Lei, Lei; Xia, Wan-xia; Shao, Li; Zhao, Shu-jin
2015-10-01
2, 3, 5, 4'-Tetrahydroxy stilbene-2-O-β-D-glucoside (THSG), the active ingredient of Polygonum multiflorum, its polyketone reaction in the biosynthesis pathways was studied by biocatalysis method. The substrates 4-coumaroyl-CoA and malonyl-CoA were catalyzed in vitro by the crude enzyme extracted from Polygonum multiflorum callus, then the products were verified by HPLC and LC-MS methods. And the crude enzyme was analyzed by ammonium sulfate precipitation method and SDS-PAGE. HPLC chromatogram showed the same retention time of both the product and resveratrol standards; LC-MS spectra showed that the m/z of product was 227, which was consistent with resveratrol standards under the mode of negative ion; Ammonium sulfate (AS) precipitation method showed AS of 40% - 70% had catalytic activity,and 50% - 60% was the optimum; SDS-PAGE showed protein bands were obviously different among different AS concentration between 20% - 80%, the protein band of 42 kDa was found in AS of 50% - 60%, which had the same molecular weight with stilbene synthase. The product of polyketone reaction in the biosynthesis of THSG is resveratrol rather than THSG, so it is speculated that THSG is the conversion product of resveratrol instead of the direct product of the polyketone reaction.
Characterisation of stilbenes in California almonds (Prunus dulcis) by UHPLC-MS.
Xie, Liyang; Bolling, Bradley W
2014-04-01
Stilbene polyphenols are present in some fruits and nuts, but their abundance in many foods, such as almonds, is unknown. Therefore, we characterised stilbenes from Nonpareil, Butte and Carmel almond (Prunus dulcis) varieties from California. UHPLC-MS conditions were optimised to resolve cis- and trans-resveratrol, d4-resveratrol, dienestrol, hexestrol, oxyresveratrol, piceatannol, pterostilbene, and resveratrol-3-β-glucoside (polydatin). Stilbenes were isolated from ethanolic almond extracts by solid-phase extraction and identified with UHPLC-MS by comparison of retention times, mass spectra, in-source CID spectra, and enzymatic hydrolysis to authentic standards. Polydatin was identified in almond extracts, with 7.19-8.52 μg/100 g almond. Piceatannol+oxyresveratrol was tentatively identified in almond blanch water, at 0.19-2.55 μg/100 g almond. Polydatin was concentrated in almond skins, which contained 95.6-97.5% of the total almond content. Therefore, almonds contain the stilbene class of polyphenols in addition to the previously identified proanthocyanidin, hydrolysable tannin, flavonoid, and phenolic acid classes. Copyright © 2013 Elsevier Ltd. All rights reserved.
Wei, Qian; Ta, Guang; He, Wenjing; Wang, Wei; Wu, Qiucheng
2017-01-01
Chinese herbal medicine (CHM) has been used for treating insomnia for centuries. The most used CHM for insomnia was Polygonum multiflorum. However, the molecular mechanism for CHM preventing insomnia is unknown. Stilbene glucoside (THSG), an important active component of P. multiflorum, may play an important role for treating insomnia. To test the hypothesis, Kunming mice were treated with different dosages of THSG. To examine the sleep duration, a computer-controlled sleep-wake detection system was implemented. Electroencephalogram (EEG) and electromyogram (EMG) electrodes were implanted to determine sleep-wake state. RT-PCR and Western blot was used to measure the levels of lactate dehydrogenase (LDH) and saliva alpha amylase. Spearman's rank correlation coefficient was used to identify the strength of correlation between the variables. The results showed that THSG significantly prolonged the sleep time of the mice (palpha amylase (palpha amylase (pamylase were negatively associated with sleep duration (palpha amylase.
Four new neolignan glucosides from the fruits of Arctium lappa.
Huang, Xiao-Ying; Feng, Zi-Ming; Yang, Ya-Nan; Jiang, Jian-Shuang; Zhang, Pei-Cheng
2015-05-01
Four new neolignan glucosides named (7S, 8R)-4,7,9,9'-tetrahydroxy-3,3'-dimethoxy-8-O-4'-neolignan-9'-O-β-d-apiofuranosyl-(1 → 6)-O-β-d-glucopyranoside (1), (8R)-4,9,9'-trihydroxy-3,3'-dimethoxy-7-oxo-8-O-4'-neolignan-4-O-β-d-glucopyranoside (2), (7R, 8S)-dihydrodehydrodiconiferyl alcohol-7'-oxo-4-O-β-d-glucopyranoside (3), and (7'S, 8'R, 8S)-4,4',9'-trihydroxy-3,3'-dimethoxy-7',9-epoxylignan-7-oxo-4-O-β-d-glucopyranoside (4) were isolated from the fruits of Arctium lappa L. Their structures and absolute configurations were elucidated on the basis of comprehensive spectroscopic analyses (UV, IR, HR-ESI-MS, 1D and 2D NMR, CD), as well as by comparison with known analogues in the literature.
Brillante, Luca; De Rosso, Mirko; Dalla Vedova, Antonio; Maoz, Itay; Flamini, Riccardo; Tomasi, Diego
2018-03-01
Grape withering is a process used to produce reinforced wines and raisins. Dehydration is usually carried out postharvest by keeping ripe grapes in special warehouses in controlled conditions of temperature, relative humidity (RH) and air flow. Alternatively, grape clusters can be left on the vines after the canes have been pruned. In general, dehydration increases stilbenes in grape, but there are few studies on the effects of on-vine withering. The stilbene profiles of Raboso Piave grape during postharvest and on-vine dehydration were studied here. High-resolution mass spectrometry (MS) was used to identify 19 stilbenes, including resveratrol monomers, dimers (viniferins), oligomers and glucoside derivatives. The two dehydration methods generally had different effects on the above nutraceuticals in grape. The samples kept in warehouses revealed significant increases in Z-ω-viniferin, E-ϵ-viniferin, δ-viniferin and another resveratrol dimer which were not observed in the plants. Trans-Resveratrol increased significantly only in samples dehydrated in the warehouse at 21 °C and 60-70% RH. The findings increase knowledge of stilbene composition in grapes subjected to withering on-vine. The choice of dehydration method affects the contents of these nutraceuticals in the grape and consequently in wines. Reasonably, it could also affect other secondary metabolites important for wine quality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Prototype Stilbene Neutron Collar
Energy Technology Data Exchange (ETDEWEB)
Prasad, M. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Shumaker, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Snyderman, N. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Verbeke, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Wong, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-10-26
A neutron collar using stilbene organic scintillator cells for fast neutron counting is described for the assay of fresh low enriched uranium (LEU) fuel assemblies. The prototype stilbene collar has a form factor similar to standard He-3 based collars and uses an AmLi interrogation neutron source. This report describes the simulation of list mode neutron correlation data on various fuel assemblies including some with neutron absorbers (burnable Gd poisons). Calibration curves (doubles vs 235U linear mass density) are presented for both thermal and fast (with Cd lining) modes of operation. It is shown that the stilbene collar meets or exceeds the current capabilities of He-3 based neutron collars. A self-consistent assay methodology, uniquely suited to the stilbene collar, using triples is described which complements traditional assay based on doubles calibration curves.
Tetrahydroxanthones from Mongolian medicinal plant Gentianella amarella ssp. acuta.
Lu, Shuangxin; Tanaka, Naonobu; Kawazoe, Kazuyoshi; Murakami, Kotaro; Damdinjav, Davaadagva; Dorjbal, Enkhjargal; Kashiwada, Yoshiki
2016-10-01
Two tetrahydroxanthones, 1,3,5S,8S-tetrahydroxy-5,6,7,8-tetrahydroxanthone (1) and 1,3,5R,8S-tetrahydroxy-5,6,7,8-tetrahydroxanthone (2), and six new tetrahydroxanthone glycosides, amarellins A-F (3-8), were isolated from the aerial parts of a Mongolian medicinal plant Gentianella amarella ssp. acuta (Gentianaceae). The structures of 1-8 were elucidated on the basis of spectroscopic analysis, chemical conversion, and ECD calculation. Amarellins A-C (3-5) were assigned as 8-O-β-D-glucoside, 8-O-β-D-xyloside, and 1-O-β-D-glucoside of 1, respectively, while amarellins D-F (6-8) were elucidated to be 8-O-β-D-xyloside, 1-O-β-D-glucoside, and 3-O-β-D-glucoside of 2, respectively.
Isomerization Intermediates In Solution Phase Photochemistry Of Stilbenes
Doany, F. E.; Hochstrasser, R. M.; Greene, B. I.
1985-04-01
Picosecond and subpicosecond spectroscopic studies have revealed evidence for an isomerization intermediate between cis and trans in the photoinduced isomerism of both stilbene and biindanyledene ("stiff" stilbene). In stiff stilbene, a transient absorption at 351 nm displays time evolution and viscosity dependence consistent with absorption by a twisted intermediate ("phantom" state) with a lOps lifetime. An analagous bottleneck state with a life-time of 4ps is also consistent with the ground state recovery dynamics of t-stilbene following excitation of c-stilbene when monitored with 0.1ps resolution.
Characteristics evaluation of stilbene single crystal grown by vertical bridgman technique
International Nuclear Information System (INIS)
Jo, Kwang Ho
2012-02-01
As the nature of organic scintillator, stilbene single crystal's decay time is only a couple of nano seconds, which makes it suitable for fast neutron detection. However, the entire amount of stilbene single crystal being used relies on import currently. As the necessity of fast neutron detection equipment such as KSTAR and Sodium-cooled Fast Reactor system increases, the goal is to have our own domestic technology through the growth of stilbene single crystal. The emission wavelength of grown stilbene single crystal is confirmed, and the property of grown stilbene single crystal is assessed compared to commercial stilbene (Ukraine ISMA research center) through gamma ray and neutron tests. In this research, we have grown stilbenes through Bridgman technique, and obtained three stilbenes out of two amples. (Two ones of Φ 30 mm x 15 mm, and Φ 40 mm x 17 mm from the first ample, and size of Φ 25 mm x 13 mm from the other) The grown stilbene's emission wavelength and inherent property of stilbene are confirmed. As the result of gamma ray test, we have confirmed linearity of grown stilbene's scintillator, and the relative light yield ratio is proven 101% efficiency to reference stilbene. Neutron detection efficiency of the three stilbenes amounts to 80% of reference stilbene, and FOM of them is 108% efficiency to reference stilbene's one. Although Ukraine ISMA research center still holds a dominant position with world-class efficiency and performance of its stilbene, we expect to produce a better stilbene with our domestic technology development. Through this, fast neutron detection technique can be obtained, which opens up an opportunity to be used not only in neutron monitoring system in nuclear fusion reactor, but also in alternative measurement technique as the unit price of He-3 increases recently
Two new stilbene trimers from Cynodon dactylon.
Li, Bi-Jun; Liu, Yao; Gu, Ai-Tong; Zhang, Qing; Chen, Lei; Wang, Shu-Mei; Wang, Feng
2017-11-01
Many naturally occurring oligostilbenes have drawn considerable attention because of their intricate structures and diverse bioactivities. Two new stilbene trimers, cystibenetrimerol A (1) and cystibenetrimerol B (2) were isolated from the dried grass of Cynodon dactylon (L.) Pers. The planar structures and stereo configurations of them were elucidated by spectroscopic and spectrometric methods. The isolation and structures elucidation of two new stilbene trimers suggested the ordinary grass belonging to the family Poaceae may be a rich source of stilbene oligomers.
Photoisomerization of Stilbene: The Detailed XMCQDPT2 Treatment.
Ioffe, I N; Granovsky, A A
2013-11-12
We report the detailed XMCQDPT2/cc-pVTZ study of trans-cis photoisomerization in one of the core systems of both experimental and computational photochemistry-the stilbene molecule. For the first time, the potential energy surface (PES) of the S1 state has been directly optimized and scanned using a multistate multiconfiguration second-order perturbation theory. We characterize the trans-stilbene, pyramidalized (phantom), and DHP-cis-stilbene geometric domains of the S1 state and describe their stationary points including the transition states between them, as well as S1/S0 intersections. Also reported are the minima and the activation barriers in the ground state. Our calculations correctly predict the kinetic isotope effect due to H/D exchange at ethylenic hydrogens, the dynamic behavior of excited cis-stilbene, and trans-cis branching ratio after relaxation to S0 through a rather unsymmetric conical intersection. In general, the XMCQDPT2 results confirm the qualitative adequacy of the TDDFT (especially SF-TDDFT) picture of the excited stilbene but also reveal quantitative discrepancies that deserve further exploration.
Stilbene crystalline powder in polymer base as a new fast neutron detector
International Nuclear Information System (INIS)
Budakovsky, S.V.; Galunov, N.Z.; Grinyov, B.V.; Karavaeva, N.L.; Kyung Kim, Jong; Kim, Yong-Kyun; Pogorelova, N.V.; Tarasenko, O.A.
2007-01-01
A new organic scintillation material consisting of stilbene grains in a polymer glue base is presented. The crystalline grains of stilbene are obtained by mechanical grinding of stilbene single crystals. The resulting composite scintillators have been studied as detectors for fast neutrons
Water deficit increases stilbene metabolism in Cabernet Sauvignon berries.
Deluc, Laurent G; Decendit, Alain; Papastamoulis, Yorgos; Mérillon, Jean-Michel; Cushman, John C; Cramer, Grant R
2011-01-12
The impact of water deficit on stilbene biosynthesis in wine grape (Vitis vinifera) berries was investigated. Water deficit increased the accumulation of trans-piceid (the glycosylated form of resveratrol) by 5-fold in Cabernet Sauvignon berries but not in Chardonnay. Similarly, water deficit significantly increased the transcript abundance of genes involved in the biosynthesis of stilbene precursors in Cabernet Sauvignon. Increased expression of stilbene synthase, but not that of resveratrol-O-glycosyltransferase, resulted in increased trans-piceid concentrations. In contrast, the transcript abundance of the same genes declined in Chardonnay in response to water deficit. Twelve single nucleotide polymorphisms (SNPs) were identified in the promoters of stilbene synthase genes of Cabernet Sauvignon, Chardonnay, and Pinot Noir. These polymorphisms resulted in eight changes within the predicted cis regulatory elements in Cabernet Sauvignon and Chardonnay. These results suggest that cultivar-specific molecular mechanisms might exist that control resveratrol biosynthesis in grapes.
Preharvest methyl jasmonate and postharvest UVC treatments: increasing stilbenes in wine.
Fernández-Marín, María Isabel; Puertas, Belén; Guerrero, Raúl F; García-Parrilla, María Carmen; Cantos-Villar, Emma
2014-03-01
Stilbene-enriched wine is considered to be an interesting new food product with added value due to its potential health-promoting properties. Stilbene concentration in grape is highly variable and rather scarce. However, it can be increased by stress treatments. For this reason, numerous pre- and postharvest grape treatments, and some combinations of them, have been tested to maximize stilbene content in grapes. In the present manuscript, Syrah grapes were treated with (i) methyl jasmonate (MEJA), (ii) ultraviolet light (UVC), and (iii) methyl jasmonate and ultraviolet light (MEJA-UVC) and compared with untreated grapes. Afterward, winemaking was developed. Wine achieved by combination of both treatments (MEJA-UVC) contained significantly higher stilbene concentration (trans-resveratrol and piceatannol) than its respective control (2.5-fold). Wine quality was improved in color-related parameters (color intensity, L*, a*, b*, ΔE*, anthocyanins, and tannin). Moreover, MEJA-UVC wines obtained the highest score in sensorial analysis. To the best of our knowledge, this is the first time that pre- and postharvest treatments are combined to increase stilbenes in wine. The effect of treatment combination (methyl jasmonate and UVC light) on grape and wine was evaluated. Our results highlight the positive effect of the treatments in stilbene content, color parameters, and sensorial analysis. Moreover, added-value by-products were achieved. © 2014 Institute of Food Technologists®
Iridoid glucosides from Veronica hederifolia.
Harput, Ummuhan Sebnem; Saracoglu, Iclal; Nagatsu, Akito; Ogihara, Yukio
2002-08-01
A new iridoid glucoside, urphoside A, and six known iridoid glucosides, pikuroside, aucubin, veronicoside, catalposide, amphicoside, and verminoside, were isolated from Veronica hederifolia together with a known megastigmane glucoside, 3-hydroxy-5,6-epoxy-beta-ionol-9-O-beta-D-glucopyranoside, and a hexitol, dulcitol. The structures of the isolated compounds were established by the extensive 1D- and 2D-NMR spectroscopy.
Chen, Dawei; Sun, Lili; Chen, Ridao; Xie, Kebo; Yang, Lin; Dai, Jungui
2016-04-18
A green and cost-effective process for the convenient synthesis of acylphloroglucinol 3-C-glucosides from 2-O-glucosides was exploited using a novel C-glycosyltransferase (MiCGTb) from Mangifera indica. Compared with previously characterized CGTs, MiCGTb exhibited unique de-O-glucosylation promiscuity and high regioselectivity toward structurally diverse 2-O-glucosides of acylphloroglucinol and achieved high yields of C-glucosides even with a catalytic amount of uridine 5'-diphosphate (UDP). These findings demonstrate for the first time the significant potential of a single-enzyme approach to the synthesis of bioactive C-glucosides from both natural and unnatural acylphloroglucinol 2-O-glucosides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Screening Analyses of Pinosylvin Stilbenes, Resin Acids and Lignans in Norwegian Conifers
Anne Fiksdahl; Karin Oyaas; Ingebjorg Leirset; Hanne Hovelstad
2006-01-01
The content and distribution of stilbenes and resin acids in Scots pine (Pinus sylvestris) and spruce (Picea abies), sampled in central Norway, have been examined. The contents of pinosylvin stilbenes in pine heartwood/living knots were 0.2-2/2-8 % (w/w). No stilbenes could be detected in spruce (Picea abies). The resin acid contents of pine sapwood/heartwood and knots were 1-4 and 5-10 % (w/w), respectively. Minor amounts of resin acids (
The Use of Stilbene Scaffold in Medicinal Chemistry and Multi- Target Drug Design.
