resulted in replacement of the normal cysteine by a premature termination codon at position 724 of the protein (p.Cys724X), leading to reduced levels of KDM5C transcript probably due to nonsense mediated mRNA decay. The clinical phenotype of the proband, who has two affected brothers and a mild cognitively impaired mother, consisted of short stature, speech delay, hyperactivity, violent behavior and high palate, besides severe mental retardation. Our findings extend the number of KDM5C mutations implicated in XLID and highlight its promise for understanding neural function and unexplained cases of XLID. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  5. The dwarf phenotype in GH240B mice, haploinsufficient for the autism candidate gene Neurobeachin, is caused by ectopic expression of recombinant human growth hormone.

    Directory of Open Access Journals (Sweden)

    Kim Nuytens

    Full Text Available Two knockout mouse models for the autism candidate gene Neurobeachin (Nbea have been generated independently. Although both models have similar phenotypes, one striking difference is the dwarf phenotype observed in the heterozygous configuration of the GH240B model that is generated by the serendipitous insertion of a promoterless human growth hormone (hGH genomic fragment in the Nbea gene. In order to elucidate this discrepancy, the dwarfism present in this Nbea mouse model was investigated in detail. The growth deficiency in Nbea+/- mice coincided with an increased percentage of fat mass and a decrease in bone mineral density. Low but detectable levels of hGH were detected in the pituitary and hypothalamus of Nbea+/- mice but not in liver, hippocampus nor in serum. As a consequence, several members of the mouse growth hormone (mGH signaling cascade showed altered mRNA levels, including a reduction in growth hormone-releasing hormone mRNA in the hypothalamus. Moreover, somatotrope cells were less numerous in the pituitary of Nbea+/- mice and both contained and secreted significantly less mGH resulting in reduced levels of circulating insulin-like growth factor 1. These findings demonstrate that the random integration of the hGH transgene in this mouse model has not only inactivated Nbea but has also resulted in the tissue-specific expression of hGH causing a negative feedback loop, mGH hyposecretion and dwarfism.

  6. Curly bare (cub), a new mouse mutation on chromosome 11 causing skin and hair abnormalities, and a modifier gene (mcub) on chromosome 5.

    Science.gov (United States)

    Johnson, Kenneth R; Lane, Priscilla W; Cook, Susan A; Harris, Belinda S; Ward-Bailey, Patricia F; Bronson, Roderick T; Lyons, Bonnie L; Shultz, Leonard D; Davisson, Muriel T

    2003-01-01

    In the outcrossing of a new recessive mouse mutation causing hair loss, a new wavy-coated phenotype appeared. The two distinct phenotypes were shown to be alternative manifestations of the same gene mutation and attributable to a single modifier locus. The new mutation, curly bare (cub), was mapped to distal Chr 11 and the modifier (mcub) was mapped to Chr 5. When homozygous for the recessive mcub allele, cub/cub mice appear hairless. A single copy of the dominant Mcub allele confers a full, curly coat in cub/cub mice. Reciprocal transfer of full-thickness skin grafts between mutant and control animals showed that the skin phenotype was tissue autonomous. The hairless cub/cub mcub/mcub mice show normal contact sensitivity responses to oxazolone. The similarity of the wavy coat phenotype to those of Tgfa and Egfr mutations and the map positions of cub and mcub suggest candidate genes that interact in the EGF receptor signal transduction pathway.

  7. Genome Sequencing and Transposon Mutagenesis of Burkholderia seminalis TC3.4.2R3 Identify Genes Contributing to Suppression of Orchid Necrosis Caused by B. gladioli.

