WorldWideScience

Sample records for tg single rag-deficient

  1. Multi-valued logic circuits using hybrid circuit consisting of three gates single-electron transistors (TG-SETs) and MOSFETs.

    Science.gov (United States)

    Shin, SeungJun; Yu, YunSeop; Choi, JungBum

    2008-10-01

    New multi-valued logic (MVL) families using the hybrid circuits consisting of three gates single-electron transistors (TG-SETs) and a metal-oxide-semiconductor field-effect transistor (MOSFET) are proposed. The use of SETs offers periodic literal characteristics due to Coulomb oscillation of SET, which allows a realization of binary logic (BL) circuits as well as multi-valued logic (MVL) circuits. The basic operations of the proposed MVL families are successfully confirmed through SPICE circuit simulation based on the physical device model of a TG-SET. The proposed MVL circuits are found to be much faster, but much larger power consumption than a previously reported MVL, and they have a trade-off between speed and power consumption. As an example to apply the newly developed MVL families, a half-adder is introduced.

  2. A single mutation in the gatekeeper residue in TgMAPKL-1 restores the inhibitory effect of a bumped kinase inhibitor on the cell cycle

    Directory of Open Access Journals (Sweden)

    Tatsuki Sugi

    2015-04-01

    Full Text Available Toxoplasma gondii is the causative pathogen for Toxoplasmosis. Bumped kinase inhibitor 1NM-PP1 inhibits the growth of T. gondii by targeting TgCDPK1. However, we recently reported that resistance to 1NM-PP1 can be acquired via a mutation in T. gondii mitogen-activated protein kinase like 1 (TgMAPKL-1. Further characterization of how this TgMAPKL-1 mutation restores the inhibitory effect of 1NM-PP1 would shed further light on the function of TgMAPKL-1 in the parasite life cycle. Therefore, we made parasite clones with TgMAPKL-1 mutated at the gatekeeper residue Ser 191, which is critical for 1NM-PP1 susceptibility. Host cell lysis of RH/ku80-/HA-TgMAPKL-1S191A was completely inhibited at 250 nM 1NM-PP1, whereas that of RH/ku80-/HA-TgMAPKL-1S191Y was not. By comparing 1NM-PP1-sensitive (RH/ku80-/HA-TgMAPKL-1S191A and -resistant (RH/ku80-/HA-TgMAPKL-1S191Y clones, we observed that inhibition of TgMAPKL-1 blocked cell cycle progression after DNA duplication. Morphological analysis revealed that TgMAPKL-1 inhibition caused enlarged parasite cells with many daughter cell scaffolds and imcomplete cytokinesis. We conclude that the mutation in TgMAPKL-1 restored the cell cycle-arresting effect of 1NM-PP1 on T. gondii endodyogeny. Given that endodyogeny is the primary mechanism of cell division for both the tachyzoite and bradyzoite stages of this parasite, TgMAPKL-1 may be a promising target for drug development. Exploration of the signals that regulate TgMAPKL-1 will provide further insights into the unique mode of T. gondii cell division.

  3. A single mutation in the gatekeeper residue in TgMAPKL-1 restores the inhibitory effect of a bumped kinase inhibitor on the cell cycle.

    Science.gov (United States)

    Sugi, Tatsuki; Kawazu, Shin-Ichiro; Horimoto, Taisuke; Kato, Kentaro

    2015-04-01

    Toxoplasma gondii is the causative pathogen for Toxoplasmosis. Bumped kinase inhibitor 1NM-PP1 inhibits the growth of T. gondii by targeting TgCDPK1. However, we recently reported that resistance to 1NM-PP1 can be acquired via a mutation in T. gondii mitogen-activated protein kinase like 1 (TgMAPKL-1). Further characterization of how this TgMAPKL-1 mutation restores the inhibitory effect of 1NM-PP1 would shed further light on the function of TgMAPKL-1 in the parasite life cycle. Therefore, we made parasite clones with TgMAPKL-1 mutated at the gatekeeper residue Ser 191, which is critical for 1NM-PP1 susceptibility. Host cell lysis of RH/ku80(-)/HA-TgMAPKL-1(S191A) was completely inhibited at 250 nM 1NM-PP1, whereas that of RH/ku80(-)/HA-TgMAPKL-1(S191Y) was not. By comparing 1NM-PP1-sensitive (RH/ku80(-)/HA-TgMAPKL-1(S191A)) and -resistant (RH/ku80(-)/HA-TgMAPKL-1(S191Y)) clones, we observed that inhibition of TgMAPKL-1 blocked cell cycle progression after DNA duplication. Morphological analysis revealed that TgMAPKL-1 inhibition caused enlarged parasite cells with many daughter cell scaffolds and imcomplete cytokinesis. We conclude that the mutation in TgMAPKL-1 restored the cell cycle-arresting effect of 1NM-PP1 on T. gondii endodyogeny. Given that endodyogeny is the primary mechanism of cell division for both the tachyzoite and bradyzoite stages of this parasite, TgMAPKL-1 may be a promising target for drug development. Exploration of the signals that regulate TgMAPKL-1 will provide further insights into the unique mode of T. gondii cell division.

  4. TG-FTIR characterization of coal and biomass single fuels and blends under slow heating rate conditions: Partitioning of the fuel-bound nitrogen

    Energy Technology Data Exchange (ETDEWEB)

    Di Nola, G.; de Jong, W.; Spliethoff, H. [Energy Technology Section, Process and Energy Department, Faculty 3me, Delft University of Technology, Leeghwaterstraat 44, 2628 CA Delft (Netherlands)

    2010-01-15

    The devolatilization behavior of a bituminous coal and different biomass fuels currently applied in the Dutch power sector for co-firing was experimentally investigated. The volatile composition during single fuel pyrolysis as well as during co-pyrolysis was studied using TG-FTIR characterization with the focus on the release patterns and quantitative analysis of the gaseous bound nitrogen species. It was shown that all investigated biomass fuels present more or less similar pyrolysis behavior, with a maximum weight loss between 300 and 380 C. Woody and agricultural biomass materials show higher devolatilization rates than animal waste. When comparing different fuels, the percentage of fuel-bound nitrogen converted to volatile bound-N species (NH{sub 3}, HCN, HNCO) does not correlate with the initial fuel-N content. Biomass pyrolysis resulted in higher volatile-N yields than coal, which potentially indicates that NO{sub x} control during co-firing might be favored. No significant interactions occurred during the pyrolysis of coal/biomass blends at conditions typical of TG analysis (slow heating rate). Evolved gas analysis of volatile species confirmed the absence of mutual interactions during woody biomass co-pyrolysis. However, non-additive behavior of selected gas species was found during slaughter and poultry litter co-pyrolysis. Higher CH{sub 4} yields between 450 and 750 C and higher ammonia and CO yields between 550 and 900 C were measured. Such a result is likely to be attributed to catalytic effects of alkali and alkaline earth metals present in high quantity in animal waste ash. The fact that the co-pyrolysis of woody and agricultural biomass is well modeled by simple addition of the individual behavior of its components permits to predict the mixture's behavior based on experimental data available for single fuels. On the other hand, animal waste co-pyrolysis presented in some cases synergistic effects in gas products although additive behavior

  5. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  6. Characterization of TG2 and TG1-TG2 double knock-out mouse epidermis.

    Science.gov (United States)

    Pitolli, Consuelo; Pietroni, Valentina; Marekov, Lyuben; Terrinoni, Alessandro; Yamanishi, Kiyofumi; Mazzanti, Cinzia; Melino, Gerry; Candi, Eleonora

    2017-03-01

    Transglutaminases (TGs) are a family of enzymes that catalyse the formation of isopeptide bonds between the γ-carboxamide groups of glutamine residues and the ε-amino groups of lysine residues leading to cross-linking reactions among proteins. Four members, TG1, TG2, TG3, and TG5, of the nine mammalian enzymes are expressed in the skin. TG1, TG3 and TG5 crosslinking properties are fundamental for cornified envelope assembly. In contrast, the role of TG2 in keratinization has never been studied at biochemical level in vivo. In this study, taking advantage of the TG2 knock-out (KO) and TG1 heterozygous mice, we generated and characterized the epidermis of TG1-TG2 double knock-out (DKO) mice. We performed morphological analysis of the epidermis and evaluation of the expression of differentiation markers. In addition, we performed analysis of the amino acid composition from isolated corneocytes. We found a significant change in amino acid composition in TG1KO cornified cell envelopes (CEs) while TG2KO amino acid composition was similar to wild-type CEs. Our results confirm a key role of TG1 in skin differentiation and CE assembly and demonstrate that TG2 is not essential for CE assembly and skin formation.

  7. Robustness analyses of numerical simulation of fusion welding NeT-TG1 application: 'Single weld-bead-on-plate'

    Energy Technology Data Exchange (ETDEWEB)

    Gilles, Philippe [AREVA, 92084 Paris La defense (France)], E-mail: philippe.gilles@areva.com; El-Ahmar, Walid; Jullien, Jean-Francois [LaMCoS, INSA-LYON, CNRS UMR 5259, F69621 (France)

    2009-01-15

    This study contributes to the NeT-TG1 European Network formed in 2002. The aim of this study is to predict, by numerical simulation, the residual stresses generated in a test plate by the fusion welding process. The experiment consisted in the deposit of a weld bead along the longitudinal centre-line of an austenitic 316L plate using an automatic Tungsten Inert Gas (TIG) welding process with 316L filler material. During and after thermal cycle, a large quantity of measurement data is obtained that serve to develop a comparison with the results of different numerical models. The comparative thermal and mechanical analysis allows assessment for the general ability of the numerical models to describe the structural behaviour. The importance of the heat-input rate and material characteristics is also investigated. The residual stresses were predicted by the finite element method using the program Code{sub A}ster of EDF and SYSWELD of ESI-GROUP. Finally the numerical results are validated by comparison with experimentally measured data.

  8. Gene Therapy for RAG-deficient Severe Combined Immunodeficiency

    NARCIS (Netherlands)

    K. Pike (Karin)

    2007-01-01

    textabstractSevere combined immunodeficiency (SCID) is a rare class of primary, inherited, immunodeficiency causing infants to suffer from persistent diarrhea, opportunistic infections and a failure to thrive. RAG proteins play a crucial role in the initiation of V(D)J recombination of

  9. [TgAb interference with experimental Tg values detected by dilution curves].

    Science.gov (United States)

    Wu, Xia; Xu, Jin; Ni, Jian; Yu, Ying; Zhang, Wen-Jie; Pan, Ming-Zhi; Huang, Rui; Tang, Gong-Shun

    2013-05-01

    To identify the interference of endogenous antithyroglobulin (TgAb) with experimental thyroglobulin (Tg) values using dilution curves. Dilution buffer, detectable TgAb serums (TgAb 20-25 IU/mL, Tg free) and undetectable TgAb serums (TgAb assay (IMA). The experimental Tg values (Y-axis) were plotted against expected serum Tg values (X-axis). Diluted curves were used to evaluate the interference of TgAb on the experimental Tg values. A linear dilution curve is supposed to appear if no TgAb interference exists. The Tg dilution curves with dilution buffer were linear. Thirty six dilution curves were obtained with TgAb serums from six patients diluted by detectable TgAb serums, and 12 showed linear. Tg serums from six patients diluted by one detectable TgAb serum resulted in both linear and non-linear results. One Tg serum diluted by six TgAb serums also resulted both linear and non-linear results. Tg serums from three patients diluted by five undetectable TgAb serums resulted in 11 dilution curves, four of which were linear. Dilution curves can be used to predict TgAb interference indirectly. Detectable TgAb may not interfere with experimental Tg values. Whereas, undetectable TgAb may interfere with Tg values. TgAb could not be used to predict Tg interference.

  10. Boosting with intranasal dendrimeric Aβ1–15 but not Aβ1–15 peptide leads to an effective immune response following a single injection of Aβ1–40/42 in APP-tg mice

    Directory of Open Access Journals (Sweden)

    Thomas Katelyn

    2006-06-01

    Full Text Available Abstract Background Immunotherapy for Alzheimer's disease (AD is emerging as a potential treatment. However, a clinical trial (AN1792 was halted after adverse effects occurred in a small subset of subjects, which may have been caused by a T cell-mediated immunological response. In general, aging limits the humoral immune response, therefore, immunogens and vaccination regimes are required that induce a strong antibody response with less potential for an adverse immune response. Method In the current study, we immunized both wildtype and J20 APP-tg mice with a priming injection of Aβ1–40/42, followed by multiple intranasal boosts with the novel immunogen dAβ1–15 (16 copies of Aβ1–15 on a lysine tree, Aβ1–15 peptide or Aβ1–40/42 full length peptide. Results J20 APP-tg mice primed with Aβ1–40/42 subcutaneously and subsequently boosted intranasally with Aβ1–15 peptide did not generate a cellular or humoral immune response. In contrast, J20 APP-tg mice boosted intranasally with dAβ1–15 or full length Aβ1–40/42 produced high levels of anti-Aβ antibodies. Splenocyte proliferation was minimal in mice immunized with dAβ1–15. Wildtype littermates of the J20 APP-tg mice produced higher amounts of anti-Aβ antibodies compared to APP-tg mice but also had low T cell proliferation. The anti-Aβ antibodies were mainly composed of IgG2b and directed to an epitope within the Aβ1–7 region, regardless of the immunogen. Examination of the brain showed a significant reduction in Aβ plaque burden in the J20 APP-tg mice producing antibodies compared to controls. Biochemically, Aβ40 or Aβ42 were also reduced in brain homogenates and elevated in plasma but the changes did not reach significance. Conclusion Our results demonstrate that priming with full length Aβ40/42 followed by boosting with dAβ1–15 but not Aβ1–15 peptide led to a robust humoral immune response with a minimal T cell response in J20 APP-tg mice. In addition, A

  11. Compound list: rosiglitazone maleate [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available rosiglitazone maleate RGZ 00151 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LAT...EST/Human/in_vitro/rosiglitazone_maleate.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tg...gates/LATEST/Rat/in_vivo/Liver/Single/rosiglitazone_maleate.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/rosiglitazone_maleate.Rat.in_vivo.Liver.Repeat.zip ...

  12. Aging of Dielectric Properties below Tg

    DEFF Research Database (Denmark)

    Olsen, Niels Boye; Dyre, Jeppe; Christensen, Tage Emil

    The dielectric loss at 1Hz in TPP is studied during a temperature step from one equilibrium state to another. In the applied cryostate the temperature can be equilibrated on a timescale of 1 second. The aging time dependence of the dielectric loss is studied below Tg applying temperature steps...

  13. Leaky RAG Deficiency in Adult Patients with Impaired Antibody Production against Bacterial Polysaccharide Antigens.

    Directory of Open Access Journals (Sweden)

    Christoph B Geier

    Full Text Available Loss of function mutations in the recombination activating genes RAG1 and RAG2 have been reported to cause a T-B-NK+ type of severe combined immunodeficiency. In addition identification of hypomorphic mutations in RAG1 and RAG2 has led to an expansion of the spectrum of disease to include Omenn syndrome, early onset autoimmunity, granuloma, chronic cytomegalovirus- or EBV-infection with expansion of gamma/delta T-cells, idiophatic CD4 lymphopenia and a phenotype resembling common variable immunodeficiency. Herein we describe a novel presentation of leaky RAG1 and RAG2 deficiency in two unrelated adult patients with impaired antibody production against bacterial polysaccharide antigens. Clinical manifestation included recurrent pneumonia, sinusitis, otitis media and in one patient recurrent cutaneous vasculitis. Both patients harbored a combination of a null mutation on one allele with a novel hypomorphic RAG1/2 mutation on the other allele. One of these novel mutations affected the start codon of RAG1 and resulted in an aberrant gene and protein expression. The second novel RAG2 mutation leads to a truncated RAG2 protein, lacking the C-terminus with intact core RAG2 and reduced VDJ recombination capacity as previously described in a mouse model. Both patients presented with severely decreased numbers of naïve CD4+ T cells and defective T independent IgG responses to bacterial polysaccharide antigens, while T cell-dependent IgG antibody formation e.g. after tetanus or TBEV vaccination was intact. In conclusion, hypomorphic mutations in genes responsible for SCID should be considered in adults with predominantly antibody deficiency.

  14. Leaky RAG Deficiency in Adult Patients with Impaired Antibody Production against Bacterial Polysaccharide Antigens

    Science.gov (United States)

    Geier, Christoph B.; Piller, Alexander; Linder, Angela; Sauerwein, Kai M. T.; Eibl, Martha M.; Wolf, Hermann M.

    2015-01-01

    Loss of function mutations in the recombination activating genes RAG1 and RAG2 have been reported to cause a T-B-NK+ type of severe combined immunodeficiency. In addition identification of hypomorphic mutations in RAG1 and RAG2 has led to an expansion of the spectrum of disease to include Omenn syndrome, early onset autoimmunity, granuloma, chronic cytomegalovirus- or EBV-infection with expansion of gamma/delta T-cells, idiophatic CD4 lymphopenia and a phenotype resembling common variable immunodeficiency. Herein we describe a novel presentation of leaky RAG1 and RAG2 deficiency in two unrelated adult patients with impaired antibody production against bacterial polysaccharide antigens. Clinical manifestation included recurrent pneumonia, sinusitis, otitis media and in one patient recurrent cutaneous vasculitis. Both patients harbored a combination of a null mutation on one allele with a novel hypomorphic RAG1/2 mutation on the other allele. One of these novel mutations affected the start codon of RAG1 and resulted in an aberrant gene and protein expression. The second novel RAG2 mutation leads to a truncated RAG2 protein, lacking the C-terminus with intact core RAG2 and reduced VDJ recombination capacity as previously described in a mouse model. Both patients presented with severely decreased numbers of naïve CD4+ T cells and defective T independent IgG responses to bacterial polysaccharide antigens, while T cell-dependent IgG antibody formation e.g. after tetanus or TBEV vaccination was intact. In conclusion, hypomorphic mutations in genes responsible for SCID should be considered in adults with predominantly antibody deficiency. PMID:26186701

  15. Iodide handling disorders (NIS, TPO, TG, IYD).

    Science.gov (United States)

    Targovnik, Héctor M; Citterio, Cintia E; Rivolta, Carina M

    2017-03-01

    Iodide Handling Disorders lead to defects of the biosynthesis of thyroid hormones (thyroid dyshormonogenesis, TD) and thereafter congenital hypothyroidism (CH), the most common endocrine disease characterized by low levels of circulating thyroid hormones. The prevalence of CH is 1 in 2000-3000 live births. Prevention of CH is based on prenatal diagnosis, carrier identification, and genetic counseling. In neonates a complete diagnosis of TD should include clinical examination, biochemical thyroid tests, thyroid ultrasound, radioiodine or technetium scintigraphy and perchlorate discharge test (PDT). Biosynthesis of thyroid hormones requires the presence of iodide, thyroid peroxidase (TPO), a supply of hydrogen peroxide (DUOX system), an iodine acceptor protein, thyroglobulin (TG), and the rescue and recycling of iodide by the action of iodotyrosine deiodinase or iodotyrosine dehalogenase 1 (IYD or DEHAL1). The iodide transport is a two-step process involving transporters located either in the basolateral or apical membranes, sodium iodide symporter (NIS) and pendrin (PDS), respectively. TD has been linked to mutations in the solute carrier family 5, member 5 transporter (SLC5A5, encoding NIS), solute carrier family 26, member 4 transporter (SLC26A4, encoding PDS), TPO, DUOX2, DUOXA2, TG and IYD genes. These mutations produce a heterogeneous spectrum of CH, with an autosomal recessive inheritance. Thereafter, the patients are usually homozygous or compound heterozygous for the gene mutations and the parents, carriers of one mutation. In the last two decades, considerable progress has been made in identifying the genetic and molecular causes of TD. Recent advances in DNA sequencing technology allow the massive screening and facilitate the studies of phenotype variability. In this article we included the most recent data related to disorders caused by mutations in NIS, TPO, TG and IYD. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Targeted disruption of TgPhIL1 in Toxoplasma gondii results in altered parasite morphology and fitness.

    Directory of Open Access Journals (Sweden)

    Whittney Dotzler Barkhuff

    Full Text Available The inner membrane complex (IMC, a series of flattened vesicles at the periphery of apicomplexan parasites, is thought to be important for parasite shape, motility and replication, but few of the IMC proteins that function in these processes have been identified. TgPhIL1, a Toxoplasma gondii protein that was previously identified through photosensitized labeling with 5-[(125I] iodonapthaline-1-azide, associates with the IMC and/or underlying cytoskeleton and is concentrated at the apical end of the parasite. Orthologs of TgPhIL1 are found in other apicomplexans, but the function of this conserved protein family is unknown. As a first step towards determining the function of TgPhIL1 and its orthologs, we generated a T. gondii parasite line in which the single copy of TgPhIL1 was disrupted by homologous recombination. The TgPhIL1 knockout parasites have a distinctly different morphology than wild-type parasites, and normal shape is restored in the knockout background after complementation with the wild-type allele. The knockout parasites are outcompeted in culture by parasites expressing functional TgPhIL1, and they generate a reduced parasite load in the spleen and liver of infected mice. These findings demonstrate a role for TgPhIL1 in the morphology, growth and fitness of T. gondii tachyzoites.

  17. Compound list: bromoethylamine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available bromoethylamine BEA 00134 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Hu...Rat/in_vivo/Liver/Single/bromoethylamine.Rat.in_vivo.Liver.Single.zip ftp://ftp.b...iosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/bromoethylamine.Rat.in_vivo.Liver.Repea...t.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/bromoethylamine.Rat.i...n_vivo.Kidney.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/bromoethylamine.Rat.in_vivo.Kidney.Repeat.zip ...

  18. Compound list: dexamethasone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available dexamethasone DEX 00153 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/dexamethason...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/dexamethasone.Rat.in_vivo.Liver.Single.zip ...

  19. Compound list: thioacetamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available thioacetamide TAA 00017 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/thioacetam...ide.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/thioacetam..._vivo/Liver/Single/thioacetamide.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/thioacetamide.Rat.in_vivo.Liver.Repeat.zip ftp:...//ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/thioacetamide.Rat.in_vivo.Kidne

  20. Compound list: captopril [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available captopril CAP 00094 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/captop...ril.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/captop...ril.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/captop...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/captopril.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.biosciencedbc....jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/captopril.Rat.in_vivo.Kidney.Single.zip ftp://ftp.b

  1. Compound list: allopurinol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available allopurinol APL 00028 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/all...opurinol.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/all...opurinol.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/all...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/allopurinol.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bios...ciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/allopurinol.Rat.in_vivo.Kidney.Single.zip

  2. Compound list: carboplatin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available carboplatin CBP 00133 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/carboplatin....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/carboplatin...T/Rat/in_vivo/Liver/Repeat/carboplatin.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bio...sciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/carboplatin.Rat.in_vivo.Kidney.Single.zi...p ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/carboplatin.Rat.in_vivo.Kidney.Repeat.zip ...

  3. Compound list: omeprazole [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available omeprazole OPZ 00012 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/omeprazole....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/omeprazole....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/omeprazole...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/omeprazole.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/omeprazole.Rat.in_vivo.Kidney.Single.zip ftp:/

  4. Compound list: cephalothin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available cephalothin CLT 00141 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ceph...alothin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ceph...T/Rat/in_vivo/Liver/Repeat/cephalothin.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bio...sciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/cephalothin.Rat.in_vivo.Kidney.Single.zi...p ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/cephalothin.Rat.in_vivo.Kidney.Repeat.zip ...

  5. Compound list: clofibrate [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available clofibrate CFB 00006 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/clofibra...te.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/clofibra...te.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/clofibra...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/clofibrate.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/clofibrate.Rat.in_vivo.Kidney.Single.zip ftp:/

  6. Compound list: triamterene [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available triamterene TRI 00101 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/triamterene....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/triamterene...T/Rat/in_vivo/Liver/Repeat/triamterene.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bio...sciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/triamterene.Rat.in_vivo.Kidney.Single.zi...p ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/triamterene.Rat.in_vivo.Kidney.Repeat.zip ...

  7. Compound list: rifampicin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available rifampicin RIF 00008 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/rifampic...in.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/rifampic...in.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/rifampic...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/rifampicin.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/rifampicin.Rat.in_vivo.Kidney.Single.zip ftp:/

  8. Compound list: imipramine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available imipramine IMI 00069 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/imipramine....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/imipramine....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/imipramine...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/imipramine.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/imipramine.Rat.in_vivo.Kidney.Single.zip ftp:/

  9. Compound list: doxorubicin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available doxorubicin DOX 00149 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/doxorubicin....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/doxorubicin....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/doxorubicin...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/doxorubicin.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bios...ciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/doxorubicin.Rat.in_vivo.Kidney.Single.zip

  10. Compound list: monocrotaline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available monocrotaline MCT 00058 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/monocrotaline....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/monocrotaline..._vivo/Liver/Single/monocrotaline.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/monocrotaline.Rat.in_vivo.Liver.Repeat.zip ftp:...//ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/monocrotaline.Rat.in_vivo.Kidne

  11. Compound list: indomethacin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available indomethacin IM 00015 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/indome...thacin.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/indome...thacin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/indome...jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/indomethacin.Rat.in_vivo.Liver.Repeat.zip ftp://ftp....biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/indomethacin.Rat.in_vivo.Kidney.Singl

  12. Compound list: enalapril [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available enalapril ENA 00095 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/enalap...ril.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/enalap...ril.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/enalap...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/enalapril.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.biosciencedbc....jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/enalapril.Rat.in_vivo.Kidney.Single.zip ftp://ftp.b

  13. Compound list: caffeine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available caffeine CAF 00097 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/caffeine....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/caffeine....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/caffeine...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/caffeine.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.biosciencedbc.jp/ar...chive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/caffeine.Rat.in_vivo.Kidney.Single.zip ftp://ftp.bioscie

  14. Compound list: acetazolamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available acetazolamide ACZ 00108 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/acetazolamide....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/acetazolamide..._vivo/Liver/Single/acetazolamide.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/acetazolamide.Rat.in_vivo.Liver.Repeat.zip ftp:...//ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/acetazolamide.Rat.in_vivo.Kidne

  15. Compound list: ethinylestradiol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ethinylestradiol EE 00055 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Hu...T/Rat/in_vitro/ethinylestradiol.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATES...T/Rat/in_vivo/Liver/Single/ethinylestradiol.Rat.in_vivo.Liver.Single.zip ftp://ft...p.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ethinylestradiol.Rat.in_vivo.Liver.R...epeat.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/ethinylestradiol.

  16. Compound list: hexachlorobenzene [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available hexachlorobenzene HCB 00022 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/...TEST/Rat/in_vitro/hexachlorobenzene.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/L...ATEST/Rat/in_vivo/Liver/Single/hexachlorobenzene.Rat.in_vivo.Liver.Single.zip ftp...://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/hexachlorobenzene.Rat.in_vivo.L...iver.Repeat.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/hexachlorob

  17. Compound list: cisplatin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available cisplatin CSP 00132 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/cisplat...in.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/cisplat...bc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/cisplatin.Rat.in_vivo.Kidney.Single.zip ftp://ft...p.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/cisplatin.Rat.in_vivo.Kidney.Repeat.zip ... ...in_vivo/Liver/Repeat/cisplatin.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bioscienced

  18. Compound list: phenacetin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available phenacetin PCT 00138 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ph...enacetin.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ph...enacetin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ph...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/phenacetin.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/phenacetin.Rat.in_vivo.Kidney.Single.zip ftp:/

  19. Compound list: acetamidofluorene [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available acetamidofluorene AAF 00144 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/acetam...idofluorene.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/acetam...ATEST/Rat/in_vivo/Liver/Single/acetamidofluorene.Rat.in_vivo.Liver.Single.zip ftp...://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/acetamidofluorene.Rat.in_vivo.Liver.Repeat.zip ...

  20. Compound list: propylthiouracil [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available propylthiouracil PTU 00029 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/pro...pylthiouracil.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/pro...ST/Rat/in_vivo/Liver/Single/propylthiouracil.Rat.in_vivo.Liver.Single.zip ftp://f...tp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/propylthiouracil.Rat.in_vivo.Liver.Repeat.zip ...

  1. Compound list: nitrofurazone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available nitrofurazone NFZ 00065 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/nitrofurazon...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/nitrofurazon..._vivo/Liver/Single/nitrofurazone.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/nitrofurazone.Rat.in_vivo.Liver.Repeat.zip ...

  2. Compound list: tunicamycin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available tunicamycin TUN 00A02 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/tunicamy...cin.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/tunicamy...cin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/tunicamycin.Rat.in_vivo.Liver.Single.zip ...

  3. Compound list: chloramphenicol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available chloramphenicol CMP 00064 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/chlorampheni...col.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST...Rat/in_vivo/Liver/Single/chloramphenicol.Rat.in_vivo.Liver.Single.zip ftp://ftp.b...iosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/chloramphenicol.Rat.in_vivo.Liver.Repeat.zip ...

  4. Compound list: chlorpheniramine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available chlorpheniramine CHL 00090 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/chlorpheni...ramine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATE...ST/Rat/in_vivo/Liver/Single/chlorpheniramine.Rat.in_vivo.Liver.Single.zip ftp://f...tp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/chlorpheniramine.Rat.in_vivo.Liver.Repeat.zip ...

  5. Compound list: chlorpromazine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available chlorpromazine CPZ 00016 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/chlorprom...azine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/chlorprom.../in_vivo/Liver/Single/chlorpromazine.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosc...iencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/chlorpromazine.Rat.in_vivo.Liver.Repeat.zip ...

  6. Compound list: phenobarbital [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available phenobarbital PB 00004 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/phenobarbita...l.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/phenobarbita...vivo/Liver/Single/phenobarbital.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscience...dbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/phenobarbital.Rat.in_vivo.Liver.Repeat.zip ...

  7. Compound list: galactosamine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available galactosamine GaN 00A06 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/galactosamine....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/galactosamine....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/galactosamine.Rat.in_vivo.Liver.Single.zip ...

  8. Compound list: amitriptyline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available amitriptyline AMT 00070 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/amitriptyline....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/amitriptyline..._vivo/Liver/Single/amitriptyline.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/amitriptyline.Rat.in_vivo.Liver.Repeat.zip ...

  9. Compound list: chlormezanone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available chlormezanone CMN 00052 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/chlormezanon...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/chlormezanon..._vivo/Liver/Single/chlormezanone.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/chlormezanone.Rat.in_vivo.Liver.Repeat.zip ...

  10. Compound list: chlormadinone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available chlormadinone CLM 00126 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/chlormadinon...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/chlormadinon..._vivo/Liver/Single/chlormadinone.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/chlormadinone.Rat.in_vivo.Liver.Repeat.zip ...

  11. Compound list: rotenone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available rotenone ROT 00152 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/rotenon...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/rotenon...e.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/rotenone.Rat.in_vivo.Liver.Repeat.zip ...

  12. Compound list: propranolol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available propranolol PPL 00170 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/propranolol...olol.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/propranolol.Rat.in_vivo.Liver.Repeat.zip ... ....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/propran

  13. Compound list: cycloheximide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available cycloheximide CHX 00A01 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/cycloh...eximide.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/cycloh...eximide.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/cycloheximide.Rat.in_vivo.Liver.Single.zip ...

  14. Compound list: glibenclamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available glibenclamide GBC 00042 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/glibenclamide....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/glibenclamide..._vivo/Liver/Single/glibenclamide.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/glibenclamide.Rat.in_vivo.Liver.Repeat.zip ...

  15. Compound list: chlorpropamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available chlorpropamide CPP 00080 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/chlorpropamid...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/chlorpropamid.../in_vivo/Liver/Single/chlorpropamide.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosc...iencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/chlorpropamide.Rat.in_vivo.Liver.Repeat.zip ...

  16. Compound list: TNFα [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available TNFα TNF 00A08 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/TNF...a.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/TNFa.Rat....in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/TNFa.Rat.in_vivo.Liver.Single.zip ...

  17. Compound list: phorone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available phorone PHO 00A03 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ph...orone.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ph...orone.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/phorone.Rat.in_vivo.Liver.Single.zip ...

  18. MrBayes tgMC³: a tight GPU implementation of MrBayes.

    Directory of Open Access Journals (Sweden)

    Cheng Ling

    Full Text Available MrBayes is model-based phylogenetic inference tool using Bayesian statistics. However, model-based assessment of phylogenetic trees adds to the computational burden of tree-searching, and so poses significant computational challenges. Graphics Processing Units (GPUs have been proposed as high performance, low cost acceleration platforms and several parallelized versions of the Metropolis Coupled Markov Chain Mote Carlo (MC(3 algorithm in MrBayes have been presented that can run on GPUs. However, some bottlenecks decrease the efficiency of these implementations. To address these bottlenecks, we propose a tight GPU MC(3 (tgMC(3 algorithm. tgMC(3 implements a different architecture from the one-to-one acceleration architecture employed in previously proposed methods. It merges multiply discrete GPU kernels according to the data dependency and hence decreases the number of kernels launched and the complexity of data transfer. We implemented tgMC(3 and made performance comparisons with an earlier proposed algorithm, nMC(3, and also with MrBayes MC(3 under serial and multiply concurrent CPU processes. All of the methods were benchmarked on the same computing node from DEGIMA. Experiments indicate that the tgMC(3 method outstrips nMC(3 (v1.0 with speedup factors from 2.1 to 2.7×. In addition, tgMC(3 outperforms the serial MrBayes MC(3 by a factor of 6 to 30× when using a single GTX480 card, whereas a speedup factor of around 51× can be achieved by using two GTX 480 cards on relatively long sequences. Moreover, tgMC(3 was compared with MrBayes accelerated by BEAGLE, and achieved speedup factors from 3.7 to 5.7×. The reported performance improvement of tgMC(3 is significant and appears to scale well with increasing dataset sizes. In addition, the strategy proposed in tgMC(3 could benefit the acceleration of other Bayesian-based phylogenetic analysis methods using GPUs.

  19. Compound list: acetaminophen [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available acetaminophen APAP 00001 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/acetam...inophen.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/acetam...inophen.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/aceta...cedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/acetaminophen.Rat.in_vivo.Liver.Repeat.zip ftp...://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/acetaminophen.Rat.in_vivo.Kidn

  20. Compound list: ethanol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ethanol ETN 00137 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ethanol....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ethanol....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ethanol....Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ethanol.Rat.in_vivo.Liver.Repeat.zip ...

  1. Compound list: ciprofloxacin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ciprofloxacin CPX 00050 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/cipro...floxacin.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/cipro...floxacin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/cipro...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ciprofloxacin.Rat.in_vivo.Liver.Repeat.zip ftp:...//ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/ciprofloxacin.Rat.in_vivo.Kidne

  2. Compound list: aspirin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available aspirin ASA 00014 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/aspirin....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/aspirin....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/aspirin....Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/aspirin.Rat.in_vivo.Liver.Repeat.zip ...

  3. Compound list: methyltestosterone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available methyltestosterone MTS 00041 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/methylte...LATEST/Rat/in_vitro/methyltestosterone.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/methyltestosterone.R... ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/methyltestosterone.Rat.in_v...ivo.Liver.Repeat.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/methylte...n-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/methyltestosterone.Rat.in_vivo.Kidney.Repeat.zip ...

  4. Compound list: tetracycline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available tetracycline TC 00048 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/tetracycline....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/tetracycline...jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/tetracycline.Rat.in_vivo.Liver.Repeat.zip ... ....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/tetracycli...ne.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.

  5. Compound list: griseofulvin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available griseofulvin GF 00043 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/griseofulvin....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/griseofulvin...jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/griseofulvin.Rat.in_vivo.Liver.Repeat.zip ... ....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/griseofulv...in.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.

  6. Compound list: benzbromarone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available benzbromarone BBr 00021 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/benzbrom...arone.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/benzbrom...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/benzbromarone.Rat.in_vivo.Liver.Repeat.zip ... ...arone.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in..._vivo/Liver/Single/benzbromarone.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc

  7. Compound list: bromobenzene [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available bromobenzene BBZ 00032 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/brom...obenzene.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/brom...obenzene.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/brom....jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/bromobenzene.Rat.in_vivo.Liver.Repeat.zip ftp://ftp....biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/bromobenzene.Rat.in_vivo.Kidney.Sing

  8. Compound list: clomipramine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available clomipramine CPM 00121 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/clomipramine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/clomipramine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/clomipramine.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/clomipramine.Rat.in_vivo.Liver.Repeat.zip ...

  9. Compound list: theophylline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available theophylline TEO 00096 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/theophylline....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/theophylline....jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/theophylline.Rat.in_vivo.Liver.Repeat.zip ... ...vo/Liver/Single/theophylline.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vi

  10. Compound list: adapin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available adapin ADP 00039 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/adapi...n.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/adapi...n.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/adapi...n.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/adapin.Rat.in_vivo.Liver.Repeat.zip ...

  11. Compound list: disopyramide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available disopyramide DIS 00102 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/disopyramide....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/disopyramide....jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/disopyramide.Rat.in_vivo.Liver.Repeat.zip ... ....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vi...vo/Liver/Single/disopyramide.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc

  12. Compound list: cyclophosphamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available cyclophosphamide CPA 00024 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/H...uman/in_vitro/cyclophosphamide.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATE...ST/Rat/in_vitro/cyclophosphamide.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATE...ST/Rat/in_vivo/Liver/Single/cyclophosphamide.Rat.in_vivo.Liver.Single.zip ftp://f...tp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/cyclophosphamide.Rat.in_vivo.Liver.

  13. Compound list: phenylbutazone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available phenylbutazone PhB 00011 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/phenylbutazon...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/phenylbutazon...iencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/phenylbutazone.Rat.in_vivo.Liver.Repeat.zip... ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/phenylbutazone.Rat.in_vivo....Kidney.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/phenylbutazone.Rat.in_vivo.Kidney.Repeat.zip ...

  14. Compound list: nitrosodiethylamine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available nitrosodiethylamine DEN 00145 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATES...s/LATEST/Rat/in_vitro/nitrosodiethylamine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tgg...ates/LATEST/Rat/in_vivo/Liver/Single/nitrosodiethylamine.Rat.in_vivo.Liver.Single....zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/nitrosodiethylamine.Rat.in_vivo.Liver.Repeat.zip ... ...T/Human/in_vitro/nitrosodiethylamine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggate

  15. Compound list: danazol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available danazol DNZ 00127 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/dana...zol.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/dana...zol.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/dana...zol.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/danazol.Rat.in_vivo.Liver.Repeat.zip ...

  16. Lorentz Distributed Noncommutative F(T,TG Wormhole Solutions

    Directory of Open Access Journals (Sweden)

    M. Sharif

    2018-01-01

    Full Text Available The aim of this paper is to study static spherically symmetric noncommutative F(T,TG wormhole solutions along with Lorentzian distribution. Here, T and TG are torsion scalar and teleparallel equivalent Gauss-Bonnet term, respectively. We take a particular redshift function and two F(T,TG models. We analyze the behavior of shape function and also examine null as well as weak energy conditions graphically. It is concluded that there exist realistic wormhole solutions for both models. We also studied the stability of these wormhole solutions through equilibrium condition and found them stable.

  17. Study of galactic halo F(T,TG) wormhole solutions

    Science.gov (United States)

    Sharif, M.; Nazir, Kanwal

    In this paper, we investigate static spherically symmetric wormhole solutions with galactic halo region in the background of F(T,TG) gravity. Here, T represents torsion scalar and TG is teleparallel equivalent Gauss-Bonnet term. For this purpose, we consider a diagonal tetrad and two specific F(T,TG) models. We analyze the wormhole structure through shape function graphically for both models. We also investigate the behavior of null/weak energy conditions. Finally, we evaluate the equilibrium condition to check stability of the wormhole solutions. It is concluded that there exists physically viable wormhole solution only for the first model that turns out to be stable.

  18. Compound list: ticlopidine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ticlopidine TCP 00146 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ticlopid...ine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ticlopid...ine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ticlopid...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ticlopidine.Rat.in_vivo.Liver.Repeat.zip ...

  19. Compound list: etoposide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available etoposide ETP 00131 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/etop...oside.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/etop...oside.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/etop...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/etoposide.Rat.in_vivo.Liver.Repeat.zip ...

  20. Compound list: labetalol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available labetalol LBT 00040 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/lab...etalol.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/lab...etalol.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/lab...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/labetalol.Rat.in_vivo.Liver.Repeat.zip ...

  1. Compound list: bendazac [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available bendazac BDZ 00129 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/bend...azac.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/bend...azac.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/bend...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/bendazac.Rat.in_vivo.Liver.Repeat.zip ...

  2. Compound list: tiopronin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available tiopronin TIO 00104 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/tiopro...nin.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/tiopro...nin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/tiopro...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/tiopronin.Rat.in_vivo.Liver.Repeat.zip ...

  3. Compound list: naproxen [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available naproxen NPX 00073 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/napro...xen.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/napro...xen.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/napro...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/naproxen.Rat.in_vivo.Liver.Repeat.zip ...

  4. Compound list: sulindac [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available sulindac SUL 00100 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/sulinda...c.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/sulinda...c.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/sulinda...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/sulindac.Rat.in_vivo.Liver.Repeat.zip ...

  5. Compound list: fenofibrate [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available fenofibrate FFB 00079 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/fenofibra...te.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/fenofibra...te.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/fenofibra...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/fenofibrate.Rat.in_vivo.Liver.Repeat.zip ...

  6. Compound list: papaverine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available papaverine PAP 00098 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/papaverine.Human.in_vitro.Liver.zip ftp://ftp....biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/papa...verine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/papa...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/papaverine.Rat.in_vivo.Liver.Repeat.zip ...

  7. Compound list: quinidine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available quinidine QND 00074 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/qui...nidine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/qui...nidine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/qui...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/quinidine.Rat.in_vivo.Liver.Repeat.zip ...

  8. Compound list: disulfiram [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available disulfiram DSF 00109 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/dis...ulfiram.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/dis...ulfiram.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/dis...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/disulfiram.Rat.in_vivo.Liver.Repeat.zip ...

  9. Compound list: diazepam [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available diazepam DZP 00023 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/diazepam....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/diazepam....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/diazepam...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/diazepam.Rat.in_vivo.Liver.Repeat.zip ...

  10. Compound list: terbinafine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available terbinafine TBF 00123 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/terbinafin...e.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/terbinafin...e.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/terbinafin...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/terbinafine.Rat.in_vivo.Liver.Repeat.zip ...

  11. Compound list: ibuprofen [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ibuprofen IBU 00072 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ibup...rofen.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ibup...rofen.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ibup...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ibuprofen.Rat.in_vivo.Liver.Repeat.zip ...

  12. Compound list: simvastatin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available simvastatin SST 00117 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/simvastatin....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/simvastatin....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/simvastatin...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/simvastatin.Rat.in_vivo.Liver.Repeat.zip ...

  13. Compound list: penicillamine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available penicillamine PEN 00099 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/peni...cillamine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/peni...cillamine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/peni...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/penicillamine.Rat.in_vivo.Liver.Repeat.zip ...

  14. Compound list: promethazine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available promethazine PMZ 00110 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/prom...ethazine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/prom...ethazine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/prom....jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/promethazine.Rat.in_vivo.Liver.Repeat.zip ...

  15. Compound list: ethambutol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ethambutol EBU 00083 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/etham...butol.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/etham...butol.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/etham...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ethambutol.Rat.in_vivo.Liver.Repeat.zip ...

  16. Compound list: nifedipine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available nifedipine NIF 00091 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/nif...edipine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/nif...edipine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/nif...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/nifedipine.Rat.in_vivo.Liver.Repeat.zip ...

  17. Compound list: coumarin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available coumarin CMA 00027 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/coum...arin.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/coum...arin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/coum...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/coumarin.Rat.in_vivo.Liver.Repeat.zip ...

  18. Compound list: amiodarone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available amiodarone AM 00033 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/amiodarone....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/amiodarone....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/amiodarone...ve/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/amiodarone.Rat.in_vivo.Liver.Repeat.zip ...

  19. Compound list: metformin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available metformin MFM 00053 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/metf...ormin.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/metf...ormin.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/metf...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/metformin.Rat.in_vivo.Liver.Repeat.zip ...

  20. Compound list: fluphenazine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available fluphenazine FP 00037 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/fluphenazi...ne.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/fluphenazi...ne.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/fluphenazi...jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/fluphenazine.Rat.in_vivo.Liver.Repeat.zip ...

  1. Compound list: benziodarone [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available benziodarone BZD 00130 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/benziodar...one.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/benziodar...one.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/benziodar....jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/benziodarone.Rat.in_vivo.Liver.Repeat.zip ...

  2. Compound list: dantrolene [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available dantrolene DTL 00119 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/dantrol...ene.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/dantrol...ene.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/dantrol...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/dantrolene.Rat.in_vivo.Liver.Repeat.zip ...

  3. Compound list: gemfibrozil [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available gemfibrozil GFZ 00031 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/gemf...ibrozil.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/gemf...ibrozil.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/gemf...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/gemfibrozil.Rat.in_vivo.Liver.Repeat.zip ...

  4. Compound list: perhexiline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available perhexiline PH 00045 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/perhexiline....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/perhexiline....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/perhexiline...rchive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/perhexiline.Rat.in_vivo.Liver.Repeat.zip ...

  5. Compound list: pemoline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available pemoline PML 00051 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/pemoline....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/pemoline....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/pemoline...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/pemoline.Rat.in_vivo.Liver.Repeat.zip ...

  6. Compound list: ajmaline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ajmaline AJM 00118 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ajmaline....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ajmaline....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ajmaline...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ajmaline.Rat.in_vivo.Liver.Repeat.zip ...

  7. Compound list: furosemide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available furosemide FUR 00078 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/furosemide....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/furosemide....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/furosemide...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/furosemide.Rat.in_vivo.Liver.Repeat.zip ...

  8. Compound list: haloperidol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available haloperidol HPL 00036 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/haloperidol....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/haloperidol....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/haloperidol...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/haloperidol.Rat.in_vivo.Liver.Repeat.zip ...

  9. Compound list: iproniazid [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available iproniazid IPA 00062 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ipronia...zid.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ipronia...zid.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ipronia...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/iproniazid.Rat.in_vivo.Liver.Repeat.zip ...

  10. Compound list: isoniazid [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available isoniazid INAH 00002 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/isonia...zid.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/isonia...zid.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/isonia.../open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/isoniazid.Rat.in_vivo.Liver.Repeat.zip ...

  11. Compound list: famotidine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available famotidine FAM 00085 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/famo...tidine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/famo...tidine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/famo...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/famotidine.Rat.in_vivo.Liver.Repeat.zip ...

  12. Compound list: tamoxifen [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available tamoxifen TMX 00054 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/tamo...xifen.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/tamo...xifen.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/tamo...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/tamoxifen.Rat.in_vivo.Liver.Repeat.zip ...

  13. Compound list: triazolam [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available triazolam TZM 00120 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/triazol...am.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/triazol...am.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/triazol...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/triazolam.Rat.in_vivo.Liver.Repeat.zip ...

  14. Compound list: acarbose [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available acarbose ACA 00116 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/acar...bose.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/acar...bose.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/acar...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/acarbose.Rat.in_vivo.Liver.Repeat.zip ...

  15. Compound list: lornoxicam [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available lornoxicam LNX 00125 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/lornoxicam....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/lornoxicam....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/lornoxicam...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/lornoxicam.Rat.in_vivo.Liver.Repeat.zip ...

  16. Compound list: meloxicam [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available meloxicam MLX 00124 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/meloxicam....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/meloxicam....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/meloxicam...open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/meloxicam.Rat.in_vivo.Liver.Repeat.zip ...

  17. Compound list: tolbutamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available tolbutamide TLB 00114 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/tolbutamide....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/tolbutamide....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/tolbutamide...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/tolbutamide.Rat.in_vivo.Liver.Repeat.zip ...

  18. Compound list: flutamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available flutamide FT 00044 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/flutamide....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/flutamide....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/flutamide...pen-tggates/LATEST/Rat/in_vivo/Liver/Repeat/flutamide.Rat.in_vivo.Liver.Repeat.zip ...

  19. Compound list: ethionamide [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available ethionamide ETH 00135 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/ethionamide....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/ethionamide....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/ethionamide...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/ethionamide.Rat.in_vivo.Liver.Repeat.zip ...

  20. Compound list: colchicine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available colchicine COL 00113 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/colchicine....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/colchicine....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/colchicine...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/colchicine.Rat.in_vivo.Liver.Repeat.zip ...

  1. Compound list: methyldopa [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available methyldopa MDP 00056 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/methyl...dopa.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/methyl...dopa.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/methyl...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/methyldopa.Rat.in_vivo.Liver.Repeat.zip ...

  2. Compound list: trimethadione [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available trimethadione TMD 00122 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/trimeth...adione.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/trimeth...adione.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/trimet...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/trimethadione.Rat.in_vivo.Liver.Repeat.zip ...

  3. Compound list: methapyrilene [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available methapyrilene MP 00025 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/meth...apyrilene.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/meth...apyrilene.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/meth...dbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/methapyrilene.Rat.in_vivo.Liver.Repeat.zip ...

  4. Compound list: methimazole [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available methimazole MTZ 00057 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/meth...imazole.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/meth...imazole.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/meth...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/methimazole.Rat.in_vivo.Liver.Repeat.zip ...

  5. Compound list: phalloidin [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available phalloidin PHA 00A11 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/phalloi...din.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/phalloi...din.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/phalloi...ive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/phalloidin.Rat.in_vivo.Liver.Repeat.zip ...

  6. Compound list: hydroxyzine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available hydroxyzine HYZ 00071 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/hydroxy...zine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/hydroxy...zine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/hydroxy...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/hydroxyzine.Rat.in_vivo.Liver.Repeat.zip ...

  7. Compound list: carbamazepine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available carbamazepine CBZ 00018 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/carbam...azepine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/carbam...azepine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/carbam...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/carbamazepine.Rat.in_vivo.Liver.Repeat.zip ...

  8. IMRT Commissioning: application of the AAPM's TG-119; Comissionamento de IMRT: aplicacao do TG-119 da AAPM

    Energy Technology Data Exchange (ETDEWEB)

    Zeppellini, Caroline; Furnari, Laura, E-mail: laurafurnari@hotmail.com [Universidade de Sao Paulo (USP), Sao Paulo, SP (Brazil). Fac. de Medicina. Inst. de Radiologia

    2013-08-15

    In order to verify the commissioning of the planning of intensity-modulated radiation therapy system (IMRT), the TG-119 of the American Association of Physicists in Medicine (AAPM) was applied. Using pre defined targets and normal structures, plans were realized, absolute and relative dose were measured with an ionizing chamber and films, and the results were compared with planned values. The maximum deviation of the measurements with the ionization chamber was 3,6%, but, in the total eleven measurements, only two were bigger than the tolerance limit of 3%, recommended by TG-119. The number of points which passed criteria gamma 3% to 3 mm ranged between 96.36% and 99.92%, all measurements were within the recommended 95%. The confidence limits found for both film and for chamber were lower than those achieved in the TG-119. Our results showed a good concordance with TG-119, what means that the system is adequate for clinical applications. (author)

  9. Comparison of TG-43 and TG-186 in breast irradiation using a low energy electronic brachytherapy source

    Energy Technology Data Exchange (ETDEWEB)

    White, Shane A.; Landry, Guillaume; Reniers, Brigitte, E-mail: brigitte.reniers@maastro.nl [Department of Radiation Oncology (MAASTRO), GROW School for Oncology and Developmental Biology, Maastricht University Medical Center (MUMC), Maastricht 6201 BN (Netherlands); Fonseca, Gabriel Paiva [Department of Radiation Oncology (MAASTRO), GROW School for Oncology and Developmental Biology, Maastricht University Medical Center (MUMC), Maastricht 6201 BN, The Netherlands and Instituto de Pesquisas Energéticas e Nucleares – IPEN-CNEN/SP, São Paulo CP 11049, 05422-970 (Brazil); Holt, Randy; Rusch, Thomas [Xoft, A Subsidiary of iCAD, Sunnyvale, California 94085-4115 (United States); Beaulieu, Luc [Centre Hospitalier Universitaire de Québec Université Laval, Radio-Oncologie et Centre de Recherche en Cancérologie de l’Université Laval, Québec, Québec G1R 2J6 Canada (Canada); Verhaegen, Frank [Department of Radiation Oncology (MAASTRO), GROW School for Oncology and Developmental Biology, Maastricht University Medical Center (MUMC), Maastricht 6201 BN, The Netherlands and Department of Oncology, McGill University, Montreal, Quebec H3G 1A4 (Canada)

    2014-06-15

    Purpose: The recently updated guidelines for dosimetry in brachytherapy in TG-186 have recommended the use of model-based dosimetry calculations as a replacement for TG-43. TG-186 highlights shortcomings in the water-based approach in TG-43, particularly for low energy brachytherapy sources. The Xoft Axxent is a low energy (<50 kV) brachytherapy system used in accelerated partial breast irradiation (APBI). Breast tissue is a heterogeneous tissue in terms of density and composition. Dosimetric calculations of seven APBI patients treated with Axxent were made using a model-based Monte Carlo platform for a number of tissue models and dose reporting methods and compared to TG-43 based plans. Methods: A model of the Axxent source, the S700, was created and validated against experimental data. CT scans of the patients were used to create realistic multi-tissue/heterogeneous models with breast tissue segmented using a published technique. Alternative water models were used to isolate the influence of tissue heterogeneity and backscatter on the dose distribution. Dose calculations were performed using Geant4 according to the original treatment parameters. The effect of the Axxent balloon applicator used in APBI which could not be modeled in the CT-based model, was modeled using a novel technique that utilizes CAD-based geometries. These techniques were validated experimentally. Results were calculated using two dose reporting methods, dose to water (D{sub w,m}) and dose to medium (D{sub m,m}), for the heterogeneous simulations. All results were compared against TG-43-based dose distributions and evaluated using dose ratio maps and DVH metrics. Changes in skin and PTV dose were highlighted. Results: All simulated heterogeneous models showed a reduced dose to the DVH metrics that is dependent on the method of dose reporting and patient geometry. Based on a prescription dose of 34 Gy, the average D{sub 90} to PTV was reduced by between ∼4% and ∼40%, depending on the

  10. Comparison of TG-43 and TG-186 in breast irradiation using a low energy electronic brachytherapy source.

    Science.gov (United States)

    White, Shane A; Landry, Guillaume; Fonseca, Gabriel Paiva; Holt, Randy; Rusch, Thomas; Beaulieu, Luc; Verhaegen, Frank; Reniers, Brigitte

    2014-06-01

    The recently updated guidelines for dosimetry in brachytherapy in TG-186 have recommended the use of model-based dosimetry calculations as a replacement for TG-43. TG-186 highlights shortcomings in the water-based approach in TG-43, particularly for low energy brachytherapy sources. The Xoft Axxent is a low energy (brachytherapy system used in accelerated partial breast irradiation (APBI). Breast tissue is a heterogeneous tissue in terms of density and composition. Dosimetric calculations of seven APBI patients treated with Axxent were made using a model-based Monte Carlo platform for a number of tissue models and dose reporting methods and compared to TG-43 based plans. A model of the Axxent source, the S700, was created and validated against experimental data. CT scans of the patients were used to create realistic multi-tissue/heterogeneous models with breast tissue segmented using a published technique. Alternative water models were used to isolate the influence of tissue heterogeneity and backscatter on the dose distribution. Dose calculations were performed using Geant4 according to the original treatment parameters. The effect of the Axxent balloon applicator used in APBI which could not be modeled in the CT-based model, was modeled using a novel technique that utilizes CAD-based geometries. These techniques were validated experimentally. Results were calculated using two dose reporting methods, dose to water (Dw,m) and dose to medium (Dm,m), for the heterogeneous simulations. All results were compared against TG-43-based dose distributions and evaluated using dose ratio maps and DVH metrics. Changes in skin and PTV dose were highlighted. All simulated heterogeneous models showed a reduced dose to the DVH metrics that is dependent on the method of dose reporting and patient geometry. Based on a prescription dose of 34 Gy, the average D90 to PTV was reduced by between ~4% and ~40%, depending on the scoring method, compared to the TG-43 result. Peak skin dose

  11. Comparison of Thyroglobulin Measurements Using Three Different Immunoassay Kits: A BRAMHS Tg-Plus RIA Kit, a BRAMHS hTg Sensitive Kryptor Kit, and a Beckman Coulter ACCESS Immunoassay Kit.

    Science.gov (United States)

    Kim, Mijin; Jeon, Min Ji; Kim, Won Gu; Lee, Jong Jin; Ryu, Jin Sook; Cho, Eun Jung; Ko, Dae Hyun; Lee, Woochang; Chun, Sail; Min, Won Ki; Kim, Tae Yong; Shong, Young Kee; Kim, Won Bae

    2016-09-01

    Second-generation thyroglobulin immunometric assays (Tg-IMAs) have been developed with improved sensitivity. Our aim was to compare the diagnostic value of Tg-IMA measurements using a Kryptor (BRAHMS AG) kit (Tg-K) and an ACCESS (Beckman Coulter) kit (Tg-A) with that of the first-generation Tg measurement using a Tg-plus (BRAHMS AG) kit (Tg+). We enrolled 82 differentiated thyroid cancer patients who underwent total thyroidectomy with radioactive iodine remnant ablation and who underwent diagnostic whole body scan using recombinant human thyroid stimulating hormone (rhTSH). The Tg+, Tg-K, and Tg-A were measured before rhTSH administration during levothyroxine treatment (suppressed Tg) from the same sample. Serum Tg+ was measured after rhTSH stimulation (stimulated Tg). Suppressed Tg+ was more significantly correlated with suppressed Tg-K (R²=0.919, P<0.001) than with suppressed Tg-A (R²=0.536, P<0.001). The optimal cut-off values of suppressed Tg+, Tg-K, and Tg-A for predicting stimulated Tg+ of 1 ng/mL were 0.3, 0.2, and 0.2 ng/mL, respectively. The sensitivity, specificity, and accuracy of suppressed Tg+ were 67%, 100%, and 90%, respectively; those of suppressed Tg-K were 83%, 90%, and 88%; those of suppressed Tg-A were 96%, 82%, and 87%, respectively. The positive predictive and negative predictive values of Tg+ were 100% and 87%, respectively; those of Tg-K were 79% and 92%; and those of Tg-A were 73% and 98%. We could not clearly demonstrate which kit had better diagnostic performance after comparison of first-generation Tg measurements with Tg-IMA measurements. Also, there were kit-to-kit variations between Tg-IMA kits. Suppressed Tg measured by Tg-IMA was insufficient to completely substitute for a stimulated Tg measurement.

  12. Identifying activated T cells in reconstituted RAG deficient mice using retrovirally transduced Pax5 deficient pro-B cells.

    Directory of Open Access Journals (Sweden)

    Nadesan Gajendran

    Full Text Available Various methods have been used to identify activated T cells such as binding of MHC tetramers and expression of cell surface markers in addition to cytokine-based assays. In contrast to these published methods, we here describe a strategy to identify T cells that respond to any antigen and track the fate of these activated T cells. We constructed a retroviral double-reporter construct with enhanced green fluorescence protein (EGFP and a far-red fluorescent protein from Heteractis crispa (HcRed. LTR-driven EGFP expression was used to enrich and identify transduced cells, while HcRed expression is driven by the CD40Ligand (CD40L promoter, which is inducible and enables the identification and cell fate tracing of T cells that have responded to infection/inflammation. Pax5 deficient pro-B cells that can give rise to different hematopoietic cells like T cells, were retrovirally transduced with this double-reporter cassette and were used to reconstitute the T cell pool in RAG1 deficient mice that lack T and B cells. By using flow cytometry and histology, we identified activated T cells that had developed from Pax5 deficient pro-B cells and responded to infection with the bacterial pathogen Listeria monocytogenes. Microscopic examination of organ sections allowed visual identification of HcRed-expressing cells. To further characterize the immune response to a given stimuli, this strategy can be easily adapted to identify other cells of the hematopoietic system that respond to infection/inflammation. This can be achieved by using an inducible reporter, choosing the appropriate promoter, and reconstituting mice lacking cells of interest by injecting gene-modified Pax5 deficient pro-B cells.

  13. Limitations of the TG-43 formalism for skin high-dose-rate brachytherapy dose calculations

    Energy Technology Data Exchange (ETDEWEB)

    Granero, Domingo, E-mail: dgranero@eresa.com [Department of Radiation Physics, ERESA, Hospital General Universitario, 46014 Valencia (Spain); Perez-Calatayud, Jose [Radiotherapy Department, La Fe University and Polytechnic Hospital, Valencia 46026 (Spain); Vijande, Javier [Department of Atomic, Molecular and Nuclear Physics, University of Valencia, Burjassot 46100, Spain and IFIC (UV-CSIC), Paterna 46980 (Spain); Ballester, Facundo [Department of Atomic, Molecular and Nuclear Physics, University of Valencia, Burjassot 46100 (Spain); Rivard, Mark J. [Department of Radiation Oncology, Tufts University School of Medicine, Boston, Massachusetts 02111 (United States)

    2014-02-15

    Purpose: In skin high-dose-rate (HDR) brachytherapy, sources are located outside, in contact with, or implanted at some depth below the skin surface. Most treatment planning systems use the TG-43 formalism, which is based on single-source dose superposition within an infinite water medium without accounting for the true geometry in which conditions for scattered radiation are altered by the presence of air. The purpose of this study is to evaluate the dosimetric limitations of the TG-43 formalism in HDR skin brachytherapy and the potential clinical impact. Methods: Dose rate distributions of typical configurations used in skin brachytherapy were obtained: a 5 cm × 5 cm superficial mould; a source inside a catheter located at the skin surface with and without backscatter bolus; and a typical interstitial implant consisting of an HDR source in a catheter located at a depth of 0.5 cm. Commercially available HDR{sup 60}Co and {sup 192}Ir sources and a hypothetical {sup 169}Yb source were considered. The Geant4 Monte Carlo radiation transport code was used to estimate dose rate distributions for the configurations considered. These results were then compared to those obtained with the TG-43 dose calculation formalism. In particular, the influence of adding bolus material over the implant was studied. Results: For a 5 cm × 5 cm{sup 192}Ir superficial mould and 0.5 cm prescription depth, dose differences in comparison to the TG-43 method were about −3%. When the source was positioned at the skin surface, dose differences were smaller than −1% for {sup 60}Co and {sup 192}Ir, yet −3% for {sup 169}Yb. For the interstitial implant, dose differences at the skin surface were −7% for {sup 60}Co, −0.6% for {sup 192}Ir, and −2.5% for {sup 169}Yb. Conclusions: This study indicates the following: (i) for the superficial mould, no bolus is needed; (ii) when the source is in contact with the skin surface, no bolus is needed for either {sup 60}Co and {sup 192}Ir. For

  14. Limitations of the TG-43 formalism for skin high-dose-rate brachytherapy dose calculations.

    Science.gov (United States)

    Granero, Domingo; Perez-Calatayud, Jose; Vijande, Javier; Ballester, Facundo; Rivard, Mark J

    2014-02-01

    In skin high-dose-rate (HDR) brachytherapy, sources are located outside, in contact with, or implanted at some depth below the skin surface. Most treatment planning systems use the TG-43 formalism, which is based on single-source dose superposition within an infinite water medium without accounting for the true geometry in which conditions for scattered radiation are altered by the presence of air. The purpose of this study is to evaluate the dosimetric limitations of the TG-43 formalism in HDR skin brachytherapy and the potential clinical impact. Dose rate distributions of typical configurations used in skin brachytherapy were obtained: a 5 cm × 5 cm superficial mould; a source inside a catheter located at the skin surface with and without backscatter bolus; and a typical interstitial implant consisting of an HDR source in a catheter located at a depth of 0.5 cm. Commercially available HDR(60)Co and (192)Ir sources and a hypothetical (169)Yb source were considered. The Geant4 Monte Carlo radiation transport code was used to estimate dose rate distributions for the configurations considered. These results were then compared to those obtained with the TG-43 dose calculation formalism. In particular, the influence of adding bolus material over the implant was studied. For a 5 cm × 5 cm(192)Ir superficial mould and 0.5 cm prescription depth, dose differences in comparison to the TG-43 method were about -3%. When the source was positioned at the skin surface, dose differences were smaller than -1% for (60)Co and (192)Ir, yet -3% for (169)Yb. For the interstitial implant, dose differences at the skin surface were -7% for (60)Co, -0.6% for (192)Ir, and -2.5% for (169)Yb. This study indicates the following: (i) for the superficial mould, no bolus is needed; (ii) when the source is in contact with the skin surface, no bolus is needed for either (60)Co and (192)Ir. For lower energy radionuclides like (169)Yb, bolus may be needed; and (iii) for the interstitial case, at

  15. HIGH EXPRESSION OF HMOX1 IN BLUE-SHELLED CHICKENS IS ASSOCIATED WITH A TG HAPLOTYPE

    Directory of Open Access Journals (Sweden)

    Z Wang

    2015-09-01

    Full Text Available ABSTRACTHMOX1 is an important gene in biosynthesis of the eggshell pigment of blue eggs. Previous studies found that HMOX1 is highly expressed in the shell gland of hens laying blue eggs (BlueH compared with hens laying brown eggs (BrownH; however, the reasons for the differential expression are unclear. In this study five single nucleotide polymorphism (SNP in HMOX1 were genotyped in 111 BlueH and 115 BrownH. The association of haplotypes of these SNP with the blue egg phenotype was tested. Haplotype-specific expression of HMOX1 was detected in the shell gland. The interaction of sequence variants and transcription factors was analyzed using electrophoretic mobility shift assay (EMSA. A TG haplotype covering upstream 1.4 kb region of HMOX1 was significantly associated with blue eggs (p<0.05. Furthermore, the birds (n=12 with the haplotype expressed 3.8 fold more transcripts than those (n=12 without the haplotype (p<0.05. After re-sequencing a 2.2 kb region harboring the TG haplotype, a total of 26 SNP were found, of which a SNP was predicted to create a binding site of Nrf2, a transcription factor initiating HMOX1 expression. However, subsequent EMSA failed to confirm the Nrf2-DNA interaction. Taken together, the data suggested that the TG haplotype is not directly involved in regulation of HMOX1 expression; a regulatory mutation located near the haplotype and linked with the haplotype may exist and be responsible for the differential expression ofHMOX1.

  16. Production of novel microbial flocculants by Klebsiella sp. TG-1 using waste residue from the food industry and its use in defecating the trona suspension.

    Science.gov (United States)

    Liu, Zhan-Ying; Hu, Zhi-Quan; Wang, Tao; Chen, Yan-Ying; Zhang, Jianbin; Yu, Jing-Ran; Zhang, Tong; Zhang, Yong-Feng; Li, Yong-Li

    2013-07-01

    A microbial-flocculants-producing (MBF-producing) bacterium, named TG-1, was isolated from waste water of a starch factory, and identified as Klebsiella sp. TG-1. The microbial flocculants (MBF) produced by TG-1, named as MBF-TG-1, was applied to defecating the strong basic trona suspension in the trona industry. After optimizing medium and culturing conditions with single-factor and orthogonal designs, the highest flocculation rate of 86.9% was achieved. Chemical analysis showed that the purified microbial flocculants (MBF-TG-1) was mainly composed of polysaccharides (84.6%), with a small amount of protein or amino acid (11.1%). Bridging mechanism was supposed as the main flocculation mechanism by analyzing the flocculation process and the biochemistry properties of MBF-TG-1. The high flocculation rate (84%) was also achieved with a low-cost medium (the solid residue of tofu production from food industry). Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. TG13: Updated Tokyo Guidelines for the management of acute cholangitis and cholecystitis

    NARCIS (Netherlands)

    Takada, Tadahiro; Strasberg, Steven M.; Solomkin, Joseph S.; Pitt, Henry A.; Gomi, Harumi; Yoshida, Masahiro; Mayumi, Toshihiko; Miura, Fumihiko; Gouma, Dirk J.; Garden, O. James; Büchler, Markus W.; Kiriyama, Seiki; Yokoe, Masamichi; Kimura, Yasutoshi; Tsuyuguchi, Toshio; Itoi, Takao; Gabata, Toshifumi; Higuchi, Ryota; Okamoto, Kohji; Hata, Jiro; Murata, Atsuhiko; Kusachi, Shinya; Windsor, John A.; Supe, Avinash N.; Lee, Sunggyu; Chen, Xiao-Ping; Yamashita, Yuichi; Hirata, Koichi; Inui, Kazuo; Sumiyama, Yoshinobu

    2013-01-01

    In 2007, the Tokyo Guidelines for the management of acute cholangitis and cholecystitis (TG07) were first published in the Journal of Hepato-Biliary-Pancreatic Surgery. The fundamental policy of TG07 was to achieve the objectives of TG07 through the development of consensus among specialists in this

  18. [TG-FTIR study on pyrolysis of wheat-straw with abundant CaO additives].

    Science.gov (United States)

    Han, Long; Wang, Qin-Hui; Yang, Yu-Kun; Yu, Chun-Jiang; Fang, Meng-Xiang; Luo, Zhong-Yang

    2011-04-01

    Biomass pyrolysis in presence of abundant CaO additives is a fundamental process prior to CaO sorption enhanced gasification in biomass-based zero emission system. In the present study, thermogravimetric Fourier transform infrared (TG-FTIR) analysis was adopted to examine the effects of CaO additives on the mass loss process and volatiles evolution of wheat-straw pyrolysis. Observations from TG and FTIR analyses simultaneously demonstrated a two-stage process for CaO catalyzed wheat-straw pyrolysis, different from the single stage process for pure wheat-straw pyrolysis. CaO additives could not only absorb the released CO2 but also reduce the yields of tar species such as toluene, phenol, and formic acid in the first stage, resulting in decreased mass loss and maximum mass loss rate in this stage with an increase in CaO addition. The second stage was attributed to the CaCO3 decomposition and the mass loss and maximum mass loss rate increased with increasing amount of CaO additives. The results of the present study demonstrated the great potential of CaO additives to capture CO2 and reduce tars yields in biomass-based zero emission system. The gasification temperature in the system should be lowered down to avoid CaCO3 decomposition.