Giacomini, Elisa; Rupiani, Sebastiano; Guidotti, Laura; Recanatini, Maurizio; Roberti, Marinella
2016-01-01
The stilbene scaffold is a basic element for a number of biologically active natural and synthetic compounds, and it is considered as a privileged structure. Stilbenes exemplified by resveratrol, combretastatin A-4 and pterostilbene are of significant interest for drug research and development because of their potential in therapeutic and preventive application. Resveratrol, present in grapes and other food products, plays a role in the prevention of several human pathological processes and has been suggested as an anticancer agent. Moreover, recent evidence has revealed its potential effect on the aging process, diabetes and neurological dysfunction. Combretastatin A-4, from the bark of South African bush willow Combretum caffrum, also shows significant antitumor activity. Pterostilbene is closely related to resveratrol, sharing the same unique therapeutic potential as anti-inflammatory, antineoplastic and antioxidant agent. Therefore, research and development of stilbene-based medicinal chemistry have become rapidly evolving and increasingly active topics covering almost the whole range of therapeutic fields. In the present review, we provide an overview of the role of stilbenes in medicinal chemistry. In this context, we highlight the chemical methodologies adopted for the synthesis of stilbene derivatives, and outline the successful design of novel stilbene based hybrids in the field of cancer, Alzheimer's and other relevant diseases. This information may be useful in further design of stilbene-based molecules as new leads for the development of novel agents with clinical potential or as effective chemical probes to dissect biological processes.
Roles of Hydroxynitrile Glucosides in Barley
DEFF Research Database (Denmark)
Roelsgaard, Pernille Sølvhøj
on barley (Hordeum vulgare). Barley accumulates five hydroxynitrile glucosides, including one cyanogenic glucoside, in the epidermal cell layer. Cyanogenic glucosides are classically known as hydrogen cyanide-releasing defense compounds which act against generalist insects and herbivores. However...... is proposed. The results obtained in this Ph.D. study provide a unique insight demonstrating that hydroxynitrile glucosides play a far more complex role in barley defense against and susceptibility to Bgh than previously described. Future studies can build on the platforms established in this study to provide...
Stilbene dimer radical cations in the radiolyses of stilbenes and 1,2,3,4-tetraphenylcyclobutanes
International Nuclear Information System (INIS)
Tojo, Sachiko; Morishima, Kazuhiro; Ishida, Akito; Majima, Tetsuro; Takamuku, Setsuo
1995-01-01
The reaction of the stilbene radical cation formed by pulse radiolysis or γ-radiolyses is explained based on neutralization as well as the formation of a π-type stilbene dimer radical cation (π-St 2 +· ), converting to the σ-type St 2 +· (σ-St 2 +· ). The r-1, c-2, t-3, t-4-tetraphenylcyclobutane radical cation generated in a rigid matrix at 77 K which converted to σ-St 2 +· upon warming. Both r-1, c-2, t-3, t-4- and r-1, t-2, c-3, t-4-tetraphenylcyclobutane radical cations underwent photochemical cycloreversion to π-St 2 +· upon irradiation at wavelengths longer than 390 nm at 77 K, and converted to σ-St 2 +· upon warming. It is suggested that π-St 2 +· has overlapping arrangements of π-electrons, while σ-St 2 +· has radical and cation centers on the 1- and 4-positions of the C 4 linkage. (author)
Cabrera-González, Justo; Viñas, Clara; Haukka, Matti; Bhattacharyya, Santanu; Gierschner, Johannes; Núñez, Rosario
2016-09-12
A set of triads in which o- and m-carborane clusters are bonded to two stilbene units through Ccluster -CH2 bonds was synthesized, and their structures were confirmed by X-ray diffraction. A study on the influence of the o- and m- isomers on the absorption and photoluminescence properties of the stilbene units in solution revealed no charge-transfer contributions in the lowest excited state, as confirmed by (TD)DFT calculations. The presence of one or two B-I groups in m-carborane derivatives does not affect the emission properties of the stilbenes in solution, probably due to the rather large distance between the iodo substituents and the fluorophore. Nevertheless, a significant redshift of the photoluminescence (PL) emission maximum in the solid state (thin films and powder samples) compared to solution was observed; this can be traced back to PL sensitization, most probably due to more densely packed stilbene moieties. Remarkably, the PL absolute quantum yields of powder samples are significantly higher than those in solution, and this was attributed to the restricted environment and the aforementioned sensitization. Thus, the bonding of the carborane clusters to two stilbene units preserves their PL behavior in solution, but produces significant changes in the solid state. Furthermore, iodinated species can be considered to be promising precursors for theranostic agents in which both imaging and therapeutic functions could possibly be combined. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
76 FR 30967 - Certain Stilbenic Optical Brightening Agents From China and Taiwan
2011-05-27
... Stilbenic Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1... is a reasonable indication that an industry in the United States is materially injured by reason of imports from China and Taiwan of certain stilbenic optical brightening agents, provided for in subheadings...
Iridoid Glucosides from Eremostachys moluccelloides
DEFF Research Database (Denmark)
Calis, Ihsan; Güvenc, Aysegül; Armagan, Metin
2007-01-01
From the aerial parts of Eremostachys moluccelloides, a new iridoid glucoside, lamalbidic acid (7), was isolated together with six known iridoid glucosides, 5-desoxysesamoside (1), 6β-hydroxy-7-epi-loganin (2), lamalbide (3), shanzhiside methyl ester (4), sesamoside (5) and 5-deoxypulchelloside I...
Directory of Open Access Journals (Sweden)
Antje Borzekowski
2018-03-01
Full Text Available Zearalenone (ZEN and its phase II sulfate and glucoside metabolites have been detected in food and feed commodities. After consumption, the conjugates can be hydrolyzed by the human intestinal microbiota leading to liberation of ZEN that implies an underestimation of the true ZEN exposure. To include ZEN conjugates in routine analysis, reliable standards are needed, which are currently not available. Thus, the aim of the present study was to develop a facilitated biosynthesis of ZEN-14-sulfate, ZEN-14-glucoside and ZEN-16-glucoside. A metabolite screening was conducted by adding ZEN to liquid fungi cultures of known ZEN conjugating Aspergillus and Rhizopus strains. Cultivation conditions and ZEN incubation time were varied. All media samples were analyzed for metabolite formation by HPLC-MS/MS. In addition, a consecutive biosynthesis was developed by using Fusarium graminearum for ZEN biosynthesis with subsequent conjugation of the toxin by utilizing Aspergillus and Rhizopus species. ZEN-14-sulfate (yield: 49% is exclusively formed by Aspergillus oryzae. ZEN-14-glucoside (yield: 67% and ZEN-16-glucoside (yield: 39% are formed by Rhizopus oryzae and Rhizopus oligosporus, respectively. Purities of ≥73% ZEN-14-sulfate, ≥82% ZEN-14-glucoside and ≥50% ZEN-16-glucoside were obtained by 1H-NMR. In total, under optimized cultivation conditions, fungi can be easily utilized for a targeted and regioselective synthesis of ZEN conjugates.
Jian, Weilin; He, Daohang; Song, Shaoyun
2016-08-01
Natural stilbenes (especially resveratrol) play important roles in plant protection by acting as both constitutive and inducible defenses. However, their exogenous applications on crops as fungicidal agents are challenged by their oxidative degradation and limited availability. In this study, a new class of resveratrol-inspired oxadiazole-stilbene hybrids was synthesized via Wittig-Horner reaction. Bioassay results indicated that some of the compounds exhibited potent fungicidal activity against Botrytis cinerea in vitro. Among these stilbene hybrids, compounds 11 showed promising inhibitory activity with the EC50 value of 144.6 μg/mL, which was superior to that of resveratrol (315.6 μg/mL). Remarkably, the considerably abnormal mycelial morphology was observed in the presence of compound 11. The inhibitory profile was further proposed by homology modeling and molecular docking studies, which showed the possible interaction of resveratrol and oxadiazole-stilbene hybrids with the cytochrome P450-dependent sterol 14α-demethylase from B. cinerea (BcCYP51) for the first time. Taken together, these results would provide new insights into the fungicidal mechanism of stilbenes, as well as an important clue for biology-oriented synthesis of stilbene hybrids with improved bioactivity against plant pathogenic fungi in crop protection.
Merocyanines: polyene-polymethine transition in donor-acceptor-substituted stilbenes and polyenes
International Nuclear Information System (INIS)
Rettig, Wolfgang; Dekhtyar, Marina
2003-01-01
Three series of donor-acceptor-substituted conjugated compounds, namely, stilbenes, the open-chain polyenes of equivalent length, and the species of intermediate structure (polyenes terminated with only one phenyl ring) have been studied by the AM1 and HMO methods to elucidate and compare the structural prerequisites of the ideal polymethinic state ('cyanine limit'). The transition from polyenic to polymethinic properties has been traced in terms of bond-length (bond-order) alternation using the variation of terminal donor and acceptor substituents. Stilbenes manifest themselves as notably 'retarded' polyenes since a larger electronic asymmetry is necessary for them to reach the same degree of polymethinic character. The ground and the excited state have been shown to differ much more strongly for stilbenes than for polyenes with respect to the position of the bond equalization point on the scale of donor-acceptor difference. For the compounds containing one phenyl ring, the features revealed are intermediate between stilbenes and polyenes. The large S 0 -S 1 discrepancy in terms of bond alternation is a general property of aromatic ring-terminated chains (stilbenes) and is related to the influence of the aromatic character which can be quantified in this way. In this context, the most relevant definition for the cyanine limit (based on the bond invariance upon excitation) was selected from the existing definitions. The major trends revealed in the polyenic/polymethinic behaviour of the molecules can be interpreted on a topological basis within HMO or even simpler models with some additional influence due to the interelectronic repulsion which is taken into account in the AM1 treatment
Crupi, Pasquale; Pichierri, Arianna; Basile, Teodora; Antonacci, Donato
2013-11-15
Flavonoids and stilbenes are secondary metabolites produced in plants that can play an important health-promoting role. The biosynthesis of these compounds generally increases as a response to biotic or abiotic stress; therefore, in order to achieve as high phenolic accumulation as possible, the interactive effects of storage conditions (temperature and time) and UV-C radiation on polyphenols content in postharvest Redglobe table grape variety were investigated. During a storage time longer than 48h, both cold storage (4°C) and UV-C exposure of almost 3min (2.4kJm(-2)) positively enhanced the content of cis- and trans-piceid (34 and 90μgg(-1) of skin, respectively) together with quercetin-3-O-galactoside and quercetin-3-O-glucoside (15 and 140μgg(-1) of skin, respectively) up to three fold respect to control grape samples. Conversely, catechin was not significantly affected by irradiation and storage treatments. With regard anthocyanins, the highest concentrations of cyanidin-3-O-glucoside and peonidin-3-Oglucoside were observed in Redglobe, stored at both room temperature and 4°C, after 5min (4.1kJm(-2)) of UV-C treatment and 24h of storage. Gathered findings showed that combined postharvest treatments can lead to possible "functional" grapes, within normal conditions of market commercialization, responding to the rising consumers demand to have foods that support and promote health. Copyright © 2013. Published by Elsevier Ltd.
Ultrasound-Assisted Extraction of Stilbenes from Grape Canes.
Piñeiro, Zulema; Marrufo-Curtido, Almudena; Serrano, Maria Jose; Palma, Miguel
2016-06-16
An analytical ultrasound-assisted extraction (UAE) method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying) and several extraction variables (solvent, sample-solvent ratio and extraction time between others) on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5) for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.
Li, Chunyu; Niu, Ming; Bai, Zhaofang; Zhang, Congen; Zhao, Yanling; Li, Ruiyu; Tu, Can; Li, Huifang; Jing, Jing; Meng, Yakun; Ma, Zhijie; Feng, Wuwen; Tang, Jinfa; Zhu, Yun; Li, Jinjie; Shang, Xiaoya; Zou, Zhengsheng; Xiao, Xiaohe; Wang, Jiabo
2017-06-01
The main constituents of a typical medicinal herb, Polygonum multiflorum (Heshouwu in Chinese), that induces idiosyncratic liver injury remain unclear. Our previous work has shown that cotreatment with a nontoxic dose of lipopolysaccharide (LPS) and therapeutic dose of Heshouwu can induce liver injury in rats, whereas the solo treatment cannot induce observable injury. In the present work, using the constituent "knock-out" and "knock-in" strategy, we found that the ethyl acetate (EA) extract of Heshouwu displayed comparable idiosyncratic hepatotoxicity to the whole extract in LPS-treated rats. Results indicated a significant elevation of plasma alanine aminotransferase, aspartate aminotransferase, and liver histologic changes, whereas other separated fractions failed to induce liver injury. The mixture of EA extract with other separated fractions induced comparable idiosyncratic hepatotoxicity to the whole extract in LPS-treated rats. Chemical analysis further revealed that 2,3,5,4'-tetrahydroxy trans-stilbene-2-O-β-glucoside (trans-SG) and its cis-isomer were the two major compounds in EA extract. Furthermore, the isolated cis-, and not its trans-isomer, displayed comparable idiosyncratic hepatotoxicity to EA extract in LPS-treated rats. Higher contents of cis-SG were detected in Heshouwu liquor or preparations from actual liver intoxication patients associated with Heshouwu compared with general collected samples. In addition, plasma metabolomics analysis showed that cis-SG-disturbing enriched pathways remarkably differed from trans-SG ones in LPS-treated rats. All these results suggested that cis-SG was closely associated with the idiosyncratic hepatotoxicity of Heshouwu. Considering that the cis-trans isomerization of trans-SG was mediated by ultraviolet light or sunlight, our findings serve as reference for controlling photoisomerization in drug discovery and for the clinical use of Heshouwu and stilbene-related medications.
Directory of Open Access Journals (Sweden)
Hamza Temsamani
2016-06-01
Full Text Available The aggregation of α-synuclein is one on the key pathogenic events in Parkinson’s disease. In the present study, we investigated the inhibitory capacities of stilbenes against α-synuclein aggregation and toxicity. Thioflavin T fluorescence, transmission electronic microscopy, and SDS-PAGE analysis were performed to investigate the inhibitory effects of three stilbenes against α-synuclein aggregation: piceatannol, ampelopsin A, and isohopeaphenol. Lipid vesicle permeabilization assays were performed to screen stilbenes for protection against membrane damage induced by aggregated α-synuclein. The viability of PC12 cells was examined using an MTT assay to assess the preventive effects of stilbenes against α-synuclein-induced toxicity. Piceatannol inhibited the formation of α synuclein fibrils and was able to destabilize preformed filaments. It seems to induce the formation of small soluble complexes protecting membranes against α-synuclein-induced damage. Finally, piceatannol protected cells against α-synuclein-induced toxicity. The oligomers tested (ampelopsin A and hopeaphenol were less active.
21 CFR 573.660 - Methyl glucoside-coconut oil ester.
2010-04-01
... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Methyl glucoside-coconut oil ester. 573.660 Section 573.660 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... ANIMALS Food Additive Listing § 573.660 Methyl glucoside-coconut oil ester. Methyl glucoside-coconut oil...
Ma, Xiaohua
2015-12-09
A novel intrinsically microporous polymer was synthesized by polycondensation reaction of 1,1′,2,2′,-tetrahydroxy-tetraphenylethylene (TPE) and 2,3,5,6-tetrafluoroterephthalonitrile (TFTPN). In addition, a series of copolymers was prepared from TPE, 5,5′,6,6′-tetrahydroxy-3,3,3′,3′-tetramethylspirobisindane (TTSBI) and TFTPN. All TPE-derived polymers exhibited high molecular weight, good solubility in common organic solvents, high thermal stability and high surface area (550 to 660 m2 g−1). The CO2 permeability of a methanol-treated and 120 °C vacuum-dried TPE-TFTPN film was 862 Barrer with a moderate CO2/N2 selectivity of 26. The selectivity of the TPE-TTSBI-PIMs decreased with increasing TTSBI content coupled with a sharp increase in permeability. Molecular simulations indicated that the introduction of the tetraphenylethylene unit resulted in an increased rotational freedom of dihedral angles in the polymer main chain relative to those of the spirobisindane-based PIM-1.
Ma, Xiaohua; Pinnau, Ingo
2015-01-01
A novel intrinsically microporous polymer was synthesized by polycondensation reaction of 1,1′,2,2′,-tetrahydroxy-tetraphenylethylene (TPE) and 2,3,5,6-tetrafluoroterephthalonitrile (TFTPN). In addition, a series of copolymers was prepared from TPE, 5,5′,6,6′-tetrahydroxy-3,3,3′,3′-tetramethylspirobisindane (TTSBI) and TFTPN. All TPE-derived polymers exhibited high molecular weight, good solubility in common organic solvents, high thermal stability and high surface area (550 to 660 m2 g−1). The CO2 permeability of a methanol-treated and 120 °C vacuum-dried TPE-TFTPN film was 862 Barrer with a moderate CO2/N2 selectivity of 26. The selectivity of the TPE-TTSBI-PIMs decreased with increasing TTSBI content coupled with a sharp increase in permeability. Molecular simulations indicated that the introduction of the tetraphenylethylene unit resulted in an increased rotational freedom of dihedral angles in the polymer main chain relative to those of the spirobisindane-based PIM-1.
International Nuclear Information System (INIS)
Yanagida, Takayuki; Watanabe, Kenichi; Fujimoto, Yutaka
2015-01-01
Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under 137 Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators
Energy Technology Data Exchange (ETDEWEB)
Yanagida, Takayuki, E-mail: yanagida@lsse.kyutech.ac.jp [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan); Watanabe, Kenichi [Nagoya University, Furocho, Chikusa, Nagoya 464-8603 (Japan); Fujimoto, Yutaka [Kyushu Institute of Technology, 2-4 Hibikino, Wakamatsu, Kitakyushu, Fukuoka 808-0196 (Japan)
2015-06-01
Solid state organic scintillators, such as anthracene, stilbene, and p-terphenyl were investigated on their basic scintillation properties and neutron–gamma discrimination capabilities. Scintillation wavelengths under X-ray irradiation of anthracene, stilbene, and p-terphenyl were 445–525, 400–500, and 350–450 nm, respectively. Scintillation light yields of anthracene, stilbene, and p-terphenyl under {sup 137}Cs gamma-ray irradiation were 20100, 16000, and 19400 ph/MeV, respectively. Neutron and gamma-ray events discrimination capabilities were examined and anthracene exhibited the best figure of merit among three organic scintillators.
21 CFR 172.816 - Methyl glucoside-coconut oil ester.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methyl glucoside-coconut oil ester. 172.816 Section... HUMAN CONSUMPTION Multipurpose Additives § 172.816 Methyl glucoside-coconut oil ester. Methyl glucoside-coconut oil ester may be safely used in food in accordance with the following conditions: (a) It is the...