    Science.gov (United States)

    Araújo, Welington L; Creason, Allison L; Mano, Emy T; Camargo-Neves, Aline A; Minami, Sonia N; Chang, Jeff H; Loper, Joyce E

    2016-06-01

    From a screen of 36 plant-associated strains of Burkholderia spp., we identified 24 strains that suppressed leaf and pseudobulb necrosis of orchid caused by B. gladioli. To gain insights into the mechanisms of disease suppression, we generated a draft genome sequence from one suppressive strain, TC3.4.2R3. The genome is an estimated 7.67 megabases in size, with three replicons, two chromosomes, and the plasmid pC3. Using a combination of multilocus sequence analysis and phylogenomics, we identified TC3.4.2R3 as B. seminalis, a species within the Burkholderia cepacia complex that includes opportunistic human pathogens and environmental strains. We generated and screened a library of 3,840 transposon mutants of strain TC3.4.2R3 on orchid leaves to identify genes contributing to plant disease suppression. Twelve mutants deficient in suppression of leaf necrosis were selected and the transposon insertions were mapped to eight loci. One gene is in a wcb cluster that is related to synthesis of extracellular polysaccharide, a key determinant in bacterial-host interactions in other systems, and the other seven are highly conserved among Burkholderia spp. The fundamental information developed in this study will serve as a resource for future research aiming to identify mechanisms contributing to biological control.

  8. Involvement of Ca2+ in Vacuole Degradation Caused by a Rapid Temperature Decrease in Saintpaulia Palisade Cells: A Case of Gene Expression Analysis in a Specialized Small Tissue.

    Science.gov (United States)

    Ohnishi, Miwa; Kadohama, Noriaki; Suzuki, Yoshihiro; Kajiyama, Tomoharu; Shichijo, Chizuko; Ishizaki, Kimitsune; Fukaki, Hidehiro; Iida, Hidetoshi; Kambara, Hideki; Mimura, Tetsuro

    2015-07-01

    Saintpaulia (African violet) leaves are known to be damaged by a rapid temperature decrease when cold water is applied to the leaf surface; the injury is ascribed to the chloroplast damage caused by the cytosolic pH decrease following the degradation of the vacuolar membrane in the palisade cells. In this report, we present evidence for the involvement of Ca(2+) in facilitating the collapse of the vacuolar membrane and in turn in the temperature sensitivity of Saintpaulia leaves. In the presence of a Ca(2+) chelator (EGTA) or certain Ca(2+) channel inhibitors (Gd(3+) or La(3+)) but not others (verapamil or nifedipine), the pH of the vacuole, monitored through BCECF (2',7'-bis(carboxyethyl)-4 or 5-carboxyfluorescein) fluorescence, did not increase in response to a rapid temperature drop. These pharmacological observations are consistent with the involvement of mechanosensitive Ca(2+) channels in the collapse of the vacuolar membrane. The high level of expression of an MCA- (Arabidopsis mechanosensitive Ca(2+) channel) like gene, a likely candidate for a mechanosensitive Ca(2+) channel(s) in plant cells, was confirmed in the palisade tissue in Saintpaulia leaves by using a newly developed method of gene expression analysis for the specialized small tissues. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  9. Haploinsufficiency of the E3 ubiquitin-protein ligase gene TRIP12 causes intellectual disability with or without autism spectrum disorders, speech delay, and dysmorphic features.

    Science.gov (United States)

    Zhang, Jing; Gambin, Tomasz; Yuan, Bo; Szafranski, Przemyslaw; Rosenfeld, Jill A; Balwi, Mohammed Al; Alswaid, Abdulrahman; Al-Gazali, Lihadh; Shamsi, Aisha M Al; Komara, Makanko; Ali, Bassam R; Roeder, Elizabeth; McAuley, Laura; Roy, Daniel S; Manchester, David K; Magoulas, Pilar; King, Lauren E; Hannig, Vickie; Bonneau, Dominique; Denommé-Pichon, Anne-Sophie; Charif, Majida; Besnard, Thomas; Bézieau, Stéphane; Cogné, Benjamin; Andrieux, Joris; Zhu, Wenmiao; He, Weimin; Vetrini, Francesco; Ward, Patricia A; Cheung, Sau Wai; Bi, Weimin; Eng, Christine M; Lupski, James R; Yang, Yaping; Patel, Ankita; Lalani, Seema R; Xia, Fan; Stankiewicz, Paweł