  19. Open TG-GATEs: a large-scale toxicogenomics database

    Science.gov (United States)

    Igarashi, Yoshinobu; Nakatsu, Noriyuki; Yamashita, Tomoya; Ono, Atsushi; Ohno, Yasuo; Urushidani, Tetsuro; Yamada, Hiroshi

    2015-01-01

    Toxicogenomics focuses on assessing the safety of compounds using gene expression profiles. Gene expression signatures from large toxicogenomics databases are expected to perform better than small databases in identifying biomarkers for the prediction and evaluation of drug safety based on a compound's toxicological mechanisms in animal target organs. Over the past 10 years, the Japanese Toxicogenomics Project consortium (TGP) has been developing a large-scale toxicogenomics database consisting of data from 170 compounds (mostly drugs) with the aim of improving and enhancing drug safety assessment. Most of the data generated by the project (e.g. gene expression, pathology, lot number) are freely available to the public via Open TG-GATEs (Toxicogenomics Project-Genomics Assisted Toxicity Evaluation System). Here, we provide a comprehensive overview of the database, including both gene expression data and metadata, with a description of experimental conditions and procedures used to generate the database. Open TG-GATEs is available from http://toxico.nibio.go.jp/english/index.html. PMID:25313160

  20. Comparison of Thyroglobulin Measurements Using Three Different Immunoassay Kits: A BRAMHS Tg-Plus RIA Kit, a BRAMHS hTg Sensitive Kryptor Kit, and a Beckman Coulter ACCESS Immunoassay Kit

    Directory of Open Access Journals (Sweden)

    Mijin Kim

    2016-09-01

    Full Text Available BackgroundSecond-generation thyroglobulin immunometric assays (Tg-IMAs have been developed with improved sensitivity. Our aim was to compare the diagnostic value of Tg-IMA measurements using a Kryptor (BRAHMS AG kit (Tg-K and an ACCESS (Beckman Coulter kit (Tg-A with that of the first-generation Tg measurement using a Tg-plus (BRAHMS AG kit (Tg+.MethodsWe enrolled 82 differentiated thyroid cancer patients who underwent total thyroidectomy with radioactive iodine remnant ablation and who underwent diagnostic whole body scan using recombinant human thyroid stimulating hormone (rhTSH. The Tg+, Tg-K, and Tg-A were measured before rhTSH administration during levothyroxine treatment (suppressed Tg from the same sample. Serum Tg+ was measured after rhTSH stimulation (stimulated Tg.ResultsSuppressed Tg+ was more significantly correlated with suppressed Tg-K (R2=0.919, P<0.001 than with suppressed Tg-A (R2=0.536, P<0.001. The optimal cut-off values of suppressed Tg+, Tg-K, and Tg-A for predicting stimulated Tg+ of 1 ng/mL were 0.3, 0.2, and 0.2 ng/mL, respectively. The sensitivity, specificity, and accuracy of suppressed Tg+ were 67%, 100%, and 90%, respectively; those of suppressed Tg-K were 83%, 90%, and 88%; those of suppressed Tg-A were 96%, 82%, and 87%, respectively. The positive predictive and negative predictive values of Tg+ were 100% and 87%, respectively; those of Tg-K were 79% and 92%; and those of Tg-A were 73% and 98%.ConclusionWe could not clearly demonstrate which kit had better diagnostic performance after comparison of first-generation Tg measurements with Tg-IMA measurements. Also, there were kit-to-kit variations between Tg-IMA kits. Suppressed Tg measured by Tg-IMA was insufficient to completely substitute for a stimulated Tg measurement.

  1. High-Tg TOPAS microstructured polymer optical fiber for fiber Bragg grating strain sensing at 110 degrees

    DEFF Research Database (Denmark)

    Markos, Christos; Stefani, Alessio; Nielsen, Kristian

    2013-01-01

    We present the fabrication and characterization of fiber Bragg gratings (FBGs) in an endlessly single-mode microstructured polymer optical fiber (mPOF) made of humidity-insensitive high-Tg TOPAS cyclic olefin copolymer. The mPOF is the first made from grade 5013 TOPAS with a glass transition...... temperature of Tg = 135°C and we experimentally demonstrate high strain operation (2.5%) of the FBG at 98°C and stable operation up to a record high temperature of 110°C. The Bragg wavelengths of the FBGs are around 860 nm, where the propagation loss is 5.1dB/m, close to the fiber loss minimum of 3.67d...

  2. The orbital evolution of NEA 30825 1900 TG1

    Science.gov (United States)

    Timoshkova, E. I.

    2008-02-01

    The orbital evolution of the near-Earth asteroid (NEA) 30825 1990 TG1 has been studied by numerical integration of the equations of its motion over the 100 000-year time interval with allowance for perturbations from eight major planets and Pluto, and the variations in its osculating orbit over this time interval were determined. The numerical integrations were performed using two methods: the Bulirsch-Stoer method and the Everhart method. The comparative analysis of the two resulting orbital evolutions of motion is presented for the time interval examined. The evolution of the asteroid motion is qualitatively the same for both variants, but the rate of evolution of the orbital elements is different. Our research confirms the known fact that the application of different integrators to the study of the long-term evolution of the NEA orbit may lead to different evolution tracks.

  3. Precision glass molding technology for low Tg glasses

    Science.gov (United States)

    Yang, Hong; Wang, Zhibin; Zhang, Yunlong; Zhang, Feng; Tian, Minqiang; Shao, Xinzheng

    2017-02-01

    Precision glass molding (PGM) technology is a cost-effective manufacturing process for high precision optical elements with complex surfaces. With this processing technology, one or more pieces of lenses may be produced through one-step molding. Due to the high efficiency of the replicative process, PGM has found wide applications in high volume production of optical elements. At present, it has been well developed and widely used in mass industry production in Japan and South Korea, but in China PGM technology research is still in the elementary stage. To develop the PGM technology, we need to conquer several technical difficulties, such as the melting technology of low Tg glasses, highprecision mold design and the corresponding machining technology and the coating technology for the molds. In this paper, we discussed the PGM technology as a complete manufacturing process, focused on the technical difficulties mentioned above, and introduced the development directions for this technology in China.

  4. Polymorphisms in Genes Involved in Fatty Acid β-Oxidation Interact with Dietary Fat Intakes to Modulate the Plasma TG Response to a Fish Oil Supplementation

    Directory of Open Access Journals (Sweden)

    Annie Bouchard-Mercier

    2014-03-01

    Full Text Available A large inter-individual variability in the plasma triglyceride (TG response to an omega-3 polyunsaturated fatty acid (n-3 PUFA supplementation has been observed. The objective was to examine gene-diet interaction effects on the plasma TG response after a fish oil supplementation, between single-nucleotide polymorphisms (SNPs within genes involved in fatty acid β-oxidation and dietary fat intakes. Two hundred and eight (208 participants were recruited in the greater Quebec City area. The participants completed a six-week fish oil supplementation (5 g fish oil/day: 1.9–2.2 g EPA and 1.1 g DHA. Dietary fat intakes were measured using three-day food records. SNPs within RXRA, CPT1A, ACADVL, ACAA2, ABCD2, ACOX1 and ACAA1 genes were genotyped using TAQMAN methodology. Gene-diet interaction effects on the plasma TG response were observed for SNPs within RXRA (rs11185660, rs10881576 and rs12339187 and ACOX1 (rs17583163 genes. For rs11185660, fold changes in RXRA gene expression levels were different depending on SFA intakes for homozygotes T/T. Gene-diet interaction effects of SNPs within genes involved in fatty acid β-oxidation and dietary fat intakes may be important in understanding the inter-individual variability in plasma TG levels and in the plasma TG response to a fish oil supplementation.

  5. Compound list: imatinib, methanesulfonate salt [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available imatinib, methanesulfonate salt IMA 00186 ftp://ftp.biosciencedbc.jp/archive/open-t...ggates/LATEST/Rat/in_vivo/Liver/Single/imatinib%2C_methanesulfonate_salt.Rat.in_vivo.Liver.Single.zip ...

  6. Database Description - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Open TG-GATEs Database Description General information of database Database name Open TG-GAT...onomy ID: 9606 Database description Toxicogenomics Project (TGP) is a government-private companies collabora... available URL of Web services - Need for user registration - About This Database Database Descript...ion Download License Update History of This Database Site Policy | Contact Us Database Description - Open TG-GATEs | LSDB Archive ...

  7. Update History of This Database - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...List Contact us Open TG-GATEs Update History of This Database Date Update contents 2015/10/01 URLs of the da...nload License Update History of This Database Site Policy | Contact Us Update History of This Database - Open TG-GATEs | LSDB Archive ... .../02/25 Open TG-GATEs( http://toxico.nibio.go.jp/ ) is released. About This Database Database Description Dow

  8. Dramatising Identity on Irish Language Television: Aifric (TG4

    Directory of Open Access Journals (Sweden)

    Ruth Lysaght

    2013-03-01

    Full Text Available Aifric (Telegael 2006-8 a live action comedy drama series for young teenagers, gives an extra dimension to a relatively conventional entertainment genre through its use of the Irish language on screen and on set. One of the largest scale longer-term drama productions for TG4, Aifric is aimed at an audience which enjoys Australian series, British soaps and American sit coms. Significantly, viewers are addressed as members of a similar culture, who understand its norms and expectations, rather than as some pan-global ‘youth audience’ who exist only to be entertained. Aifric presents humorous stories about somewhat quirky characters with credible relationships. Although the language is not foregrounded as a theme in the drama, its treatment results from very conscious decisions by the programme-makers. Performed by largely native-speaking actors, there is a strong drive to present a vibrant and funny Irish-speaking world. However, for most viewers, the use of the indigenous national language on screen remains noteworthy. Telegael were sensitive to this in taking on the commission, and in choosing to create an ‘Aifric universe’ where Irish is fluently used by everyone, add another layer to the question of Irish language identity.

  9. GLUT4 expression in human muscle fibres is not correlated with intracellular triglyceride (TG) content. Is TG a maker or a marker of insulin resistance?

    DEFF Research Database (Denmark)

    Gaster, M; Ottosen, P D; Vach, W

    2003-01-01

    We have recently reported a progressive decline in the expression of glucose transporter isoform 4 (GLUT4) from control subjects through obese non-diabetics to obese type 2 diabetic subjects, indicating that the reduced GLUT4 in slow twitch fibres could be secondary to obesity. In this study we...... investigate the association of GLUT4 expression with the intracellular triglyceride (TG) content in the same muscle fibres and with plasma lipid parameters. We used histochemistry and stereology to study the relationship between TG content and GLUT4 expression in muscle fibres from obese, obese type 2...... densities in slow and fast fibres did not correlate with the corresponding GLUT4 density in the same fibres in our study groups (p>0.05). Plasma TG and FFA did not correlate with GLUT4 expression in slow or fast fibres (p>0.05). In conclusion, TG content was increased in diabetic slow fibres with a reduced...

  10. Comparative study by TG and DSC Of membranes polyamide66/bentonite clay nanocomposite; Estudo comparativo por TG e DSC de membranas de nanocompositos poliamida66/argila bentonitica

    Energy Technology Data Exchange (ETDEWEB)

    Medeiros, K.M. de; Kojuch, L.R.; Araujo, E.M.; Lira, H.L., E-mail: keilamm@ig.com.b [Universidade Federal de Campina Grande (UFCG), PB (Brazil). Unidade Academica de Engenharia de Materiais; Lima, F. [Universidade Estadual da Paraiba (UEPB), Campina Grande, PB (Brazil). Dept. de Quimica

    2010-07-01

    In this study, it was obtained membranes of nanocomposites polyamide66 with 3 and 5% bentonite clay consists of silicates in layers from the interior of Paraiba. The clay was treated with a quaternary ammonium salt in order to make it organophilic. The membranes were prepared by phase inversion technique from the nanocomposites in solution. The clays were characterized by X-ray diffraction (XRD) and thermogravimetry (TG). Also the membranes were characterized by differential scanning calorimetry (DSC) and TG. The XRD and TG confirmed the presence of salt in the clay and thermal stability of the treated clay. For DSC, it was observed that there was no change in melting temperature of the membranes of nanocomposites compared to membrane pure polyamide66. By TG, it was found that the decomposition of the membranes of polyamide66 with treated clay were higher compared with the untreated clay. (author)

  11. The Lack of Utility of Anti-tTG IgG in the Diagnosis of Celiac Disease When Anti-tTG IgA Is Negative.

    Science.gov (United States)

    Absah, Imad; Rishi, Abdul R; Gebrail, Rami; Snyder, Melissa R; Murray, Joseph A

    2016-09-12

    Guidelines for diagnosing celiac disease (CD) recommend initial testing with a highly sensitive serologic test for anti-tissue transglutaminase immunoglobulin A antibodies (tTG IgA). When the probability of CD is high, IgA deficiency should be considered. The two approaches to address this include measuring "both tTG IgA and tTG IgG" or measuring "total IgA". We aim to assess the utility of an isolated positive tTG IgG result in diagnosing CD. We conducted a retrospective review of patients undergoing serologic testing for CD from January 1997 to June 2014. Patients with positive tTG IgG and negative tTG IgA were included. Moreover, all patients who had any other positive CD-specific serologic findings were excluded. Demographic, clinical presentation, tests and biopsy results were recorded. The indication for checking celiac serology was gastrointestinal symptoms in 172 of 233 patients, iron deficiency anemia in 12, and high-risk screening in 48. Small bowel biopsy was obtained in 178 patients (77%); 160 had normal results and 18 had histologic changes suggestive of enteropathy. 9 patients had increased intraepithelial lymphocytes, and 9 had partial villous atrophy. However, only 6 cases of CD were confirmed. The utility of isolated tTG IgG in diagnosis of CD was low at 3% (6/178). In this cohort of patients, the utility of isolated tTG IgG in diagnosing CD was low at 3%.

  12. Lack of Utility of Anti-tTG IgG to Diagnose Celiac Disease When Anti-tTG IgA Is Negative.

    Science.gov (United States)

    Absah, Imad; Rishi, Abdul R; Gebrail, Rami; Snyder, Melissa R; Murray, Joseph A

    2017-05-01

    Guidelines for diagnosing celiac disease (CD) recommend initial testing with a highly sensitive serologic test for anti-tissue transglutaminase immunoglobulin A antibodies (tTG IgA). When the probability of CD is high, IgA deficiency should be considered. The 2 approaches to address this include measuring "both tTG IgA and tTG IgG" or measuring "total IgA." We aim to assess the utility of an isolated positive tTG IgG result in diagnosing CD. We conducted a retrospective review of patients undergoing serologic testing for CD from January 1997 to June 2014. Patients with positive tTG IgG and negative tTG IgA were included. Moreover, all patients who had any other positive CD-specific serologic findings were excluded. Demographics, clinical presentation, tests, and biopsy results were recorded. The indication for checking celiac serology was gastrointestinal symptoms in 172 of 233 patients, iron deficiency anemia in 12, and high-risk screening in 48. Small bowel biopsy was performed in 178 patients (77%); 160 had normal results and 18 had histologic changes suggestive of enteropathy. Nine patients had increased intraepithelial lymphocytes, and 9 had partial villous atrophy. Only 6 cases of CD were, however, confirmed. The utility of isolated tTG IgG in diagnosis of CD was low at 3% (6/178). In this cohort of patients, the utility of isolated tTG IgG in diagnosing CD was low at 3%.

  13. Compound list: desmopressin acetate [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available desmopressin acetate DDAVP 00159 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LA...TEST/Rat/in_vivo/Liver/Single/desmopressin_acetate.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/a...rchive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/desmopressin_acetate.Rat.in_vivo.Liver.Repeat.zip ftp://...ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/desmopre...ssin_acetate.Rat.in_vivo.Kidney.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/desmopressin_acetate.Rat.in_vivo.Kidney.Repeat.zip ...

  14. Compound list: amphotericin B [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available amphotericin B AMB 00157 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/amphot...at/in_vivo/Liver/Single/amphotericin_B.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-...tggates/LATEST/Rat/in_vivo/Liver/Repeat/amphotericin_B.Rat.in_vivo.Liver.Repeat.z...ip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/amphotericin_B.Rat.in_vi...vo.Kidney.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/amphotericin_B.Rat.in_vivo.Kidney.Repeat.zip ...

  15. Compound list: puromycin aminonucleoside [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available puromycin aminonucleoside PAN 00143 ftp://ftp.biosciencedbc.jp/archive/open-tggates.../LATEST/Rat/in_vitro/puromycin_aminonucleoside.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/ope...n-tggates/LATEST/Rat/in_vivo/Liver/Single/puromycin_aminonucleoside.Rat.in_vivo.Liver.Single.zip ftp://ftp.b...iosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/puromycin_aminonu...o/Kidney/Single/puromycin_aminonucleoside.Rat.in_vivo.Kidney.Single.zip ftp://ftp.biosciencedbc.jp/archive/o

  16. Compound list: N-nitrosomorpholine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available N-nitrosomorpholine NMOR 00163 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATE...ST/Human/in_vitro/N-nitrosomorpholine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggat...es/LATEST/Rat/in_vivo/Liver/Single/N-nitrosomorpholine.Rat.in_vivo.Liver.Single.zip ...

  17. Compound list: fluoxetine hydrochloride [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available fluoxetine hydrochloride FLX 00158 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/flu...pen-tggates/LATEST/Rat/in_vivo/Liver/Single/fluoxetine_hydrochloride.Rat.in_vivo.Liver.Single.zip ftp://ftp....biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/fluoxetine_hydrochloride.Rat.in_vivo.Liver.Repeat.zip ...

  18. Compound list: 2-nitrofluorene [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available 2-nitrofluorene 2NF 00160 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/2-nitrofluor...ene.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/2-nitrofluorene.Rat.in_vivo.Liver.Single.zip ...

  19. Compound list: methylene dianiline [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available methylene dianiline DAPM 00155 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/methyl...es/LATEST/Rat/in_vivo/Liver/Single/methylene_dianiline.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc....jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/methylene_dianiline.Rat.in_vivo.Liver.Repeat.zip ...

  20. Compound list: aflatoxin B1 [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available aflatoxin B1 AFB1 00165 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/aflat...oxin_B1.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/aflatoxin_B1.Rat.in_vivo.Liver.Single.zip ...

  1. Origin of enhanced crystal growth kinetics near Tg probed with indomethacin polymorphs.

    Science.gov (United States)

    Wu, Tian; Yu, Lian

    2006-08-17

    Using three crystal polymorphs of indomethacin (IMC), we tested two interpretations of the enhanced crystal growth kinetics near the glass transition temperature Tg. This enhancement refers to the stronger temperature dependence of liquid viscosity eta than crystal growth rate (corrected for thermodynamic driving force). This enhancement is attributed in the first interpretation to an increase of the number of preferred interfacial growth sites with decreasing temperature and, in the second interpretation, to the breakdown of the Stokes-Einstein relation in deeply supercooled liquids. We measured the growth rates of the IMC polymorphs (alpha, gamma, and delta) from Tg + 9 K (Tg = 314 K) to near the respective melting points. From Tg + 19 K to Tg + 69 K, the growth rates of the polymorphs changed by 10(4) fold but displayed the same temperature dependence (eta-0.78) after corrections for thermodynamic driving forces. These results argue for a liquid-state origin of the enhanced growth kinetics. Below ca. Tg + 19 K, delta IMC continued to grow in the same spherulite morphology but alpha and gamma IMC grew in different, fiberlike morphologies and, if measured consistently, at faster rates. We conclude that the liquid dynamics of IMC controls its crystal growth kinetics over a wide range of temperatures but changes of growth morphologies near Tg also lead to apparent acceleration of growth of certain polymorphs. This work also extended a previous study of D-sorbitol to lower temperatures to enable a broader analysis of crystal growth kinetics of organic molecules near Tg.

  2. TG13 indications and techniques for biliary drainage in acute cholangitis (with videos)

    NARCIS (Netherlands)

    Itoi, Takao; Tsuyuguchi, Toshio; Takada, Tadahiro; Strasberg, Steven M.; Pitt, Henry A.; Kim, Myung-Hwan; Belli, Giulio; Mayumi, Toshihiko; Yoshida, Masahiro; Miura, Fumihiko; Büchler, Markus W.; Gouma, Dirk J.; Garden, O. James; Jagannath, Palepu; Gomi, Harumi; Kimura, Yasuyuki; Higuchi, Ryota

    2013-01-01

    The Tokyo Guidelines of 2007 (TG07) described the techniques and recommendations of biliary decompression in patients with acute cholangitis. TG07 recommended that endoscopic transpapillary biliary drainage should be selected as a first-choice therapy for acute cholangitis because it is associated

  3. Compound list: valproic acid [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available valproic acid VPA 00005 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/valproic_acid....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/valproic_acid..._vivo/Liver/Single/valproic_acid.Rat.in_vivo.Liver.Single.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/valproic_acid.Rat.in_vivo.Liver.Repeat.zip ftp:...//ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/valproic_acid.Rat.in_vivo.Kidne

  4. Compound list: butylated hydroxyanisole [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available butylated hydroxyanisole BHA 00156 ftp://ftp.biosciencedbc.jp/archive/open-tggates/...LATEST/Human/in_vitro/butylated_hydroxyanisole.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/o...pen-tggates/LATEST/Rat/in_vivo/Liver/Single/butylated_hydroxyanisole.Rat.in_vivo.Liver.Single.zip ftp://ftp....biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/butylated_hydroxyanisole.Rat.in_vivo.Liver.Repeat.zip ...

  5. Compound list: buthionine sulfoximine [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available buthionine sulfoximine BSO 00A04 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LA...TEST/Human/in_vitro/buthionine_sulfoximine.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-...tggates/LATEST/Rat/in_vitro/buthionine_sulfoximine.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive.../open-tggates/LATEST/Rat/in_vivo/Liver/Single/buthionine_sulfoximine.Rat.in_vivo.Liver.Single.zip ...

  6. Compound list: nicotinic acid [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available nicotinic acid NIC 00081 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/nicotinic_aci...d.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/nicotinic_aci.../in_vivo/Liver/Single/nicotinic_acid.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosc...iencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/nicotinic_acid.Rat.in_vivo.Liver.Repeat.zip ...

  7. Compound list: mefenamic acid [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available mefenamic acid MEF 00084 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/mefenamic_aci...d.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/mefenamic_aci.../in_vivo/Liver/Single/mefenamic_acid.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosc...iencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/mefenamic_acid.Rat.in_vivo.Liver.Repeat.zip ...

  8. Compound list: diethyl maleate [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available diethyl maleate DEM 00A05 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/diet...hyl_maleate.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/diet...hyl_maleate.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/diethyl_maleate.Rat.in_vivo.Liver.Single.zip ...

  9. Accessing Forbidden Glass Regimes through High-Pressure Sub-Tg Annealing

    Science.gov (United States)

    Svenson, Mouritz N.; Mauro, John C.; Rzoska, Sylwester J.; Bockowski, Michal; Smedskjaer, Morten M.

    2017-04-01

    Density and hardness of glasses are known to increase upon both compression at the glass transition temperature (Tg) and ambient pressure sub-Tg annealing. However, a serial combination of the two methods does not result in higher density and hardness, since the effect of compression is countered by subsequent annealing and vice versa. In this study, we circumvent this by introducing a novel treatment protocol that enables the preparation of high-density, high-hardness bulk aluminosilicate glasses. This is done by first compressing a sodium-magnesium aluminosilicate glass at 1 GPa at Tg, followed by sub-Tg annealing in-situ at 1 GPa. Through density, hardness, and heat capacity measurements, we demonstrate that the effects of hot compression and sub-Tg annealing can be combined to access a “forbidden glass” regime that is inaccessible through thermal history or pressure history variation alone. We also study the relaxation behavior of the densified samples during subsequent ambient pressure sub-Tg annealing. Density and hardness are found to relax and approach their ambient condition values upon annealing, but the difference in relaxation time of density and hardness, which is usually observed for hot compressed glasses, vanishes for samples previously subjected to high-pressure sub-Tg annealing. This confirms the unique configurational state of these glasses.

  10. Compound list: cyclosporine A [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available cyclosporine A CSA 00142 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/cyclosporine..._A.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/cyclosporine...iencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/cyclosporine_A.Rat.in_vivo.Liver.Repeat.zip... ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/cyclosporine_A.Rat.in_vivo....Kidney.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/cyclosporine_A.Rat.in_vivo.Kidney.Repeat.zip ...

  11. Compound list: erythromycin ethylsuccinate [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available erythromycin ethylsuccinate EME 00082 ftp://ftp.biosciencedbc.jp/archive/open-tggat...es/LATEST/Human/in_vitro/erythromycin_ethylsuccinate.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/arc...hive/open-tggates/LATEST/Rat/in_vitro/erythromycin_ethylsuccinate.Rat.in_vitro.Liver.zip ftp://ftp.bioscienc...edbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/erythromycin_ethylsu...ccinate.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/erythrom

  12. Compound list: allyl alcohol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available allyl alcohol AA 00010 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/allyl_alcohol....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/allyl_alcohol...dbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/allyl_alcohol.Rat.in_vivo.Liver.Repeat.zip ftp:/.../ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/allyl_alcohol.Rat.in_vivo.Kidney....Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Kidney/Repeat/allyl_alcohol.Rat.in_vivo.Kidney.Repeat.zip ...

  13. Compound list: 2,4-dinitrophenol [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available 2,4-dinitrophenol DNP 00154 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/...Human/in_vitro/2%2C4-dinitrophenol.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/...LATEST/Rat/in_vivo/Liver/Single/2%2C4-dinitrophenol.Rat.in_vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/2%2C4-dinitrophenol.Rat.in_vivo.Liver.Repeat.zip ...

  14. Compound list: naphthyl isothiocyanate [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available naphthyl isothiocyanate ANIT 00009 ftp://ftp.biosciencedbc.jp/archive/open-tggates/...LATEST/Human/in_vitro/naphthyl_isothiocyanate.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/op...en-tggates/LATEST/Rat/in_vitro/naphthyl_isothiocyanate.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/arc...hive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/naphthyl_isothiocyanate.Rat.in_...vivo.Liver.Single.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/naphthyl_isothiocyanate.Rat.in_vivo.Liver.Repeat.zip ...

  15. Involvement of cell surface TG2 in the aggregation of K562 cells triggered by gluten.

    Science.gov (United States)

    Feriotto, G; Calza, R; Bergamini, C M; Griffin, M; Wang, Z; Beninati, S; Ferretti, V; Marzola, E; Guerrini, R; Pagnoni, A; Cavazzini, A; Casciano, F; Mischiati, C

    2017-03-01

    Gluten-induced aggregation of K562 cells represents an in vitro model reproducing the early steps occurring in the small bowel of celiac patients exposed to gliadin. Despite the clear involvement of TG2 in the activation of the antigen-presenting cells, it is not yet clear in which compartment it occurs. Herein we study the calcium-dependent aggregation of these cells, using either cell-permeable or cell-impermeable TG2 inhibitors. Gluten induces efficient aggregation when calcium is absent in the extracellular environment, while TG2 inhibitors do not restore the full aggregating potential of gluten in the presence of calcium. These findings suggest that TG2 activity is not essential in the cellular aggregation mechanism. We demonstrate that gluten contacts the cells and provokes their aggregation through a mechanism involving the A-gliadin peptide 31-43. This peptide also activates the cell surface associated extracellular TG2 in the absence of calcium. Using a bioinformatics approach, we identify the possible docking sites of this peptide on the open and closed TG2 structures. Peptide docks with the closed TG2 structure near to the GTP/GDP site, by establishing molecular interactions with the same amino acids involved in stabilization of GTP binding. We suggest that it may occur through the displacement of GTP, switching the TG2 structure from the closed to the active open conformation. Furthermore, docking analysis shows peptide binding with the β-sandwich domain of the closed TG2 structure, suggesting that this region could be responsible for the different aggregating effects of gluten shown in the presence or absence of calcium. We deduce from these data a possible mechanism of action by which gluten makes contact with the cell surface, which could have possible implications in the celiac disease onset.

  16. Association of Cytotoxic T-Lymphocyte Antigen 4 (CTLA4) and Thyroglobulin (TG) Genetic Variants with Autoimmune Hypothyroidism

    Science.gov (United States)

    Patel, Hinal; Mansuri, Mohmmad Shoab; Singh, Mala; Begum, Rasheedunnisa; Shastri, Minal; Misra, Ambikanandan

    2016-01-01

    Autoimmune hypothyroidism is known to be caused by immune responses related to the thyroid gland and its immunological feature includes presence of autoimmune antibodies. Therefore the aim was to analyze presence of anti-TPO antibodies in hypothyroidism patients in Gujarat. Cytotoxic T-Lymphocyte Antigen 4 (CTLA4) is one of the susceptibility genes for various autoimmune diseases. Hence, exon1 +49A/G and 3’UTR CT60A/G single nucleotide polymorphisms (SNPs) in CTLA4 and its mRNA expression levels were investigated in autoimmune hypothyroidism patients. Thyroglobulin (TG) is known to be associated with autoimmune thyroid disorders and thus exon 33 (E33) SNP in TG was investigated. We analyzed the presence of anti-TPO antibodies in the plasma samples of 84 hypothyroidism patients and 62 controls by ELISA. PCR-RFLP technique was used for genotyping of polymorphisms. sCTLA4 and flCTLA4 mRNA expression levels were assessed by real time PCR. 59.52% of hypothyroid patients had anti-TPO antibodies in their circulation. The genotype and allele frequencies differed significantly for +49A/G (p = 0.0004 for +49AG, p = 0.0019 for +49GG & p = 0.0004 for allele), CT60 (p = 0.0110 for CT60AG, p = 0.0005 for CT60GG & phypothyroidism when adjusted for age and gender. Our results suggest +49A/G and CT60 polymorphism of CTLA4 and E33 polymorphism of TG may be genetic risk factors for autoimmune hypothyroidism susceptibility and down regulation of both forms of CTLA4 advocates the crucial role of CTLA4 in pathogenesis of autoimmune hypothyroidism. PMID:26963610

  17. Report of the Task Group 186 on model-based dose calculation methods in brachytherapy beyond the TG-43 formalism: current status and recommendations for clinical implementation.

    Science.gov (United States)

    Beaulieu, Luc; Carlsson Tedgren, Asa; Carrier, Jean-Francois; Davis, Stephen D; Mourtada, Firas; Rivard, Mark J; Thomson, Rowan M; Verhaegen, Frank; Wareing, Todd A; Williamson, Jeffrey F

    2012-10-01

    The charge of Task Group 186 (TG-186) is to provide guidance for early adopters of model-based dose calculation algorithms (MBDCAs) for brachytherapy (BT) dose calculations to ensure practice uniformity. Contrary to external beam radiotherapy, heterogeneity correction algorithms have only recently been made available to the BT community. Yet, BT dose calculation accuracy is highly dependent on scatter conditions and photoelectric effect cross-sections relative to water. In specific situations, differences between the current water-based BT dose calculation formalism (TG-43) and MBDCAs can lead to differences in calculated doses exceeding a factor of 10. MBDCAs raise three major issues that are not addressed by current guidance documents: (1) MBDCA calculated doses are sensitive to the dose specification medium, resulting in energy-dependent differences between dose calculated to water in a homogeneous water geometry (TG-43), dose calculated to the local medium in the heterogeneous medium, and the intermediate scenario of dose calculated to a small volume of water in the heterogeneous medium. (2) MBDCA doses are sensitive to voxel-by-voxel interaction cross sections. Neither conventional single-energy CT nor ICRU∕ICRP tissue composition compilations provide useful guidance for the task of assigning interaction cross sections to each voxel. (3) Since each patient-source-applicator combination is unique, having reference data for each possible combination to benchmark MBDCAs is an impractical strategy. Hence, a new commissioning process is required. TG-186 addresses in detail the above issues through the literature review and provides explicit recommendations based on the current state of knowledge. TG-43-based dose prescription and dose calculation remain in effect, with MBDCA dose reporting performed in parallel when available. In using MBDCAs, it is recommended that the radiation transport should be performed in the heterogeneous medium and, at minimum, the dose

  18. Compound list: tannic acid [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available tannic acid TAN 00093 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/tannic_acid....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/tannic_acid....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/tannic_acid...archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/tannic_acid.Rat.in_vivo.Liver.Repeat.zip ...

  19. Compound list: vitamin A [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available vitamin A VA 00059 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/vitamin..._A.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/vitamin..._A.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/vitamin...pen-tggates/LATEST/Rat/in_vivo/Liver/Repeat/vitamin_A.Rat.in_vivo.Liver.Repeat.zip ...

  20. Compound list: carbon tetrachloride [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available carbon tetrachloride CCL4 00003 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/carbon...ates/LATEST/Rat/in_vitro/carbon_tetrachloride.Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open...-tggates/LATEST/Rat/in_vivo/Liver/Single/carbon_tetrachloride.Rat.in_vivo.Liver.S...ingle.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Repeat/carbon_tetrachloride.Rat.in_vivo.Liver.Repeat.zip ...

  1. Physical Stabilization of Pharmaceutical Glasses Based on Hydrogen Bond Reorganization under Sub-Tg Temperature.

    Science.gov (United States)

    Tominaka, Satoshi; Kawakami, Kohsaku; Fukushima, Mayuko; Miyazaki, Aoi

    2017-01-03

    Amorphous solid dispersions (ASDs) play a key role in the pharmaceutical industry through the use of high-energy amorphous state to improve solubility of pharmaceutical agents. Understanding the physical stability of pharmaceutical glasses is of great importance for their successful development. We focused on the anti-HIV agent, ritonavir (RTV), and investigated the influence of annealing at temperatures below the glass transition temperature (sub-Tg) on physical stability, and found that the sub-Tg annealing effectively stabilized RTV glasses. Through the atomic structure analyses using X-ray pair distribution functions and infrared spectroscopy, we ascertained that this fascinating effect of the sub-Tg annealing originated from strengthened hydrogen bonding between molecules and probably from a better local packing associated with the stronger hydrogen bonds. The sub-Tg annealing is effective as a physical stabilization strategy for some pharmaceutical molecules, which have relatively large energy barrier for nucleation.

  2. FPGA Implementation of Burst-Mode Synchronization for SOQSPK-TG

    Science.gov (United States)

    2014-06-01

    Ft Belvoir, VA 22060-6218 U.S. ARMY PEO STRI Acquisition Center 1...IMPLEMENTATION OF BURST-MODE SYNCHRONIZATION FOR SOQSPK-TG Erik Perrins Department of Electrical Engineering & Computer Science University of Kansas Lawrence

  3. CEL file attributes - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us Open...y of This Database Site Policy | Contact Us CEL file attributes - Open TG-GATEs | LSDB Archive ...

  4. ApoAV reduces plasma triglycerides by inhibiting very low density lipoprotein-triglyceride (VLDL-TG) production and stimulating lipoprotein lipase-mediated VLDL-TG hydrolysis

    NARCIS (Netherlands)

    Schaap, Frank G.; Rensen, Patrick C. N.; Voshol, Peter J.; Vrins, Carlos; van der Vliet, Hendrik N.; Chamuleau, Robert A. F. M.; Havekes, Louis M.; Groen, Albert K.; van Dijk, Ko Willems

    2004-01-01

    ApoAV has been discovered recently as a novel modifier of triglyceride (TG) metabolism, but the pathways involved are currently unknown. To gain insight into the function of apoAV, adenovirus-mediated gene transfer of murine apoa5 to C57Bl/6 mice was employed. The injection of low doses of Ad-apoa5

  5. Notes on the implementation of the TG-43 formalism in high-rate brachytherapy; Notas sobre la implementacion del formalismo TG-43 en braquiterapia de lata tasa

    Energy Technology Data Exchange (ETDEWEB)

    Sendon del Rio, J. R.; Gonzalez Ruiz, C.; Garcia Marcos, R.; Jimenez Rojas, R.; Lopez Bote, M. A.

    2011-07-01

    The TG-43 formalism is based on dosimetric parameters depend on the specific font design extracted from dose distributions calculated by Monte Carlo in water. Relatively easy to implement, yet provides a degree of uncertainty, making it necessary to verify the calculation algorithm in the planning system to assess its behavior.

  6. Relationship TG/HDL-C and insulin resistance in adult women by nutritional status

    Directory of Open Access Journals (Sweden)

    Lorena Belén

    2014-04-01

    Full Text Available Introduction: The ratio assessment TG/HDL-C is an indicator of LDL size, facilitating the detection of individuals with increased atherogenic risk. Estimating the size of the LDL becomes important, especially in patients with TG values near the upper limit of normal values of reference and HDL-C. The objective of the study is to estimate the association between TG/HDL-C and insulin resistance (IR by nutritional status in adult women attending the Foundation for Endocrine Metabolic Diseases Research and Applied Clinical Research (FIEEM.Material and methods: Design Cross-sectional, non-pregnant adult women, apparently healthy, older than 30 years old, attending FIEEM in the Autonomous City of Buenos Aires. Dependent variable: TG/HDL-C ≥ 3.0 considered high value. Independent variables: IR by homeostatic model index HOMA-IR ≥ 2.5 categorizing the sample into two groups: with and without IR, and controlled by nutritional status using body mass index (BMI and waist circumference (CC. SPSS Statistics 15.0, calculating X2 or Fisher exact test, OR with confidence intervals of 95% and establishing logistic regression p value < 0.05.Results: We evaluated a purposive sample of 104 women (31.4% and 26% IR with TG/HDL-C high. 84.6% were overweight or obese and 88.5% increased CC. Women with BMI had significantly increased 0.15-fold increased risk (95% CI = 0.01 to 1.26 for TG/HDL-C high (p = 0.04 than the control women. There was no significance with increased CC. The ratio TG/HDL-C high IR was significantly correlated (r = 0.30 p = 0.002.Conclusions: Body weight was significantly associated with IR and the ratio TG/HDL-C increased. This ratio correlated significantly with IR in apparently healthy women.

  7. Very mild disease phenotype of congenic CftrTgH(neoimHgu cystic fibrosis mice

    Directory of Open Access Journals (Sweden)

    Leonhard-Marek Sabine

    2008-04-01

    Full Text Available Abstract Background A major boost to cystic fibrosis disease research was given by the generation of various mouse models using gene targeting in embryonal stem cells. Moreover, the introduction of the same mutation on different inbred strains generating congenic strains facilitated the search for modifier genes. From the original CftrTgH(neoimHgu mouse model with a divergent genetic background (129/Sv, C57BL/6, HsdOla:MF1 two inbred mutant mouse strains CF/1-CftrTgH(neoimHgu and CF/3-CftrTgH(neoimHgu had been generated using strict brother × sister mating. CF/1-CftrTgH(neoimHgu and CF/3-CftrTgH(neoimHgu mice were fertile and showed normal growth and lifespan. In this work the CftrTgH(neoimHgu insertional mutation was backcrossed from CF/3-CftrTgH(neoimHgu onto the inbred backgrounds C57BL/6J and DBA/2J generating congenic animals in order to clarify the differential impact of the Cftr mutation and the genetic background on the disease phenotype of the cystic fibrosis mutant mice. Clinical and electrophysiological features of the two congenic strains were compared with those of CF/1-CftrTgH(neoimHgu and CF/3-CftrTgH(neoimHgu and wild type controls. Results Under the standardized housing conditions of the animal facility, the four mouse strains CF/1-CftrTgH(neoimHgu, CF/3-CftrTgH(neoimHgu, D2.129P2(CF/3-CftrTgH(neoimHgu and B6.129P2(CF/3-CftrTgH(neoimHgu exhibited normal life expectancy. Growth of congenic cystic fibrosis mice was comparable with that of wild type controls. All mice but D2.129P2(CF/3-CftrTgH(neoimHgu females were fertile. Short circuit current measurements revealed characteristic response profiles of the HsdOla:MF1, DBA/2J and C57BL/6J backgrounds in nose, ileum and colon. All cystic fibrosis mouse lines showed the disease-typical hyperresponsiveness to amiloride in the respiratory epithelium. The mean chloride secretory responses to carbachol or forskolin were 15–100% of those of the cognate wild type control animals

  8. Spaceflight influences both mucosal and peripheral cytokine production in PTN-Tg and wild type mice.

    Directory of Open Access Journals (Sweden)

    Justin L McCarville

    Full Text Available Spaceflight is associated with several health issues including diminished immune efficiency. Effects of long-term spaceflight on selected immune parameters of wild type (Wt and transgenic mice over-expressing pleiotrophin under the human bone-specific osteocalcin promoter (PTN-Tg were examined using the novel Mouse Drawer System (MDS aboard the International Space Station (ISS over a 91 day period. Effects of this long duration flight on PTN-Tg and Wt mice were determined in comparison to ground controls and vivarium-housed PTN-Tg and Wt mice. Levels of interleukin-2 (IL-2 and transforming growth factor-beta1 (TGF-β1 were measured in mucosal and systemic tissues of Wt and PTN-Tg mice. Colonic contents were also analyzed to assess potential effects on the gut microbiota, although no firm conclusions could be made due to constraints imposed by the MDS payload and the time of sampling. Spaceflight-associated differences were observed in colonic tissue and systemic lymph node levels of IL-2 and TGF-β1 relative to ground controls. Total colonic TGF-β1 levels were lower in Wt and PTN-Tg flight mice in comparison to ground controls. The Wt flight mouse had lower levels of IL-2 and TGF-β1 compared to the Wt ground control in both the inguinal and brachial lymph nodes, however this pattern was not consistently observed in PTN-Tg mice. Vivarium-housed Wt controls had higher levels of active TGF-β1 and IL-2 in inguinal lymph nodes relative to PTN-Tg mice. The results of this study suggest compartmentalized effects of spaceflight and on immune parameters in mice.

  9. Spaceflight influences both mucosal and peripheral cytokine production in PTN-Tg and wild type mice.

    Science.gov (United States)

    McCarville, Justin L; Clarke, Sandra T; Shastri, Padmaja; Liu, Yi; Kalmokoff, Martin; Brooks, Stephen P J; Green-Johnson, Julia M

    2013-01-01

    Spaceflight is associated with several health issues including diminished immune efficiency. Effects of long-term spaceflight on selected immune parameters of wild type (Wt) and transgenic mice over-expressing pleiotrophin under the human bone-specific osteocalcin promoter (PTN-Tg) were examined using the novel Mouse Drawer System (MDS) aboard the International Space Station (ISS) over a 91 day period. Effects of this long duration flight on PTN-Tg and Wt mice were determined in comparison to ground controls and vivarium-housed PTN-Tg and Wt mice. Levels of interleukin-2 (IL-2) and transforming growth factor-beta1 (TGF-β1) were measured in mucosal and systemic tissues of Wt and PTN-Tg mice. Colonic contents were also analyzed to assess potential effects on the gut microbiota, although no firm conclusions could be made due to constraints imposed by the MDS payload and the time of sampling. Spaceflight-associated differences were observed in colonic tissue and systemic lymph node levels of IL-2 and TGF-β1 relative to ground controls. Total colonic TGF-β1 levels were lower in Wt and PTN-Tg flight mice in comparison to ground controls. The Wt flight mouse had lower levels of IL-2 and TGF-β1 compared to the Wt ground control in both the inguinal and brachial lymph nodes, however this pattern was not consistently observed in PTN-Tg mice. Vivarium-housed Wt controls had higher levels of active TGF-β1 and IL-2 in inguinal lymph nodes relative to PTN-Tg mice. The results of this study suggest compartmentalized effects of spaceflight and on immune parameters in mice.

  10. Intranasal insulin prevents anesthesia-induced hyperphosphorylation of tau in 3xTg-AD mice

    Directory of Open Access Journals (Sweden)

    Yanxing eChen

    2014-05-01

    Full Text Available Background: It is well documented that elderly individuals are at increased risk of cognitive decline after anesthesia. General anesthesia is believed to be a risk factor for Alzheimer’s disease (AD. Recent studies suggest that anesthesia may increase the risk for cognitive decline and AD through promoting abnormal hyperphosphorylation of tau, which is crucial to neurodegeneration seen in AD. Methods: We treated 3xTg-AD mice, a commonly used transgenic mouse model of AD, with daily intranasal administration of insulin (1.75U/day for one week. The insulin- and control-treated mice were then anesthetized with single intraperitoneal injection of propofol (250 mg/kg body weight. Tau phosphorylation and tau protein kinases and phosphatases in the brains of mice 30 min and two hours after propofol injection were then investigated by using Western blots and immunohistochemistry.Results: Propofol strongly promoted hyperphosphorylation of tau at several AD-related phosphorylation sites. Intranasal administration of insulin attenuated propofol-induced hyperphosphorylation of tau, promoted brain insulin signaling, and led to up-regulation of protein phosphatase 2A, a major tau phosphatase in the brain. Intranasal insulin also resulted in down-regulation of several tau protein kinases, including cyclin-dependent protein kinase 5, calcium/calmodulin-dependent protein kinase II, and c-Jun N-terminal kinase. Conclusion: Our results demonstrate that pretreatment with intranasal insulin prevents AD-like tau hyperphosphorylation. These findings provide the first evidence supporting that intranasal insulin administration might be used for the prevention of anesthesia-induced cognitive decline and increased risk for AD and dementia.

  11. Three-Dimensional Heat Transfer Analysis of a TG-CVI Reactor

    Directory of Open Access Journals (Sweden)

    Ramadan Zaher

    2015-01-01

    Full Text Available Thermal-gradient chemical vapor infiltration (TG-CVI is an alternative process to the classical CVI by involving a temperature gradient to obtain uniform densification. It allows fabricating C/SiC and C/C composites starting from a fibrous preform and gasses precursor. The main interest of these processes is increasing the density homogeneity and the densification rate. In the proposed TG-CVI reactor, a heater with a constant temperature (1323 K is placed in the core of the reactor and the cool gas flows from the outside to the center. Therefore, a continuous radially moving densification from inside to the outside of porous preform can be achieved. A numerical model was developed in order to investigate temperature distribution and velocity profile in the TG-CVI reactor. The commercial CFD software CFD-ACE+ was used. The obtained three-dimensional results were compared with experimental data. Three reference points were defined to measure the temperature in the preform. The computed results of TG-CVI showed a good agreement with the measured data. The simulation results of this study are important for the optimization of the densification process in the preform in The TG-CVI reactor.

  12. Toxoplasma gondii protease inhibitor-1 (TgPI-1) is a novel vaccine candidate against toxoplasmosis.

    Science.gov (United States)

    Cuppari, Anahi Fernandez; Sanchez, Vanesa; Ledesma, Bibiana; Frank, Fernanda M; Goldman, Alejandra; Angel, Sergio O; Martin, Valentina

    2008-09-15

    The Toxoplasma gondii serin protease inhibitor-1 (TgPI-1) is a dense granule antigen that showed to specifically inhibit trypsin, chymotrypsin and neutrophil elastase, suggesting a possible modulatory role during the parasite invasion process and on the development of the innate immune response. To study the immune-protective value of TgPI-1, C3H/HeN mice were immunized with a recombinant form of the antigen rTgPI-1 combined with alum. All immunized mice produced specific anti-rTgPI-1 immunoglobulins, with high IgG antibody titers and a mixed IgG(1)/IgG(2a) response, with predominance of IgG(1) production. The cellular immune response was associated with the production of IFN-gamma and IL-10 cytokines. Vaccinated mice displayed significant protection against an oral challenge either after a lethal infection with Me49 cysts (90% survival vs. 50%) and also after a non-lethal infection (58% reduction in brain parasite load) compared to the non-vaccinated control group. In conclusion, rTgPI-1 elicits a strong specific immune response providing partial protection against both T. gondii acute and chronic infection, so it would be a good candidate in a vaccine against toxoplasmosis, which could be combined with other relevant parasite antigens.

  13. Validation of static IMRT. TG-119 recommendations of the American Association of Physicists in Medicine; Validacion de IMRT estatica. Recomendaciones TG-119 de la AAPM

    Energy Technology Data Exchange (ETDEWEB)

    Gomez Barrado, A.; Sanchez Jimenez, E.; Sanchez-Reyes, A.

    2013-07-01

    The implementation of radiotherapy by intensity modulated (IMRT) requires a series of previous checks that ensure the quality of the treatments. There are several national and international recommendations, and of which we highlight the conclusions of the Task Group 119 from the American Association of Physicists in Medicine (AAPM). This work describes the implementation and results of the tests proposed in the recommendations of the AAPM TG-1191, to validate an improved model of our linear accelerator (LINAC) in our Planner system. (Author)

  14. Heat and current coming from the Lengwil TG veneering plant; Chaleur et courant provenant de l'usine de placage de Lengwil TG

    Energy Technology Data Exchange (ETDEWEB)

    Keel, A.

    1998-07-01

    With the recent cogeneration installation of the Lengwil TG veneering plant, the firm Schmid-Holzenergie-Contracting AG showed the possibility to produce current from wood (coupling strength-heat or cogeneration). The implemented installation is described with a special interest in the example of contracting: situations where the operating is different from the energy consumer. In this example the wastes wood of the veneering plant are recovered to feed the energy production system. (A.L.B.)

  15. Sub-Tg enthalpy relaxation in an unstable oxide glass former: insights into the structural heterogeneity

    DEFF Research Database (Denmark)

    Yue, Yuanzheng; Zhang, Yanfei

    Structural heterogeneity plays a crucial role in determining functionality of glasses. In this work we have found that the sub-Tg enthalpy relaxation pattern in a hyperquenched glass is highly sensitive to structural heterogeneity. As a consequence, the former can be used as an effective approach...... we chose the glass compositions with very different glass stabilities to crystallization. By using hyperquenching-annealing-calorimetry approach, we have observed that the pattern of calorimetric response below Tg dramatically varies with glass composition. The variations are attributed to different...... to detect and quantify the structural heterogeneity in glass-forming liquids. However, the chemical nature of structural heterogeneity should be revealed by other means such as high resolution microscopic and spectroscopic methods. To study the impact of the structural heterogeneity on the sub-Tg relaxation...

  16. A combined QXRD/TG method to quantify the phase composition of hydrated Portland cements

    Energy Technology Data Exchange (ETDEWEB)

    Soin, Alexander V.; Catalan, Lionel J.J. [Department of Chemical Engineering, Lakehead University, 955 Oliver Road, Thunder Bay, Ontario P7B 5E1 (Canada); Kinrade, Stephen D., E-mail: stephen.kinrade@lakeheadu.ca [Department of Chemistry, Lakehead University, 955 Oliver Road, Thunder Bay, Ontario P7B 5E1 (Canada)

    2013-06-15

    A new method is reported for quantifying the mineral phases in hydrated cement pastes that is based on a combination of quantitative X-ray diffractometry (QXRD) and thermogravimetry (TG). It differs from previous methods in that it gives a precise measure of the amorphous phase content without relying on an assumed stoichiometric relationship between the principal hydration products, calcium hydroxide (CH) and calcium silicate hydrate (C–S–H). The method was successfully applied to gray and white ordinary Portland cements (GOPC and WOPC, respectively) that were cured for up to 56 days. Phase distributions determined by QXRD/TG closely matched those from gray-level analysis of backscattered scanning electron microscope (BSEM) images, whereas elemental compositions obtained for the amorphous phase by QXRD/TG agreed well with those measured by quantitative energy dispersive X-ray spectroscopy (EDS)

  17. Gene expression data (CEL files) - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Open TG-GATEs Gene expression data (CEL files) Data detail Data name Gene expression data (C... of the file formats that expresses gene expression data (raw data) generated from Affymetrix GeneChip®. Dat...gates/LATEST/Rat/ File size: 12.0GB total File name: Gene expression data from hu...Simple search URL - Data acquisition method Gene expression data were generated from Affymetrix GeneChip®. I...olicy | Contact Us Gene expression data (CEL files) - Open TG-GATEs | LSDB Archive ...

  18. Database Description - Open TG-GATEs Pathological Image Database | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Open TG-GATEs Pathological Image Database Database Description General information of database Database... name Open TG-GATEs Pathological Image Database Alternative name - DOI 10.18908/lsdba.nbdc00954-0...iomedical Innovation 7-6-8, Saito-asagi, Ibaraki-city, Osaka 567-0085, Japan TEL:81-72-641-9826 Email: Database... classification Toxicogenomics Database Organism Taxonomy Name: Rattus norvegi... Article title: Author name(s): Journal: External Links: Original website information Database

  19. Sub-Tg enthalpy relaxation in an extremely unstable oxide glass and its implication for structural heterogeneity

    DEFF Research Database (Denmark)

    Zhang, Yanfei; Hu, L.N.; Liu, S.J.

    2013-01-01

    We study the sub-Tg relaxation in an extremely unstable glass former, i.e., 65SiO2-35Al2O3, and its relation to structural heterogeneity (e.g., structurally ordered domains in glass matrix). This is done by hyperquenching (~106 K/s) the liquid, then annealing the hyperquenched glass below Tg...... and subsequently scanning the annealed hyperquenched glass in a differential scanning calorimeter. The results show that structural ordering can take place even below Tg. An endothermic pre-peak is observed when the hyperquenched sample is annealed at 0.75Tg for sufficiently long time, which is, however, much...... weaker compared to that of stable glass formers subjected to same annealing conditions. We also investigate the effect of the sub-Tg annealing on crystallization above Tg. The results imply that some structurally ordered domains exist already in the liquid state. The ordered domains lower the activation...

  20. Adiponectin gene polymorphism rs2241766 T/G is associated with response to pioglitazone treatment in type 2 diabetic patients from southern China.

    Directory of Open Access Journals (Sweden)

    Hong Yang

    Full Text Available INTRODUCTION: Insulin sensitizing drugs such as pioglitazone are not uniformly treatment effective among individual type 2 diabetic patients. Here, the relationship of pioglitazone efficacy to single nucleotide polymorphisms (SNP of the adiponectin gene, a critical gene directly regulated by the drug, was examined in a cohort of Chinese Han type 2 diabetic patients. METHODS: Eighty type 2 diabetic patients were treated with pioglitazone (15 mg/day for 12 weeks without interruption of their current therapeutic regimen. Fasting plasma glucose, fasting insulin, homeostasis model assessment for insulin resistance (HOMA-IR, and glycated hemoglobin (HbA1c% were collected both prior to and following pioglitazone treatment. Response to pioglitazone was defined as a decrease of at least 15% in HbA1c% levels. Three regions of the adiponectin gene containing SNPs (promoter, intron 2 and exon 2, and exon 3 were amplified and sequenced to determine genotype. RESULTS: Serum adiponectin levels were significantly increased (p<0.001 whereas fasting plasma glucose, fasting insulin, HOMA-IR, and HbA1c% values were significantly decreased relative to baseline measurements (p<0.001. Response of patients with TG and TT genotypes at rs2241766 (exon2; 52.9% vs. 12.7%, respectively p = 0.001 was statistically significant relative to all other patients. Amongst rs2241766 TG and TT patients, the mean decrease in HbA1c% levels was greater where the genotype was TG (1.15±0.80 vs. 0.52±0.64, p = 0.001. CONCLUSIONS: The adiponectin gene polymorphism rs2241766 T/G is associated with pioglitazone efficacy in type 2 diabetic patients, and status of the polymorphism may be an important clinical factor to consider prior to pioglitazone treatment.

  1. BTN1A1 , FABP3 and TG genes polymorphism in East Anatolian red ...

    African Journals Online (AJOL)

    ... in future investigations, taking into consideration all possible genotype at different loci and using other restriction enzymes for recognizing the variants. Keywords: BTN1A1, TG, FABP3, cattle, polymerase chain reaction-restriction fragment lenght polymorphism (PCR-RFLP) African Journal of Biotechnology Vol. 12(20), pp.

  2. CAPS markers TAO1 and TG105 in the identification of I2 resistant ...

    African Journals Online (AJOL)

    Nigerian Journal of Biotechnology ... The restriction enzymes Fok1 and Hinf1, for TAO1 and TG105 respectively, produced fragments at base pairs indicative of susceptible, homozygous and heterozygous resistant ... Restriction fragments from the two markers indicated that 11 accessions were homozygous resistant to Fol.

  3. CAPS Markers TAO1 and TG105 in the Identification of I2 Resistant ...

    African Journals Online (AJOL)

    Prof. Ogunji

    www.ajol.info/index.php/njb/index and www.biotechsocietynigeria.org. 43 ... The restriction enzymes Fok1 and Hinf1, for TAO1 and TG105 .... Restriction enzyme digestion and analysis of amplified products (Staniazsek et al., 2007): PCR.

  4. Neuritin attenuates cognitive function impairments in tg2576 mouse model of Alzheimer's disease.

    Directory of Open Access Journals (Sweden)

    Yoori Choi

    Full Text Available Neuritin, also known as CPG15, is a neurotrophic factor that was initially discovered in a screen to identify genes involved in activity-dependent synaptic plasticity. Neuritin plays multiple roles in the process of neural development and synaptic plasticity, although its binding receptor(s and downstream signaling effectors remain unclear. In this study, we found that the cortical and hippocampal expression of neuritin is reduced in the brains of Alzheimer's disease (AD patients and demonstrated that viral-mediated expression of neuritin in the dentate gyrus of 13-month-old Tg2576 mice, an AD animal model, attenuated a deficit in learning and memory as assessed by a Morris water maze test. We also found that neuritin restored the reduction in dendritic spine density and the maturity of individual spines in primary hippocampal neuron cultures prepared from Tg2576 mice. It was also shown that viral-mediated expression of neuritin in the dentate gyrus of 7-week-old Sprague-Dawley rats increased neurogenesis in the hippocampus. Taken together, our results demonstrate that neuritin restores the reduction in dendritic spine density and the maturity of individual spines in primary hippocampal neurons from Tg2576 neurons, and also attenuates cognitive function deficits in Tg2576 mouse model of AD, suggesting that neuritin possesses a therapeutic potential for AD.

  5. Hematology - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data ...ivo tests. Data file File name: open_tggates_hematology.zip File URL: ftp://ftp.biosciencedbc.jp/archive/ope...en About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Hematology - Open TG-GATEs | LSDB Archive ...

  6. TG-FTIR Study of the Influence of potassium Chloride on Wheat Straw Pyrolysis

    DEFF Research Database (Denmark)

    Jensen, Anker; Dam-Johansen, Kim; Wójtowicz, M.A.

    1998-01-01

    of products into char, tar and gas. In this work, a combination of thermogravimetry and evolved gas analysis by Fourier transform infrared analysis (TG-FTIR) has been applied to study the influence of potassium chloride (KCl) on wheat straw pyrolysis. Raw straw, washed straw and washed straw impregnated...

  7. High-Tg Thiol-Click Thermoset Networks via the Thiol-Maleimide Michael Addition.

    Science.gov (United States)

    Parker, Shelbi; Reit, Radu; Abitz, Haley; Ellson, Gregory; Yang, Kejia; Lund, Benjamin; Voit, Walter E

    2016-07-01

    Thiol-click reactions lead to polymeric materials with a wide range of interesting mechanical, electrical, and optical properties. However, this reaction mechanism typically results in bulk materials with a low glass transition temperature (Tg ) due to rotational flexibility around the thioether linkages found in networks such as thiol-ene, thiol-epoxy, and thiol-acrylate systems. This report explores the thiol-maleimide reaction utilized for the first time as a solvent-free reaction system to synthesize high-Tg thermosetting networks. Through thermomechanical characterization via dynamic mechanical analysis, the homogeneity and Tg s of thiol-maleimide networks are compared to similarly structured thiol-ene and thiol-epoxy networks. While preliminary data show more heterogeneous networks for thiol-maleimide systems, bulk materials exhibit Tg s 80 °C higher than other thiol-click systems explored herein. Finally, hollow tubes are synthesized using each thiol-click reaction mechanism and employed in low- and high-temperature environments, demonstrating the ability to withstand a compressive radial 100 N deformation at 100 °C wherein other thiol-click systems fail mechanically. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. TG13 current terminology, etiology, and epidemiology of acute cholangitis and cholecystitis

    NARCIS (Netherlands)

    Kimura, Yasutoshi; Takada, Tadahiro; Strasberg, Steven M.; Pitt, Henry A.; Gouma, Dirk J.; Garden, O. James; Büchler, Markus W.; Windsor, John A.; Mayumi, Toshihiko; Yoshida, Masahiro; Miura, Fumihiko; Higuchi, Ryota; Gabata, Toshifumi; Hata, Jiro; Gomi, Harumi; Dervenis, Christos; Lau, Wan-Yee; Belli, Giulio; Kim, Myung-Hwan; Hilvano, Serafin C.; Yamashita, Yuichi

    2013-01-01

    While referring to the evidence adopted in the Tokyo Guidelines 2007 (TG07) as well as subsequently obtained evidence, further discussion took place on terminology, etiology, and epidemiological data. In particular, new findings have accumulated on the occurrence of symptoms in patients with

  9. Body weight - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us Open...atabase Description Download License Update History of This Database Site Policy | Contact Us Body weight - Open TG-GATEs | LSDB Archive ...

  10. Cell sample - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us Open...y About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Cell sample - Open TG-GATEs | LSDB Archive ...

  11. Individual list - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us Open...ion Download License Update History of This Database Site Policy | Contact Us Individual list - Open TG-GATEs | LSDB Archive ...

  12. Iron Chelation Inhibits Osteoclastic Differentiation In Vitro and in Tg2576 Mouse Model of Alzheimer's Disease.

    Directory of Open Access Journals (Sweden)

    Jun-Peng Guo

    Full Text Available Patients of Alzheimer's disease (AD frequently have lower bone mineral density and higher rate of hip fracture. Tg2576, a well characterized AD animal model that ubiquitously express Swedish mutant amyloid precursor protein (APPswe, displays not only AD-relevant neuropathology, but also age-dependent bone deficits. However, the underlying mechanisms remain poorly understood. As APP is implicated as a regulator of iron export, and the metal chelation is considered as a potential therapeutic strategy for AD, we examined iron chelation's effect on the osteoporotic deficit in Tg2576 mice. Remarkably, in vivo treatment with iron chelator, clinoquinol (CQ, increased both trabecular and cortical bone-mass, selectively in Tg2576, but not wild type (WT mice. Further in vitro studies showed that low concentrations of CQ as well as deferoxamine (DFO, another iron chelator, selectively inhibited osteoclast (OC differentiation, without an obvious effect on osteoblast (OB differentiation. Intriguingly, both CQ and DFO's inhibitory effect on OC was more potent in bone marrow macrophages (BMMs from Tg2576 mice than that of wild type controls. The reduction of intracellular iron levels in BMMs by CQ was also more dramatic in APPswe-expressing BMMs. Taken together, these results demonstrate a potent inhibition on OC formation and activation in APPswe-expressing BMMs by iron chelation, and reveal a potential therapeutic value of CQ in treating AD-associated osteoporotic deficits.

  13. Determinação quantitativa de TNT e HNS por TG e FT-IR Quantitative determination of TNT and HNS by TG and FT-IR

    Directory of Open Access Journals (Sweden)

    Gilson da Silva

    2008-01-01

    Full Text Available 2,4,6-trinitrotoluene (TNT is an energetic material that shows scarce crystalline properties that can be improved by addition of 2,2',4,4',6,6'-hexanitrostilbene (HNS in the crystallization process. HNS is a very important high explosive used in a variety of military, aerospace and industrial formulations owing to its suitable properties. It is an insensitive and thermal stable explosive that can be produced from 2,4,6-trinitrotoluene (TNT. The purpose of this work is the quantitative determination of HNS and TNT in explosives by thermogravimetric analysis (TG and Fourier transform infrared spectroscopy (FT-IR.

  14. Análises de protocolos de braquiterapia, por alta taxa de dose, do controle de qualidade de alguns serviços locais, baseados no TG40, TG56 e ARCAL XXX Analysis of the high dose rate brachytherapy protocols of quality assurance programs of some local services, based on TG40, TG56 and ARCAL XXX.

    Directory of Open Access Journals (Sweden)

    Carmen S. Guzmán Calcina

    2001-08-01

    Full Text Available A braquiterapia por alta taxa de dose está recebendo atenção considerável na maioria dos países. Por isso, nos serviços que utilizam este equipamento exige-se que o desenvolvimento de um programa de controle de qualidade seja cada vez mais rigoroso, para garantir não apenas a segurança aos pacientes, mas também aos operadores e demais envolvidos. Este trabalho tem por objetivos fazer um levantamento dos tipos de testes para um equipamento de braquiterapia por alta taxa de dose, propostos pelos protocolos oficiais publicados (TG40, TG56 e ARCAL XXX e avaliar os tipos de testes que atualmente são realizados por alguns serviços de radioterapia, comparando-os com aqueles apresentados nos protocolos citados. Das análises feitas, observou-se que: a quanto aos protocolos oficiais, o TG56 é mais completo que o TG40 e o ARCAL XXX; b quanto às instituições analisadas, estas em geral se basearam no TG56 para elaborar seus próprios protocolos, os quais demonstraram ter também concordância com os outros já citados. Nestes protocolos, a inexistência dos testes anuais foi notada, o que pode ser explicado por sua aparição nas freqüências trimestral e semestral. Do produto deste estudo são apresentadas tabelas dos tipos de testes com suas respectivas freqüências de utilização, das quais um protocolo pode ser inferido para auxiliar na implementação, pelo menos, dos tipos de testes de controle de qualidade básicos e indispensáveis para o equipamento, garantindo, assim, um tratamento adequado aos pacientes e uma melhor segurança ao pessoal envolvido e, conseqüentemente, assegurando a garantia de qualidade na braquiterapia por alta taxa de dose.High dose rate brachytherapy has been increasingly recognized in most countries, and radiotherapy services using this equipment are encouraged to have a very efficient quality assurance program to ensure protection for patients, workers and other personnel involved. The objective of this

  15. Spontaneous loss of tolerance of autoreative B cell in Act1-deficient AM14 Tg rheumatoid factor (RF) mice

    Science.gov (United States)

    Giltiay, Natalia V.; Lu, Yi; Cullen, Jaime L.; Jørgensen, Trine N.; Shlomchik, Mark J.; Li, Xiaoxia

    2013-01-01

    Self-reactive B cells in BALB/c AM14 transgenic (AM14 Tg) rheumatoid factor (RF) mice are not subject to central or peripheral toleralization. Instead, they remain at a stage of “clonal ignorance”, i.e. they do not proliferate and differentiate into Ab-producing cells. However, the immunoregulatory mechanisms that prevent autoantibody production in these mice remain unclear. In this study, we show that crossing AM14 Tg mice to a mouse strain deficient in Act1, a molecule involved in the regulation of BAFF-R and CD40-signaling in B cells, results in spontaneous activation of AM14 Tg B cells and production of AM14-specific antibodies. Three to five-month old AM14 Tg Act1−/− mice showed significant expansion of AM14 Tg B cells, including a 2–3 fold increase in the spleen and cLNs compared to AM14 Tg Act1+/+ mice. Furthermore, in the presence of endogenous self-Ag (IgHa congenic background), AM14 Tg Act1−/− B cells were spontaneously activated and differentiated into antibody forming cells (AFC). In contrast with previous studies using AM14 Tg MLR.Faslpr mice, we found that a significant number of AM14 Tg cells AM14 Tg Act1−/− mice displayed phenotypic characteristics of GC B cells. Anti-CD40L treatment significantly limited the expansion and activation of AM14 Tg Act1−/− B cells, suggesting that CD40L-mediated signals are required for the retention of these cells. Our results support the important role of Act1 in the regulation of self-reactive B cells and reveal how Act1 functions to prevent the production of autoantibodies. PMID:23904159

  16. MO-PIS-Exhibit Hall-01: Tools for TG-142 Linac Imaging QA I

    Energy Technology Data Exchange (ETDEWEB)

    Clements, M [RAD Image, Colorado Springs, CO (United States); Wiesmeyer, M [Standard Imaging, Inc., Middleton, WI (United States)

    2014-06-15

    Partners in Solutions is an exciting new program in which AAPM partners with our vendors to present practical “hands-on” information about the equipment and software systems that we use in our clinics. The therapy topic this year is solutions for TG-142 recommendations for linear accelerator imaging QA. Note that the sessions are being held in a special purpose room built on the Exhibit Hall Floor, to encourage further interaction with the vendors. Automated Imaging QA for TG-142 with RIT Presentation Time: 2:45 – 3:15 PM This presentation will discuss software tools for automated imaging QA and phantom analysis for TG-142. All modalities used in radiation oncology will be discussed, including CBCT, planar kV imaging, planar MV imaging, and imaging and treatment coordinate coincidence. Vendor supplied phantoms as well as a variety of third-party phantoms will be shown, along with appropriate analyses, proper phantom setup procedures and scanning settings, and a discussion of image quality metrics. Tools for process automation will be discussed which include: RIT Cognition (machine learning for phantom image identification), RIT Cerberus (automated file system monitoring and searching), and RunQueueC (batch processing of multiple images). In addition to phantom analysis, tools for statistical tracking, trending, and reporting will be discussed. This discussion will include an introduction to statistical process control, a valuable tool in analyzing data and determining appropriate tolerances. An Introduction to TG-142 Imaging QA Using Standard Imaging Products Presentation Time: 3:15 – 3:45 PM Medical Physicists want to understand the logic behind TG-142 Imaging QA. What is often missing is a firm understanding of the connections between the EPID and OBI phantom imaging, the software “algorithms” that calculate the QA metrics, the establishment of baselines, and the analysis and interpretation of the results. The goal of our brief presentation will be to

  17. Draft genome sequence of Paenisporosarcina sp. strain TG-20, a psychrophilic bacterium isolated from the basal ice of Taylor Glacier.

    Science.gov (United States)

    Lee, Jun Hyuck; Koh, Hye Yeon; Lee, Sung Gu; Doyle, Shawn; Christner, Brent C; Kim, Hak Jun

    2012-12-01

    We report the draft genome sequence of Paenisporosarcina sp. strain TG-20, which is 4.12 Mb in size and consists of 4,071 protein-coding genes and 76 RNA genes. The genome sequence of Paenisporosarcina sp. TG-20 may provide useful information about molecular adaptations that enhance survival in icy subsurface environments.

  18. Impaired hippocampal acetylcholine release parallels spatial memory deficits in Tg2576 mice subjected to basal forebrain cholinergic degeneration

    DEFF Research Database (Denmark)

    Laursen, Bettina; Mørk, Arne; Plath, Niels

    2013-01-01

    (BFCD) in 3 months old male Tg2576 mice to co-express cholinergic degeneration with Aβ overexpression as these characteristics constitutes key hallmarks of AD. At 9 months, SAP lesioned Tg2576 mice were cognitively impaired in two spatial paradigms addressing working memory and mid to long-term memory...

  19. Value of 18F-FDG PET negativity and Tg suppressibility as markers of prognosis in patients with elevated Tg and 131I-negative differentiated thyroid carcinoma (TENIS syndrome).