Ultrasound-Assisted Extraction of Stilbenes from Grape Canes
Directory of Open Access Journals (Sweden)
Zulema Piñeiro
2016-06-01
Full Text Available An analytical ultrasound-assisted extraction (UAE method has been optimized and validated for the rapid extraction of stilbenes from grape canes. The influence of sample pre-treatment (oven or freeze-drying and several extraction variables (solvent, sample-solvent ratio and extraction time between others on the extraction process were analyzed. The new method allowed the main stilbenes in grape canes to be extracted in just 10 min, with an extraction temperature of 75 °C and 60% ethanol in water as the extraction solvent. Validation of the extraction method was based on analytical properties. The resulting RSDs (n = 5 for interday/intraday precision were less than 10%. Furthermore, the method was successfully applied in the analysis of 20 different grape cane samples. The result showed that grape cane byproducts are potentially sources of bioactive compounds of interest for pharmaceutical and food industries.
21 CFR 178.3600 - Methyl glucoside-coconut oil ester.
2010-04-01
... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Methyl glucoside-coconut oil ester. 178.3600... SANITIZERS Certain Adjuvants and Production Aids § 178.3600 Methyl glucoside-coconut oil ester. Methyl glucoside-coconut oil ester identified in § 172.816(a) of this chapter may be safely used as a processing...
Effect of stilbene resveratrol on haematological indices of rats
Czech Academy of Sciences Publication Activity Database
Doubek, J.; Volný, T.; Lojek, Antonín; Knotková, Z.; Kotrbáček, V.; Scheer, P.; Holešovská, Z.
2005-01-01
Roč. 74, č. 2 (2005), s. 205-208 ISSN 0001-7213 Institutional research plan: CEZ:AV0Z50040507 Keywords : antioxidative capacity * stilbene-resveratrol Subject RIV: BO - Biophysics Impact factor: 0.353, year: 2005
Unexpected secoiridoid glucosides from Manulea corymbosa.
Gousiadou, Chrysoula; Kokubun, Tetsuo; Gotfredsen, Charlotte H; Jensen, Søren R
2014-03-28
From an extract of Manulea corymbosa were isolated four known secoiridoid glucosides (1-4), 10 new monoterpenoid esters of secologanol, namely, manuleosides A-I (5-11, 13, and 14) and dimethyl rhodanthoside A (12), and four new phenylpropanoid esters of carbocyclic iridoid glucosides, manucorymbosides I-IV (15-18). Also, the caffeoyl phenylethanoid glycoside verbascoside was isolated. The presence of secoiridoids apparently derived from loganic acid in the family Scrophulariaceae is unprecedented and greatly unexpected.
Enzymatic Biosynthesis of Novel Resveratrol Glucoside and Glycoside Derivatives
Pandey, Ramesh Prasad; Parajuli, Prakash; Shin, Ju Yong; Lee, Jisun; Lee, Seul; Hong, Young-Soo; Park, Yong Il; Kim, Joong Su; Sohng, Jae Kyung
2014-01-01
A UDP glucosyltransferase from Bacillus licheniformis was overexpressed, purified, and incubated with nucleotide diphosphate (NDP) d- and l-sugars to produce glucose, galactose, 2-deoxyglucose, viosamine, rhamnose, and fucose sugar-conjugated resveratrol glycosides. Significantly higher (90%) bioconversion of resveratrol was achieved with α-d-glucose as the sugar donor to produce four different glucosides of resveratrol: resveratrol 3-O-β-d-glucoside, resveratrol 4′-O-β-d-glucoside, resveratr...
López-Alfaro, Isabel; González-Arenzana, Lucía; López, Noelia; Santamaría, Pilar; López, Rosa; Garde-Cerdán, Teresa
2013-12-15
The purpose of this paper was to study the effect of pulsed electric fields (PEF) on the stilbene content of three grape varieties. For this purpose, four different PEF treatments were applied using a continuous system over three varieties, Graciano, Tempranillo and Grenache, destemmed and crushed. In addition, the influence of PEF on their physicochemical composition was studied. PEF treatments did not affect the pH or total acidity of Graciano, however, musts from Tempranillo and Grenache had higher pH values and lower total acidity. In the three varieties, all treatments resulted in an increase of potassium content, deeper colour intensity and total polyphenol index and lower tonality, more pronounced in the treatments with higher time and energy. The stilbene content of the must significantly increased with respect to the control. This increase depended on the variety and the treatment applied. Tempranillo increased up 200% the total stilbene concentration, Grenache 60% and Graciano 50%. For the three varieties, the treatment with the highest time and energy was the most effective on the total stilbene extraction. These results indicate that PEF could be a suitable technology for obtaining musts with deeper colour and higher phenolic content, including resveratrol and piceid. Copyright © 2013 Elsevier Ltd. All rights reserved.
Photoinduced gelation by stilbene oxalyl amide compounds.
Miljanić, Snezana; Frkanec, Leo; Meić, Zlatko; Zinić, Mladen
2005-03-29
Oxalyl amide derivatives bearing 4-dodecyloxy-stilbene as a cis-trans photoisomerizing unit were synthesized. The trans derivative acted as a versatile gelator of various organic solvents, whereas the corresponding cis derivative showed a poor gelation ability or none at all. In diluted solution (c = 2.0 x10(-5) mol dm(-3), ethanol), the cis isomer was photochemically converted into the trans isomer within 4 min. Depending on the radiation wavelength, the trans isomer was stable or liable to photodecomposition. When exposed to irradiation, a concentrated solution of the cis isomer (c = 2.0 x 10(-2) mol dm(-3), ethanol) turned into a gel. The FT-Raman, FT-IR, and 1H NMR spectra demonstrated that the gelation process occurred because of a rapid cis --> trans photoisomerization followed by a self-assembly of the trans molecules. Apart from the formation of hydrogen bonding between the oxalyl amide parts of the molecules, confirmed by FT-IR spectroscopy, it was assumed that the pi-pi stacking between the trans-stilbene units of the molecule and a lipophilic interaction between long alkyl chains were the interactions responsible for gelation.
Unexpected Secoiridoid Glucosides from Manulea corymbosa
DEFF Research Database (Denmark)
Gousiadou, Chrysoula; Kokubun, Tetsuo; Gotfredsen, Charlotte Held
2014-01-01
From an extract of Manulea corymbosa were isolated four known secoiridoid glucosides (1–4), 10 new monoterpenoid esters of secologanol, namely, manuleosides A–I (5–11, 13, and 14) and dimethyl rhodanthoside A (12), and four new phenylpropanoid esters of carbocyclic iridoid glucosides, manucorymbo......, manucorymbosides I–IV (15–18). Also, the caffeoyl phenylethanoid glycoside verbascoside was isolated. The presence of secoiridoids apparently derived from loganic acid in the family Scrophulariaceae is unprecedented and greatly unexpected....
Safety assessment of decyl glucoside and other alkyl glucosides as used in cosmetics.
Fiume, Monice M; Heldreth, Bart; Bergfeld, Wilma F; Belsito, Donald V; Hill, Ronald A; Klaassen, Curtis D; Liebler, Daniel; Marks, James G; Shank, Ronald C; Slaga, Thomas J; Snyder, Paul W; Andersen, F Alan
2013-01-01
The Cosmetic Ingredient Review (CIR) Expert Panel assessed the safety of 19 alkyl glucosides as used in cosmetics and concluded that these ingredients are safe in the present practices of use and concentration when formulated to be nonirritating. Most of these ingredients function as surfactants in cosmetics, but some have additional functions as skin-conditioning agents, hair-conditioning agents, or emulsion stabilizers. The Panel reviewed the available animal and clinical data on these ingredients. Since glucoside hydrolases in human skin are likely to break down these ingredients to release their respective fatty acids and glucose, the Panel also reviewed CIR reports on the safety of fatty alcohols and were able to extrapolate data from those previous reports to support safety.
Giampietro, Letizia; D'Angelo, Alessandra; Giancristofaro, Antonella; Ammazzalorso, Alessandra; De Filippis, Barbara; Di Matteo, Mauro; Fantacuzzi, Marialuigia; Linciano, Pasquale; Maccallini, Cristina; Amoroso, Rosa
2014-01-01
In an effort to develop safe and efficacious compounds for the treatment of metabolic disorders, new compounds based on a combination of clofibric acid, the active metabolite of clofibrate, and trans-stilbene, chalcone, and other lipophilic groups were synthesized. They were evaluated for PPARα transactivation activity; all branched derivatives showed an increase of the transcriptional activity of receptor compared to the linear ones. Noteworthy, stilbene and benzophenone branched derivatives activated the PPARα better than clofibric acid.
Ferrer-Ugalde, A; Cabrera-González, J; Juárez-Pérez, E J; Teixidor, F; Pérez-Inestrosa, E; Montenegro, J M; Sillanpää, R; Haukka, M; Núñez, R
2017-02-14
Two novel styrene-containing meta-carborane derivatives substituted at the second carbon cluster atom (C c ) with either a methyl (Me) or a phenyl (Ph) group are introduced herein along with a new set of stilbene-containing ortho- (o-) and meta- (m-) carborane dyads. The latter set of compounds have been prepared from styrene-containing carborane derivatives via a Heck coupling reaction. High regioselectivity has been achieved for these compounds by using a combination of palladium complexes [Pd 2 (dba) 3 ]/[Pd(t-Bu 3 P) 2 ] as a catalytic system, yielding exclusively E isomers. All compounds have been fully characterised and the crystal structures of seven of them were analysed by X-ray diffraction. The absorption spectra of these compounds are similar to those of their respective fluorophore groups (styrene or stilbene), showing a very small influence of the substituent (Me or Ph) linked to the second C c atom or the cluster isomer (o- or m-). On the other hand, fluorescence spectroscopy revealed high emission intensities for Me-o-carborane derivatives, whereas their Ph-o-carborane analogues evidenced an almost total lack of fluorescence, confirming the significant role of the substituent bound to the adjacent C c in o-carboranes. In contrast, all the m-carborane derivatives display similar photoluminescence (PL) behavior regardless of the substituent attached to the second C c , demonstrating its small influence on emission properties. Additionally, m-carborane derivatives are significantly more fluorescent than their o-counterparts, reaching quantum yield values as high as 30.2%. Regarding solid state emission, only stilbene-containing Ph-o-carborane derivatives, which showed very low fluorescence in solution, exhibited notable PL emission in films attributed to aggregation-induced emission. DFT calculations were performed to successfully complement the photoluminescence studies, supporting the experimentally observed photophysical behavior of the styrene and
Structural Revision of Some Recently Published Iridoid Glucosides
DEFF Research Database (Denmark)
Jensen, Søren Rosendal; Calis, Ihsan; Gotfredsen, Charlotte Held
2007-01-01
). Finally, two alleged iridoid galactosides from Buddleja crispa named buddlejosides A and B (12a and 12b) have been shown to be the corresponding glucosides; the former is identical to agnuside (13a) while the latter is 3,4-dihydroxybenzoylaucubin (13b), an iridoid glucoside not previously published...
Struijs, K.; Vincken, J.P.; Doeswijk, T.G.; Voragen, A.G.J.; Gruppen, H.
2009-01-01
Lignan macromolecule from flaxseed hulls is composed of secoisolariciresinol diglucoside (SDG) and herbacetin diglucoside (HDG) moieties ester-linked by 3-hydroxy-3-methylglutaric acid (HMGA), and of p-coumaric acid glucoside (CouAG) and ferulic acid glucoside (FeAG) moieties ester-linked directly
Target molecular weights for red cell band 3 stilbene and mercurial binding sites
International Nuclear Information System (INIS)
Verkman, A.S.; Skorecki, K.L.; Jung, C.Y.; Ausiello, D.A.
1986-01-01
Radiation inactivation was used to measure the target sizes for binding of disulfonic stilbene anion transport inhibitor 4,4'-dibenzamido-2,2'-disulfonic stilbene (DBDS) and mercurial water transport inhibitor p-chloromercuribenzene sulfonate (pCMBS) to human erythrocytes. The measured target size for erythrocyte ghost acetylcholinesterase was 78 +/- 3 kDa. DBDS binding to ghost membranes was measured by a fluorescence enhancement technique. Radiation (0-26 Mrad) had no effect on total membrane protein and DBDS binding affinity, whereas DBDS binding stoichiometry decreased exponentially with radiation dose, giving a target size of 59 +/- 4 kDa. H2-4,4'-diisothiocyano-2,2'-disulfonic stilbene (H2-DIDS, 5 microM) blocked greater than 95% of DBDS binding at all radiation doses. pCMBS binding was measured from the time course of tryptophan fluorescence quenching in ghosts treated with the sulfhydryl reagent N-ethylmaleimide (NEM). Radiation did not affect the kinetics of tryptophan quenching, whereas the total amplitude of the fluorescence signal inactivated with radiation with a target size of 31 +/- 6 kDa. These results support the notion that DBDS and pCMBS bind to the transmembrane domain of erythrocyte band 3 in NEM-treated ghosts and demonstrate that radiation inactivation may probe a target significantly smaller than a covalently linked protein subunit. The small target size for the band 3 stilbene binding site may correspond to the intramembrane domain of the band 3 monomer (52 kDa), which is physically distinct from the cytoplasmic domain (42 kDa)
Hagey, Lee R; Ogawa, Shoujiro; Kato, Narimi; Satoh née Okihara, Rika; Une, Mizuho; Mitamura, Kuniko; Ikegawa, Shigeo; Hofmann, Alan F; Iida, Takashi
2012-11-01
A key intermediate in the biosynthetic pathway by which C(24) bile acids are formed from cholesterol has long been considered to be varanic acid, (24ξ,25ξ)-3α,7α,12α-24-tetrahydroxy-5β-cholestan-27-oic acid. The (24R,25R)-epimer of this tetrahydroxy bile acid, in the form of its taurine N-acyl amidate, was thought to be the major biliary bile acid in lizards of the family Varanidae. We report here that a major biliary bile acid of three lizard species - the Komodo dragon (Varanus komodoensis), Gray's monitor (Varanus olivaceus), and the Gila monster (Heloderma suspectum) - is a novel epimer of varanic acid. The epimer was shown to be (24R,25S)-3α,7α,12α,24-tetrahydroxy-5β-cholestan-27-oic acid (present in bile as its taurine conjugate). The structure was established by mass spectroscopy and by (1)H and (13)C nuclear magnetic spectroscopy, as well as by synthesis of the compound. Copyright © 2012 Elsevier Inc. All rights reserved.
Occurrence of riboflavinyl glucoside in rat urine
International Nuclear Information System (INIS)
Ohkawa, Hiroshi; Ohishi, Nobuko; Yagi, Kunio
1983-01-01
To investigate the metabolism of riboflavin, [2- 14 C]-riboflavin was administered orally to a rat. The urine pooled for 24 h after administration was fractionated by paper and silica gel thin layer chromatographies using various solvent systems. Among the radioactive metabolites, riboflavinyl glucoside was found along with 7-carboxy lumichrome and 8-carboxy lumichrome. The radioactivity of riboflavinyl glucoside comprised about 6 % of the total radioactivity excreted in the urine during 24 h. (author)
Directory of Open Access Journals (Sweden)
Gang Li
2018-01-01
Full Text Available Fenugreek (Trigonella foenum-graecum L. is a well-known annual plant that is widely distributed worldwide and has possessed obvious hypoglycemic and hypercholesterolemia characteristics. In our previous study, three polyphenol stilbenes were separated from fenugreek seeds. Here, we investigated the effect of polyphenol stilbenes on adipogenesis and insulin resistance in 3T3-L1 adipocytes. Oil Red O staining and triglyceride assays showed that polyphenol stilbenes differently reduced lipid accumulation by suppressing the expression of adipocyte-specific proteins. In addition, polyphenol stilbenes improved the uptake of 2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino-2-deoxyglucose (2-NBDG by promoting the phosphorylation of protein kinase B (AKT and AMP-activated protein kinase (AMPK. In present studies, it was found that polyphenol stilbenes had the ability to scavenge reactive oxygen species (ROS. Results from adenosine triphosphate (ATP production and mitochondrial membrane potentials suggested that mitochondria play a critical role in insulin resistance and related signaling activation, such as AKT and AMPK. Rhaponticin, one of the stilbenes from fenugreek, had the strongest activity among the three compounds in vitro. Future studies will focus on mitochondrial biogenesis and function.
Mendez, Violaine; Guillois, Kevin; Daniè le, Sté phane; Tuel, Alain; Caps, Valerie
2010-01-01
Aerobic partial oxidations of alkanes and alkenes are important processes of the petrochemical industry. The radical mechanisms involved can be catalyzed by soluble salts of transition metals (Co, Cu, Mn...). We show here that the model methylcyclohexane/stilbene co-oxidation reaction can be efficiently catalyzed at lower temperature by supported gold nanoparticles. The support has little influence on gold intrinsic activity but more on the apparent reaction rates which are a combination of catalytic activity and diffusion limitations. These are here minimized by using gadolinium-doped titania nanocrystallites as support for gold nanoparticles. This material is obtained by mild hydrolysis of a new Gd4TiO(OiPr)14 bimetallic oxoalkoxide. It leads to enhanced wettability of the < 3 nm gold particles in the tert-butyl hydroperoxide (TBHP)-initiated epoxidation of stilbene in methylcyclohexane; Au/TiO2:Gd3+ is in turn as active as the state-of-the-art hydrophobic Au/SiO2 catalyst. The rate-determining step of this reaction is identified as the gold-catalyzed homolytic decomposition of TBHP generating radicals and initiating the methylcyclohexane-mediated epoxidation of stilbene, yielding a methylcyclohexan-1-ol/trans-stilbene oxide mixture. Methylcyclohexan-1-ol can also be obtained in the absence of the alkene in the gold-catalyzed solvent-free autoxidation of methylcyclohexane, evidencing the catalytic potential of gold nanoparticles for low temperature C-H activation. © 2010 The Royal Society of Chemistry.