    2017-04-01

    Impairment of ubiquitin-proteasome system activity involving ubiquitin ligase genes UBE3A, UBE3B, and HUWE1 and deubiquitinating enzyme genes USP7 and USP9X has been reported in patients with neurodevelopmental delays. To date, only a handful of single-nucleotide variants (SNVs) and copy-number variants (CNVs) involving TRIP12, encoding a member of the HECT domain E3 ubiquitin ligases family on chromosome 2q36.3 have been reported. Using chromosomal microarray analysis and whole-exome sequencing (WES), we have identified, respectively, five deletion CNVs and four inactivating SNVs (two frameshifts, one missense, and one splicing) in TRIP12. Seven of these variants were found to be de novo; parental studies could not be completed in two families. Quantitative PCR analyses of the splicing mutation showed a dramatically decreased level of TRIP12 mRNA in the proband compared to the family controls, indicating a loss-of-function mechanism. The shared clinical features include intellectual disability with or without autistic spectrum disorders, speech delay, and facial dysmorphism. Our findings demonstrate that E3 ubiquitin ligase TRIP12 plays an important role in nervous system development and function. The nine presented pathogenic variants further document that TRIP12 haploinsufficiency causes a childhood-onset neurodevelopmental disorder. Finally, our data enable expansion of the phenotypic spectrum of ubiquitin-proteasome dependent disorders.

  10. Autosomal recessive HEM/Greenberg skeletal dysplasia is caused by 3 beta-hydroxysterol delta 14-reductase deficiency due to mutations in the lamin B receptor gene.

    Science.gov (United States)

    Waterham, Hans R; Koster, Janet; Mooyer, Petra; Noort Gv, Gerard van; Kelley, Richard I; Wilcox, William R; Wanders, Ronald J A; Hennekam, Raoul C M; Oosterwijk, Jan C

    2003-04-01

    Hydrops-ectopic calcification-"moth-eaten" (HEM) or Greenberg skeletal dysplasia is an autosomal recessive chondrodystrophy with a lethal course, characterized by fetal hydrops, short limbs, and abnormal chondro-osseous calcification. We found elevated levels of cholesta-8,14-dien-3beta-ol in cultured skin fibroblasts of an 18-wk-old fetus with HEM, compatible with a deficiency of the cholesterol biosynthetic enzyme 3beta-hydroxysterol delta(14)-reductase. Sequence analysis of two candidate genes encoding putative human sterol delta(14)-reductases (TM7SF2 and LBR) identified a homozygous 1599-1605TCTTCTA-->CTAGAAG substitution in exon 13 of the LBR gene encoding the lamin B receptor, which results in a truncated protein. Functional complementation of the HEM cells by transfection with control LBR cDNA confirmed that LBR encoded the defective sterol delta(14)-reductase. Mutations in LBR recently have been reported also to cause Pelger-Huët anomaly, an autosomal dominant trait characterized by hypolobulated nuclei and abnormal chromatin structure in granulocytes. The fact that the healthy mother of the fetus showed hypolobulated nuclei in 60% of her granulocytes confirms that classic Pelger-Huët anomaly represents the heterozygous state of 3beta-hydroxysterol delta(14)-reductase deficiency.

  11. A novel TRPS1 gene mutation causing trichorhinophalangeal syndrome with growth hormone responsive short stature: a case report and review of the literature.