    Science.gov (United States)

    Ranade, Rohit; Kand, Purushottam; Basu, Sandip

    2015-10-01

    The aim of the study was to investigate the prognostic value of fluorine-18 fluorodeoxyglucose (18F-FDG) PET negativity and thyroglobulin (Tg) suppressibility in differentiated thyroid carcinoma patients with elevated Tg and a negative radioiodine scan. The study population was selected from thyroid cancer patients registered at a large tertiary cancer care center for management and consisted of patients with metastatic thyroid cancer with elevated Tg on follow-up, negative 131I whole-body scan and negative 18F-FDG PET/computed tomography (CT) study. Patients with thyroid carcinoma were subjected to a thyroid-stimulating hormone-stimulated assessment on the basis of a 131I whole-body scan, serum Tg level and whole-body 18F-FDG PET/CT scan for evaluation of metastatic disease burden. The same patients were subjected to a follow-up evaluation of serum Tg and whole-body 18F-FDG PET/CT scan under thyroid-stimulating hormone suppression while on thyroxine sodium. Comparison was also made between the findings of 18F-FDG PET/CT in patients demonstrating suppressible Tg. A total of 40 (25 male and 15 female) patients were included in the study. All patients had a negative whole-body 18F-FDG PET/CT study but had stimulated Tg more than 5 ng/dl (range: 5.1-> 250 ng/ml), indicating the presence of disease. The patients demonstrated variable Tg suppressibility and were classified on the basis of the extent of Tg suppressibility (%Tg suppressibility > 90% in 21 patients; %Tg suppressibility 65-90% in 12 patients; and %Tg suppressibility 65%) is observed in a significant fraction of these patients, which appears to be independent of the status of metastasis or the histopathology. Also patients who show no Tg suppressibility but had a negative 18F-FDG PET/CT scan still had a better prognosis indicated by the disease-free interval in these patients as indicated in our study. Whether there exists any relation between the extent of suppressibility and their long-term outcome

  20. Loureirin B: An Effective Component in Dragon's Blood Modulating Sodium Currents in TG Neurons.

    Science.gov (United States)

    Liu, Xiangming; Yin, Shijin; Chen, Su; Ma, Quanshun

    2005-01-01

    To test, analyze and express the relationship between the pharmacological effect of Traditional Chinese Medicine (TCM) dragon's blood and that of its component loureirin B, specify an operational definition for effective component from raw drug of TCM. Using the whole-cell patch-clamp technique, the effects of dragon's blood and its component loureirin B on tetrodotoxin-sensitive (TTX-S) and tetrodotoxin-resistant (TTX-R) sodium currents in trigeminal ganglion (TG) neurons were observed. The results show that both dragon's blood and loureirin B suppressed two types of peak sodium currents in a dose-dependent way. 0.1% dragon's blood and 0.2mmol/L loureirin B affected the activation and inactivation of sodium channels. The results further prove the analgetic mechanism of dragon's blood interfering with the nociceptive transmission. According to the above definition, loureirin B is the effective component in dragon's blood modulating sodium currents in TG neurons.

  1. Evaluating autoimmunity markers (TPO Ab, Tg Ab and TM Ab in hypothyroid patients of Bushehr province

    Directory of Open Access Journals (Sweden)

    Iraj Nabipour

    2005-09-01

    Full Text Available Background: Chronic autoimmune thyroiditis (Hashimoto's Thyroiditis is the common cause of primary hypothyroidism in iodine sufficient countries. Iran is named an iodine sufficient country, in this century. Methods: A total of 88 hypothyroid patients, on suppressing dose of levothyroxine who were followed in a university endocrine disorder clinic were evaluated for serum thyroid autoimmunity markers: thyroid peroxidase antibody (TPO Ab, thyroglobulin antibody (Tg Ab and thyroid microsomal antibody (TM Ab using ELISA method. Results: The prevalence of TPO Ab, Tg Ab and TM Ab were 73.9%, 45.5% and 71.6%, respectively. Among the patients with high level of TPO Ab (> 75 u/ml, 45.3% had grade 1 or 2 of goiter (P< 0.05. Conclusion: Autoimmune thyroid disease (Hashimoto's thyroiditis is the most common cause of hypothyroidism in Bushehr province.

  2. Non-isothermal kinetic characterisation of a gas–solid reaction by TG analysis

    Directory of Open Access Journals (Sweden)

    ZELJKO CUPIC

    2005-11-01

    Full Text Available A series of silica-supported Ni-catalyst precursors was synthesized, with different SiO2/Nimole ratios between 0.2 and 1.15. The reduction of all the prepared samples was studied by thermogravimetry (TG in a hydrogen flow. The results of the TG analysis were analyzed by the multi-thermal history model-fitting method, with non-linear regression. The activation energies for the reduction of each sample were determined. The statistical F-test was performed to discriminate between various models. It was found that increasing the SiO2/Ni mole ratio leads to a change in the reaction mechanism of the nickel reduction, resulting finally in a change from second order reaction kinetics to three halves order reaction kinetics.

  3. Helhetsorienterad utvärdering av kollektivtrafikåtgärder

    DEFF Research Database (Denmark)

    Hiselius, Lena Winslott; Barfod, Michael Bruhn; Leleur, Steen

    Under hösten 2008 och våren 2009 har forskare vid Avd. Trafik och väg vid Lunds Tekniska Högskola, DTU Transport vid Danmarks Tekniska Universitet samt National-ekonomiska institutionen vid Lunds Universitet genomfört ett forskningsprojekt med syfte att studera tillämpningen av en sammansatt...... (helhetsorienterad) analys av kollektiv-trafikåtgärder....

  4. Textural properties of low-fat set-type yoghurt depending on mTG addition

    Directory of Open Access Journals (Sweden)

    Lívia Darnay

    2016-07-01

    Full Text Available Our aim was to determine how 0.5-2 U/g non-inactivated mTG affects the pH development and apparent viscosity during fermentation. Furthermore we wished to examine how the enzyme addition could change protein structure, gel strength and sensory characteristics by healthy low-fat set-type yoghurt product. Therefore commercial mTG enzyme preparation was added in different concentrations (0.5-2.0 U/g, in 0.5 U/g steps to 1.5 % bovine milk simultaneously with DVS starter culture. Our study revealed that enzyme dosage (0.5-2 U/g protein had no impact on pH development and apparent viscosity during fermentation when manufacturing low-fat (1.5 % set-type yoghurt. The addition of mTG contributed to 38 % more whey retention with incorporation of β-casein, and caused 44 % higher gel strength up to a level of 1 U/g protein.

  5. Interaction and kinetic analysis for coal and biomass co-gasification by TG-FTIR.

    Science.gov (United States)

    Xu, Chaofen; Hu, Song; Xiang, Jun; Zhang, Liqi; Sun, Lushi; Shuai, Chao; Chen, Qindong; He, Limo; Edreis, Elbager M A

    2014-02-01

    This study aims to investigate the interaction and kinetic behavior of CO2 gasification of coal, biomass and their blends by thermogravimetry analysis (TG). The gas products evolved from gasification were measured online with Fourier Transform Infrared Spectroscopy (FTIR) coupled with TG. Firstly, TG experiments indicated that interaction between the coals and biomasses mainly occurred during co-gasification process. The most significant synergistic interaction occurred for LN with SD at the blending mass ratio 4:1. Furthermore, thermal kinetic analysis indicated that the activation energy involved in co-gasification decreased as the SD content increased until the blending ratio of SD with coal reached 4:1. The rise of the frequency factor indicated that the increase of SD content favored their synergistic interaction. Finally, FTIR analysis of co-gasification of SD with LN indicated that except for CO, most gases including CH3COOH, C6H5OH, H2O, etc., were detected at around 50-700°C. Copyright © 2014. Published by Elsevier Ltd.

  6. Effects of the C57BL/6 strain background on tauopathy progression in the rTg4510 mouse model.

    Science.gov (United States)

    Bailey, Rachel M; Howard, John; Knight, Joshua; Sahara, Naruhiko; Dickson, Dennis W; Lewis, Jada

    2014-01-15

    Cross-breeding of transgenic mice is commonly used to assess gene-gene interactions, particularly in the context of disease. Strain background changes can influence the phenotype of mouse models and can confound crossbreeding studies. We sought to determine if changing the strain background of a commonly used mouse model of tauopathy (rTg4510) would significantly impact the originally reported phenotype. On the original F1 FVB/N x 129S6 background, rTg4510 mice present with progressive cognitive decline, increased insoluble tau, robust tau pathology and age-dependent neurodegeneration. One of the most common strains in mouse modeling is C57BL/6. We and others have previously reported that this strain background alters the phenotypes of various models, including the JNPL3 model of tauopathy. To determine if the phenotype of rTg4510 mice was similarly affected by the introduction of the C57BL/6 background, we compared rTg4510 mice on the original F1 FVB/N x 129S6 background to rTg4510 mice on an F1 FVB/N x C57BL/6NTac (B6/NTac) background, herein termed rTg4510B6. Despite a small, but significant increase in soluble human tau levels, young rTg4510B6 mice had equivalent levels of tau phosphorylation, aggregation and cognitive impairments as age-matched rTg4510 mice. At 6.5 months of age, rTg4510B6 mice displayed hyperphosphorylated insoluble tau and robust cortical tau neuropathology that was equivalent to age-matched rTg4510 mice; however, 10.5-month-old rTg4510B6 mice had greater amounts of phospho-tau in the cortex and hippocampus when compared to age-matched rTg4510 mice. Non-transgenic (NT) littermates of rTg4510B6 (NTB6) mice also had greater amounts of cortical and hippocampal phospho-tau at 10.5 months of age when compared to NT littermates of rTg4510 mice. Additionally, older rTg4510B6 mice had gross forebrain neurodegeneration that was equivalent to age-matched rTg4510 mice. Overall, our data shows that introduction of the C57BL/6 strain into the rTg4510

  7. Recombinant TgHSP70 Immunization Protects against Toxoplasma gondii Brain Cyst Formation by Enhancing Inducible Nitric Oxide Expression

    Directory of Open Access Journals (Sweden)

    Neide M. Silva

    2017-04-01

    Full Text Available Toxoplasma gondii is known to cause congenital infection in humans and animals and severe disease in immunocompromised individuals; consequently development of vaccines against the parasite is highly necessary. Under stress conditions, T. gondii expresses the highly immunogenic heat shock protein 70 (TgHSP70. Here, we assessed the protective efficacy of rTgHSP70 immunization combined with Alum in oral ME-49 T. gondii infection and the mechanisms involved on it. It was observed that immunized mice with rTgHSP70 or rTgHSP70 adsorbed in Alum presented a significantly reduced number of cysts in the brain that was associated with increased iNOS+ cell numbers in the organ, irrespective the use of the adjuvant. Indeed, ex vivo experiments showed that peritoneal macrophages pre-stimulated with rTgHSP70 presented increased NO production and enhanced parasite killing, and the protein was able to directly stimulate B cells toward antibody producing profile. In addition, rTgHSP70 immunization leads to high specific antibody titters systemically and a mixed IgG1/IgG2a response, with predominance of IgG1 production. Nonetheless, it was observed that the pretreatment of the parasite with rTgHSP70 immune sera was not able to control T. gondii internalization and replication by NIH fibroblast neither peritoneal murine macrophages, nor anti-rTgHSP70 antibodies were able to kill T. gondii by complement-mediated lysis, suggesting that these mechanisms are not crucial to resistance. Interestingly, when in combination with Alum, rTgHSP70 immunization was able to reduce inflammation in the brain of infected mice and in parallel anti-rTgHSP70 immune complexes in the serum. In conclusion, immunization with rTgHSP70 induces massive amounts of iNOS expression and reduced brain parasitism, suggesting that iNOS expression and consequently NO production in the brain is a protective mechanism induced by TgHSP70 immunization, therefore rTgHSP70 can be a good candidate for

  8. LncRNA-TP53TG1 Participated in the Stress Response Under Glucose Deprivation in Glioma.

    Science.gov (United States)

    Chen, Xin; Gao, Yang; Li, Deheng; Cao, Yiqun; Hao, Bin

    2017-12-01

    Gliomas are the most common brain tumors of the center nervous system. And long non-coding RNAs (lncRNAs) are non-protein coding transcripts, which have been considered as one type of gene expression regulator for cancer development. In this study, we investigated the role of lncRNA-TP53TG1 in response to glucose deprivation in human gliomas. The expression levels of TP53TG1 in glioma tissues and cells were analyzed by qRT-PCR. In addition, the influence of TP53TG1 on glucose metabolism related genes at the mRNA level during both high and low glucose treatment was detected by qRT-PCR. MTT, clonogenicity assays, and flow cytometry were performed to detect the cell proliferation and cell apoptosis. Furthermore, the migration of glioma cells was examined by Transwell assays. The expression of TP53TG1 was significantly higher in human glioma tissues or cell lines compared with normal brain tissue or NHA. Moreover, TP53TG1 and some tumor glucose metabolism related genes, such as GRP78, LDHA, and IDH1 were up-regulated significantly in U87 and LN18 cells under glucose deprivation. In addition, knockdown of TP53TG1 decreased cell proliferation and migration and down-regulated GRP78 and IDH1 expression levels and up-regulated PKM2 levels in U87 cells under glucose deprivation. However, over-expression of TP53TG1 showed the opposite tendency. Moreover, the effects of TP53TG1 were more remarkable in low glucose than that in high glucose. Our data showed that TP53TG1 under glucose deprivation may promote cell proliferation and migration by influencing the expression of glucose metabolism related genes in glioma. J. Cell. Biochem. 118: 4897-4904, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Molecular weight dependence of the intrinsic size effect on Tg in AAO template-supported polymer nanorods: A DSC study

    Science.gov (United States)

    Askar, Shadid; Wei, Tong; Tan, Anthony W.; Torkelson, John M.

    2017-05-01

    Many studies have established a major effect of nanoscale confinement on the glass transition temperature (Tg) of polystyrene (PS), most commonly in thin films with one or two free surfaces. Here, we characterize smaller yet significant intrinsic size effects (in the absence of free surfaces or significant attractive polymer-substrate interactions) on the Tg and fragility of PS. Melt infiltration of various molecular weights (MWs) of PS into anodic aluminum oxide (AAO) templates is used to create nanorods supported on AAO with rod diameter (d) ranging from 24 to 210 nm. The Tg (both as Tg,onset and fictive temperature) and fragility values are characterized by differential scanning calorimetry. No intrinsic size effect is observed for 30 kg/mol PS in template-supported nanorods with d = 24 nm. However, effects on Tg are present for PS nanorods with Mn and Mw ≥ ˜175 kg/mol, with effects increasing in magnitude with increasing MW. For example, in 24-nm-diameter template-supported nanorods, Tg, rod - Tg, bulk = -2.0 to -2.5 °C for PS with Mn = 175 kg/mol and Mw = 182 kg/mol, and Tg, rod - Tg, bulk = ˜-8 °C for PS with Mn = 929 kg/mol and Mw = 1420 kg/mol. In general, reductions in Tg occur when d ≤ ˜2Rg, where Rg is the bulk polymer radius of gyration. Thus, intrinsic size effects are significant when the rod diameter is smaller than the diameter (2Rg) associated with the spherical volume pervaded by coils in bulk. We hypothesize that the Tg reduction occurs when chain segment packing frustration is sufficiently perturbed by confinement in the nanorods. This explanation is supported by observed reductions in fragility with the increasing extent of confinement. We also explain why these small intrinsic size effects do not contradict reports that the Tg-confinement effect in supported PS films with one free surface exhibits little or no MW dependence.

  10. Local glass transition temperature Tg(z) of polystyrene next to different polymers: Hard vs. soft confinement

    Science.gov (United States)

    Baglay, Roman R.; Roth, Connie B.

    2017-05-01

    The depth to which the local glass transition temperature Tg and alpha-relaxations are perturbed near a boundary is believed to be related to the characteristic length scales associated with cooperative dynamics in dynamically heterogeneous glasses. Following our recent work [R. R. Baglay and C. R. Roth, J. Chem. Phys. 143, 111101 (2015)] that measured a very broad 350-400 nm local Tg(z) profile across a glassy-rubbery interface of polystyrene (PS)/poly(n-butyl methacrylate) (PnBMA), we compare here how the Tg(z) profile in PS varies when changing the neighboring polymer from a lower Tg material to a higher Tg material. Here we report local Tg(z) profiles for PS when in contact with polysulfone (PSF), poly(methyl methacrylate) (PMMA), and poly(isobutyl methacrylate) (PiBMA). We find that the distance from the interface before bulk Tg of PS (Tgbulk=101 °C) is recovered depends on whether PS forms the high-Tg glassy component experiencing so-called soft confinement, z ≈ 225-250 nm for PS next to PiBMA (Tgbulk=62°C) and PnBMA (Tgbulk=21 °C), or PS forms the low-Tg rubbery component experiencing hard confinement, z ≈ 100-125 nm for PS next to PSF (Tgbulk=186°C) and PMMA (Tgbulk=120 °C). The depth to which these Tg(z) perturbations persist and the magnitude of the local Tg perturbation at the interface are independent of the difference in Tgbulk between the two polymers, the interaction parameter, and the chemical structure. We demonstrate that these broad, extended Tg(z) length scales appear to be universal across these different systems but show that the strong dynamical coupling across the dissimilar polymer-polymer interface only occurs when this interface has been annealed to equilibrium. We consider why dissimilar polymer-polymer interfaces exhibit continuous local dynamics across the interface in contrast to polymer-free surface, polymer-substrate, or polymer-liquid interfaces that show discontinuous local dynamics.

  11. Structural modification through pressurized sub-Tg annealing of metallic glasses

    Science.gov (United States)

    Foroughi, A.; Ashuri, H.; Tavakoli, R.; Stoica, M.; Şopu, D.; Eckert, J.

    2017-12-01

    The atomic structure of metallic glasses (MGs) plays an important role in their physical and mechanical properties. Numerous molecular dynamics (MD) simulations have been performed to reveal the structure of MGs at the atomic scale. However, the cooling rates utilized in most of the MD simulations (usually on the order of 109-1012 K/s) are too high to allow the structure to relax into the actual structures. In this study, we performed long-term pressurized sub-Tg annealing for up to 1 μs using MD simulation to systematically study the structure evolution of Cu50Zr50 MG. We find that from relaxation to rejuvenation, structural excitation of MGs and transition during sub-Tg annealing depend on the level of hydrostatic pressure. At low hydrostatic pressures, up to 2 GPa in this alloy, the relaxation rate increases with the increasing pressure. The lowest equivalent cooling rate reaches 3.3 × 106 K/s in the sample annealed at 2 GPa hydrostatic pressure, which is in the order of the cooling rate in melt spinning experiments. Higher pressures retard the relaxation rate or even rejuvenate the sample. Structural relaxation at low hydrostatic pressure during sub-Tg annealing is governed by short-range atomic rearrangements through annihilation of free volume and anti-free volume defects. In contrast, at high hydrostatic pressures, most of the atoms just experience thermal vibration rather than real atomic jumps. The formation of anti-free volume defects is the main source of structural instability at the high pressure region.

  12. Instability of the insertional mutation in CftrTgH(neoimHgu cystic fibrosis mouse model

    Directory of Open Access Journals (Sweden)

    Dorin Julia R

    2004-04-01

    Full Text Available Abstract Background A major boost to the cystic fibrosis disease research was given by the generation of various mouse models using gene targeting in embryonal stem cells. Moreover, the introduction of the same mutation on different inbred strains generating congenic strains facilitated the search for modifier genes. From the original CftrTgH(neoimHgu CF mouse model we have generated using strict brother × sister mating two inbred CftrTgH(neoimHgu mouse lines (CF/1 and CF/3. Thereafter, the insertional mutation was introgressed from CF/3 into three inbred backgrounds (C57BL/6, BALB/c, DBA/2J generating congenic animals. In every backcross cycle germline transmission of the insertional mutation was monitored by direct probing the insertion via Southern RFLP. In order to bypass this time consuming procedure we devised an alternative PCR based protocol whereby mouse strains are differentiated at the Cftr locus by Cftr intragenic microsatellite genotypes that are tightly linked to the disrupted locus. Results Using this method we were able to identify animals carrying the insertional mutation based upon the differential haplotypic backgrounds of the three inbred strains and the mutant CftrTgH(neoimHgu at the Cftr locus. Moreover, this method facilitated the identification of the precise vector excision from the disrupted Cftr locus in two out of 57 typed animals. This reversion to wild type status took place without any loss of sequence revealing the instability of insertional mutations during the production of congenic animals. Conclusions We present intragenic microsatellite markers as a tool for fast and efficient identification of the introgressed locus of interest in the recipient strain during congenic animal breeding. Moreover, the same genotyping method allowed the identification of a vector excision event, posing questions on the stability of insertional mutations in mice.

  13. TG haplotype in the LRP8 is associated with myocardial infarction in south Indian population.

    Science.gov (United States)

    Asif, Muhammed; Bhat, Shivarama; Nizamuddin, Sheikh; Mustak, Mohammed S

    2017-10-12

    Myocardial infarction (MI) is a complex multifactorial cardiovascular disease. India experiences a much greater burden of MI, also suggesting an experimental increase of this burden in the future. The absolute reasons for MI are context dependent and differ with different geographical settings. Several reports indicate that SNPs that are associated with certain diseases in other populations may not be associated with Indian population. It is, therefore, important to validate the association of SNPs. Low density lipoprotein receptor related protein 8 (LRP8) gene plays central role in human lipoprotein metabolism as it facilitates the clearance of bad cholesterol LDL, VLDL from plasma and is reported to be associated with MI in the western population. However, this gene has not been studied in the South Indian population. We aim to test the role of the LRP8 gene variants correlating with the lipid profile in MI patients in South Indian population. We sequenced regions of SNPs rs10788952, rs7546246, rs2297660 and rs5174 of LRP8 in 100 MI patients and 100 age-matched controls. Our result revealed a total of 4 variations. None of the SNPs were significantly associated with MI (p>0.973). Interestingly, haplotype based association analysis showed TG and CG of rs10788952 and rs7546246 significantly associated with MI (p<0.01 and p<0.00005) and in particular, haplotype TG was positively correlated with the risk of MI, as this increased the LDL and total cholesterol level in MI patients in south Indians. Our results suggest that haplotype TG is a risk factor for MI in South Indian population. Copyright © 2017. Published by Elsevier B.V.

  14. Follow-up of patients with thyroglobulin-antibodies: Rising Tg-Ab trend is a risk factor for recurrence of differentiated thyroid cancer.

    Science.gov (United States)

    de Meer, Siegrid G A; Vorselaars, Wessel M C M; Kist, Jakob W; Stokkel, Marcel P M; de Keizer, Bart; Valk, Gerlof D; Borel Rinkes, Inne H M; Vriens, Menno R

    2017-11-01

    Differentiated thyroid cancer is the most common endocrine malignancy. Recurrences (5-20%) are the main reason for follow-up. Thyroglobulin (Tg) has proven to be an excellent disease marker, but thyroglobulin-antibodies (Tg-Ab) may interfere with Tg measurement, leading to over or underestimation. It is proposed that the Tg-Ab trend can be used as a marker for disease recurrence, yet few studies define trend and have a long-term follow-up. The objective of our study was to investigate the value of a well-defined Tg-Ab trend as a surrogate marker for disease recurrence during long-term follow-up. We retrospectively studied patients treated at the Nuclear Department of the University Medical Center Utrecht from 1998 to 2010 and the Netherlands Cancer Institute from 2000 to 2009. All patients with Tg-Ab 12 months after treatment were included. The definition of a rise was >50% increase of the Tg-Ab value in a 2 year time period. A decline as >50% decrease of the Tg-Ab value. Twenty-five patients were included. None of the patients with declining or stable Tg-Ab without a concomitant rise in Tg developed a recurrence. Four patients did suffer a recurrence. Three of these patients had a rising Tg-Ab trend, in two of these patients Tg was undetectable. Tg-Ab trend can be used as a crude surrogate marker for long-term follow-up of Tg-Ab patients. A rising trend in Tg-Ab warrants further investigation to detect recurrent disease. Stable or declining Tg-Ab levels do not seem to reflect a risk for recurrence.

  15. Drosophila TG-A transglutaminase is secreted via an unconventional Golgi-independent mechanism involving exosomes and two types of fatty acylations.

    Science.gov (United States)

    Shibata, Toshio; Hadano, Jinki; Kawasaki, Daichi; Dong, Xiaoqing; Kawabata, Shun-Ichiro

    2017-06-23

    Transglutaminases (TGs) play essential intracellular and extracellular roles by covalently cross-linking many proteins. Drosophila TG is encoded by one gene and has two alternative splicing-derived isoforms, TG-A and TG-B, which contain distinct N-terminal 46- and 38-amino acid sequences, respectively. The TGs identified to date do not have a typical endoplasmic reticulum (ER)-signal peptide, and the molecular mechanisms of their secretion under physiologic conditions are unclear. Immunocytochemistry revealed that TG-A localizes to multivesicular-like structures, whereas TG-B localizes to the cytosol. We also found that TG-A, but not TG-B, was modified concomitantly by N-myristoylation and S-palmitoylation, and N-myristoylation was a pre-requisite for S-palmitoylation. Moreover, TG-A, but not TG-B, was secreted in response to calcium signaling induced by Ca(2+) ionophores and uracil, a pathogenic bacteria-derived substance. Brefeldin A and monensin, inhibitors of the ER/Golgi-mediated conventional pathway, did not suppress TG-A secretion, whereas inhibition of S-palmitoylation by 2-bromopalmitate blocked TG-A secretion. Ultracentrifugation, electron microscopy analyses, and treatments with inhibitors of multivesicular body formation revealed that TG-A was secreted via exosomes together with co-transfected mammalian CD63, an exosomal marker, and the secreted TG-A was taken up by other cells. The 8-residue N-terminal fragment of TG-A containing the fatty acylation sites was both necessary and sufficient for the exosome-dependent secretion of TG-A. In conclusion, TG-A is secreted through an unconventional ER/Golgi-independent pathway involving two types of fatty acylations and exosomes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Guidance for Classifying Studies Conducted Using the OECD Test Guideline 223 (TG223) (Acute Avian Oral Sequential Dose Study)

    Science.gov (United States)

    Guidance based on comparison of results from the TG223 validation studies to results from avian acute oral studies previously submitted to EPA for two test chemicals following EPA's 850.2100 (public draft) guidelines.

  17. WE-F-201-02: Review TG-186 and WGMBDCA Guidelines, Commission Process, and Dosimetry Benchmarks

    Energy Technology Data Exchange (ETDEWEB)

    Rivard, M. [Tufts University School of Medicine, Boston, MA (United States)

    2015-06-15

    With the recent introduction of heterogeneity correction algorithms for brachytherapy, the AAPM community is still unclear on how to commission and implement these into clinical practice. The recently-published AAPM TG-186 report discusses important issues for clinical implementation of these algorithms. A charge of the AAPM-ESTRO-ABG Working Group on MBDCA in Brachytherapy (WGMBDCA) is the development of a set of well-defined test case plans, available as references in the software commissioning process to be performed by clinical end-users. In this practical medical physics course, specific examples on how to perform the commissioning process are presented, as well as descriptions of the clinical impact from recent literature reporting comparisons of TG-43 and heterogeneity-based dosimetry. Learning Objectives: Identify key clinical applications needing advanced dose calculation in brachytherapy. Review TG-186 and WGMBDCA guidelines, commission process, and dosimetry benchmarks. Evaluate clinical cases using commercially available systems and compare to TG-43 dosimetry.

  18. Download - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available chments Open-tggates_AllAttribute.zip (1.8 MB) Simple search and download Downlaod via FTP FTP server is som... English ]; } else { document.getElementById(lang).innerHTML= '[ Japanese | English ]'; } } window.onload = ...List Contact us Open TG-GATEs Download First of all, please read the license of this database. Data names an...d data descriptions are about the downloadable data in this page. They might not correspond to the contents ...of the original database. Click the links on Data Name for descriptions of the data. # Data name File Simple search and dow

  19. License - Open TG-GATEs | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Open TG-GATEs License License to Use This Database Last updated : 2012/05/24 You may use this database...scribed below. The Standard License specifies the license terms regarding the use of this database and the r...equirements you must follow in using this database. The Additional License specif...icense. Standard License The Standard License for this database is the license specified in the Creative Com...mons Attribution-Share Alike 2.1 Japan . If you use data from this database, plea

  20. Vibration of a steam turbo-generator (TG) set during shutdown period

    OpenAIRE

    Sinha, Jyoti; Hahn, W; Elbhbah, Keri; Obi-Mgbam, Kelechi G.

    2016-01-01

    The steam turbo-generator (TG) sets in power plants during the shutdown period often operate at a very low speed with the aid of barring gear. This low speed is known as the barring speed and it is of the order upto 100 RPM. The purpose is to float the rotor in the fluid bearings so that the rotor heavy self-weight should not cause any damage to the bearings. The barring speed also maintains uniformity of temperature across the complete rotor when cooling down from operating condition to norm...

  1. Increased hippocampal excitability in the 3xTgAD mouse model for Alzheimer's disease in vivo.

    Directory of Open Access Journals (Sweden)

    Katherine E Davis

    Full Text Available Mouse Alzheimer's disease (AD models develop age- and region-specific pathology throughout the hippocampal formation. One recently established pathological correlate is an increase in hippocampal excitability in vivo. Hippocampal pathology also produces episodic memory decline in human AD and we have shown a similar episodic deficit in 3xTg AD model mice aged 3-6 months. Here, we tested whether hippocampal synaptic dysfunction accompanies this cognitive deficit by probing dorsal CA1 and DG synaptic responses in anaesthetized, 4-6 month-old 3xTgAD mice. As our previous reports highlighted a decline in episodic performance in aged control mice, we included aged cohorts for comparison. CA1 and DG responses to low-frequency perforant path stimulation were comparable between 3xTgAD and controls at both age ranges. As expected, DG recordings in controls showed paired-pulse depression; however, paired-pulse facilitation was observed in DG and CA1 of young and old 3xTgAD mice. During stimulus trains both short-latency (presumably monosynaptic: 'direct' and long-latency (presumably polysynaptic: 're-entrant' responses were observed. Facilitation of direct responses was modest in 3xTgAD animals. However, re-entrant responses in DG and CA1 of young 3xTgAD mice developed earlier in the stimulus train and with larger amplitude when compared to controls. Old mice showed less DG paired-pulse depression and no evidence for re-entrance. In summary, DG and CA1 responses to low-frequency stimulation in all groups were comparable, suggesting no loss of synaptic connectivity in 3xTgAD mice. However, higher-frequency activation revealed complex change in synaptic excitability in DG and CA1 of 3xTgAD mice. In particular, short-term plasticity in DG and CA1 was facilitated in 3xTgAD mice, most evidently in younger animals. In addition, re-entrance was facilitated in young 3xTgAD mice. Overall, these data suggest that the episodic-like memory deficit in 3xTgAD mice

  2. A generic high-dose rate {sup 192}Ir brachytherapy source for evaluation of model-based dose calculations beyond the TG-43 formalism

    Energy Technology Data Exchange (ETDEWEB)

    Ballester, Facundo, E-mail: Facundo.Ballester@uv.es [Department of Atomic, Molecular and Nuclear Physics, University of Valencia, Burjassot 46100 (Spain); Carlsson Tedgren, Åsa [Department of Medical and Health Sciences (IMH), Radiation Physics, Faculty of Health Sciences, Linköping University, Linköping SE-581 85, Sweden and Department of Medical Physics, Karolinska University Hospital, Stockholm SE-171 76 (Sweden); Granero, Domingo [Department of Radiation Physics, ERESA, Hospital General Universitario, Valencia E-46014 (Spain); Haworth, Annette [Department of Physical Sciences, Peter MacCallum Cancer Centre and Royal Melbourne Institute of Technology, Melbourne, Victoria 3000 (Australia); Mourtada, Firas [Department of Radiation Oncology, Helen F. Graham Cancer Center, Christiana Care Health System, Newark, Delaware 19713 (United States); Fonseca, Gabriel Paiva [Instituto de Pesquisas Energéticas e Nucleares – IPEN-CNEN/SP, São Paulo 05508-000, Brazil and Department of Radiation Oncology (MAASTRO), GROW, School for Oncology and Developmental Biology, Maastricht University Medical Center, Maastricht 6201 BN (Netherlands); Zourari, Kyveli; Papagiannis, Panagiotis [Medical Physics Laboratory, Medical School, University of Athens, 75 MikrasAsias, Athens 115 27 (Greece); Rivard, Mark J. [Department of Radiation Oncology, Tufts University School of Medicine, Boston, Massachusetts 02111 (United States); Siebert, Frank-André [Clinic of Radiotherapy, University Hospital of Schleswig-Holstein, Campus Kiel, Kiel 24105 (Germany); Sloboda, Ron S. [Department of Medical Physics, Cross Cancer Institute, Edmonton, Alberta T6G 1Z2, Canada and Department of Oncology, University of Alberta, Edmonton, Alberta T6G 2R3 (Canada); and others

    2015-06-15

    Purpose: In order to facilitate a smooth transition for brachytherapy dose calculations from the American Association of Physicists in Medicine (AAPM) Task Group No. 43 (TG-43) formalism to model-based dose calculation algorithms (MBDCAs), treatment planning systems (TPSs) using a MBDCA require a set of well-defined test case plans characterized by Monte Carlo (MC) methods. This also permits direct dose comparison to TG-43 reference data. Such test case plans should be made available for use in the software commissioning process performed by clinical end users. To this end, a hypothetical, generic high-dose rate (HDR) {sup 192}Ir source and a virtual water phantom were designed, which can be imported into a TPS. Methods: A hypothetical, generic HDR {sup 192}Ir source was designed based on commercially available sources as well as a virtual, cubic water phantom that can be imported into any TPS in DICOM format. The dose distribution of the generic {sup 192}Ir source when placed at the center of the cubic phantom, and away from the center under altered scatter conditions, was evaluated using two commercial MBDCAs [Oncentra{sup ®} Brachy with advanced collapsed-cone engine (ACE) and BrachyVision ACUROS{sup TM}]. Dose comparisons were performed using state-of-the-art MC codes for radiation transport, including ALGEBRA, BrachyDose, GEANT4, MCNP5, MCNP6, and PENELOPE2008. The methodologies adhered to recommendations in the AAPM TG-229 report on high-energy brachytherapy source dosimetry. TG-43 dosimetry parameters, an along-away dose-rate table, and primary and scatter separated (PSS) data were obtained. The virtual water phantom of (201){sup 3} voxels (1 mm sides) was used to evaluate the calculated dose distributions. Two test case plans involving a single position of the generic HDR {sup 192}Ir source in this phantom were prepared: (i) source centered in the phantom and (ii) source displaced 7 cm laterally from the center. Datasets were independently produced by

  3. A generic high-dose rate (192)Ir brachytherapy source for evaluation of model-based dose calculations beyond the TG-43 formalism.

    Science.gov (United States)

    Ballester, Facundo; Carlsson Tedgren, Åsa; Granero, Domingo; Haworth, Annette; Mourtada, Firas; Fonseca, Gabriel Paiva; Zourari, Kyveli; Papagiannis, Panagiotis; Rivard, Mark J; Siebert, Frank-André; Sloboda, Ron S; Smith, Ryan L; Thomson, Rowan M; Verhaegen, Frank; Vijande, Javier; Ma, Yunzhi; Beaulieu, Luc

    2015-06-01

    In order to facilitate a smooth transition for brachytherapy dose calculations from the American Association of Physicists in Medicine (AAPM) Task Group No. 43 (TG-43) formalism to model-based dose calculation algorithms (MBDCAs), treatment planning systems (TPSs) using a MBDCA require a set of well-defined test case plans characterized by Monte Carlo (MC) methods. This also permits direct dose comparison to TG-43 reference data. Such test case plans should be made available for use in the software commissioning process performed by clinical end users. To this end, a hypothetical, generic high-dose rate (HDR) (192)Ir source and a virtual water phantom were designed, which can be imported into a TPS. A hypothetical, generic HDR (192)Ir source was designed based on commercially available sources as well as a virtual, cubic water phantom that can be imported into any TPS in DICOM format. The dose distribution of the generic (192)Ir source when placed at the center of the cubic phantom, and away from the center under altered scatter conditions, was evaluated using two commercial MBDCAs [Oncentra(®) Brachy with advanced collapsed-cone engine (ACE) and BrachyVision ACUROS™ ]. Dose comparisons were performed using state-of-the-art MC codes for radiation transport, including ALGEBRA, BrachyDose, GEANT4, MCNP5, MCNP6, and PENELOPE2008. The methodologies adhered to recommendations in the AAPM TG-229 report on high-energy brachytherapy source dosimetry. TG-43 dosimetry parameters, an along-away dose-rate table, and primary and scatter separated (PSS) data were obtained. The virtual water phantom of (201)(3) voxels (1 mm sides) was used to evaluate the calculated dose distributions. Two test case plans involving a single position of the generic HDR (192)Ir source in this phantom were prepared: (i) source centered in the phantom and (ii) source displaced 7 cm laterally from the center. Datasets were independently produced by different investigators. MC results were then

  4. Environmental enrichment does not influence hypersynchronous network activity in the Tg2576 mouse model of Alzheimer’s disease

    Directory of Open Access Journals (Sweden)

    Charlotte eBezzina

    2015-09-01

    Full Text Available The cognitive reserve hypothesis claims that the brain can overcome pathology by reinforcing preexistent processes or by developing alternative cognitive strategies. Epidemiological studies have revealed that this reserve can be built throughout life experiences as education or leisure activities. We previously showed that an early transient environmental enrichment durably improves memory performances in the Tg2576 mouse model of Alzheimer’s disease. Recently, we evidenced a hypersynchronous brain network activity in young adult Tg2576 mice. As aberrant oscillatory activity can contribute to memory deficits, we wondered whether the long-lasting memory improvements observed after environmental enrichment were associated with a reduction of neuronal network hypersynchrony. Thus, we exposed non-transgenic and Tg2576 mice to standard or enriched housing conditions for 10 weeks, starting at 3 months of age. Two weeks after environmental enrichment period, Tg2576 mice presented similar seizure susceptibility to a GABA receptor antagonist. Immediately after and two weeks after this enrichment period, standard and enriched-housed Tg2576 mice did not differ with regards to the frequency of interictal spikes on their electroencephalographic recordings. Thus, the long-lasting effect of this environmental enrichment protocol on memory capacities in Tg2576 mice is not mediated by a reduction of their cerebral aberrant neuronal activity at early ages.

  5. Association of adiponectin gene polymorphism 45TG with gestational diabetes mellitus diagnosed on the new IADPSG criteria, plasma adiponectin levels and adverse pregnancy outcomes.

    Science.gov (United States)

    Han, Yun; Zheng, Yan-li; Fan, Yu-ping; Liu, Man-hua; Lu, Xiao-yan; Tao, Qian

    2015-02-01

    The aim of this study was to identify the association of adiponectin gene single nucleotide polymorphism (SNP) 45TG with gestational diabetes mellitus (GDM) diagnosed on the new International Diabetes in Pregnancy Consensus Group (IADPSG) criteria, plasma adiponectin levels and adverse pregnancy outcomes in Han women of Nantong area in China. This cross-sectional study included 128 pregnant women with GDM (GDM group) and 140 pregnant women with normal glucose tolerance (NGT group) according to oral glucose tolerance test results based on the new IADPSG criteria. The GDM pregnant women were treated by diet control or diet control and insulin injection. All pregnant women attended antenatal cares and were recorded until delivery. Adiponectin gene was amplified through PCR, and SNP was detected using restriction enzyme SmaI. Plasma adiponectin levels were measured by ELISA. The G allele and TG+GG genotype were significantly more frequent than the T allele in the GDM group than in the NGT group (p criteria, the adiponectin SNP45 may be closely correlated with the prevalence of GDM in Han women of Nantong area in China, and the allele +45G in adiponectin gene might be associated with reduced plasma adiponectin levels and adverse pregnancy outcomes.

  6. Electrochemical magneto immunosensor for the detection of anti-TG2 antibody in celiac disease.

    Science.gov (United States)

    Kergaravat, Silvina V; Beltramino, Luis; Garnero, Nidia; Trotta, Liliana; Wagener, Marta; Isabel Pividori, Maria; Hernandez, Silvia R

    2013-10-15

    An electrochemical magneto immunosensor for the detection of anti-transglutaminase antibodies (ATG2) in celiac disease was developed. The immunological reaction is performed on magnetic beads (MBs) as a solid support in which the transglutaminase enzyme (TG2) is covalently immobilized (TG2-MB) and then ATG2 were revealed by an antibody labeled with peroxidase. The electrochemical response of the enzymatic reaction with o-phenilendiamine and H₂O₂ as substrates by square wave voltammetry was correlated with the ATG2. Graphite-epoxi composite cylindrical electrodes and screen printed electrodes were used as transducers in the immunosensor. A total number of 29 sera from clinically confirmed cases of celiac disease and 19 negative control sera were tested by the electrochemical magneto immunosensor. The data were submitted to the receiver-operating characteristic plot (ROC) analysis which indicated that 16.95 units was the most effective cut-off value (COV) to discriminate correctly between celiac and non-celiac patients. Using this point for prediction, sensitivity was found to be 100%, while specificity was 84%. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Does fragility of glass formation determine the strength of Tg-nanoconfinement effects?

    Science.gov (United States)

    Mangalara, Jayachandra Hari; Marvin, Michael D.; Wiener, Nicholas R.; Mackura, Mark E.; Simmons, David S.

    2017-03-01

    Nanoscale confinement has been shown to alter the glass transition and associated mechanical and transport properties of glass-forming materials. Inspired by expected interrelations between nanoconfinement effects, cooperative dynamics in supercooled liquids, and the "fragility" (or temperature-abruptness) of the glass transition, it is commonly expected that nanoconfinement effects on Tg should be more pronounced for more fragile glass formers. Here we employ molecular dynamics simulations of glass formation in the bulk and under nanoconfinement of model polymers in which we systematically tune fragility by several routes. Results indicate that a correlation between fragility and the strength of nanoconfinement effects is weak to modest at best when considering all systems but can appear to be stronger when considering a subset of systems. This outcome is consistent with a reanalysis of the Adam-Gibbs theory of glass formation indicating that fragility does not necessarily track in a universal way with the scale of cooperative motion in glass-forming liquids. Finally, we find that factors such as composition gradients or variability in measurement sensitivity to different parts of the dynamic gradient have the potential to significantly confound efforts to identify trends in Tg-nanoconfinement effects with variables such as fragility, emphasizing the importance of employing diverse data sets and multiple metrologies in the study of this problem.

  8. Gender-Specific Neuroimmunoendocrine Response to Treadmill Exercise in 3xTg-AD Mice

    Directory of Open Access Journals (Sweden)

    Lydia Giménez-Llort

    2010-01-01

    Full Text Available The 3xTg-AD mouse develops a progressive Alzheimer's disease- (AD- like brain pathology that causes cognitive- and neuropsychiatric-like symptoms of dementia. Since its neuroimmunoendocrine axis is likewise impaired, this mouse is also useful for modelling complex age-related neurodegeneration. This study analyzed behavioral, physiological, neurochemical, pathological and immunoendocrine alterations in male and female 3xTg-AD mice and assayed the effects of a short therapy of forced physical exercise at the moderate pathology stage of 6 months of age. Gender effects were observed in most AD-related pathology and dysfunctions. Five weeks of treadmill training produced beneficial effects, such as the reduction of brain oxidative stress and GABA-A receptor dysfunction in males and improvement of sensorimotor function in females. In both sexes, exercise decreased the brain amyloid 42/40 ratio levels. The results highlight the importance of analyzing experimental therapies in both mouse model genders in order to improve our understanding of the disease and develop more appropriate therapies.

  9. SU-F-P-15: Report On AAPM TG 178 Gamma Knife Dosimetry and Quality Assurance

    Energy Technology Data Exchange (ETDEWEB)

    Goetsch, S [San Diego Medical Physics, Solana Beach, CA (United States)

    2016-06-15

    Purpose: AAPM Task Group 178 Gamma Stereotactic Radiosurgery Dosimetry and Quality Assurance was formed in August, 2008. The Task Group has 12 medical physicists, two physicians and two consultants. Methods: A round robin dosimetry intercomparison of proposed ionization chambers, electrometer and dosimetry phantoms was conducted over a 15 month period in 2011 and 2012 (Med Phys 42, 11, Nov, 2015). The data obtained at 9 institutions (with ten different Elekta Gamma Knife units) was analyzed by the lead author using several protocols. Results: The most consistent results were obtained using the Elekta ABS 16cm diameter phantom, with the TG-51 protocol modified as recommended by Alfonso et al (Med Phys 35, 11, Nov 2008). A key white paper (Med Phys, in press) sponsored by Elekta Corporation, was used to obtain correction factors for the ionization chambers and phantoms used in this intercomparison. Consistent results were obtained for both Elekta Gamma Knife Model 4C and Gamma Knife Perfexion units as measured with each of two miniature ionization chambers Conclusion: The full TG 178 report gives clinical history and background of gamma stereotactic radiosurgery, clinical examples and history, quality assurance recommendations and outline of possible dosimetry protocols. The report will be reviewed by the AAPM Working Group on Recommendations for Radiotherapy External Beam Quality Assurance and then by the AAPM Science Council before publication in Medical Physics. Consultant to Elekta, Inc.

  10. Gender-Specific Neuroimmunoendocrine Response to Treadmill Exercise in 3xTg-AD Mice.

    Science.gov (United States)

    Giménez-Llort, Lydia; García, Yoelvis; Buccieri, Karla; Revilla, Susana; Suñol, Cristina; Cristofol, Rosa; Sanfeliu, Coral

    2010-10-12

    The 3xTg-AD mouse develops a progressive Alzheimer's disease- (AD-) like brain pathology that causes cognitive- and neuropsychiatric-like symptoms of dementia. Since its neuroimmunoendocrine axis is likewise impaired, this mouse is also useful for modelling complex age-related neurodegeneration. This study analyzed behavioral, physiological, neurochemical, pathological and immunoendocrine alterations in male and female 3xTg-AD mice and assayed the effects of a short therapy of forced physical exercise at the moderate pathology stage of 6 months of age. Gender effects were observed in most AD-related pathology and dysfunctions. Five weeks of treadmill training produced beneficial effects, such as the reduction of brain oxidative stress and GABA-A receptor dysfunction in males and improvement of sensorimotor function in females. In both sexes, exercise decreased the brain amyloid β 42/40 ratio levels. The results highlight the importance of analyzing experimental therapies in both mouse model genders in order to improve our understanding of the disease and develop more appropriate therapies.

  11. Cheese whey protein recovery by ultrafiltration through transglutaminase (TG) catalysis whey protein cross-linking.

    Science.gov (United States)

    Wen-Qiong, Wang; Lan-Wei, Zhang; Xue, Han; Yi, Lu

    2017-01-15

    In whey ultrafiltration (UF) production, two main problems are whey protein recovery and membrane fouling. In this study, membrane coupling protein transglutaminase (TG) catalysis protein cross-linking was investigated under different conditions to find out the best treatment. We found that the optimal conditions for protein recovery involved catalyzing whey protein cross-linking with TG (40U/g whey proteins) at 40°C for 60min at pH 5.0. Under these conditions, the recovery rate was increased 15-20%, lactose rejection rate was decreased by 10%, and relative permeate flux was increase 30-40% compared to the sample without enzyme treatment (control). It was noticeable that the total resistance and cake resistance were decreased after enzyme catalysis. This was mainly due to the increased particle size and decreased zeta potential. Therefore, membrane coupling enzyme catalysis protein cross-linking is a potential means for further use. Copyright © 2016. Published by Elsevier Ltd.

  12. Tissue Transglutaminase (TG2)-Induced Inflammation in Initiation, Progression, and Pathogenesis of Pancreatic Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Mehta, Kapil, E-mail: kmehta@mdanderson.org; Han, Amy [Department of Experimental Therapeutics, The University of Texas M. D. Anderson Cancer Center, Houston, TX 77030 (United States); Graduate School of Biomedical Sciences, The University of Texas Health Science Center, Houston, TX 77030 (United States)

    2011-02-25

    Pancreatic cancer (PC) is among the deadliest cancers, with a median survival of six months. It is generally believed that infiltrating PC arises through the progression of early grade pancreatic intraepithelial lesions (PanINs). In one model of the disease, the K-ras mutation is an early molecular event during progression of pancreatic cancer; it is followed by the accumulation of additional genetic abnormalities. This model has been supported by animal studies in which activated K-ras and p53 mutations produced metastatic pancreatic ductal adenocarcinoma in mice. According to this model, oncogenic K-ras induces PanIN formation but fails to promote the invasive stage. However, when these mice are subjected to caerulein treatment, which induces a chronic pancreatitis-like state and inflammatory response, PanINs rapidly progress to invasive carcinoma. These results are consistent with epidemiologic studies showing that patients with chronic pancreatitis have a much higher risk of developing PC. In line with these observations, recent studies have revealed elevated expression of the pro-inflammatory protein tissue transglutaminase (TG2) in early PanINs, and its expression increases even more as the disease progresses. In this review we discuss the implications of increased TG2 expression in initiation, progression, and pathogenesis of pancreatic cancer.

  13. Peripheral treatment with enoxaparin exacerbates amyloid plaque pathology in Tg2576 mice.

    Science.gov (United States)

    Cui, Hao; King, Anna E; Jacobson, Glenn A; Small, David H

    2017-04-01

    Alzheimer's disease (AD) is a complex, progressive neurological disorder characterized by the formation of extracellular amyloid plaques composed of β-amyloid protein (Aβ), the key component in pathogenesis of AD. Peripheral administration of enoxaparin (ENO) reportedly reduces the level of Aβ and the amyloid plaques in the cortex of amyloid precursor protein (APP) transgenic mice. However, the exact mechanism of these effects is unclear. Our previous studies indicated that ENO can inhibit APP processing to Aβ in primary cortical cells from Tg2576 mice by downregulating BACE1 levels. This study examines whether ENO-induced reduction of amyloid load is due to the decreased APP processing to Aβ in Tg2576 mice. Surprisingly, our results indicated that ENO significantly increases the Aβ42/Aβ40 ratio in cortex and enhances the amyloid plaque load in both cortex and hippocampus, although overall APP processing was not influenced by ENO. Moreover, ENO stimulated the aggregation of both Aβ40 and Aβ42 in vitro. Although ENO has been reported to improve cognition in vivo and has potential as a therapeutic agent for AD, the results from our study suggest that ENO can exacerbate the amyloid pathology, and the strategy of using ENO for the treatment of AD may require further assessment. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Cystatin C, CRP, log TG/HDLc and metabolic syndrome are associated with microalbuminuria in hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Moura, Rafaela do Socorro Souza e Silva [Pós-Graduação em Ciências Médicas, Faculdade de Medicina, Universidade de Brasília, Brasília, DF (Brazil); Vasconcelos, Daniel França [Área de Cardiologia, Faculdade de Medicina, Universidade de Brasília, Brasília, DF (Brazil); Freitas, Eduardo [Departamento de Estatística, Universidade de Brasília, Brasília, DF (Brazil); Moura, Flavio José Dutra de; Rosa, Tânia Torres; Veiga, Joel Paulo Russomano, E-mail: joelprv@unb.br [Área de Clínica Médica, Nefrologia, Faculdade de Medicina, Universidade de Brasília, Brasília, DF (Brazil)

    2014-01-15

    In patients with systemic hypertension, microalbuminuria is a marker of endothelial damage and is associated with an increased risk for cardiovascular disease. To determine the factors that may lead to the occurrence of microalbuminuria in hypertensive patients with serum creatinine lower than 1.5 mg/dL. This cross-sectional study included 133 Brazilians with essential hypertension followed up at a hypertension outpatient clinic. Those with serum creatinine higher than 1.5 mg/dL, as well as those with diabetes mellitus, were excluded. Systolic and diastolic blood pressures were measured, and body mass index (BMI) and GFR estimated by using the CKD-EPI formula were calculated. The serum levels of the following were assessed: CysC, creatinine, total cholesterol, HDL cholesterol, LDL cholesterol, triglycerides, C-reactive protein (CRP) and fasting glucose. Microalbuminuria was determined in 24-hour urine. Hypertensive patients were classified according to the presence of one or more criteria for metabolic syndrome. In a multiple regression analysis, the serum levels of CysC and CRP, the atherogenic index log TG/HDLc and the presence of three or more criteria for metabolic syndrome were positively correlated with microalbuminuria (r{sup 2}: 0.277, p < 0.05). CysC, CRP, log TG/HDLc, and the presence of three or more criteria for metabolic syndrome, regardless of serum creatinine, were associated with microalbuminuria, an early marker of kidney damage and cardiovascular risk in patients with essential hypertension.

  15. TG-43 U1 based dosimetric characterization of model 67-6520 Cs-137 brachytherapy source

    Energy Technology Data Exchange (ETDEWEB)

    Meigooni, Ali S.; Wright, Clarissa; Koona, Rafiq A.; Awan, Shahid B.; Granero, Domingo; Perez-Calatayud, Jose; Ballester, Facundo [Department of Radiation Medicine, North Shore University Hospital, 300 Community Drive, Manhasset, New York 11030 and Department of Radiation Medicine, University of Kentucky Chandler Medical Center, Lexington, Kentucky 40536-0084 (United States); Department of Radiation Medicine, University of Kentucky Chandler Medical Center, Lexington, Kentucky 40536-0084 (United States); Department of Radiation Physics, ERESA, Hospital General Universitario, Avenida Tres Cruces, 2, E-46014 Valencia (Spain); Department of Oncology, Physics Section, ' ' La Fe' ' University Hospital, Avenida Campanar 21, E-46009 Valencia (Spain); Department of Atomic, Molecular and Nuclear Physics, University of Valencia, C/ Dr. Moliner 50, E-46100 Burjassot, Spain and Instituto de Fisica Corpuscular (IFIC), C/ Dr. Moliner 50, E-46100 Burjassot (Spain)

    2009-10-15

    Purpose: Brachytherapy treatment has been a cornerstone for management of various cancer sites, particularly for the treatment of gynecological malignancies. In low dose rate brachytherapy treatments, {sup 137}Cs sources have been used for several decades. A new {sup 137}Cs source design has been introduced (model 67-6520, source B3-561) by Isotope Products Laboratories (IPL) for clinical application. The goal of the present work is to implement the TG-43 U1 protocol in the characterization of the aforementioned {sup 137}Cs source. Methods: The dosimetric characteristics of the IPL {sup 137}Cs source are measured using LiF thermoluminescent dosimeters in a Solid Water phantom material and calculated using Monte Carlo simulations with the GEANT4 code in Solid Water and liquid water. The dose rate constant, radial dose function, and two-dimensional anisotropy function of this source model were obtained following the TG-43 U1 recommendations. In addition, the primary and scatter dose separation (PSS) formalism that could be used in convolution/superposition methods to calculate dose distributions around brachytherapy sources in heterogeneous media was studied. Results: The measured and calculated dose rate constants of the IPL {sup 137}Cs source in Solid Water were found to be 0.930({+-}7.3%) and 0.928({+-}2.6%) cGy h{sup -1} U{sup -1}, respectively. The agreement between these two methods was within our experimental uncertainties. The Monte Carlo calculated value in liquid water of the dose rate constant was {Lambda}=0.948({+-}2.6%) cGy h{sup -1} U{sup -1}. Similarly, the agreement between measured and calculated radial dose functions and the anisotropy functions was found to be within {+-}5%. In addition, the tabulated data that are required to characterize the source using the PSS formalism were derived. Conclusions: In this article the complete dosimetry of the newly designed {sup 137}Cs IPL source following the AAPM TG-43 U1 dosimetric protocol and the PSS

  16. Association between MDM2 SNP309 T>G polymorphism and the risk of bladder cancer: new data in a Chinese population and an updated meta-analysis

    Directory of Open Access Journals (Sweden)

    Xie LG

    2015-12-01

    Full Text Available Linguo Xie,1,2,* Yan Sun,2,* Tao Chen,1,2,* Dawei Tian,1,2 Yujuan Li,3 Yu Zhang,1,2 Na Ding,2 Zhonghua Shen,1,2 Hao Xu,1,2 Xuewu Nian,4 Nan Sha,1,2 Ruifa Han,1,2 Hailong Hu,1,2 Changli Wu1,2 Objective: Human murine double minute 2 protein (MDM2 is mainly a negative regulator of p53 tumor suppressor pathway. We aimed to investigate the association between MDM2 SNP309 polymorphism and bladder cancer risk. Methods: A total of 535 bladder cancer patients and 649 health controls were recruited for our study. MDM2 SNP309 T>G polymorphism was genotyped by polymerase chain reaction-ligase detection reaction method. Logistic regression was used to analyze the relationship between the genotype and susceptibility of bladder cancer. Kaplan–Meier estimates and log-rank test were obtained to analyze the association between the genotype and risk of recrudesce in nonmuscle-invasive bladder cancer patients. A multivariable Cox proportional hazards model was fitted to identify independent prognostic factors. To further investigate the association, we conducted a meta-analysis including six studies. Results: The frequency of the MDM2 SNP309 T>G polymorphism showed no significant difference between cases and controls (all P>0.05. In the stratification analysis, the results showed that G allele carriers were prone to have a significant decrease in risk of low-grade bladder cancer (adjusted odds ratio: 0.613, 95% confidence interval: 0.427–0.881, and G variant was associated with a significantly reduced risk of recurrence in nonmuscle-invasive bladder cancer patients with or without chemotherapy (P<0.05. The results of the meta-analysis showed that G allele and GG genotype of MDM2 SNP309 polymorphism were significantly associated with increased risk of bladder cancer in Caucasians (both P<0.05, and no association was observed in total populations and Asians (P>0.05. Conclusion: MDM2 SNP309 T>G polymorphism has no influence on bladder cancer risk in Asians, but

  17. Solid-phase microextraction for bioconcentration studies according to OECD TG 305

    Energy Technology Data Exchange (ETDEWEB)

    Duering, Rolf-Alexander; Boehm, Leonard [Land Use and Nutrition (IFZ) Justus Liebig University Giessen, Institute of Soil Science and Soil Conservation, Research Centre for BioSystems, Giessen (Germany); Schlechtriem, Christian [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Schmallenberg (Germany)

    2012-12-15

    An important aim of the European Community Regulation on chemicals and their safe use is the identification of (very) persistent, (very) bioaccumulative, and toxic substances. In other regulatory chemical safety assessments (pharmaceuticals, biocides, pesticides), the identification of such (very) persistent, (very) bioaccumulative, and toxic substances is of increasing importance. Solid-phase microextraction is especially capable of extracting total water concentrations as well as the freely dissolved fraction of analytes in the water phase, which is available for bioconcentration in fish. However, although already well established in environmental analyses to determine and quantify analytes mainly in aqueous matrices, solid-phase microextraction is still a rather unusual method in regulatory ecotoxicological research. Here, the potential benefits and drawbacks of solid-phase microextraction are discussed as an analytical routine approach for aquatic bioconcentration studies according to OECD TG 305, with a special focus on the testing of hydrophobic organic compounds characterized by log K{sub OW}> 5. (orig.)

  18. Synthesis, characterization and TG-DSC study of cadmium halides adducts with caffeine

    Energy Technology Data Exchange (ETDEWEB)

    Farias, Robson F. de; Silva, Ademir O. da; Silva, Umberto G. da

    2003-11-28

    The synthesis, characterization and TG-DSC study of the compounds CdX{sub 2}{center_dot}ncaff, for which X: Cl, Br and I; n=1 and 2 and caff: caffeine is reported. It is verified that caffeine is coordinated through more than one coordination site, despite the fact that the nitrogen of the imidazole ring is the main coordination site. The following thermal stability trend is observed: Cl>Br>I and monoadducts are more stable than bisadducts. The thermal degradation (td) enthalpies have the values (kJ mol{sup -1}): 58.2 and 71.5; 74.9 and 91.4; 31.1 and 47.5 for Cl, Br and I mono and bisadducts, respectively.

  19. Chronic Hypertension Leads to Neurodegeneration in the TgSwDI Mouse Model of Alzheimer's Disease.

    Science.gov (United States)

    Kruyer, Anna; Soplop, Nadine; Strickland, Sidney; Norris, Erin H

    2015-07-01

    Numerous epidemiological studies link vascular disorders, such as hypertension, diabetes mellitus, and stroke, with Alzheimer's disease (AD). Hypertension, specifically, is an important modifiable risk factor for late-onset AD. To examine the link between midlife hypertension and the onset of AD later in life, we chemically induced chronic hypertension in the TgSwDI mouse model of AD in early adulthood. Hypertension accelerated cognitive deficits in the Barnes maze test (Phypertension induced hippocampal neurodegeneration at an early age in this mouse line (43% reduction in the dorsal subiculum; P<0.05), establishing this as a useful research model of AD with mixed vascular and amyloid pathologies. © 2015 American Heart Association, Inc.

  20. TG-FTIR-MS (Evolved Gas Analysis) of bidi tobacco powder during combustion and pyrolysis.

    Science.gov (United States)

    Ahamad, Tansir; Alshehri, Saad M

    2012-01-15

    Bidi smoke, a complex mixture of toxic and carcinogens chemicals causes a large and growing number of premature deaths in South Asian countries especially in India and Bangladesh. The evolved products during the thermal degradation of bidi tobacco powder (BTP) have been measured by using TG-FTIR-MS technique. The results revealed that the main gases and volatile products released during the combustion and pyrolysis of BTP are CO, CO(2), NH(3), HCN, NO, isoprene, formaldehyde, acetaldehyde, acrolein, etc. Still others such as nicotine, phenol, polyaromatic hydrocarbon and some tobacco specific nitrosamines are contained in submicron sized solid particles that are suspended in Bidi smoke. The intensity or the quantity of evolved products is higher during the combustion than pyrolysis of BTP. The evolved chemical data suggest that Bidi smoke is responsible for cancer of the throat, oral cavity, pharynx, larynx, lungs, esophagus, stomach, and liver. Copyright © 2011 Elsevier B.V. All rights reserved.

  1. ETS transcription factor ELF5 induces lumen formation in a 3D model of mammary morphogenesis and its expression is inhibited by Jak2 inhibitor TG101348.

    Science.gov (United States)

    Chean, Jennifer; Chen, Charng-Jui; Shively, John E

    2017-10-01

    The loss of expression of a single gene can revert normal tissue to a malignant phenotype. For example, while normal breast has high lumenal expression of CEACAM1, the majority of breast cancers exhibit the early loss of this gene with the concurrent loss of their lumenal phenotype. MCF7 cells that lack CEACAM1 expression and fail to form lumena in 3D culture, regain the normal phenotype when transfected with CEACAM1. In order to probe the mechanism of this gain of function, we treated these cells with the clinically relevant Jak2 inhibitor TG101348 (TG), expecting that disruption of the prolactin receptor signaling pathway would interfere with the positive effects of transfection of MCF7 cells with CEACAM1. Indeed, lumen formation was inhibited, resulting in the down regulation of a set of genes, likely involved in the complex process of lumen formation. As expected, inhibition of the expression of many of these genes also inhibited lumen formation, confirming their involvement in a single pathway. Among the genes identified by the inhibition assay, ETS transcription factor ELF5 stood out, since it has been identified as a master regulator of mammary morphogenesis, and is associated with prolactin receptor signaling. When ELF5 was transfected into the parental MCF7 cells that lack CEACAM1, lumen formation was restored, indicating that ELF5 can replace CEACAM1 in this model system of lumenogenesis. We conclude that the event(s) that led to the loss of expression of CEACAM1 is epistatic in that multiple genes associated with a critical pathway were affected, but that restoration of the normal phenotype can be achieved with reactivation of certain genes at various nodal points in tissue morphogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Quality assurance for image-guided radiation therapy utilizing CT-based technologies: A report of the AAPM TG-179

    Energy Technology Data Exchange (ETDEWEB)

    Bissonnette, Jean-Pierre; Balter, Peter A.; Dong Lei; Langen, Katja M.; Lovelock, D. Michael; Miften, Moyed; Moseley, Douglas J.; Pouliot, Jean; Sonke, Jan-Jakob; Yoo, Sua [Task Group 179, Department of Radiation Physics, Princess Margaret Hospital, University of Toronto, Toronto, Ontario, M5G 2M9 (Canada); Department of Radiation Physics, University of Texas M.D. Anderson Cancer Center, Houston, Texas 77030 (United States); Department of Radiation Oncology, M. D. Anderson Cancer Center Orlando, Orlando, Florida 32806 (United States); Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York 10021 (United States); Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado 80045 (United States); Department of Radiation Physics, Princess Margaret Hospital, University of Toronto, Toronto, Ontario, M5G 2M9 (Canada); Department of Radiation Oncology, UCSF Comprehensive Cancer Center, 1600 Divisadero St., Suite H 1031, San Francisco, California 94143-1708 (United States); Department of Radiation Oncology, Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital, Plesmanlaan 121, 1066 CX Amsterdam (Netherlands); Department of Radiation Oncology, Duke University, Durham, North Carolina 27710 (United States)

    2012-04-15

    Purpose: Commercial CT-based image-guided radiotherapy (IGRT) systems allow widespread management of geometric variations in patient setup and internal organ motion. This document provides consensus recommendations for quality assurance protocols that ensure patient safety and patient treatment fidelity for such systems. Methods: The AAPM TG-179 reviews clinical implementation and quality assurance aspects for commercially available CT-based IGRT, each with their unique capabilities and underlying physics. The systems described are kilovolt and megavolt cone-beam CT, fan-beam MVCT, and CT-on-rails. A summary of the literature describing current clinical usage is also provided. Results: This report proposes a generic quality assurance program for CT-based IGRT systems in an effort to provide a vendor-independent program for clinical users. Published data from long-term, repeated quality control tests form the basis of the proposed test frequencies and tolerances.Conclusion: A program for quality control of CT-based image-guidance systems has been produced, with focus on geometry, image quality, image dose, system operation, and safety. Agreement and clarification with respect to reports from the AAPM TG-101, TG-104, TG-142, and TG-148 has been addressed.

  3. DHA Improves Cognition and Prevents Dysfunction of Entorhinal Cortex Neurons in 3xTg-AD Mice

    Science.gov (United States)

    Arsenault, Dany; Julien, Carl; Tremblay, Cyntia; Calon, Frédéric

    2011-01-01

    Defects in neuronal activity of the entorhinal cortex (EC) are suspected to underlie the symptoms of Alzheimer's disease (AD). Whereas neuroprotective effects of docosahexaenoic acid (DHA) have been described, the effects of DHA on the physiology of EC neurons remain unexplored in animal models of AD. Here, we show that DHA consumption improved object recognition (↑12%), preventing deficits observed in old 3xTg-AD mice (↓12%). Moreover, 3xTg-AD mice displayed seizure-like akinetic episodes, not detected in NonTg littermates and partly prevented by DHA (↓50%). Patch-clamp recording revealed that 3xTg-AD EC neurons displayed (i) loss of cell capacitance (CC), suggesting reduced membrane surface area; (ii) increase of firing rate versus injected current (F-I) curve associated with modified action potentials, and (iii) overactivation of glutamatergic synapses, without changes in synaptophysin levels. DHA consumption increased CC (↑12%) and decreased F-I slopes (↓21%), thereby preventing the opposite alterations observed in 3xTg-AD mice. Our results indicate that cognitive performance and basic physiology of EC neurons depend on DHA intake in a mouse model of AD. PMID:21383850

  4. DHA improves cognition and prevents dysfunction of entorhinal cortex neurons in 3xTg-AD mice.

    Directory of Open Access Journals (Sweden)

    Dany Arsenault

    2011-02-01

    Full Text Available Defects in neuronal activity of the entorhinal cortex (EC are suspected to underlie the symptoms of Alzheimer's disease (AD. Whereas neuroprotective effects of docosahexaenoic acid (DHA have been described, the effects of DHA on the physiology of EC neurons remain unexplored in animal models of AD. Here, we show that DHA consumption improved object recognition (↑12%, preventing deficits observed in old 3xTg-AD mice (↓12%. Moreover, 3xTg-AD mice displayed seizure-like akinetic episodes, not detected in NonTg littermates and partly prevented by DHA (↓50%. Patch-clamp recording revealed that 3xTg-AD EC neurons displayed (i loss of cell capacitance (CC, suggesting reduced membrane surface area; (ii increase of firing rate versus injected current (F-I curve associated with modified action potentials, and (iii overactivation of glutamatergic synapses, without changes in synaptophysin levels. DHA consumption increased CC (↑12% and decreased F-I slopes (↓21%, thereby preventing the opposite alterations observed in 3xTg-AD mice. Our results indicate that cognitive performance and basic physiology of EC neurons depend on DHA intake in a mouse model of AD.

  5. Furoquinoline Alkaloids and Methoxyflavones from the Stem Bark of Melicope madagascariensis (Baker T.G. Hartley

    Directory of Open Access Journals (Sweden)

    Vincent E. Rasamison

    2016-09-01

    Full Text Available Abstract Melicope madagascariensis (Rutaceae is an endemic plant species of Madagascar that was first classified as a member of the genus Euodia J. R. & G. Forst (Rutaceae under the scientific name Euodia madagascariensis Baker. Based on morphological characteristics, Thomas Gordon Hartley taxonomically revised E. madagascariensis Baker to be M. madagascariensis (Baker T.G. Hartley. Chemotaxonomical studies have long been used to help the identification and confirmation of taxonomical classification of plant species and botanicals. Aiming to find more evidences to support the taxonomical revision performed on E. madagascariensis, we carried out phytochemical investigation of two samples of the plant. Fractionation of the ethanol extracts prepared from two stem bark samples of M. madagascariensis (Baker T.G. Hartley led to the isolation of seven known furoquinoline alkaloids 1–7 and two known methoxyflavones 8 and 9. The presence of furoquinoline alkaloids and methoxyflavones in the title species is in agreement with its taxonomic transfer from Euodia to Melicope. Antiprotozoal evaluation of the isolated compounds showed that 6-methoxy-7-hydroxydictamnine (heliparvifoline, 3 showed weak antimalarial activity (IC50 = 35 µM against the chloroquine-resistant strain Dd2 of Plasmodium falciparum. Skimmianine (4 displayed moderate cytotoxicity with IC50 value of 1.5 µM against HT-29 colon cancer cell line whereas 3,5-dihydroxy-3′,4′,7-trimethoxyflavone (9 was weakly active in the same assay (IC50 = 13.9 µM. Graphical Abstract

  6. The polyphenol oleuropein aglycone protects TgCRND8 mice against Aß plaque pathology.

    Directory of Open Access Journals (Sweden)

    Cristina Grossi

    Full Text Available The claimed beneficial effects of the Mediterranean diet include prevention of several age-related dysfunctions including neurodegenerative diseases and Alzheimer-like pathology. These effects have been related to the protection against cognitive decline associated with aging and disease by a number of polyphenols found in red wine and extra virgin olive oil. The double transgenic TgCRND8 mice (overexpressing the Swedish and Indiana mutations in the human amyloid precursor protein, aged 1.5 and 4, and age-matched wild type control mice were used to examine in vivo the effects of 8 weeks dietary supplementation of oleuropein aglycone (50 mg/kg of diet, the main polyphenol found in extra virgin olive oil. We report here that dietary supplementation of oleuropein aglycone strongly improves the cognitive performance of young/middle-aged TgCRND8 mice, a model of amyloid-ß deposition, respect to age-matched littermates with un-supplemented diet. Immunofluorescence analysis of cerebral tissue in oleuropein aglycone-fed transgenic mice showed remarkably reduced ß-amyloid levels and plaque deposits, which appeared less compact and "fluffy"; moreover, microglia migration to the plaques for phagocytosis and a remarkable reduction of the astrocyte reaction were evident. Finally, oleuropein aglycone-fed mice brain displayed an astonishingly intense autophagic reaction, as shown by the increase of autophagic markers expression and of lysosomal activity. Data obtained with cultured cells confirmed the latter evidence, suggesting mTOR regulation by oleuropein aglycone. Our results support, and provide mechanistic insights into, the beneficial effects against Alzheimer-associated neurodegeneration of a polyphenol enriched in the extra virgin olive oil, a major component of the Mediterranean diet.