Escherichia coli modular coculture system for resveratrol glucosides production
DEFF Research Database (Denmark)
Thuan, Nguyen Huy; Trung, Nguyen Thanh; Cuong, Nguyen Xuan
2018-01-01
converting para-coumaric acid into resveratrol and the downstream module expressing glucosyltransferase to convert the resveratrol into its glucosidated forms; polydatin and resveratroloside. Upon optimization of the initial inoculum ratio of two E. coli populations, 92 mg resveratrol glucosides/L (236 µ......M) was produced i.e. achieving 84% bioconversion from 280 µM of p-coumaric acid in 60 h by 3 L fed batch fermentor. This is the report of applying coculture system to produce resveratrol glucosides by expressing the aglycone formation pathway and sugar dependent pathway into two different cells....
Directory of Open Access Journals (Sweden)
Roy Deodutta
2004-01-01
Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental
Cyanogenic glucoside patterns in sweet and bitter almonds
DEFF Research Database (Denmark)
Sánchez Pérez, Raquel; Møller, Birger Lindberg; Olsen, Carl Erik
2009-01-01
When an almond (Prunus dulcis (Mill.) D. A. Webb) kernel containing cyanogenic glucosides (prunasin or amygdalin) is disintegrated, the glucosides will typically be hydrolyzed by amygdalin hydrolase, prunasin hydrolase, and mandelonitrile lyase with concomitant release of glucose, benzaldehyde......, and hydrogen cyanide (HCN). Benzaldehyde and HCN, in low amounts, provide the characteristic almond taste and flavour. Because of the toxicity of HCN, low cyanogenic glucoside content in the kernel is a prime breeding target. Biochemical analyses of different almond tissues were carried out to investigate...... their ability to synthesize and degrade prunasin and amygdalin. The analyses were carried out during the entire growth season, from almond tree flowering to kernel ripening using the following tissues: leaves, petioles, and the fruit (endosperm and cotyledon). Four different genotypes were investigated...
Flavonoids and a neolignan glucoside from Guarea macrophylla (Meliaceae)
International Nuclear Information System (INIS)
Pereira, Cristiane; Barreto Junior, Cleber Bomfim; Kuster, Ricardo Machado; Simas, Naomi Kato; Sakuragui, Cassia Monica; Porzel, Andrea; Wessjohann, Ludger
2012-01-01
This work describes the phytochemical study of the methanol extract obtained from leaves of Guarea macrophylla, leading to the isolation and identification of three flavonoid glycosides (quercetin 3-O-β-D-glucopyranoside, quercetin 3-O-b-D-galactopyranoside, kaempferol 7-O-β-D-glucopyranoside) and a neolignan glucoside, dehydrodiconiferyl alcohol-4-b-D-glucoside. All compounds were identified by a combination of spectroscopic methods ( 1 H, 1D, 2D NMR, 13 C and UV), ESI-MS and comparison with the literature data. This is the first report of flavonoids in the genus Guarea and of a neolignan glucoside in the Meliaceae family. (author)
Flavonoids and a neolignan glucoside from Guarea macrophylla (Meliaceae
Directory of Open Access Journals (Sweden)
Cristiane Pereira
2012-01-01
Full Text Available This work describes the phytochemical study of the methanol extract obtained from leaves of Guarea macrophylla, leading to the isolation and identification of three flavonoid glycosides (quercetin 3-O-β-D-glucopyranoside, quercetin 3-O-b-D-galactopyranoside, kaempferol 7-O-β-D-glucopyranoside and a neolignan glucoside, dehydrodiconiferyl alcohol-4-β-D-glucoside. All compounds were identified by a combination of spectroscopic methods (¹H, 1D, 2D NMR, 13C and UV, ESI-MS and comparison with the literature data. This is the first report of flavonoids in the genus Guarea and of a neolignan glucoside in the Meliaceae family.
Different inhibition mechanisms of gentisic acid and cyaniding-3-O-glucoside on polyphenoloxidase.
Zhou, Lei; Xiong, Zhiqiang; Liu, Wei; Zou, Liqiang
2017-11-01
Gentisic acid and cyanidin-3-O-glucoside are important bioactive polyphenols which are widely distributed in many fruits and cereals. In this work, kinetic study, spectral analysis and computational simulation were used to compare the inhibitory effects and inhibition mechanisms of gentisic acid and cyanidin-3-O-glucoside on mushroom polyphenoloxidase (PPO). The inhibitory effect of cyanidin-3-O-glucoside on PPO was much stronger than that of gentisic acid. Gentisic acid inhibited PPO in a reversible mixed-type manner while cyanidin-3-O-glucoside was an irreversible inhibitor. Gentisic acid and cyanidin-3-O-glucoside made the thermal inactivation of PPO easier, and induced apparent conformational changes of PPO. Compared with gentisic acid, cyanidin-3-O-glucoside had stronger effects on the thermal inactivation and conformation of PPO. Molecular docking results revealed gentisic acid bound to the active site of PPO by hydrogen bonding, π-π stacking and van der Waals forces. However, cyanidin-3-O-glucoside might irreversibly interact with the Met or Cys in PPO by covalent bonds. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Ya-Fei Tan
2008-09-01
Full Text Available A natural product, stilbene glycoside (2,3,5,4’-tetrahydroxydiphenylethylene-2-O-glucoside, TBG, has been evaluated for the first time as a potential substrate for horseradish peroxidase (HRP-catalyzed fluorogenic reactions. The properties of TBG as a fluorogenic substrate for HRP and its application in a fluorometric enzyme-linked immunosensing system were compared with commercially available substrates such as p-hydroxyphenylpropionic acid (pHPPA, chavicol and Amplex red using Brucella melitensis antibody (BrAb as a model analyte. The immunosensing body based on HRP-BrAb was constructed by dispersing graphite, BrAg and paraffin wax at room temperature. In a competitive immunoassay procedure, the BrAb competed with HRP-BrAb to react with the immobilized BrAg. In the enzymatic reaction, the binding HRP-BrAb on the sensing body surface can catalyze the polymerization reaction of TBG by H2O2 forming fluorescent dimers and causing an increase in fluorescence intensity. TBG showed comparable ability for HRP detection and its enzyme-linked immunosensing reaction system, in a linear detection ranging of 3.5´10-8~7.6´10-6g/L and with a detection limit of 1.7´10-9 g/L. The immobilized biocomposite surface could be regenerated with excellent reproducibility (RSD=3.8% by simply polishing with an alumina paper. The proposed immunosensing system has been used to determine the BrAb in rabbit serum samples with satisfactory results.
Tandem malonate-based glucosides (TMGs) for membrane protein structural studies
DEFF Research Database (Denmark)
Hussain, Hazrat; Mortensen, Jonas S.; Du, Yang
2017-01-01
class of glucoside amphiphiles, designated tandem malonate-based glucosides (TMGs). A few TMG agents proved effective at both stabilizing a range of membrane proteins and extracting proteins from the membrane environment. These favourable characteristics, along with synthetic convenience, indicate...
Energy Technology Data Exchange (ETDEWEB)
Wright, A. von (Univ. of Eastern Finland, Kuopio (Finland). Dept. of Biosciences.), Email: atte.vonWright@uef.fi
2010-10-15
Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Wright, A. von (Univ. of Kuopio, Dept. of Biosciences (Finland)), email: atte.vonWright@uku.fi
2009-10-15
Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type 2 diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and its derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type 2 diabetes) highlighting results. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Wright, A. von (Kuopio Univ., Department of Biosciences (Finland))
2008-07-01
Plant polyphenolics have a wide range of bioactivities. Coniferous trees are a rich source of stilbenes, such as pinosylvin in the genus Pinus. Pinosylvin is structurally very similar to resveratrol, a stilbene found in grapes and red berries, and which is reported to have beneficial health effects such as prevention of cardiovascular diseases, tumourigenesis, and according to recent findings, also type II diabetes. In our previous studies the bioactivities of pinosylvin (antimicrobial effects and cytotoxic activities against cancer cells) were very similar to those of resveratrol. In this project we elucidate the potential of pinosylvin and as derivatives in food applications as multifunctional antimicrobial agents with positive health effects (including prevention of type II diabetes) highlighting results. (orig.)
Digital Data Processing of Stilbene
International Nuclear Information System (INIS)
AMIRI, Moslem; MATEJ, Zdenek; MRAVEC, Filip; PRENOSIL, Vaclav; CVACHOVEC, Frantisek
2013-06-01
Stilbene is a proven spectrometric detector for mixed fields of neutrons and gamma rays. By digital processing of shape output pulses from the detector it is possible to obtain information about the energy of the interacting neutron / photon and distinguish which of these two particles interacts in the detector. Another numerical processing of digital data can finalize the energy spectrum of both components of the mixed field. The quality of the digitized data is highly dependent on the parameters of the hardware used for digitization and on the quality of software processing. Our results also show how the quality of the particle type identification depends on the sampling rate and as well as the method of processing of the sampled data. (authors)
Iridoid Glucosides from Phlomis tuberosa L. and Phlomis herba-ventis L
DEFF Research Database (Denmark)
Alipieva, Kalina A.; Jensen, Søren Rosendal; Franzyk, Henrik
2000-01-01
A new iridoid glucoside, 5-deoxysesamoside, was isolated from Phlomis tuberosa together with three known iridoid glucosides sesamoside, shanzhiside methyl ester and lamalbid. Lamiide was found in Ph. herba-ventis ssp. pungens. in high concentrations....
Identification and quantification of stilbenes in some Tunisian red wines using UPLC-MS and HPLC-DAD
Directory of Open Access Journals (Sweden)
Kamel Arraki
2017-06-01
Full Text Available Seven Tunisian red wines mainly from the Mornag appellation were analyzed for resveratrol and analogues. The wines of each variety were evaporated, concentrated, and then subjected to fractionation and purification using XAD16 and DOWEX column chromatography. In addition to resveratrol, seven stilbenes were identified by UPLC-MS. The stilbenes derived were shown to be piceatannol, piceid, a-viniferin, e-viniferin, hopeaphenol and isohopeaphenol. From the point of view of the presence of resveratrol derivatives, one wine, Sidi Zahia, was the richest qualitatively.
Directory of Open Access Journals (Sweden)
Quentin Lefebvre
2013-09-01
Full Text Available A continuous flow oxidative photocyclization of stilbene derivatives has been developed which allows the scalable synthesis of backbone functionalized phenanthrenes and helicenes of various sizes in good yields.
Further iridoid glucosides in the genus Manulea (Scrophulariaceae)
DEFF Research Database (Denmark)
Gousiadou, Chryssoula; Kokubun, Tetsuo; Gotfredsen, Charlotte Held
2015-01-01
From Manulea altissima (Scrophulariaceae) were isolated five known secoiridoid glucosides sweroside, eustomoside, eustoside, secoxyloganin and secologanoside as well as the 4″-O-rhamnopyranosyl-feruloyl ester of adoxosidic acid, named altissimoside. Also, the caffeoyl phenylethanoid glycoside...... verbascoside was isolated. In addition two previously unknown terpenoid esters of 6β-hydroxy 8-epi-boschnaloside, named manucoside A and B were isolated from a formerly obtained fraction from the work-up of Manulea corymbosa. The distribution of iridoid glucosides in the Scrophulariaceae is discussed....
Effect of Dietary Stilbenes on 5-Lipoxygenase and Cyclooxygenases Activities In Vitro
Czech Academy of Sciences Publication Activity Database
Kutil, Zsófia; Kvasnicová, Marie; Temml, V.; Schuster, D.; Maršík, Petr; Cusimamani, E.F.; Lou, J.D.; Vaněk, Tomáš; Landa, Přemysl
2015-01-01
Roč. 18, č. 7 (2015), s. 1471-1477 ISSN 1094-2912 R&D Projects: GA MŠk LH12164 Institutional support: RVO:61389030 Keywords : Dietary stilbenes * Cyclooxygenase inhibition * Docking Subject RIV: EI - Biotechnology ; Bionics Impact factor: 1.586, year: 2015
Recent Developments of C-Aryl Glucoside SGLT2 Inhibitors.
Zhang, Yang; Liu, Zhao-Peng
2016-01-01
Sodium-glucose cotransporter 2 (SGLT2) is almost exclusively expressed in the proximal renal tubules. It is responsible for about 90% of the glucose reabsorption from tubular fluid. Selective inhibition of SGLT2 is expected to favor in the normalization of plasma glucose levels in T2DM patients through the prevention of renal glucose reabsorption and the promotion of glucose excretion from urine. Selective SGLT2 inhibitors have the merits to minimize the gastrointestinal side effects associated with SGLT1 inhibition, and selective SGLT2 inhibition may have a low risk of hypoglycemia. Since the C-aryl glucosides are metabolically more stable than the O-glucosides, numerous efforts have been made in the development of potent and selective C-aryl glucoside SGLT2 inhibitors, and a number of them are now used as anti-diabetes drugs in clinic or at various stages of clinical developments. Based on their structural features, in this review, these SGLT2 inhibitors are classified as three types: the phenyl/arylmethylphenyl C-glucosides, with an emphasis on the modifications on the proximal and/or the distal phenyl ring, and the spacer; the heteroarylmethylphenyl Cglucosides, with a replacement of the distal phenyl ring by a heterocycle like pyridazine, pyrimidine, thiophene and benzothiophene, thiazole, 1,3,4-thiadiazole, and triazolopyridinone; and the glucose-modified Caryl glucosides, including the glucose C-1 derived O-spiroketals, C-4 gem-difluoro analogues, C-5 and C-6 modified derivatives, dioxa-bicyclo[3.2.1]octane bridged ketals, the thioglucosides, and carbasugars. The structure-activity relationships (SARs) of each type along with their inhibitory potency against human SGLT2 and selectivity over human SGLT1 are discussed.
Further iridoid glucosides in the genus Manulea (Scrophulariaceae).
Gousiadou, Chrysoula; Kokubun, Tetsuo; Gotfredsen, Charlotte H; Jensen, Søren R
2015-01-01
From Manulea altissima (Scrophulariaceae) were isolated five known secoiridoid glucosides sweroside, eustomoside, eustoside, secoxyloganin and secologanoside as well as the 4″-O-rhamnopyranosyl-feruloyl ester of adoxosidic acid, named altissimoside. Also, the caffeoyl phenylethanoid glycoside verbascoside was isolated. In addition two previously unknown terpenoid esters of 6β-hydroxy 8-epi-boschnaloside, named manucoside A and B were isolated from a formerly obtained fraction from the work-up of Manulea corymbosa. The distribution of iridoid glucosides in the Scrophulariaceae is discussed. Copyright © 2014 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Nataliya N. Makarova
2018-04-01
Full Text Available Oligo- and polycyclosiloxanes were obtained by the polycondensation of (tetrahydroxy(tetraarylcyclotetrasiloxanes in equilibrium and non-equilibrium conditions in the presence and absence of montmorillonite (MMT. Their composition and the structures of their components were investigated by infrared (IR spectroscopy, 29Si nuclear magnetic resonance (NMR spectroscopy, atmospheric pressure chemical ionization (APCI mass spectrometry, powder X-ray diffraction (XRD, and gel-penetrating chromatography (GPC. Also, a comparison of polymers formed in the presence of MMT and via anionic polymerization was performed showing differences in their structures.
Structural revision of some recently published iridoid glucosides.
Jensen, Søren R; Caliş, Ihsan; Gotfredsen, Charlotte H; Søtofte, Inger
2007-01-01
The structures of six different iridoid glucosides have been revised. Three compounds isolated from Eremostachys glabra and designated 6,9-epi-8-O-acetylshanziside (1), 5,9-epi-penstemoside (2), and 5,9-epi-7,8-didehydropenstemoside (3) have been shown to be identical to the known iridoids barlerin (4, 8-O-acetylshanziside), penstemoside (5), and 7,8-didehydropenstemoside (6), respectively. Another compound named harpagoside-B, isolated from Scrophularia deserti and proposed to be 9-epi-6-O-methylharpagoside (11), was demonstrated from the spectroscopic data given to be the known harpagoside (10b). Finally, two alleged iridoid galactosides from Buddleja crispa named buddlejosides A and B (12a and 12b) have been shown to be the corresponding glucosides; the former is identical to agnuside (13a), while the latter is 3,4-dihydroxybenzoylaucubin (13b), an iridoid glucoside not previously published. This clearly showed that care should be taken with the interpretation of NOEs involving bridgehead protons in iridoid structures because they can be capricious and lead to erroneous structural assignments.
Identification of Iridoid Glucoside Transporters in Catharanthus roseus
Larsen, Bo; Fuller, Victoria L.; Pollier, Jacob; Van Moerkercke, Alex; Schweizer, Fabian; Payne, Richard; Colinas, Maite; O’Connor, Sarah E.; Goossens, Alain; Halkier, Barbara A.
2017-01-01
Abstract Monoterpenoid indole alkaloids (MIAs) are plant defense compounds and high-value pharmaceuticals. Biosynthesis of the universal MIA precursor, secologanin, is organized between internal phloem-associated parenchyma (IPAP) and epidermis cells. Transporters for intercellular transport of proposed mobile pathway intermediates have remained elusive. Screening of an Arabidopsis thaliana transporter library expressed in Xenopus oocytes identified AtNPF2.9 as a putative iridoid glucoside importer. Eight orthologs were identified in Catharanthus roseus, of which three, CrNPF2.4, CrNPF2.5 and CrNPF2.6, were capable of transporting the iridoid glucosides 7-deoxyloganic acid, loganic acid, loganin and secologanin into oocytes. Based on enzyme expression data and transporter specificity, we propose that several enzymes of the biosynthetic pathway are present in both IPAP and epidermis cells, and that the three transporters are responsible for transporting not only loganic acid, as previously proposed, but multiple intermediates. Identification of the iridoid glucoside-transporting CrNPFs is an important step toward understanding the complex orchestration of the seco-iridioid pathway. PMID:28922750
Flavonoids and a neolignan glucoside from Guarea macrophylla (Meliaceae)
Pereira, Cristiane; Barreto Júnior, Cleber Bomfim; Kuster, Ricardo Machado; Simas, Naomi Kato; Sakuragui, Cassia Mônica; Porzel, Andrea; Wessjohann, Ludger
2012-01-01
This work describes the phytochemical study of the methanol extract obtained from leaves of Guarea macrophylla, leading to the isolation and identification of three flavonoid glycosides (quercetin 3-O-β-D-glucopyranoside, quercetin 3-O-b-D-galactopyranoside, kaempferol 7-O-β-D-glucopyranoside) and a neolignan glucoside, dehydrodiconiferyl alcohol-4-β-D-glucoside. All compounds were identified by a combination of spectroscopic methods (¹H, 1D, 2D NMR, 13C and UV), ESI-MS and com...