    Science.gov (United States)

    Merjaneh, Lina; Parks, John S; Muir, Andrew B; Fadoju, Doris

    2014-01-01

    The role of growth hormone (GH) and its therapeutic supplementation in the trichorhinophalangeal syndrome type I (TRPS I) is not well delineated. TRPS I is a rare congenital syndrome, characterized by craniofacial and skeletal malformations including short stature, sparse, thin scalp hair and lateral eyebrows, pear-shaped nose, cone shaped epiphyses and hip dysplasia. It is inherited in an autosomal dominant manner and caused by haploinsufficiency of the TRPS1 gene. We report a family (Mother and 3 of her 4 children) with a novel mutation in the TRPS1 gene. The diagnosis was suspected only after meeting all family members and comparing affected and unaffected siblings since the features of this syndrome might be subtle. The eldest sibling, who had neither GH deficiency nor insensitivity, improved his growth velocity and height SDS after 2 years of treatment with exogenous GH. No change in growth velocity was observed in the untreated siblings during this same period. This report emphasizes the importance of examining all family members when suspecting a genetic syndrome. It also demonstrates the therapeutic effect of GH treatment in TRPS I despite normal GH-IGF1 axis. A review of the literature is included to address whether TRPS I is associated with: a) GH deficiency, b) GH resistance, or c) GH-responsive short stature. More studies are needed before recommending GH treatment for TRPS I but a trial should be considered on an individual basis.

  12. A novel mutation in the nerve-specific 5'UTR of the GJB1 gene causes X-linked Charcot-Marie-Tooth disease.

    LENUS (Irish Health Repository)

    Murphy, Sinéad M

    2011-03-01

    X-linked Charcot-Marie-Tooth disease (CMT1X) is the second most common cause of CMT, and is usually caused by mutations in the gap junction protein beta 1 (GJB1) gene which codes for connexin 32 (CX32). CX32 has three tissue-specific promoters, P1 which is specific for liver and pancreas, P1a specific for liver, oocytes and embryonic stem cells, and P2 which is nerve-specific. Over 300 mutations have been described in GJB1, spread throughout the coding region. We describe two families with X-linked inheritance and a phenotype consistent with CMT1X who did not have mutations in the GJB1 coding region. The non-coding region of GJB1 was sequenced and an upstream exon-splicing variant found at approximately - 373G>A which segregated with the disease in both families and was not present in controls. This substitution is located at the last base of the nerve-specific 5\\'UTR and thus may disrupt splicing of the nerve-specific transcript. Online consensus splice-site programs predict a reduced score for the mutant sequence vs. the normal sequence. It is likely that other mutations within the GJB1 non-coding regions account for the CMT1X families who do not have coding region mutations.

  13. Alcohol consumption during gestation causes histone3 lysine9 hyperacetylation and an alternation of expression of heart development-related genes in mice.

    Science.gov (United States)

    Pan, Bo; Zhu, Jing; Lv, Tiewei; Sun, Huichao; Huang, Xupei; Tian, Jie

    2014-09-01

    Alcohol abuse during gestation may cause congenital heart diseases (CHDs). The underlying mechanisms of alcohol-induced cardiac deformities are still not clear. Recent studies suggest that histone modification may play a crucial role in this pathological process. Moreover, our previous studies reported that ethanol could induce histone3 lysine9 (H3K9) hyperacetylation and overexpression of heart development-related genes in vitro. The aim of this study was to investigate the effect of alcohol consumption during gestation on the imbalance of H3K9 acetylation and the alternation of the expression of heart development-related genes during cardiogenesis. Pregnant mice were exposed to a single dose of alcohol (10 μl/g/d, 56% alcohol) by gavage every day in the morning from embryo day 7.5 (E7.5) to E15.5. Hematoxylin and eosin (H&E) staining was applied for observing the structure of the embryonic hearts. Western blotting and quantitative real-time polymerase chain reaction were used for detecting the level of H3K9 acetylation and gene expression. Histone acetyltransferase (HAT) and histone deacetylase (HDAC) activities were detected by colorimetric assay and fluorometric assay. H&E staining of cardiac tissue showed abnormalities of embryonic hearts at E17.5. The level of H3K9 acetylation reached peak at E17.5 and decreased sharply to a low level at birth and maintained at low level afterward. Alcohol exposure increased H3K9 acetylation at E11.5, E14.5, E17.5, and E18.5, respectively (p hearts at E14.5 and E17.5, Mef2c at E14.5, and Nkx2.5 at E14.5 and E17.5, (p 0.05). On embryonic day 17.5, HA