  7. Using the Tg(nrd:egfp/albino zebrafish line to characterize in vivo expression of neurod.

    Directory of Open Access Journals (Sweden)

    Jennifer L Thomas

    Full Text Available In this study, we used a newly-created transgenic zebrafish, Tg(nrd:egfp/albino, to further characterize the expression of neurod in the developing and adult retina and to determine neurod expression during adult photoreceptor regeneration. We also provide observations regarding the expression of neurod in a variety of other tissues. In this line, EGFP is found in cells of the developing and adult retina, pineal gland, cerebellum, olfactory bulbs, midbrain, hindbrain, neural tube, lateral line, inner ear, pancreas, gut, and fin. Using immunohistochemistry and in situ hybridization, we compare the expression of the nrd:egfp transgene to that of endogenous neurod and to known retinal cell types. Consistent with previous data based on in situ hybridizations, we show that during retinal development, the nrd:egfp transgene is not expressed in proliferating retinal neuroepithelium, and is expressed in a subset of retinal neurons. In contrast to previous studies, nrd:egfp is gradually re-expressed in all rod photoreceptors. During photoreceptor regeneration in adult zebrafish, in situ hybridization reveals that neurod is not expressed in Müller glial-derived neuronal progenitors, but is expressed in photoreceptor progenitors as they migrate to the outer nuclear layer and differentiate into new rod photoreceptors. During photoreceptor regeneration, expression of the nrd:egfp matches that of neurod. We conclude that Tg(nrd:egfp/albino is a good representation of endogenous neurod expression, is a useful tool to visualize neurod expression in a variety of tissues and will aid investigating the fundamental processes that govern photoreceptor regeneration in adults.

  8. Cistatina C, PCR, Log TG/HDLc e Sindrome Metabolica estao Relacionados a Microalbuminuria na Hipertensao

    Directory of Open Access Journals (Sweden)

    Rafaela do Socorro Souza e Silva Moura

    2014-01-01

    Full Text Available Fundamento: Em pacientes com hipertensão arterial sistêmica, a microalbuminúria é um marcador de lesão endotelial e está associada a um risco aumentado de doença cardiovascular. Objetivo: O objetivo do presente estudo foi determinar os fatores que influenciam a ocorrência de microalbumiúria em pacientes hipertensos com creatinina sérica menor que 1,5 mg/dL. Métodos: Foram incluídos no estudo 133 pacientes brasileiros atendidos em um ambulatório multidisciplinar para hipertensos. Pacientes com creatinina sérica maior do que 1,5 mg/dL e aqueles com diabete mellitus foram excluídos do estudo. A pressão arterial sistólica e diastólica foi aferida. O índice de massa corporal (IMC e a taxa de filtração glomerular estimada pela fórmula CKD-EPI foram calculados. Em um estudo transversal, creatinina, cistatina C, colesterol total, HDL colesterol, LDL colesterol, triglicerídeos, proteína C-reativa (PCR e glicose foram mensurados em amostra de sangue. A microalbuminúria foi determinada na urina colhida em 24 horas. Os hipertensos foram classificados pela presença de um ou mais critérios para síndrome metabólica. Resultados: Em análise de regressão múltipla, os níveis séricos de cistatina C, PCR, o índice aterogênico log TG/HDLc e a presença de três ou mais critérios para síndrome metabólica foram positivamente correlacionados com a microalbuminuria (r2: 0,277; p < 0,05. Conclusão: Cistatina C, PCR, log TG/HDLc e presença de três ou mais critérios para síndrome metabólica, independentemente da creatinina sérica, foram associados com a microalbuminúria, um marcador precoce de lesão renal e de risco cardiovascular em pacientes com hipertensão arterial essencial.

  9. Association between IFN-γ +874A/T and IFN-γR1 (-611A/G, +189T/G, and +95C/T Gene Polymorphisms and Chronic Periodontitis in a Sample of Iranian Population

    Directory of Open Access Journals (Sweden)

    Zahra Heidari

    2015-01-01

    Full Text Available Background. Interferon gamma (IFN-γ is an immune regulatory cytokine that acts through its receptor and plays important role in progression of inflammatory disease such as chronic periodontitis (CP. The purpose of this study was to determine the differences in the distribution of IFN-γ (+874A/T and IFN-γR1 (-611A/G, +189T/G, and +95C/T gene polymorphisms among CP and healthy individuals and to investigate relationships between these polymorphisms and susceptibility to CP. Materials and Methods. 310 individuals were enrolled in the study including 210 CP patients and 100 healthy controls. Single nucleotide polymorphisms at IFN-γ (+874A/T and IFN-γR1 (-611A/G, +189T/G, and +95C/T were analyzed by ARMS-PCR and PCR-RFLP methods. Results. The significant difference was found in genotype and allele frequency of IFN-γ (+874A/T gene polymorphism in chronic periodontitis patients and healthy controls. The distribution of genotypes and allele frequencies for IFN-γR1 (-611A/G, +189T/G, and +95C/T were similar among the groups and no differences in the frequencies of alleles or genotypes of IFN-γR1 genetic polymorphisms variants between case and control groups were detected. Conclusion. The finding of this study showed that IFN-γ +874A/T gene polymorphism may affect susceptibility to CP, whereas IFN-γR1 genetic polymorphisms at -611A/G, +189T/G, and +95C/T were not associated with this disease.

  10. Effect of Different rhBMP-2 and TG-VEGF Ratios on the Formation of Heterotopic Bone and Neovessels

    Directory of Open Access Journals (Sweden)

    Wei Xin Cai

    2014-01-01

    Full Text Available Bioengineered bone substitutes might represent alternatives to autologous bone grafts in medically compromised patients due to reduced operation time and comorbidity. Due to the lack of an inherent vascular system their dimension is limited to the size of critical bone size defect. To overcome this shortcoming, the experiment tried to create heterotopic bone around vessels. In vivo, a two-component fibrin and thrombin gel containing recombinant bone morphogenic protein (rhBMP-2 and transglutamate vascular endothelial growth factor (TG-VEGF in different ratios, respectively, was injected into a dimensionally stable membrane tube, wrapped around the femoral vessel bundle in twelve New Zealand white rabbits. Sacrifice occurred eight weeks postoperatively. Microcomputed tomography of the specimens showed significantly increased bone volume in the rhBMP-2 to TG-VEGF ratio of 10 to 1 group. Histology showed new bone formation in close proximity to the vessel bundle. Immunohistochemistry detected increased angiogenesis within the newly formed bone in the rhBMP-2 to TG-VEGF ratios of 3 to 1 and 5 to 1. Heterotopic bone was engineered in vivo around vessels using different rhBMP-2 and TG-VEGF ratios in a fibrin matrix injected into a dimensionally stable membrane tube which prevented direct contact with skeletal muscles.

  11. Preclinical Metabolism and Pharmacokinetics of SB1317 (TG02), a Potent CDK/JAK2/FLT3 Inhibitor

    NARCIS (Netherlands)

    Pasha, Mohammed Khalid; Jayaraman, Ramesh; Reddy, Venkatesh Pilla; Yeo, Pauline; Goh, Evelyn; Williams, Anthony; Goh, Kee Chuan; Kantharaj, Ethirajulu

    2012-01-01

    SB1317 (TG02) is a novel small molecule potent CDK/JAK2/FLT3 inhibitor. To evaluate full potential of this development candidate, we conducted drug metabolism and pharmacokinetic studies of this novel anti-cancer agent. SB1317 was soluble, highly permeable in Caco-2 cells, and showed >99% binding to

  12. TG1042 (Adenovirus-interferon-γ in primary cutaneous B-cell lymphomas: a phase II clinical trial.

    Directory of Open Access Journals (Sweden)

    Brigitte Dreno

    Full Text Available While a variety of registered therapies exist for Cutaneous T Cell Lymphoma, no such therapy is available for Cutaneous B Cell Therapy. In this context we performed a phase II, open label, multicenter, non-comparative study to evaluate the efficacy and safety of repeated intra-lesional administrations of TG1042 (adenovirus-interferon-γ in patients with relapsing primary cutaneous B-cell lymphomas (CBCL.Thirteen patients have been enrolled and received intralesional injections of TG1042 containing 5×10(10 viral particles into up to six lesions simultaneously. Injections were performed on days 1, 8 and 15 of each of four consecutive 28 day cycles.Eleven (85% out of 13 enrolled patients showed an objective response after injections of TG1042. Seven patients (54% exhibited complete and four (31% displayed partial response. The median time to disease progression in the study population was 23.5 months (range 6.25 to 26+. Most commonly observed adverse events were minor to moderate flu-like symptoms, fatigue and injection site reactions.Our study showed that treatment with TG1042 was associated with a clinical benefit in the majority of the patients with relapsing CBCL, including tumor regression, a clinically meaningful duration of response and a good treatment tolerance.www.clinicaltrials.govNCT00394693.

  13. Citalopram Ameliorates Impairments in Spatial Memory and Synaptic Plasticity in Female 3xTgAD Mice

    Directory of Open Access Journals (Sweden)

    Zhang Wei

    2017-01-01

    Full Text Available Alzheimer’s disease (AD is the primary cause of dementia. There is no effective treatment. Amyloid-β peptide (Aβ plays an important role in the pathogenesis and thus strategies suppressing Aβ production and accumulation seem promising. Citalopram is an antidepressant drug and can decrease Aβ production and amyloid plaques in transgenic mice of AD and humans. Whether citalopram can ameliorate memory deficit was not known yet. We tested the effects of citalopram on behavioral performance and synaptic plasticity in female 3xTgAD mice, a well-characterized model of AD. Mice were treated with citalopram or water from 5 months of age for 3 months. Citalopram treatment at approximately 10 mg/kg/day significantly improved spatial memory in the Morris water maze (MWM test, while not affecting anxiety-like and depression-like behavior in 3xTgAD mice. Further, hippocampal long-term potentiation (LTP impairment in 3xTgAD mice was reversed by citalopram treatment. Citalopram treatment also significantly decreased the levels of insoluble Aβ40 in hippocampal and cortical tissues in 3xTgAD mice, accompanied with a reduced amyloid precursor protein (APP. Together, citalopram treatment may be a promising strategy for AD and further clinical trials should be conducted to verify the effect of citalopram on cognition in patients with AD or mild cognitive impairment.

  14. TG containing stearic acid, synthesized from coconut oil, exhibit lipidemic effects in rats similar to those of cocoa butter.

    Science.gov (United States)

    Rao, Reena; Lokesh, Belur R

    2003-09-01

    Lipase-catalyzed interesterification was used to prepare structured TG from coconut oil TG by partially replacing some of the atherogenic saturated FA with stearic acid, which is known to have a neutral effect on lipid levels in the body. The level of stearic acid was increased from 4% in the native coconut oil to 40% in the structured lipids, with most of the stearic acid being incorporated into the sn-1 and sn-3 positions of TG. When structured lipids were fed to rats at a 10% level for a period of 60 d, a 15% decrease in total cholesterol and a 23% decrease in LDL cholesterol levels in the serum were observed when compared to those fed coconut oil. Similarly, the total and free cholesterol levels in the livers of the rats fed structured lipids were lowered by 31 and 36%, respectively, when compared to those fed coconut oil. The TG levels in the serum and in the liver showed decreases of 14 and 30%, respectively, in animals fed structured lipids. Rats fed cocoa butter and structured lipids having a similar amount of stearic acid had similar lipid levels in the serum and liver. These studies indicated that the atherogenic potential of coconut oil lipids can be reduced significantly by enriching them with stearic acid. This also changed the physical properties of coconut oil closer to those of cocoa butter as determined by DSC.

  15. Molecular structure of virgin and Tg cycled (Ag2Se)x (AsSe)1-x bulk glasses

    Science.gov (United States)

    Wachtman, Jacob; Chen, Ping; Boochand, P.

    2009-03-01

    AsSe, the base glass (x = 0) in the titled ternary, is an interesting example of a chalcogenide that is partially de-mixed into As4Se4 molecules segregated from a connected AsSe network, with the latter determining glass network properties. Raman scattering reveals sharp modes of the Realgar molecules that are superimposed on broad modes coming from of the backbone. Upon Tg cycling virgin samples (as quenched melts), the concentration of de-mixed As4Se4 molecules decreases, suggesting that thermally induced polymerization occurs; molecules break up to form part of the connective tissue. Modulated DSC experiments reveal a broad exotherm near 140 ^oC in virgin samples, which becomes nearly extinct in Tg cycled samples. The exotherm may represent Realgar molecules nano-crystallizing as the temperature approaches Tg. Compositional trends in thermal parameters such as Tg(x), δCp(x), and the δHnr(x) as a function of Ag2Se content `x' of the glasses will be reported.

  16. STUDY ON THE CONTENT OF SEDIMENT PARTICLES IN THE AIR AROUND TG. JIU TOWN

    Directory of Open Access Journals (Sweden)

    Ramona Violeta Cazalbașu

    2016-12-01

    Full Text Available One of the most important problems of the modern era is the air pollution. This phenomenon, highly complex, has become the focus of several international organizations since the consequences of air pollution are felt outside the country borders. By and large wecan speak of a regional pollution, which consists of atmospheric contamination by waste or by products liquids, solids gas, threatening the health of people, plants and animals or which can attack materials, reduce visibility and cause unpleasant odors. On a planetary scale, the elimination or accumulation in the atmosphere of certain products, leads to irreparable consequences on the planet's natural balance: ozone depletion and global warming of the atmosphere. This paper presents the study on the sedimentparticles in the air in Tg-Jiu. Determination of particulate matter from the air was done according to Standard no. 10195 / 75.Air purity.Determination of settled particles. In 2014 no exceeding of the maximum allowable concentration of sediment particles has been found in the four sampling points and in2015, out of a total of 60 measurements in four sampling points only one was above the maximum permissible concentration

  17. Studies concerning recycling by composting organic waste in Tg-Mureş

    Directory of Open Access Journals (Sweden)

    Florica Morar

    2011-12-01

    Full Text Available Recycling organic waste has become a matter of utmost importance for overall healthiness of the Earth, its volume largely interacting with the economic development. The problem tends to become a vital matter of survival for an entire society. In this context, recovery, recycling, physical-chemical treatment, composting or incineration are methods of waste processing, commonly used in most countries of the world. These measures are intended to both environmental protection and rational use and economically efficient. Based on the data regarding the municipal waste generated in Mures County, in previous years, and in Tg-Mures city, in 2007 were calculated the quantities expected to generate by the year 2038. Also, concerning the cleaning recovery it is proposed the pile composting method, being, from our point of view, more Beneficial in the area. In conclusion, at county level but at city level too, there is still working to do, primarily in terms of awareness, not only the population but also the relevant, local bodies, of what means the cleaning recovery of the municipal waste.

  18. High-Tg, Low-Dielectric Epoxy Thermosets Derived from Methacrylate-Containing Polyimides

    Directory of Open Access Journals (Sweden)

    Chien-Han Chen

    2017-12-01

    Full Text Available Three methacrylate-containing polyimides (Px–MMA; x = 1–3 were prepared from the esterification of hydroxyl-containing polyimides (Px–OH; x = 1–3 with methacrylic anhydride. Px–MMA exhibits active ester linkages (Ph–O–C(=O– that can react with epoxy in the presence of 4-dimethylaminopyridine (DMAP, so Px–MMA acted as a curing agent for a dicyclopentadiene-phenol epoxy (HP7200 to prepare epoxy thermosets (Px–MMA/HP7200; x = 1–3 thermosets. For property comparisons, P1–OH/HP7200 thermosets were also prepared. The reaction between active ester and epoxy results in an ester linkage, which is less polar than secondary alcohol resulting from the reaction between phenolic OH and epoxy, so P1–MMA/HP7200 are more hydrophobic and exhibit better dielectric properties than P1–OH/HP7200. The double bond of methacrylate can cure at higher temperatures, leading to epoxy thermosets with a high-Tg and moderate-to-low dielectric properties.

  19. Catalytic pyrolysis characteristics of scrap printed circuit boards by TG-FTIR.

    Science.gov (United States)

    Zhao, Chunhu; Zhang, Xiaoping; Shi, Lin

    2017-03-01

    In the present work, pyrolysis and catalytic pyrolysis of waste printed circuit boards (WPCBs) was carried out in the coupling of Thermo Gravimetric Analysis and Fourier Transform Infrared Spectroscopy (TG-FTIR) under nitrogen atmosphere. The reaction temperature was increased from 30 to 700°C, while the heating rates were varied from 10 to 40°C/min. Experimental results show that the effect of catalyst on the WPCBs particles pyrolysis was significance. Compared with another two combustion-supporting agents (MgO, CaO), the whole pyrolysis process was optimized when the catalyst ZSM-5 was added into the WPCBs particles. The distributed activation energy model (DAEM) was used to analyze the kinetic parameters of the WPCBs pyrolysis. It was found that values of frequency factor (k0) changed with different activation energy (E) values during pyrolysis process. The activation energy values range from 129.15 to 280.53kJ/mol, and the frequency factor values range from 9.02×1010 to 4.21×1022s-1. The generated major products for the catalytic pyrolysis of WPCBs were H2, CO2, CO, H2O, phenols and aromatics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Unattended acoustic sensor simulation of TG25 trials using CHORALE workshop

    Science.gov (United States)

    Gozard, Patrick; Le Goff, Alain; Naz, Pierre; Cathala, Thierry; Latger, Jean; Dupuy, Yann

    2004-08-01

    The simulation workshop CHORALE of the French DGA is used by government services and industrial companies for weapon system validation and qualification trials in the infrared domain, and detection of moving vehicles in the acoustic domain. Recently, acoustic simulation tests were performed on the 3D geometrical database of the DGA/DCE/ETBS proving ground. Results have been compared to the acoustic measurements of the NATO-TG25 trials. This article describes the trials, the modeling of the 3D geometrical database and the comparison between acoustic simulation results and measurements. The 3D scene is described by a set of polygons. Each polygon is characterized by its acoustic resistivity or its complex impedance. Sound sources are associated with moving vehicles and are characterized by their spectra and directivities. A microphone sensor is defined by its position, its frequency band and its directivity. For each trial, atmospheric profiles (air temperature, pressure and humidity according to altitude), trajectories and sound spectrum of moving objects were measured. These data were used to prepare the scenario for the acoustic simulation.

  1. Pyrolysis behaviors of rice straw, rice husk, and corncob by TG-MS technique

    Energy Technology Data Exchange (ETDEWEB)

    Worasuwannarak, Nakorn; Sonobe, Taro [The Joint Graduate School of Energy and Environment, King Mongkut' s University of Technology Thonburi, 126 Pracha-Uthit Road, Bangmod, Tungkru, Bangkok 10140 (Thailand); Tanthapanichakoon, Wiwut [National Nanotechnology Center, NSTDA, 111 Paholyothin Road, Klong Luang, Pathumtani (Thailand)

    2007-03-15

    The pyrolysis behaviors of rice straw, rice husk, and corncob have been investigated with the TG-MS technique, while paying close attention to the gas formation during the pyrolysis. The weight decreasing profiles and the gas formation rates were significantly different among the samples although their elemental compositions were almost the same. It was found that H{sub 2}O is the main product formed for all the samples. The differences in the gas formation rates were found to be due to their differences in the composition of hemicellulose, cellulose, and lignin. There were significant interactions between cellulose and lignin during the pyrolysis. The interactions between cellulose and lignin during the pyrolysis contributed to a decrease in tar yields but an increase in char yields. From the gas formation data and FTIR analyses of the chars, it may be concluded that the suppression of tar formation during the pyrolysis of biomass was brought about by the cross-linking reactions between lignin and cellulose to form H{sub 2}O and ester groups during the pyrolysis. (author)

  2. Dosimetry comparison between TG-43 and Monte Carlo calculations using the Freiburg flap for skin high-dose-rate brachytherapy.

    Science.gov (United States)

    Vijande, Javier; Ballester, Facundo; Ouhib, Zoubir; Granero, Domingo; Pujades-Claumarchirant, M Carmen; Perez-Calatayud, Jose

    2012-01-01

    The purpose of this work was to evaluate whether the delivered dose to the skin surface and at the prescription depth when using a Freiburg flap applicator is in agreement with the one predicted by the treatment planning system (TPS) using the TG-43 dose-calculation formalism. Monte Carlo (MC) simulations and radiochromic film measurements have been performed to obtain dose distributions with the source located at the center of one of the spheres and between two spheres. Primary and scatter dose contributions were evaluated to understand the role played by the scatter component. A standard treatment plan was generated using MC- and TG-43-based TPS applying the superposition principle. The MC model has been validated by performing additional simulations in the same conditions but transforming air and Freiburg flap materials into water to match TG-43 parameters. Both dose distributions differ less than 1%. Scatter defect compared with TG-43 data is up to 15% when the source is located at the center of the sphere and up to 25% when the source is between two spheres. Maximum deviations between TPS- and MC-based distributions are of 5%. The deviations in the TG-43-based dose distributions for a standard treatment plan with respect to the MC dose distribution calculated taking into account the composition and shape of the applicator and the surrounding air are lower than 5%. Therefore, this study supports the validity of the TPS used in clinical practice. Copyright © 2012 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

  3. Dosimetric and radiobiological comparison of TG-43 and Monte Carlo calculations in (192)Ir breast brachytherapy applications.

    Science.gov (United States)

    Peppa, V; Pappas, E P; Karaiskos, P; Major, T; Polgár, C; Papagiannis, P

    2016-10-01

    To investigate the clinical significance of introducing model based dose calculation algorithms (MBDCAs) as an alternative to TG-43 in (192)Ir interstitial breast brachytherapy. A 57 patient cohort was used in a retrospective comparison between TG-43 based dosimetry data exported from a treatment planning system and Monte Carlo (MC) dosimetry performed using MCNP v. 6.1 with plan and anatomy information in DICOM-RT format. Comparison was performed for the target, ipsilateral lung, heart, skin, breast and ribs, using dose distributions, dose-volume histograms (DVH) and plan quality indices clinically used for plan evaluation, as well as radiobiological parameters. TG-43 overestimation of target DVH parameters is statistically significant but small (less than 2% for the target coverage indices and 4% for homogeneity indices, on average). Significant dose differences (>5%) were observed close to the skin and at relatively large distances from the implant leading to a TG-43 dose overestimation for the organs at risk. These differences correspond to low dose regions (<50% of the prescribed dose), being less than 2% of the prescribed dose. Detected dosimetric differences did not induce clinically significant differences in calculated tumor control probabilities (mean absolute difference <0.2%) and normal tissue complication probabilities. While TG-43 shows a statistically significant overestimation of most indices used for plan evaluation, differences are small and therefore not clinically significant. Improved MBDCA dosimetry could be important for re-irradiation, technique inter-comparison and/or the assessment of secondary cancer induction risk, where accurate dosimetry in the whole patient anatomy is of the essence. Copyright © 2016 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  4. SU-E-T-87: A TG-100 Approach for Quality Improvement of Associated Dosimetry Equipment

    Energy Technology Data Exchange (ETDEWEB)

    Manger, R; Pawlicki, T; Kim, G [UCSD Medical Center, La Jolla, CA (United States)

    2015-06-15

    Purpose: Dosimetry protocols devote so much time to the discussion of ionization chamber choice, use and performance that is easy to forget about the importance of the associated dosimetry equipment (ADE) in radiation dosimetry - barometer, thermometer, electrometer, phantoms, triaxial cables, etc. Improper use and inaccuracy of these devices may significantly affect the accuracy of radiation dosimetry. The purpose of this study is to evaluate the risk factors in the monthly output dosimetry procedure and recommend corrective actions using a TG-100 approach. Methods: A failure mode and effects analysis (FMEA) of the monthly linac output check procedure was performed to determine which steps and failure modes carried the greatest risk. In addition, a fault tree analysis (FTA) was performed to expand the initial list of failure modes making sure that none were overlooked. After determining the failure modes with the highest risk priority numbers (RPNs), 11 physicists were asked to score corrective actions based on their ease of implementation and potential impact. The results were aggregated into an impact map to determine the implementable corrective actions. Results: Three of the top five failure modes were related to the thermometer and barometer. The two highest RPN-ranked failure modes were related to barometric pressure inaccuracy due to their high lack-of-detectability scores. Six corrective actions were proposed to address barometric pressure inaccuracy, and the survey results found the following two corrective actions to be implementable: 1) send the barometer for recalibration at a calibration laboratory and 2) check the barometer accuracy against the local airport and correct for elevation. Conclusion: An FMEA on monthly output measurements displayed the importance of ADE for accurate radiation dosimetry. When brainstorming for corrective actions, an impact map is helpful for visualizing the overall impact versus the ease of implementation.

  5. [Influence of urea formaldehyde resin on pyrolysis of biomass: a modeling study by TG-FTIR].

    Science.gov (United States)

    Li, Si-jin; Mu, Jun; Zhang, Yu

    2014-06-01

    Pyrolysis is an efficient and recycling way to utilize waste wood-based panels, in which urea-formaldehyde resin (UF) is the main difference between wood-based board and other kinds of biomass. The present paper studied the three main components (cellulose, hemicelluloses, lignin) of poplar wood, in order to effectively and environmentally utilize or dispose of waste wood-based panels with pyrolysis technique, to study the influence of urea formaldehyde resin on pyrolytic characteristic of wood during the process of the pyrolysis of waste wood-based panels, and to in-depth explore the mechanism of the effect of UF on each component of wood. Innovatively, the weight-loss character and gas evolution rule of the model (made from cellulose, xylan and lignin, based on the chemical components stud of poplar wood), the main components as well as the ones mixed with UF were analyzed by TG-FTIR (thermogravimetric analyzer coupled to a Fourier transform infrared spectrometer). Results indicated that UF promoted the generation of water and carboxylic acid substances during the cellulose pyrolysis process. UF combined with lignin, formed some kind of unstable nitrogenous structure which produced a large amount of NH3, which took part in the low-temperature (200-300 degrees C) pyrolysis of lignin, and directly affected the production of pyrolysis products. It can be concluded that during the process of the pyrolysis of waste wood-based panels, lignin was the one that UF mainly impacted among the three main components of wood.

  6. Compound list: N-methyl-N-nitrosourea [Open TG-GATEs

    Lifescience Database Archive (English)

    Full Text Available N-methyl-N-nitrosourea MNU 00164 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LA...TEST/Human/in_vitro/N-methyl-N-nitrosourea.Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-...tggates/LATEST/Rat/in_vivo/Liver/Single/N-methyl-N-nitrosourea.Rat.in_vivo.Liver.Single.zip ...

  7. Regulatory single nucleotide polymorphisms at the beginning of ...

    Indian Academy of Sciences (India)

    There are two regulatory single nucleotide polymorphisms (rSNPs) at the beginning of the second intron of the mouse - gene that are strongly associated with lung cancer susceptibility. We performed functional analysis of three SNPs (rs12228277: T>A, rs12226937: G>A, and rs61761074: T>G) located in the same ...

  8. CXCR4 Antagonist TG-0054 Mobilizes Mesenchymal Stem Cells, Attenuates Inflammation, and Preserves Cardiac Systolic Function in a Porcine Model of Myocardial Infarction.

    Science.gov (United States)

    Hsu, Wan-Tseng; Jui, Hsiang-Yiang; Huang, Ying-Huey; Su, Mao-Yuan M; Wu, Yen-Wen; Tseng, Wen-Yih I; Hsu, Ming-Chu; Chiang, Bor-Luen; Wu, Kenneth K; Lee, Chii-Ming

    2015-01-01

    Interaction between chemokine stromal cell-derived factor 1 and the CXC chemokine receptor 4 (CXCR4) governs the sequestration and mobilization of bone marrow stem cells. We investigated the therapeutic potential of TG-0054, a novel CXCR4 antagonist, in attenuating cardiac dysfunction after myocardial infarction (MI). In miniature pigs (minipigs), TG-0054 mobilized CD34(+)CXCR4(+), CD133(+)CXCR4(+), and CD271(+)CXCR4(+) cells into peripheral circulation. After isolation and expansion, TG-0054-mobilized CD271(+) cells were proved to be mesenchymal stem cells (designated CD271-MSCs) since they had trilineage differentiation potential, surface markers of MSCs, and immunosuppressive effects on allogeneic lymphocyte proliferation. MI was induced in 22 minipigs using balloon occlusion of the left anterior descending coronary artery, followed by intravenous injections of 2.85 mg/kg of TG-0054 or saline at 3 days and 7 days post-MI. Serial MRI analyses revealed that TG-0054 treatment prevented left ventricular (LV) dysfunction at 12 weeks after MI (change of LV ejection fraction from baseline, -1.0 ± 6.2% in the TG-0054 group versus -7.9 ± 5.8% in the controls). The preserved cardiac function was accompanied by a significant decrease in the myocardial expression of TNF-α, IL-1β, and IL-6 at 7 days post-MI. Moreover, the plasma levels of TNF-α, IL-1β, and IL-6 were persistently suppressed by the TG-0054 treatment. Infusion of TG-0054-mobilized CD271-MSCs reduced both myocardial and plasma cytokine levels in a pattern, which is temporally correlated with TG-0054 treatment. This study demonstrated that TG-0054 improves the impaired LV contractility following MI, at least in part, by mobilizing MSCs to attenuate the postinfarction inflammation. This insight may facilitate exploring novel stem cell-based therapy for treating post-MI heart failure.

  9. Cytokine-producing microglia have an altered beta-amyloid load in aged APP/PS1 Tg mice

    DEFF Research Database (Denmark)

    Babcock, Alicia A; Ilkjær, Laura; Clausen, Bettina H

    2015-01-01

    Beta-amyloid (Aβ) plaques and chronic neuroinflammation are significant neuropathological features of Alzheimer's disease. Microglial cells in aged brains have potential to produce cytokines such as TNF and IL-1 family members (IL-1α, IL-1β, and IL-1Ra) and to phagocytose Aβ in Alzheimer's disease...... of CD11b, TNF, and IL-1Ra. Cytokine production and Aβ load were assessed in neocortical CD11b(+)(CD45(+)) microglia by flow cytometry. Whereas most microglia in aged mice produced IL-1Ra, relatively low proportions of microglia produced TNF, IL-1α, and IL-1β. However, microglial production...... of these latter cytokines was generally increased in APP/PS1 Tg mice. Microglia that phagocytosed endogenously-produced Aβ were only observed in APP/PS1 Tg mice. Differences in phagocytic index and total Aβ load were observed in microglia with specific cytokine profiles. Both phagocytic index and total Aβ load...

  10. Brief Eclectic Psychotherapy for Traumatic Grief (BEP-TG): toward integrated treatment of symptoms related to traumatic loss

    Science.gov (United States)

    Smid, Geert E.; Kleber, Rolf J.; de la Rie, Simone M.; Bos, Jannetta B. A.; Gersons, Berthold P. R.; Boelen, Paul A.

    2015-01-01

    Background Traumatic events such as disasters, accidents, war, or criminal violence are often accompanied by the loss of loved ones, and may then give rise to traumatic grief. Traumatic grief refers to a clinical diagnosis of persistent complex bereavement disorder (PCBD) with comorbid (symptoms of) posttraumatic stress disorder (PTSD) and/or major depressive disorder (MDD) following confrontation with a traumatic loss. Trauma survivors, who are frequently from different cultural backgrounds, have often experienced multiple losses and ambiguous loss (missing family members or friends). Current evidence-based treatments for PTSD do not focus on traumatic grief. Objective To develop a treatment for traumatic grief combining treatment interventions for PTSD and PCBD that may accommodate cultural aspects of grief. Method To provide a rationale for treatment, we propose a cognitive stress model of traumatic grief. Based on this model and on existing evidence-based treatments for PTSD and complicated grief, we developed Brief Eclectic Psychotherapy for Traumatic Grief (BEP-TG) for the treatment of patients with traumatic grief. The treatment is presented along with a case vignette. Results Processes contributing to traumatic grief include inadequately integrating the memory of the traumatic loss, negative appraisal of the traumatic loss, sensitivity to matching triggers and new stressors, and attempting to avoid distress. BEP-TG targets these processes. The BEP-TG protocol consists of five parts with proven effectiveness in the treatment of PCBD, PTSD, and MDD: information and motivation, grief-focused exposure, memorabilia and writing assignments, finding meaning and activation, and a farewell ritual. Conclusion Tailored to fit the needs of trauma survivors, BEP-TG can be used to address traumatic grief symptoms related to multiple losses and ambiguous loss, as well as cultural aspects of bereavement through its different components. PMID:26154434

  11. Delayed cystogenesis and increased ciliogenesis associated with the re-expression of polaris in Tg737 mutant mice.

    Science.gov (United States)

    Brown, Nicole E; Murcia, Noel S

    2003-04-01

    Renal cysts and shortened cilia on renal tubular epithelia have been observed in Tg737orpk (orpk) mutant mice, suggesting a potential connection between cystogenesis and ciliogenesis. To further test this hypothesis we have characterized the progression of cystic disease and cilia expression in orpk, orpk;Tg737Rsq (orpk rescue), and Tg737 Delta 2-3 beta Gal;Tg737Rsq (KO rescue) mice. Methods. Orpk, orpk rescue, and KO rescue animals were generated and analyzed from postnatal day (P) 0 to P21 (orpk mutants) or from P0 to P210 (orpk rescue and KO rescue animals). Proximal tubules (PT) and collecting tubules (CT) were identified by immunohistochemistry using segment-specific lectins and a segment-specific cystic index was calculated. Scanning electron microscopy was utilized to observe and measure cilia expression in cysts from orpk, orpk rescue, and KO rescue animals. KO rescue and orpk rescue animals develop adult-onset autosomal-recessive polycystic kidney disease (ARPKD). Ultrastructural analysis of cilia expression revealed that cysts from orpk expressed short cilia, whereas cysts from KO rescue animals expressed normal length cilia and cysts from orpk rescue animals expressed cilia that are two to five times longer than wild type. While this data is consistent with a role for polaris in ciliogenesis, it does not support a direct connection between ciliogenesis and cystic disease. Similarities in cyst formation and striking differences in cilia expression associated with these ARPKD mouse models indicates that cyst formation and cilia expression are independent phenotypic features regulated by polaris.

  12. Differential GFP expression patterns induced by different heavy metals in Tg(hsp70:gfp) transgenic medaka (Oryzias latipes).

    Science.gov (United States)

    Ng, Grace Hwee Boon; Xu, Hongyan; Pi, Na; Kelly, Barry C; Gong, Zhiyuan

    2015-06-01

    Heat shock protein 70 (Hsp70) is one of the most widely used biomarker for monitoring environment perturbations in biological systems. To facilitate the analysis of hsp70 expression as a biomarker, we generated a Tg(hsp70:gfp) transgenic medaka line in which green fluorescence protein (GFP) reporter gene was driven by the medaka hsp70 promoter. Here, we characterized Tg(hsp70:gfp) medaka for inducible GFP expression by seven environment-relevant heavy metals, including mercury, arsenic, lead, cadmium, copper, chromium, and zinc. We found that four of them (mercury, arsenic, lead, and cadmium) induced GFP expression in multiple and different organs. In general, the liver, kidney, gut, and skin are among the most frequent organs to show induced GFP expression. In contrast, no detectable GFP induction was observed to copper, chromium, or zinc, indicating that the transgenic line was not responsive to all heavy metals. RT-qPCR determination of hsp70 mRNA showed similar induction and non-induction by these metals, which also correlated with the levels of metal uptake in medaka exposed to these metals. Our observations suggested that these heavy metals have different mechanisms of toxicity and/or differential bioaccumulation in various organs; different patterns of GFP expression induced by different metals may be used to determine or exclude metals in water samples tested. Furthermore, we also tested several non-metal toxicants such as bisphenol A, 2,3,7,8-tetrachlorodibenzo-p-dioxin, 4-introphenol, and lindane; none of them induced significant GFP expression in Tg(hsp70:gfp) medaka, further suggesting that the inducibility of Tg(hsp70:gfp) for GFP expression is specific to a subset of heavy metals.

  13. Brief Eclectic Psychotherapy for Traumatic Grief (BEP-TG): toward integrated treatment of symptoms related to traumatic loss.

    Science.gov (United States)

    Smid, Geert E; Kleber, Rolf J; de la Rie, Simone M; Bos, Jannetta B A; Gersons, Berthold P R; Boelen, Paul A

    2015-01-01

    Traumatic events such as disasters, accidents, war, or criminal violence are often accompanied by the loss of loved ones, and may then give rise to traumatic grief. Traumatic grief refers to a clinical diagnosis of persistent complex bereavement disorder (PCBD) with comorbid (symptoms of) posttraumatic stress disorder (PTSD) and/or major depressive disorder (MDD) following confrontation with a traumatic loss. Trauma survivors, who are frequently from different cultural backgrounds, have often experienced multiple losses and ambiguous loss (missing family members or friends). Current evidence-based treatments for PTSD do not focus on traumatic grief. To develop a treatment for traumatic grief combining treatment interventions for PTSD and PCBD that may accommodate cultural aspects of grief. To provide a rationale for treatment, we propose a cognitive stress model of traumatic grief. Based on this model and on existing evidence-based treatments for PTSD and complicated grief, we developed Brief Eclectic Psychotherapy for Traumatic Grief (BEP-TG) for the treatment of patients with traumatic grief. The treatment is presented along with a case vignette. Processes contributing to traumatic grief include inadequately integrating the memory of the traumatic loss, negative appraisal of the traumatic loss, sensitivity to matching triggers and new stressors, and attempting to avoid distress. BEP-TG targets these processes. The BEP-TG protocol consists of five parts with proven effectiveness in the treatment of PCBD, PTSD, and MDD: information and motivation, grief-focused exposure, memorabilia and writing assignments, finding meaning and activation, and a farewell ritual. Tailored to fit the needs of trauma survivors, BEP-TG can be used to address traumatic grief symptoms related to multiple losses and ambiguous loss, as well as cultural aspects of bereavement through its different components.

  14. Role of Tulipa gesneriana TEOSINTE BRANCHED1 (TgTB1) in the control of axillary bud outgrowth in bulbs.

    Science.gov (United States)

    Moreno-Pachon, Natalia M; Mutimawurugo, Marie-Chantal; Heynen, Eveline; Sergeeva, Lidiya; Benders, Anne; Blilou, Ikram; Hilhorst, Henk W M; Immink, Richard G H

    2017-12-07

    Tulip vegetative reproduction. Tulips reproduce asexually by the outgrowth of their axillary meristems located in the axil of each bulb scale. The number of axillary meristems in one bulb is low, and not all of them grow out during the yearly growth cycle of the bulb. Since the degree of axillary bud outgrowth in tulip determines the success of their vegetative propagation, this study aimed at understanding the mechanism controlling the differential axillary bud activity. We used a combined physiological and "bottom-up" molecular approach to shed light on this process and found that first two inner located buds do not seem to experience dormancy during the growth cycle, while mid-located buds enter dormancy by the end of the growing season. Dormancy was assessed by weight increase and TgTB1 expression levels, a conserved TCP transcription factor and well-known master integrator of environmental and endogenous signals influencing axillary meristem outgrowth in plants. We showed that TgTB1 expression in tulip bulbs can be modulated by sucrose, cytokinin and strigolactone, just as it has been reported for other species. However, the limited growth of mid-located buds, even when their TgTB1 expression is downregulated, points at other factors, probably physical, inhibiting their growth. We conclude that the time of axillary bud initiation determines the degree of dormancy and the sink strength of the bud. Thus, development, apical dominance, sink strength, hormonal cross-talk, expression of TgTB1 and other possibly physical but unidentified players, all converge to determine the growth capacity of tulip axillary buds.

  15. Impaired attention in the 3xTgAD mouse model of Alzheimer's disease: rescue by donepezil (Aricept).

    Science.gov (United States)

    Romberg, Carola; Mattson, Mark P; Mughal, Mohamed R; Bussey, Timothy J; Saksida, Lisa M

    2011-03-02

    Several mouse models of Alzheimer's disease (AD) with abundant β-amyloid and/or aberrantly phosphorylated tau develop memory impairments. However, multiple non-mnemonic cognitive domains such as attention and executive control are also compromised early in AD individuals. Currently, it is unclear whether mutations in the β-amyloid precursor protein (APP) and tau are sufficient to cause similar, AD-like attention deficits in mouse models of the disease. To address this question, we tested 3xTgAD mice (which express APPswe, PS1M146V, and tauP301L mutations) and wild-type control mice on a newly developed touchscreen-based 5-choice serial reaction time test of attention and response control. The 3xTgAD mice attended less accurately to short, spatially unpredictable stimuli when the attentional demand of the task was high, and also showed a general tendency to make more perseverative responses than wild-type mice. The attentional impairment of 3xTgAD mice was comparable to that of AD patients in two aspects: first, although 3xTgAD mice initially responded as accurately as wild-type mice, they subsequently failed to sustain their attention over the duration of the task; second, the ability to sustain attention was enhanced by the cholinesterase inhibitor donepezil (Aricept). These findings demonstrate that familial AD mutations not only affect memory, but also cause significant impairments in attention, a cognitive domain supported by the prefrontal cortex and its afferents. Because attention deficits are likely to affect memory encoding and other cognitive abilities, our findings have important consequences for the assessment of disease mechanisms and therapeutics in animal models of AD.

  16. Chronic temporal lobe epilepsy is associated with enhanced Alzheimer-like neuropathology in 3×Tg-AD mice.

    Directory of Open Access Journals (Sweden)

    Xiao-Xin Yan

    Full Text Available The comorbidity between epilepsy and Alzheimer's disease (AD is a topic of growing interest. Senile plaques and tauopathy are found in epileptic human temporal lobe structures, and individuals with AD have an increased incidence of spontaneous seizures. However, why and how epilepsy is associated with enhanced AD-like pathology remains unknown. We have recently shown β-secretase-1 (BACE1 elevation associated with aberrant limbic axonal sprouting in epileptic CD1 mice. Here we sought to explore whether BACE1 upregulation affected the development of Alzheimer-type neuropathology in mice expressing mutant human APP, presenilin and tau proteins, the triple transgenic model of AD (3×Tg-AD. 3×Tg-AD mice were treated with pilocarpine or saline (i.p. at 6-8 months of age. Immunoreactivity (IR for BACE1, β-amyloid (Aβ and phosphorylated tau (p-tau was subsequently examined at 9, 11 or 14 months of age. Recurrent convulsive seizures, as well as mossy fiber sprouting and neuronal death in the hippocampus and limbic cortex, were observed in all epileptic mice. Neuritic plaques composed of BACE1-labeled swollen/sprouting axons and extracellular AβIR were seen in the hippocampal formation, amygdala and piriform cortices of 9 month-old epileptic, but not control, 3×Tg-AD mice. Densities of plaque-associated BACE1 and AβIR were elevated in epileptic versus control mice at 11 and 14 months of age. p-Tau IR was increased in dentate granule cells and mossy fibers in epileptic mice relative to controls at all time points examined. Thus, pilocarpine-induced chronic epilepsy was associated with accelerated and enhanced neuritic plaque formation and altered intraneuronal p-tau expression in temporal lobe structures in 3×Tg-AD mice, with these pathologies occurring in regions showing neuronal death and axonal dystrophy.

  17. Brief Eclectic Psychotherapy for Traumatic Grief (BEP-TG: toward integrated treatment of symptoms related to traumatic loss

    Directory of Open Access Journals (Sweden)

    Geert E. Smid

    2015-07-01

    Full Text Available Background: Traumatic events such as disasters, accidents, war, or criminal violence are often accompanied by the loss of loved ones, and may then give rise to traumatic grief. Traumatic grief refers to a clinical diagnosis of persistent complex bereavement disorder (PCBD with comorbid (symptoms of posttraumatic stress disorder (PTSD and/or major depressive disorder (MDD following confrontation with a traumatic loss. Trauma survivors, who are frequently from different cultural backgrounds, have often experienced multiple losses and ambiguous loss (missing family members or friends. Current evidence-based treatments for PTSD do not focus on traumatic grief. Objective: To develop a treatment for traumatic grief combining treatment interventions for PTSD and PCBD that may accommodate cultural aspects of grief. Method: To provide a rationale for treatment, we propose a cognitive stress model of traumatic grief. Based on this model and on existing evidence-based treatments for PTSD and complicated grief, we developed Brief Eclectic Psychotherapy for Traumatic Grief (BEP-TG for the treatment of patients with traumatic grief. The treatment is presented along with a case vignette. Results: Processes contributing to traumatic grief include inadequately integrating the memory of the traumatic loss, negative appraisal of the traumatic loss, sensitivity to matching triggers and new stressors, and attempting to avoid distress. BEP-TG targets these processes. The BEP-TG protocol consists of five parts with proven effectiveness in the treatment of PCBD, PTSD, and MDD: information and motivation, grief-focused exposure, memorabilia and writing assignments, finding meaning and activation, and a farewell ritual. Conclusion: Tailored to fit the needs of trauma survivors, BEP-TG can be used to address traumatic grief symptoms related to multiple losses and ambiguous loss, as well as cultural aspects of bereavement through its different components.

  18. Evaluation of cassette-based digital radiography detectors using standardized image quality metrics: AAPM TG-150 Draft Image Detector Tests.

    Science.gov (United States)

    Li, Guang; Greene, Travis C; Nishino, Thomas K; Willis, Charles E

    2016-09-08

    The purpose of this study was to evaluate several of the standardized image quality metrics proposed by the American Association of Physics in Medicine (AAPM) Task Group 150. The task group suggested region-of-interest (ROI)-based techniques to measure nonuniformity, minimum signal-to-noise ratio (SNR), number of anomalous pixels, and modulation transfer function (MTF). This study evaluated the effects of ROI size and layout on the image metrics by using four different ROI sets, assessed result uncertainty by repeating measurements, and compared results with two commercially available quality control tools, namely the Carestream DIRECTVIEW Total Quality Tool (TQT) and the GE Healthcare Quality Assurance Process (QAP). Seven Carestream DRX-1C (CsI) detectors on mobile DR systems and four GE FlashPad detectors in radiographic rooms were tested. Images were analyzed using MATLAB software that had been previously validated and reported. Our values for signal and SNR nonuniformity and MTF agree with values published by other investigators. Our results show that ROI size affects nonuniformity and minimum SNR measurements, but not detection of anomalous pixels. Exposure geometry affects all tested image metrics except for the MTF. TG-150 metrics in general agree with the TQT, but agree with the QAP only for local and global signal nonuniformity. The difference in SNR nonuniformity and MTF values between the TG-150 and QAP may be explained by differences in the calculation of noise and acquisition beam quality, respectively. TG-150's SNR nonuniformity metrics are also more sensitive to detector nonuniformity compared to the QAP. Our results suggest that fixed ROI size should be used for consistency because nonuniformity metrics depend on ROI size. Ideally, detector tests should be performed at the exact calibration position. If not feasible, a baseline should be established from the mean of several repeated measurements. Our study indicates that the TG-150 tests can be

  19. TG/DTG, FT-ICR Mass Spectrometry, and NMR Spectroscopy Study of Heavy Fuel Oil

    KAUST Repository

    Elbaz, Ayman M.

    2015-11-12

    There is an increasing interest in the comprehensive study of heavy fuel oil (HFO) due to its growing use in furnaces, boilers, marines, and recently in gas turbines. In this work, the thermal combustion characteristics and chemical composition of HFO were investigated using a range of techniques. Thermogravimetric analysis (TGA) was conducted to study the nonisothermal HFO combustion behavior. Chemical characterization of HFO was accomplished using various standard methods in addition to direct infusion atmospheric pressure chemical ionization Fourier transform ion cyclotron resonance mass spectrometry (APCI-FTICR MS), high resolution 1H nuclear magnetic resonance (NMR), 13C NMR, and two-dimensional heteronuclear multiple bond correlation (HMBC) spectroscopy. By analyzing thermogravimetry and differential thermogravimetry (TG/DTG) results, three different reaction regions were identified in the combustion of HFO with air, specifically, low temperature oxidation region (LTO), fuel deposition (FD), and high temperature oxidation (HTO) region. At the high end of the LTO region, a mass transfer resistance (skin effect) was evident. Kinetic analysis in LTO and HTO regions was conducted using two different kinetic models to calculate the apparent activation energy. In both models, HTO activation energies are higher than those for LTO. The FT-ICR MS technique resolved thousands of aromatic and sulfur containing compounds in the HFO sample and provided compositional details for individual molecules of three major class species. The major classes of compounds included species with one sulfur atom (S1), with two sulfur atoms (S2), and purely hydrocarbons (HC). The DBE (double bond equivalent) abundance plots established for S1 and HC provided additional information on their distributions in the HFO sample. The 1H NMR and 13C NMR results revealed that nearly 59% of the 1H nuclei were distributed as paraffinic CH2 and 5% were in aromatic groups. Nearly 21% of 13C nuclei were

  20. MO-AB-206-02: Testing Gamma Cameras Based On TG177 WG Report

    Energy Technology Data Exchange (ETDEWEB)

    Halama, J. [Loyola Univ. Medical Center (United States)

    2016-06-15

    This education session will cover the physics and operation principles of gamma cameras and PET scanners. The first talk will focus on PET imaging. An overview of the principles of PET imaging will be provided, including positron decay physics, and the transition from 2D to 3D imaging. More recent advances in hardware and software will be discussed, such as time-of-flight imaging, and improvements in reconstruction algorithms that provide for options such as depth-of-interaction corrections. Quantitative applications of PET will be discussed, as well as the requirements for doing accurate quantitation. Relevant performance tests will also be described. Learning Objectives: Be able to describe basic physics principles of PET and operation of PET scanners. Learn about recent advances in PET scanner hardware technology. Be able to describe advances in reconstruction techniques and improvements Be able to list relevant performance tests. The second talk will focus on gamma cameras. The Nuclear Medicine subcommittee has charged a task group (TG177) to develop a report on the current state of physics testing of gamma cameras, SPECT, and SPECT/CT systems. The report makes recommendations for performance tests to be done for routine quality assurance, annual physics testing, and acceptance tests, and identifies those needed satisfy the ACR accreditation program and The Joint Commission imaging standards. The report is also intended to be used as a manual with detailed instructions on how to perform tests under widely varying conditions. Learning Objectives: At the end of the presentation members of the audience will: Be familiar with the tests recommended for routine quality assurance, annual physics testing, and acceptance tests of gamma cameras for planar imaging. Be familiar with the tests recommended for routine quality assurance, annual physics testing, and acceptance tests of SPECT systems. Be familiar with the tests of a SPECT/CT system that include the CT images

  1. Neuroprotective effects of bee venom phospholipase A2 in the 3xTg AD mouse model of Alzheimer's disease.

    Science.gov (United States)

    Ye, Minsook; Chung, Hwan-Suck; Lee, Chanju; Yoon, Moon Sik; Yu, A Ram; Kim, Jin Su; Hwang, Deok-Sang; Shim, Insop; Bae, Hyunsu

    2016-01-16

    Alzheimer's disease (AD) is a severe neuroinflammatory disease. CD4(+)Foxp3(+) regulatory T cells (Tregs) modulate various inflammatory diseases via suppressing Th cell activation. There are increasing evidences that Tregs have beneficial roles in neurodegenerative diseases. Previously, we found the population of Treg cells was significantly increased by bee venom phospholipase A2 (bvPLA2) treatment in vivo and in vitro. To examine the effects of bvPLA2 on AD, bvPLA2 was administered to 3xTg-AD mice, mouse model of Alzheimer's disease. The levels of amyloid beta (Aβ) deposits in the hippocampus, glucose metabolism in the brain, microglia activation, and CD4(+) T cell infiltration were analyzed to evaluate the neuroprotective effect of bvPLA2. bvPLA2 treatment significantly enhanced the cognitive function of the 3xTg-AD mice and increased glucose metabolism, as assessed with 18F-2 fluoro-2-deoxy-D-glucose ([F-18] FDG) positron emission tomography (PET). The levels of Aβ deposits in the hippocampus were dramatically decreased by bvPLA2 treatment. This neuroprotective effect of bvPLA2 was associated with microglial deactivation and reduction in CD4(+) T cell infiltration. Interestingly, the neuroprotective effects of bvPLA2 were abolished in Treg-depleted mice. The present studies strongly suggest that the increase of Treg population by bvPLA2 treatment might inhibit progression of AD in the 3xTg AD mice.

  2. Measurements of Gasification Characteristics of Coal and Char in CO2-Rich Gas Flow by TG-DTA

    Directory of Open Access Journals (Sweden)

    Zhigang Li

    2013-01-01

    Full Text Available Pyrolysis, combustion, and gasification properties of pulverized coal and char in CO2-rich gas flow were investigated by using gravimetric-differential thermal analysis (TG-DTA with changing O2%, heating temperature gradient, and flow rate of CO2-rich gases provided. Together with TG-DTA, flue gas generated from the heated coal, such as CO, CO2, and hydrocarbons (HCs, was analyzed simultaneously on the heating process. The optimum O2% in CO2-rich gas for combustion and gasification of coal or char was discussed by analyzing flue gas with changing O2 from 0 to 5%. The experimental results indicate that O2% has an especially large effect on carbon oxidation at temperature less than 1100°C, and lower O2 concentration promotes gasification reaction by producing CO gas over 1100°C in temperature. The TG-DTA results with gas analyses have presented basic reference data that show the effects of O2 concentration and heating rate on coal physical and chemical behaviors for the expected technologies on coal gasification in CO2-rich gas and oxygen combustion and underground coal gasification.

  3. EVOLVED GAS ANALYSIS (COUPLED TG-DSC-FT-IR APPLIED IN THE STUDY OF FRUCTOOLIGOSACCHARIDES FROM CHICORY

    Directory of Open Access Journals (Sweden)

    Roberta de Souza Leone

    2014-08-01

    Full Text Available EGA (Evolved Gas Analysis is a group of coupled techniques (in this case TG-DSC and FT-IR that was used to provide information about the thermal and calorimetric behavior of standard fructooligosaccharides (FOS from chicory. These FOS are found in several foods (tuber, roots, fruits, leaves, cereals, etc. and have been the subject of several studies. In the present study thermogravimetry (TG allowed the characterization of FOS a standard (Sigma-Aldrich, in which the weight loss can be observed in three stages (m 7.56, 55.53 and 36.53%, respectively. The simultaneous use of DSC showed endo and exothermic events in temperature characteristics and in agreement with TG curves. The enthalpies of the main stages of decomposition were calculated: ΔHdehydr 260 J g-1 and ΔHdec 410 J g-1. From the FT-IR spectrum of the volatiles was possible to characterize the main bands, which confirmed CO and CO2 as a result of thermal decomposition.

  4. Vitamin E reduces amyloidosis and improves cognitive function in Tg2576 mice following repetitive concussive brain injury.

    Science.gov (United States)

    Conte, Valeria; Uryu, Kunihiro; Fujimoto, Scott; Yao, Yuemang; Rokach, Joshua; Longhi, Luca; Trojanowski, John Q; Lee, Virginia M-Y; McIntosh, Tracy K; Praticò, Domenico

    2004-08-01

    Traumatic brain injury is a well-recognized environmental risk factor for developing Alzheimer's disease. Repetitive concussive brain injury (RCBI) exacerbates brain lipid peroxidation, accelerates amyloid (Abeta) formation and deposition, as well as cognitive impairments in Tg2576 mice. This study evaluated the effects of vitamin E on these four parameters in Tg2576 mice following RCBI. Eleven-month-old mice were randomized to receive either regular chow or chow-supplemented with vitamin E for 4 weeks, and subjected to RCBI (two injuries, 24 h apart) using a modified controlled cortical impact model of closed head injury. The same dietary regimens were maintained up to 8 weeks post-injury, when the animals were killed for biochemical and immunohistochemical analyses after behavioral evaluation. Vitamin E-treated animals showed a significant increase in brain vitamin E levels and a significant decrease in brain lipid peroxidation levels. After RBCI, compared with the group on regular chow, animals receiving vitamin E did not show the increase in Abeta peptides, and had a significant attenuation of learning deficits. This study suggests that the exacerbation of brain oxidative stress following RCBI plays a mechanistic role in accelerating Alphabeta accumulation and behavioral impairments in the Tg2576 mice.

  5. Retinal remodeling in the Tg P347L rabbit, a large-eye model of retinal degeneration.

    Science.gov (United States)

    Jones, B W; Kondo, M; Terasaki, H; Watt, C B; Rapp, K; Anderson, J; Lin, Y; Shaw, M V; Yang, J-H; Marc, R E

    2011-10-01

    Retinitis pigmentosa (RP) is an inherited blinding disease characterized by progressive loss of retinal photoreceptors. There are numerous rodent models of retinal degeneration, but most are poor platforms for interventions that will translate into clinical practice. The rabbit possesses a number of desirable qualities for a model of retinal disease including a large eye and an existing and substantial knowledge base in retinal circuitry, anatomy, and ophthalmology. We have analyzed degeneration, remodeling, and reprogramming in a rabbit model of retinal degeneration, expressing a rhodopsin proline 347 to leucine transgene in a TgP347L rabbit as a powerful model to study the pathophysiology and treatment of retinal degeneration. We show that disease progression in the TgP347L rabbit closely tracks human cone-sparing RP, including the cone-associated preservation of bipolar cell signaling and triggering of reprogramming. The relatively fast disease progression makes the TgP347L rabbit an excellent model for gene therapy, cell biological intervention, progenitor cell transplantation, surgical interventions, and bionic prosthetic studies. Copyright © 2011 Wiley-Liss, Inc.

  6. Addendum to the AAPM's TG-51 protocol for clinical reference dosimetry of high-energy photon beams

    Science.gov (United States)

    McEwen, Malcolm; DeWerd, Larry; Ibbott, Geoffrey; Followill, David; Rogers, David W. O.; Seltzer, Stephen; Seuntjens, Jan

    2014-01-01

    An addendum to the AAPM's TG-51 protocol for the determination of absorbed dose to water in megavoltage photon beams is presented. This addendum continues the procedure laid out in TG-51 but new kQ data for photon beams, based on Monte Carlo simulations, are presented and recommendations are given to improve the accuracy and consistency of the protocol's implementation. The components of the uncertainty budget in determining absorbed dose to water at the reference point are introduced and the magnitude of each component discussed. Finally, the consistency of experimental determination of ND,w coefficients is discussed. It is expected that the implementation of this addendum will be straightforward, assuming that the user is already familiar with TG-51. The changes introduced by this report are generally minor, although new recommendations could result in procedural changes for individual users. It is expected that the effort on the medical physicist's part to implement this addendum will not be significant and could be done as part of the annual linac calibration. PMID:24694120

  7. MrBayes tgMC3++: A High Performance and Resource-Efficient GPU-Oriented Phylogenetic Analysis Method.

    Science.gov (United States)

    Ling, Cheng; Hamada, Tsuyoshi; Gao, Jingyang; Zhao, Guoguang; Sun, Donghong; Shi, Weifeng

    2016-01-01

    MrBayes is a widespread phylogenetic inference tool harnessing empirical evolutionary models and Bayesian statistics. However, the computational cost on the likelihood estimation is very expensive, resulting in undesirably long execution time. Although a number of multi-threaded optimizations have been proposed to speed up MrBayes, there are bottlenecks that severely limit the GPU thread-level parallelism of likelihood estimations. This study proposes a high performance and resource-efficient method for GPU-oriented parallelization of likelihood estimations. Instead of having to rely on empirical programming, the proposed novel decomposition storage model implements high performance data transfers implicitly. In terms of performance improvement, a speedup factor of up to 178 can be achieved on the analysis of simulated datasets by four Tesla K40 cards. In comparison to the other publicly available GPU-oriented MrBayes, the tgMC 3 ++ method (proposed herein) outperforms the tgMC 3 (v1.0), nMC 3 (v2.1.1) and oMC 3 (v1.00) methods by speedup factors of up to 1.6, 1.9 and 2.9, respectively. Moreover, tgMC 3 ++ supports more evolutionary models and gamma categories, which previous GPU-oriented methods fail to take into analysis.

  8. Impaired thermoregulation and beneficial effects of thermoneutrality in the 3×Tg-AD model of Alzheimer's disease.

    Science.gov (United States)

    Vandal, Milene; White, Philip J; Tournissac, Marine; Tremblay, Cyntia; St-Amour, Isabelle; Drouin-Ouellet, Janelle; Bousquet, Melanie; Traversy, Marie-Thérèse; Planel, Emmanuel; Marette, Andre; Calon, Frederic

    2016-07-01

    The sharp rise in the incidence of Alzheimer's disease (AD) at an old age coincides with a reduction in energy metabolism and core body temperature. We found that the triple-transgenic mouse model of AD (3×Tg-AD) spontaneously develops a lower basal body temperature and is more vulnerable to a cold environment compared with age-matched controls. This was despite higher nonshivering thermogenic activity, as evidenced by brown adipose tissue norepinephrine content and uncoupling protein 1 expression. A 24-hour exposure to cold (4 °C) aggravated key neuropathologic markers of AD such as: tau phosphorylation, soluble amyloid beta concentrations, and synaptic protein loss in the cortex of 3×Tg-AD mice. Strikingly, raising the body temperature of aged 3×Tg-AD mice via exposure to a thermoneutral environment improved memory function and reduced amyloid and synaptic pathologies within a week. Our results suggest the presence of a vicious cycle between impaired thermoregulation and AD-like neuropathology, and it is proposed that correcting thermoregulatory deficits might be therapeutic in AD. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Association between hemoglobin and diabetes in relation to the triglycerides-to-high-density lipoprotein cholesterol (TG-HDL) ratio in Japanese individuals: the Nagasaki Islands Study.

    Science.gov (United States)

    Shimizu, Yuji; Nakazato, Mio; Sekita, Takaharu; Koyamatsu, Jun; Kadota, Koichiro; Yamasaki, Hironori; Goto, Hisashi; Takamura, Noboru; Aoyagi, Kiyoshi; Maeda, Takahiro

    2014-01-01

    Our previous study reported that categorizing diabetes patients according to the serum triglycerides-to-high-density lipoprotein cholesterol (TG-HDL) ratio is useful for estimating the risk of atherosclerosis, as a high TG-HDL ratio in patients with diabetes constitutes risk factors for atherosclerosis. Another study showed that a high hemoglobin level is associated with the risk of atherosclerosis. However, no previous studies have examined the association between the hemoglobin level and diabetes categorized by the TG-HDL ratio. In order to investigate these associations, we conducted a cross-sectional study of 3,733 (1,299 men and 2,434 women) Japanese participants 30-89 years of age undergoing a general health checkup. We investigated the association between the hemoglobin levels and the incidence of diabetes in all subjects, who were divided into tertiles according to the TG-HDL ratio. Diabetes was defined as an HbA1c (NGSP) level of ≥ 6.5% and/or the initiation of glucose-lowering or insulin therapy. Of the 265 diabetes patients identified in this study, 116 had a high TG-HDL ratio (high TG-HDL diabetes) and 71 had a low TG-HDL ratio (low TG-HDL diabetes). Independent from classical cardiovascular risk factors, the multivariate odds ratio of a 1 SD (standard deviation) increment in hemoglobin (1.30 g/dL for men, 1.16 g/dL for women) was 1.04 (95% confidence intervals (CI): 0.88-1.22) for all patients with diabetes, 1.44 (95%CI: 1.17-1.77) for the patients with high TG-HDL diabetes and 0.67 (95%CI: 0.54-0.83) for the patients with low TG-HDL diabetes. The hemoglobin level is positively associated with high TG-HDL diabetes and inversely associated with low TG-HDL diabetes. These findings suggest that measuring the hemoglobin level is clinically relevant for estimating the risk of atherosclerosis in patients with diabetes categorized according to the TG-HDL ratio.

  10. (TG/CAn repeats in human gene families: abundance and selective patterns of distribution according to function and gene length

    Directory of Open Access Journals (Sweden)

    Ramachandran Srinivasan

    2005-06-01

    Full Text Available Abstract Background Creation of human gene families was facilitated significantly by gene duplication and diversification. The (TG/CAn repeats exhibit length variability, display genome-wide distribution, and are abundant in the human genome. Accumulation of evidences for their multiple functional roles including regulation of transcription and stimulation of recombination and splicing elect them as functional elements. Here, we report analysis of the distribution of (TG/CAn repeats in human gene families. Results The 1,317 human gene families were classified into six functional classes. Distribution of (TG/CAn repeats were analyzed both from a global perspective and from a stratified perspective based on their biological properties. The number of genes with repeats decreased with increasing repeat length and several genes (53% had repeats of multiple types in various combinations. Repeats were positively associated with the class of Signaling and communication whereas, they were negatively associated with the classes of Immune and related functions and of Information. The proportion of genes with (TG/CAn repeats in each class was proportional to the corresponding average gene length. The repeat distribution pattern in large gene families generally mirrored the global distribution pattern but differed particularly for Collagen gene family, which was rich in repeats. The position and flanking sequences of the repeats of Collagen genes showed high conservation in the Chimpanzee genome. However the majority of these repeats displayed length polymorphism. Conclusion Positive association of repeats with genes of Signaling and communication points to their role in modulation of transcription. Negative association of repeats in genes of Information relates to the smaller gene length, higher expression and fundamental role in cellular physiology. In genes of Immune and related functions negative association of repeats perhaps relates to the smaller gene

  11. The glass transition and interfacial dynamics of single strand fibers of polymers.

    Science.gov (United States)

    Cho, Hyun Woo; Sung, Bong June

    2017-02-08

    We investigate the glass transition and interfacial dynamics of single strand fibers of flexible polymers by employing molecular dynamics (MD) simulations along with a coarse grained model. While the polymer fiber has drawn significant attention due to its applicability in tissue engineering and stretchable electronics, its dynamic properties, especially the glass transition temperature (Tg), are yet to be understood at the molecular level. For example, there has been a controversy on the effect of the polymer fiber radius (R) on Tg: Tg decreased with a decrease in R for some polymer fibers, whereas Tg of other polymer fibers was not sensitive to R. In this article, we estimate the bond relaxation time of polymers and evaluate both Tg and fragility (m) as a function of R. We illustrate that Tg of the polymer fiber decreased with a decrease in R monotonically and also that the values of Tg follow faithfully the empirical equation proposed by Keddie et al. as a function of R, which was successfully employed to fit the values of Tg of both polyvinyl alcohol (PVA) fibers and polyethylene (PE) fibers. We also find that the dynamics of polymers at the interface between a polymer fiber and air is faster than that of polymers at the center. By employing Adam-Gibbs theory, we show that the fast interface dynamics of polymer fibers should influence the cooperative motion of monomers, which should be responsible for the decrease in Tg for smaller values of R. Near the interface there are more mobile monomers that participate in the cooperative motions of polymers. Interesting is that due to the curved surface (unlike flat polymer films) the cooperative motion of monomers is anisotropic in polymer fibers.

  12. Sleep-Wake Cycle Dysfunction in the TgCRND8 Mouse Model of Alzheimer's Disease: From Early to Advanced Pathological Stages.

    Science.gov (United States)

    Colby-Milley, Jessica; Cavanagh, Chelsea; Jego, Sonia; Breitner, John C S; Quirion, Rémi; Adamantidis, Antoine

    2015-01-01

    In addition to cognitive decline, individuals affected by Alzheimer's disease (AD) can experience important neuropsychiatric symptoms including sleep disturbances. We characterized the sleep-wake cycle in the TgCRND8 mouse model of AD, which overexpresses a mutant human form of amyloid precursor protein resulting in high levels of β-amyloid and plaque formation by 3 months of age. Polysomnographic recordings in freely-moving mice were conducted to study sleep-wake cycle architecture at 3, 7 and 11 months of age and corresponding levels of β-amyloid in brain regions regulating sleep-wake states were measured. At all ages, TgCRND8 mice showed increased wakefulness and reduced non-rapid eye movement (NREM) sleep during the resting and active phases. Increased wakefulness in TgCRND8 mice was accompanied by a shift in the waking power spectrum towards fast frequency oscillations in the beta (14-20 Hz) and low gamma range (20-50 Hz). Given the phenotype of hyperarousal observed in TgCRND8 mice, the role of noradrenergic transmission in the promotion of arousal, and previous work reporting an early disruption of the noradrenergic system in TgCRND8, we tested the effects of the alpha-1-adrenoreceptor antagonist, prazosin, on sleep-wake patterns in TgCRND8 and non-transgenic (NTg) mice. We found that a lower dose (2 mg/kg) of prazosin increased NREM sleep in NTg but not in TgCRND8 mice, whereas a higher dose (5 mg/kg) increased NREM sleep in both genotypes, suggesting altered sensitivity to noradrenergic blockade in TgCRND8 mice. Collectively our results demonstrate that amyloidosis in TgCRND8 mice is associated with sleep-wake cycle dysfunction, characterized by hyperarousal, validating this model as a tool towards understanding the relationship between β-amyloid overproduction and disrupted sleep-wake patterns in AD.

  13. Sleep-Wake Cycle Dysfunction in the TgCRND8 Mouse Model of Alzheimer's Disease: From Early to Advanced Pathological Stages.

    Directory of Open Access Journals (Sweden)

    Jessica Colby-Milley

    Full Text Available In addition to cognitive decline, individuals affected by Alzheimer's disease (AD can experience important neuropsychiatric symptoms including sleep disturbances. We characterized the sleep-wake cycle in the TgCRND8 mouse model of AD, which overexpresses a mutant human form of amyloid precursor protein resulting in high levels of β-amyloid and plaque formation by 3 months of age. Polysomnographic recordings in freely-moving mice were conducted to study sleep-wake cycle architecture at 3, 7 and 11 months of age and corresponding levels of β-amyloid in brain regions regulating sleep-wake states were measured. At all ages, TgCRND8 mice showed increased wakefulness and reduced non-rapid eye movement (NREM sleep during the resting and active phases. Increased wakefulness in TgCRND8 mice was accompanied by a shift in the waking power spectrum towards fast frequency oscillations in the beta (14-20 Hz and low gamma range (20-50 Hz. Given the phenotype of hyperarousal observed in TgCRND8 mice, the role of noradrenergic transmission in the promotion of arousal, and previous work reporting an early disruption of the noradrenergic system in TgCRND8, we tested the effects of the alpha-1-adrenoreceptor antagonist, prazosin, on sleep-wake patterns in TgCRND8 and non-transgenic (NTg mice. We found that a lower dose (2 mg/kg of prazosin increased NREM sleep in NTg but not in TgCRND8 mice, whereas a higher dose (5 mg/kg increased NREM sleep in both genotypes, suggesting altered sensitivity to noradrenergic blockade in TgCRND8 mice. Collectively our results demonstrate that amyloidosis in TgCRND8 mice is associated with sleep-wake cycle dysfunction, characterized by hyperarousal, validating this model as a tool towards understanding the relationship between β-amyloid overproduction and disrupted sleep-wake patterns in AD.