Holographic recording of surface relief gratings in stilbene azobenzene derivatives at 633 nm
International Nuclear Information System (INIS)
Ozols, A; Saharov, D; Kokars, V; Kampars, V; Maleckis, A; Mezinskis, G; Pludons, A
2010-01-01
Holographic recording in stilbene azobenzene derivatives by He-Ne 633 nm laser light has been experimentally studied. It was found that surface relief gratings (SRG) can be recorded by red light. Usually shorter wavelengths are used to induce the trans-cis photo-isomerization in organic materials. SRG with 2 μm period and an amplitude of 130 nm have been recorded with 0.88 W/cm 2 light in about 20 minutes in amorphous films of 3-(4-(bis(2-(trityloxy)ethyl)amino)phenyl)-2-(4-(2-bromo-4-nitrophenyl) diazenyl)phenyl)acrylonitrile spin-coated on glass substrates. Self-diffraction efficiency up to 17.4% and specific recording energy down to 114 J/(cm 2 %) were measured. The recorded SRG were stable as proved by subsequent AFM measurements. The photo-induced changes in absorption spectra did not reveal noticeable signs of trans-cis transformations. Rather, spectrally uniform bleaching of the films took place. We conclude that a photothermally stimulated photo-destruction of chromophores is responsible for the SRG recording. The recording of stable SRG in the stilbene azobenzene derivatives we studied is accompanied by the recording of relaxing volume-phase gratings due to the photo-orientation of chromophores by the linearly polarized recording light. It should also be noted that holographic recording efficiency in stilbene azobenzene derivatives exhibit an unusual non-monotonic sample storage-time dependence presumably caused by the peculiarities of structural relaxation of the films.
Varietal Distributions of Stilbenes in Grape Cane of Vitis vinifera L.
Czech Academy of Sciences Publication Activity Database
Soural, I.; Balík, J.; Vrchotová, Naděžda; Tříska, Jan
2017-01-01
Roč. 20, č. 1 (2017), s. 11-14 ISSN 1335-2563 R&D Projects: GA MŠk(CZ) LO1415; GA MŠk(CZ) LD14038 Institutional support: RVO:86652079 Keywords : Vitis vinifera L. * varieties * grape canes * stilbenes * distribution Subject RIV: EH - Ecology, Behaviour OBOR OECD: Environmental sciences (social aspects to be 5.7)
Digital pile-up rejection for plutonium experiments with solution-grown stilbene
Energy Technology Data Exchange (ETDEWEB)
Bourne, M.M., E-mail: mmbourne@umich.edu; Clarke, S.D., E-mail: clarkesd@umich.edu; Paff, M., E-mail: mpaff@umich.edu; DiFulvio, A., E-mail: difulvio@umich.edu; Norsworthy, M., E-mail: marknors@umich.edu; Pozzi, S.A., E-mail: pozzisa@umich.edu
2017-01-11
A solution-grown stilbene detector was used in several experiments with plutonium samples including plutonium oxide, mixed oxide, and plutonium metal samples. Neutrons from different reactions and plutonium isotopes are accompanied by numerous gamma rays especially by the 59-keV gamma ray of {sup 241}Am. Identifying neutrons correctly is important for nuclear nonproliferation applications and makes neutron/gamma discrimination and pile-up rejection necessary. Each experimental dataset is presented with and without pile-up filtering using a previously developed algorithm. The experiments were simulated using MCNPX-PoliMi, a Monte Carlo code designed to accurately model scintillation detector response. Collision output from MCNPX-PoliMi was processed using the specialized MPPost post-processing code to convert neutron energy depositions event-by-event into light pulses. The model was compared to experimental data after pulse-shape discrimination identified waveforms as gamma ray or neutron interactions. We show that the use of the digital pile-up rejection algorithm allows for accurate neutron counting with stilbene to within 2% even when not using lead shielding.
76 FR 19383 - Certain Stilbenic Optical Brightening Agents From China and Taiwan
2011-04-07
... Stilbenic Optical Brightening Agents From China and Taiwan AGENCY: United States International Trade... reasonable indication that an industry in the United States is materially injured or threatened with material injury, or the establishment of an industry in the United States is materially retarded, by reason of...
Czech Academy of Sciences Publication Activity Database
Li, S.; Zhang, D.; Yang, L.; Li, Y.; Zhu, X.; Kmoníčková, Eva; Zídek, Zdeněk
-, č. 452610 (2013), s. 1-6 ISSN 2090-9063 R&D Projects: GA MŠk(CZ) ME10116 Institutional support: RVO:68378041 Keywords : flavones * alternative medicine * stilbenes Subject RIV: FR - Pharmacology ; Medidal Chemistry
Hydrolysis of Toxic Natural Glucosides Catalyzed by Cyclodextrin Dicyanohydrins
DEFF Research Database (Denmark)
Bjerre, Jeannette; Nielsen, Erik Holm; Bols, Mikael
2008-01-01
, and an impressive rate increase of up to 7569 (kcat/kuncat) was found for the hydroxycoumarin glucoside substrate 4-MUGP. Good and moderate degrees of catalysis (kcat/kuncat) of up to 1259 were found for the natural glucosides phloridzin and skimmin. By using a newly developed catechol detection UV-assay, a weak...
77 FR 27079 - Certain Stilbenic Optical Brightening Agents From China and Taiwan
2012-05-08
... industry in the United States is materially injured by reason of imports from China and Taiwan of certain... Optical Brightening Agents From China and Taiwan Determinations On the basis of the record \\1\\ developed... that imports of certain stilbenic optical brightening agents from China and Taiwan were being sold at...
Akwabi-Ameyaw, Adwoa; Caravella, Justin A; Chen, Lihong; Creech, Katrina L; Deaton, David N; Madauss, Kevin P; Marr, Harry B; Miller, Aaron B; Navas, Frank; Parks, Derek J; Spearing, Paul K; Todd, Dan; Williams, Shawn P; Wisely, G Bruce
2011-10-15
To further explore the optimum placement of the acid moiety in conformationally constrained analogs of GW 4064 1a, a series of stilbene replacements were prepared. The benzothiophene 1f and the indole 1g display the optimal orientation of the carboxylate for enhanced FXR agonist potency. Copyright © 2011 Elsevier Ltd. All rights reserved.
Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L.
Directory of Open Access Journals (Sweden)
Ivo Soural
2015-04-01
Full Text Available Grape cane, leaves and grape marc are waste products from viticulture, which can be used to obtain secondary stilbene derivatives with high antioxidant value. The presented work compares several extraction methods: maceration at laboratory temperature, extraction at elevated temperature, fluidized-bed extraction, Soxhlet extraction, microwave-assisted extraction, and accelerated solvent extraction. To obtain trans-resveratrol, trans-ε-viniferin and r2-viniferin from grape cane of the V. vinifera variety Cabernet Moravia, various conditions were studied: different solvents, using powdered versus cut cane material, different extraction times, and one-step or multiple extractions. The largest concentrations found were 6030 ± 680 µg/g dry weight (d.w. for trans-resveratrol, 2260 ± 90 µg/g d.w. for trans-ε-viniferin, and 510 ± 40 µg/g d.w. for r2-viniferin. The highest amounts of stilbenes (8500 ± 1100 µg/g d.w. were obtained using accelerated solvent extraction in methanol.
Factors influencing the production of stilbenes by the knotweed, Reynoutria × bohemica
Czech Academy of Sciences Publication Activity Database
Kovářová, Marcela; Bartůňková, Kristýna; Frantík, Tomáš; Koblihová, Helena; Prchalová, K.; Vosátka, Miroslav
2010-01-01
Roč. 10, č. 19 (2010), s. 1-16 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : japanese knotweed * Reynoutria * stilbenes Subject RIV: EF - Botanics Impact factor: 4.085, year: 2010 http://www.biomedcentral.com/1471-2229/10/19
The evolution of plant chemical defence - new roles for hydroxynitrile glucosides in Lotus japonicus
DEFF Research Database (Denmark)
Knudsen, Camilla
Plants are sessile organisms well-known to produce a vast array of chemical compounds of which many are used in chemical defence against herbivores and pathogens. The biosynthesis of these plant chemical defence compounds poses a considerable risk of self-toxicity for the plant itself. Several...... on hydroxynitrile glucoside metabolism in the legume model plant Lotus japonicus. Lotus japonicus produces both cyanogenic and non-cyanogenic hydroxynitrile glucosides as chemical defence compounds. The cyanogenic glucosides linamarin and lotaustralin are stored in the cell vacuole as inactive glycosides and, upon...... function and evolution. Further, it contributes to our understanding of the formation and role of biosynthetic gene clusters in plant chemical defence. The bifurcation in hydroxynitrile glucoside biosynthesis and catabolism observed in Lotus japonicus makes it a very suitable model system to study...
Insect Counter-Adaptations to Plant Cyanogenic Glucosides
DEFF Research Database (Denmark)
Pentzold, Stefan
. This thesis presents evidence that larvae of the sequestering lepidopteran specialist Zygaena filipendulae have evolved diverse behavioural, morphological, physiological and metabolic adaptations to keep cyanogenic glucosides from its food plant Lotus corniculatus (Fabaceae) intact and thus non-toxic during...
Conversion of major soy isoflavone glucosides and aglycones in in vitro intestinal models
Islam, M.A.; Punt, A.; Spenkelink, A.; Murk, A.J.; Leeuwen, F.X.R.; Rietjens, I.
2014-01-01
ScopeThis study compares conversion of three major soy isoflavone glucosides and their aglycones in a series of in vitro intestinal models. Methods and resultsIn an in vitro human digestion model isoflavone glucosides were not deconjugated, whereas studies in a Caco-2 transwell model confirmed that
Iridoid glucosides of Paederota bonarota and the relationships between Paederota and Veronica. II
DEFF Research Database (Denmark)
Jensen, Søren Rosendal; Gotfredsen, Charlotte Held; Pierce, Simon
2007-01-01
In a chemical investigation of the water soluble compounds in Paederota bonarota five known iridoid glucosides were isolated together with a compound with an 8,9-double bond, namely bonarotoside (10-O-benzoyl arborescosidic acid). The known iridoid glucosides were aucubin, catalpol and the 6-O-es...
International Nuclear Information System (INIS)
Guray, Tufan; Uysal, Uelkue Dilek; Gedikbey, Tevfik; Huseyinli, A. Ali
2005-01-01
A selective and sensitive new spectrophotometric method has been developed for the determination of aluminium. 2,2',3,4-Tetrahydroxy-3'-sulpho-5'-nitroazobenzene (tetrahydroxyazon SN) formed an orange chelate with aluminium at pH 4. Molar absorptivity of the complex in 1:2 is 5.46 x 10 4 l mol -1 cm -1 at 479 nm. The method obeys Beer's law in the range of 0.005-1.079 μg ml -1 . The determination of aluminium is not interfered with by earth alkaline, alkaline elements, rare earth elements, halides, phosphates, sulphates, urea, ascorbic acid, Sn 2+ , Sr 2+ , Cr 3+ , Cd 2+ , Hg 2+ , or Mn 2+ . The proposed method is rapid and simple, and it has been successfully applied to the determination of aluminium in certified pharmaceutical suspension and granite
Energy Technology Data Exchange (ETDEWEB)
Lobo, Livia T.; Silva, Geilson A. da; Freitas, Manolo C.C. de; Silva, Milton N. da; Arruda, Alberto C.; Guilhon, Giselle M.S.P.; Santos, Lourivaldo S.; Santos, Alberdan S.; Arruda, Mara S.P., E-mail: mspa@ufpa.b [Universidade Federal do Para (UFPA), Belem, PA (Brazil). Inst. de Ciencias Exatas e Naturais. Programa de Pos-Graduacao em Quimica; Souza Filho, Antonio Pedro S. [Centro de Pesquisa Agroflorestal da Amazonia Oriental (CPATU), Belem, PA (Brazil)
2010-07-01
The Amazon biodiversity may provide plants whose chemical substances are capable of controlling weeds. In this study we report the isolation and identification of five stilbenes from the leaves of 'timbo vermelho' (Deguelia rufescens var. urucu): 4-methoxylonchocarpene (1); 3,5-dimethoxy-4'-hydroxy-3'-prenyl-trans-stilbene (2), lonchocarpene (3), 3,5-dimethoxy-4'-Oprenyl- trans-stilbene (4) and pterostilbene (5). Compounds 2 and 4 are new natural products although 2 has been previously cited as synthesis product. Potential allelopathic activity for 1, 2 and 4 was evaluated over seed germination and plant growth of Mimosa pudica weed. The observed effects on seed germination did not vary significantly (p > 0.05) when the analysis of phytotoxicity was performed with the substances alone, the maximum inhibition did not exceed 20%. The most intense inhibitions on radicle and hypocotyl development were found for compound 4 (p < 0.05). When tested in pairs, showed antagonism for seed germination and synergism for radicle and hypocotyl development. (author)
International Nuclear Information System (INIS)
Shani, G.; Cojocaru, M.
1977-01-01
A method for measurement of low level alpha particles in high level gamma background is investigated. Because of its pulse-shape-discrimination properties and being a solid scintillator, trans-stilbene seems to be the proper scintillator, for this purpose. The investigation was done by measuring the effect of different gamma background level (from very low to very high) on constant alpha count rate. Two different pulse-shape-discrimination systems were used and compared. The Ortec system measures the pulse fall time and supplies a corresponding pulse height and the Elscint system checks whether the pulse is what is expected to be the gamma pulse, or is a longer pulse. Both systems yielded good results and were found to be adequate for alpha-gamma separation with trans-stilbene. (Auth.)
Various Extraction Methods for Obtaining Stilbenes from Grape Cane of Vitis vinifera L
Czech Academy of Sciences Publication Activity Database
Soural, I.; Vrchotová, Naděžda; Tříska, Jan; Balík, J.; Horník, Štěpán; Cuřínová, Petra; Sýkora, Jan
2015-01-01
Roč. 20, č. 4 (2015), s. 6093-6112 ISSN 1420-3049 R&D Projects: GA MŠk(CZ) LD14038 Institutional support: RVO:67179843 ; RVO:67985858 Keywords : Vitis vinifera L * grape cane * stilbenes * accelerated solvent extraction ( ASE ) * microwave-assisted extraction (MAE) * LC-MS Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.465, year: 2015
Dopico-García, M S; Fique, A; Guerra, L; Afonso, J M; Pereira, O; Valentão, P; Andrade, P B; Seabra, R M
2008-06-15
Phenolic profile of 10 different varieties of red "Vinho Verde" grapes (Azal Tinto, Borraçal, Brancelho, Doçal, Espadeiro, Padeiro de Basto, Pedral, Rabo de ovelha, Verdelho and Vinhão), from Minho (Portugal) were studied. Nine Flavonols, four phenolic acids, three flavan-3-ols, one stilben and eight anthocyanins were determined. Malvidin-3-O-glucoside was the most abundant anthocyanin while the main non-coloured compound was much more heterogeneous: catechin, epicatechin, myricetin-3-O-glucoside, quercetin-3-O-glucoside or syringetin-3-O-glucoside. Anthocyanin contents ranged from 42 to 97%. Principal component analysis (PCA) was applied to analyse the date and study the relations between the samples and their phenolic profiles. Anthocyanin profile proved to be a good marker to characterize the varieties even considering different origin and harvest. "Vinhão" grapes showed anthocyanins levels until twenty four times higher than the rest of the samples, with 97% of these compounds.
Bioconversion of apigenin-7-O-β-glucoside in aqueous two-phase system
Directory of Open Access Journals (Sweden)
Ilić Sanja M.
2005-01-01
Full Text Available The study is concerned with the conversion of apigenin-7-O-β-glucoside into apigenin in polyethylene glycol 6000 / dextran 20000 aqueous two-phase system by β-glucosidase. Apigenin was separated from apigenin-7-O-β-glucoside and β-glucosidase by their partition into opposite phases. In 14% PEG / 22.5% DEX aqueous two-phase system obtained yield of apigenin in top phase was 108%.
Stability of DON and DON-3-glucoside during baking as affected by the presence of food additives.
Vidal, Arnau; Sanchis, Vicente; Ramos, Antonio J; Marín, Sonia
2018-03-01
The mycotoxin deoxynivalenol (DON) is one of the most common mycotoxins of cereals worldwide, and its occurrence has been widely reported in raw wheat. The free mycotoxin form is not the only route of exposure; modified forms can also be present in cereal products. Deoxynivalenol-3-glucoside (DON-3-glucoside) is a common DON plant conjugate. The mycotoxin concentration could be affected by food processing; here, we studied the stability of DON and DON-3-glucoside during baking of small doughs made from white wheat flour and other ingredients. A range of common food additives and ingredients were added to assess possible interference: ascorbic acid (E300), citric acid (E330), sorbic acid (E200), calcium propionate (E282), lecithin (E322), diacetyltartaric acid esters of fatty acid mono- and diglycerides (E472a), calcium phosphate (E341), disodium diphosphate (E450i), xanthan gum (E415), polydextrose (E1200), sorbitol (E420i), sodium bicarbonate (E500i), wheat gluten and malt flour. The DON content was reduced by 40%, and the DON-3-glucoside concentration increased by >100%, after baking for 20 min at 180°C. This confirmed that DON and DON-3-glucoside concentrations can vary during heating, and DON-3-glucoside could even increase after baking. However, DON and DON-3-glucoside are not affected significantly by the presence of the food additives tested.
Ko, Eun Young; Nile, Shivraj Hariram; Sharma, Kavita; Li, Guan Hao; Park, Se Won
2014-01-01
Quercetin and quercetin glucosides are the major flavonols present in onion (Allium cepa L.) and are predominantly present as quercetin, quercetin-3,4′-diglucoside and quercetin-4′-glucoside. Effect of different light wavelengths on onion after harvest and storage, with fluorescent, blue, red and ultra violet light influenced the quercetin and quercetin glucosides profile. In a peeled onion, all the light treatments elevated quercetin content in bulb. Among them, particularly fluorescent ligh...
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Zhang, Na; Quan, Zheng-Jun; Zhang, Zhang; Da, Yu-Xia; Wang, Xi-Cun
2016-12-06
The straightforward visible-light-induced synthesis of stilbene compounds via the cross-coupling of nitroalkenes and diazonium tetrafluoroborates under transition-metal-free conditions is described. The protocol uses green LEDs as light sources and eosin Y as an organophotoredox catalyst. Broad substrate scope and exclusive selectivity for the (E)-configuration of stilbenes are observed. This protocol proceeds via a radical pathway, with nitroalkenes serving as the radical acceptor, and the nitro group is cleaved during the process.