  14. High-sensitivity human thyroglobulin (hTG) immunoradiometric assay in the follow-up of patients with differentiated thyroid cancer.

    Science.gov (United States)

    Giovanella, Luca; Ceriani, Luca

    2002-05-01

    Circulating human thyroglobulin (hTG) measurement has a pivotal role in the management of patients affected by differentiated thyroid cancer (DTC). Generally, hTG serum concentration less than 1 ng/ml is considered a marker of complete remission after total thyroid ablation. Recently, high-sensitivity immunoradiometric assays (IRMA) have been developed to detect very low hTG serum concentrations. The present study was undertaken to test a newly developed high-sensitivity hTG IRMA and to evaluate its diagnostic performance and reproducibility in the follow-up of patients affected by DTC. We retrospectively selected 156 patients without signs of recurrence and 39 patients with DTC recurrence. Serum samples were collected during L-thyroxine (T4) suppressive therapy (ONT4) and 4 weeks after T4 withdrawal (OFFT4), and hTG was measured by a specific high-sensitivity IRMA (DYNOtest Tg-plus, BRAHMS Diagnostica GmbH, Berlin, Germany). Sera showing the presence of antibodies against hTG (AbhTG) or hTG-recovery less than 80% were excluded from the study. The receiver operator characteristic (ROC) curve analysis was performed to select the best cut-off levels, and diagnostic performance of the marker was evaluated. By using ONT4 cut-off level of 0.2 ng/ml and OFFT4 cut-off level of 0.5 ng/ml we obtained a sensitivity/specificity/accuracy profile of 0.92/0.98/0.97 and 0.97/0.98/0.98, respectively. We found false-negative results in three (12%) and one (4%) out of 24 patients with cervical recurrence by using 0.2 and 0.5 ng/ml cut-off levels, respectively. However, we found false-negative results in 13 (54%) and six (25%) patients when 1.0 ng/ml cut-off level was used. Finally, DYNOtest Tg-plus showed a very satisfactory intra- and inter-assay reproducibility in the very low hTG concentration range. Based on our data, we conclude that DYNOtest Tg-plus assay is effective and accurate in evaluation of patients with DTC.

  15. A novel Toxoplasma gondii nuclear factor TgNF3 is a dynamic chromatin-associated component, modulator of nucleolar architecture and parasite virulence.

    Directory of Open Access Journals (Sweden)

    Alejandro Olguin-Lamas

    2011-03-01

    Full Text Available In Toxoplasma gondii, cis-acting elements present in promoter sequences of genes that are stage-specifically regulated have been described. However, the nuclear factors that bind to these cis-acting elements and regulate promoter activities have not been identified. In the present study, we performed affinity purification, followed by proteomic analysis, to identify nuclear factors that bind to a stage-specific promoter in T. gondii. This led to the identification of several nuclear factors in T. gondii including a novel factor, designated herein as TgNF3. The N-terminal domain of TgNF3 shares similarities with the N-terminus of yeast nuclear FK506-binding protein (FKBP, known as a histone chaperone regulating gene silencing. Using anti-TgNF3 antibodies, HA-FLAG and YFP-tagged TgNF3, we show that TgNF3 is predominantly a parasite nucleolar, chromatin-associated protein that binds specifically to T. gondii gene promoters in vivo. Genome-wide analysis using chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq identified promoter occupancies by TgNF3. In addition, TgNF3 has a direct role in transcriptional control of genes involved in parasite metabolism, transcription and translation. The ectopic expression of TgNF3 in the tachyzoites revealed dynamic changes in the size of the nucleolus, leading to a severe attenuation of virulence in vivo. We demonstrate that TgNF3 physically interacts with H3, H4 and H2A/H2B assembled into bona fide core and nucleosome-associated histones. Furthermore, TgNF3 interacts specifically to histones in the context of stage-specific gene silencing of a promoter that lacks active epigenetic acetylated histone marks. In contrast to virulent tachyzoites, which express the majority of TgNF3 in the nucleolus, the protein is exclusively located in the cytoplasm of the avirulent bradyzoites. We propose a model where TgNF3 acts essentially to coordinate nucleolus and nuclear functions by modulating

  16. ANÁLISES DE PROTOCOLOS TELETERÁPICOS DE CONTROLE DE QUALIDADE DE ALGUNS SERVIÇOS LOCAIS, BASEADOS NO TG40 E ARCAL XXX Routine teletherapy quality control protocols based on TG40 and ARCAL XXX

    Directory of Open Access Journals (Sweden)

    Carmen S. Guzmán Calcina

    2002-01-01

    Full Text Available Considerando a importância da garantia da qualidade nos serviços de radioterapia, este trabalho tem como primeiro objetivo fazer uma avaliação dos testes propostos pelos protocolos oficiais internacionais TG40 e ARCAL XXX para os equipamentos de cobalto, acelerador linear e simulador. O segundo objetivo consistiu em se fazer uma avaliação dos testes que atualmente são realizados por alguns serviços de radioterapia nacionais e da América Latina, comparando-os com os apresentados nos protocolos citados. Dos resultados obtidos, observou-se que embora o TG40 apresente os testes básicos necessários para um controle de qualidade adequado, o ARCAL ainda sugere testes complementares. Dos resultados e discussões, concluiu-se que é necessário que os serviços de radioterapia implementem os testes de controle de qualidade básicos e indispensáveis aos seus equipamentos, e que os demais testes sejam implementados de acordo com as suas necessidades e disponibilidades. Como produto deste estudo, sugestões de protocolos são apresentadas para o trabalho de rotina, provenientes da fusão dos protocolos analisados.In view of the great importance of quality control in radiotherapy services, this paper aimed primarily to evaluate the tests recommended by international protocols TG40 and ARCAL XXX for teletherapic equipments (cobalt, linear accelerator and simulator. A second objective was to evaluate the tests currently used in some radiotherapy services in Brazil and Latin America and to compare these tests with the ones recommended by the international protocols. Our results suggest that ARCAL is more complete than TG40, although the latter includes all the essential basic tests. We concluded that radiotherapy services should implement all basic quality control tests and that all other complementary tests should be implemented according to the need of each service. Finally, suggestions of protocols are presented, elaborated from the official and

  17. Prolonged oral cannabinoid administration prevents neuroinflammation, lowers β-amyloid levels and improves cognitive performance in Tg APP 2576 mice

    Directory of Open Access Journals (Sweden)

    Martín-Moreno Ana María

    2012-01-01

    Full Text Available Abstract Background Alzheimer's disease (AD brain shows an ongoing inflammatory condition and non-steroidal anti-inflammatories diminish the risk of suffering the neurologic disease. Cannabinoids are neuroprotective and anti-inflammatory agents with therapeutic potential. Methods We have studied the effects of prolonged oral administration of transgenic amyloid precursor protein (APP mice with two pharmacologically different cannabinoids (WIN 55,212-2 and JWH-133, 0.2 mg/kg/day in the drinking water during 4 months on inflammatory and cognitive parameters, and on 18F-fluoro-deoxyglucose (18FDG uptake by positron emission tomography (PET. Results Novel object recognition was significantly reduced in 11 month old Tg APP mice and 4 month administration of JWH was able to normalize this cognitive deficit, although WIN was ineffective. Wild type mice cognitive performance was unaltered by cannabinoid administration. Tg APP mice showed decreased 18FDG uptake in hippocampus and cortical regions, which was counteracted by oral JWH treatment. Hippocampal GFAP immunoreactivity and cortical protein expression was unaffected by genotype or treatment. In contrast, the density of Iba1 positive microglia was increased in Tg APP mice, and normalized following JWH chronic treatment. Both cannabinoids were effective at reducing the enhancement of COX-2 protein levels and TNF-α mRNA expression found in the AD model. Increased cortical β-amyloid (Aβ levels were significantly reduced in the mouse model by both cannabinoids. Noteworthy both cannabinoids enhanced Aβ transport across choroid plexus cells in vitro. Conclusions In summary we have shown that chronically administered cannabinoid showed marked beneficial effects concomitant with inflammation reduction and increased Aβ clearance.

  18. SU-F-T-248: FMEA Risk Analysis Implementation (AAPM TG-100) in Total Skin Electron Irradiation Technique

    Energy Technology Data Exchange (ETDEWEB)

    Ibanez-Rosello, B; Bautista-Ballesteros, J; Bonaque, J [Hospital La Fe, Valencia, Valencia (Spain); Perez-Calatayud, J [Hospital La Fe, Valencia, Valencia (Spain); Clinica Benidorm, Benidorm, Alicante (Spain); Gonzalez-Sanchis, A; Lopez-Torrecilla, J; Brualla-Gonzalez, L; Garcia-Hernandez, T; Vicedo-Gonzalez, A; Granero, D; Serrano, A; Borderia, B; Solera, C [Hospital General ERESA, Valencia, Valencia (Spain); Rosello, J [Hospital General ERESA, Valencia, Valencia (Spain); Universidad de Valencia, Valencia, Valencia (Spain)

    2016-06-15

    Purpose: Total Skin Electron Irradiation (TSEI) is a radiotherapy treatment which involves irradiating the entire body surface as homogeneously as possible. It is composed of an extensive multi-step technique in which quality management requires high consumption of resources and a fluid communication between the involved staff, necessary to improve the safety of treatment. The TG-100 proposes a new perspective of quality management in radiotherapy, presenting a systematic method of risk analysis throughout the global flow of the stages through the patient. The purpose of this work has been to apply TG-100 approach to the TSEI procedure in our institution. Methods: A multidisciplinary team specifically targeting TSEI procedure was formed, that met regularly and jointly developed the process map (PM), following TG-100 guidelines of the AAPM. This PM is a visual representation of the temporal flow of steps through the patient since start until the end of his stay in the radiotherapy service. Results: This is the first stage of the full risk analysis, which is being carried out in the center. The PM provides an overview of the process and facilitates the understanding of the team members who will participate in the subsequent analysis. Currently, the team is implementing the analysis of failure modes and effects (FMEA). The failure modes of each of the steps have been identified and assessors are assigning a value of severity (S), frequency of occurrence (O) and lack of detection (D) individually. To our knowledge, this is the first PM made for the TSEI. The developed PM can be useful for those centers that intend to implement the TSEI technique. Conclusion: The PM of TSEI technique has been established, as the first stage of full risk analysis, performed in a reference center in this treatment.

  19. Prolonged oral cannabinoid administration prevents neuroinflammation, lowers β-amyloid levels and improves cognitive performance in Tg APP 2576 mice.

    Science.gov (United States)

    Martín-Moreno, Ana María; Brera, Begoña; Spuch, Carlos; Carro, Eva; García-García, Luis; Delgado, Mercedes; Pozo, Miguel A; Innamorato, Nadia G; Cuadrado, Antonio; de Ceballos, María L

    2012-01-16

    Alzheimer's disease (AD) brain shows an ongoing inflammatory condition and non-steroidal anti-inflammatories diminish the risk of suffering the neurologic disease. Cannabinoids are neuroprotective and anti-inflammatory agents with therapeutic potential. We have studied the effects of prolonged oral administration of transgenic amyloid precursor protein (APP) mice with two pharmacologically different cannabinoids (WIN 55,212-2 and JWH-133, 0.2 mg/kg/day in the drinking water during 4 months) on inflammatory and cognitive parameters, and on ¹⁸F-fluoro-deoxyglucose (¹⁸FDG) uptake by positron emission tomography (PET). Novel object recognition was significantly reduced in 11 month old Tg APP mice and 4 month administration of JWH was able to normalize this cognitive deficit, although WIN was ineffective. Wild type mice cognitive performance was unaltered by cannabinoid administration. Tg APP mice showed decreased ¹⁸FDG uptake in hippocampus and cortical regions, which was counteracted by oral JWH treatment. Hippocampal GFAP immunoreactivity and cortical protein expression was unaffected by genotype or treatment. In contrast, the density of Iba1 positive microglia was increased in Tg APP mice, and normalized following JWH chronic treatment. Both cannabinoids were effective at reducing the enhancement of COX-2 protein levels and TNF-α mRNA expression found in the AD model. Increased cortical β-amyloid (Aβ) levels were significantly reduced in the mouse model by both cannabinoids. Noteworthy both cannabinoids enhanced Aβ transport across choroid plexus cells in vitro. In summary we have shown that chronically administered cannabinoid showed marked beneficial effects concomitant with inflammation reduction and increased Aβ clearance.

  20. Early-life Sodium-exposure Unmasks Susceptibility to Stroke in hyperlipidemic-hypertensive Tg[hCETP]25-Rats

    Science.gov (United States)

    Decano, Julius L.; Viereck, Jason C.; McKee, Ann C.; Hamilton, James A.; Ruiz-Opazo, Nelson; Herrera, Victoria L.M.

    2009-01-01

    Background Early-life risk factor exposure increases aortic atherosclerosis and blood pressure in humans and animal models, however, limited insight has been made into end-organ complications. Methods and Results We investigated the effects of early-life Na-exposure (0.23% vs 0.4%NaCl regular-rat chow) on vascular disease outcomes using the inbred, transgenic[hCETP]25 Dahl salt-sensitive hypertensive rat model of male-predominant coronary atherosclerosis, Tg25. Rather than the expected increased coronary heart disease, fetal 0.4%Na-exposure (≤2g-Na/2000cal/diet/day) induced adult-onset stroke in both sexes (ANOVA Pcerebral cortical hemorrhagic infarctions, microhemorrhages, neuronal ischemia, microvascular injury. Ex-vivo MRI of stroke+ rat brains detected cerebral hemorrhages, microhemorrhages and ischemia with middle cerebral artery-distribution, and cerebellar non-involvement. Ultrasound micro-imaging detected carotid artery disease. Pre-stroke analysis detected neuronal ischemia, and decreased mass of isolated cerebral, but not cerebellar, microvessels. Conclusions Early-life Na-exposure exacerbated hypertension and unmasked stroke susceptibility with greater female vulnerability in hypertensive-hyperlipidemic Tg25-rats. The reproducible modeling in Tg25sp rats of carotid artery disease, cerebral hemorrhagic-infarctions, neuronal ischemia, microhemorrhages, and microvascular alterations suggests a pathogenic spectrum with causal interrelationships. This “mixed-stroke” spectrum could represent paradigms of ischemic-hemorrhagic transformation, and/or a microangiopathic basis for the association of ischemic-lesions, microhemorrhages, and strokes in humans. Altogether, the data reveal early-life Na-exposure as a significant modifier of hypertension and stroke disease-course, hence a potential modifiable prevention target deserving systematic study. PMID:19273719

  1. Investigation of thermodynamic properties of magnesium chloride amines by HPDSC and TG. For application in a high-lift high-temperature chemical heat pump

    NARCIS (Netherlands)

    Bevers, E.R.T.; Oonk, H.A.J.; Haije, W.G.; Ekeren, P.J. van

    2007-01-01

    The formation as well as the decomposition of magnesium chloride ammonia complexes was studied by high-pressure differential scanning calorimetry (HPDSC) and thermogravimetric analysis (TG). HPDSC runs were performed under constant ammonia pressure conditions to determine the transition temperatures

  2. Estimation of local confidence limit for 6 MV photon beam IMRT system using AAPM TG 119 test protocol

    Directory of Open Access Journals (Sweden)

    Avinash Kadam

    2016-03-01

    Full Text Available Purpose: The aim of this study was to estimate local confidence limit for 6 MV photon beam based intensity modulated radiation therapy (IMRT using TG119 test protocol.Methods: The American Association of Physicists in Medicine (AAPM Task Group 119 (TG119 prescribed a protocol to evaluate overall accuracy of IMRT system rather than independent uncertainty in dose calculation, dose delivery and measurement system. Two preliminary and five clinical test cases were created based on dose prescriptions and planning objectives given by TG119 report. Verification plans were created in a planning slab phantom, 2D Matrix dosimetry system (I’MatriXX with multicube phantom and aS-1000 electronic portal imaging device (EPID. Radiation absorbed doses to high dose points in the planning target volume (PTV region and low dose points in avoidance structures were measured using CC13 ionization chamber having sensitive volume of 0.13 cm3. The measured and planned doses were normalized with respect to their prescription doses and intercompared. The gamma analysis was carried out for both I’MatriXX and EPID, adopting the acceptance criteria of 3% DD (dose difference and 3 mm DTA (distance to agreement with 10% threshold dose.Results: For the point dose measurements with ion chamber, the average dose difference ratio in high dose low gradient PTV region was -0.0133 ± 0.012 corresponding to a confidence limit of 0.037. The average dose difference in low dose region (avoidance structure was -0.00004 ± 0.010 corresponding to a confidence limit of 0.021. The average percentage of points passing the gamma criteria of 3% DD and 3 mm DTA for composite planar dose distribution measured by I’MatriXX was 99.47 ± 0.43 which corresponds to a confidence limit of 1.38 (i.e. 98.62% passing. Similarly, the average percentage of points passing the gamma criteria of 3% DD and 3 mm DTA for per-field dose distribution measured by EPID was 98.00 ± 2.49 which corresponds to a

  3. Implementation of a Quality Assurance Program in a new Radiotherapy Center taking as base the TG-40; Implementacion del programa de Garantia de Calidad en un Centro nuevo de Radioterapia tomando como base el TG-40

    Energy Technology Data Exchange (ETDEWEB)

    Marles, A.; Besa, P.; Hecht, P.; Arriagada, L.; Ruz, A.; Garay, C. [Pontificia Universidad Catolica de Chile, Centro de Cancer. Diagonal Paraguay, 319. Santiago (Chile)

    1998-12-31

    The recommended principles in the `Comprehensive QA for radiation oncology: Report of AAPM Radiation Therapy Committee Task Group 40`, TG-40, have been the base for implementation of the Quality Assurance Program of a modern Radiotherapy service. During its application has been necessary: to initiate its implementation before the equipment installation, assuming the costs of the contracts of the qualified personnel, realizing an initial investment adequate for equipment acquisition necessary for acceptation, commissioning and routinary control, the experienced formation of the personnel in the protocol philosophy, establishing procedures for day by day process which would allow the retrofeeding, the elaboration of templates and opening to changes and adjustments according to the necessities. The experience of two years had been demonstrated that the TG-40: a) It is feasible to be implemented but sometimes no strict totally and it is essential to have qualified personnel and the necessary material resources; b) It does not contains all the necessary for its practical implementation and must be completing with procedures and routine formats which facilitate their application; c) It allows the detection and opportune failure correction in the process; d) It is a continuous process that does not finishes. (Author)

  4. Identification of TG100-115 as a new and potent TRPM7 kinase inhibitor, which suppresses breast cancer cell migration and invasion.

    Science.gov (United States)

    Song, Chiman; Bae, Yeonju; Jun, JinJoo; Lee, Hyomin; Kim, Nam Doo; Lee, Kyung-Bok; Hur, Wooyoung; Park, Jae-Yong; Sim, Taebo

    2017-04-01

    Transient receptor potential melastatin 7 (TRPM7) regulates breast cancer cell proliferation, migration, invasion and metastasis in its ion channel- and kinase domain-dependent manner. The pharmacological effects of TRPM7 ion channel inhibitors on breast cancer cells have been studied, but little is known about the effects of TRPM7 kinase domain inhibitors due to lack of potent TRPM7 kinase inhibitors. Screening was performed by using TRPM7 kinase assay. Effects of TG100-115 on breast cancer cell proliferation, migration, invasion, myosin IIA phosphorylation, and TRPM7 ion channel activity were assessed by using MTT, wound healing, transwell assay, Western blotting, and patch clamping, respectively. We found that CREB peptide is a potent substrate for the TR-FRET based TRPM7 kinase assay. Using this method, we discovered a new and potent TRPM7 kinase inhibitor, TG100-115. TG100-115 inhibited TRPM7 kinase activity in an ATP competitive fashion with over 70-fold stronger activity than that of rottlerin, known as a TRPM7 kinase inhibitor. TG100-115 has little effect on proliferation of MDA-MB-231 cells, but significantly decreases cell migration and invasion. Moreover, TG100-115 inhibits TRPM7 kinase regulated phosphorylation of the myosin IIA heavy chain and phosphorylation of focal adhesion kinase. TG100-115 also suppressed TRPM7 ion channel activity. TG100-115 can be used as a potent TRPM7 kinase inhibitor and a potent inhibitor of breast cancer cell migration. TG100-115 could be a useful tool for studying the pharmacological effects of TRPM7 kinase activity aimed at providing insight into new therapeutic approaches to the treatment of breast cancer. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Efficient protein-repelling thin films regulated by chain mobility of low-Tg polymers with increased stability via crosslinking

    Science.gov (United States)

    Zhang, Jinghui; Huang, Zhiwei; Liu, Dan

    2017-12-01

    Polymer thin films are generally employed as coatings on implants to prevent protein adsorption. Polymer chain mobility and surface softness have been found to contribute to the protein resistance, but also bring film instability in a liquid protein medium. We investigated the protein resistance ability of three low-Tg polymers, including hydrophobic polymers polyisoprene (PI), poly(n-butyl methacrylate) (PnBMA) and hydrophilic polyethylene oxide (PEO), by overcoming the instability issue with crosslinking. We found that the Tgs of PI and PEO can be increased to around 0 °C after crosslinking. The remained strong chain mobility of both films can still resist protein adsorption regardless the hydrophobicity, yet greatly increases the film stability under an aqueous circumstance. The PnBMA film increased its Tg to around room temperature after crosslinking, which deteriorated the protein-resistance ability having the surface covered by BSA molecules. Our results support that the chain mobility of a polymer film plays an important role in resisting protein adsorption due to the increased entropy associated with more mobile polymer chains. By tune the degree of crosslinking, the stability of polymer in aqueous environment can be increased while the protein resistant ability can be remained. Our results provide a new strategy to design polymer materials for effective antifouling.

  6. Relationship of body weight parameters with the incidence of common spontaneous tumors in Tg.rasH2 mice.

    Science.gov (United States)

    Paranjpe, Madhav G; Denton, Melissa D; Vidmar, Tom J; Elbekai, Reem H

    2014-10-01

    The mechanistic relationship between increased food consumption, increased body weights, and increased incidence of tumors has been well established in 2-year rodent models. Body weight parameters such as initial body weights, terminal body weights, food consumption, and the body weight gains in grams and percentages were analyzed to determine whether such relationship exists between these parameters with the incidence of common spontaneous tumors in Tg.rasH2 mice. None of these body weight parameters had any statistically significant relationship with the incidence of common spontaneous tumors in Tg.rasH2 males, namely lung tumors, splenic hemangiosarcomas, nonsplenic hemangiosarcomas, combined incidence of all hemangiosarcomas, and Harderian gland tumors. These parameters also did not have any statistically significant relationship with the incidence of lung and Harderian gland tumors in females. However, in females, increased initial body weights did have a statistically significant relationship with the nonsplenic hemangiosarcomas, and increased terminal body weights did have a statistically significant relationship with the incidence of splenic hemangiosarcomas, nonsplenic hemangiosarcomas, and the combined incidence of all hemangiosarcomas. In addition, increased body weight gains in grams and percentages had a statistically significant relationship with the combined incidence of all hemangiosarcomas in females, but not separately with splenic and nonsplenic hemangiosarcomas. © 2013 by The Author(s).

  7. Mesenchymal Stem Cells Preserve Working Memory in the 3xTg-AD Mouse Model of Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Jiri Ruzicka

    2016-01-01

    Full Text Available The transplantation of stem cells may have a therapeutic effect on the pathogenesis and progression of neurodegenerative disorders. In the present study, we transplanted human mesenchymal stem cells (MSCs into the lateral ventricle of a triple transgenic mouse model of Alzheimer´s disease (3xTg-AD at the age of eight months. We evaluated spatial reference and working memory after MSC treatment and the possible underlying mechanisms, such as the influence of transplanted MSCs on neurogenesis in the subventricular zone (SVZ and the expression levels of a 56 kDa oligomer of amyloid β (Aβ*56, glutamine synthetase (GS and glutamate transporters (Glutamate aspartate transporter (GLAST and Glutamate transporter-1 (GLT-1 in the entorhinal and prefrontal cortices and the hippocampus. At 14 months of age we observed the preservation of working memory in MSC-treated 3xTg-AD mice, suggesting that such preservation might be due to the protective effect of MSCs on GS levels and the considerable downregulation of Aβ*56 levels in the entorhinal cortex. These changes were observed six months after transplantation, accompanied by clusters of proliferating cells in the SVZ. Since the grafted cells did not survive for the whole experimental period, it is likely that the observed effects could have been transiently more pronounced at earlier time points than at six months after cell application.

  8. Mesenchymal Stem Cells Preserve Working Memory in the 3xTg-AD Mouse Model of Alzheimer's Disease.

    Science.gov (United States)

    Ruzicka, Jiri; Kulijewicz-Nawrot, Magdalena; Rodrigez-Arellano, Jose Julio; Jendelova, Pavla; Sykova, Eva

    2016-01-25

    The transplantation of stem cells may have a therapeutic effect on the pathogenesis and progression of neurodegenerative disorders. In the present study, we transplanted human mesenchymal stem cells (MSCs) into the lateral ventricle of a triple transgenic mouse model of Alzheimer's disease (3xTg-AD) at the age of eight months. We evaluated spatial reference and working memory after MSC treatment and the possible underlying mechanisms, such as the influence of transplanted MSCs on neurogenesis in the subventricular zone (SVZ) and the expression levels of a 56 kDa oligomer of amyloid β (Aβ*56), glutamine synthetase (GS) and glutamate transporters (Glutamate aspartate transporter (GLAST) and Glutamate transporter-1 (GLT-1)) in the entorhinal and prefrontal cortices and the hippocampus. At 14 months of age we observed the preservation of working memory in MSC-treated 3xTg-AD mice, suggesting that such preservation might be due to the protective effect of MSCs on GS levels and the considerable downregulation of Aβ*56 levels in the entorhinal cortex. These changes were observed six months after transplantation, accompanied by clusters of proliferating cells in the SVZ. Since the grafted cells did not survive for the whole experimental period, it is likely that the observed effects could have been transiently more pronounced at earlier time points than at six months after cell application.

  9. Adaptation of the fish juvenile growth test (OECD TG 215, 2000) to the marine species Dicentrarchus labrax.

    Science.gov (United States)

    Tornambè, A; Manfra, L; Canepa, S; Oteri, F; Martuccio, G; Cicero, A M; Magaletti, E

    2018-02-01

    The OECD TG 215 method (2000) (C.14 method of EC Regulation 440/2008) was developed on the rainbow trout (Oncorynchus mykiss) to assess chronic toxicity (28d) of chemicals on fish juveniles. It contemplates to use other well documented species identifying suitable conditions to evaluate their growth. OECD proposes the European sea bass (Dicentrarchus labrax, L. 1758) as Mediterranean species among vertebrates recommended in the OECD guidelines for the toxicity testing of chemicals. In this context, our study is aimed to proposing the adaptation of the growth test (OECD TG 215, 2000) to D. labrax. For this purpose toxicity tests were performed with sodium dodecyl sulfate, a reference toxicant commonly used in fish toxicity assays. The main aspects of the testing procedure were reviewed: fish size (weight), environmental conditions, dilution water type, experimental design, loading rate and stocking density, feeding (food type and ration), test validity criteria. The experience gained from growth tests with the sea bass allows to promote its inclusion among the species to be used for the C.14 method. Copyright © 2016. Published by Elsevier Inc.

  10. Differential contribution of APP metabolites to early cognitive deficits in a TgCRND8 mouse model of Alzheimer's disease.

    Science.gov (United States)

    Hamm, Valentine; Héraud, Céline; Bott, Jean-Bastien; Herbeaux, Karine; Strittmatter, Carole; Mathis, Chantal; Goutagny, Romain

    2017-02-01

    Alzheimer's disease (AD) is a neurodegenerative pathology commonly characterized by a progressive and irreversible deterioration of cognitive functions, especially memory. Although the etiology of AD remains unknown, a consensus has emerged on the amyloid hypothesis, which posits that increased production of soluble amyloid β (Aβ) peptide induces neuronal network dysfunctions and cognitive deficits. However, the relative failures of Aβ-centric therapeutics suggest that the amyloid hypothesis is incomplete and/or that the treatments were given too late in the course of AD, when neuronal damages were already too extensive. Hence, it is striking to see that very few studies have extensively characterized, from anatomy to behavior, the alterations associated with pre-amyloid stages in mouse models of AD amyloid pathology. To fulfill this gap, we examined memory capacities as well as hippocampal network anatomy and dynamics in young adult pre-plaque TgCRND8 mice when hippocampal Aβ levels are still low. We showed that TgCRND8 mice present alterations in hippocampal inhibitory networks and γ oscillations at this stage. Further, these mice exhibited deficits only in a subset of hippocampal-dependent memory tasks, which are all affected at later stages. Last, using a pharmacological approach, we showed that some of these early memory deficits were Aβ-independent. Our results could partly explain the limited efficacy of Aβ-directed treatments and favor multitherapy approaches for early symptomatic treatment for AD.

  11. Quantitative evaluation of therapeutic effect of Liriope platyphylla on phthalic anhydride-induced atopic dermatitis in IL-4/Luc/CNS-1 Tg mice.

    Science.gov (United States)

    Kwak, Moon Hwa; Kim, Ji Eun; Hwang, In Sik; Lee, Young Ju; An, Bum Su; Hong, Jin Tae; Lee, Sang Hak; Hwang, Dae Youn

    2013-07-30

    A variety of previous pharmacological studies have suggested that Liriope platyphylla may exert beneficial biological effects on inflammation, diabetes, neurodegenerative disorder, obesity, and atopic dermatitis (AD). The therapeutic effect of aqueous extract of Liriope platyphylla (AEtLP) on AD was quantified using the luciferase report system in IL-4/Luc/CNS-1 transgenic (Tg) mice. Alteration of the luciferase signal was quantified in IL-4/Luc/CNS-1 Tg mice co-treated with phthalic anhydride (PA) and AEtLP for 2 weeks using the IVIS imaging system. Phenotypes of AD were assessed by ear thickness analysis, measurement of immune-related organ weights, ELISA, and histological and pathological analysis in Tg mice. A strong luciferase signal was detected in the abdominal region of IL-4/Luc/CNS-1 Tg mice treated with only PA. However, this signal was significantly reduced in IL-4/Luc/CNS-1 Tg mice co-treated with PA+AEtLP in an AEtLP concentration-dependent manner. Especially, three organs, the thymus, pancreas, and submandibular lymph node (SL), showed a high signal response to PA treatment. Furthermore, to verify whether or not alteration of the luciferase signal is associated with AD, these disease response phenotypes were measured in the same group of mice. Common allergenic responses including increases in ear thickness, lymph node weight, IgE concentration, and infiltrated mast cells were detected in IL-4/Luc/CNS-1 Tg mice treated with PA. However, these responses were dramatically decreased by AEtLP treatment for 2 weeks. These results indicate that the luciferase signal may successfully reflect the therapeutic effects of AEtLP in IL-4/Luc/CNS-1 Tg mice. Further, we suggest additional evidence that Liriope platyphylla may be considered as an effective therapeutic drug for the treatment of AD. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  12. Functional characterization of the common c.-32-13T>G mutation of GAA gene: identification of potential therapeutic agents.

    Science.gov (United States)

    Dardis, Andrea; Zanin, Irene; Zampieri, Stefania; Stuani, Cristiana; Pianta, Annalisa; Romanello, Milena; Baralle, Francisco E; Bembi, Bruno; Buratti, Emanuele

    2014-01-01

    Glycogen storage disease type II is a lysosomal storage disorder due to mutations of the GAA gene, which causes lysosomal alpha-glucosidase deficiency. Clinically, glycogen storage disease type II has been classified in infantile and late-onset forms. Most late-onset patients share the leaky splicing mutation c.-32-13T>G. To date, the mechanism by which the c.-32-13T>G mutation affects the GAA mRNA splicing is not fully known. In this study, we demonstrate that the c.-32-13T>G mutation abrogates the binding of the splicing factor U2AF65 to the polypyrimidine tract of exon 2 and that several splicing factors affect exon 2 inclusion, although the only factor capable of acting in the c.-32-13 T>G context is the SR protein family member, SRSF4 (SRp75). Most importantly, a preliminary screening using small molecules described to be able to affect splicing profiles, showed that resveratrol treatment resulted in a significant increase of normal spliced GAA mRNA, GAA protein content and activity in cells transfected with a mutant minigene and in fibroblasts from patients carrying the c-32-13T>G mutation. In conclusion, this work provides an in-depth functional characterization of the c.-32-13T>G mutation and, most importantly, an in vitro proof of principle for the use of small molecules to rescue normal splicing of c.-32-13T>G mutant alleles.

  13. [Interobserver and intraobserver reliability of corneal surface temperature measurements with the TG-1000 thermograph in normal eyes].

    Science.gov (United States)

    Pattmöller, M; Wang, J; Pattmöller, J; Zemova, E; Eppig, T; Seitz, B; Szentmáry, N; Langenbucher, A

    2015-09-01

    The aim of this study was to analyze the reliability of temperature measurements with the ocular TG-1000 thermograph in a setup of sequential measurements performed by one observer (intraobserver) and a sequence of measurements performed by different observers (interobserver) in normal subjects without pathologies of the anterior segment of the eye. A total of 50 right eyes from 50 individuals (mean age 29.1 ± 7.9 years) without ocular pathologies or history of ocular surgery were enrolled in this prospective monocentric clinical case series. Eyes with signs of dry eye syndrome (based on a positive McMonnies questionnaire) were excluded from the study. Corneal surface temperature measurements were performed by three examiners to assess interobserver reliability. In addition, in a subgroup of 22 individuals, a sequence of 3 measurements were performed by 1 of the examiners to examine intraobserver reliability. Corneal surface temperature was measured within an interval of 10 s (11 frames) on a region of interest of 16 ± 12 mm (320 ± 240 pixels). Central and mid-peripheral local temperatures at 3 mm (3, 6, 9 and 12 o'clock) were extracted and analyzed from the raw data. The ocular TG-1000 thermograph yielded consistent results for the interobserver as well as intraobserver conditions in measuring corneal surface temperature in the center as well as mid-periphery of the cornea. Cronbach's alpha was 0.9 or higher at all corneal locations, which proves a high consistency of results for the interobserver and intraobserver measurements. The average corneal surface temperature ranged between 34.0 °C and 34.7 °C with a slight decrease from the upper temporal (9 and 12 o'clock) to the lower nasal (3 and 6 o'clock) quadrants. The TG-1000 thermograph yielded consistent results of corneal surface temperature in individuals without anterior segment pathologies or history of ocular surgery. With the option of raw data export (11 frames within 10 s with a

  14. Enrichment and purging of human embryonic stem cells by detection of cell surface antigens using the monoclonal antibodies TG30 and GCTM-2.

    Science.gov (United States)

    Polanco, Juan Carlos; Wang, Bei; Zhou, Qi; Chy, Hun; O'Brien, Carmel; Laslett, Andrew L

    2013-12-06

    Human embryonic stem cells (hESC) can self-renew indefinitely in vitro, and with the appropriate cues can be induced to differentiate into potentially all somatic cell lineages. Differentiated hESC derivatives can potentially be used in transplantation therapies to treat a variety of cell-degenerative diseases. However, hESC differentiation protocols usually yield a mixture of differentiated target and off-target cell types as well as residual undifferentiated cells. For the translation of differentiated hESC-derivatives from the laboratory to the clinic, it is important to be able to discriminate between undifferentiated (pluripotent) and differentiated cells, and generate methods to separate these populations. Safe application of hESC-derived somatic cell types can only be accomplished with pluripotent stem cell-free populations, as residual hESCs could induce tumors known as teratomas following transplantation. Towards this end, here we describe a methodology to detect pluripotency associated cell surface antigens with the monoclonal antibodies TG30 (CD9) and GCTM-2 via fluorescence activated cell sorting (FACS) for the identification of pluripotent TG30(Hi)-GCTM-2(Hi) hESCs using positive selection. Using negative selection with our TG30/GCTM-2 FACS methodology, we were able to detect and purge undifferentiated hESCs in populations undergoing very early-stage differentiation (TG30(Neg)-GCTM-2(Neg)). In a further study, pluripotent stem cell-free samples of differentiated TG30(Neg)-GCTM-2(Neg) cells selected using our TG30/GCTM-2 FACS protocol did not form teratomas once transplanted into immune-compromised mice, supporting the robustness of our protocol. On the other hand, TG30/GCTM-2 FACS-mediated consecutive passaging of enriched pluripotent TG30(Hi)-GCTM-2(Hi) hESCs did not affect their ability to self-renew in vitro or their intrinsic pluripotency. Therefore, the characteristics of our TG30/GCTM-2 FACS methodology provide a sensitive assay to obtain highly

  15. Acoustic Doppler current profiling from the JGOFS Arabian Sea cruises aboard the RV T.G. Thompson

    Energy Technology Data Exchange (ETDEWEB)

    Kim, H.S.; Flagg, C.N.; Shi, Y. [Brookhaven National Lab., Upton, NY (United States). Oceanographic and Atmospheric Sciences Div.

    1996-12-01

    Acoustic Doppler current profiler (ADCP) data is part of the core data for the US JGOFS Arabian Sea project, along with hydrographic and nutrient data. Seventeen cruises are scheduled to take place between September 1994 and January 1996 on the R/V T.G. Thompson. Seven of the cruises follow a standard cruise track, taking hydrographic, chemical and biological measurements. The rest of the cruises, which take place generally within the standard cruise region defined by a set track, are for the deployment and recovery of moored equipment and towing of a SeaSoar. Detailed description of ADCP hardware, the AutoADCP data acquisition system, and the collection of navigation and compass data on the Thompson is documented in Section 2. Followed by data collection for each cruise together with a cruise track, Section 3 presents the processing and analysis of velocity and acoustic backscatter intensity data. Section 5 shows results of profile quality diagnosis.

  16. Tau causes synapse loss without disrupting calcium homeostasis in the rTg4510 model of tauopathy.

    Directory of Open Access Journals (Sweden)

    Katherine J Kopeikina

    Full Text Available Neurofibrillary tangles (NFTs of tau are one of the defining hallmarks of Alzheimer's disease (AD, and are closely associated with neuronal degeneration. Although it has been suggested that calcium dysregulation is important to AD pathogenesis, few studies have probed the link between calcium homeostasis, synapse loss and pathological changes in tau. Here we test the hypothesis that pathological changes in tau are associated with changes in calcium by utilizing in vivo calcium imaging in adult rTg4510 mice that exhibit severe tau pathology due to over-expression of human mutant P301L tau. We observe prominent dendritic spine loss without disruptions in calcium homeostasis, indicating that tangles do not disrupt this fundamental feature of neuronal health, and that tau likely induces spine loss in a calcium-independent manner.

  17. An amperometric immunosensor for diagnosis of celiac disease based on covalent immobilization of open conformation tissue transglutaminase for determination of anti-tTG antibodies in human serum.

    Science.gov (United States)

    Giannetto, Marco; Mattarozzi, Monica; Umiltà, Eleonora; Manfredi, Anita; Quaglia, Sara; Careri, Maria

    2014-12-15

    A new amperometric immunosensor based on the covalent immobilization of tissue transglutaminase enzyme in its open conformation (open-tTG) was developed and optimized for determination of anti-tissue transglutaminase antibodies (anti-tTG) in human serum. Experimental design allowed us to find the optimal conditions for quantification of both IgA and IgG isotypes of anti-tTG in order to assess suitability of the device for diagnostic purposes. The glassy carbon electrodic substrate was electrochemically functionalized with gold nanoparticles and subsequently derivatized with a self-assembled monolayer of 11-mercaptoundecanoic acid for the covalent anchoring of the enzyme. This step was performed under carefully controlled conditions in order to keep the open conformation of the tTG. The immunosensor showed good analytical performance with limit of detection levels (1.7 AU mL(-1) for IgA and 2.7 AU mL(-1) for IgG) below the diagnostic threshold value (3.0 AU mL(-1)) and inter-sensor reproducibility giving RSD lower than 10%. The developed sensor was validated in serum samples from pediatric patients for clinical applications, using two ELISA kits specific for the determination of anti-tTG IgA and IgG antibodies as reference methods; good recovery rates ranging from 74% to 117% were calculated. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Mobility of coated and uncoated TiO2 nanomaterials in soil columns--Applicability of the tests methods of OECD TG 312 and 106 for nanomaterials.

    Science.gov (United States)

    Nickel, Carmen; Gabsch, Stephan; Hellack, Bryan; Nogowski, Andre; Babick, Frank; Stintz, Michael; Kuhlbusch, Thomas A J

    2015-07-01

    Nanomaterials are commonly used in everyday life products and during their life cycle they can be released into the environment. Soils and sediments are estimated as significant sinks for those nanomaterials. To investigate and assess the behaviour of nanomaterials in soils and sediments standardized test methods are needed. In this study the applicability of two existing international standardized test guidelines for the testing of nanomaterials, OECD TG 106 "Adsorption/Desorption using a Bath Equilibrium Method" and the OECD TG 312 "Leaching in Soil Columns", were investigated. For the study one coated and two uncoated TiO2 nanomaterials were used, respectively. The results indicate that the OECD TG 106 is not applicable for nanomaterials. However, the test method according to OECD TG 312 was found to be applicable if nano-specific adaptations are applied. The mobility investigations of the OECD TG 312 indicated a material-dependent mobility of the nanomaterials, which in some cases may lead to an accumulation in the upper soil layers. Whereas no significant transport was observed for the uncoated materials for the double-coated material (coating with dimethicone and aluminiumoxide) a significant transport was detected and attributed to the coating. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. On-line monitoring of pine needles combustion emissions in the presence of fire retardant using a "thermogravimetry (TG)-bridge/mass spectrometry method".

    Science.gov (United States)

    Tzamtzis, N; Karma, S; Pappa, A; Statheropoulos, M

    2006-07-28

    In this work a new method called TG-bridge/mass spectrometry is presented, for the on-line monitoring of the pine needles combustion emissions in a common lab furnace. The TG-bridge (thermogravimetry-bridge) system has been developed in-house as a TG-MS (thermogravimetry-mass spectrometry) interface, for TG-MS analysis. In this work, TG-bridge was used for directly sampling of the combustion emissions from the inside of the furnace and transferring them into the mass spectrometer (MS), without disturbing the sub-pressure conditions inside the MS ion source. The effect of Fire-Trol 931 (a long-term fire retardant) on the emissions, produced during the combustion of pine needles, is tested in the lab for future application in the field. It was shown that in treated samples, increased evolution of ammonia and aromatic compounds took place, compared to untreated samples. Maximum concentrations of specific compounds, such as benzene and toluene, evolved during the combustion experiments in the furnace, were determined.

  20. Reduced voltage sensitivity of activation of P/Q-type Ca2+ channels is associated with the ataxic mouse mutation rolling Nagoya (tg(rol)).

    Science.gov (United States)

    Mori, Y; Wakamori, M; Oda, S; Fletcher, C F; Sekiguchi, N; Mori, E; Copeland, N G; Jenkins, N A; Matsushita, K; Matsuyama, Z; Imoto, K

    2000-08-01

    Recent genetic analyses have revealed an important association of the gene encoding the P/Q-type voltage-dependent Ca(2+) channel alpha(1A) subunit with hereditary neurological disorders. We have identified the ataxic mouse mutation, rolling Nagoya (tg(rol)), in the alpha(1A) gene that leads to a charge-neutralizing arginine-to-glycine substitution at position 1262 in the voltage sensor-forming segment S4 in repeat III. Ca(2+) channel currents in acutely dissociated Purkinje cells, where P-type is the dominant type, showed a marked decrease in slope and a depolarizing shift by 8 mV of the conductance-voltage curve and reduction in current density in tg(rol) mouse cerebella, compared with those in wild-type. Compatible functional change was induced by the tg(rol) mutation in the recombinant alpha(1A) channel, indicating that a defect in voltage sensor of P/Q-type Ca(2+) channels is the direct consequence of the tg(rol) mutation. Furthermore, somatic whole-cell recording of mutant Purkinje cells displayed only abortive Na(+) burst activity and hardly exhibited Ca(2+) spike activity in cerebellar slices. Thus, in tg(rol) mice, reduced voltage sensitivity, which may derive from a gating charge defect, and diminished activity of the P-type alpha(1A) Ca(2+) channel significantly impair integrative properties of Purkinje neurons, presumably resulting in locomotor deficits.

  1. Reference and working memory deficits in the 3xTg-AD mouse between 2 and 15-months of age: a cross-sectional study.

    Science.gov (United States)

    Stevens, Leanne M; Brown, Richard E

    2015-02-01

    Impairments in working memory (WM) can predict the shift from mild cognitive impairment (MCI) to Alzheimer's disease (AD) and the rate at which AD progresses with age. The 3xTg-AD mouse model develops both Aβ plaques and neurofibrillary tangles, the neuro-pathological hallmarks of AD, by 6 months of age, but no research has investigated the age-related changes in WM in these mice. Using a cross-sectional design, we tested male and female 3xTg-AD and wildtype control (B6129SF2/J) mice between 2 and 15 months of age for reference and working memory errors in the 8-arm radial maze. The 3xTg-AD mice had deficits in both working and reference memory across the ages tested, rather than showing the predicted age-related memory deficits. Male 3xTg-AD mice showed more working and reference memory errors than females, but there were no sex differences in wildtype control mice. These results indicate that the 3xTg-AD mouse replicates the impairments in WM found in patients with AD. However, these mice show memory deficits as early as two months of age, suggesting that the genes underlying reference and working memory in these mice cause deficits from an early age. The finding that males were affected more than females suggests that more attention should be paid to sex differences in transgenic AD mice. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Análise TG-ROC de testes de imunofluorescência no diagnóstico de leishmaniose visceral canina Análisis TG-ROC de pruebas de inmunofluorescencia en el diagnóstico de leishmaniasis visceral canina TG-ROC analysis of immunofluorescence assays in canine visceral leishmaniasis diagnosis

    Directory of Open Access Journals (Sweden)

    Rita Maria da Silva

    2009-12-01

    Full Text Available OBJETIVO: Analisar a acurácia do diagnóstico de dois protocolos de imunofluorescência indireta para leishmaniose visceral canina. MÉTODOS: Cães provenientes de inquérito soroepidemiológico realizado em área endêmica nos municípios de Araçatuba e de Andradina, na região noroeste do estado de São Paulo, em 2003, e área não endêmica da região metropolitana de São Paulo, foram utilizados para avaliar comparativamente dois protocolos da reação de imunofluorescência indireta (RIFI para leishmaniose: um utilizando antígeno heterólogo Leishmania major (RIFI-BM e outro utilizando antígeno homólogo Leishmania chagasi (RIFI-CH. Para estimar acurácia utilizou-se a análise two-graph receiver operating characteristic (TG-ROC. A análise TG-ROC comparou as leituras da diluição 1:20 do antígeno homólogo (RIFI-CH, consideradas como teste referência, com as diluições da RIFI-BM (antígeno heterólogo. RESULTADOS: A diluição 1:20 do teste RIFI-CH apresentou o melhor coeficiente de contingência (0,755 e a maior força de associação entre as duas variáveis estudadas (qui-quadrado=124,3, sendo considerada a diluição-referência do teste nas comparações com as diferentes diluições do teste RIFI-BM. Os melhores resultados do RIFI-BM foram obtidos na diluição 1:40, com melhor coeficiente de contingência (0,680 e maior força de associação (qui-quadrado=80,8. Com a mudança do ponto de corte sugerido nesta análise para a diluição 1:40 da RIFI-BM, o valor do parâmetro especificidade aumentou de 57,5% para 97,7%, embora a diluição 1:80 tivesse apresentado a melhor estimativa para sensibilidade (80,2% com o novo ponto de corte. CONCLUSÕES: A análise TG-ROC pode fornecer importantes informações sobre os testes de diagnósticos, além de apresentar sugestões sobre pontos de cortes que podem melhorar as estimativas de sensibilidade e especificidade do teste, e avaliá-los a luz do melhor custo

  3. Characteristics of TBS-extractable hyperphosphorylated tau species: Aggregation intermediates in rTg4510 mouse brain

    Science.gov (United States)

    Sahara, Naruhiko; DeTure, Michael; Ren, Yan; Ebrahim, Abdul-Shukkur; Kang, Dongcheul; Knight, Joshua; Volbracht, Christiane; Pedersen, Jan Torleif; Dickson, Dennis W.; Yen, Shu-Hui; Lewis, Jada

    2012-01-01

    Conditional overexpression of four-repeat human tau containing the P301L missense mutation in the rTg4510 mouse model of tauopathy leads to progressive accumulation of neurofibrillary tangles and hyperphosphorylated, sarkosyl-insoluble tau species, which are biochemically comparable to abnormal tau characteristic of hereditary tauopathies termed FTDP-17. To fully understand the impact of tau species at different stages of self-assembly on neurodegeneration, we fractionated rTg4510 brain representing several stages of tauopathy to obtain TBS-extractable (S1), high salt/sarkosyl-extractable (S3), and sarkosyl-insoluble (P3) fractions. Under reducing condition, the S1 fraction was demonstrated by Western blotting to contain both 50–60 kDa normally-sized and 64 kDa tau. Both are thermo-stable, but the 64 kDa tau showed a higher degree of phosphorylation. Under non-reducing condition, nearly all TBS-extractable 64 kDa tau were detected as ~130 kDa species consistent with the size of dimer. Quantitative analysis showed ~80 times more 64 kDa tau in S1 than P3 fraction. Immunoelectron microscopy revealed tau-positive granules/short filaments in S1 fraction. These structures displayed MC1 immunoreactivities indicative of conformational/pathological change of tau. MC1 immunoreactivity was detected by dot blotting in samples from 2.5 month-old mice, whereas Ab39 immunoreactivity indicative of late stages of tau assembly was detected only in P3 fraction. Quantitative analysis also demonstrated a significant inverse correlation between brain weight and 64 kDa tau, but the level of TBS-extractable 64 kDa tau reflects neurodegeneration better than that of sarkosyl-insoluble 64 kDa tau. Together, the findings suggest that TBS-extractable 64 kDa tau production is a potential target for therapeutic intervention of tauopathies. PMID:22941973

  4. SU-E-T-179: Clinical Impact of IMRT Failure Modes at Or Near TG-142 Tolerance Criteria Levels

    Energy Technology Data Exchange (ETDEWEB)

    Faught, J Tonigan; Balter, P; Johnson, J; Kry, S; Court, L; Stingo, F; Followill, D [UT MD Anderson Cancer Center, Houston, TX (United States)

    2015-06-15

    Purpose: Quantitatively assess the clinical impact of 11 critical IMRT dose delivery failure modes. Methods: Eleven step-and-shoot IMRT failure modes (FMs) were introduced into twelve Pinnacle v9.8 treatment plans. One standard and one highly modulated plan on the IROC IMRT phantom and ten previous H&N patient treatment plans were used. FMs included physics components covered by basic QA near tolerance criteria levels (TG-142) such as beam energy, MLC positioning, and MLC modeling. Resultant DVHs were compared to those of failure-free plans and the severity of plan degradation was assessed considering PTV coverage and OAR and normal tissue tolerances and used for FMEA severity scoring. Six of these FMs were physically simulated and phantom irradiations performed. TLD and radiochromic film results are used for comparison to treatment planning studies. Results: Based on treatment planning studies, the largest clinical impact from the phantom cases was induced by 2 mm systematic MLC shift in one bank with the combination of a D95% target under dose near 16% and OAR overdose near 8%. Cord overdoses of 5%–11% occurred with gantry angle, collimator angle, couch angle, MLC leaf end modeling, and MLC transmission and leakage modeling FMs. PTV coverage and/or OAR sparing was compromised in all FMs introduced in phantom plans with the exception of CT number to electron density tables, MU linearity, and MLC tongue-and-groove modeling. Physical measurements did not entirely agree with treatment planning results. For example, symmetry errors resulted in the largest physically measured discrepancies of up to 3% in the PTVs while a maximum of 0.5% deviation was seen in the treatment planning studies. Patient treatment plan study results are under analysis. Conclusion: Even in the simplistic anatomy of the IROC phantom, some basic physics FMs, just outside of TG-142 tolerance criteria, appear to have the potential for large clinical implications.

  5. Comparison of Dose Distributions With TG-43 and Collapsed Cone Convolution Algorithms Applied to Accelerated Partial Breast Irradiation Patient Plans

    Energy Technology Data Exchange (ETDEWEB)

    Thrower, Sara L., E-mail: slloupot@mdanderson.org [The University of Texas Graduate School of Biomedical Sciences at Houston, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Shaitelman, Simona F.; Bloom, Elizabeth [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Salehpour, Mohammad; Gifford, Kent [Department of Radiation Physics, The University of Texas Graduate School of Biomedical Sciences at Houston, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2016-08-01

    Purpose: To compare the treatment plans for accelerated partial breast irradiation calculated by the new commercially available collapsed cone convolution (CCC) and current standard TG-43–based algorithms for 50 patients treated at our institution with either a Strut-Adjusted Volume Implant (SAVI) or Contura device. Methods and Materials: We recalculated target coverage, volume of highly dosed normal tissue, and dose to organs at risk (ribs, skin, and lung) with each algorithm. For 1 case an artificial air pocket was added to simulate 10% nonconformance. We performed a Wilcoxon signed rank test to determine the median differences in the clinical indices V90, V95, V100, V150, V200, and highest-dosed 0.1 cm{sup 3} and 1.0 cm{sup 3} of rib, skin, and lung between the two algorithms. Results: The CCC algorithm calculated lower values on average for all dose-volume histogram parameters. Across the entire patient cohort, the median difference in the clinical indices calculated by the 2 algorithms was <10% for dose to organs at risk, <5% for target volume coverage (V90, V95, and V100), and <4 cm{sup 3} for dose to normal breast tissue (V150 and V200). No discernable difference was seen in the nonconformance case. Conclusions: We found that on average over our patient population CCC calculated (<10%) lower doses than TG-43. These results should inform clinicians as they prepare for the transition to heterogeneous dose calculation algorithms and determine whether clinical tolerance limits warrant modification.

  6. Inclusion complexes of cypermethrin and permethrin with monochlorotriazinyl-beta-cyclodextrin: A combined spectroscopy, TG/DSC and DFT study

    Science.gov (United States)

    Yao, Qi; You, Bin; Zhou, Shuli; Chen, Meng; Wang, Yujiao; Li, Wei

    2014-01-01

    The suitable size hydrophobic cavity and monochlorotriazinyl group as a reactive anchor make MCT-β-CD to be widely used in fabric finishing. In this paper, the inclusion complexes of monochlorotriazinyl-beta-cyclodextrin (MCT-β-CD) with cypermethrin (CYPERM) and permethrin (PERM) are synthesized and analyzed by TG/DSC, FT-IR and Raman spectroscopy. TG/DSC reveals that the decomposed temperatures of inclusion complexes are lower by 25-30 °C than that of physical mixtures. DFT calculations in conjunction with FT-IR and Raman spectral analyses are used to study the structures of MCT-β-CD and their inclusion complexes. Four isomers of trisubstituted MCT-β-CD are designed and DFT calculations reveal that 1,3,5-trisubstituted MCT-β-CD has the lowest energy and can be considered as main component of MCT-β-CD. The ground-state geometries, vibrational wavenumbers, IR and Raman intensities of MCT-β-CD and their inclusion complexes were calculated at B3LYP/6-31G (d) level of theory. Upon examining the optimized geometry of inclusion complex, we find that the CYPERM and PERM are inserted into the toroid of MCT-β-CD from the larger opening. The band at 1646 cm-1 in IR and at 1668 cm-1 in Raman spectrum reveals that monochloroazinyl group of MCT-β-CD exists in ketone form but not in anion form. The noticeable IR and Raman shift of phenyl reveals that these two benzene rings of CYPERM and PERM stays inside the cavity of MCT-β-CD and has weak interaction with MCT-β-CD. This spectroscopy conclusion is consistent with theoretical predicted structure.

  7. Zebrafish Tg(hb9:MTS-Kaede): a new in vivo tool for studying the axonal movement of mitochondria.

    Science.gov (United States)

    Bergamin, Giorgia; Cieri, Domenico; Vazza, Giovanni; Argenton, Francesco; Mostacciuolo, Maria Luisa

    2016-06-01

    Deregulation of axonal transport in neurons is emerging as the major cause of many neurodegenerative diseases in human, such as Charcot-Marie-Tooth (CMT) neuropathy. However, little is known about how mitochondria move in vivo and whether cell culture systems truly represent what happens in living animals. Here we describe the generation of a new zebrafish transgenic line that specifically allows to study mitochondrial dynamics in motor neurons and its application to analyse mitochondrial movement in zebrafish models expressing CMT2A causing mutations. The Tol2 transposon system was used to generate a transgenic zebrafish line expressing the photoconvertible fluorescent protein Kaede in mitochondria of motor neurons. Mitochondrial shape and movement were monitored by time-lapse confocal live imaging and measured by kymograph analysis. The effects of two well-known CMT causing mutations, L76P and R94Q substitutions in MFN2, were then investigated with the same methods. We generated the transgenic zebrafish Tg(hb9:MTS-Kaede) line with genetically labelled mitochondria in motor neurons. Kaede protein was correctly and stably targeted to mitochondrial matrix while retaining its photoconvertibility, thus qualifying this model for in vivo studies. Expression of the L76P and R94Q mutations reduced mitochondrial movement in axons and altered mitochondrial distribution in distinct ways. These findings confirm previously published data obtained in cell cultures and strengthen the hypothesis of different mechanism of action of the two MFN2 mutations. Considering the number of neurodegenerative diseases associated to mitochondrial dynamics, the Tg(hb9:MTS-Kaede) zebrafish line is a promising model to study in vivo alterations of mitochondrial transport underlying human diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. The atherogenic dyslipidemia ratio [log(TG/HDL-C] is associated with residual vascular risk, beta-cell function loss and microangiopathy in type 2 diabetes females

    Directory of Open Access Journals (Sweden)

    Hermans Michel P

    2012-10-01

    Full Text Available Abstract Background Atherogenic dyslipidemia (AD, defined as low HDL-C plus elevated triglycerides (TG, comorbid to T2DM, increases cardiometabolic risk for CAD even when LDL-C is at target. In T2DM males, AD was shown to correlate with β-cell function loss, yet it is not established whether this applies across gender. Aim To establish the prevalence and severity of AD in T2DM females, and to determine how it relates to cardiometabolic phenotype, glucose homeostasis, micro- and macrovascular complications, and 10-year absolute CV risk (UKPDS Risk Engine. Methods 340 T2DM females were ranked according to quintiles (Q of the continuous variable log(TG/HDL-C, with AD prevalence defined as HDL-C -1 plus TG ≥150 mg.dL-1, and β-cell function assessed with HOMA. Results AD prevalence was 35%; mean HDL-C and TG were 52 (15 and 160 (105 mg.dL-1. AD was significantly related to central fat, metabolic syndrome, sedentarity and skeletal sarcopenia, as well as to hsCRP, fibrinogen, uric acid, cystatin-C, Big ET-1, and 10-year UKPDS CV risk. AD correlated stepwise with lower β-cell function and hyperbolic product, and with accelerated loss of residual insulin secretion, higher HbA1c and prevalent microangiopathy. Conclusions log(TG/HDL-C is a simple means to grade AD and residual macrovascular risk in T2DM females. This ratio associates with major non-LDL cardiometabolic variables and ranks predicted CAD risk. In addition, log(TG/HDL-C identifies worsening glucose homeostasis, poorer glycemic control, and prevalent microangiopathy.

  9. Data on repeated (131)I-WB scans and the incidence of positive Tg and negative (131)I-WBS in DTC patients from a 24 months study.

    Science.gov (United States)

    Adedapo, Kayode S; Vangu, Mboyo Di Tamba

    2011-01-01

    We present data on repeated iodine-131 whole body scans ((131)I-WBS) in differentiated thyroid cancer patients (DTC) after surgery and (131)I remnant ablation and on increased thyroglobulin (Tg) with negative (131)I-WBS, in a retrospective study at our hospital. A total of 106 patients (91 female and 15 male) treated with (131)I for DTC met the inclusion criteria. The mean age of the patients was 45 years, age range 16-81 years. A total of 101 patients had complete 24 months follow-up following (131)I remnant ablation treatment. The mean (131)I dose administered after the first 6 months of follow- up was 3GBq while mean total dose was 4.9GBq, range 1.1-7.4GBq. Our results showed that at the end of the first 6 months post treatment, 58/101 patients had a negative (131)I-WBS. By the end of the 4th (131)I treatment at 24th months, the remaining 43 patients became negative for (131)I-WBS. We found increased Tg and negative (131)I-WBS in 2 of the 101 patients at the 24th months examination the so called Tg elevated negative (131)I-WBS (TENIS syndrome). The possible explanation of this syndrome is discussed. In conclusion, our study in DTC operated patients does not support the use of repeated diagnostic (131)I-WBS after an undetectable Tg because we found no Tg rebound in patients with negative (131)I-WBS, after 24 months of follow-up with serial measurements of Tg on and of suppression with L thyroxine.

  10. A vacuolar iron transporter in tulip, TgVit1, is responsible for blue coloration in petal cells through iron accumulation.

    Science.gov (United States)

    Momonoi, Kazumi; Yoshida, Kumi; Mano, Shoji; Takahashi, Hideyuki; Nakamori, Chihiro; Shoji, Kazuaki; Nitta, Akira; Nishimura, Mikio

    2009-08-01

    Blue color in flowers is due mainly to anthocyanins, and a considerable part of blue coloration can be attributed to metal-complexed anthocyanins. However, the mechanism of metal ion transport into vacuoles and subsequent flower color development has yet to be fully explored. Previously, we studied the mechanism of blue color development specifically at the bottom of the inner perianth in purple tulip petals of Tulipa gesneriana cv. Murasakizuisho. We found that differences in iron content were associated with the development of blue- and purple-colored cells. Here, we identify a vacuolar iron transporter in T. gesneriana (TgVit1), and characterize the localization and function of this transporter protein in tulip petals. The amino acid sequence of TgVit1 is 85% similar that of the Arabidopsis thaliana vacuolar iron transporter AtVIT1, and also showed similarity to the AtVIT1 homolog in yeast, Ca(2+)-sensitive cross-complementer 1 (CCC1). The gene TgVit1 was expressed exclusively in blue-colored epidermal cells, and protein levels increased with increasing mRNA expression and blue coloration. Transient expression experiments revealed that TgVit1 localizes to the vacuolar membrane, and is responsible for the development of the blue color in purple cells. Expression of TgVit1 in yeast rescued the growth defect of ccc1 mutant cells in the presence of high concentrations of FeSO(4). Our results indicate that TgVit1 plays an essential role in blue coloration as a vacuolar iron transporter in tulip petals. These results suggest a new role for involvement of a vacuolar iron transporter in blue flower color development.

  11. Vaccine potential of antigen cocktails composed of recombinant Toxoplasma gondii TgPI-1, ROP2 and GRA4 proteins against chronic toxoplasmosis in C3H mice.

    Science.gov (United States)

    Picchio, Mariano S; Sánchez, Vanesa R; Arcon, Nadia; Soto, Ariadna S; Perrone Sibilia, Matías; Aldirico, María de Los Angeles; Urrutia, Mariela; Moretta, Rosalía; Fenoy, Ignacio M; Goldman, Alejandra; Martin, Valentina

    2018-02-01

    The development of an effective and safe vaccine to prevent Toxoplasma gondii infection is an important aim due to the great clinical and economic impact of this parasitosis. We have previously demonstrated that immunization with the serine protease inhibitor-1 (TgPI-1) confers partial protection to C3H/HeN and C57BL/6 mice. In order to improve the level of protection, in this work, we combined this novel antigen with ROP2 and/or GRA4 recombinant proteins (rTgPI-1+rROP2, rTgPI-1+rGRA4, rTgPI-1+rROP2+rGRA4) to explore the best combination against chronic toxoplasmosis in C3H/HeN mice. All tested vaccine formulations, administered following a homologous prime-boost protocol that combines intradermal and intranasal routes, conferred partial protection as measured by the reduction of brain cyst burden following oral challenge with tissue cysts of Me49 T. gondii strain. The highest level of protection was achieved by the mixture of rTgPI-1 and rROP2 proteins with an average parasite burden reduction of 50% compared to the unvaccinated control group. The vaccine-induced protective effect was related to the elicitation of systemic cellular and humoral immune responses that included antigen-specific spleen cell proliferation, the release of Th1/Th2 cytokines, and the generation of antigen-specific antibodies in serum. Additionally, mucosal immune responses were also induced, characterized by secretion of antigen-specific IgA antibodies in intestinal lavages and specific mesenteric lymph node cell proliferation. Our results demonstrate that rTgPI-1+rROP2 antigens seem a promising mixture to be combined with other immunogenic proteins in a multiantigenic vaccine formulation against toxoplasmosis. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Dosimetric Validation of Volumetric Modulated Arc Therapy (VMAT) Using AAPM TG-119 Benchmark Plans in an Upgraded CLINAC 2100CD for Flattening Filter Free (FFF) Photon Beams

    Science.gov (United States)

    Sangaiah, Ashokkumar; Ganesh, K M; Ramalingam, K; Karthikeyan, K; Jagadheeskumar, N

    2017-11-26

    Background: Recently we have upgraded our Varian Clinac 2100CD with a 6MV FFF beam, this upgrade being the first of its kind in our country. Even though the dosimetric characteristics of FFF beams have been reported both in experimental and Monte Carlo studies, application in planning and delivery is complex. The aim of this study was to validate the commissioning of upgraded FFF beams dosimetrically using AAPM TG-119 bench mark plans for VMAT and to make a comparison with IMRT plans for both flattened filtered and FFF beams. Materials and Methods: AAPM TG-119 proposes a set of test clinical cases for testing the accuracy of IMRT planning and delivery systems. For these clinical cases we generated four treatment plans using IMRT FF, IMRT FFF, VMAT FF and VMAT FFF on a Varian Clinac 2100CD machine equipped with a millennium 120 MLC in Eclipse treatment planning system. Dose prescription and planning objectives were set according to the TG-119 goals and plans were scored based on planning objectives. Plans were compared using dose coverage, the conformity index and the homogeneity index. Point doses were measured at points recommended by TG-119 using a CC13 ion chamber. Planar dosimetry was accomplished using Imatrix and gamma evaluation was conducted using Omnipro IMRT software. Results: Dose distributions of FFF beam based plans were comparable to FF plans for both IMRT and VMAT. Our planning results matched TG-119 planning results. Measured point doses were within ±2% of planned doses and planar dosimetry gamma values were 95% of data points for all plans. Conclusion: We found a reduction of 40% treatment time for FFF against FF beams for sliding window IMRT. Upgraded FFF beams were in good agreement with TG-119 benchmark plans and goals. Creative Commons Attribution License

  13. Cotinine halts the advance of Alzheimer’s disease-like pathology and associated depressive-like behavior in Tg6799 mice

    Directory of Open Access Journals (Sweden)

    Sagar ePatel

    2014-07-01

    Full Text Available Alzheimer’s disease (AD is associated with cognitive and non-cognitive symptoms for which there are currently no effective therapies. We have previously reported that cotinine, a natural product obtained from tobacco leaves, prevented memory loss and diminished amyloid-β (Aβ plaque pathology in the transgenic 6799 mice (Tg6799 mice when treated prior to the development of the pathology. We have also shown that cotinine reduces depressive-like behavior in normal and chronically stressed C57BL/6 mice. Here, we extend our previous studies by investigating the effects of cotinine on the progression of AD-like pathology, depressive-like behavior, and the mechanisms underlying its beneficial effects in the Tg6799 mice when left untreated until after a more advanced stage of the disease’s development. The results show that vehicle-treated Tg6799 mice displayed an accentuated loss of working memory and an abundant Aβ plaque pathology that were accompanied by higher levels of depressive-like behavior as compared to control littermates. By contrast, prolonged daily cotinine treatment, withheld until after a mid-level progression of AD-like pathology, reduced Aβ levels, Aβ plaques, and depressive-like behavior as well as dramatically improved working memory in Tg6799 mice to levels no different from control littermates. The beneficial effects of cotinine were accompanied by an increase in the expression of the active form of protein kinase B (Akt and the postsynaptic density protein 95 (PSD95 in the hippocampi and frontal cortices of Tg6799 mice. This suggests that cotinine halts the progression of AD-like pathology while reducing depressive-like behavior by stimulating signaling pathways supporting synaptic plasticity in Tg6799 mice. The potential use of cotinine to treat cognitive and non-cognitive symptoms of AD is discussed.

  14. Estudo termoanalítico de comprimidos revestidos contendo captopril através de termogravimetria (TG e calorimetria exploratória diferencial (DSC Thermal analysis study of captopril coated tablets by thermogravimetry (TG and differential scanning calorimetry (DSC

    Directory of Open Access Journals (Sweden)

    Giovana Carolina Bazzo

    2005-09-01

    Full Text Available No presente trabalho foram desenvolvidos comprimidos de captopril revestidos com hidroxipropilmetilcelulose (HPMC, Opadry®, polivinilpirrolidona (PVP, Eudragit® E e goma laca. Foi realizado estudo termoanalítico do fármaco e das formulações através de termogravimetria (TG e calorimetria exploratória diferencial (DSC. Através da análise das curvas DSC verificou-se que não houve a ocorrência de interação entre o fármaco e os excipientes lactose, celulose microcristalina, croscarmelose sódica, Aerosil® e talco, utilizados na formulação do comprimido. Através desta técnica detectou-se a possibilidade de interação entre captopril e estearato de magnésio. De acordo com os resultados obtidos através de DSC não foram observadas alterações na cristalinidade do fármaco decorrentes dos processos de compressão e revestimento. A termogravimetria foi utilizada para o estudo da cinética de degradação do captopril e dos comprimidos. Os parâmetros cinéticos foram determinados através do método de Ozawa. Os resultados demonstraram que não houve alteração da estabilidade térmica do captopril na forma de comprimido. A formulação revestida com HPMC foi a que apresentou maior estabilidade térmica, quando comparada às demais formulações de revestimento.In the present study, captopril coated tablets with hydroxypropylmethylcellulose (HPMC, Opadry®, polyvinylpirrolidone (PVP, Eudragit® and shellac were produced. Differential scanning calorimetry (DSC and thermogravimetry (TG were used to evaluate the thermal properties of the drug and the formulations. On the basis of DSC results, captopril was found to be compatible with lactose, microcrystalline cellulose, sodium croscarmellose, Aerosil® and talc. Some possibility of interaction between drug-excipient was observed with magnesium stearate. However, additional techniques to confirm the results obtained are needed. There was no influence of mechanical treatment (tableting

  15. Influence of prevastein (R), an isoflavone-rich soy product, on mammary gland development and Tumorigenesis in Tg.NK (MMTV/c-neu) mice

    DEFF Research Database (Denmark)

    Thomsen, Anni R.; Mortensen, Alicja; Breinholt, Vibeke

    2005-01-01

    We investigated spontaneous mammary tumor development and mammary gland morphogenesis in female Tg.NK mice postnatally exposed to dietary soy isoflavones (0, 11, 39, and 130 mg aglycones/kg diet) added to a Western-style diet. Instead of preventing mammary tumorigenesis, the highest dose of isofl......We investigated spontaneous mammary tumor development and mammary gland morphogenesis in female Tg.NK mice postnatally exposed to dietary soy isoflavones (0, 11, 39, and 130 mg aglycones/kg diet) added to a Western-style diet. Instead of preventing mammary tumorigenesis, the highest dose...

  16. SU-E-T-401: Evaluation of TG-43 Dose Calculation Accuracy for SAVI-Based Accelerated Partial Breast Irradiation (APBI) Via Monte Carlo Simulations

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Y [UT Southwestern Medical Center, Dallas, TX (United States); Southern Medical University, Guangzhou, Guangdong (China); Tian, Z; Jiang, S; Jia, X [UT Southwestern Medical Center, Dallas, TX (United States); Scanderbeg, D; Yashar, C [UCSD Medical Center, La Jolla, CA (United States); Zhang, M [Rutgers University, New Brunswick, NJ (United States)

    2015-06-15

    Purpose: The current standard TG-43 dose calculation method for SAVI-based Accelerated Partial Breast Irradiation (APBI) assumes an ideal geometry of infinite homogeneous water. However, in SAVI treatments, the air cavity inside the device and the short source-to-skin distance raise concerns about the dose accuracy of the TG-43 method. This study is to evaluate TG-43 dose calculation accuracy in SAVI treatments using Monte Carlo (MC) simulations. Methods: We recalculated the dose distributions of 15 APBI patients treated with SAVI devices, including five cases with a size of 6–1, five with 8−1 and five with 10−1, using our in-house developed fast MC dose package for HDR brachytherapy (gBMC). A phase-space file was used to model the Ir-192 HDR source. For each case, the patient CT was converted into a voxelized phantom and the dwell positions and times were extracted from treatment plans for MC dose calculations. Clinically relevant dosimetric parameters of the recalculated dose were compared to those computed via the TG-43 approach. Results: A systematic overestimation of doses was found for the 15 cases in TG-43 results, with D90, V150, and V200 for PTV-eval 2.8±1.8%, 2.0±2.2%, and 1.8±3.5% higher than MC results. TG-43 also overestimated the dose to skin with the maximum dose 4.4±8.4% higher on average. The relatively large standard deviation seen in the difference of maximum skin dose is partially ascribed to the statistical uncertainty of MC simulations when computing the maximum dose. It took gBMC ∼1 minute to compute dose for a SAVI plan. Conclusion: The high efficiency of our gBMC package facilitated the studies with a relatively large number of cases. An overestimation of TG-43 doses was found when using this MC package to recompute doses in SAVI cases. Clinical utilization of TG-43 dose calculation method in this scenario should be aware of this fact.

  17. Biomechanical assays amniotic membrane preserved in glycerol correlating with optical coherence tomography (OCT) and thermal gravimetric analysis (TG)

    Energy Technology Data Exchange (ETDEWEB)

    Soares, Fernando Augusto N.; Santin, Stefany P.; Martino Junior, Antonio C.; Machado, Luci Diva B.; Freitas, Anderson Z.; Mathor, Monica B., E-mail: fernandonevessoares@yahoo.com.br [Instituto de Pesquisas Energetias Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Young's modulus, the OCT technique, to generate high-resolution images in real time being a non-destructive technique, thermogravimetry (TG) assessing the amount of water and rate of water output membranes after treatment with ionizing radiation, relating the possible changes with non-irradiated tissue. However the results of the tensile test had the same behavior compared to the values of total attenuation coefficient by OCT, in addition the dehydration rate analyzed by TG had no statistically significant variation to some radiation doses. (author)

  18. Establishment of expanded and streamlined pipeline of PITCh knock-in - a web-based design tool for MMEJ-mediated gene knock-in, PITCh designer, and the variations of PITCh, PITCh-TG and PITCh-KIKO.

    Science.gov (United States)

    Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Nakade, Shota; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi

    2017-05-04

    The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer ( http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html ), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively.

  19. Prolonged Running, not Fluoxetine Treatment, Increases Neurogenesis, but does not Alter Neuropathology, in the 3xTg Mouse Model of Alzheimer's Disease.

    NARCIS (Netherlands)

    Marlatt, M.W.; Potter, M.C.; Bayer, T.A.; van Praag, H.; Lucassen, P.J.

    2013-01-01

    Reductions in adult neurogenesis have been documented in the original 3xTg mouse model of Alzheimer's disease (AD), notably occurring at the same age when spatial memory deficits and amyloid plaque pathology appeared. As this suggested reduced neurogenesis was associated with behavioral deficits, we

  20. Structure-to-property Relationships in Addition Cured Polymers 2: Resin Tg Composite Initial Mechanical Properties of Norbornenyl Cured Polyimide Resins

    Science.gov (United States)

    Alston, W. B.

    1986-01-01

    PRM (polymerization of monomeric reactants) methodology was used to prepare thirty different polyimide oligomeric resins. Monomeric composition as well as chain length between sites of crosslinks were varied to examine their effects on glass transition temperature (Tg) of the cured/postcured resins. An almost linear correlation of Tg versus molecular distance between the crosslinks was observed. An attempt was made to correlate Tg with initial mechanical properties (flexural strength and interlaminar shear strength) of unidirectional graphite fiber composites prepared with these resins. However, the scatter in mechanical strength data prevented obtaining as clear a correlation as was observed for the structural modification/crosslink distance versus Tg. Instead, only a range of composite mechanical properties was obtained at the test temperatures studied (room temperature, 288 and 316 C). Perhaps more importantly, what did become apparent during the attempted correlation study was: (1) that PMR methodology could be used to prepare composites from resins that contain a wide variety of monomer modifications, and (2) that these composites almost invariably provided satisfactory initial mechanical properties as long as the resins selected were melt processable.

  1. Structure-to-property relationships in addition cured polymers. II - Resin Tg and composite initial mechanical properties of norbornenyl cured polyimide resins

    Science.gov (United States)

    Alston, William B.

    1986-01-01

    PRM (polymerization of monomeric reactants) methodology was used to prepare thirty different polyimide oligomeric resins. Monomeric composition as well as chain length between sites of crosslinks were varied to examine their effects on glass transition temperature (Tg) of the cured/postcured resins. An almost linear correlation of Tg versus molecular distance between the crosslinks was observed. An attempt was made to correlate Tg with initial mechanical properties (flexural strength and interlaminar shear strength) of unidirectional graphite fiber composites prepared with these resins. However, the scatter in mechanical strength data prevented obtaining as clear a correlation as was observed for the structural modification/crosslink distance versus Tg. Instead, only a range of composite mechanical properties was obtained at the test temperatures studied (room temperature, 288 and 316 C). Perhaps more importantly, what did become apparent during the attempted correlation study was: (1) that PMR methodology could be used to prepare composites from resins that contain a wide variety of monomer modifications, and (2) that these composites almost invariably provided satisfactory initial mechanical properties as long as the resins selected were melt processable.

  2. Atherogenic Impact of Lecithin-Cholesterol Acyltransferase and Its Relation to Cholesterol Esterification Rate in HDL (FERHDL) and AIP [log(TG/HDL-C)] Biomarkers: The Butterfly Effect?

    Czech Academy of Sciences Publication Activity Database

    Dobiášová, Milada

    2017-01-01

    Roč. 66, č. 2 (2017), s. 193-203 ISSN 0862-8408 Institutional support: RVO:67985823 Keywords : lecithin-cholesterol acyltransferase (LCAT) * atherosclerosis * FERHDL (fractional esterification rate in HDL) * AIP (atherogenic index of plasma, log(TG/HDL-C) * biomarkers of cardiometabolic risk * lipoprotein particle size Subject RIV: FA - Cardiovascular Diseases incl. Cardiotharic Surgery Impact factor: 1.461, year: 2016

  3. Effects of aliskiren on blood pressure, albuminuria, and (Pro)renin receptor expression in diabetic TG(mRen-2)27 Rats

    NARCIS (Netherlands)

    D.L. Feldman (David); L. Jin (Li); H. Xuan (Hong); A. Contrepas (Aurelie); Y. Zhou (Yinong); R.L. Webb (Randy); D.N. Mueller (Dominik); S. Feldt (Sandra); F. Cumin (Frederick); W. Maniara (Wieslawa); E. Persohn (Elke); H. Schuetz (Helmut); A.H.J. Danser (Jan); G. Nguyen (Genevieve)

    2008-01-01

    textabstractThe aim of this study was to explore the effects of the renin inhibitor aliskiren in streptozotocin-diabetic TG(mRen-2)27 rats. Furthermore, we investigated in vitro the effect of aliskiren on the interactions between renin and the (pro)renin receptor and between aliskiren and prorenin.

  4. Effect of RET c.2307T>G Polymorphism on the Outcomes of Posterior Sagittal Neurectomy for Hirschsprung Disease Procedure in Indonesian Population.

    Science.gov (United States)

    Rochadi; Haryana, Sophia Mubarika; Sadewa, Ahmad Hamim; Gunadi

    2014-01-01

    We investigated the effect of RET c.2307T>G polymorphism on the outcomes of posterior sagittal neurectomy for Hirschsprung disease (PSNHD) procedure in Indonesia. Hirschsprung disease (HSCR) is a neurocristopathy characterized by absence of enteric ganglia along variable lengths of the intestine in neonates. The RET c.2307T>G polymorphism has been shown to be associated with HSCR. Many surgical techniques with some advantage and disadvantage were established for HSCR. We have conducted PSNHD in short-segment HSCR patients.Thirty-one nonsyndromic HSCR patients underwent PSNHD. The polymorphism was determined using PCR-RFLP in genomic DNA. The rate of enterocolitis and constipation outcomes following PSNHD were 6 (19%) and 4 (13%) patients, respectively. The RET c.2307T>G polymorphism did not influence either enterocolitis or constipation outcome following PSNHD at P value of 0.07 (OR = 0.28; 95% CI = 0.08-1.05) and 0.67 (OR = 0.58; 95% CI = 0.12-2.76), respectively. Our study suggested that RET c.2307T>G polymorphism may not affect outcomes of PSNHD procedure in Indonesia. Furthermore, a multicenter study with a larger sample size is necessary to clarify this result.

  5. Identification of Toxoplasma TgPH1, a pleckstrin homology domain-containing protein that binds to the phosphoinositide PI(3,5)P2.

    Science.gov (United States)

    Daher, Wassim; Morlon-Guyot, Juliette; Alayi, Tchilabalo Dilezitoko; Tomavo, Stan; Wengelnik, Kai; Lebrun, Maryse

    2016-05-01

    The phosphoinositide phosphatidylinositol-3,5-bisphosphate (PI(3,5)P2) plays crucial roles in the maintenance of lysosome/vacuole morphology, membrane trafficking and regulation of endolysosome-localized membrane channel activity. In Toxoplasma gondii, we previously reported that PI(3,5)P2 is essential for parasite survival by controlling homeostasis of the apicoplast, a particular organelle of algal origin. Here, by using a phosphoinositide pull-down assay, we identified TgPH1 in Toxoplasma a protein conserved in many apicomplexan parasites. TgPH1 binds specifically to PI(3,5)P2, shows punctate intracellular localization, but plays no vital role for tachyzoite growth in vitro. TgPH1 is a protein predominantly formed by a pleckstrin homology (PH) domain. So far, PH domains have been described to bind preferentially to bis- or trisphosphate phosphoinositides containing two adjacent phosphates (i.e. PI(3,4)P2, PI(4,5)P2, PI(3,4,5)P3). Therefore, our study reveals an unusual feature of TgPH1 which binds preferentially to PI(3,5)P2. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Language Image in National Minority Language Television Idents. TG4 (Teilifís na Gaeilge, Ireland and Whakaata Māori (Māori Television, New Zealand

    Directory of Open Access Journals (Sweden)

    Ruth Lysaght

    2009-03-01

    Full Text Available Born of community and political action, Teilifis na Gaeilge (TG4 began in 1996, and Whakaata Māori/ Māori Television Service (MTS in 2004. Despite obvious differences between the two broadcasting environments, both stations attempt to reclaim a national (but minority language (Ó Ruairc 1996; Moring 2007 and compete with other broadcasters (Horrocks and Perry 2004 to attract an audience (Smith and Abel 2008 by an appeal to identity (Cormack 2000; 2007; Delap 2007. This paper investigates idents from TG4 and MTS. What image or brand have the language and culture in these mini-advertisements? Thornley’s (2004 discussion of “transculturation” is useful in examining the often inventive approach taken to elements of the dominant culture. Indeed, the motto ‘Súil eile’ [another perspective] is the criterion for many TG4 projects, and there is a clear awareness of multiple audiences in the MTS logline, ‘mā mātou, mā rātou, mā koutou, mā tātou’ [just for us, for them, for all of you, for all of us]. In the symbiotic relationship between a minority station and other larger stations in terms of the depiction/creation of local and national identity, language is used as another marketing tool. TG4 and MTS idents respond to and celebrate current sociolinguistic changes (Romaine 2006; Ó Tuathaigh 2008, making them visible.

  7. Antisense Oligonucleotides Promote Exon Inclusion and Correct the Common c.-32-13T>G GAA Splicing Variant in Pompe Disease

    NARCIS (Netherlands)

    E. van der Wal (Erik); A.J. Bergsma (Atze); J. Pijnenburg (Joon); A.T. van der Ploeg (Ans); W.W.M.P. Pijnappel (Pim)

    2017-01-01

    textabstractThe most common variant causing Pompe disease is c.-32-13T>G (IVS1) in the acid α-glucosidase (GAA) gene, which weakens the splice acceptor of GAA exon 2 and induces partial and complete exon 2 skipping. It also allows a low level of leaky wild-type splicing, leading to a childhood/adult

  8. c-Jun interacts with the corepressor TG-interacting factor (TGIF) to suppress Smad2 transcriptional activity

    Science.gov (United States)

    Pessah, Marcia; Prunier, Céline; Marais, Jacqueline; Ferrand, Nathalie; Mazars, Anne; Lallemand, François; Gauthier, Jean-Michel; Atfi, Azeddine

    2001-01-01

    The Sma and Mad related (Smad) family proteins are critical mediators of the transforming growth factor-β (TGF-β) superfamily signaling. After TGF-β-mediated phosphorylation and association with Smad4, Smad2 moves to the nucleus and activates expression of specific genes through cooperative interactions with DNA-binding proteins, including members of the winged-helix family of transcription factors, forkhead activin signal transducer (FAST)-1 and FAST2. TGF-β has also been described to activate other signaling pathways, such as the c-Jun N-terminal Kinase (JNK) pathway. Here, we show that activation of JNK cascade blocked the ability of Smad2 to mediate TGF-β-dependent activation of the FAST proteins. This inhibitory activity is mediated through the transcriptional factor c-Jun, which enhances the association of Smad2 with the nuclear transcriptional corepressor TG-interacting factor (TGIF), thereby interfering with the assembly of Smad2 and the coactivator p300 in response to TGF-β signaling. Interestingly, c-Jun directly binds to the nuclear transcriptional corepressor TGIF and is required for TGIF-mediated repression of Smad2 transcriptional activity. These studies thus reveal a mechanism for suppression of Smad2 signaling pathway by JNK cascade through transcriptional repression. PMID:11371641

  9. Age-related changes of protein SUMOylation balance in the AβPP Tg2576 mouse model of Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Robert eNisticò

    2014-04-01

    Full Text Available Alzheimer's disease (AD is a complex disorder that affects the central nervous system causing a severe neurodegeneration. This pathology affects an increasing number of people worldwide due to the overall aging of the human population. In recent years SUMO protein modification has emerged as a possible cellular mechanism involved in AD. Some of the proteins engaged in the physiopathological process of AD, like BACE1, GSK3-β tau, AβPP and JNK, are in fact subject to protein SUMO modifications or interactions. Here, we have investigated the SUMO/deSUMOylation balance and SUMO-related proteins during the onset and progression of the pathology in the Tg2576 mouse model of AD. We examined four age-stages (1.5; 3; 6; 17 months old and observed shows an increase in SUMO-1 protein conjugation at 3 and 6 months in transgenic mice with respect to WT in both cortex and hippocampus. Interestingly this is paralleled by increased expression levels of Ubc9 and SENP1 in both brain regions. At 6 months of age also the SUMO-1 mRNA resulted augmented. SUMO-2-ylation was surprisingly decreased in old transgenic mice and was unaltered in the other time windows. The fact that alterations in SUMO/deSUMOylation equilibrium occur from the early phases of AD suggests that global posttranslational modifications may play an important role in the mechanisms underlying disease pathogenesis, thus providing potential targets for pharmacological interventions.

  10. Cryopreservation of Escherichia coli K12TG1: protection from the damaging effects of supercooling by freezing.

    Science.gov (United States)

    Simonin, H; Bergaoui, I M; Perrier-Cornet, J M; Gervais, P

    2015-04-01

    Injuries in living cells caused by water freezing during a freeze-thaw process have been extensively reported. In particular, intracellular water freezing has long been incriminated in cell death caused by a high cooling rate, but this supposition could not always be demonstrated. This work aims to discriminate the role of water freezing, dehydration and cold-induced injuries in cellular damage occuring during cryopreservation. For this purpose, Escherichia coli K12TG1 suspensions were maintained in a supercooled or frozen state at -20°C for times ranging from 10 min to 5 h. The supercooled state was maintained for a long period at -20°C by applying a non-injurious isostatic pressure (Pfreezing, the survival rate remained high throughout the experiment, and the cell membranes suffered little damage. Moreover, cells subjected to 5h of osmotic treatments at -20°C, conditions that mimic cryoconcentration upon freezing, and subsequently diluted and thawed suffered little damage. Dehydration due to cryoconcentration upon freezing protects the cells against the deleterious effects of supercooling, especially in the plasma membranes. The decrease in membrane leakage upon dehydration at low temperatures could be linked to differences in the gel state of the membrane revealed by a higher Laurdan general polarization (GP) value. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Co-pyrolysis characteristics of municipal sewage sludge and hazelnut shell by TG-DTG-MS and residue analysis.

    Science.gov (United States)

    Xu, Xinyang; Zhao, Bing; Sun, Manli; Chen, Xi; Zhang, Mingchuan; Li, Haibo; Xu, Shucong

    2017-04-01

    Co-pyrolysis characteristics of municipal sewage sludge and hazelnut shell blend have been studied in this work. The behavior of co-pyrolysis was researched by a method of multi-heating rates and different blend ratios to analyze thermal decomposition stages. The experimental data of the blended samples in TG-DTG plots were compared with calculated data to investigate the interactions during co-pyrolysis. The bio-chars investigated by SEM and FTIR spectra were used to examine the physical and chemical changes. The results showed there are four thermal decomposition stages during co-pyrolysis, with hydrocarbon transforming to gas evolution in the second and the third stages. The inhibitive interaction occurred between 260 and 400°C and the accelerative interaction occurred between 450 and 900°C during co-pyrolysis. The activation energy of the blended sample was 51.97-178.84kJ/mol in the second stage and 207.04-630.73kJ/mol in the third stage calculated by DAEM. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Extra-virgin olive oil ameliorates cognition and neuropathology of the 3xTg mice: role of autophagy.

    Science.gov (United States)

    Lauretti, Elisabetta; Iuliano, Luigi; Praticò, Domenico

    2017-08-01

    Consumption of extra virgin olive oil (EVOO), a major component of the Mediterranean diet, has been associated with reduced incidence of Alzheimer's disease (AD). However, the mechanisms involved in this protective action remain to be fully elucidated. Herein, we investigated the effect of daily consumption of EVOO on the AD-like phenotype of a mouse mode of the disease with plaques and tangles. Triple transgenic mice (3xTg) received either regular chow or a chow diet supplemented with EVOO starting at 6 months of age for 6 months, then assessed for the effect of the diet on the AD-like neuropathology and behavioral changes. Compared with controls, mice receiving the EVOO-rich diet had an amelioration of their behavioral deficits, and a significant increase in the steady state levels of synaptophysin, a protein marker of synaptic integrity. In addition, they had a significant reduction in insoluble Aβ peptide levels and deposition, lower amount of phosphorylated tau protein at specific epitopes, which were secondary to an activation of cell autophagy. Taken together, our findings support a beneficial effect of EVOO consumption on all major features of the AD phenotype (behavioral deficits, synaptic pathology, Aβ and tau neuropathology), and demonstrate that autophagy activation is the mechanism underlying these biological actions.

  13. Methylene blue does not reverse existing neurofibrillary tangle pathology in the rTg4510 mouse model of tauopathy.

    Science.gov (United States)

    Spires-Jones, Tara L; Friedman, Taylor; Pitstick, Rose; Polydoro, Manuela; Roe, Allyson; Carlson, George A; Hyman, Bradley T

    2014-03-06

    Alzheimer's disease is characterized pathologically by aggregation of amyloid beta into senile plaques and aggregation of pathologically modified tau into neurofibrillary tangles. While changes in amyloid processing are strongly implicated in disease initiation, the recent failure of amyloid-based therapies has highlighted the importance of tau as a therapeutic target. "Tangle busting" compounds including methylene blue and analogous molecules are currently being evaluated as therapeutics in Alzheimer's disease. Previous studies indicated that methylene blue can reverse tau aggregation in vitro after 10 min, and subsequent studies suggested that high levels of drug reduce tau protein levels (assessed biochemically) in vivo. Here, we tested whether methylene blue could remove established neurofibrillary tangles in the rTg4510 model of tauopathy, which develops robust tangle pathology. We find that 6 weeks of methylene blue dosing in the water from 16 months to 17.5 months of age decreases soluble tau but does not remove sarkosyl insoluble tau, or histologically defined PHF1 or Gallyas positive tangle pathology. These data indicate that methylene blue treatment will likely not rapidly reverse existing tangle pathology. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  14. X11beta rescues memory and long-term potentiation deficits in Alzheimer's disease APPswe Tg2576 mice.

    LENUS (Irish Health Repository)

    Mitchell, Jacqueline C

    2009-12-01

    Increased production and deposition of amyloid beta-protein (Abeta) are believed to be key pathogenic events in Alzheimer\\'s disease. As such, routes for lowering cerebral Abeta levels represent potential therapeutic targets for Alzheimer\\'s disease. X11beta is a neuronal adaptor protein that binds to the intracellular domain of the amyloid precursor protein (APP). Overexpression of X11beta inhibits Abeta production in a number of experimental systems. However, whether these changes to APP processing and Abeta production induced by X11beta overexpression also induce beneficial effects to memory and synaptic plasticity are not known. We report here that X11beta-mediated reduction in cerebral Abeta is associated with normalization of both cognition and in vivo long-term potentiation in aged APPswe Tg2576 transgenic mice that model the amyloid pathology of Alzheimer\\'s disease. Overexpression of X11beta itself has no detectable adverse effects upon mouse behaviour. These findings support the notion that modulation of X11beta function represents a therapeutic target for Abeta-mediated neuronal dysfunction in Alzheimer\\'s disease.

  15. Delineating Amyloid Plaque Associated Neuronal Sphingolipids in Transgenic Alzheimer's Disease Mice (tgArcSwe) Using MALDI Imaging Mass Spectrometry.

    Science.gov (United States)

    Kaya, Ibrahim; Brinet, Dimitri; Michno, Wojciech; Syvänen, Stina; Sehlin, Dag; Zetterberg, Henrik; Blennow, Kaj; Hanrieder, Jörg

    2017-02-15

    The major pathological hallmarks of Alzheimer's disease (AD) are the progressive aggregation and accumulation of beta-amyloid (Aβ) and hyperphosphorylated tau protein into neurotoxic deposits. Aβ aggregation has been suggested as the critical early inducer, driving the disease progression. However, the factors that promote neurotoxic Aβ aggregation remain elusive. Imaging mass spectrometry (IMS) is a powerful technique to comprehensively elucidate the spatial distribution patterns of lipids, peptides, and proteins in biological tissue sections. In the present study, matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS)-based imaging was used on transgenic Alzheimer's disease mouse (tgArcSwe) brain tissue to investigate the sphingolipid microenvironment of individual Aβ plaques and elucidate plaque-associated sphingolipid alterations. Multivariate data analysis was used to interrogate the IMS data for identifying pathologically relevant, anatomical features based on their lipid chemical profile. This approach revealed sphingolipid species that distinctly located to cortical and hippocampal deposits, whose Aβ identity was further verified using fluorescent amyloid staining and immunohistochemistry. Subsequent multivariate statistical analysis of the spectral data revealed significant localization of gangliosides and ceramides species to Aβ positive plaques, which was accompanied by distinct local reduction of sulfatides. These plaque-associated changes in sphingolipid levels implicate a functional role of sphingolipid metabolism in Aβ plaque pathology and AD pathogenesis. Taken together, the presented data highlight the potential of imaging mass spectrometry as a powerful approach for probing Aβ plaque-associated lipid changes underlying AD pathology.

  16. PVQAT TG2 Update

    Energy Technology Data Exchange (ETDEWEB)

    Bosco, N.

    2015-02-24

    Thermal and mechanical fatigue: What are the appropriate number of thermal cycles for a long-term reliability test? Should this number be climate specific? What is the effect and appropriate level of DML testing?

  17. IgG1 antiendomysium and IgG antitissue transglutaminase (anti-tTG) antibodies in coeliac patients with selective IgA deficiency

    Science.gov (United States)

    Cataldo, F; Lio, D; Marino, V; Picarelli, A; Ventura, A; Corazza, G; a SIGEP

    2000-01-01

    BACKGROUND—In selective IgA deficiency (IgAD), there is no reliable screening test for coeliac disease (CD).
AIM—To evaluate the usefulness of IgG1 antiendomysium and IgG antitissue transglutaminase tests for CD diagnosis in IgAD.
METHODS—IgA and IgG antigliadin antibodies (IgA- and IgG-AGA), IgA and IgG1 antiendomysium antibodies (IgA- and IgG1-EMA), and IgA and IgG antitissue transglutaminase (IgA- and IgG-anti-tTG) were assayed in: (a) 20 untreated IgAD/CD patients; (b) 34 IgAD/CD patients on a strict gluten free diet (GFD); (c) 10 IgAD/CD patients not on a strict GFD; (d) 11 untreated CD patients without IgAD; (e) 10 healthy IgAD patients; and (f) 25 healthy controls.
RESULTS—In all untreated IgAD/CD patients, IgG1-EMA, IgG-anti-tTG, and IgG-AGA were positive whereas IgA antibodies against these antigens were negative. IgAD/CD patients on a strict GFD did not produce IgG-AGA or IgG1-EMA but four of 34 produced IgG anti-tTG. IgAD/CD subjects not on a strict GFD produced IgG-AGA whereas 5/10 and 4/10 were IgG1- EMA and IgG-anti-tTG negative, respectively. Untreated CD patients without IgAD were AGA (IgA and IgG), EMA (IgA and IgG1), and anti-tTG (IgA and IgG) positive. Healthy controls were AGA and EMA negative whereas two of 10 apparently healthy IgAD subjects and one of 25 healthy negative control were IgG-anti-tTG positive.
CONCLUSIONS—Both IgG1-EMA and IgG-anti-tTG tests appear to be useful for identification of IgAD/CD patients whereas they are less satisfactory for monitoring dietary compliance in these subjects. In addition, our findings seem to suggest that IgG-EMA autoantibodies produced by coeliac patients are mainly of the IgG1 subtype.


Keywords: IgG1 antiendomysium antibodies; IgG antitissue transglutaminase antibodies; selective IgA deficiency; coeliac disease PMID:10940273

  18. The PTPN13 Y2081D (T>G) (rs989902) polymorphism is associated with an increased risk of sporadic colorectal cancer.

    Science.gov (United States)

    Laczmanska, I; Karpinski, P; Gil, J; Laczmanski, L; Makowska, I; Bebenek, M; Ramsey, D; Sasiadek, M M

    2017-07-01

    Colorectal cancer (CRC) is one of the most common cancers worldwide and, although the majority of cases are sporadic, its development and progression depends on a range of factors: environmental, genetic and epigenetic. A variety of genetic pathways have been described as being crucial in CRC, including protein tyrosine phosphatases (PTPs). PTPN13 (also called FAP-1) is a non-receptor PTP and interacts with a number of important components of growth and apoptosis pathways. It is also involved in the inhibition of Fas-induced apoptosis. The single nucleotide polymorphism genotype at Y2081D (T>G) (rs989902) of PTPN13 exon 39 was determined in DNA extracted from blood samples from 174 sporadic CRC patients and 176 healthy individuals. Also, a meta-analysis was performed based on three articles accessed via the PubMed and ResearchGate databases. The risk of CRC was 2.087 times greater for patients with the GG genotype than for those with the TT genotype (P = 0.0475). In the meta-analysis, a significantly increased risk of cancer associated with the G allele was observed in the squamous cell carcinoma of the head and neck subgroup (TT vs GG+GT, OR 1.23, 95% CI [1.02, 1.47], P = 0.0258), and a significantly decreased risk in the breast cancer subgroup (TT vs GG+GT, OR 0.63, 95% CI [0.41, 0.96], P = 0.0334) and in the CRC subgroup (GT+TT vs GG, OR 0.51, 95% CI [0.41, 0.95], P = 0.0333). PTPN13 rs989902 is significantly associated with the risk of CRC in the Polish population. Given that this report provides the first evidence of an association of PTPN13 rs989902 with the risk of CRC in a Caucasian population, further large scale studies are necessary to confirm this finding. Colorectal Disease © 2017 The Association of Coloproctology of Great Britain and Ireland.

  19. Generation of Tg(cyp1a:gfp) Transgenic Zebrafish for Development of a Convenient and Sensitive In Vivo Assay for Aryl Hydrocarbon Receptor Activity.

    Science.gov (United States)

    Xu, Hongyan; Li, Caixia; Li, Yan; Ng, Grace Hwee Boon; Liu, Chunsheng; Zhang, Xiaoyan; Gong, Zhiyuan

    2015-12-01

    Both dioxins/dioxin-like compounds and polycyclic aromatic hydrocarbons (PAHs) are persistent organic pollutants and cause multiple adverse health effects on human and wildlife. Cyp1a is the most commonly used biomarker induced by these pollutants through activation of the aryl hydrocarbon receptor (AhR) pathway. Here we generated Tg(cyp1a:gfp) transgenic zebrafish for establishing a convenient in vivo assay for analysing these xenobiotic compounds. The Tg(cyp1a:gfp) larvae at 4 day post-fertilization were tested with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), and GFP induction was observed mainly in the kidney, liver and gut. Similar GFP expression was also induced strongly by two dioxin-like chemicals, co-planar polychlorinated biphenyl (PCB126) and polychlorinated dibenzo-p-furan (PeCDF) and relatively weakly by two PAHs, 3-methylcholanthrene (3-MC) and benzo[a]pyrene (BAP). The lowest observed effective concentration (LOEC) of TCDD was estimated to be ∼1 pM and the EC50 (effective concentration to induce GFP in 50 % of Tg(cyp1a:gfp) larvae) was ∼10 pM. PCB126 and PeCDF had ∼10× lower potencies in GFP induction than TCDD, while the potencies for 3-MC and BAP were at least 1000× lower. The sensitivity of Tg(cyp1a:gfp) larvae to respond TCDD was also favourable compared to that of ethoxyresorufin-O-deethylase (EROD) assay in both zebrafish larvae and adult livers. As GFP-based assay in transgenic zebrafish can be easily accommodated in multi-well dishes, the Tg(cyp1a:gfp) zebrafish should provide not only a valuable biomonitoring tool for aquatic contaminants but also a potential high-throughput chemical screening platform for identification of new AhR agonists.

  20. Specific expression of the vacuolar iron transporter, TgVit, causes iron accumulation in blue-colored inner bottom segments of various tulip petals.

    Science.gov (United States)

    Momonoi, Kazumi; Tsuji, Toshiaki; Kazuma, Kohei; Yoshida, Kumi

    2012-01-01

    Several flowers of Tulipa gesneriana exhibit a blue color in the bottom segments of the inner perianth. We have previously reported the inner-bottom tissue-specific iron accumulation and expression of the vacuolar iron transporter, TgVit1, in tulip cv. Murasakizuisho. To clarify whether the TgVit1-dependent iron accumulation and blue-color development in tulip petals are universal, we analyzed anthocyanin, its co-pigment components, iron contents and the expression of TgVit1 mRNA in 13 cultivars which show a blue color in the bottom segments of the inner perianth accompanying yellow- and white-colored inner-bottom petals. All of the blue bottom segments contained the same anthocyanin component, delphinidin 3-rutinoside. The flavonol composition varied with cultivar and tissue part. The major flavonol in the bottom segments of the inner perianth was rutin. The iron content in the upper part was less than that in the bottom segments of the inner perianth. The iron content in the yellow and white petals was higher in the bottom segment of the inner perianth than in the upper tissues. TgVit1 mRNA expression was apparent in all of the bottom tissues of the inner perianth. The result of a reproduction experiment by mixing the constituents suggests that the blue coloration in tulip petals is generally caused by iron complexation to delphinidin 3-rutinoside and that the iron complex is solubilized and stabilized by flavonol glycosides. TgVit1-dependent iron accumulation in the bottom segments of the inner perianth might be controlled by an unknown system that differentiated the upper parts and bottom segments of the inner perianth.

  1. NOG-hIL-4-Tg, a new humanized mouse model for producing tumor antigen-specific IgG antibody by peptide vaccination.

    Directory of Open Access Journals (Sweden)

    Yoshie Kametani

    Full Text Available Immunodeficient mice transplanted with human peripheral blood mononuclear cells (PBMCs are promising tools to evaluate human immune responses to vaccines. However, these mice usually develop severe graft-versus-host disease (GVHD, which makes estimation of antigen-specific IgG production after antigen immunization difficult. To evaluate antigen-specific IgG responses in PBMC-transplanted immunodeficient mice, we developed a novel NOD/Shi-scid-IL2rγnull (NOG mouse strain that systemically expresses the human IL-4 gene (NOG-hIL-4-Tg. After human PBMC transplantation, GVHD symptoms were significantly suppressed in NOG-hIL-4-Tg compared to conventional NOG mice. In kinetic analyses of human leukocytes, long-term engraftment of human T cells has been observed in peripheral blood of NOG-hIL-4-Tg, followed by dominant CD4+ T rather than CD8+ T cell proliferation. Furthermore, these CD4+ T cells shifted to type 2 helper (Th2 cells, resulting in long-term suppression of GVHD. Most of the human B cells detected in the transplanted mice had a plasmablast phenotype. Vaccination with HER2 multiple antigen peptide (CH401MAP or keyhole limpet hemocyanin (KLH successfully induced antigen-specific IgG production in PBMC-transplanted NOG-hIL-4-Tg. The HLA haplotype of donor PBMCs might not be relevant to the antibody secretion ability after immunization. These results suggest that the human PBMC-transplanted NOG-hIL-4-Tg mouse is an effective tool to evaluate the production of antigen-specific IgG antibodies.

  2. The early changes in behavior and the myelinated fibers of the white matter in the Tg2576 transgenic mouse model of Alzheimer's disease.

    Science.gov (United States)

    Zhang, Lei; Lu, Wei; Chen, Lin; Qiu, Xuan; Li, Chen; Huang, Chun-Xia; Gong, Xia; Min, Qi-Cheng; Lu, Fang; Wan, Jing-Yuan; Chao, Feng-Lei; Tang, Yong

    2013-10-25

    Recently, increasing evidences have indicated that abnormal behavior and white matter changes had appeared before senile plaques were formed in Alzheimer's disease (AD). However, the exact nature of these changes in behavior and white matter structure in early AD are unclear. This study used the Morris water maze, an ELISA assay, a transmission electron microscopic technique and new stereological methods to investigate the behavior, Aβ protein expression and white matter structure of Tg2576 transgenic mice at four ages. Only 10 months of age, the time latency in the Morris water maze tasks for Tg2576 transgenic mice were significantly longer than that of wild-type mice. The concentration of Aβ40 protein in the white matter of the Tg2576 transgenic mice was significantly increased in four ages mice, but the Aβ42 protein was significantly increased only in the 6-month-old mice. In 10-month-old mice, the axon volume in the white matter of the Tg2576 transgenic mice was significantly decreased when compared to the wild-type mice. These results suggest that the deposition of Aβ in the white matter of Tg2576 transgenic mice appeared before the spatial memory decline. The early detection of the Aβ content in the white matter of AD might help diagnose suspected AD. In addition, the axon changes in the white matter of AD might be one of the morphological causes of the behavioral deficits observed in 10-month-old transgenic mouse models of AD, and protecting the axons in the white matter might be an important method for delaying the progression of AD. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Cognitive and emotional alterations in young Alzheimer's disease (3xTgAD) mice: effects of neonatal handling stimulation and sexual dimorphism.

    Science.gov (United States)

    Cañete, T; Blázquez, G; Tobeña, A; Giménez-Llort, L; Fernández-Teruel, A

    2015-03-15

    Alzheimer disease is the most common neurodegenerative disorder and cause of senile dementia. It is characterized by an accelerated memory loss, and alterations of mood, reason, judgment and language. The main neuropathological hallmarks of the disorder are β-amyloid (βA) plaques and neurofibrillary Tau tangles. The triple transgenic 3xTgAD mouse model develops βA and Tau pathologies in a progressive manner which mimicks the pattern that takes place in the human brain with AD, and showing cognitive alterations characteristic of the disease. The present study intended to examine whether 3xTgAD mice of both sexes present cognitive, emotional and other behavioral alterations at the early age of 4 months, an age in which only some intraneuronal amyloid accumulation is found. Neonatal handling (H) is an early-life treatment known to produce profound and long-lasting behavioral and neurobiological effects in rodents, as well as improvements in cognitive functions. Therefore, we also aimed at evaluating the effects of H on the behavioral/cognitive profile of 4-month-old male and female 3xTgAD mice. The results indicate that, (1) 3xTgAD mice present spatial learning/memory deficits and emotional alterations already at the early age of 4 months, (2) there exists sexual dimorphism effects on several behavioral variables at this age, (3) neonatal handling exerts a preventive effect on some cognitive (spatial learning) and emotional alterations appearing in 3xTgAD mice already at early ages, and 4) H treatment appears to produce stronger positive effects in females than in males in several spatial learning measures and in the open field test. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Homologous prime-boost strategy with TgPI-1 improves the immune response and protects highly susceptible mice against chronic Toxoplasma gondii infection.

    Science.gov (United States)

    Sánchez, Vanesa R; Fenoy, Ignacio M; Picchio, Mariano S; Soto, Ariadna S; Arcon, Nadia; Goldman, Alejandra; Martin, Valentina

    2015-10-01

    Subunit-based vaccines are safer than live or attenuated pathogen vaccines, although they are generally weak immunogens. Thus, proper combination of immunization strategies and adjuvants are needed to increase their efficacy. We have previously protected C3H/HeN mice from Toxoplasma gondii infection by immunization with the serine protease inhibitor-1 (TgPI-1) in combination with alum. In this work, we explore an original vaccination protocol that combines administration of recombinant TgPI-1 by intradermal and intranasal routes in order to enhance protection in the highly susceptible C57BL/6 strain. Mice primed intradermally with rTgPI-1 plus alum and boosted intranasally with rTgPI-1 plus CpG-ODN elicited a strong specific Th1/Th2 humoral response, along with a mucosal immune response characterized by specific-IgA in intestinal lavages. A positive cellular response of mesentheric lymph node cells and Th1/Th2 cytokine secretion in the ileon were also detected. When immunized mice were challenged with the cystogenic Me49 T. gondii strain, they displayed up to 62% reduction in brain parasite burden. Moreover, adoptive transfer of mesenteric lymph node cells from vaccinated to naïve mice induced significant protection against infection. These results demonstrate that this strategy that combines the administration of TgPI-1 by two different routes, intradermal priming and intranasal boost, improves protective immunity against T. gondii chronic infection in highly susceptible mice. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Design of a PET/CT facility considering the shielding calculation in accordance with AAPM TG-108; Diseno de una instalacion PET/CT considerando el calculo de blindaje segun AAPM TG-108

    Energy Technology Data Exchange (ETDEWEB)

    Guevara R, V. Y.; Romero C, N. [Empresa QC DOSE S. A. C., Av. Tomas Marsano 1915, Surquillo, Lima 34 (Peru); Berrocal T, M., E-mail: vguevara@qcdose.com [Universidad Nacional Mayor de San Marcos, C. German Amezaga 375, Edif. Jorge Basadre, Ciudad Universitaria, Lima 1 (Peru)

    2014-08-15

    A Positron Emission Tomography / Computed Tomography facility may require protection barriers on floor, ceiling and walls, because the patient becomes a radioactive source that emits photons of 0.511 MeV, after having received a radiopharmaceutical, usually F-18 fluorodeoxyglucose (F-18 FDG). This work has as objective to propose the design of a PET/CT facility, taking into account technical and radiation protection considerations applied internationally, and also develop the necessary shielding for such installation by applying as published by the American Association of Physicists in Medicine Task Group Report 108. A shielding spreadsheet in Excel program was developed with reference to the recommendations of the AAPM TG - 08, to determine the shielding required for the walls, floor and ceiling. For fixing the radiation levels in the shielding calculation has been considered the actual restrictions for the occupationally exposed personnel (100 μSv/week) as well as the people in general (20 μSv/ week). The radiopharmaceutical used as a reference for the shielding calculation was the F-18 FDG. With the assistance of an architectural plan were determined distances from potential sources of radiation in facility (uptake and image acquisition living rooms) to points of interest around them. Finally the thickness of the protective barriers in lead and concrete necessary to achieve the established radiation levels were calculated and these results were stored in a table. This paper shows that technical aspects considered in the design of the installation and environments distribution can improve work processes within the PET/CT facility, consequently resulting in a reduction of the dose levels for people in general. (author)

  6. Evaluation of an in-house TgSAG1 (P30) IgG ELISA for diagnosis of naturally acquired Toxoplasma gondii infection in pigs.

    Science.gov (United States)

    Pardini, L; Maksimov, P; Herrmann, D C; Bacigalupe, D; Rambeaud, M; Machuca, M; Moré, G; Basso, W; Schares, G; Venturini, M C

    2012-10-26

    Toxoplasma gondii is an apicomplexan protozoan parasite which is able to infect a large variety of warm-blooded animals. Raw or undercooked pork has been regarded as an important source of infection for humans. The aim of this study was to evaluate an in-house enzyme-linked immunosorbent assay to diagnose natural T. gondii infection in swine using native affinity chromatography-purified T. gondii surface protein-1 (TgSAG1-ELISA) as antigen, comparing its performance to that of indirect fluorescent antibody test (IFAT) and immunoblotting (IB). To obtain a panel of sera showing the evolution of the antibody response in the time course 12 pigs were experimentally inoculated intravenously (iv) with tachyzoites of the T. gondii strains RH (clonal type I), ME49 (clonal type II) and NED (clonal type III) and serologically monitored for a period of 11 weeks. Both IFAT and ELISA showed a similar time course of antibody response to T. gondii; but by IFAT this response was characterized by rapidly rising titers with peaks at two weeks post inoculation (wpi), while the ELISA indices increased slowly and reached a maximum in most animals at five wpi. Three-hundred randomly selected sera from a total of 602 pigs of different ages derived from outdoor and indoor farms from Argentina were analyzed. Serum samples testing either positive or negative by both IFAT and IB were considered as "relative standards of comparison" (RSC). Sensitivity and specificity of TgSAG1-ELISA were obtained by a Receiver Operating Characteristics (ROC) analysis and statistical agreement among serological tests was evaluated. Antibodies to T. gondii were detected in 160 of 300 sera (53.3%) by IB, in 133 of 300 (44.3%) by IFAT and in 123 of 300 sera (41%) by TgSAG1-ELISA. One hundred and eleven sera tested positive and 118 sera tested negative by both IFAT and IB (RSC); 103 of 111 positive RSC sera tested positive by TgSAG1-ELISA, and 116 of 118 negative RSC sera tested negative by TgSAG1-ELISA. Agreement

  7. Thermal behavior of vehicle plastic blends contained acrylonitrile-butadiene-styrene (ABS) in pyrolysis using TG-FTIR.

    Science.gov (United States)

    Liu, Guicai; Liao, Yanfen; Ma, Xiaoqian

    2017-03-01

    As important plastic blends in End-of-Life vehicles (ELV), pyrolysis profiles of ABS/PVC, ABS/PA6 and ABS/PC were investigated using thermogravimetric-Fourier transform infrared spectrometer (TG-FTIR). Also, CaCO3 was added as plastic filler to discuss its effects on the pyrolysis of these plastics. The results showed that the interaction between ABS and PVC made PVC pyrolysis earlier and HCl emission slightly accelerated. The mixing of ABS and PA6 made their decomposition temperature closer, and ketones in PA6 pyrolysis products were reduced. The presence of ABS made PC pyrolysis earlier, and phenyl compounds in PC pyrolysis products could be transferred into alcohol or H2O. The interaction between ABS and other polymers in pyrolysis could be attributed to the intermolecular radical transfer, and free radicals from the polymer firstly decomposed led to a fast initiation the decomposition of the other polymer. As plastic filler, CaCO3 promoted the thermal decomposition of PA6 and PC, and had no obvious effects on ABS and PVC pyrolysis process. Also, CaCO3 made the pyrolysis products from PA6 and PC further decomposed into small-molecule compounds like CO2. The kinetics analysis showed that isoconversional method like Starink method was more suitable for these polymer blends. Starink method showed the average activation energy of ABS50/PVC50, ABS50/PA50 and ABS50/PC50 was 186.63kJ/mol, 239.61kJ/mol and 248.95kJ/mol, respectively, and the interaction among them could be reflected by the activation energy variation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Insight into the phenotype of infants with Pompe disease identified by newborn screening with the common c.-32-13T>G "late-onset" GAA variant.

    Science.gov (United States)

    Rairikar, Mugdha V; Case, Laura E; Bailey, Lauren A; Kazi, Zoheb B; Desai, Ankit K; Berrier, Kathryn L; Coats, Julie; Gandy, Rachel; Quinones, Rebecca; Kishnani, Priya S

    2017-09-19

    Newborn screening (NBS) has led to early diagnosis and early initiation of treatment for infantile onset Pompe Disease (IOPD). However, guidelines for management of late onset Pompe disease (LOPD) via NBS, especially with the IVS c.-32-13T>G are not clear. This IVS variant is noted in 68-90% cases with LOPD and has been presumed to result in "adult" disease in compound heterozygosity, with a few cases with earlier onset and a mild to no phenotype in homozygosity. Our study evaluates newborns with LOPD having IVS variant with a diligent multidisciplinary approach to determine if they have an early presentation. Seven children with LOPD identified by NBS with IVS variant (3 compound heterozygous, and 4 homozygous) were evaluated with clinical, biochemical (CK, AST, ALT, and urinary Glc4), cardiac evaluation, physical therapy (PT), occupational, and speech/language therapy. All seven patients demonstrated motor involvement by age 6months; the three patients with c.-32-13 T>G variant in compound heterozygosity had symptoms as neonates. Patients with c.-32-13 T>G variant in compound heterozygosity had more involvement with persistent hyperCKemia, elevated AST and ALT, swallowing difficulties, limb-girdle weakness, delayed motor milestones, and were initiated on ERT. The patients with c.-32-13T>G variant in homozygosity had normal laboratory parameters, and presented with very subtle yet LOPD specific signs, identified only by meticulous assessments. This patient cohort represents the first carefully phenotyped cohort of infants with LOPD with the "late-onset" GAA variant c.-32-13T>G detected by NBS in the USA. It emphasizes not only the opportunity for early detection of skeletal and other muscle involvement in infants with c.-32-13T>G variant but also a high probability of overlooking or underestimating the significance of clinically present and detectable features. It can thus serve as a valuable contribution in the development of evaluation and treatment algorithms

  9. Age-dependent modifications of AMPA receptor subunit expression levels and related cognitive effects in 3xTg-AD mice

    Directory of Open Access Journals (Sweden)

    Pamela eCantanelli

    2014-08-01

    Full Text Available GluA1, GluA2, GluA3, and GluA4 are the constitutive subunits of AMPA receptors (AMPARs, the major mediators of fast excitatory transmission in the mammalian central nervous system. Most AMPARs are Ca2+-impermeable because of the presence of the GluA2 subunit. GluA2 mRNA undergoes an editing process that results in a Q to R substitution, a key factor in the regulation of AMPAR Ca2+-permeability. AMPARs lacking GluA2 or containing the unedited subunit are permeable to Ca2+ and Zn2+. The phenomenon physiologically modulates synaptic plasticity while, in pathologic conditions, leads to increased vulnerability to excitotoxic neuronal death. Given the importance of these subunits, we have therefore evaluated possible associations between changes in expression levels of AMPAR subunits and development of cognitive deficits in 3xTg-AD mice, a widely investigated transgenic mouse model of Alzheimer’s disease. With qRT-PCR, we assayed hippocampal mRNA expression levels of GluA1-4 subunits occurring in young [3 months of age (m.o.a.] and old (12 m.o.a Tg-AD mice and made comparisons with levels found in age-matched wild type (WT mice. Efficiency of GluA2 RNA editing was also analyzed. All animals were cognitively tested for short- and long-term spatial memory with the Morris Water Maze (MWM navigation task. 3xTg-AD mice showed age-dependent decreases of mRNA levels for all the AMPAR subunits, with the exception of GluA2. Editing remained fully efficient with aging in 3xTg-AD and WT mice. A one-to-one correlation analysis between MWM performances and GluA1-4 mRNA expression profiles showed negative correlations between GluA2 levels and MWM performances in young 3xTg-AD mice. On the contrary, positive correlations between GluA2 mRNA and MWM performances were found in young WT mice. Our data suggest that increases of AMPARs that contain GluA1, GluA3, and GluA4 subunits may help in maintaining cognition in pre-symptomatic 3xTg-AD mice.

  10. Carnitine-acylcarnitine translocase deficiency with c.199-10 T>G and novel c.1A>G mutation: Two case reports and brief literature review.

    Science.gov (United States)

    Yan, Hui-Ming; Hu, Hao; Ahmed, Aisha; Feng, Bing-Bing; Liu, Jing; Jia, Zheng-Jun; Wang, Hua

    2017-11-01

    Carnitine-acylcarnitine translocate deficiency (CACTD) is a rare and life-threatening, autosomal recessive disorder of fatty acid β-oxidation characterized by hypoketotic hypoglycemia, hyperammonemia, cardiomyopathy, liver dysfunction, and muscle weakness; culminating in early death. To date, CACTD cases screened from the Chinese mainland population, especially patient with compound heterozygote with c.199-10T>G and a novel c.1A>G mutation in the SLC25A20 gene has never been described. Herein, we report 2 neonatal cases of CACTD identified from the mainland China. These 2 patients were presented with severe metabolic crisis and their clinical conditions deteriorate rapidly and both died of cardiorespiratory collapse in the first week of life. We present the clinical and biochemical features of 2 probands and a brief literature review of previously reported CACTD cases with the c.199-10T>G mutation. The acylcarnitine profiles by tandem-mass-spectrometry and the mutation analysis of SLC25A20 gene confirmed the diagnosis of CACTD in both patients. Mutation analysis demonstrated that patient No. 1 was homozygous for c.199-10T>G mutation, while patient No. 2 was a compound heterozygote for 2 mutations, a maternally-inherited c.199-10T>G and a paternally-inherited, novel c.1A>G mutation. Both patients were treated with an aggressive treatment regimen include high glucose and arginine infusion, respiratory, and circulatory support. The first proband died 3 days after delivery due to sudden cardiac arrest. The second patient's clinical condition, at one time, was improved by high glucose infusion, intravenous arginine, and circulatory support. However, the patient failed to wean from mechanical ventilation. Unfortunately, her parents refused further treatment due to fear of financial burdens. The patient died of congestive heart failure in the 6th day of life. We report the first 2 cases of CACTD identified from the mainland China. Apart from a founder mutation c.199-10T>G

  11. Tg737 regulates epithelial-mesenchymal transition and cancer stem cell properties via a negative feedback circuit between Snail and HNF4α during liver stem cell malignant transformation.

    Science.gov (United States)

    Huang, Qike; Pu, Meng; Zhao, Ge; Dai, Bin; Bian, Zhenyuan; Tang, Haili; Chen, Chong; Liu, Wei; Qu, Xuan; Shen, Liangliang; Tao, Kaishan

    2017-08-28

    Determining the origin of liver cancer stem cells is important for treating hepatocellular carcinoma. Tg737 deficiency plays an important role in the malignant transformation of liver stem cells, but the underlying mechanism remains unclear. Here we established a chemical-induced mouse hepatoma model and found that Tg737 and hepatocyte nuclear factor 4-alpha (HNF4α) expression decreased and epithelial-mesenchymal transition (EMT)-related marker expression increased during liver cancer development. To investigate the underlying mechanism, we knocked down Tg737 in WB-F344 (WB) rat hepatic oval cells. Loss of Tg737 resulted in nuclear β-catenin accumulation and activation of the Wnt/β-catenin pathway, which further promoted EMT and the malignant phenotype. XAV939, a β-catenin inhibitor, attenuated WB cell malignant transformation due to Tg737 knockdown. To clarify the relationships of Tg737, the β-catenin pathway, and HNF4α, we inhibited Snail and overexpressed HNF4α after Tg737 knockdown in WB cells and found that Snail and HNF4α comprise a negative feedback circuit. Taken together, the results showed that Tg737 regulates a Wnt/β-catenin/Snail-HNF4α negative feedback circuit, thereby blocking EMT and the malignant transformation of liver stem cells to liver cancer stem cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Relationship of the triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio to the remainder of the lipid profile: The Very Large Database of Lipids-4 (VLDL-4) study.

    Science.gov (United States)

    Quispe, Renato; Manalac, Raoul J; Faridi, Kamil F; Blaha, Michael J; Toth, Peter P; Kulkarni, Krishnaji R; Nasir, Khurram; Virani, Salim S; Banach, Maciej; Blumenthal, Roger S; Martin, Seth S; Jones, Steven R

    2015-09-01

    High levels of the triglycerides to high-density lipoprotein cholesterol (TG/HDL-C) ratio are associated with obesity, metabolic syndrome, and insulin resistance. We evaluated variability in the remaining lipid profile, especially remnant lipoprotein particle cholesterol (RLP-C) and its components (very low-density lipoprotein cholesterol subfraction 3 and intermediate-density lipoprotein cholesterol), with variability in the TG/HDL-C ratio in a very large study cohort representative of the general U.S. We examined data from 1,350,908 US individuals who were clinically referred for lipoprotein cholesterol ultracentrifugation (Atherotech, Birmingham, AL) from 2009 to 2011. Demographic information other than age and sex was not available. Changes to the remaining lipid profile across percentiles of the TG/HDL-C ratio were quantified, as well as by three TG/HDL-C cut-off points previously proposed in the literature: 2.5 (male) and 2 (female), 3.75 (male) and 3 (female), and 3.5 (male and female). The mean age of our study population was 58.7 years, and 48% were men. The median TG/HDL-C ratio was 2.2. Across increasing TG/HDL-C ratios, we found steadily increasing levels of RLP-C, non-HDL-C and LDL density. Among the lipid parameters studied, RLP-C and LDL density had the highest relative increase when comparing individuals with elevated TG/HDL-C levels to those with lower TG/HDL-C levels using established cut-off points. Approximately 47% of TG/HDL-C ratio variance was attributable to RLP-C. In the present analysis, a higher TG/HDL-C ratio was associated with an increasingly atherogenic lipid phenotype, characterized by higher RLP-C along with higher non-HDL-C and LDL density. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Investigation into the cancer protective effect of flaxseed in Tg.NK (MMTV/c-neu) mice, a murine mammary tumor model

    DEFF Research Database (Denmark)

    Birkved, Franziska Kramer; Mortensen, Alicja; Penalvo, Jose L

    2011-01-01

    development were evaluated. Hepatic cytochrome P450 and glutathione S-transferase activities were significantly reduced in animals receiving low flaxseed doses. An incidence of palpable tumors before sacrifice, a number of tumors per mouse, and a number of large tumors (>6 mm diameter) at necropsy were...... to the controls. Thus, the effect of small dietary doses of flaxseed on mammary tumor development in Tg.NK mice remains to be established.......The aim of the present study was to investigate whether low flaxseed doses relevant to human dietary exposure can prevent mammary tumors in transgenic Tg.NK mice, a model of breast cancer. Animals were exposed to flaxseed through the diet at human relevant levels. Tumor-related parameters and tumor...

  14. Comparison of the thermal decomposition kinetics for charged LiMn{sub 2}O{sub 4} by TG and C80 methods

    Energy Technology Data Exchange (ETDEWEB)

    Wang Qingsong [State Key Laboratory of Fire Science, University of Science and Technology of China, Hefei 230026 (China)], E-mail: pinew@ustc.edu.cn; Sun Jinhua [State Key Laboratory of Fire Science, University of Science and Technology of China, Hefei 230026 (China); Chen Dongliang [State Key Laboratory of Fire Science, University of Science and Technology of China, Hefei 230026 (China); College of Mechanical and Electrical Engineering, Beijing University of Chemical Technology, Beijing 100029 (China); Chen Chunhua [Department of Materials Science and Engineering, University of Science and Technology of China, Hefei 230026 (China)

    2009-01-22

    In order to disclose the decomposition kinetics of charged LiMn{sub 2}O{sub 4} used in lithium-ion batteries, thermogravimetric analyzer (TGA) and C80 micro-calorimeter were employed in this study. Three stages of weight loss were detected by TG and two main exothermic processes were detected by C80 micro-calorimeter for the charged LiMn{sub 2}O{sub 4}. The chemical reaction kinetics is supposed to fit by an Arrhenius law, and then the activation energy is calculated as E{sub a} = 90.4 and 140.1 kJ mol{sup -1} based on TG and C80 data, respectively. And the C80 method shows more advantages in studying the thermodynamic and kinetic parameters for both the electrodes alone and its co-existing system with electrolyte.

  15. REST/NRSF-induced changes of ChAT protein expression in the neocortex and hippocampus of the 3xTg-AD mouse model for Alzheimer's disease.

    Science.gov (United States)

    Orta-Salazar, E; Aguilar-Vázquez, A; Martínez-Coria, H; Luquín-De Anda, S; Rivera-Cervantes, M; Beas-Zarate, C; Feria-Velasco, A; Díaz-Cintra, S

    2014-10-29

    The cholinergic system is one of the neurotransmitter systems altered in Alzheimer's disease (AD), the most common form of human dementia. The objective of this work was to determine the REST/NRSF involvement in altered ChAT expression in the neocortex and hippocampus of an AD transgenic mouse (homozygous 3xTg-AD) that over-expresses 3 proteins, amyloid-β precursor protein, presenilin-1, and tau, all of which are associated with AD and cause cellular degeneration. Two groups (WT and 3xTg-AD) of 11-month-old female mice were analyzed and compared. Half of the brains of each group were used for ChAT immunohistochemistry, and Western Blot analyses of ChAT and REST/NRSF were performed on the other half. We observed significant decreases in the number of ChAT-immunoreactive cells in the Meynert nucleus and of fibers in the frontal motor cortex and hippocampal CA1 area in transgenic mice compared with control mice. An increased level of REST/NRSF protein and a reduction of ChAT protein expression in the 3xTg-AD mice compared with their controls were also found in both in the latter two cerebral regions. The increased REST/NRSF expression reported here and its effect on the regulatory region for ChAT transcription could explain the decreased expression of ChAT in the 3xTg-AD mouse; these findings may be associated with the degeneration observed in AD. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. In silico analysis and gene expression of TgNAC01 transcription factor involved in xylogenesis and abiotic stress in Tectona grandis.

    Directory of Open Access Journals (Sweden)

    Vladimir Camel Paucar

    2017-09-01

    Full Text Available Secondary xylem is the most abundant component of plant biomass. Therefore, knowing the genes that regulate its formation would help to design strategies for wood genetic improvement. Thus, the objective of this work was to perform computational analysis of the primary and secondary structure of the TgNAC01 transcription factor (FT of Tectona grandis, and to evaluate its evolutionary history, conserved domains and gene expression in lignified tissues of 12 and 60 years. For this, an ion-electron interaction potential (IEP was evaluated using the information-spectrum method (IEM using the R-Project and SFAPS library, followed by structural modeling using the MODELLER software and visualized by PyMol program. In addition, the analysis of multiple sequence alignment and phylogeny was performed using Bioedit and MrBayes software, respectively. We also evaluated the qRT-PCR levels of TgNAC01. As results, it was found that TgNAC01 maintains a twisted antiparallel β-sheet structure, which is compacted against an α-helix in the N-terminal region, having three α-helix domains and seven folded β-domains. Also, through the IEM, it was demonstrated that it has about five biological functions, and mutations on amino acids with higher IEP, which leads to evolutions on genetic regulation networks. Finally, the FT TgNAC01 plays an esential role in the organization and development of the parts that make up the sapwood, such as the radial cells of the cambial zone, the vessels, fibers and the growth rings.

  17. [Morphological analysis of the hippocampal region associated with an innate behaviour task in the transgenic mouse model (3xTg-AD) for Alzheimer disease].

    Science.gov (United States)

    Orta-Salazar, E; Feria-Velasco, A; Medina-Aguirre, G I; Díaz-Cintra, S

    2013-10-01

    Different animal models for Alzheimer disease (AD) have been designed to support the hypothesis that the neurodegeneration (loss of neurons and synapses with reactive gliosis) associated with Aβ and tau deposition in these models is similar to that in the human brain. These alterations produce functional changes beginning with decreased ability to carry out daily and social life activities, memory loss, and neuropsychiatric disorders in general. Neuronal alteration plays an important role in early stages of the disease, especially in the CA1 area of hippocampus in both human and animal models. Two groups (WT and 3xTg-AD) of 11-month-old female mice were used in a behavioural analysis (nest building) and a morphometric analysis of the CA1 region of the dorsal hippocampus. The 3xTg-AD mice showed a 50% reduction in nest quality associated with a significant increase in damaged neurons in the CA1 hippocampal area (26%±6%, P<.05) compared to the WT group. The decreased ability to carry out activities of daily living (humans) or nest building (3xTg-AD mice) is related to the neuronal alterations observed in AD. These alterations are controlled by the hippocampus. Post-mortem analyses of the human hippocampus, and the CA1 region in 3xTg-AD mice, show that these areas are associated with alterations in the deposition of Aβ and tau proteins, which start accumulating in the early stages of AD. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

  18. Impaired Attention in the 3xTgAD Model of Alzheimer’s Disease Assessed Using a Translational Touchscreen Method for Mice: Rescue by Donepezil (Aricept)

    Science.gov (United States)

    Romberg, Carola; Mattson, Mark P.; Mughal, Mohamed R.; Bussey, Timothy J.; Saksida, Lisa M.

    2011-01-01

    Several mouse models of Alzheimer’s Disease (AD) with abundant β-amyloid and/or aberrantly phosphorylated tau develop memory impairments. However, multiple non-mnemonic cognitive domains such as attention and executive control are also compromised early in AD individuals. Currently, it is unclear whether mutations in the β-amyloid precursor protein (APP) and tau are sufficient to cause similar, AD-like attention deficits in mouse models of the disease. To address this question, we tested 3xTgAD mice (which express APPswe, PS1M146V and tauP301L mutations) and wild type control mice on a newly-developed touchscreen-based 5-choice serial reaction time test of attention and response control. The 3xTgAD mice attended less accurately to short, spatially unpredictable stimuli when the attentional demand of the task was high, and also showed a general tendency to make more perseverative responses than wild type mice. The attentional impairment of 3xTgAD mice was comparable to that of AD patients in two aspects; first, although 3xTgAD mice initially responded as accurately as wild type mice, they subsequently failed to sustain their attention over the duration of the task; second, the ability to sustain attention was enhanced by the cholinesterase inhibitor donepezil (Aricept). These findings demonstrate that familial AD mutations not only affect memory, but also cause significant impairments in attention, a cognitive domain supported by the prefrontal cortex and its afferents. Because attention deficits are likely to affect memory encoding and other cognitive abilities, our findings have important consequences for the assessment of disease mechanisms and therapeutics in animal models of AD. PMID:21368062

  19. Effects of soy-derived isoflavones and a high-fat diet on spontaneous mammary rimor development in Tg.NK (MMTV/c-neu) mice

    DEFF Research Database (Denmark)

    Luijten, M.; Thomsen, A.R.; van den Berg, J.A.H.

    2004-01-01

    Phytoestrogens such as isoflavonoids and lignans have been postulated as breast cancer protective constituents in soy and whole-grain cereals. We investigated the ability of isoflavones (IFs) and flaxseed to modulate spontaneous mammary tumor development in female heterozygous Tg.NK (MMTV/c-neu) ......-modulating effects of phytoestrogens are dependent both on the background diet and on the timing of exposure in the life cycle....

  20. The -93T/G LPL Promoter Polymorphism Is Associated With Lower Third-Trimester Triglycerides in Pregnant African American Women.

    Science.gov (United States)

    Schmella, Mandy J; Ferrell, Robert E; Gallaher, Marcia J; Lykins, David L; Althouse, Andrew D; Roberts, James M; Hubel, Carl A

    2015-07-01

    Hypertriglyceridemia is a risk factor for cardiovascular disease and several pregnancy complications. Lipoprotein lipase (LPL) genetic variation modulates nonpregnancy plasma triglycerides, but its effects during pregnancy are unknown. The G allele of the LPL -93T/G promoter polymorphism is 16-23 times more prevalent in Blacks than in Whites, contributing to lower triglycerides in nonpregnant African Americans by increasing LPL expression. This study investigated whether the triglyceride-lowering effect of -93G is observed in African Americans during pregnancy. Genotyping was performed on 124 African American women with uncomplicated pregnancies for common functional LPL polymorphisms/mutations (-93T/G, D9N, N291S, and S447X). Third-trimester plasma triglyceride, high- and low-density lipoprotein cholesterol, apolipoprotein B, and free fatty acid concentrations were measured with colorimetric assays. Clinical characteristics and lipid values were compared across the -93T/G genotypes. Triglycerides were significantly lower in women with the -93GG compared to the -93TT genotype, both with (n = 124, p = .02) and without (n = 108, p = .03) inclusion of participants with other LPL variant alleles. Triglyceride differences persisted after adjustment for prepregnancy body mass index, gestational age at delivery, and smoking. There were no significant differences in the other lipids or apolipoprotein B by -93T/G genotype. Despite the considerable metabolic changes accompanying pregnancy, the triglyceride-lowering effect associated with the -93GG LPL genotype in African Americans persists during late pregnancy. The -93GG genotype might protect against pregnancy complications stemming from hypertriglyceridemia, but the overall increased risk of pregnancy complications in African American women points to complex, multifactorial relationships among risk factors, race, and adverse pregnancy outcomes. © The Author(s) 2015.

  1. The −93T/G LPL Promoter Polymorphism Is Associated with Lower Third-Trimester Plasma Triglycerides in Pregnant African American Women

    Science.gov (United States)

    Schmella, Mandy J.; Ferrell, Robert E.; Gallaher, Marcia J.; Lykins, David R.; Althouse, Andrew D.; Roberts, James M.; Hubel, Carl A.

    2014-01-01

    Background Hypertriglyceridemia is a risk factor for cardiovascular disease and several pregnancy complications. Lipoprotein lipase (LPL) genetic variation modulates nonpregnancy plasma triglycerides, but effects during pregnancy are unknown. The G allele of the LPL −93T/G promoter polymorphism is 16–23 times more prevalent in Blacks than in Whites, contributing to lower triglycerides in nonpregnant African Americans by increasing LPL expression. Purpose This study investigated whether the triglyceride-lowering effect of −93G in African Americans is observed during pregnancy. Methods Genotyping was performed on 124 African American women with uncomplicated pregnancies for common functional LPL polymorphisms/mutations (−93T/G, D9N, N291S, S447X). Third-trimester plasma triglyceride, high- and low-density lipoprotein cholesterol, apolipoprotein B, and free fatty acid concentrations were measured with colorimetric assays. Clinical characteristics and lipid values were compared across the −93T/G genotypes. Results Triglycerides were significantly lower in women with the −93GG compared to the −93TT genotype, both with (n = 124, p = 0.02) and without (n = 108, p = 0.03) inclusion of participants with other LPL variant alleles. Triglyceride differences persisted after adjustment for pre-pregnancy body mass index, gestational age at delivery, and smoking. There were no significant differences in the other lipids or apolipoprotein B by −93T/G genotype. Conclusions Despite the considerable metabolic changes accompanying pregnancy, the triglyceride-lowering effect associated with the −93GG LPL genotype in African Americans persists during late pregnancy. The −93GG genotype might protect against pregnancy complications stemming from hypertriglyceridemia, but the overall increased risk for pregnancy complications in African American women points to complex, multifactorial relationships among risk factors, race, and adverse pregnancy outcomes. PMID:25566792

  2. Characterization of pH dependent Mn(II oxidation strategies and formation of a bixbyite-like phase by Mesorhizobium australicum T-G1

    Directory of Open Access Journals (Sweden)

    Tsing eBohu

    2015-07-01

    Full Text Available Despite the ubiquity of Mn oxides in natural environments, there are only a few observations of biological Mn(II oxidation at pH < 6. The lack of low pH Mn-oxidizing bacteria (MOB isolates limits our understanding of how pH influences biological Mn(II oxidation in extreme environments. Here, we report that a novel MOB isolate, Mesorhizobium australicum strain T-G1, isolated from an acidic and metalliferous uranium mining area, can oxidize Mn(II at both acidic and neutral pH using different enzymatic pathways. X-ray diffraction (XRD, Raman spectroscopy, and scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM-EDS revealed that T-G1 initiated bixbyite-like Mn oxide formation at pH 5.5 which coincided with multi-copper oxidase (MCO expression from early exponential phase to late stationary phase. In contrast, reactive oxygen species (ROS, particularly superoxide, appeared to be more important for T-G1 mediated Mn(II oxidation at neutral pH. ROS was produced in parallel with the occurrence of Mn(II oxidation at pH 7.2 from early stationary phase. Solid phase Mn oxides did not precipitate, which is consistent with the presence of a high amount of H2O2 and lower activity of catalase in the liquid culture at pH 7.2. Our results show that M. australicum T-G1, an acid tolerant MOB, can initiate Mn(II oxidation by varying its oxidation mechanisms depending on the pH and may play an important role in low pH manganese biogeochemical cycling.