Novel glyceryl glucoside is a low toxic alternative for cryopreservation agent
Energy Technology Data Exchange (ETDEWEB)
Su, Cathy; Allum, Allison J. [Department of Environmental & Radiological Health Sciences, Colorado State University, 1618 Campus Delivery, Fort Collins, CO 80523 (United States); Aizawa, Yasushi [Research and Development Group, Toyo Sugar Refining Co. Ltd., Tokyo 103-0046 (Japan); Kato, Takamitsu A., E-mail: Takamitsu.Kato@Colostate.edu [Department of Environmental & Radiological Health Sciences, Colorado State University, 1618 Campus Delivery, Fort Collins, CO 80523 (United States)
2016-08-05
Glyceryl glucoside (GG, α-D-glucosyglycerol) is a natural glycerol derivative found in alcoholic drinks. Recently GG has been used as an alternative for glycerol in cosmetic products. However, the safety of using GG is still unclear. Currently, dimethyl sulfoxide (DMSO) and glycerol are wildly used in cryopreservation. Despite GG being a derivative of glycerol, the ability of GG in cryopreservation is still unknown. By using a system of Chinese Hamster Ovary cells (CHO), A549 cells and AG1522 cells, the study examined the cryoprotective effects of DMSO, glycerol and GG. Cytotoxic and genotoxic responses induced by the three chemicals were also investigated with CHO to determine the safety of GG for cosmetic products. Our data suggests that GG has great cryopresearvation ability in the concentration of 30%–40% (v/v). For cytotoxic studies, DMSO showed the highest cytotoxicity above 3% (v/v) in cell doubling time delay among three chemicals. For the acute cytotoxicity with trypan blue dye exclusion assay, GG showed stronger cell killing effect within 24 h above 4% (v/v). For the continuous cytotoxicity with colony formation assay for 7 days, DMSO showed significantly reduced clonogenic ability above 2%. In genotoxicity studies, CHO treated with glycerol at 2% concentration induced three times higher frequencies of sister chromatid exchange (SCE) than background levels. GG did not induce significant amounts of SCE compared to background. Micronuclei formation was equally observed in the 2% and above concentrations of glycerol and GG. Our data showed that GG has significant effects on cryopreservation compared to DMSO. Glycerol and GG have similar cytotoxicity effects to CHO, but glycerol induced genotoxic responses in the same concentration. Therefore, we conclude that GG may be a safer alternative compound to glycerol in cosmetic products and safer alternative to DMSO in cryopreservation. -- Highlights: •Glyceryl Glucoside is low cytotoxicity and genotoxicity
Nakano, Takahiro; Sugimoto, Sachiko; Matsunami, Katsuyoshi; Otsuka, Hideaki
2011-01-01
From aerial parts of Dianthus japonicus, six new and seven known oleanane-type triterpene saponins were isolated. The structures of the new saponins, named dianthosaponins A-F, were elucidated by means of high resolution mass spectrometry, and extensive inspection of one- and two-dimensional NMR spectroscopic data. A new C-glycosyl flavone, a glycosidic derivative of anthranilic acid amide and a maltol glucoside were also isolated.
Guillois, Kevin
2013-03-01
The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.
Guillois, Kevin; Mangematin, Sté phane; Tuel, Alain; Caps, Valerie
2013-01-01
The gold-catalyzed aerobic oxidations of alkenes are thought to rely on the in situ synthesis of hydroperoxide species, which have however never been clearly identified. Here, we show direct experimental evidence for the presence of 1-methylcyclohexyl hydroperoxide in the aerobic co-oxidation of stilbene and methylcyclohexane catalyzed by the Au/SiO2-R972 optimized catalyst prepared in Part I. Determination of its response in gas chromatography, by triphenylphosphine titration followed by 31P NMR, allows to easily follow its concentration throughout the co-oxidation process and to clearly highlight the simultaneous existence of the methylcyclohexane autoxidation pathway and the stilbene epoxidation pathway. © 2012 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
von Poser, Gilsane Lino; Henriques, Amélia T.; Schripsema, Jan
1996-01-01
In this work we report the isolation of iridoid glucosides from two species of Scrophulariaceae. From the aerial parts of Scoparia ericacea geniposidic acid, geniposide, scandoside methylester, shanzhiside methylester, caryoptoside and the phenylpropanoid glucoside verbascoside were isolated...
International Nuclear Information System (INIS)
Püttner, Ralph; Schmidt-Weber, Philipp; Kampen, Thorsten; Kolczewski, Christine; Hermann, Klaus; Horn, Karsten
2017-01-01
Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.
Energy Technology Data Exchange (ETDEWEB)
Püttner, Ralph [Department of Physics, Freie Universität Berlin, 14195 Berlin (Germany); Schmidt-Weber, Philipp [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Kampen, Thorsten [SPECS Surface Nano Analysis GmbH, 13355 Berlin (Germany); Kolczewski, Christine [Deutsches Museum München, 80538 Munich (Germany); Hermann, Klaus [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany); Horn, Karsten, E-mail: horn@fhi-berlin.mpg.de [Fritz Haber Institute of the Max Planck Society, 14195 Berlin (Germany)
2017-02-15
Highlights: • NEXAFS spectra of the cis- and trans-isomer of stilbene reveal distinct differences by which the isomers can be distinguished. • DFT calculations using the transition potential approach assign specific transitions that are different in the two isomers. • On Si(100), these differences in NEXAFS are also observed, suggesting that their conformations survive in the bonding situation. • NEXAFS is thus shown to be a sensitive tool to distinguish isomers in adsorbed species. - Abstract: Near-edge x-ray absorption fine structure spectra of the cis- and trans-isomers of stilbene in the gas phase reveal clear differences, which are analyzed by results from density-functional theory calculations using the transition potential approach. The differences between the two species also occur in stilbene adsorbed on Si(100), opening the way towards studying structural changes in molecules in different surface environments, and configurational switching in organic molecules on surfaces in particular.
Synthesis of monoterpene piperidines from the iridoid glucoside antirrhinoside
DEFF Research Database (Denmark)
Franzyk, Henrik; Frederiksen, Signe Maria; Jensen, Søren Rosendal
1997-01-01
Synthesis of five novel piperidine monoterpene alkaloids using the iridoid glucoside antirrhinoside as a synthon is described. Two strategies for their preparation were investigated: the first possible pathway involved an intermediate diol from which the piperidine ring was expected to be constru......Synthesis of five novel piperidine monoterpene alkaloids using the iridoid glucoside antirrhinoside as a synthon is described. Two strategies for their preparation were investigated: the first possible pathway involved an intermediate diol from which the piperidine ring was expected...... to be constructed via reaction of its ditosylate with an amine; the second strategy involved a double reductive amination as the key step to the piperidine ring, which proved successful. The stereochemistry of C-5 and C-9 in the obtained piperidine monoterpenes was the same as that reported for alfa...
Cytogenetic activity of the coumarin glucoside seseloside
International Nuclear Information System (INIS)
Arshava, E.A.
1986-01-01
The cytogenetic effect of the coumarin glucoside seseloside on plant objects was studied. It was established that low concentrations of the preparation (from 1 x 10 -5 to 1 x 10 -3 μg/ml) inhibit both spontaneous and radiation-induced mutagenesis. The effect of high concentrations (10 and 100 μg/ml) causes a mutagenic effect
Iridoid glucosides from the aerial parts of Globularia alypum L. (Globulariaceae).
Es-Safi, Nour-Eddine; Khlifi, Samira; Kollmann, Albert; Kerhoas, Lucien; El Abbouyi, Ahmed; Ducrot, Paul-Henri
2006-01-01
From the hydromethanolic extract of the aerial parts of Globularia alypum grown in Morocco, a new chlorinated iridoid glucoside, globularioside has been isolated beside 5 known iridoid glycosides, globularin, globularicisin, globularidin, globularinin and globularimin. This is the first report of a chlorinated iridoid in G. alypum and in the Globulareaceae. Unlike all other known 7-chlorinated iridoid glucosides where the chlorine atom exhibits an alpha configuration, globularioside incorporate the chlorine atom as a 7beta substituent. The structures of the isolated compounds were established on the basis of ESI-MS, MS-MS, 1D and 2D NMR spectral analysis.
Sesquiterpene lactones and monoterpene glucosides from plant species Picris echoides
Directory of Open Access Journals (Sweden)
MILUTIN STEFANOVIC
2000-11-01
Full Text Available Investigation of the constituents of the aerial parts of domestic plant species Picris echoides afforded the sesquiterpene lactones, i.e., guaianolides jacquilenin (1, 11-epi-jacquilenin (2, achillin (3 and eudesmanolide telekin (4. The chemical indentification of the two monoterpene glucosides (-cis-chrysanthenol-b-D-glucopyranoside (5 and its 6-acetate 6 is also repoted. The guaianolide achillin (3 and the two monoterpene glucosides 5 and 6 were isolated for the first time from this plant species. Isolation was achieved by column chromatography and the structures were established mainly by the interpretation of their physical and spectral data, which were in agreement with those in the literature.
DEFF Research Database (Denmark)
Knoch, Eva; Motawie, Mohammed Saddik; Olsen, Carl Erik
2016-01-01
Barley (Hordeum vulgare L.) produces five leucine-derived hydroxynitrile glucosides (HNGs), of which only epiheterodendrin is a cyanogenic glucoside. The four non-cyanogenic HNGs are the β-HNG epidermin and the γ-HNGs osmaronin, dihydroosmaronin and sutherlandin. By analyzing 247 spring barley...
Total Glucosides of Paeonia lactiflora Pall Suppress Nitric Oxide ...
African Journals Online (AJOL)
iNOS) expression and ... Keywords: Total glucosides, Paeonia lactiflora, Nitric oxide, iNOs, Nuclear factor-κB. Tropical Journal of Pharmaceutical Research ... Nuclear factor (NF)-κB is the key transcriptional factor regulating iNOS gene transcription.
Zagrobelny, Mika; Olsen, Carl Erik; Pentzold, Stefan; Fürstenberg-Hägg, Joel; Jørgensen, Kirsten; Bak, Søren; Møller, Birger Lindberg; Motawia, Mohammed Saddik
2014-01-01
Considering the staggering diversity of bioactive natural products present in plants, insects are only able to sequester a small number of phytochemicals from their food plants. The mechanisms of how only some phytochemicals are sequestered and how the sequestration process takes place remains largely unknown. In this study the model system of Zygaena filipendulae (Lepidoptera) and their food plant Lotus corniculatus is used to advance the knowledge of insect sequestration. Z. filipendulae larvae are dependent on sequestration of the cyanogenic glucosides linamarin and lotaustralin from their food plant, and have a much lower fitness if reared on plants without these compounds. This study investigates the fate of the cyanogenic glucosides during ingestion, sequestration in the larvae, and in the course of insect ontogeny. To this purpose, double-labeled linamarin and lotaustralin were chemically synthesized carrying two stable isotopes, a (2)H labeled aglucone and a (13)C labeled glucose moiety. In addition, a small amount of (14)C was incorporated into the glucose residue. The isotope-labeled compounds were applied onto cyanogenic L. corniculatus leaves that were subsequently presented to the Z. filipendulae larvae. Following ingestion by the larvae, the destiny of the isotope labeled cyanogenic glucosides was monitored in different tissues of larvae and adults at selected time points, using radio-TLC and LC-MS analyses. It was shown that sequestered compounds are taken up intact, contrary to earlier hypotheses where it was suggested that the compounds would have to be hydrolyzed before transport across the gut. The uptake from the larval gut was highly stereo selective as the β-glucosides were retained while the α-glucosides were excreted and recovered in the frass. Sequestered compounds were rapidly distributed into all analyzed tissues of the larval body, partly retained throughout metamorphosis and transferred into the adult insect where they were
Ko, Eun Young; Nile, Shivraj Hariram; Sharma, Kavita; Li, Guan Hao; Park, Se Won
2015-07-01
Quercetin and quercetin glucosides are the major flavonols present in onion (Allium cepa L.) and are predominantly present as quercetin, quercetin-3,4'-diglucoside and quercetin-4'-glucoside. Effect of different light wavelengths on onion after harvest and storage, with fluorescent, blue, red and ultra violet light influenced the quercetin and quercetin glucosides profile. In a peeled onion, all the light treatments elevated quercetin content in bulb. Among them, particularly fluorescent light effect was more eminent which stimulates the maximum synthesis of quercetin in onion. In case of whole onion bulb, skin and pulp showed different responses to light treatment, respectively. The pulp had the highest quercetin glucosides under blue light, whereas the lowest under fluorescent light. Onion skin showed nearly opposite pattern as compared to the pulp. In particular, light treatment proved to be a better way to increase the level of quercetin content in onions which might be utilized for industrial production of bioactive compounds from onion and onion waste products.
International Nuclear Information System (INIS)
Izazi Azzahidah Amin; Mohd Ambar Yarmo; Nik Idris Nik Yusoff
2013-01-01
The purpose of this study is to synthesis alkylpoly glucoside via condensation of decanol with dextrose in the presence of heterogenous catalyst. In this study, silicotungstic acid sol-gel (STSG) prepared using sol-gel was used as solid acid catalyst. The catalyst was characterized using BET surface area measurement, X-ray Diffraction (XRD) and X-ray Photoelectron Spectroscopy (XPS) surface analysis. The final product was easy to be separated from catalyst without the need of a further neutralization. Silicotungstic acid sol-gel has been found efficient to be solid catalyst for synthesis alkylpoly glucosides. Condensation reaction was carried out 8 hours at 110-120 degree Celsius under vacuum condition at 10 mmHg. The determination of decyl glucoside has been achieved by LC/ ESI-MS/ MS (ToF) giving a mass peak at m/z = 343.2 correspond to the m/z of [M+Na] + . Alkylpoly glucoside produced was analysed by FTIR, 1 H and 13 C NMR spectrometric technique. (author)
Directory of Open Access Journals (Sweden)
Wolfgang Streicher
Full Text Available BACKGROUND: Advanced castration resistant prostate cancer (CRPC is often characterized by an increase of C-terminally truncated, constitutively active androgen receptor (AR variants. Due to the absence of a ligand binding domain located in the AR-C-terminus, these receptor variants (also termed ARΔLBD are unable to respond to all classical forms of endocrine treatments like surgical/chemical castration and/or application of anti-androgens. METHODOLOGY: In this study we tested the effects of the naturally occurring stilbene resveratrol (RSV and (E-4-(2, 6-Difluorostyryl-N, N-dimethylaniline, a fluorinated dialkylaminostilbene (FIDAS on AR- and ARΔLBD in prostate cancer cells. The ability of the compounds to modulate transcriptional activity of AR and the ARΔLBD-variant Q640X was shown by reporter gene assays. Expression of endogenous AR and ARΔLBD mRNA and protein levels were determined by qRT-PCR and Western Blot. Nuclear translocation of AR-molecules was analyzed by fluorescence microscopy. AR and ARΔLBD/Q640X homo-/heterodimer formation was assessed by mammalian two hybrid assays. Biological activity of both compounds in vivo was demonstrated using a chick chorioallantoic membrane xenograft assay. RESULTS: The stilbenes RSV and FIDAS were able to significantly diminish AR and Q640X-signalling. Successful inhibition of the Q640X suggests that RSV and FIDAS are not interfering with the AR-ligand binding domain like all currently available anti-hormonal drugs. Repression of AR and Q640X-signalling by RSV and FIDAS in prostate cancer cells was caused by an inhibition of the AR and/or Q640X-dimerization. Although systemic bioavailability of both stilbenes is very low, both compounds were also able to downregulate tumor growth and AR-signalling in vivo. CONCLUSION: RSV and FIDAS are able to inhibit the dimerization of AR and ARΔLBD molecules suggesting that stilbenes might serve as lead compounds for a novel generation of AR-inhibitors.
Glucosides from Vitex agnus-castus.
Kuruüzüm-Uz, Ayşe; Ströch, Karsten; Demirezer, L Omür; Zeeck, Axel
2003-08-01
The methanolic extract of the flowering stems of Vitex agnus-castus yielded three new iridoids: 6'-O-foliamenthoylmussaenosidic acid (agnucastoside A), 6'-O-(6,7-dihydrofoliamenthoyl)mussaenosidic acid (agnucastoside B) and 7-O-trans-p-coumaroyl-6'-O-trans-caffeoyl-8-epiloganic acid (agnucastoside C) in addition to four known iridoids (aucubin, agnuside, mussaenosidic acid and 6'-O-p-hydroxybenzoylmussaenosidic acid) and one known phenylbutanone glucoside (myzodendrone). The structure elucidations were mainly done by spectroscopic methods (1D and 2D NMR spectra) and MS data interpretation. The purified compounds were tested for biological activities against various microorganisms and cancer cell lines.
Energy Technology Data Exchange (ETDEWEB)
Hecht, S.S.; Chen, M.L.; Yagi, H.; Jerina, D.M.; Carmella, S.G. [University of Minnesota, Minneapolis, MN (United States)
2003-12-01
Carcinogen metabolite phenotyping is proposed as a more reliable way to determinethe role of host metabolism in PAH-related cancer. Phenanthrene,is the simplest PAH with a bay region and is metabolized to diol epoxides by the same enzymes and with the same stereochemistry as the prototypic carcinogenic PAH, benzo(a)pyrene. The major end product of this metabolic activation pathway is r-1,t-2,3,c-4-tetrahydroxy-1,2,3,4-tetrahydrophenanthrene (trans, anti-PheT). We have developed a method for the analysis of trans, anti-PheT in human urine. r-1,t-2,4,c-3,-tetrahydroxy-1,2,3,4-tetrahydrophenanthrene (trans,syn-PheT) was used as internal standard. After hydrolysis by beta-glucuronidase and sulfatase, solid phase extraction, and high-performance liquid chromatography collection, the sample was silylated and analyzed by gas chromatography-negative ion chemical ionization-mass spectrometry-selected ion monitoring. Thechromatograms were clean and trans, anti-PheT was detected in all human urine samples. Levels of trans, anti-PheT were 791 {+-} 363 pmol/mg creatinine (n = 20) in psoriasis patients treated with a PAH-containing ointment, 25.7 {+-} 16.8 pmol/mg creatinine (n = 32) in coke oven workers exposed to PAH, 4.58 {+-} 2.95 pmol/mg creatinine (n = 31) in smokers, and 1.51 {+-} 1.15 pmol/mg creatinine (n = 30) in nonsmokers. Levels of trans, anti-PheT correlated with levels of 1-hydroxypyrene in the urine of coke oven workers, smokers, and nonsmokers. Trans, anti-PheT appears to be an excellent biomarker of PAH uptake. Levels of trans, anti-PheT were 8,000-19,000 times higher than those can be detected in human urine.