  3. TG-MS analysis and kinetic study for thermal decomposition of six representative components of municipal solid waste under steam atmosphere.

    Science.gov (United States)

    Zhang, Jinzhi; Chen, Tianju; Wu, Jingli; Wu, Jinhu

    2015-09-01

    Thermal decomposition of six representative components of municipal solid waste (MSW, including lignin, printing paper, cotton, rubber, polyvinyl chloride (PVC) and cabbage) was investigated by thermogravimetric-mass spectroscopy (TG-MS) under steam atmosphere. Compared with TG and derivative thermogravimetric (DTG) curves under N2 atmosphere, thermal decomposition of MSW components under steam atmosphere was divided into pyrolysis and gasification stages. In the pyrolysis stage, the shapes of TG and DTG curves under steam atmosphere were almost the same with those under N2 atmosphere. In the gasification stage, the presence of steam led to a greater mass loss because of the steam partial oxidation of char residue. The evolution profiles of H2, CH4, CO and CO2 were well consistent with DTG curves in terms of appearance of peaks and relevant stages in the whole temperature range, and the steam partial oxidation of char residue promoted the generation of more gas products in high temperature range. The multi-Gaussian distributed activation energy model (DAEM) was proved plausible to describe thermal decomposition behaviours of MSW components under steam atmosphere. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Characterization of pH dependent Mn(II) oxidation strategies and formation of a bixbyite-like phase by Mesorhizobium australicum T-G1

    Science.gov (United States)

    Bohu, Tsing; Santelli, Cara M; Akob, Denise M.; Neu, Thomas R; Ciobota, Valerian; Rösch, Petra; Popp, Jürgen; Nietzsche, Sándor; Küsel, Kirsten

    2015-01-01

    Despite the ubiquity of Mn oxides in natural environments, there are only a few observations of biological Mn(II) oxidation at pH microscopy with energy dispersive X-ray spectroscopy revealed that T-G1 initiated bixbyite-like Mn oxide formation at pH 5.5 which coincided with multi-copper oxidase expression from early exponential phase to late stationary phase. In contrast, reactive oxygen species (ROS), particularly superoxide, appeared to be more important for T-G1 mediated Mn(II) oxidation at neutral pH. ROS was produced in parallel with the occurrence of Mn(II) oxidation at pH 7.2 from early stationary phase. Solid phase Mn oxides did not precipitate, which is consistent with the presence of a high amount of H2O2 and lower activity of catalase in the liquid culture at pH 7.2. Our results show that M. australicum T-G1, an acid tolerant MOB, can initiate Mn(II) oxidation by varying its oxidation mechanisms depending on the pH and may play an important role in low pH manganese biogeochemical cycling.

  5. Primary fatty acid amide metabolism: conversion of fatty acids and an ethanolamine in N18TG2 and SCP cells1[S

    Science.gov (United States)

    Farrell, Emma K.; Chen, Yuden; Barazanji, Muna; Jeffries, Kristen A.; Cameroamortegui, Felipe; Merkler, David J.

    2012-01-01

    Primary fatty acid amides (PFAM) are important signaling molecules in the mammalian nervous system, binding to many drug receptors and demonstrating control over sleep, locomotion, angiogenesis, and many other processes. Oleamide is the best-studied of the primary fatty acid amides, whereas the other known PFAMs are significantly less studied. Herein, quantitative assays were used to examine the endogenous amounts of a panel of PFAMs, as well as the amounts produced after incubation of mouse neuroblastoma N18TG2 and sheep choroid plexus (SCP) cells with the corresponding fatty acids or N-tridecanoylethanolamine. Although five endogenous primary amides were discovered in the N18TG2 and SCP cells, a different pattern of relative amounts were found between the two cell lines. Higher amounts of primary amides were found in SCP cells, and the conversion of N-tridecanoylethanolamine to tridecanamide was observed in the two cell lines. The data reported here show that the N18TG2 and SCP cells are excellent model systems for the study of PFAM metabolism. Furthermore, the data support a role for the N-acylethanolamines as precursors for the PFAMs and provide valuable new kinetic results useful in modeling the metabolic flux through the pathways for PFAM biosynthesis and degradation. PMID:22095832

  6. Assessment of the lethal and sublethal effects of 20 environmental chemicals in zebrafish embryos and larvae by using OECD TG 212.

    Science.gov (United States)

    Horie, Yoshifumi; Yamagishi, Takahiro; Takahashi, Hiroko; Shintaku, Youko; Iguchi, Taisen; Tatarazako, Norihisa

    2017-10-01

    Fish embryo toxicity tests are used to assess the lethal and sublethal effects of environmental chemicals in aquatic organisms. Previously, we used a short-term toxicity test published by the Organization for Economic Co-operation and Development (test no. 212: Fish, Short-term Toxicity Test on Embryo and Sac-Fry Stages [OECD TG 212]) to assess the lethal and sublethal effects of aniline and several chlorinated anilines in zebrafish embryos and larvae. To expand upon this previous study, we used OECD TG 212 in zebrafish embryos and larvae to assess the lethal and sublethal effects of 20 additional environmental chemicals that included active pharmaceutical ingredients, pesticides, metals, aromatic compounds or chlorinated anilines. Zebrafish embryos (Danio rerio) were exposed to the test chemicals until 8 days post-fertilization. A delayed lethal effect was induced by 16 of the 20 test chemicals, and a positive correlation was found between heart rate turbulence and mortality. We also found that exposure to the test chemicals at concentrations lower than the lethal concentration induced the sublethal effects of edema, body curvature and absence of swim-bladder inflation. In conclusion, the environmental chemicals assessed in the present study induced both lethal and sublethal effects in zebrafish embryos and larvae, as assessed by using OECD TG 212. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  7. Homozygosity for the common GAA gene splice site mutation c.-32-13T>G in Pompe disease is associated with the classical adult phenotypical spectrum.

    Science.gov (United States)

    Musumeci, Olimpia; Thieme, Andrea; Claeys, Kristl G; Wenninger, Stephan; Kley, Rudolf A; Kuhn, Marius; Lukacs, Zoltan; Deschauer, Marcus; Gaeta, Michele; Toscano, Antonio; Gläser, Dieter; Schoser, Benedikt

    2015-09-01

    Homozygosity for the common Caucasian splice site mutation c.-32-13T>G in intron 1 of the GAA gene is rather rare in Pompe patients. We report on the clinical, biochemical, morphological, muscle imaging, and genetic findings of six adult Pompe patients from five unrelated families with the c.-32-13T>G GAA gene mutation in homozygous state. All patients had decreased GAA activity and elevated creatine kinase levels. Five patients, aged between 43 and 61 years (median 53 years), initially presented with myalgia, hyperCKaemia, and/or exercise induced fatigue at an age of onset (12-55 years). All but one had proximal lower limb weakness combined with axial weakness and moderate respiratory insufficiency; the sixth patient presented with hyperCKaemia only. Muscle biopsies showed PAS-positive vacuolar myopathy with lysosomal changes and reduced GAA activity. Muscle MRI of lower limb muscles revealed a moderate adipose substitution of the gluteal muscles, biceps femoris and slight fatty infiltration of all thigh muscles. One MRI of the respiratory muscles revealed a diaphragmatic atrophy with unilateral diaphragm elevation. So, the common Caucasian, so called mild, splice site mutation c.-32-13T>G in intron 1 of the GAA gene in a homozygote status reflects the full adult Pompe disease phenotype severity spectrum. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Floating zone growth and characterization of Ca 2Fe 2O 5 single crystals

    Science.gov (United States)

    Maljuk, A.; Strempfer, J.; Lin, C. T.

    2003-11-01

    We report the growth of inclusion and sub-grain free Ca 2Fe 2O 5 (CFO) single crystals by the floating zone method. Single crystals were successfully obtained with volumes of up to 1.0 cm 3. The X-ray rocking curve of the CFO single crystal has the full-width at half-maximum (FWHM) of 0.065°. The oxygen content in the as-grown CFO single crystal was measured by the thermo-gravimetric (TG) method in Ar/H 2 flow. Two magnetic transitions at T1≈140 K and T2≈60 K were observed in the CFO crystal.

  9. Genetic association analysis of the functional c.714T>G polymorphism and mucosal expression of dectin-1 in inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Hilbert S de Vries

    Full Text Available BACKGROUND: Dectin-1 is a pattern recognition receptor (PRR expressed by myeloid cells that specifically recognizes beta-1,3 glucan, a polysaccharide and major component of the fungal cell wall. Upon activation, dectin-1 signaling converges, similar to NOD2, on the adaptor molecule CARD9 which is associated with inflammatory bowel disease (IBD. An early stop codon polymorphism (c.714T>G in DECTIN-1 results in a loss-of-function (p.Y238X and impaired cytokine responses, including TNF-alpha, interleukin (IL-1beta and IL-17 upon in vitro stimulation with Candida albicans or beta-glucan. The aim of the present study was to test the hypothesis that the DECTIN-1 c.714T>G (p.Y238X polymorphism is associated with lower disease susceptibility or severity in IBD and to investigate the level of dectin-1 expression in inflamed and non-inflamed colon tissue of IBD patients. METHODOLOGY: Paraffin embedded tissue samples from non-inflamed and inflamed colon of IBD patients and from diverticulitis patients were immunohistochemically stained for dectin-1 and related to CD68 macrophage staining. Genomic DNA of IBD patients (778 patients with Crohn's disease and 759 patients with ulcerative colitis and healthy controls (n = 772 was genotyped for the c.714T>G polymorphism and genotype-phenotype interactions were investigated. PRINCIPAL FINDINGS: Increased expression of dectin-1 was observed in actively inflamed colon tissue, as compared to non-inflamed tissue of the same patients. Also an increase in dectin-1 expression was apparent in diverticulitis tissue. No statistically significant difference in DECTIN-1 c.714T>G allele frequencies was observed between IBD patients and healthy controls. Furthermore, no differences in clinical characteristics could be observed related to DECTIN-1 genotype, neither alone, nor stratified for NOD2 genotype. CONCLUSIONS: Our data demonstrate that dectin-1 expression is elevated on macrophages, neutrophils, and other immune cells

  10. Gene Polymorphisms of ADIPOQ +45T>G, UCP2 -866G>A, and FABP2 Ala54Thr on the Risk of Colorectal Cancer: A Matched Case-Control Study.

    Directory of Open Access Journals (Sweden)

    Xiaoqin Hu

    Full Text Available As insulin resistance (IR is an established risk factor for colorectal cancer (CRC, we explored the association between each of the IR-related gene polymorphisms of adiponectin (ADIPOQ rs2241766, uncoupling protein 2 (UCP2 rs659366, and fatty acid-binding protein (FABP2 rs1799883 and CRC risk. Genotyping of blood samples and collection of lifestyle and dietary habits were performed for 400 case-control pairs. Unconditional logistic regression (ULR was applied to assess the effects of the three single nucleotide polymorphisms (SNP, environmental factors. Both ULR and generalized multifactor dimensionality reduction (GMDR were used to test the gene-gene and gene-environment interactions on CRC risk. Subjects carrying the ADIPOQ rs2241766 TG+GG genotype had a higher CRC risk than those carrying the TT genotype (OR = 1.429, 95% CI 1.069-1.909. The additive and multiplicative interactions between ADIPOQ rs2241766 and FABP2 rs1799883 on CRC were found by ULR (RERI = 0.764, 95%CI 0.218∼1.311, AP = 0.514, 95%CI 0.165∼0.864, S = -1.745, 95%CI is unachievable, and Pmulti = 0.017, respectively. Furthermore, the high order gene-gene interaction of the three SNPs were found by GMDR (P = 0.0107. A significant dosage effect with an increasing number of risk genotypes was observed as the risk of CRC increased (Ptrend = 0.037. In GMDR, the gene-environment interaction among the three SNPs and red meat consumption on CRC risk was significant (P = 0.0107. Compared with subjects with low red meat consumption and null risk genotypes, those with high-red meat consumption and three risk genotypes had 3.439-fold CRC risk (95% CI 1.410-8.385. In conclusion, the results showed that the ADIPOQ rs2241766 TG+GG genotype increased CRC risk. Given the complexity of the carcinogen for CRC, ADIPOQ rs2241766, UCP2 rs659366, FABP2 rs1799883 and red meat consumption potentially worked together in affecting CRC risk.

  11. Dietary DHA supplementation causes selective changes in phospholipids from different brain regions in both wild type mice and the Tg2576 mouse model of Alzheimer's disease.

    Science.gov (United States)

    Bascoul-Colombo, Cécile; Guschina, Irina A; Maskrey, Benjamin H; Good, Mark; O'Donnell, Valerie B; Harwood, John L

    2016-06-01

    Alzheimer's disease (AD) is of major concern in ageing populations and we have used the Tg2576 mouse model to understand connections between brain lipids and amyloid pathology. Because dietary docosahexaenoic acid (DHA) has been identified as beneficial, we compared mice fed with a DHA-supplemented diet to those on a nutritionally-sufficient diet. Major phospholipids from cortex, hippocampus and cerebellum were separated and analysed. Each phosphoglyceride had a characteristic fatty acid composition which was similar in cortex and hippocampus but different in the cerebellum. The biggest changes on DHA-supplementation were within ethanolamine phospholipids which, together with phosphatidylserine, had the highest proportions of DHA. Reciprocal alterations in DHA and arachidonate were found. The main diet-induced alterations were found in ethanolamine phospholipids, (and included their ether derivatives), as were the changes observed due to genotype. Tg mice appeared more sensitive to diet with generally lower DHA percentages when on the standard diet and higher relative proportions of DHA when the diet was supplemented. All four major phosphoglycerides analysed showed age-dependent decreases in polyunsaturated fatty acid contents. These data provide, for the first time, a detailed evaluation of phospholipids in different brain areas previously shown to be relevant to behaviour in the Tg2576 mouse model for AD. The lipid changes observed with genotype are consistent with the subtle alterations found in AD patients, especially for the ethanolamine phospholipid molecular species. They also emphasise the contrasting changes in fatty acid content induced by DHA supplementation within individual phospholipid classes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Leigh-Like Syndrome Due to Homoplasmic m.8993T>G Variant with Hypocitrullinemia and Unusual Biochemical Features Suggestive of Multiple Carboxylase Deficiency (MCD).

    Science.gov (United States)

    Balasubramaniam, Shanti; Lewis, B; Mock, D M; Said, H M; Tarailo-Graovac, M; Mattman, A; van Karnebeek, C D; Thorburn, D R; Rodenburg, R J; Christodoulou, J

    2017-01-01

    Leigh syndrome (LS), or subacute necrotizing encephalomyelopathy, is a genetically heterogeneous, relentlessly progressive, devastating neurodegenerative disorder that usually presents in infancy or early childhood. A diagnosis of Leigh-like syndrome may be considered in individuals who do not fulfil the stringent diagnostic criteria but have features resembling Leigh syndrome.We describe a unique presentation of Leigh-like syndrome in a 3-year-old boy with elevated 3-hydroxyisovalerylcarnitine (C5-OH) on newborn screening (NBS). Subsequent persistent plasma elevations of C5-OH and propionylcarnitine (C3) as well as fluctuating urinary markers were suggestive of multiple carboxylase deficiency (MCD). Normal enzymology and mutational analysis of genes encoding holocarboxylase synthetase (HLCS) and biotinidase (BTD) excluded MCD. Biotin uptake studies were normal excluding biotin transporter deficiency. His clinical features at 13 months of age comprised psychomotor delay, central hypotonia, myopathy, failure to thrive, hypocitrullinemia, recurrent episodes of decompensation with metabolic keto-lactic acidosis and an episode of hyperammonemia. Biotin treatment from 13 months of age was associated with increased patient activity, alertness, and attainment of new developmental milestones, despite lack of biochemical improvements. Whole exome sequencing (WES) analysis failed to identify any other variants which could likely contribute to the observed phenotype, apart from the homoplasmic (100%) m.8993T>G variant initially detected by mitochondrial DNA (mtDNA) sequencing.Hypocitrullinemia has been reported in patients with the m.8993T>G variant and other mitochondrial disorders. However, persistent plasma elevations of C3 and C5-OH have previously only been reported in one other patient with this homoplasmic mutation. We suggest considering the m.8993T>G variant early in the diagnostic evaluation of MCD-like biochemical disturbances, particularly when associated with

  13. SU-E-I-101: Initial Implementation and Evaluation of AAPM TG-150 Draft Image Receptor Non-Uniformity Testing Recommendations.

    Science.gov (United States)

    Dave, J; Gingold, E; Yorkston, J; Bercha, I; Goldman, L; Walz-Flannigan, A; Willis, C

    2012-06-01

    To implement in software the procedures described in AAPM Task Group 150's draft recommendations for image receptor performance testing, and to evaluate the effectiveness and practicality of these procedures. Images of flat fields were acquired using digital x-ray image receptors at 6 cooperating institutions. Four flat field images obtained with each detector spanned a range of input detector air kerma. Software based on AAPM TG150's draft report processed the test images and generated results. Image receptor response and several measures of non-uniformity were evaluated. Images were divided into 10 mm square regions, after eliminating 10 mm borders. For each region, signal (mean), noise (standard deviation) and SNR were calculated. Characteristic signal, noise and SNR were calculated based on average values from all regions. Local non-uniformity for signal (SLN), noise (NLN) and SNR (SNRLN) were expressed as the maximum ratio of the absolute difference between each region's value and its 4 nearest neighbors, to the respective characteristic value. Global non-uniformity (SGN, NGN, SNRGN) were expressed similarly but differences between maximum and minimum values obtained from the regions were used (without comparison to local neighbors). TG150 tests discriminated between good and poorly performing detectors. Improper detector calibration was detectable, with noise non-uniformity proving to be a more sensitive measure than signal or SNR non-uniformity. Detector rotation relative to calibration conditions produced a greater change in signal non-uniformity than the other measures. Image receptor structured noise was characterized by an increase in noise non-uniformity with incident air kerma. AAPM TG150's proposed approach to image receptor testing was implemented and evaluated. The approach appears to be an effective and practical one for routine quality assurance testing of digital radiographic image receptors. © 2012 American Association of Physicists in Medicine.

  14. Annealing to optimize the primary drying rate, reduce freezing-induced drying rate heterogeneity, and determine T(g)' in pharmaceutical lyophilization.

    Science.gov (United States)

    Searles, J A; Carpenter, J F; Randolph, T W

    2001-07-01

    In a companion paper we show that the freezing of samples in vials by shelf-ramp freezing results in significant primary drying rate heterogeneity because of a dependence of the ice crystal size on the nucleation temperature during freezing.1 The purpose of this study was to test the hypothesis that post-freezing annealing, in which the product is held at a predetermined temperature for a specified duration, can reduce freezing-induced heterogeneity in sublimation rates. In addition, we test the impact of annealing on primary drying rates. Finally, we use the kinetics of relaxations during annealing to provide a simple measurement of T(g)', the glass transition temperature of the maximally freeze-concentrated amorphous phase, under conditions and time scales most appropriate for industrial lyophilization cycles. Aqueous solutions of hydroxyethyl starch (HES), sucrose, and HES:sucrose were either frozen by placement on a shelf while the temperature was reduced ("shelf-ramp frozen") or by immersion into liquid nitrogen. Samples were then annealed for various durations over a range of temperatures and partially lyophilized to determine the primary drying rate. The morphology of fully dried liquid nitrogen-frozen samples was examined using scanning electron microscopy. Annealing reduced primary drying rate heterogeneity for shelf-ramp frozen samples, and resulted in up to 3.5-fold increases in the primary drying rate. These effects were due to increased ice crystal sizes, simplified amorphous structures, and larger and more numerous holes on the cake surface of annealed samples. Annealed HES samples dissolved slightly faster than their unannealed counterparts. Annealing below T(g)' did not result in increased drying rates. We present a simple new annealing-lyophilization method of T(g)' determination that exploits this phenomenon. It can be carried out with a balance and a freeze-dryer, and has the additional advantage that a large number of candidate formulations can

  15. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    Science.gov (United States)

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  16. Eplerenone ameliorates the phenotypes of metabolic syndrome with NASH in liver-specific SREBP-1c Tg mice fed high-fat and high-fructose diet.

    Science.gov (United States)

    Wada, Tsutomu; Miyashita, Yusuke; Sasaki, Motohiro; Aruga, Yusuke; Nakamura, Yuto; Ishii, Yoko; Sasahara, Masakiyo; Kanasaki, Keizo; Kitada, Munehiro; Koya, Daisuke; Shimano, Hitoshi; Tsuneki, Hiroshi; Sasaoka, Toshiyasu

    2013-12-01

    Because the renin-angiotensin-aldosterone system has been implicated in the development of insulin resistance and promotion of fibrosis in some tissues, such as the vasculature, we examined the effect of eplerenone, a selective mineralocorticoid receptor (MR) antagonist, on nonalcoholic steatohepatitis (NASH) and metabolic phenotypes in a mouse model reflecting metabolic syndrome in humans. We adopted liver-specific transgenic (Tg) mice overexpressing the active form of sterol response element binding protein-1c (SREBP-1c) fed a high-fat and fructose diet (HFFD) as the animal model in the present study. When wild-type (WT) C57BL/6 and liver-specific SREBP-1c Tg mice grew while being fed HFFD for 12 wk, body weight and epididymal fat weight increased in both groups with an elevation in blood pressure and dyslipidemia. Glucose intolerance and insulin resistance were also observed. Adipose tissue hypertrophy and macrophage infiltration with crown-like structure formation were also noted in mice fed HFFD. Interestingly, the changes noted in both genotypes fed HFFD were significantly ameliorated with eplerenone. HFFD-fed Tg mice exhibited the histological features of NASH in the liver, including macrovesicular steatosis and fibrosis, whereas HFFD-fed WT mice had hepatic steatosis without apparent fibrotic changes. Eplerenone effectively ameliorated these histological abnormalities. Moreover, the direct suppressive effects of eplerenone on lipopolysaccharide-induced TNFα production in the presence and absence of aldosterone were observed in primary-cultured Kupffer cells and bone marrow-derived macrophages. These results indicated that eplerenone prevented the development of NASH and metabolic abnormalities in mice by inhibiting inflammatory responses in both Kupffer cells and macrophages.

  17. Early-life sodium exposure unmasks susceptibility to stroke in hyperlipidemic, hypertensive heterozygous Tg25 rats transgenic for human cholesteryl ester transfer protein.

    Science.gov (United States)

    Decano, Julius L; Viereck, Jason C; McKee, Ann C; Hamilton, James A; Ruiz-Opazo, Nelson; Herrera, Victoria L M

    2009-03-24

    Early-life risk factor exposure increases aortic atherosclerosis and blood pressure in humans and animal models; however, limited insight has been gained as to end-organ complications. We investigated the effects of early-life Na exposure (0.23% versus 0.4% NaCl regular rat chow) on vascular disease outcomes using the inbred, transgenic [hCETP](25) Dahl salt-sensitive hypertensive rat model of male-predominant coronary atherosclerosis, Tg25. Rather than the expected increase in coronary heart disease, fetal 0.4% Na exposure (cerebral cortical hemorrhagic infarctions, microhemorrhages, neuronal ischemia, and microvascular injury. Ex vivo MRI of stroke-positive rat brains detected cerebral hemorrhages, microhemorrhages, and ischemia with middle cerebral artery distribution and cerebellar noninvolvement. Ultrasound microimaging detected carotid artery disease. Prestroke analysis detected neuronal ischemia and decreased mass of isolated cerebral but not cerebellar microvessels. Early-life Na exposure exacerbated hypertension and unmasked stroke susceptibility, with greater female vulnerability in hypertensive, hyperlipidemic Tg25 rats. The reproducible modeling in stroke-prone Tg25 rats of carotid artery disease, cerebral hemorrhagic infarctions, neuronal ischemia, microhemorrhages, and microvascular alterations suggests a pathogenic spectrum with causal interrelationships. This "mixed-stroke" spectrum could represent paradigms of ischemic-hemorrhagic transformation and/or a microangiopathic basis for the association of ischemic lesions, microhemorrhages, and strokes in humans. Together, the data reveal early-life Na exposure to be a significant modifier of hypertension and stroke disease course and hence a potentially modifiable prevention target that deserves systematic study.

  18. SU-F-T-458: Tracking Trends of TG-142 Parameters Via Analysis of Data Recorded by 2D Chamber Array

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrian, A; Kabat, C; Defoor, D; Saenz, D; Rasmussen, K; Kirby, N; Gutierrez, A; Papanikolaou, N; Stathakis, S [University of Texas HSC SA, San Antonio, TX (United States)

    2016-06-15

    Purpose: With increasing QA demands of medical physicists in clinical radiation oncology, the need for an effective method of tracking clinical data has become paramount. A tool was produced which scans through data automatically recorded by a 2D chamber array and extracts relevant information recommended by TG-142. Using this extracted information a timely and comprehensive analysis of QA parameters can be easily performed enabling efficient monthly checks on multiple linear accelerators simultaneously. Methods: A PTW STARCHECK chamber array was used to record several months of beam outputs from two Varian 2100 series linear accelerators and a Varian NovalisTx−. In conjunction with the chamber array, a beam quality phantom was used to simultaneously to determine beam quality. A minimalist GUI was created in MatLab that allows a user to set the file path of the data for each modality to be analyzed. These file paths are recorded to a MatLab structure and then subsequently accessed by a script written in Python (version 3.5.1) which then extracts values required to perform monthly checks as outlined by recommendations from TG-142. The script incorporates calculations to determine if the values recorded by the chamber array fall within an acceptable threshold. Results: Values obtained by the script are written to a spreadsheet where results can be easily viewed and annotated with a “pass” or “fail” and saved for further analysis. In addition to creating a new scheme for reviewing monthly checks, this application allows for able to succinctly store data for follow up analysis. Conclusion: By utilizing this tool, parameters recommended by TG-142 for multiple linear accelerators can be rapidly obtained and analyzed which can be used for evaluation of monthly checks.

  19. Her Excellency Ms Monique T.G. van Daalen Ambassador Extraordinary and Plenipotentiary Permanent Representative of the Kingdom of the Netherlands to the United Nations Office and other international organisations in Geneva

    CERN Multimedia

    Bennett, Sophia Elizabeth

    2017-01-01

    Her Excellency Ms Monique T.G. van Daalen Ambassador Extraordinary and Plenipotentiary Permanent Representative of the Kingdom of the Netherlands to the United Nations Office and other international organisations in Geneva

  20. Importance of Risk Perception: Predictors of PrEP Acceptance Among Thai MSM and TG Women at a Community-Based Health Service.

    Science.gov (United States)

    Plotzker, Rosalyn; Seekaew, Pich; Jantarapakde, Jureeporn; Pengnonyang, Supabhorn; Trachunthong, Deondara; Linjongrat, Danai; Janyam, Surang; Nakpor, Thitiyanun; Charoenying, Sutinee; Mills, Stephen; Vannakit, Ravipa; Cassell, Michael; Phanuphak, Praphan; Lertpiriyasuwat, Cheewanan; Phanuphak, Nittaya

    2017-12-15

    HIV prevalence among Thai men who have sex with men (MSM) and transgender women (TG) are 9.15% and 11.8%, respectively, compared with 1.1% in the general population. To better understand early adopters of pre-exposure prophylaxis (PrEP) in Thailand, we analyzed biobehavioral and sociodemographic characteristics of PrEP-eligible MSM and TG. Four Thai urban community clinics between October 2015 and February 2016. Sociodemographics, HIV risk characteristics, and PrEP knowledge and attitudes were analyzed in association with PrEP initiation among eligible Thai MSM and TG. Adjusted analysis explored factors associated with PrEP acceptance. We then analyzed HIV risk perception, which was strongly associated with PrEP initiation. Of 297 participants, 55% accepted PrEP (48% of MSM, 54% of TG). Perceived HIV risk levels were associated with PrEP acceptance [odds ratio (OR): 4.3; 95% confidence interval (95% CI): 1.5 to 12.2. OR: 6.3; 95% CI: 2.1 to 19.0. OR: 14.7; 95% CI: 3.9 to 55.1; for minimal, moderate, and high perceived risks, respectively]. HIV risk perception was associated with previous HIV testing (OR: 2.2; 95% CI: 1.4 to 3.5); inconsistent condom use (OR: 1.8; 95% CI: 1.1 to 2.9); amphetamine use in the past 6 months (OR: 3.1; 95% CI: 1.1 to 8.6); and uncertainty in the sexually transmitted infection history (OR: 2.3; 95% CI: 1.4 to 3.7). Approximately half of those who reported either inconsistent condom use (46%), multiple partners (50%), group sex (48%), or had baseline bacterial sexually transmitted infection (48%) perceived themselves as having no or mild HIV risk. HIV risk perception plays an important role in PrEP acceptance. Perception does not consistently reflect actual risk. It is therefore critical to assess a client's risk perception and provide education about HIV risk factors that will improve the accuracy of perceived HIV risk.

  1. Innate Immunity Stimulation via Toll-Like Receptor 9 Ameliorates Vascular Amyloid Pathology in Tg-SwDI Mice with Associated Cognitive Benefits.

    Science.gov (United States)

    Scholtzova, Henrieta; Do, Eileen; Dhakal, Shleshma; Sun, Yanjie; Liu, Shan; Mehta, Pankaj D; Wisniewski, Thomas

    2017-01-25

    Alzheimer's disease (AD) is characterized by the presence of parenchymal amyloid-β (Aβ) plaques, cerebral amyloid angiopathy (CAA) and neurofibrillary tangles. Currently there are no effective treatments for AD. Immunotherapeutic approaches under development are hampered by complications related to ineffectual clearance of CAA. Genome-wide association studies have demonstrated the importance of microglia in AD pathogenesis. Microglia are the primary innate immune cells of the brain. Depending on their activation state and environment, microglia can be beneficial or detrimental. In our prior work, we showed that stimulation of innate immunity with Toll-like receptor 9 agonist, class B CpG (cytosine-phosphate-guanine) oligodeoxynucleotides (ODNs), can reduce amyloid and tau pathologies without causing toxicity in Tg2576 and 3xTg-AD mouse models. However, these transgenic mice have relatively little CAA. In the current study, we evaluated the therapeutic profile of CpG ODN in a triple transgenic mouse model, Tg-SwDI, with abundant vascular amyloid, in association with low levels of parenchymal amyloid deposits. Peripheral administration of CpG ODN, both before and after the development of CAA, negated short-term memory deficits, as assessed by object-recognition tests, and was effective at improving spatial and working memory evaluated using a radial arm maze. These findings were associated with significant reductions of CAA pathology lacking adverse effects. Together, our extensive evidence suggests that this innovative immunomodulation may be a safe approach to ameliorate all hallmarks of AD pathology, supporting the potential clinical applicability of CpG ODN. Recent genetic studies have underscored the emerging role of microglia in Alzheimer's disease (AD) pathogenesis. Microglia lose their amyloid-β-clearing capabilities with age and as AD progresses. Therefore, the ability to modulate microglia profiles offers a promising therapeutic avenue for reducing AD

  2. Characterization of a Single Chain Fv Antibody that Reacts with Free Morphine

    Directory of Open Access Journals (Sweden)

    Kazuhisa Sugimura

    2013-02-01

    Full Text Available An immune phage library derived from mice, hyperimmunized with morphine-conjugated BSA, was used to isolate a single-chain Fv (scFv clone, M86, with binding activity to morphine-conjugated thyroglobulin (morphine-C-Tg but not to codeine-, cocaine-, or ketamine-conjugated Tg. Surface plasmon resonance analysis using a morphine-C-Tg-coupled CM5 sensor chip showed that the Kd value was 1.26 × 10−8 M. To analyze its binding activity to free morphine and related compounds, we performed a competitive ELISA with M86 and morphine-C-Tg in the absence or presence of varying doses of free morphine and related compounds. IC50 values for opium, morphine, codeine, and heroin were 257 ng/mL, 36.4, 7.3, and 7.4 nM, respectively. Ketamine and cocaine exhibited no competitive binding activity to M86. Thus, we established a phage library-derived scFv, M86, which recognized not only free morphine and codeine as opium components but also heroin. This characteristic of M86 may be useful for developing therapeutic reagents for opiate addiction and as a free morphine-specific antibody probe.

  3. The triglyceride to high-density lipoprotein cholesterol (TG/HDL-C) ratio as a predictor of insulin resistance but not of β cell function in a Chinese population with different glucose tolerance status.

    Science.gov (United States)

    Zhou, Meicen; Zhu, Lixin; Cui, Xiangli; Feng, Linbo; Zhao, Xuefeng; He, Shuli; Ping, Fan; Li, Wei; Li, Yuxiu

    2016-06-07

    Triglyceride/high-density lipoprotein-cholesterol (TG/HDL-C) ratio was a surrogate marker of IR; however, the relationship of TG/HDL-C with IR might vary by ethnicity. This study aims to investigate whether lipid ratios-TG/HDL-C, cholesterol/high-density lipoprotein-cholesterol (TC/HDL-C) ratio, low-density lipoprotein-cholesterol/high-density lipoprotein-cholesterol (LDL-C/HDL-C)) could be potential clinical markers of insulin resistance (IR) and β cell function and further to explore the optimal cut-offs in a Chinese population with different levels of glucose tolerance. Four hundred seventy-nine subjects without a history of diabetes underwent a 75 g 2 h Oral Glucose Tolerance Test (OGTT). New-onset diabetes (n = 101), pre-diabetes (n = 186), and normal glucose tolerance (n = 192) were screened. IR was defined by HOMA-IR > 2.69. Based on indices (HOMA-β, early-phase disposition index [DI30], (ΔIns30/ΔGlu30)/HOMA-IR and total-phase index [DI120]) that indicated different phases of insulin secretion, the subjects were divided into two groups, and the lower group was defined as having inadequate β cell compensation. Logistic regression models and accurate estimates of the areas under receiver operating characteristic curves (AUROC) were obtained. In all of the subjects, TG/HDL, TC/HDL-C, LDL-C/HDL-C, and TG were significantly associated with IR. The AUROCs of TG/HDL-C and TG were 0.71 (95 % CI: 0.66-0.75) and 0.71 (95 % CI: 0.65-0.75), respectively. The optimal cut-offs of TG/HDL-C and TG for IR diagnosis were 1.11 and 1.33 mmol/L, respectively. The AUROCs of TC/HDL-C and LDL-C/HDL-C were 0.66 and 0.65, respectively, but they were not acceptable for IR diagnosis. TG/HDL-C,LDL-C/HDL-C and TG were significantly associated with HOMA-β, but AUROCs were less than 0.50; therefore, the lipid ratios could not be predictors of basal β cell dysfunction. None of the lipid ratios was associated with early-phase insulin secretion. Only TG/HDL-C and

  4. Sex-specific effects of high fat diet on indices of metabolic syndrome in 3xTg-AD mice: implications for Alzheimer's disease.

    Science.gov (United States)

    Barron, Anna M; Rosario, Emily R; Elteriefi, Reem; Pike, Christian J

    2013-01-01

    Multiple factors of metabolic syndrome have been implicated in the pathogenesis of Alzheimer's disease (AD), including abdominal obesity, insulin resistance, endocrine dysfunction and dyslipidemia. High fat diet, a common experimental model of obesity and metabolic syndrome, has been shown to accelerate cognitive decline and AD-related neuropathology in animal models. However, sex interacts with the metabolic outcomes of high fat diet and, therefore, may alter neuropathological consequences of dietary manipulations. This study examines the effects of sex and high fat diet on metabolic and AD-related neuropathological outcomes in 3xTg-AD mice. Three month-old male and female 3xTg-AD mice were fed either standard or high fat diets for 4 months. Obesity was observed in all high fat fed mice; however, ectopic fat accumulation, hyperglycemia and hyperinsulinemia were observed only in males. Interestingly, despite the different metabolic outcomes of high fat diet, the neuropathological consequences were similar: both male and female mice maintained under high fat diet exhibited significant worsening in behavioral performance and hippocampal accumulation of β-amyloid protein. Because high fat diet resulted in obesity and increased AD-like pathology in both sexes, these data support a role of obesity-related factors in promoting AD pathogenesis.

  5. Articular cartilage and growth plate defects are associated with chondrocyte cytoskeletal abnormalities in Tg737orpk mice lacking the primary cilia protein polaris.

    Science.gov (United States)

    McGlashan, S R; Haycraft, C J; Jensen, C G; Yoder, B K; Poole, C A

    2007-05-01

    Primary cilia are highly conserved organelles found on almost all eukaryotic cells. Tg737(orpk) (orpk) mice carry a hypomorphic mutation in the Tg737 gene resulting in the loss of polaris, a protein essential for ciliogenesis. Orpk mice have an array of skeletal patterning defects and show stunted growth after birth, suggesting defects in appositional and endochondral development. This study investigated the association between orpk tibial long bone growth and chondrocyte primary cilia expression using histomorphometric and immunohistochemical analysis. Wild-type chondrocytes throughout the developing epiphysis and growth plate expressed primary cilia, which showed a specific orientation away from the articular surface in the first 7-10 cell layers. In orpk mice, primary cilia were identified on very few cells and were significantly shorter. Orpk chondrocytes also showed significant increases in cytoplasmic tubulin, a likely result of failed ciliary assembly. The growth plates of orpk mice were significantly smaller in length and width, with marked changes in cellular organization in the presumptive articular cartilage, proliferative and hypertrophic zones. Cell density at the articular surface and in the hypertrophic zone was significantly altered, suggesting defects in both appositional and endochondral growth. In addition, orpk hypertrophic chondrocytes showed re-organization of the F-actin network into stress fibres and failed to fully undergo hypertrophy, while there was a marked reduction in type X collagen sequestration. These data suggest that failure to form a functional primary cilium affects chondrocyte differentiation and results in delayed chondrocyte hypertrophy within the orpk growth plate.

  6. Increased mRNA Levels of TCF7L2 and MYC of the Wnt Pathway in Tg-ArcSwe Mice and Alzheimer's Disease Brain

    Directory of Open Access Journals (Sweden)

    Elin S. Blom

    2011-01-01

    Full Text Available Several components in the Wnt pathway, including β-catenin and glycogen synthase kinase 3 beta, have been implied in AD pathogenesis. Here, mRNA brain levels from five-month-old tg-ArcSwe and nontransgenic mice were compared using Affymetrix microarray analysis. With surprisingly small overall changes, Wnt signaling was the most affected pathway with altered expression of nine genes in tg-ArcSwe mice. When analyzing mRNA levels of these genes in human brain, transcription factor 7-like 2 (TCF7L2 and v-myc myelocytomatosis viral oncogene homolog (MYC, were increased in Alzheimer's disease (AD (P<.05. Furthermore, no clear differences in TCF7L2 and MYC mRNA were found in brains with frontotemporal lobar degeneration, suggesting that altered regulation of these Wnt-related genes could be specific to AD. Finally, mRNA levels of three neurogenesis markers were analyzed. Increased mRNA levels of dihydropyrimidinase-like 3 were observed in AD brain, suggesting that altered Wnt pathway regulation may signify synaptic rearrangement or neurogenesis.

  7. Amitriptyline-mediated cognitive enhancement in aged 3×Tg Alzheimer's disease mice is associated with neurogenesis and neurotrophic activity.

    Directory of Open Access Journals (Sweden)

    Wayne Chadwick

    Full Text Available Approximately 35 million people worldwide suffer from Alzheimer's disease (AD. Existing therapeutics, while moderately effective, are currently unable to stem the widespread rise in AD prevalence. AD is associated with an increase in amyloid beta (Aβ oligomers and hyperphosphorylated tau, along with cognitive impairment and neurodegeneration. Several antidepressants have shown promise in improving cognition and alleviating oxidative stress in AD but have failed as long-term therapeutics. In this study, amitriptyline, an FDA-approved tricyclic antidepressant, was administered orally to aged and cognitively impaired transgenic AD mice (3×TgAD. After amitriptyline treatment, cognitive behavior testing demonstrated that there was a significant improvement in both long- and short-term memory retention. Amitriptyline treatment also caused a significant potentiation of non-toxic Aβ monomer with a concomitant decrease in cytotoxic dimer Aβ load, compared to vehicle-treated 3×TgAD controls. In addition, amitriptyline administration caused a significant increase in dentate gyrus neurogenesis as well as increases in expression of neurosynaptic marker proteins. Amitriptyline treatment resulted in increases in hippocampal brain-derived neurotrophic factor protein as well as increased tyrosine phosphorylation of its cognate receptor (TrkB. These results indicate that amitriptyline has significant beneficial actions in aged and damaged AD brains and that it shows promise as a tolerable novel therapeutic for the treatment of AD.

  8. Combustion of hazardous biological waste derived from the fermentation of antibiotics using TG-FTIR and Py-GC/MS techniques.

    Science.gov (United States)

    Yang, Shijun; Zhu, Xiangdong; Wang, Junsheng; Jin, Xing; Liu, Yuchen; Qian, Feng; Zhang, Shicheng; Chen, Jianmin

    2015-10-01

    The combustion characteristics for three kinds of antibiotics residue (AR) materials were investigated by TG-FTIR and Py-GC/MS technique. The TG results indicated that AR combustion involved three stages, and correlation between the H/C atomic ratio of the raw materials and peak temperature of weight loss for the second stage was obtained. The FTIR spectra identified evolving gaseous products as CO2, CH4, HCNO, NH3, HCN, and NO. An AR material with a low H/C ratio promoted the formation of CO2 and HCN, but suppressed the yields of NH3 and CH4. The Py-GC/MS results suggested that abundant volatiles can be produced, including alkenes, benzene, phenols, furans, acid, and heterocyclic-N, nitrile-N and amine-N compounds, and confirmed the FTIR absorption characteristics in the low temperature range. A possible pathway for the AR combustion was also tentatively presented. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Aplicación de la TG en el deporte para el estudio de la fiabilidad, validez y estimación de la muestra

    Directory of Open Access Journals (Sweden)

    \\u00C1ngel Blanco Villase\\u00F1or

    2014-01-01

    Full Text Available La Teoría de la Generalizabilidad (TG es una teoría de los errores multifaceta que asume que cualquier situación de medida posee infinitas fuentes de variación. En este sentido esta teoría puede aplicarse en el ámbito de la observación con la intención de conocer la influencia de estas fuentes de error sobre la medida. De todas las posibilidades, en este trabajo se presentan, a modo de ejemplo, tres aplicaciones de la TG en las primeras fases de una investigación en el ámbito observacional: 1 para el estudio de la validez, 2 para la estimación de la muestra; y, 3 para el estudio de la fiabilidad. Actualmente existen aplicaciones informáticas (GT, EduG o, recientemente, SAGT que facilitan la implementación de este tipo de análisis que permiten al investigador contar con recursos procedimentales para que las decisiones que tiene que tomar en el proceso de investigación puedan estar justificadas antes de ser implementadas como la muestra necesaria para poder generalizar con precisión o disponer de una herramienta de observación válida y fiablepara afrontar el arduo proceso de codificación y registro de las conductas acontecidas en los contextos naturales donde se aplican.

  10. Extra-virgin olive oil attenuates amyloid-β and tau pathologies in the brains of TgSwDI mice.

    Science.gov (United States)

    Qosa, Hisham; Mohamed, Loqman A; Batarseh, Yazan S; Alqahtani, Saeed; Ibrahim, Baher; LeVine, Harry; Keller, Jeffrey N; Kaddoumi, Amal

    2015-12-01

    Extra-virgin olive oil (EVOO) is one of the main elements of Mediterranean diet. Several studies have suggested that EVOO has several health promoting effects that could protect from and decrease the risk of Alzheimer's disease (AD). In this study, we investigated the effect of consumption of EVOO-enriched diet on amyloid- and tau-related pathological alterations that are associated with the progression of AD and cerebral amyloid angiopathy (CAA) in TgSwDI mice. Feeding mice with EVOO-enriched diet for 6months, beginning at an age before amyloid-β (Aβ) accumulation starts, has significantly reduced total Aβ and tau brain levels with a significant improvement in mouse cognitive behavior. This reduction in brain Aβ was explained by the enhanced Aβ clearance pathways and reduced brain production of Aβ via modulation of amyloid-β precursor protein processing. On the other hand, although feeding mice with EVOO-enriched diet for 3months, beginning at an age after Aβ accumulation starts, showed improved clearance across the blood-brain barrier and significant reduction in Aβ levels, it did not affect tau levels or improve cognitive functions of TgSwDI mouse. Collectively, results of this study suggest that the long-term consumption of EVOO-containing diet starting at early age provides a protective effect against AD and its related disorder CAA. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Tg(Th-CreFI172Gsat (Th-Cre defines neurons that are required for full hypercapnic and hypoxic reflexes

    Directory of Open Access Journals (Sweden)

    Jenny J. Sun

    2017-08-01

    Full Text Available The catecholaminergic (CA system has been implicated in many facets of breathing control and offers an important target to better comprehend the underlying etiologies of both developmental and adult respiratory pathophysiologies. Here, we used a noninvasive DREADD-based pharmacogenetic approach to acutely perturb Tg(Th-CreFI172Gsat (Th-Cre-defined neurons in awake and unrestrained mice in an attempt to characterize CA function in breathing. We report that clozapine-N-oxide (CNO-DREADD-mediated inhibition of Th-Cre-defined neurons results in blunted ventilatory responses under respiratory challenge. Under a hypercapnic challenge (5% CO2/21% O2/74% N2, perturbation of Th-Cre neurons results in reduced fR, and . Under a hypoxic challenge (10% O2/90% N2, we saw reduced fR, and , in addition to instability in both interbreath interval and tidal volume, resulting in a Cheyne-Stokes-like respiratory pattern. These findings demonstrate the necessity of Th-Cre-defined neurons for the hypercapnic and hypoxic ventilatory responses and breathing stability during hypoxia. However, given the expanded non-CA expression domains of the Tg(Th-CreFI172Gsat mouse line found in the brainstem, full phenotypic effect cannot be assigned solely to CA neurons. Nonetheless, this work identifies a key respiratory population that may lead to further insights into the circuitry that maintains respiratory stability in the face of homeostatic challenges.

  12. Printed highly conductive Cu films with strong adhesion enabled by low-energy photonic sintering on low-Tg flexible plastic substrate

    Science.gov (United States)

    Wu, Xinzhou; Shao, Shuangshuang; Chen, Zheng; Cui, Zheng

    2017-01-01

    Copper (Cu) films and circuits were fabricated by screen-printing Cu nanoink on low-Tg (glass transition temperature) flexible plastic substrates (PEN and PET) instead of widely used high-Tg polyimide (PI) substrate. Photonic sintering of printed Cu films was carried out using intensive pulsed light (IPL). Low resistivities of 28 μΩ · cm on PEN and 44 μΩ · cm on PET were obtained without damaging the substrates. The sintered Cu films exhibited strong adhesion to PEN and PET substrates, with measured adhesion strength of 5B by the ASTM D3359 international standard, whereas the top part of the copper film on the PI substrate was stripped off during the adhesion test. The sintered Cu films also showed excellent stability in harsh conditions and mechanical flexibility in rolling tests. The underlying mechanisms of the high conductivity and strong adhesion on PEN and PET substrates with low-energy IPL sintering were investigated. Simple circuits and radio frequency identification antennas were made by screen-printing Cu nanoink and IPL sintering, demonstrating the technique’s feasibility for practical applications.

  13. Effects of dietary supplementation of carnosine on mitochondrial dysfunction, amyloid pathology, and cognitive deficits in 3xTg-AD mice.

    Directory of Open Access Journals (Sweden)

    Carlo Corona

    Full Text Available BACKGROUND: The pathogenic road map leading to Alzheimer's disease (AD is still not completely understood; however, a large body of studies in the last few years supports the idea that beside the classic hallmarks of the disease, namely the accumulation of amyloid-β (Aβ and neurofibrillary tangles, other factors significantly contribute to the initiation and the progression of the disease. Among them, mitochondria failure, an unbalanced neuronal redox state, and the dyshomeostasis of endogenous metals like copper, iron, and zinc have all been reported to play an important role in exacerbating AD pathology. Given these factors, the endogenous peptide carnosine may be potentially beneficial in the treatment of AD because of its free-radical scavenger and metal chelating properties. METHODOLOGY: In this study, we explored the effect of L-carnosine supplementation in the 3xTg-AD mouse, an animal model of AD that shows both Aβ- and tau-dependent pathology. PRINCIPAL FINDINGS: We found that carnosine supplementation in 3xTg-AD mice promotes a strong reduction in the hippocampal intraneuronal accumulation of Aβ and completely rescues AD and aging-related mitochondrial dysfunctions. No effects were found on tau pathology and we only observed a trend toward the amelioration of cognitive deficits. CONCLUSIONS AND SIGNIFICANCE: Our data indicate that carnosine can be part of a combined therapeutic approach for the treatment of AD.

  14. Differential contribution of APP metabolites to early cognitive deficits in a TgCRND8 mouse model of Alzheimer’s disease

    Science.gov (United States)

    Hamm, Valentine; Héraud, Céline; Bott, Jean-Bastien; Herbeaux, Karine; Strittmatter, Carole; Mathis, Chantal; Goutagny, Romain

    2017-01-01

    Alzheimer’s disease (AD) is a neurodegenerative pathology commonly characterized by a progressive and irreversible deterioration of cognitive functions, especially memory. Although the etiology of AD remains unknown, a consensus has emerged on the amyloid hypothesis, which posits that increased production of soluble amyloid β (Aβ) peptide induces neuronal network dysfunctions and cognitive deficits. However, the relative failures of Aβ-centric therapeutics suggest that the amyloid hypothesis is incomplete and/or that the treatments were given too late in the course of AD, when neuronal damages were already too extensive. Hence, it is striking to see that very few studies have extensively characterized, from anatomy to behavior, the alterations associated with pre-amyloid stages in mouse models of AD amyloid pathology. To fulfill this gap, we examined memory capacities as well as hippocampal network anatomy and dynamics in young adult pre-plaque TgCRND8 mice when hippocampal Aβ levels are still low. We showed that TgCRND8 mice present alterations in hippocampal inhibitory networks and γ oscillations at this stage. Further, these mice exhibited deficits only in a subset of hippocampal-dependent memory tasks, which are all affected at later stages. Last, using a pharmacological approach, we showed that some of these early memory deficits were Aβ-independent. Our results could partly explain the limited efficacy of Aβ-directed treatments and favor multitherapy approaches for early symptomatic treatment for AD. PMID:28275722

  15. Crystal structure of the inactive state of the receiver domain of Spo0A from Paenisporosarcina sp. TG-14, a psychrophilic bacterium isolated from an Antarctic glacier.

    Science.gov (United States)

    Lee, Chang Woo; Park, Sun-Ha; Lee, Sung Gu; Shin, Seung Chul; Han, Se Jong; Kim, Han-Woo; Park, Hyun Ho; Kim, Sunghwan; Kim, Hak Jun; Park, Hyun; Park, HaJeung; Lee, Jun Hyuck

    2017-06-01

    The two-component phosphorelay system is the most prevalent mechanism for sensing and transducing environmental signals in bacteria. Spore formation, which relies on the two-component phosphorelay system, enables the long-term survival of the glacial bacterium Paenisporosarcina sp. TG-14 in the extreme cold environment. Spo0A is a key response regulator of the phosphorelay system in the early stage of spore formation. The protein is composed of a regulatory N-terminal phospho-receiver domain and a DNA-binding C-terminal activator domain. We solved the three-dimensional structure of the unphosphorylated (inactive) form of the receiver domain of Spo0A (PaSpo0A-R) from Paenisporosarcina sp. TG-14. A structural comparison with phosphorylated (active form) Spo0A from Bacillus stearothermophilus (BsSpo0A) showed minor notable differences. A molecular dynamics study of a model of the active form and the crystal structures revealed significant differences in the α4 helix and the preceding loop region where phosphorylation occurs. Although an oligomerization study of PaSpo0A-R by analytical ultracentrifugation (AUC) has shown that the protein is in a monomeric state in solution, both crosslinking and crystal-packing analyses indicate the possibility of weak dimer formation by a previously undocumented mechanism. Collectively, these observations provide insight into the mechanism of phosphorylation-dependent activation unique to Spo0A.

  16. Comparison between TG-43 dosimetry and Monte Carlo calculations using the FLAP Freiburg applicator for skin treatments with HDR brachytherapy; Comparacion dosimetrica entre TG-43 y calculos Monte Carlo usando el aplicador Freiburg Flap para tratamiento de piel con braquiterapia HDR

    Energy Technology Data Exchange (ETDEWEB)

    Vijande, J.; Ballester, F.; Granero, D.; Pujades, M. c.; Perez-Calatayud, J.; Lliso, F.; Carmona, V.; Camacho, C.

    2011-07-01

    The objective of this study is to compare the dose administered, both the skin surface and the depth limitation (5 mm) obtained using the data of TG-43 (under conditions of total dispersion in water) with that obtained calculations using Monte Carlo (MC) (taking into account both the air surrounding the FF, as its density and composition). Of special interest is the assessment of the possible existence of a defect of dispersion in the skin.

  17. Association of Single Nucleotide Polymorphisms of Adiponectin Gene with Type 2 Diabetes Mellitus, and Their Influence on Cardiovascular Risk Markers.

    Science.gov (United States)

    Momin, A A; Bankar, M P; Bhoite, G M

    2017-03-01

    Type 2 diabetes mellitus is a genetically heterogeneous condition, characterized by insulin deficiency and/or insulin resistance. The etiology of type 2 diabetes is complex, with involvement of genetic and environmental factors. The adipose tissue protein 'adiponectin' is known to increase insulin sensitivity with decreased risk of type 2 diabetes mellitus. The gene for adiponectin is present on chromosome 3q27, the association of number of single nucleotide polymorphisms of adiponectin gene with type 2 diabetes and its complications have been reported. In the present study the two most common SNPs +45T/G & +276G/T, and their association with type 2 diabetes mellitus and cardiovascular markers were studied. The significant difference in genotype frequencies of +45T/G & +276G/T was found in type 2 diabetic patients and controls, with odds ratio of 1.13 & 1.26 respectively. BMI, Fasting blood glucose, fasting insulin, HOMA IR, triglyceride and VLDL cholesterol levels were increased, and HDL cholesterol level was decreased in patients carrier for +45T/G SNP than the wild type. While only decrease in the HDL cholesterol was reported in carriers for SNP +276G/T than the wild type. The logistic regression analysis revealed the positive association of SNP +45T/G with total cholesterol & LDL cholesterol. And negative association of HDL cholesterol was found with SNPs +45T/G and +276G/T. The haplotype analysis shows the alterations in means of biochemical markers in the patients having haplotype (GG) for mutant allele of SNP +45T/G and wild allele for SNP +276G/T.

  18. Exercise alters the immune profile in Tg2576 Alzheimer mice toward a response coincident with improved cognitive performance and decreased amyloid

    Directory of Open Access Journals (Sweden)

    Cribbs David H

    2008-04-01

    Full Text Available Abstract Background Inflammation is associated with Aβ pathology in Alzheimer's disease (AD and transgenic AD models. Previously, it has been demonstrated that chronic stimulation of the immune response induces pro-inflammatory cytokines IL-1β and TNF-α which contribute to neurodegeneration. However, recent evidence has shown that inducing the adaptive immune response reduces Aβ pathology and is neuroprotective. Low concentrations of IFN-γ modulate the adaptive immune response by directing microglia to differentiate to antigen presenting cells. Our objective was to determine if exercise could induce a shift from the immune profile in aged (17–19 months Tg2576 mice to a response that reduces Aβ pathology. Methods TG (n = 29 and WT (n = 27 mice were divided into sedentary (SED and exercised (RUN groups. RUN animals were provided an in-cage running wheel for 3 weeks. Tissue was harvested and hippocampus and cortex dissected out. Quantitative data was analyzed using 2 × 2 ANOVA and student's t-tests. Results IL-1β and TNF-α were significantly greater in hippocampi from sedentary Tg2576 (TGSED mice than in wildtype (WTSED (p = 0.04, p = 0.006. Immune response proteins IFN-γ and MIP-1α are lower in TGSED mice than in WTSED (p = 0.03, p = 0.07. Following three weeks of voluntary wheel running, IL-1β and TNF-α decreased to levels indistinguishable from WT. Concurrently, IFN-γ and MIP-1α increased in TGRUN. Increased CD40 and MHCII, markers of antigen presentation, were observed in TGRUN animals compared to TGSED, as well as CD11c staining in and around plaques and vasculature. Additional vascular reactivity observed in TGRUN is consistent with an alternative activation immune pathway, involving perivascular macrophages. Significant decreases in soluble Aβ40 (p = 0.01 and soluble fibrillar Aβ (p = 0.01 were observed in the exercised transgenic animals. Conclusion Exercise shifts the immune response from innate to an adaptive or

  19. Development of a Single High Fat Meal Challenge to Unmask ...

    Science.gov (United States)

    Stress tests are used clinically to determine the presence of underlying disease and predict future cardiovascular risk. In previous studies, we used treadmill exercise stress in rats to unmask the priming effects of air pollution inhalation. Other day-to-day activities stress the cardiovascular system, and when modeled experimentally, may be useful in identifying latent effects of air pollution exposure. For example, a single high fat (HF) meal can cause transient vascular endothelial dysfunction and increases in LDL cholesterol, triglycerides (TG), oxidative stress, and inflammation. Given the prevalence of HF meals in western diets, the goal of this study was to develop a HF meal challenge in rats to see if air pollution primes the body for a subsequent stress-induced adverse response. Healthy male Wistar Kyoto rats were fasted for six hours and then administered a single oral gavage of isocaloric lard-based HF or low fat (LF) suspensions, or a water vehicle control. We hypothesized that rats given a HF load would elicit postprandial changes in cardiopulmonary function that were distinct from LF and vehicle controls. One to four hours after gavage, rats underwent whole body plethysmography to assess breathing patterns, cardiovascular ultrasounds, blood draws for measurements of systemic lipids and hormones and a test for sensitivity to aconitine-induced arrhythmia. HF gavage caused an increase in circulating TG relative to LF and vehicle controls and an incre

  20. Characteristics of miniature electronic brachytherapy x-ray sources based on TG-43U1 formalism using Monte Carlo simulation techniques

    Energy Technology Data Exchange (ETDEWEB)

    Safigholi, Habib; Faghihi, Reza; Jashni, Somaye Karimi; Meigooni, Ali S. [Faculty of Engineering, Science and Research Branch, Islamic Azad University, Fars, 73481-13111, Persepolis (Iran, Islamic Republic of); Department of Nuclear Engineering and Radiation Research Center, Shiraz University, 71936-16548, Shiraz (Iran, Islamic Republic of); Shiraz University of Medical Sciences, 71348-14336, Shiraz (Iran, Islamic Republic of); Department of Radiation therapy, Comprehensive Cancer Center of Nevada, 3730 South Eastern Avenue, Las Vegas, Nevada 89169 (United States)

    2012-04-15

    Purpose: The goal of this study is to determine a method for Monte Carlo (MC) characterization of the miniature electronic brachytherapy x-ray sources (MEBXS) and to set dosimetric parameters according to TG-43U1 formalism. TG-43U1 parameters were used to get optimal designs of MEBXS. Parameters that affect the dose distribution such as anode shapes, target thickness, target angles, and electron beam source characteristics were evaluated. Optimized MEBXS designs were obtained and used to determine radial dose functions and 2D anisotropy functions in the electron energy range of 25-80 keV. Methods: Tungsten anode material was considered in two different geometries, hemispherical and conical-hemisphere. These configurations were analyzed by the 4C MC code with several different optimization techniques. The first optimization compared target thickness layers versus electron energy. These optimized thicknesses were compared with published results by Ihsan et al.[Nucl. Instrum. Methods Phys. Res. B 264, 371-377 (2007)]. The second optimization evaluated electron source characteristics by changing the cathode shapes and electron energies. Electron sources studied included; (1) point sources, (2) uniform cylinders, and (3) nonuniform cylindrical shell geometries. The third optimization was used to assess the apex angle of the conical-hemisphere target. The goal of these optimizations was to produce 2D-dose anisotropy functions closer to unity. An overall optimized MEBXS was developed from this analysis. The results obtained from this model were compared to known characteristics of HDR {sup 125}I, LDR {sup 103}Pd, and Xoft Axxent electronic brachytherapy source (XAEBS) [Med. Phys. 33, 4020-4032 (2006)]. Results: The optimized anode thicknesses as a function of electron energy is fitted by the linear equation Y ({mu}m) = 0.0459X (keV)-0.7342. The optimized electron source geometry is obtained for a disk-shaped parallel beam (uniform cylinder) with 0.9 mm radius. The TG-43

  1. IgG1 antiendomysium and IgG antitissue transglutaminase (anti-tTG) antibodies in coeliac patients with selective IgA deficiency

    OpenAIRE

    Cataldo, F; Lio, D.; Marino, V.; Picarelli, A.; Ventura, A.; Corazza, G; a SIGEP,

    2000-01-01

    BACKGROUND—In selective IgA deficiency (IgAD), there is no reliable screening test for coeliac disease (CD).
AIM—To evaluate the usefulness of IgG1 antiendomysium and IgG antitissue transglutaminase tests for CD diagnosis in IgAD.
METHODS—IgA and IgG antigliadin antibodies (IgA- and IgG-AGA), IgA and IgG1 antiendomysium antibodies (IgA- and IgG1-EMA), and IgA and IgG antitissue transglutaminase (IgA- and IgG-anti-tTG) were assayed in: (a) 20 untreated IgAD/CD patients; (b) 34 IgAD/CD patients...

  2. Quantitative evaluation of the therapeutic effect of fermented soybean products containing a high concentration of GABA on phthalic anhydride-induced atopic dermatitis in IL-4/Luc/CNS-1 Tg mice.

    Science.gov (United States)

    Lee, Young Ju; Kim, Ji Eun; Kwak, Moon Hwa; Go, Jun; Kim, Dong Seob; Son, Hong Joo; Hwang, Dae Youn

    2014-05-01

    Cheonggukjang (CKJ) is a fermented soybean product that exhibits diverse biological and pharmacological activities, including anti-obesity, anti-diabetic, and anti-inflammatory effects on human chronic diseases. In this study, the effects of the aqueous extract of CKJ containing a high concentration of GABA on atopic dermatitis (AD) were quantified using the luciferase reporter system in IL-4/Luc/CNS-1 transgenic (Tg) mice. Alterations of the luciferase signal and phenotypes of AD were quantified in the IL-4/Luc/CNS-1 Tg mice co-treated with phthalic anhydride (PA) and CKJ for 4 weeks using the IVIS imaging system. A strong luciferase signal was detected in the abdominal region of IL-4/Luc/CNS-1 Tg mice treated with PA alone. However, this signal was significantly reduced in IL-4/Luc/CNS-1 Tg mice co-treated with PA and CKJ. The thymus showed the greatest decrease in luciferase following CKJ treatment, but the level increased after PA treatment. Furthermore, the CKJ-treated group showed improvement of common allergic responses including decreased ear thickness, dermis thickness, auricular lymph node (ALN) weight and infiltrating mast cells. However, IgE concentration and epidermis thickness were maintained a constant level. These results indicated that the luciferase signal may successfully reflect the therapeutic effects of CKJ in IL-4/Luc/CNS-1 Tg mice. The results also suggested that CKJ may be considered an effective substance for the treatment of AD.

  3. Differential sensitivities to dioxin-like compounds PCB 126 and PeCDF between Tg(cyp1a:gfp) transgenic medaka and zebrafish larvae.

    Science.gov (United States)

    Xu, Hongyan; Li, Caixia; Suklai, Pacharaporn; Zeng, Qinghua; Chong, Raymond; Gong, Zhiyuan

    2018-02-01

    It has been intensively documented that there are species-differences in the sensitivity to dioxin-like compounds (DLCs) in mammalian and avian. However, this issue is still unclear in fish. This study aimed at evaluating the differential sensitivities to DLCs in fish larvae. Here, larvae of Tg(cyp1a:gfp) medaka and Tg(cyp1a:gfp) zebrafish were tested with 2,3,7,8-Tetrachlorodibenzodioxin (TCDD), polychlorinated biphenyl 126 (PCB 126) and 2,3,4,7,8,-Pentachlorodibenzofuran (PeCDF). Comparative analyses were performed on induction of GFP fluorescence, expression of endogenous cyp1a mRNAs and EROD activity between the two species after exposure to these chemicals. We found that PCB 126 and PeCDF exposure at high concentrations induced strong GFP expression in multiple organs (liver, head kidney and gut) in both medaka and zebrafish larvae. Moreover, the expression of endogenous cyp1a mRNA was significantly elevated in the zebrafish larvae exposed to TCDD, PCB 126 and PeCDF at different concentrations. Likewise, almost all the exposure conditions could cause prominent elevation of EROD activity in the zebrafish larvae, while the EROD activities were just slightly elevated in the medaka larvae exposed to 1 nM and 0.5 nM of TCDD as well as to 1.5 nM and 15 nM of PeCDF, but not in the medaka larvae exposed to PCB 126. Taken together, zebrafish was proved to be more sensitive than medaka to PCB 126 and to PeCDF in this study. The findings suggested species-specific sensitivity to DLCs in fish and will facilitate choosing a sensitive and reliable fish model or tool to evaluate the risk of dioxins and DLCs exposure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Results from oral gavage carcinogenicity studies of ruxolitinib in Tg.rasH2 mice and Sprague-Dawley (Crl:CD) rats.

    Science.gov (United States)

    Shuey, Dana L; Oliver, Julian; Zhou, Gongfu; Roberts, Alan

    2016-11-01

    Ruxolitinib is a selective and potent inhibitor of Janus kinase (JAK) 1 and JAK2. It is approved for the treatment of patients with intermediate or high-risk myelofibrosis, or those with polycythemia vera who have had an inadequate response to or are intolerant of hydroxyurea. To investigate its carcinogenic potential, ruxolitinib was administered by oral gavage once daily to Tg.rasH2 mice for 6 months at doses of 15, 45 or 125 mg/kg/day, and to Sprague-Dawley (Crl:CD) rats for 2 years at 10, 20 or 60 mg/kg/day. Ruxolitinib had no effect on survival, and did not increase the incidence of any neoplastic findings in either species. Exposure (AUC) was similar to or exceeded that associated with therapeutic use. Lymphoid depletion and a decrease in extramedullary hematopoiesis in the spleen occurred in rats, which were attributed to the pharmacologic activity of ruxolitinib. In Tg.rasH2 mice, increased inflammation in the nasal cavity was observed. Dose-dependent decreases in a number of spontaneous neoplastic/preneoplastic lesions were observed in rats, including mammary tumors in females, adrenal pheochromocytomas in males, hepatocellular adenomas/carcinomas in males, and hepatic basophilic (males and females) and eosinophilic (males) foci. Peribiliary fibrosis was also decreased. Clear cell foci in the liver were increased in females. Based on the results of these studies, ruxolitinib is not considered to be carcinogenic. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Dose comparison between TG-43-based calculations and radiochromic film measurements of the Freiburg flap applicator used for high-dose-rate brachytherapy treatments of skin lesions.

    Science.gov (United States)

    Aldelaijan, Saad; Bekerat, Hamed; Buzurovic, Ivan; Devlin, Phillip; DeBlois, Francois; Seuntjens, Jan; Devic, Slobodan

    Current high-dose-rate brachytherapy skin treatments with the Freiburg flap (FF) applicator are planned with treatment planning systems based on the American Association of Physicists in Medicine TG-43 data sets, which assume full backscatter conditions in dose calculations. The aim of this work is to describe an experimental method based on radiochromic film dosimetry to evaluate dose calculation accuracy during surface treatments with the FF applicator at different depths and bolus thicknesses. Absolute doses were measured using a reference EBT3 radiochromic film dosimetry system within a Solid Water phantom at different depths (0, 0.5, 1, 2, and 3 cm) with respect to the phantom surface. The impact of bolus (up to 3-cm thickness) placed on top of the applicator was investigated for two clinical loadings created using Oncentra MasterPlan: 5 cm × 5 cm and 11 cm × 11 cm. For smaller loading and depths beyond 2 cm and for larger loading and depths beyond 1 cm, the dose difference was less than 3% (±4%). At shallower depths, differences of up to 6% (±4%) at the surface were observed if no bolus was added. The addition of 2-cm bolus for the smaller loading and 1 cm for larger loading minimized the difference to less than 3% (±4%). For typical FF applicator loading sizes, the actual measured dose was 6% (±4%) lower at the skin level when compared with TG-43. Additional bolus above the FF was shown to decrease the dose difference. The consideration of change in clinical practice should be carefully investigated in light of clinical reference data. Copyright © 2017 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

  6. Effect of amaranth on dielectric, thermal and optical properties of KDP single crystal

    Energy Technology Data Exchange (ETDEWEB)

    Chandran, Senthilkumar; Paulraj, Rajesh, E-mail: rajeshp@ssn.edu.in; Ramasamy, P.

    2017-01-15

    Bulk single crystals of pure and amaranth doped KDP were grown using point seed technique. Effect of amaranth doping on KDP crystals was analyzed using powder XRD, thermal analysis (TG/DTA), dielectric, photoconductivity and etching studies. The phase purity and crystallinity of pure and dye doped crystals were confirmed by powder X-ray diffraction analysis. It is observed from TG-DTA analysis that the decomposition point decreased while doping with amaranth. Dielectric constant and loss increases with increasing temperatures. The photoconductivity decreases with the increase of amaranth concentration. - Highlights: • Pure and amaranth doped KDP crystals grown from point seed technique. • The addition of amaranth changes the decomposition points of dye doped KDP crystals. • Dielectric constant is increased. • It shows positive photoconductivity.

  7. Growth and characterization of nonlinear optical single crystal: Nicotinic L-tartaric

    Energy Technology Data Exchange (ETDEWEB)

    Sheelarani, V.; Shanthi, J., E-mail: shanthinelson@gmail.com [Department of Physics, Avinashilingam Institute for Home Science and Higher Education for Women, Coimbatore-641043 (India)

    2015-06-24

    Nonlinear optical single crystals were grown from Nicotinic and L-Tartaric acid by slow evaporation technique at room temperature. Structure of the grown crystal was confirmed by single crystal X-ray diffraction studies, The crystallinity of the Nicotinic L-Tartaric (NLT) crystals was confirmed from the powder XRD pattern. The transparent range and cut off wavelength of the grown crystal was studied by the UV–Vis spectroscopic analysis.The thermal stability of the crystal was studied by TG-DTA. The second harmonic generation (SHG) efficiency of NLT was confirmed by Kurtz Perry technique.

  8. In vivo turnover of tau and APP metabolites in the brains of wild-type and Tg2576 mice: greater stability of sAPP in the beta-amyloid depositing mice.

    Directory of Open Access Journals (Sweden)

    Jose Morales-Corraliza

    2009-09-01

    Full Text Available The metabolism of the amyloid precursor protein (APP and tau are central to the pathobiology of Alzheimer's disease (AD. We have examined the in vivo turnover of APP, secreted APP (sAPP, Abeta and tau in the wild-type and Tg2576 mouse brain using cycloheximide to block protein synthesis. In spite of overexpression of APP in the Tg2576 mouse, APP is rapidly degraded, similar to the rapid turnover of the endogenous protein in the wild-type mouse. sAPP is cleared from the brain more slowly, particularly in the Tg2576 model where the half-life of both the endogenous murine and transgene-derived human sAPP is nearly doubled compared to wild-type mice. The important Abeta degrading enzymes neprilysin and IDE were found to be highly stable in the brain, and soluble Abeta40 and Abeta42 levels in both wild-type and Tg2576 mice rapidly declined following the depletion of APP. The cytoskeletal-associated protein tau was found to be highly stable in both wild-type and Tg2576 mice. Our findings unexpectedly show that of these various AD-relevant protein metabolites, sAPP turnover in the brain is the most different when comparing a wild-type mouse and a beta-amyloid depositing, APP overexpressing transgenic model. Given the neurotrophic roles attributed to sAPP, the enhanced stability of sAPP in the beta-amyloid depositing Tg2576 mice may represent a neuroprotective response.

  9. Activation pattern of ACE2/Ang-(1-7) and ACE/Ang II pathway in course of heart failure assessed by multiparametric MRI in vivo in Tgαq*44 mice.

    Science.gov (United States)

    Tyrankiewicz, Urszula; Olkowicz, Mariola; Skórka, Tomasz; Jablonska, Magdalena; Orzylowska, Anna; Bar, Anna; Gonet, Michal; Berkowicz, Piotr; Jasinski, Krzysztof; Zoladz, Jerzy A; Smolenski, Ryszard T; Chlopicki, Stefan

    2018-01-01

    Here, we analyzed systemic (plasma) and local (heart/aorta) changes in ACE/ACE-2 balance in Tgαq*44 mice in course of heart failure (HF). Tgαq*44 mice with cardiomyocyte-specific Gαq overexpression and late onset of HF were analyzed at different age for angiotensin pattern in plasma, heart, and aorta using liquid chromatography/mass spectrometry, for progression of HF by in vivo magnetic resonance imaging under isoflurane anesthesia, and for physical activity by voluntary wheel running. Six-month-old Tgαq*44 mice displayed decreased ventricle radial strains and impaired left atrial function. At 8-10 mo, Tgαq*44 mice showed impaired systolic performance and reduced voluntary wheel running but exhibited preserved inotropic reserve. At 12 mo, Tgαq*44 mice demonstrated a severe impairment of basal cardiac performance and modestly compromised inotropic reserve with reduced voluntary wheel running. Angiotensin analysis in plasma revealed an increase in concentration of angiotensin-(1-7) in 6- to 10-mo-old Tgαq*44 mice. However, in 12- to 14-mo-old Tgαq*44 mice, increased angiotensin II was noted with a concomitant increase in Ang III, Ang IV, angiotensin A, and angiotensin-(1-10). The pattern of changes in the heart and aorta was also compatible with activation of ACE2, followed by activation of the ACE pathway. In conclusion, mice with cardiomyocyte Gαq protein overexpression develop HF that is associated with activation of the systemic and the local ACE/Ang II pathway. However, it is counterbalanced by a prominent ACE2/Ang-(1-7) activation, possibly allowing to delay decompensation. NEW & NOTEWORTHY Changes in ACE/ACE-2 balance were analyzed based on measurements of a panel of nine angiotensins in plasma, heart, and aorta of Tgαq*44 mice in relation to progression of heart failure (HF) characterized by multiparametric MRI and exercise performance. The early stage of HF was associated with upregulation of the ACE2/angiotensin-(1-7) pathway, whereas the end

  10. Musik som en omvårdnadsåtgärd i det dagliga livet för omvårdnad av personer med demenssjukdom : En litteraturstudie

    OpenAIRE

    O’Connell, Denise

    2016-01-01

    Musik som verktyg för att lindra oro och stress är en tilltalande omvårdnadsåtgärd då den kan anpassas direkt till individen. Den är utan biverkningar samt kostnadseffektiv. Syfte: Att undersöka effekten av musikåtgärder i omvårdnad av personer med demenssjukdom. Metod: Föreliggande studie är en litteraturstudie omfattande båda kvantitativa och kvalitativa studier från databaserna Web of Science, PubMed och CINAHL. 13 artiklar skrivna på engelska utgjorde resultatunderlaget. Resultat: Resulta...

  11. Mannan-Abeta28 conjugate prevents Abeta-plaque deposition, but increases microhemorrhages in the brains of vaccinated Tg2576 (APPsw mice

    Directory of Open Access Journals (Sweden)

    Karapetyan Adrine

    2008-09-01

    Full Text Available Abstract Background New pre-clinical trials in AD mouse models may help to develop novel immunogen-adjuvant configurations with the potential to avoid the adverse responses that occurred during the clinical trials with AN-1792 vaccine formulation. Recently, we have pursued an alternative immunization strategy that replaces QS21 the Th1 type adjuvant used in the AN-1792 clinical trial with a molecular adjuvant, mannan that can promote a Th2-polarized immune response through interactions with mannose-binding and CD35/CD21 receptors of the innate immune system. Previously we established that immunization of wild-type mice with mannan-Aβ28 conjugate promoted Th2-mediated humoral and cellular immune responses. In the current study, we tested the efficacy of this vaccine configuration in amyloid precursor protein (APP transgenic mice (Tg2576. Methods Mannan was purified, activated and chemically conjugated to Aβ28 peptide. Humoral immune responses induced by the immunization of mice with mannan-Aβ28 conjugate were analyzed using a standard ELISA. Aβ42 and Aβ40 amyloid burden, cerebral amyloid angiopathy (CAA, astrocytosis, and microgliosis in the brain of immunized and control mice were detected using immunohistochemistry. Additionally, cored plaques and cerebral vascular microhemorrhages in the brains of vaccinated mice were detected by standard histochemistry. Results Immunizations with low doses of mannan-Aβ28 induced potent and long-lasting anti-Aβ humoral responses in Tg2576 mice. Even 11 months after the last injection, the immunized mice were still producing low levels of anti-Aβ antibodies, predominantly of the IgG1 isotype, indicative of a Th2 immune response. Vaccination with mannan-Aβ28 prevented Aβ plaque deposition, but unexpectedly increased the level of microhemorrhages in the brains of aged immunized mice compared to two groups of control animals of the same age either injected with molecular adjuvant fused with an irrelevant

  12. A generic TG-186 shielded applicator for commissioning model-based dose calculation algorithms for high-dose-rate 192 Ir brachytherapy.

    Science.gov (United States)

    Ma, Yunzhi; Vijande, Javier; Ballester, Facundo; Tedgren, Åsa Carlsson; Granero, Domingo; Haworth, Annette; Mourtada, Firas; Fonseca, Gabriel Paiva; Zourari, Kyveli; Papagiannis, Panagiotis; Rivard, Mark J; Siebert, Frank André; Sloboda, Ron S; Smith, Ryan; Chamberland, Marc J P; Thomson, Rowan M; Verhaegen, Frank; Beaulieu, Luc

    2017-11-01

    A joint working group was created by the American Association of Physicists in Medicine (AAPM), the European Society for Radiotherapy and Oncology (ESTRO), and the Australasian Brachytherapy Group (ABG) with the charge, among others, to develop a set of well-defined test case plans and perform calculations and comparisons with model-based dose calculation algorithms (MBDCAs). Its main goal is to facilitate a smooth transition from the AAPM Task Group No. 43 (TG-43) dose calculation formalism, widely being used in clinical practice for brachytherapy, to the one proposed by Task Group No. 186 (TG-186) for MBDCAs. To do so, in this work a hypothetical, generic high-dose rate (HDR) 192 Ir shielded applicator has been designed and benchmarked. A generic HDR 192 Ir shielded applicator was designed based on three commercially available gynecological applicators as well as a virtual cubic water phantom that can be imported into any DICOM-RT compatible treatment planning system (TPS). The absorbed dose distribution around the applicator with the TG-186 192 Ir source located at one dwell position at its center was computed using two commercial TPSs incorporating MBDCAs (Oncentra® Brachy with Advanced Collapsed-cone Engine, ACE™, and BrachyVision ACUROS™) and state-of-the-art Monte Carlo (MC) codes, including ALGEBRA, BrachyDose, egs_brachy, Geant4, MCNP6, and Penelope2008. TPS-based volumetric dose distributions for the previously reported "source centered in water" and "source displaced" test cases, and the new "source centered in applicator" test case, were analyzed here using the MCNP6 dose distribution as a reference. Volumetric dose comparisons of TPS results against results for the other MC codes were also performed. Distributions of local and global dose difference ratios are reported. The local dose differences among MC codes are comparable to the statistical uncertainties of the reference datasets for the "source centered in water" and "source displaced" test

  13. SU-G-201-10: Experimental Determination of Modified TG-43 Dosimetry Parameters for the Xoft Axxent® Electronic Brachytherapy Source

    Energy Technology Data Exchange (ETDEWEB)

    Simiele, S; Palmer, B; DeWerd, L [Department of Medical Physics, School of Medicine and Public Health, University of Wisconsin-Madison, Madison, WI (United States)

    2016-06-15

    Purpose: The establishment of an air kerma rate standard at NIST for the Xoft Axxent{sup ®} electronic brachytherapy source (Axxent{sup ®} source) motivated the establishment of a modified TG-43 dosimetry formalism. This work measures the modified dosimetry parameters for the Axxent{sup ®} source in the absence of a treatment applicator for implementation in Xoft’s treatment planning system. Methods: The dose-rate conversion coefficient (DRCC), radial dose function (RDF) values, and polar anisotropy (PA) were measured using TLD-100 microcubes with NIST-calibrated sources. The DRCC and RDF measurements were performed in liquid water using an annulus of Virtual Water™ designed to align the TLDs at the height of the anode at fixed radii from the source. The PA was measured at several distances from the source in a PMMA phantom. MCNP-determined absorbed dose energy dependence correction factors were used to convert from dose to TLD to dose to liquid water for the DRCC, RDF, and PA measurements. The intrinsic energy dependence correction factor from the work of Pike was used. The AKR was determined using a NIST-calibrated HDR1000 Plus well-type ionization chamber. Results: The DRCC was determined to be 8.6 (cGy/hr)/(µGy/min). The radial dose values were determined to be 1.00 (1cm), 0.60 (2cm), 0.42 (3cm), and 0.32 (4cm), with agreement ranging from (5.7% to 10.9%) from the work of Hiatt et al. 2015 and agreement from (2.8% to 6.8%) with internal MCNP simulations. Conclusion: This work presents a complete dataset of modified TG-43 dosimetry parameters for the Axxent{sup ®} source in the absence of an applicator. Prior to this study a DRCC had not been measured for the Axxent{sup ®} source. This data will be used for calculating dose distributions for patients receiving treatment with the Axxent{sup ®} source in Xoft’s breast balloon and vaginal applicators, and for intraoperative radiotherapy. Sources and partial funding for this work were provided by Xoft

  14. An oceanic fixed nitrogen sink exceeding 400 Tg N a−1 vs the concept of homeostasis in the fixed-nitrogen inventory

    Directory of Open Access Journals (Sweden)

    L. A. Codispoti

    2007-01-01

    Full Text Available Measurements of the N2 produced by denitrification, a better understanding of non-canonical pathways for N2 production such as the anammox reaction, better appreciation of the multiple environments in which denitrification can occur (e.g. brine pockets in ice, within particles outside of suboxic water, etc. suggest that it is unlikely that the oceanic denitrification rate is less than 400 Tg N a−1. Because this sink term far exceeds present estimates for nitrogen fixation, the main source for oceanic fixed-N, there is a large apparent deficit (~200 Tg N a−1 in the oceanic fixed-N budget. The size of the deficit appears to conflict with apparent constraints of the atmospheric carbon dioxide and sedimentary δ15N records that suggest homeostasis during the Holocene. In addition, the oceanic nitrate/phosphate ratio tends to be close to the canonical Redfield biological uptake ratio of 16 (by N and P atoms which can be interpreted to indicate the existence of a powerful feed-back mechanism that forces the system towards a balance. The main point of this paper is that one cannot solve this conundrum by reducing the oceanic sink term. To do so would violate an avalanche of recent data on oceanic denitrification. A solution to this problem may be as simple as an upwards revision of the oceanic nitrogen fixation rate, and it is noted that most direct estimates for this term have concentrated on nitrogen fixation by autotrophs in the photic zone, even though nitrogen fixing genes are widespread. Another simple explanation may be that we are simply no longer in the Holocene and one might expect to see temporary imbalances in the oceanic fixed-N budget as we transition from the Holocene to the Anthropocene in line with an apparent denitrification maximum during the Glacial-Holocene transition. Other possible full or partial explanations involve plausible changes in the oceanic nitrate/phosphate and N/C ratios, an oceanic phosphorus budget that may also

  15. TNFRSF1B +676 T>G polymorphism predicts survival of non-Small cell lung cancer patients treated with chemoradiotherapy

    Directory of Open Access Journals (Sweden)

    Komaki Ritsuko

    2011-10-01

    Full Text Available Abstract Background The dysregulation of gene expression in the TNF-TNFR superfamily has been involved in various human cancers including non-small cell lung cancer (NSCLC. Furthermore, functional polymorphisms in TNF-α and TNFRSF1B genes that alter gene expression are likely to be associated with risk and clinical outcomes of cancers. However, few reported studies have investigated the association between potentially functional SNPs in both TNF-α and TNFRSF1B and prognosis of NSCLC patients treated with chemoradiotherapy. Methods We genotyped five potentially functional polymorphisms of TNF-α and TNFRSF1B genes [TNF-α -308 G>A (rs1800629 and -1031 T>C (rs1799964; TNFRSF1B +676 T>G (rs1061622, -1709A>T(rs652625 and +1663A>G (rs1061624] in 225 NSCLC patients treated with chemoradiotherapy or radiotherapy alone. Kaplan-Meier survival analysis, log-rank tests and Cox proportional hazard models were used to evaluate associations between these variants and NSCLC overall survival (OS. Results We found that the TNFRSF1B +676 GG genotype was associated with a significantly better OS of NSCLC (GG vs. TT: adjusted HR = 0.38, 95% CI = 0.15-0.94; GG vs. GT/TT: adjusted HR = 0.35, 95% CI = 0.14-0.88. Further stepwise multivariate Cox regression analysis showed that the TNFRSF1B +676 GG was an independent prognosis predictor in this NSCLC cohort (GG vs. GT/TT: HR = 0.35, 95% CI = 0.14-0.85, in the presence of node status (N2-3 vs. N0-1: HR = 1.60, 95% CI = 1.09-2.35 and tumor stage (T3-4 vs. T0-2: HR = 1.48, 95% CI = 1.08-2.03. Conclusions Although the exact biological function for this SNP remains to be explored, our findings suggest a possible role of TNFRSF1B +676 T>G (rs1061622 in the prognosis of NSCLC. Further large and functional studies are needed to confirm our findings.

  16. Identification and association of the single nucleotide polymorphisms in calpain3 (CAPN3 gene with carcass traits in chickens

    Directory of Open Access Journals (Sweden)

    Du Hua-Rui

    2009-03-01

    Full Text Available Abstract Background The aim of this study is to screen single nucleotide polymorphisms (SNP of chicken Calpain3 (CAPN3 gene and to analyze the potential association between CAPN3 gene polymorphisms and carcass traits in chickens. We screened CAPN3 single nucleotide polymorphisms (SNP in 307 meat-type quality chicken from 5 commercial pure lines (S01, S02, S03, S05, and D99 and 4 native breeds from Guangdong Province (Huiyang Huxu chicken and Qingyuan Ma chicken and Sichuan Province (Caoke chicken and Shandi Black-bone chicken, China. Results Two SNPs (11818T>A and 12814T>G were detected by single strand conformation polymorphism (SSCP method and were verified by DNA sequencing. Association analysis showed that the 12814T>G genotypes were significantly associated with body weight (BW, carcass weight (CW, breast muscle weight (BMW, and leg muscle weight (LMW. Haplotypes constructed on the two SNPs (H1, TG; H2, TT; H3, AG; and H4, AT were associated with BW, CW (P P Conclusion We speculated that the CAPN3 gene was a major gene affecting chicken muscle growth and carcass traits or it was linked with the major gene(s. Diplotypes H1H2 and H2H2 might be advantageous for carcass traits.

  17. Age-related synaptic dysfunction in Tg2576 mice starts as a failure in early long-term potentiation which develops into a full abolishment of late long-term potentiation.

    Science.gov (United States)

    Fernández-Fernández, Diego; Dorner-Ciossek, Cornelia; Kroker, Katja S; Rosenbrock, Holger

    2016-03-01

    Tg2576 mice are widely used to study amyloid-dependent synaptic dysfunction related to Alzheimer's disease. However, conflicting data have been reported for these mice with regard to basal transmission as well as the in vitro correlate of memory, long-term potentiation (LTP). Some studies show clear impairments, whereas others report no deficiency. The present study uses hippocampal slices from 3-, 10-, and 15-month-old wild-type (WT) and Tg2576 mice to evaluate synaptic function in each group, including experiments to investigate basal synaptic transmission, short- and long-term plasticity by inducing paired-pulse facilitation, and both early and late LTP. We show that synaptic function remains intact in hippocampal slices from Tg2576 mice at 3 months of age. However, both early and late LTP decline progressively during aging in these mice. This deterioration of synaptic plasticity starts affecting early LTP, ultimately leading to the abolishment of both forms of LTP in 15-month-old animals. In comparison, WT littermates display normal synaptic parameters during aging. Additional pharmacological investigation into the involvement of NMDA receptors and L-type voltage-gated calcium channels in LTP suggests a distinct mechanism of induction among age groups, demonstrating that both early and late LTP are differentially affected by these channels in Tg2576 mice during aging. © 2015 Wiley Periodicals, Inc.

  18. Draft genome sequence of Paenisporosarcina sp. strain TG-14, a psychrophilic bacterium isolated from sediment-laden stratified basal ice from Taylor Glacier, McMurdo Dry Valleys, Antarctica.

    Science.gov (United States)

    Koh, Hye Yeon; Lee, Sung Gu; Lee, Jun Hyuck; Doyle, Shawn; Christner, Brent C; Kim, Hak Jun

    2012-12-01

    The psychrophilic bacterium Paenisporosarcina sp. TG-14 was isolated from sediment-laden stratified basal ice from Taylor Glacier, McMurdo Dry Valleys, Antarctica. Here we report the draft genome sequence of this strain, which may provide useful information on the cold adaptation mechanism in extremely variable environments.

  19. Commentary on "T.G. Ritto, M.R. Escalante, Rubens Sampaio, M.B. Rosales, Drill-string horizontal dynamics with uncertainty on the frictional force, Journal of Sound and Vibration 332 (2013) 145-153"

    Science.gov (United States)

    Ritto, T. G.; Sampaio, Rubens; Rosales, M. B.

    2016-12-01

    The goal of this article is to clarify some points of the formulation presented in the "T.G. Ritto, M.R. Escalante, Rubens Sampaio, M.B. Rosales, Drill-string horizontal dynamics with uncertainty on the frictional force, Journal of Sound and Vibration 332 (2013) 145-153".

  20. Assembly of the novel five-component apicomplexan multi-aminoacyl-tRNA synthetase complex is driven by the hybrid scaffold protein Tg-p43.

    Directory of Open Access Journals (Sweden)

    Jason M van Rooyen

    Full Text Available In Toxoplasma gondii, as in other eukaryotes, a subset of the amino-acyl-tRNA synthetases are arranged into an abundant cytoplasmic multi-aminoacyl-tRNA synthetase (MARS complex. Through a series of genetic pull-down assays, we have identified the enzymes of this complex as: methionyl-, glutaminyl-, glutamyl-, and tyrosyl-tRNA synthetases, and we show that the N-terminal GST-like domain of a partially disordered hybrid scaffold protein, Tg-p43, is sufficient for assembly of the intact complex. Our gel filtration studies revealed significant heterogeneity in the size and composition of isolated MARS complexes. By targeting the tyrosyl-tRNA synthetases subunit, which was found exclusively in the complete 1 MDa complex, we were able to directly visualize MARS particles in the electron microscope. Image analyses of the negative stain data revealed the observed heterogeneity and instability of these complexes to be driven by the intrinsic flexibility of the domain arrangements within the MARS complex. These studies provide unique insights into the assembly of these ubiquitous but poorly understood eukaryotic complexes.

  1. Influence of catalysts on co-combustion of sewage sludge and water hyacinth blends as determined by TG-MS analysis.

    Science.gov (United States)

    Huang, Limao; Xie, Candie; Liu, Jingyong; Zhang, Xiaochun; Chang, KenLin; Kuo, Jiahong; Sun, Jian; Xie, Wuming; Zheng, Li; Sun, Shuiyu; Buyukada, Musa; Evrendilek, Fatih

    2018-01-01

    Effects of the three metal carbonates (K2CO3, Na2CO3, and MgCO3) were quantified on catalytic co-combustion of the sewage sludge and water hyacinth (SW) blend using a thermogravimetric-mass spectrometric (TG-MS) analysis and kinetics modeling. The main dominating steps of the catalysts were the organic volatile matter release and combustion stage. Weighted mean values of activation energy (Em) were estimated at 181.18KJ·mol-1, 199.76KJ·mol-1, 138.76KJ·mol-1, and 177.88KJ·mol-1 for SW, SW+5% K2CO3, SW+5% Na2CO3, and SW+5% MgCO3, respectively. The lowest Em occurred with SW+5% Na2CO3. Overall, catalyst effect on co-combustion appeared to be negligible as indicated by Gibbs free energy (ΔG). The normalized intensities of SW+MgCO3 were strongest. The addition of Na2CO3 and MgCO3 to SW increased flue gases emissions (CO2, NO2, SO2, HCN, and NH3) of SW, whereas the addition of K2CO3 to SW reduced flue gases emissions from the entire combustion process. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Age-dependent regulation of obesity and Alzheimer-related outcomes by hormone therapy in female 3xTg-AD mice.

    Science.gov (United States)

    Christensen, Amy; Pike, Christian J

    2017-01-01

    Depletion of ovarian hormones at menopause is associated with increased Alzheimer's disease (AD) risk. Hormone loss also increases central adiposity, which promotes AD development. One strategy to improve health outcomes in postmenopausal women is estrogen-based hormone therapy (HT), though its efficacy is controversial. The window of opportunity hypothesis posits that HT is beneficial only if initiated near the onset of menopause. Here, we tested this hypothesis by assessing the efficacy of HT against diet-induced obesity and AD-related pathology in female 3xTg-AD mice at early versus late middle-age. HT protected against obesity and reduced β-amyloid burden only at early middle-age. One mechanism that contributes to AD pathogenesis is microglial activation, which is increased by obesity and reduced by estrogens. In parallel to its effects on β-amyloid accumulation, we observed that HT reduced morphological evidence of microglial activation in early but not late middle-age. These findings suggest that HT may be effective during human perimenopause in reducing indices of obesity and AD-related pathology, a conclusion consistent with the window of opportunity hypothesis.

  3. Immune response to diphtheria toxin-mediated depletion complicates the use of the CD11c-DTR(tg) model for studies of bacterial gastrointestinal infections.

    Science.gov (United States)

    Westermark, Linda; Fahlgren, Anna; Fällman, Maria

    2012-09-01

    Dendritic cells play an important role in the immune response against pathogens, as they are responsible for the activation and control of both innate and adaptive immune responses. The CD11c-DTR(tg) model, which allows transient elimination of dendritic cells by diphtheria toxin-treatment (DTx), has been extensively used to study the importance of this immune cell during steady-state and infection conditions in mice. Infecting dendritic cell-depleted mice orally with Yersinia pseudotuberculosis results in a markedly reduced level of infection compared with infection of non-depleted mice. We show here that it is not the lack of dendritic cells per se that is responsible for the reduced infection efficiency, instead it is an immune response induced by the DTx-treatment that prevents the bacteria from establishing colonization in Peyer's patches. The DTx-induced depletion initiates an immune response, with elevated serum levels of keratinocyte-derived cytokine (KC) and recruitment of polymorphonuclear neutrophils to dendritic cell-containing organs, such as Peyer's patches. Since the window for having an animal depleted of dendritic cells is limited in time for this model, the DTx-mediated effect on the immune system complicates the use of this model in studies of early events during bacterial infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. A touch screen-automated cognitive test battery reveals impaired attention, memory abnormalities, and increased response inhibition in the TgCRND8 mouse model of Alzheimer's disease.

    Science.gov (United States)

    Romberg, Carola; Horner, Alexa E; Bussey, Timothy J; Saksida, Lisa M

    2013-03-01

    Transgenic mouse models of Alzheimer's disease (AD) with abundant β-amyloid develop memory impairments. However, multiple nonmnemonic cognitive domains such as attention and executive control are also compromised early in AD individuals, but have not been routinely assessed in animal models. Here, we assessed the cognitive abilities of TgCRND8 mice-a widely used model of β-amyloid pathology-with a touch screen-based automated test battery. The test battery comprises highly translatable tests of multiple cognitive constructs impaired in human AD, such as memory, attention, and response control, as well as appropriate control tasks. We found that familial AD mutations affect not only memory, but also cause significant alterations of sustained attention and behavioral flexibility. Because changes in attention and response inhibition may affect performance on tests of other cognitive abilities including memory, our findings have important consequences for the assessment of disease mechanisms and therapeutics in animal models of AD. A more comprehensive phenotyping with specialized, multicomponent cognitive test batteries for mice might significantly advance translation from preclinical mouse studies to the clinic. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Histopathological studies of "CH1641-like" scrapie sources versus classical scrapie and BSE transmitted to ovine transgenic mice (TgOvPrP4.

    Directory of Open Access Journals (Sweden)

    Anna Bencsik

    Full Text Available The possibility of the agent causing bovine spongiform encephalopathy (BSE infecting small ruminants is of serious concern for human health. Among scrapie cases, the CH1641 source in particular appears to have certain biochemical properties similar to the BSE strain. In France, several natural scrapie cases were identified as "CH1641-like" natural scrapie isolates in sheep and goats. The Tg(OvPrP4 mouse line expressing the ovine prion protein is a sensitive model for studying and identifying strains of agents responsible for scrapie and BSE. This model is also very useful when studying specific scrapie source CH1641, known to be not transmissible to wild-type mice despite the similarity of some of its biochemical properties to those of the BSE strain. As it is important to be able to fully distinguish CH1641 from BSE, we herein report the histopathological data from CH1641 scrapie transmission experiments compared to specific cases of "CH1641-like" natural scrapie isolates in sheep, murine scrapie strains and BSE. In addition to the conventional vacuolar lesion profile approach and PrP(d brain mappings, an innovative differential PET-blot analysis was introduced to classify the different strains of agent and revealed the first direct concordance between ways of grouping strains on the basis of PrP(d biochemical characteristics.

  6. Identification of CHEK1, SLC26A4, c-KIT, TPO and TG as new biomarkers for human follicular thyroid carcinoma.

    Science.gov (United States)

    Makhlouf, Anne-Marie; Chitikova, Zhanna; Pusztaszeri, Marc; Berczy, Margaret; Delucinge-Vivier, Celine; Triponez, Frederic; Meyer, Patrick; Philippe, Jacques; Dibner, Charna

    2016-07-19

    The search for preoperative biomarkers for thyroid malignancies, in particular for follicular thyroid carcinoma (FTC) diagnostics, is of utmost clinical importance. We thus aimed at screening for potential biomarker candidates for FTC. To evaluate dynamic alterations in molecular patterns as a function of thyroid malignancy progression, a comparative analysis was conducted in clinically distinct subgroups of FTC and poorly differentiated thyroid carcinoma (PDTC) nodules. NanoString analysis of FFPE samples was performed in 22 follicular adenomas, 56 FTC and 25 PDTC nodules, including oncocytic and non-oncocytic subgroups. The expression levels of CHEK1, c-KIT, SLC26A4, TG and TPO were significantly altered in all types of thyroid carcinomas. Based on collective changes of these biomarkers which correlating among each other, a predictive score has been established, allowing for discrimination between benign and FTC samples with high sensitivity and specificity. Additional transcripts related to thyroid function, cell cycle, circadian clock, and apoptosis regulation were altered in the more aggressive oncocytic subgroups only, with expression levels correlating with disease progression. Distinct molecular patterns were observed for oncocytic and non-oncocytic FTCs and PDTCs. A predictive score correlation coefficient based on collective alterations of identified here biomarkers might help to improve the preoperative diagnosis of FTC nodules.

  7. Delineating Amyloid Plaque Associated Neuronal Sphingolipids in Transgenic Alzheimer’s Disease Mice (tgArcSwe) Using MALDI Imaging Mass Spectrometry

    Science.gov (United States)

    2016-01-01

    The major pathological hallmarks of Alzheimer’s disease (AD) are the progressive aggregation and accumulation of beta-amyloid (Aβ) and hyperphosphorylated tau protein into neurotoxic deposits. Aβ aggregation has been suggested as the critical early inducer, driving the disease progression. However, the factors that promote neurotoxic Aβ aggregation remain elusive. Imaging mass spectrometry (IMS) is a powerful technique to comprehensively elucidate the spatial distribution patterns of lipids, peptides, and proteins in biological tissue sections. In the present study, matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS)-based imaging was used on transgenic Alzheimer’s disease mouse (tgArcSwe) brain tissue to investigate the sphingolipid microenvironment of individual Aβ plaques and elucidate plaque-associated sphingolipid alterations. Multivariate data analysis was used to interrogate the IMS data for identifying pathologically relevant, anatomical features based on their lipid chemical profile. This approach revealed sphingolipid species that distinctly located to cortical and hippocampal deposits, whose Aβ identity was further verified using fluorescent amyloid staining and immunohistochemistry. Subsequent multivariate statistical analysis of the spectral data revealed significant localization of gangliosides and ceramides species to Aβ positive plaques, which was accompanied by distinct local reduction of sulfatides. These plaque-associated changes in sphingolipid levels implicate a functional role of sphingolipid metabolism in Aβ plaque pathology and AD pathogenesis. Taken together, the presented data highlight the potential of imaging mass spectrometry as a powerful approach for probing Aβ plaque-associated lipid changes underlying AD pathology. PMID:27984697

  8. The Protective Effect of Icariin on Mitochondrial Transport and Distribution in Primary Hippocampal Neurons from 3× Tg-AD Mice.

    Science.gov (United States)

    Chen, Yijing; Han, Shuangxue; Huang, Xiuxian; Ni, Jiazuan; He, Xiaoyang

    2016-01-27

    Icariin, a pharmacologically active component isolated from the Chinese herb Epimedium, has been shown to improve spatial learning and memory abilities in Alzheimer's disease (AD) rats through inhibition of Aβ production and tau protein hyperphosphorylation. However, the potential mechanism of icariin-induced protective effects against mitochondrial dysfunctions in AD still remains unclear. In the present study, we investigated the effect of icariin on the modulation of mitochondrial transport and distribution in primary hippocampal cultures from triple-transgenic (3× Tg) AD mice. The results showed that icariin enhanced mitochondrial motility and increased mitochondrial index and mitochondrial length and size in the diseased neurons. Additionally, the expression of the key mitochondrial enzyme, pyruvate dehydrogenase-E1α (PDHE1α), and the post synaptic density protein 95 (PSD95), was preserved in AD neurons after icariin treatment, accompanied by a downregulation of Aβ and phosphorylated tau expression in the corresponding areas. Further study showed that icariin treatment resulted in a decrease in mitochondrial fission protein dynamin-related protein 1 (Drp1) and an increase in fusion protein Mitofusin 2 (Mfn2). These data indicate that icariin can promote mitochondrial transport, protect mitochondria against fragmentation and preserve the expression of mitochondrial and synaptic functional proteins in AD neurons. Thus, icariin may be a potential therapeutic complement for AD and other mitochondrial malfunction-related neuronal degenerative diseases.

  9. The Protective Effect of Icariin on Mitochondrial Transport and Distribution in Primary Hippocampal Neurons from 3× Tg-AD Mice

    Directory of Open Access Journals (Sweden)

    Yijing Chen

    2016-01-01

    Full Text Available Icariin, a pharmacologically active component isolated from the Chinese herb Epimedium, has been shown to improve spatial learning and memory abilities in Alzheimer’s disease (AD rats through inhibition of Aβ production and tau protein hyperphosphorylation. However, the potential mechanism of icariin-induced protective effects against mitochondrial dysfunctions in AD still remains unclear. In the present study, we investigated the effect of icariin on the modulation of mitochondrial transport and distribution in primary hippocampal cultures from triple-transgenic (3× Tg AD mice. The results showed that icariin enhanced mitochondrial motility and increased mitochondrial index and mitochondrial length and size in the diseased neurons. Additionally, the expression of the key mitochondrial enzyme, pyruvate dehydrogenase-E1α (PDHE1α, and the post synaptic density protein 95 (PSD95, was preserved in AD neurons after icariin treatment, accompanied by a downregulation of Aβ and phosphorylated tau expression in the corresponding areas. Further study showed that icariin treatment resulted in a decrease in mitochondrial fission protein dynamin-related protein 1 (Drp1 and an increase in fusion protein Mitofusin 2 (Mfn2. These data indicate that icariin can promote mitochondrial transport, protect mitochondria against fragmentation and preserve the expression of mitochondrial and synaptic functional proteins in AD neurons. Thus, icariin may be a potential therapeutic complement for AD and other mitochondrial malfunction-related neuronal degenerative diseases.

  10. Antisense Oligonucleotides Promote Exon Inclusion and Correct the Common c.-32-13T>G GAA Splicing Variant in Pompe Disease

    Directory of Open Access Journals (Sweden)

    Erik van der Wal

    2017-06-01

    Full Text Available The most common variant causing Pompe disease is c.-32-13T>G (IVS1 in the acid α-glucosidase (GAA gene, which weakens the splice acceptor of GAA exon 2 and induces partial and complete exon 2 skipping. It also allows a low level of leaky wild-type splicing, leading to a childhood/adult phenotype. We hypothesized that cis-acting splicing motifs may exist that could be blocked using antisense oligonucleotides (AONs to promote exon inclusion. To test this, a screen was performed in patient-derived primary fibroblasts using a tiling array of U7 small nuclear RNA (snRNA-based AONs. This resulted in the identification of a splicing regulatory element in GAA intron 1. We designed phosphorodiamidate morpholino oligomer-based AONs to this element, and these promoted exon 2 inclusion and enhanced GAA enzyme activity to levels above the disease threshold. These results indicate that the common IVS1 GAA splicing variant in Pompe disease is subject to negative regulation, and inhibition of a splicing regulatory element using AONs is able to restore canonical GAA splicing and endogenous GAA enzyme activity.

  11. Antisense Oligonucleotides Promote Exon Inclusion and Correct the Common c.-32-13T>G GAA Splicing Variant in Pompe Disease.

    Science.gov (United States)

    van der Wal, Erik; Bergsma, Atze J; Pijnenburg, Joon M; van der Ploeg, Ans T; Pijnappel, W W M Pim

    2017-06-16

    The most common variant causing Pompe disease is c.-32-13T>G (IVS1) in the acid α-glucosidase (GAA) gene, which weakens the splice acceptor of GAA exon 2 and induces partial and complete exon 2 skipping. It also allows a low level of leaky wild-type splicing, leading to a childhood/adult phenotype. We hypothesized that cis-acting splicing motifs may exist that could be blocked using antisense oligonucleotides (AONs) to promote exon inclusion. To test this, a screen was performed in patient-derived primary fibroblasts using a tiling array of U7 small nuclear RNA (snRNA)-based AONs. This resulted in the identification of a splicing regulatory element in GAA intron 1. We designed phosphorodiamidate morpholino oligomer-based AONs to this element, and these promoted exon 2 inclusion and enhanced GAA enzyme activity to levels above the disease threshold. These results indicate that the common IVS1 GAA splicing variant in Pompe disease is subject to negative regulation, and inhibition of a splicing regulatory element using AONs is able to restore canonical GAA splicing and endogenous GAA enzyme activity. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. IgG(1) antiendomysium and IgG antitissue transglutaminase (anti-tTG) antibodies in coeliac patients with selective IgA deficiency. Working Groups on Celiac Disease of SIGEP and Club del Tenue.

    Science.gov (United States)

    Cataldo, F; Lio, D; Marino, V; Picarelli, A; Ventura, A; Corazza, G R

    2000-09-01

    In selective IgA deficiency (IgAD), there is no reliable screening test for coeliac disease (CD). To evaluate the usefulness of IgG(1) antiendomysium and IgG antitissue transglutaminase tests for CD diagnosis in IgAD. IgA and IgG antigliadin antibodies (IgA- and IgG-AGA), IgA and IgG(1) antiendomysium antibodies (IgA- and IgG(1)-EMA), and IgA and IgG antitissue transglutaminase (IgA- and IgG-anti-tTG) were assayed in: (a) 20 untreated IgAD/CD patients; (b) 34 IgAD/CD patients on a strict gluten free diet (GFD); (c) 10 IgAD/CD patients not on a strict GFD; (d) 11 untreated CD patients without IgAD; (e) 10 healthy IgAD patients; and (f) 25 healthy controls. In all untreated IgAD/CD patients, IgG(1)-EMA, IgG-anti-tTG, and IgG-AGA were positive whereas IgA antibodies against these antigens were negative. IgAD/CD patients on a strict GFD did not produce IgG-AGA or IgG(1)-EMA but four of 34 produced IgG anti-tTG. IgAD/CD subjects not on a strict GFD produced IgG-AGA whereas 5/10 and 4/10 were IgG(1)- EMA and IgG-anti-tTG negative, respectively. Untreated CD patients without IgAD were AGA (IgA and IgG), EMA (IgA and IgG(1)), and anti-tTG (IgA and IgG) positive. Healthy controls were AGA and EMA negative whereas two of 10 apparently healthy IgAD subjects and one of 25 healthy negative control were IgG-anti-tTG positive. Both IgG(1)-EMA and IgG-anti-tTG tests appear to be useful for identification of IgAD/CD patients whereas they are less satisfactory for monitoring dietary compliance in these subjects. In addition, our findings seem to suggest that IgG-EMA autoantibodies produced by coeliac patients are mainly of the IgG(1) subtype.

  13. A fixed cations and low Tg polymer: the poly(4-vinyl-pyridine) quaternized by poly(ethylene oxide) links. Conductivity study; Un electrolyte polymere a cations fixes et bas Tg: les poly(4-vinylpyridine) quaternisees par des chainons de poly(oxyde d`ethylene). Etude de la conductivite

    Energy Technology Data Exchange (ETDEWEB)

    Gramain, Ph. [Ecole Nationale Superieure de Chimie de Montpellier, 34 (France); Frere, Y. [Centre National de la Recherche Scientifique (CNRS), 67 - Strasbourg (France). Institut Charles Sadron

    1996-12-31

    The spontaneous ionic polymerization of 4-vinyl-pyridine in presence of mono-tosylated or bromated short chains of poly(ethylene oxide)-(PEO) is used to prepare amorphous comb-like poly-cations with low Tg. The polymer electrolyte properties of these new structures have been studied without any addition of salts. The ionic conductivity of these fixed cation poly-electrolytes depends on the length of the grafted PEO and varies from 10{sup -7} to 10{sup -4} S/cm between 25 and 80 deg. C. It is only weakly dependent on the nature of the cation but it is controlled by the movements of the pyridinium cation which are facilitated by the plastifying effect of the POE chains which do not directly participate to the ionic transport. (J.S.) 17 refs.

  14. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    Science.gov (United States)

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  15. Internal dosimetry of a chylomicron-like emulsion doubly-labeled with 3H-TG and {sup 14}C-CE in humans

    Energy Technology Data Exchange (ETDEWEB)

    Marcato, Larissa A.; Carvalho, Diego V.S.; Santos, Robinson A.; Hamada, Margarida M.; Mesquita, Carlos H. de [Energy and Nuclear Research Institute (IPEN/CNEN/SP), Sao Paulo, SP (Brazil); Vinagre, Carmen [University of Sao Paulo, SP (Brazil). The Heart Institute of the Medical School Hospital; Maranhao, Raul C. [University of Sao Paulo, SP (Brazil). Faculty of Pharmaceutical Sciences

    2010-07-01

    Full text: This paper describes a research about the calculation of the effective equivalent doses to which participants are exposed when submitted to studies that use artificial lipid emulsions doubly-labeled with radioactive tracers {sup 14}C and {sup 3}H. Several studies have used these emulsions in order to improve the knowledge of the biodistribution parameters of plasma lipoproteins. In the particular case of studies with chylomicron-like emulsion doubly- labeled with radioactive cholesteryl esters ({sup 14}C-CE) and triacylglycerols ({sup 3}H-TG) the dosimetric calculations was estimated indirectly. Initially, the LIA limits suggested by ICRP no 26 for {sup 3}H and {sup 14}C were used, however the LIA parameter is dependent on the chemical form of the labeled product and these parameters have not been scheduled yet for artificial lipoproteins. In particular for the {sup 14}C-CE, the internal dose in humans was estimated from the allometric theory using data from the biodistribution in rats with approximately 0.4 kg. The purpose of this paper is to improve the estimation of the effective equivalent dose in humans in order to contribute to future studies that will utilize artificial lipoproteins. For this study, chylomicron-like emulsion containing radioactive lipids were injected intravenously in bolus into the volunteers and aliquots of blood were collected at predetermined intervals of time. The activity of each aliquot was measured in liquid scintillator using a spectrometer. The plasmatic radioactive decay curves were determined and subsequently the kinetic parameters and effective equivalent doses were calculated using the ANACOMP software. It was proposed a kinetic model consisting of eight compartments for the biodistribution of plasma lipoproteins in humans. (author)

  16. Reducing AD-like pathology in 3xTg-AD mouse model by DNA epitope vaccine - a novel immunotherapeutic strategy.

    Directory of Open Access Journals (Sweden)

    Nina Movsesyan

    2008-05-01

    Full Text Available The development of a safe and effective AD vaccine requires a delicate balance between providing an adequate anti-Abeta antibody response sufficient to provide therapeutic benefit, while eliminating an adverse T cell-mediated proinflammatory autoimmune response. To achieve this goal we have designed a prototype chemokine-based DNA epitope vaccine expressing a fusion protein that consists of 3 copies of the self-B cell epitope of Abeta(42 (Abeta(1-11 , a non-self T helper cell epitope (PADRE, and macrophage-derived chemokine (MDC/CCL22 as a molecular adjuvant to promote a strong anti-inflammatory Th2 phenotype.We generated pMDC-3Abeta(1-11-PADRE construct and immunized 3xTg-AD mouse model starting at age of 3-4 months old. We demonstrated that prophylactic immunizations with the DNA epitope vaccine generated a robust Th2 immune response that induced high titers of anti-Abeta antibody, which in turn inhibited accumulation of Abeta pathology in the brains of older mice. Importantly, vaccination reduced glial activation and prevented the development of behavioral deficits in aged animals without increasing the incidence of microhemorrhages.Data from this transitional pre-clinical study suggest that our DNA epitope vaccine could be used as a safe and effective strategy for AD therapy. Future safety and immunology studies in large animals with the goal to achieve effective humoral immunity without adverse effects should help to translate this study to human clinical trials.

  17. Metal binding properties of the EPS produced by Halomonas sp. TG39 and its potential in enhancing trace element bioavailability to eukaryotic phytoplankton.

    Science.gov (United States)

    Gutierrez, Tony; Biller, Dondra V; Shimmield, Tracy; Green, David H

    2012-12-01

    An emergent property of exopolysaccharides (EPS) produced by marine bacteria is their net negative charge, predominantly conferred by their high uronic acids content. Here, we investigated the EPS produced by an algal-associated marine bacterium, Halomonas sp. strain TG39, for its capacity to sequester trace metals and mediate their bioavailability to eukaryotic phytoplankton. Metal analysis of the purified EPS revealed that it contained high levels of K, Ca, Mg and several essential trace metals, including Zn, Cu, Fe and the metalloid Si. Desorption experiments with marine sediment showed that the EPS possessed a specific binding capacity for Ca, Si, Fe, Mn, Mg and Al. Depending on the ionic conditions, Fe was the third or fourth most highly-adsorbed metal out of 27 elements analyzed. Experiments employing Fe-limited synthetic ocean seawater showed that growth of the marine diatom Thalassiosira weissflogii (axenic strain) was enhanced when incubated in the presence of either purified EPS or EPS that had been pre-exposed to marine sediment, compared to non-EPS amended controls. This growth enhancement was attributed to the EPS binding and increasing the bioavailability of key trace metal elements, such as Fe(III). Since the bacterium used in this study was originally isolated from a marine micro-alga, this work highlights the possibility that bacterial associates of eukaryotic algae could be influencing the bioavailability of Fe(III) to phytoplankton via their production of polyanionic EPS. More widely, this work reinforces the potential importance of marine bacterial EPS in trace metal biogeochemical cycling.

  18. Superoxide dismutase 1 and tgSOD1 mouse spinal cord seed fibrils, suggesting a propagative cell death mechanism in amyotrophic lateral sclerosis.

    Directory of Open Access Journals (Sweden)

    Ruth Chia

    2010-05-01

    Full Text Available Amyotrophic lateral sclerosis (ALS is a neurodegenerative disease that specifically affects motor neurons and leads to a progressive and ultimately fatal loss of function, resulting in death typically within 3 to 5 years of diagnosis. The disease starts with a focal centre of weakness, such as one limb, and appears to spread to other parts of the body. Mutations in superoxide dismutase 1 (SOD1 are known to cause disease and it is generally accepted they lead to pathology not by loss of enzymatic activity but by gain of some unknown toxic function(s. Although different mutations lead to varying tendencies of SOD1 to aggregate, we suggest abnormal proteins share a common misfolding pathway that leads to the formation of amyloid fibrils.Here we demonstrate that misfolding of superoxide dismutase 1 leads to the formation of amyloid fibrils associated with seeding activity, which can accelerate the formation of new fibrils in an autocatalytic cascade. The time limiting event is nucleation to form a stable protein "seed" before a rapid linear polymerisation results in amyloid fibrils analogous to other protein misfolding disorders. This phenomenon was not confined to fibrils of recombinant protein as here we show, for the first time, that spinal cord homogenates obtained from a transgenic mouse model that overexpresses mutant human superoxide dismutase 1 (the TgSOD1(G93A mouse also contain amyloid seeds that accelerate the formation of new fibrils in both wildtype and mutant SOD1 protein in vitro.These findings provide new insights into ALS disease mechanism and in particular a mechanism that could account for the spread of pathology throughout the nervous system. This model of disease spread, which has analogies to other protein misfolding disorders such as prion disease, also suggests it may be possible to design assays for therapeutics that can inhibit fibril propagation and hence, possibly, disease progression.

  19. Superoxide dismutase 1 and tgSOD1 mouse spinal cord seed fibrils, suggesting a propagative cell death mechanism in amyotrophic lateral sclerosis.

    Science.gov (United States)

    Chia, Ruth; Tattum, M Howard; Jones, Samantha; Collinge, John; Fisher, Elizabeth M C; Jackson, Graham S

    2010-05-13

    Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease that specifically affects motor neurons and leads to a progressive and ultimately fatal loss of function, resulting in death typically within 3 to 5 years of diagnosis. The disease starts with a focal centre of weakness, such as one limb, and appears to spread to other parts of the body. Mutations in superoxide dismutase 1 (SOD1) are known to cause disease and it is generally accepted they lead to pathology not by loss of enzymatic activity but by gain of some unknown toxic function(s). Although different mutations lead to varying tendencies of SOD1 to aggregate, we suggest abnormal proteins share a common misfolding pathway that leads to the formation of amyloid fibrils. Here we demonstrate that misfolding of superoxide dismutase 1 leads to the formation of amyloid fibrils associated with seeding activity, which can accelerate the formation of new fibrils in an autocatalytic cascade. The time limiting event is nucleation to form a stable protein "seed" before a rapid linear polymerisation results in amyloid fibrils analogous to other protein misfolding disorders. This phenomenon was not confined to fibrils of recombinant protein as here we show, for the first time, that spinal cord homogenates obtained from a transgenic mouse model that overexpresses mutant human superoxide dismutase 1 (the TgSOD1(G93A) mouse) also contain amyloid seeds that accelerate the formation of new fibrils in both wildtype and mutant SOD1 protein in vitro. These findings provide new insights into ALS disease mechanism and in particular a mechanism that could account for the spread of pathology throughout the nervous system. This model of disease spread, which has analogies to other protein misfolding disorders such as prion disease, also suggests it may be possible to design assays for therapeutics that can inhibit fibril propagation and hence, possibly, disease progression.

  20. Extracellular Vesicles Isolated from the Brains of rTg4510 Mice Seed Tau Protein Aggregation in a Threshold-dependent Manner.

    Science.gov (United States)

    Polanco, Juan Carlos; Scicluna, Benjamin James; Hill, Andrew Francis; Götz, Jürgen

    2016-06-10

    The microtubule-associated protein tau has a critical role in Alzheimer disease and related tauopathies. There is accumulating evidence that tau aggregates spread and replicate in a prion-like manner, with the uptake of pathological tau seeds causing misfolding and aggregation of monomeric tau in recipient cells. Here we focused on small extracellular vesicles enriched for exosomes that were isolated from the brains of tau transgenic rTg4510 and control mice. We found that these extracellular vesicles contained tau, although the levels were significantly higher in transgenic mice that have a pronounced tau pathology. Tau in the vesicles was differentially phosphorylated, although to a lower degree than in the brain cells from which they were derived. Several phospho-epitopes (AT8, AT100, and AT180) thought to be critical for tau pathology were undetected in extracellular vesicles. Despite this, when assayed with FRET tau biosensor cells, extracellular vesicles derived from transgenic mice were capable of seeding tau aggregation in a threshold-dependent manner. We also observed that the dye used to label extracellular vesicle membranes was still present during nucleation and formation of tau inclusions, suggesting either a role for membranes in the seeding or in the process of degradation. Together, we clearly demonstrate that extracellular vesicles can transmit tau pathology. This indicates a role for extracellular vesicles in the transmission and spreading of tau pathology. The characteristics of tau in extracellular vesicles and the seeding threshold we identified may explain why tau pathology develops very slowly in neurodegenerative diseases such as Alzheimer disease. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Synthesis and characterization of polysiloxane-based single-ion conductors

    Science.gov (United States)

    Liang, Siwei

    Polysiloxane-based single-ion conductors containing different side groups and bulky ionic side chains have been discussed in this thesis. Firstly, three borate monomers: lithium triphenylstyryl borate (B1), a variant with three ethylene oxides between the vinyl and the borate (B2) and a third with perfluorinated phenyl rings (B3) were synthesized and used to prepare polysiloxane ionomers based on cyclic carbonates via hydrosilylation. B1 ion content variations show maximum 25 ºC conductivity at 8mol%, reflecting a tradeoff between carrier density and Tg increase. Ethylene oxide spacers (B2) lower Tg, and increase dielectric constant, both raising conductivity. Perfluorinating the four phenyl rings (B3) lowers the ion association energy, as anticipated by ab initio estimations. This increases conductivity, a direct result of 3X higher measured carrier density. The ˜ 9 kJ/mol activation energy of simultaneously conducting ions is less than half that of ionomers with either sulfonate or bis(trifluoromethanesulfonyl) imide anions, suggesting that ionomers with weak-binding borate anions may provide a pathway to useful single-ion Li+ conductors, if their Tg can be lowered. Then two groups of novel non-volatile plasticizers containing pendant cyclic carbonates and short ethylene oxide chains have been successfully synthesized, as confirmed by 1H and 29Si NMR spectra. After mixing with polysiloxane-based ionomer, the resulting polymer electrolyte blends show improved conductivity. At room temperature the d. c. conductivity has been improved to between 10-4 to 10-5 S/cm. Electrode polarization in dielectric relaxation spectroscopy reveals that part of the increased conductivity comes from lowering Tg, which raises the mobility of the conducting ions. The number density of simultaneously conducting ions is also boosted by the plasticizers, particularly for those containing more of the strongly solvating oligo- (ethylene oxide). Polysiloxane phosphonium single

  2. Single Audit: Single Audit Act Effectiveness Issues

    National Research Council Canada - National Science Library

    Thompson, Sally

    2002-01-01

    As discussed in the report we are releasing today, our work to review agency actions to ensure that recipients take timely and appropriate corrective actions to fix audit findings contained in single...

  3. Synthesis and characterization of rare earth coordinated with thiourea single crystal

    Science.gov (United States)

    Singh, Harjinder; Slathia, Goldy; Bamzai, K. K.

    2017-05-01

    Single crystal of yttrium chloride coordinated with thiourea was successfully grown from aqueous solution by slow solvent evaporation technique at room temperature using deionized water as a solvent. The structure of the crystal belongs to orthorhombic system and crystallizes in non-centro-symmetric space group Pn21a. The thermal stability was analyzed by thermo gravimetric / differential thermo analytical (TG/DTA). FTIR studies confirmed the compound formation and presence of functional groups in the crystal. UV-Vis-NIR spectroscopic studies show that the crystals possess wide transmittance in the visible region and significant optical band gap of 4.2ev with cut off wavelength of 246 nm.

  4. Single-basined choice

    NARCIS (Netherlands)

    Bossert, W.; Peters, H.J.M.

    2013-01-01

    Single-basined preferences generalize single-dipped preferences by allowing for multiple worst elements. These preferences have played an important role in areas such as voting, strategy-proofness and matching problems. We examine the notion of single-basinedness in a choice-theoretic setting. In

  5. Superconducting Single Photon Detectors

    NARCIS (Netherlands)

    Dorenbos, S.N.

    2011-01-01

    This thesis is about the development of a detector for single photons, particles of light. New techniques are being developed that require high performance single photon detection, such as quantum cryptography, single molecule detection, optical radar, ballistic imaging, circuit testing and

  6. Single-Sex Classrooms

    Science.gov (United States)

    Protheroe, Nancy

    2009-01-01

    Although single-sex education was once the norm in the U.S., the practice has largely been confined to private schools for more than a century. However, with the introduction of the final version of the U.S. Department of Education's so-called single-sex regulations in 2006, public schools were allowed greater flexibility to offer single-sex…

  7. Single frequency intracavity SRO

    DEFF Research Database (Denmark)

    Abitan, Haim; Buchhave, Preben

    2000-01-01

    Summary form only given. A single resonance optical parametric oscillator (SRO) is inserted intracavity to a CW high power, single frequency, and ring Nd:YVO4 laser. We obtain a stable single frequency CW SRO with output at 1.7-1.9 μm (idler) and a resonating signal at 2.3-2.6 μm. The behavior...

  8. SU-E-T-275: Dose Verification in a Small Animal Image-Guided Radiation Therapy X-Ray Machine: A Dose Comparison between TG-61 Based Look-Up Table and MOSFET Method for Various Collimator Sizes.

    Science.gov (United States)

    Rodrigues, A; Nguyen, G; Li, Y; Roy Choudhury, K; Kirsch, D; Das, S; Yoshizumi, T

    2012-06-01

    To verify the accuracy of TG-61 based dosimetry with MOSFET technology using a tissue-equivalent mouse phantom. Accuracy of mouse dose between a TG-61 based look-up table was verified with MOSFET technology. The look-up table followed a TG-61 based commissioning and used a solid water block and radiochromic film. A tissue-equivalent mouse phantom (2 cm diameter, 8 cm length) was used for the MOSFET method. Detectors were placed in the phantom at the head and center of the body. MOSFETs were calibrated in air with an ion chamber and f-factor was applied to derive the dose to tissue. In CBCT mode, the phantom was positioned such that the system isocenter coincided with the center of the MOSFET with the active volume perpendicular to the beam. The absorbed dose was measured three times for seven different collimators, respectively. The exposure parameters were 225 kVp, 13 mA, and an exposure time of 20 s. For a 10 mm, 15 mm, and 20 mm circular collimator, the dose measured by the phantom was 4.3%, 2.7%, and 6% lower than TG-61 based measurements, respectively. For a 10 × 10 mm, 20 × 20 mm, and 40 × 40 mm collimator, the dose difference was 4.7%, 7.7%, and 2.9%, respectively. The MOSFET data was systematically lower than the commissioning data. The dose difference is due to the increased scatter radiation in the solid water block versus the dimension of the mouse phantom leading to an overestimation of the actual dose in the solid water block. The MOSFET method with the use of a tissue- equivalent mouse phantom provides less labor intensive geometry-specific dosimetry and accuracy with better dose tolerances of up to ± 2.7%. © 2012 American Association of Physicists in Medicine.

  9. SU-F-T-364: Monte Carlo-Dose Verification of Volumetric Modulated Arc Therapy Plans Using AAPM TG-119 Test Patterns

    Energy Technology Data Exchange (ETDEWEB)

    Onizuka, R [Graduate School of Health Sciences, Kumamoto University (Japan); Araki, F; Ohno, T [Faculty of Life Sciences, Kumamoto University (Japan); Nakaguchi, Y [Kumamoto University Hospital (Japan)

    2016-06-15

    Purpose: To investigate the Monte Carlo (MC)-based dose verification for VMAT plans by a treatment planning system (TPS). Methods: The AAPM TG-119 test structure set was used for VMAT plans by the Pinnacle3 (convolution/superposition), using a Synergy radiation head of a 6 MV beam with the Agility MLC. The Synergy was simulated with the EGSnrc/BEAMnrc code, and VMAT dose distributions were calculated with the EGSnrc/DOSXYZnrc code by the same irradiation conditions as TPS. VMAT dose distributions of TPS and MC were compared with those of EBT3 film, by 2-D gamma analysis of ±3%/3 mm criteria with a threshold of 30% of prescribed doses. VMAT dose distributions between TPS and MC were also compared by DVHs and 3-D gamma analysis of ±3%/3 mm criteria with a threshold of 10%, and 3-D passing rates for PTVs and OARs were analyzed. Results: TPS dose distributions differed from those of film, especially for Head & neck. The dose difference between TPS and film results from calculation accuracy for complex motion of MLCs like tongue and groove effect. In contrast, MC dose distributions were in good agreement with those of film. This is because MC can model fully the MLC configuration and accurately reproduce the MLC motion between control points in VMAT plans. D95 of PTV for Prostate, Head & neck, C-shaped, and Multi Target was 97.2%, 98.1%, 101.6%, and 99.7% for TPS and 95.7%, 96.0%, 100.6%, and 99.1% for MC, respectively. Similarly, 3-D gamma passing rates of each PTV for TPS vs. MC were 100%, 89.5%, 99.7%, and 100%, respectively. 3-D passing rates of TPS reduced for complex VMAT fields like Head & neck because MLCs are not modeled completely for TPS. Conclusion: MC-calculated VMAT dose distributions is useful for the 3-D dose verification of VMAT plans by TPS.

  10. TG-interacting factor transcriptionally induced by AKT/FOXO3A is a negative regulator that antagonizes arsenic trioxide-induced cancer cell apoptosis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zi-Miao; Tseng, Hong-Yu; Cheng, Ya-Ling [Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Yeh, Bi-Wen [Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China); Department of Urology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Wu, Wen-Jeng [Department of Urology, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Department of Urology, School of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan (China); Huang, Huei-Sheng, E-mail: huanghs@mail.ncku.edu.tw [Department of Medical Laboratory Science and Biotechnology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan (China)

    2015-05-15

    Arsenic trioxide (ATO) is a multi-target drug approved by the Food and Drug Administration as the first-line chemotherapeutic agent for the treatment of acute promyelocytic leukemia. In addition, several clinical trials are being conducted with arsenic-based drugs for the treatment of other hematological malignancies and solid tumors. However, ATO's modest clinical efficacy on some cancers, and potential toxic effects on humans have been reported. Determining how best to reduce these adverse effects while increasing its therapeutic efficacy is obviously a critical issue. Previously, we demonstrated that the JNK-induced complex formation of phosphorylated c-Jun and TG-interacting factor (TGIF) antagonizes ERK-induced cyclin-dependent kinase inhibitor CDKN1A (p21{sup WAF1/CIP1}) expression and resultant apoptosis in response to ATO in A431 cells. Surprisingly, at low-concentrations (0.1–0.2 μM), ATO increased cellular proliferation, migration and invasion, involving TGIF expression, however, at high-concentrations (5–20 μM), ATO induced cell apoptosis. Using a promoter analysis, TGIF was transcriptionally regulated by ATO at the FOXO3A binding site (− 1486 to − 1479 bp) via the c-Src/EGFR/AKT pathway. Stable overexpression of TGIF promoted advancing the cell cycle into the S phase, and attenuated 20 μM ATO-induced apoptosis. Furthermore, blockage of the AKT pathway enhanced ATO-induced CDKN1A expression and resultant apoptosis in cancer cells, but overexpression of AKT1 inhibited CDKN1A expression. Therefore, we suggest that TGIF is transcriptionally regulated by the c-Src/EGFR/AKT pathway, which plays a role as a negative regulator in antagonizing ATO-induced CDKN1A expression and resultant apoptosis. Suppression of these antagonistic effects might be a promising therapeutic strategy toward improving clinical efficacy of ATO. - Highlights: • ATO-induced biphasic survival responses of cancer cells depend on low- or high-concentrations. • TGIF

  11. A novel recombinant 6Aβ15-THc-C chimeric vaccine (rCV02) mitigates Alzheimer's disease-like pathology, cognitive decline and synaptic loss in aged 3 × Tg-AD mice.

    Science.gov (United States)

    Yu, Yun-Zhou; Liu, Si; Wang, Hai-Chao; Shi, Dan-Yang; Xu, Qing; Zhou, Xiao-Wei; Sun, Zhi-Wei; Huang, Pei-Tang

    2016-06-03

    Alzheimer's disease (AD) is a neurodegenerative disorder that impairs memory and cognition. Targeting amyloid-β (Aβ) may be currently the most promising immunotherapeutic strategy for AD. In this study, a recombinant chimeric 6Aβ15-THc-C immunogen was formulated with alum adjuvant as a novel Aβ B-cell epitope candidate vaccine (rCV02) for AD. We examined its efficacy in preventing the cognitive deficit and synaptic impairment in 3 × Tg-AD mice. Using a toxin-derived carrier protein, the rCV02 vaccine elicited robust Aβ-specific antibodies that markedly reduced AD-like pathology and improved behavioral performance in 3 × Tg-AD mice. Along with the behavioral improvement in aged 3 × Tg-AD mice, rCV02 significantly decreased calpain activation concurrent with reduced soluble Aβ or oligomeric forms of Aβ, probably by preventing dynamin 1 and PSD-95 degradation. Our data support the hypothesis that reducing Aβ levels in rCV02-immunized AD mice increases the levels of presynaptic dynamin 1 and postsynaptic PSD-95 allowing functional recovery of cognition. In conclusion, this novel and highly immunogenic rCV02 shows promise as a new candidate prophylactic vaccine for AD and may be useful for generating rapid and strong Aβ-specific antibodies in AD patients with pre-existing memory Th cells generated after immunization with conventional tetanus toxoid vaccine.

  12. SINGLE: single photon sensitive cryogenic light detectors

    Science.gov (United States)

    Biassoni, Matteo; SINGLE Collaboration

    2017-09-01

    Thermal detectors operated at few mK as calorimeters are a powerful tool for the study of rare particle physics processes. In order to implement particle identification, light detection can be effectively performed by means of other thermal detectors operated as light sensors. This configuration can be used also in large scale, thousand-channels setups, but the light sensors must be sensitive enough to detect few, possibly a single, photons. The SINGLE project described here aims at producing silicon based, large area devices that can be operated as thermal detectors with single-photon sensitivity, and demonstrate the reliability of the performance, scalability of the production process and integrability with present and next generation cryogenic experiments for the search for rare events.

  13. SU-D-19A-05: The Dosimetric Impact of Using Xoft Axxent® Electronic Brachytherapy Source TG-43 Dosimetry Parameters for Treatment with the Xoft 30 Mm Diameter Vaginal Applicator

    Energy Technology Data Exchange (ETDEWEB)

    Simiele, S; Micka, J; Culberson, W; DeWerd, L [University of WI-Madison/ADCL, Madison, WI (United States)

    2014-06-01

    Purpose: A full TG-43 dosimetric characterization has not been performed for the Xoft Axxent ® electronic brachytherapy source (Xoft, a subsidiary of iCAD, San Jose, CA) within the Xoft 30 mm diameter vaginal applicator. Currently, dose calculations are performed using the bare-source TG-43 parameters and do not account for the presence of the applicator. This work focuses on determining the difference between the bare-source and sourcein- applicator TG-43 parameters. Both the radial dose function (RDF) and polar anisotropy function (PAF) were computationally determined for the source-in-applicator and bare-source models to determine the impact of using the bare-source dosimetry data. Methods: MCNP5 was used to model the source and the Xoft 30 mm diameter vaginal applicator. All simulations were performed using 0.84p and 0.03e cross section libraries. All models were developed based on specifications provided by Xoft. The applicator is made of a proprietary polymer material and simulations were performed using the most conservative chemical composition. An F6 collision-kerma tally was used to determine the RDF and PAF values in water at various dwell positions. The RDF values were normalized to 2.0 cm from the source to accommodate the applicator radius. Source-in-applicator results were compared with bare-source results from this work as well as published baresource results. Results: For a 0 mm source pullback distance, the updated bare-source model and source-in-applicator RDF values differ by 2% at 3 cm and 4% at 5 cm. The largest PAF disagreements were observed at the distal end of the source and applicator with up to 17% disagreement at 2 cm and 8% at 8 cm. The bare-source model had RDF values within 2.6% of the published TG-43 data and PAF results within 7.2% at 2 cm. Conclusion: Results indicate that notable differences exist between the bare-source and source-in-applicator TG-43 simulated parameters. Xoft Inc. provided partial funding for this work.

  14. QUANTUM CRYPTOGRAPHY: Single Photons.

    Science.gov (United States)

    Benjamin, S

    2000-12-22

    Quantum cryptography offers the potential of totally secure transfer of information, but as Benjamin discusses in this Perspective, its practical implementation hinges on being able to generate single photons (rather than two or more) at a time. Michler et al. show how this condition can be met in a quantum dot microdisk structure. Single molecules were also recently shown to allow controlled single-photon emission.

  15. Single photon quantum cryptography.

    Science.gov (United States)

    Beveratos, Alexios; Brouri, Rosa; Gacoin, Thierry; Villing, André; Poizat, Jean-Philippe; Grangier, Philippe

    2002-10-28

    We report the full implementation of a quantum cryptography protocol using a stream of single photon pulses generated by a stable and efficient source operating at room temperature. The single photon pulses are emitted on demand by a single nitrogen-vacancy color center in a diamond nanocrystal. The quantum bit error rate is less that 4.6% and the secure bit rate is 7700 bits/s. The overall performances of our system reaches a domain where single photons have a measurable advantage over an equivalent system based on attenuated light pulses.

  16. Single-atom nanoelectronics

    CERN Document Server

    Prati, Enrico

    2013-01-01

    Single-Atom Nanoelectronics covers the fabrication of single-atom devices and related technology, as well as the relevant electronic equipment and the intriguing new phenomena related to single-atom and single-electron effects in quantum devices. It also covers the alternative approaches related to both silicon- and carbon-based technologies, also from the point of view of large-scale industrial production. The publication provides a comprehensive picture of the state of the art at the cutting edge and constitutes a milestone in the emerging field of beyond-CMOS technology. Although there are

  17. Single-Phase PLLs

    DEFF Research Database (Denmark)

    Golestan, Saeed; Guerrero, Josep M.; Quintero, Juan Carlos Vasquez

    2017-01-01

    Single-phase phase-locked loops (PLLs) are popular for the synchronization and control of single-phase gridconnected converters. They are also widely used for monitoring and diagnostic purposes in the power and energy areas. In recent years, a large number of single-phase PLLs with different stru......-PLLs). The members of each category are then described and their pros and cons are discussed. This work provides a deep insight into characteristics of different single-phase PLLs and, therefore, can be considered as a reference for researchers and engineers....

  18. A Novel β-Globin Chain Hemoglobin Variant, Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp], Associated with Low Oxygen Saturation, Intermittent Aplastic Crises and Splenomegaly.

    Science.gov (United States)

    Collier, Anderson B; Coon, Lea M; Monteleone, Philip; Umaru, Samuel; Swanson, Kenneth C; Hoyer, James D; Oliveira, Jennifer L

    2016-01-01

    Hemoglobin (Hb) variants may be associated with low oxygen saturation and exacerbated episodes of anemia from common stressors such as viral infections. These attributes frequently cause increased clinical concern and unnecessary and expensive testing if not considered early in the evaluation of the patient. Some clinically significant Hb variants result in a normal Hb electrophoresis result, which can be method-dependent. Herein we describe a patient with low oxygen saturation and a history of hemolytic anemia who was subsequently found to carry a novel, unstable β-globin variant that we have named Hb Allentown [β137(H15)Val→Trp (GTG>TGG) HBB: c.412_413delinsTG, p.Val138Trp] for the place of identification of the variant. Hb Allentown is formed by a rare double nucleotide substitution within the same codon. Additionally, positive identification of rare Hb variants characterized by a single method is discouraged, as the Hb variant was misclassified as Hb S-South End or β6(A3)Glu→Val;β132(H10)Lys→Asn (HBB: c.[20A > T;399A > C]) by the initial laboratory.

  19. Single gaze gestures

    DEFF Research Database (Denmark)

    Møllenbach, Emilie; Lilholm, Martin; Gail, Alastair

    2010-01-01

    This paper examines gaze gestures and their applicability as a generic selection method for gaze-only controlled interfaces. The method explored here is the Single Gaze Gesture (SGG), i.e. gestures consisting of a single point-to-point eye movement. Horizontal and vertical, long and short SGGs were...

  20. Single-sided NMR

    CERN Document Server

    Casanova, Federico; Blümich, Bernhard

    2011-01-01

    Single-Sided NMR describes the design of the first functioning single-sided tomograph, the related measurement methods, and a number of applications. One of the key advantages to this method is the speed at which the images are obtained.