Synthesis of radio-labeled caffeyl alcohol- and 5-hydroxyconiferyl alcohol-4-O-β-D-glucosides
International Nuclear Information System (INIS)
Matsui, Naoyuki; Fukushima, Kazuhiko; Terashima, Noritsugu; Yasuda, Seiichi
1996-01-01
Syntheses of caffeyl alcohol-4-O-β-D-glucoside and 5-hydroxyconiferyl alcohol-4-O-β-D-glucoside were achieved with radio-labeling with 14 C at the glucose residue and with 3 H at the side chain γ-position of aglycon. The treatment of these compounds with commercially available β-glucosidase gave the corresponding aglycons, caffeyl alcohol, and 5-hydroxyconiferyl alcohol. (author)
The integrated enzymatic production and downstream processing of glucosides
Roode, de B.M.
2001-01-01
Glucosides are of commercial interest for the industry in general and for the pharmaceutical and food industry in particular. Chemical preparation of glycosides is not applicable in the food industry, and therefore an enzyme-catalyzed reaction would be an alternative. However, until now the
The presence of tyrosine glucoside in the haemolymph of lepidopteran insects
International Nuclear Information System (INIS)
Ishizaki, Yumi; Umebachi, Yoshishige
1980-01-01
A ninhydrin-positive substance from the haemolymph of Papilio xuthus was purified and identified as β-glucosyl-O-tyrosine by (1) color reactions, (2) incorporation of 14 C-tyrosine, (3) identification and estimation of hydrolysis products, (4) α- and β-glucosidase tests, and (5) UV-spectrum. The concentration of the tyrosine glucoside in haemolymph reaches a maximum at the prepupal stage, then decreases, and is on a low level during the middle stage of pupa. At the late pupal stage, the level again rises and is kept high before emergence. After emergence, it rapidly decreases. The same tyrosine glucoside has proved to be also present in the haemolymph of twelve other species of Lepidoptera. (author)
Oliveira, Joana; Petrov, Vesselin; Parola, A Jorge; Pina, Fernando; Azevedo, Joana; Teixeira, Natércia; Brás, Natércia F; Fernandes, Pedro A; Mateus, Nuno; Ramos, Maria João; de Freitas, Victor
2011-02-17
In the present work, the proton-transfer reactions of the methylpyranomalvidin-3-O-glucoside pigment in water with different pH values was studied by NMR and UV-visible spectroscopies. The results showed four equilibrium forms: the methylpyranomalvidin-3-O-glucoside cation, the neutral quinoidal base, the respective anionic quinoidal base, and a dianionic base unprotonated at the methyl group. According to the NMR data, it seems that for methylpyranomalvidin-3-O-glucoside besides the acid-base equilibrium between the pyranoflavylium cation and the neutral quinoidal base, a new species is formed at pD 4.88-6.10. This is corroborated by the appearance of a new set of signals in the NMR spectrum that may be assigned to the formation of hemiketal/cis-chalcone species to a small extent. The two ionization constants (pK(a1) and pK(a2)) obtained by both methods (NMR and UV-visible) for methylpyranomalvidin-3-O-glucoside are in agreement (pK(a1) = 5.17 ± 0.03; pK(a2) = 8.85 ± 0.08; and pK(a1) = 4.57 ± 0.07; pK(a2) = 8.23 ± 0.04 obtained by NMR and UV-visible spectroscopies, respectively). Moreover, the fully dianionic unprotonated form (at the methyl group) of the methylpyranomalvidin-3-O-glucoside is converted slowly into a new structure that displays a yellow color at basic pH. On the basis of the results obtained through LC-MS and NMR, the proposed structure was found to correspond to the flavonol syringetin-3-glucoside.
Energy Technology Data Exchange (ETDEWEB)
Brown, J. A.; Goldblum, B. L., E-mail: bethany@nuc.berkeley.edu; Brickner, N. M.; Daub, B. H.; Kaufman, G. S.; Bibber, K. van; Vujic, J. [Department of Nuclear Engineering, University of California, Berkeley, California 94720 (United States); Bernstein, L. A.; Bleuel, D. L.; Caggiano, J. A.; Hatarik, R.; Phillips, T. W.; Zaitseva, N. P. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Wender, S. A. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)
2014-05-21
The neutron time-of-flight (nTOF) diagnostics used to characterize implosions at the National Ignition Facility (NIF) has necessitated the development of novel scintillators that exhibit a rapid temporal response and high light yield. One such material, a bibenzyl-stilbene mixed single-crystal organic scintillator grown in a 99.5:0.5 ratio in solution, has become the standard scintillator used for nTOF diagnostics at NIF. The prompt fluorescence lifetime and relative light yield as a function of proton energy were determined to calibrate this material as a neutron detector. The temporal evolution of the intensity of the prompt fluorescent response was modeled using first-order reaction kinetics and the prompt fluorescence decay constant was determined to be 2.46 ± 0.01 (fit) ± 0.13 (systematic) ns. The relative response of the bibenzyl-stilbene mixed crystal generated by recoiling protons was measured, and results were analyzed using Birks' relation to quantify the non-radiative quenching of excitation energy in the scintillator.
Directory of Open Access Journals (Sweden)
Li-Li Sun
2018-01-01
Full Text Available Polygoni Multiflori Radix (PMR is increasingly being used not just as a traditional herbal medicine but also as a popular functional food. In this study, multivariate chemometric methods and mass spectrometry were combined to analyze the ultra-high-performance liquid chromatograph (UPLC fingerprints of PMR from six different geographical origins. A chemometric strategy based on multivariate curve resolution–alternating least squares (MCR–ALS and three classification methods is proposed to analyze the UPLC fingerprints obtained. Common chromatographic problems, including the background contribution, baseline contribution, and peak overlap, were handled by the established MCR–ALS model. A total of 22 components were resolved. Moreover, relative species concentrations were obtained from the MCR–ALS model, which was used for multivariate classification analysis. Principal component analysis (PCA and Ward's method have been applied to classify 72 PMR samples from six different geographical regions. The PCA score plot showed that the PMR samples fell into four clusters, which related to the geographical location and climate of the source areas. The results were then corroborated by Ward's method. In addition, according to the variance-weighted distance between cluster centers obtained from Ward's method, five components were identified as the most significant variables (chemical markers for cluster discrimination. A counter-propagation artificial neural network has been applied to confirm and predict the effects of chemical markers on different samples. Finally, the five chemical markers were identified by UPLC–quadrupole time-of-flight mass spectrometer. Components 3, 12, 16, 18, and 19 were identified as 2,3,5,4′-tetrahydroxy-stilbene-2-O-β-d-glucoside, emodin-8-O-β-d-glucopyranoside, emodin-8-O-(6′-O-acetyl-β-d-glucopyranoside, emodin, and physcion, respectively. In conclusion, the proposed method can be applied for the
DEFF Research Database (Denmark)
Strucko, Tomas; Magdenoska, Olivera; Mortensen, Uffe Hasbro
2015-01-01
factories for production of specific compounds. To examine this possibility, we have reconstructed a de novo vanillin-β-glucoside pathway in an identical manner in S288c and CEN.PK strains. Characterization of the two resulting strains in two standard conditions revealed that the S288c background strain...... produced up to 10-fold higher amounts of vanillin-β-glucoside compared to CEN.PK. This study demonstrates that yeast strain background may play a major role in the outcome of newly developed cell factories for production of a given product....
Synthesis of amide isosteres of schweinfurthin-based stilbenes.
Stockdale, David P; Beutler, John A; Wiemer, David F
2017-10-15
The schweinfurthins are plant-derived stilbenes with an intriguing profile of anti-cancer activity. To obtain analogues of the schweinfurthins that might preserve the biological activity but have greater water solubility, a formal replacement of the central olefin with an amide has been explored. Two pairs of amides have been prepared, each containing the same hexahydroxanthene "left half" joined through an amide linkage to two different "right halves." In each series, the amide has been inserted in both possible orientations, placing the carbonyl group on the tricyclic ABC ring system and the amine on the D-ring, or placing the amine on the hexahydroxanthene and the carbonyl group on the D-ring. The four new schweinfurthin analogues have been tested in the NCI 60 cell line screen, and in both cases the more active isomer carried the carbonyl group on the C-ring. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhao, Xiao-Hui; Han, Fa; Li, Yu-Lin; Yue, Hui-Lan
2013-02-01
Stilbene glycosides are the primary constituents of Rheum tanguticum Maxim. ex Balf., to which different bioactivities has been attributed, including: anti-HIV, anti-oxidant, anti-tumour, anti-malarial, and anti-allergy activity. However, effective methods for the isolation and purification of stilbene glycosides, such as trans-rhapontin, cis-rhapontin and trans-desoxyrhaponticin, from this herb are not currently available. To develop an efficient method for the preparative isolation and purification of three stilbene glycosides from Rheum tanguticum Maxim. ex Balf. via high-speed counter-current chromatography (HSCCC). A solvent system composed of chloroform:n-butanol:methanol:water (4:1:3:2, v/v/v/v) was developed for the separation. The upper phase was used as the stationary phase, and the lower phase was used as the mobile phase. The flow rate was 1.8 mL/min. The apparatus was controlled at 800 rpm and 25 °C, and the effluent was monitored at 280 nm. Chemical constituents were analysed by high-performance liquid chromatography (HPLC), and their structures were identified by ¹H- and ¹³C-NMR. Under the optimised conditions, 25.5 mg trans-rhapontin, 16.0 mg cis-rhapontin and 20.5 mg trans-desoxyrhaponticin were separated from 80 mg crude sample; the isolates had purities of 99.6, 97.2 and 99.2%, respectively. A simple and efficient HSCCC method has been optimised for the preparative separation of stilbene glycosides from Rheum tanguticum Maxim. ex Balf. Copyright © 2012 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Vannozzi Alessandro
2012-08-01
Full Text Available Abstract Background Plant stilbenes are a small group of phenylpropanoids, which have been detected in at least 72 unrelated plant species and accumulate in response to biotic and abiotic stresses such as infection, wounding, UV-C exposure and treatment with chemicals. Stilbenes are formed via the phenylalanine/polymalonate-route, the last step of which is catalyzed by the enzyme stilbene synthase (STS, a type III polyketide synthase (PKS. Stilbene synthases are closely related to chalcone synthases (CHS, the key enzymes of the flavonoid pathway, as illustrated by the fact that both enzymes share the same substrates. To date, STSs have been cloned from peanut, pine, sorghum and grapevine, the only stilbene-producing fruiting-plant for which the entire genome has been sequenced. Apart from sorghum, STS genes appear to exist as a family of closely related genes in these other plant species. Results In this study a complete characterization of the STS multigenic family in grapevine has been performed, commencing with the identification, annotation and phylogenetic analysis of all members and integration of this information with a comprehensive set of gene expression analyses including healthy tissues at differential developmental stages and in leaves exposed to both biotic (downy mildew infection and abiotic (wounding and UV-C exposure stresses. At least thirty-three full length sequences encoding VvSTS genes were identified, which, based on predicted amino acid sequences, cluster in 3 principal groups designated A, B and C. The majority of VvSTS genes cluster in groups B and C and are located on chr16 whereas the few gene family members in group A are found on chr10. Microarray and mRNA-seq expression analyses revealed different patterns of transcript accumulation between the different groups of VvSTS family members and between VvSTSs and VvCHSs. Indeed, under certain conditions the transcriptional response of VvSTS and VvCHS genes appears to be
Koyama, Yuka; Matsunami, Katsuyoshi; Otsuka, Hideaki; Shinzato, Takakazu; Takeda, Yoshio
2010-04-01
From a 1-BuOH-soluble fraction of a MeOH extract of the leaves of Microtropis japonica, collected in the Okinawa islands, six ent-labdane glucosides, named microtropiosides A-F, were isolated together with one known acyclic sesquiterpene glucoside. Their structures were elucidated by a combination of spectroscopic analyses, and their absolute configurations determined by application of the beta-D-glucopyranosylation-induced shift-trend rule in (13)C NMR spectroscopy and the modified Mosher's method. Copyright 2010 Elsevier Ltd. All rights reserved.
Distribution and Biosynthesis of Iridoid Glucosides in the Loasaceae Family
DEFF Research Database (Denmark)
Rodriguez-Lopez, Veronica
In order to make a more precise inventory of iridoid glucosides from Loasaceae family 13 species belonging to 7 genera (Eucnide bartonioides, E. grandiflora, Gronovia scandens, Fuertesia domingensis, Loasa parviflora, L. tricolor, L. urens, L. speciosa, Klaphrotia mentzeloides, Cajophora cernua, ...
DEFF Research Database (Denmark)
Mamma, D.; Hatzinikolaou, D.G.; Christakopoulos, Paul
2004-01-01
,6)-beta-glucosides as well as aryl beta-glucosides. Determination of k(cat)/K-m revealed that G(II) hydrolyzed 3-8 times more efficiently the above-mentioned substrates. The ability of G(I) and G(II) to deglycosylate various flavonoid glycosides was also investigated. Both enzymes were active against...... flavonoids glycosylated at the 7 position but G(II) hydrolyzed them 5 times more efficiently than G(I). Of the flavanols tested, both enzymes were incapable of hydrolyzing quercetrin and kaempferol-3-glucoside. The main difference between G(I) and G(II) as far as the hydrolysis of flavanols is concerned...
Tamura, Y; Nakamura, S; Fukui, H; Tabata, M
1984-10-01
The growth and sweet diterpene glucosides of Stevia plants propagated by stem-tip cultures were compared with those of the control plants propagated by seeds. There was no significant difference between the two groups both in growth and in chemical composition. As for the contents of sweet diterpene glucosides, however, the clonal plants showed significantly smaller variations than the sexually propagated plants; they were almost as homogeneous as the plants propagated by cuttings. These results suggest that the clonal propagation by stem-tip culture is an effective method of obtaining a population of uniform plants for the production of sweet diterpene glucosides.
Directory of Open Access Journals (Sweden)
Hitoshi Nagashima
2013-03-01
Full Text Available The existence of di-glucosylated derivative of T-2 toxin in plant (corn powder was confirmed for the first time in addition to that of HT-2 toxin. These masked mycotoxins (mycotoxin glucosides were identified as T-2 toxin-di-glucoside (T2GlcGlc and HT-2 toxin-di-glucoside (HT2GlcGlc based on accurate mass measurements of characteristic ions and fragmentation patterns using high-resolution liquid chromatography-Orbitrap mass spectrometric (LC-Orbitrap MS analysis. Although the absolute structure of T2GlcGlc was not clarified, two glucose molecules were suggested to be conjugated at 3-OH position in tandem when considering the structure of T-2 toxin. On the other hand, the specification of the structure seems to be more complicated in the case of HT2GlcGlc, since HT-2 toxin has two possible positions (at 3-OH and 4-OH to be glusocylated. In addition, 15-monoacetoxyscirpenol-glucoside (MASGlc was also detected in the identical sample.
DEFF Research Database (Denmark)
Lai, Daniela
that involves specific β-glucosidases. If plant tissue is disrupted, cyanogenic glucosides come into contact with these β-glucosidases and are hydrolyzed, which results in the release of hydrogen cyanide gas. The work reported in this thesis is focused on the β-glucosidases that activated hydroxynitrile...... glucosides in the model plant Lotus japonicus. The work highlights how closely related β-glucosidases have evolved distinct substrate specificities and differential expression patterns to serve distinct physiological and ecological roles....
Energy Technology Data Exchange (ETDEWEB)
Wang, Yechun; Yi, Hankuil; Wang, Melissa; Yu, Oliver; Jez, Joseph M. (WU); (Danforth)
2012-10-24
To increase the biochemical efficiency of biosynthetic systems, metabolic engineers have explored different approaches for organizing enzymes, including the generation of unnatural fusion proteins. Previous work aimed at improving the biosynthesis of resveratrol, a stilbene associated a range of health-promoting activities, in yeast used an unnatural engineered fusion protein of Arabidopsis thaliana (thale cress) 4-coumaroyl-CoA ligase (At4CL1) and Vitis vinifera (grape) stilbene synthase (VvSTS) to increase resveratrol levels 15-fold relative to yeast expressing the individual enzymes. Here we present the crystallographic and biochemical analysis of the 4CL::STS fusion protein. Determination of the X-ray crystal structure of 4CL::STS provides the first molecular view of an artificial didomain adenylation/ketosynthase fusion protein. Comparison of the steady-state kinetic properties of At4CL1, VvSTS, and 4CL::STS demonstrates that the fusion protein improves catalytic efficiency of either reaction less than 3-fold. Structural and kinetic analysis suggests that colocalization of the two enzyme active sites within 70 {angstrom} of each other provides the basis for enhanced in vivo synthesis of resveratrol.
Ioffe, Ilya N; Quick, Martin; Quick, Michael T; Dobryakov, Alexander L; Richter, Celin; Granovsky, Alex A; Berndt, Falko; Mahrwald, Rainer; Ernsting, Nikolaus P; Kovalenko, Sergey A
2017-10-25
Spontaneous polarization of a nonpolar molecule upon photoexcitation (the sudden polarization effect) earlier discussed for 90°-twisted alkenes is observed and calculated for planar ring-fluorinated stilbenes, trans-2,3,5,6,2',3',5',6'-octofluorostilbene (tF2356) and trans-2,3,4,5,6,2',3',4',5',6'-decafluorostilbene (tF23456). Due to the fluorination, Franck-Condon states S 1 FC and S 2 FC are dominated by the quasi-degenerate HOMO-1 → LUMO and HOMO-2 → LUMO excitations, while their interaction gives rise to a symmetry-broken zwitterionic S 1 state. After optical excitation of tF2356, one observes an ultrafast (∼0.06 ps) evolution that reflects relaxation from initial nonpolar S 3 FC to long-lived (1.3 ns in n-hexane and 3.4 ns in acetonitrile) polar S 1 . The polarity of S 1 is evidenced by a solvatochromic shift of its fluorescence band. The experimental results provide a sensitive test for quantum-chemical calculations. In particular, our calculations agree with the experiment, and raise concerns about the applicability of the common TDDFT approach to relatively simple stilbenic systems.
Czech Academy of Sciences Publication Activity Database
Kovářová, Marcela; Frantík, Tomáš; Koblihová, Helena; Bartůňková, Kristýna; Nývltová, Z.; Vosátka, Miroslav
2011-01-01
Roč. 11, č. 98 (2011), s. 1-14 ISSN 1471-2229 R&D Projects: GA MPO FT-TA3/008; GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516 Keywords : knotweed * stilbenes * leaf damage Subject RIV: EF - Botanics Impact factor: 3.447, year: 2011
International Nuclear Information System (INIS)
Hallahan, Cornelius; McGarry, Yvonne; Collins, J.D.
1985-01-01
A radioimmunoassay for the measurement of the synthetic anabolic agent diethylstilboestrol (DES) is described. It is based on a commercially available antiserum and a tritiated derivative of DES. The method can detect low concentrations of residues (less than 0.5 ng/ml) in small samples (0.05 to 0.2 ml) of biological fluids. DES was measured in plasma, bile and urine obtained from a calf slaughtered 22 days after subcutaneous implantation of 24 mg DES. The assay described is suitable as a rapid screening procedure for identifying animals treated with stilbene substances. (author)
Directory of Open Access Journals (Sweden)
Tomas Strucko
2015-12-01
Full Text Available The yeast Saccharomyces cerevisiae is a widely used eukaryotic model organism and a key cell factory for production of biofuels and wide range of chemicals. From the broad palette of available yeast strains, the most popular are those derived from laboratory strain S288c and the industrially relevant CEN.PK strain series. Importantly, in recent years these two strains have been subjected to comparative “-omics” analyzes pointing out significant genotypic and phenotypic differences. It is therefore possible that the two strains differ significantly with respect to their potential as cell factories for production of specific compounds. To examine this possibility, we have reconstructed a de novo vanillin-β-glucoside pathway in an identical manner in S288c and CEN.PK strains. Characterization of the two resulting strains in two standard conditions revealed that the S288c background strain produced up to 10-fold higher amounts of vanillin-β-glucoside compared to CEN.PK. This study demonstrates that yeast strain background may play a major role in the outcome of newly developed cell factories for production of a given product. Keywords: Yeast, Cell factory, Strain choice, Heterologous production, Vanillin-glucoside, Shikimate pathway
Design, Synthesis and Cytotoxic Evaluation of o-Carboxamido Stilbene Analogues
Directory of Open Access Journals (Sweden)
Mohamad Nurul Azmi
2013-11-01
Full Text Available Resveratrol, a natural stilbene found in grapes and wines exhibits a wide range of pharmacological properties. Resveratrol is also known as a good chemopreventive agent for inhibiting carcinogenesis processes that target kinases, cyclooxygenases, ribonucleotide reductase and DNA polymerases. A total of 19 analogues with an amide moiety were synthesized and the cytotoxic effects of the analogues on a series of human cancer cell lines are reported. Three compounds 6d, 6i and 6n showed potent cytotoxicity against prostate cancer DU-145 (IC50 = 16.68 µM, colon cancer HT-29 (IC50 = 7.51 µM and breast cancer MCF-7 (IC50 = 21.24 µM, respectively, which are comparable with vinblastine. The resveratrol analogues were synthesized using the Heck method.
Piao, Shu-juan; Chen, Li-xia; Kang, Ning; Qiu, Feng
2011-01-01
Cortex Mori, one of the well-known traditional Chinese herbal medicines, is derived from the root bark of Morus alba L. according to the China Pharmacopeia. Stilbene glycosides are the main components isolated from aqueous extracts of Morus alba and their content varies depending on where Cortex Mori was collected. We have established a qualitative and quantitative method based on the bioactive stilbene glycosides for control of the quality of Cortex Mori from different sources. To develop a high-performance liquid chromatography coupled with ultraviolet absorption detection for simultaneous quantitative determination of five major characteristic stilbene glycosides in 34 samples of the root bark of Morus alba L. (Cortex Mori) from different sources. The analysis was performed on an ODS column using methanol-water-acetic acid (18: 82: 0.1, v/v/v) as the mobile phase and the peaks were monitored at 320 nm. All calibration curves showed good linearity (r ≥ 0.9991) within test ranges. This method showed good repeatability for the quantification of these five components in Cortex Mori with intra- and inter-day standard deviations less than 2.19% and 1.45%, respectively. The validated method was successfully applied to quantify the five investigated components, including a pair of cis-trans-isomers 1 and 2 and a pair of isomers 4 and 5 in 34 samples of Cortex Mori from different sources. Copyright © 2010 John Wiley & Sons, Ltd.
Mutational analysis of β-glucoside utilization in Klebsiella aerogenes
Indian Academy of Sciences (India)
Unknown
in M9 minimal medium with 0.4% succinate as carbon source. At mid-log phase, .... Figure 2. Isolation and properties of Sal– mutants of K. aerogenes AN292. (a) Contrast- ing effects of 200 mM phenyl-β-D-glucoside (p-glu) on the growth of K. aerogenes. AN292 (Ka AN292) ... side utilization systems. One for the aromatic ...
Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.
1999-10-01
In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.
Chlorinated Iridoid Glucosides from Veronica longifolia and their Antioxidant Activity
DEFF Research Database (Denmark)
Jensen, Søren Rosendal; Gotfredsen, Charlotte Held; Harput, U. Sebnem
2010-01-01
From Veronica longifolia were isolated three chlorinated iridoid glucosides, namely asystasioside E (6) and its 6-O-esters 6a and 6b, named longifoliosides A and B, respectively. The structures of 6a and 6b were proved by analysis of their spectroscopic data and by conversion to the catalpol ester...
Roepke, Jonathon; Gordon, Harley O W; Neil, Kevin J A; Gidda, Satinder; Mullen, Robert T; Freixas Coutin, José A; Bray-Stone, Delaney; Bozzo, Gale G
2017-06-01
Flavonol bisglycosides accumulate in plant vegetative tissues in response to abiotic stress, including simultaneous environmental perturbations (i.e. nitrogen deficiency and low temperature, NDLT), but disappear with recovery from NDLT. Previously, we determined that a recombinant Arabidopsis β-glucosidase (BGLU), BGLU15, hydrolyzes flavonol 3-O-β-glucoside-7-O-α-rhamnosides and flavonol 3-O-β-glucosides, forming flavonol 7-O-α-rhamnosides and flavonol aglycones, respectively. In this study, the transient expression of a BGLU15-Cherry fusion protein in onion epidermal cells demonstrated that BGLU15 was localized to the apoplast. Analysis of BGLU15 T-DNA insertional inactivation lines (bglu15-1 and bglu15-2) revealed negligible levels of BGLU15 transcripts, whereas its paralogs BGLU12 and BGLU16 were expressed in wild-type and bglu15 plants. The recombinant BGLU16 did not hydrolyze quercetin 3-O-β-glucoside-7-O-α-rhamnoside or rhamnosylated flavonols, but was active with the synthetic substrate, p-nitrophenyl-β-d-glucoside. In addition, shoots of both bglu15 mutants contained negligible flavonol 3-O-β-glucoside-7-O-α-rhamnoside hydrolase activity, whereas this activity increased by 223% within 2 d of NDLT recovery in wild-type plants. The levels of flavonol 3-O-β-glucoside-7-O-α-rhamnosides and quercetin 3-O-β-glucoside were high and relatively unchanged in shoots of bglu15 mutants during recovery from NDLT, whereas rapid losses were apparent in wild-type shoots. Moreover, losses of two flavonol 3-O-β-neohesperidoside-7-O-α-rhamnosides and kaempferol 3-O-α-rhamnoside-7-O-α-rhamnoside were evident during recovery from NDLT, regardless of whether BGLU15 was present. A spike in a kaempferol 7-O-α-rhamnoside occurred with stress recovery, regardless of germplasm, suggesting a contribution from hydrolysis of kaempferol 3-O-β-neohesperidoside-7-O-α-rhamnosides and/or kaempferol 3-O-α-rhamnoside-7-O-α-rhamnoside by hitherto unknown mechanisms. Thus
Directory of Open Access Journals (Sweden)
Tina eFrisch
2015-10-01
Full Text Available Alliaria petiolata (garlic mustard, Brassicaceae contains the glucosinolate sinigrin as well as alliarinoside, a γ-hydroxynitrile glucoside structurally related to cyanogenic glucosides. sinigrin may defend this plant against a broad range of enemies, while alliarinoside confers resistance to specialized (glucosinolate-adapted herbivores. Hydroxynitrile glucosides and glucosinolates are two classes of specialized metabolites, which generally do not occur in the same plant species. Administration of [UL-14C]-methionine to excised leaves of A. petiolata showed that both alliarinoside and sinigrin were biosynthesized from methionine. The biosynthesis of alliarinoside was shown not to bifurcate from sinigrin biosynthesis at the oxime level in contrast to the general scheme for hydroxynitrile glucoside biosynthesis. Instead, the aglucon of alliarinoside was formed from metabolism of sinigrin in experiments with crude extracts, suggesting a possible biosynthetic pathway in intact cells. Hence, the alliarinoside pathway may represent a route to hydroxynitrile glucoside biosynthesis resulting from convergent evolution. Metabolite profiling by LC-MS showed no evidence of the presence of cyanogenic glucosides in A. petiolata. However, we detected hydrogen cyanide (HCN release from sinigrin and added thiocyanate ion and benzyl thiocyanate in A. petiolata indicating an enzymatic pathway from glucosinolates via allyl thiocyanate and indole glucosinolate derived thiocyanate ion to HCN. Alliarinoside biosynthesis and HCN release from glucosinolate-derived metabolites expand the range of glucosinolate-related defences and can be viewed as a third line of defence, with glucosinolates and thiocyanate forming protein being the first and second lines, respectively.
Directory of Open Access Journals (Sweden)
Yuki Ito
Full Text Available Approximately 10-15% of individuals infected with Helicobacter pylori will develop ulcer disease (gastric or duodenal ulcer, while most people infected with H. pylori will be asymptomatic. The majority of infected individuals remain asymptomatic partly due to the inhibition of synthesis of cholesteryl α-glucosides in H. pylori cell wall by α1,4-GlcNAc-capped mucin O-glycans, which are expressed in the deeper portion of gastric mucosa. However, it has not been determined how cholesteryl α-glucosyltransferase (αCgT, which forms cholesteryl α-glucosides, functions in the pathogenesis of H. pylori infection. Here, we show that the activity of αCgT from H. pylori clinical isolates is highly correlated with the degree of gastric atrophy. We investigated the role of cholesteryl α-glucosides in various aspects of the immune response. Phagocytosis and activation of dendritic cells were observed at similar degrees in the presence of wild-type H. pylori or variants harboring mutant forms of αCgT showing a range of enzymatic activity. However, cholesteryl α-glucosides were recognized by invariant natural killer T (iNKT cells, eliciting an immune response in vitro and in vivo. Following inoculation of H. pylori harboring highly active αCgT into iNKT cell-deficient (Jα18(-/- or wild-type mice, bacterial recovery significantly increased in Jα18(-/- compared to wild-type mice. Moreover, cytokine production characteristic of Th1 and Th2 cells dramatically decreased in Jα18(-/- compared to wild-type mice. These findings demonstrate that cholesteryl α-glucosides play critical roles in H. pylori-mediated gastric inflammation and precancerous atrophic gastritis.
International Nuclear Information System (INIS)
Croteau, R.; Sood, V.K.; Renstroem, B.; Bhushan, R.
1984-01-01
Previous studies have shown that the monoterpene ketone l-[G- 3 H] menthone is reduced to the epimeric alcohols l-menthol and d-neomenthol in leaves of flowering peppermint (Mentha piperita L.), and that a portion of the menthol is converted to methyl acetate while the bulk of the neomenthol is transformed to neomenthyl-β-D-glucoside which is then transported to the rhizome. Analysis of the disposition of l-[G] 3 H]menthone applied to midstem leaves of intact flowering plants allowed the kinetics of synthesis and transport of the monoterpenyl glucoside to be determined, and gave strong indication that the glucoside was subsequently metabolized in the rhizome. Studies with d-[G- 3 H]neomenthyl-β-D-glucoside as substrate, using excised rhizomes or rhizome segments, confirmed the hydrolysis of the glucoside as an early step in metabolism at this site, and revealed that the terpenoid moiety was further converted to a series of ether-soluble, methanol-soluble, and water-soluble products. The conversion of menthone to the lactone, and of the lactone to more polar products, were confirmed in vivo using l-[G- 3 H]menthone and l-[G- 3 H]-3,4-menthone lactone as substrates. Additional oxidation products were formed in vivo via the desaturation of labeled neomenthol and/or menthone, but none of these transformations appeared to lead to ring opening of the p-menthane skeleton. Each step in the main reaction sequence, from hydrolysis of neomenthyl glucoside to lactonization of menthone, was demonstrated in cell-free extracts from the rhizomes of flowering mint plants. The lactomization step is of particular significance in providing a means of cleaving the p-methane ring to afford an acyclic carbon skeleton that can be further degraded by modifications of the well-known β-oxidation sequence. 41 references, 3 figures, 1 table
Superior optical nonlinearity of an exceptional fluorescent stilbene dye
Energy Technology Data Exchange (ETDEWEB)
He, Tingchao [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Sreejith, Sivaramapanicker; Zhao, Yanli [Division of Chemistry and Biological Chemistry, School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore); Gao, Yang; Grimsdale, Andrew C. [School of Materials Science and Engineering, Nanyang Technological University, Singapore, Singapore 639798 (Singapore); Lin, Xiaodong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [College of Physics Science and Technology, Shenzhen University, Shenzhen 518060 (China); Sun, Handong, E-mail: linxd@szu.edu.cn, E-mail: hdsun@ntu.edu.sg [Division of Physics and Applied Physics, Centre for Disruptive Photonic Technologies (CDPT), School of Physical and Mathematical Sciences, Nanyang Technological University, 21 Nanyang Link, Singapore 637371 (Singapore)
2015-03-16
Strong multiphoton absorption and harmonic generation in organic fluorescent chromophores are, respectively, significant in many fields of research. However, most of fluorescent chromophores fall short of the full potential due to the absence of the combination of such different nonlinear upconversion behaviors. Here, we demonstrate that an exceptional fluorescent stilbene dye could exhibit efficient two- and three-photon absorption under the excitation of femtosecond pulses in solution phase. Benefiting from its biocompatibility and strong excited state absorption behavior, in vitro two-photon bioimaging and superior optical limiting have been exploited, respectively. Simultaneously, the chromophore could generate efficient three-photon excited fluorescence and third-harmonic generation (THG) when dispersed into PMMA film, circumventing the limitations of classical fluorescent chromophores. Such chromophore may find application in the production of coherent light sources of higher photon energy. Moreover, the combination of three-photon excited fluorescence and THG can be used in tandem to provide complementary information in biomedical studies.
International Nuclear Information System (INIS)
Kremlev, M.M.; Fialkov, Yu.A.
1976-01-01
The interaction is studied of trans-α, β-dibromostilbene and meso -1, 2 - dibromo -1, 2 - diphenylethane with potassium and cesium fluorides in dimethyl sulphoxide and N - methyl pyrrolidone. It has been found that in this interaction there takes place debromination of vicinal dibromides resulting in the formation of tolan and trans-stilbene, respectively, with a quantitative yield
Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm
Directory of Open Access Journals (Sweden)
Dharmesh Harwani
2014-12-01
Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.
Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.
Harwani, Dharmesh
2014-01-01
Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.
Jiao, Yuntong; Xu, Weirong; Duan, Dong; Wang, Yuejin; Nick, Peter
2016-10-01
Stilbenes are central phytoalexins in Vitis, and induction of the key enzyme stilbene synthase (STS) is pivotal for disease resistance. Here, we address the potential for breeding resistance using an STS allele isolated from Chinese wild grapevine Vitis pseudoreticulata (VpSTS) by comparison with its homologue from Vitis vinifera cv. 'Carigane' (VvSTS). Although the coding regions of both alleles are very similar (>99% identity on the amino acid level), the promoter regions are significantly different. By expression in Arabidopsis as a heterologous system, we show that the allele from the wild Chinese grapevine can confer accumulation of stilbenes and resistance against the powdery mildew Golovinomyces cichoracearum, whereas the allele from the vinifera cultivar cannot. To dissect the upstream signalling driving the activation of this promoter, we used a dual-luciferase reporter system in a grapevine cell culture. We show elevated responsiveness of the promoter from the wild grape to salicylic acid (SA) and to the pathogen-associated molecular pattern (PAMP) flg22, equal induction of both alleles by jasmonic acid (JA), and a lack of response to the cell death-inducing elicitor Harpin. This elevated SA response of the VpSTS promoter depends on calcium influx, oxidative burst by RboH, mitogen-activated protein kinase (MAPK) signalling, and JA synthesis. We integrate the data in the context of a model where the resistance of V. pseudoreticulata is linked to a more efficient recruitment of SA signalling for phytoalexin synthesis. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Czech Academy of Sciences Publication Activity Database
Honová, J.; Luňák, S.; Vala, M.; Stříteský, S.; Fekete, Ladislav; Weiter, M.; Kovalenko, A.
2016-01-01
Roč. 70, č. 10 (2016), s. 1416-1424 ISSN 0366-6352 R&D Projects: GA MŠk LO1409; GA ČR(CZ) GA15-05095S; GA MŠk LM2015088 Institutional support: RVO:68378271 Keywords : organic solar cell * thiophene-free * diphenyl-amino-stilbene * hole mobility * molecular structure Subject RIV: BM - Solid Matter Physics ; Magnetism OBOR OECD: Condensed matter physics (including formerly solid state physics, supercond.) Impact factor: 1.258, year: 2016
Hepatoprotective activity of twelve novel 7'-hydroxy lignan glucosides from Arctii Fructus.
Yang, Ya-Nan; Huang, Xiao-Ying; Feng, Zi-Ming; Jiang, Jian-Shuang; Zhang, Pei-Cheng
2014-09-17
Twelve novel 7'-hydroxy lignan glucosides (1-12), including two benzofuran-type neolignans, two 8-O-4' neolignans, two dibenzylbutyrolactone lignans, and six tetrahydrofuranoid lignans, together with six known lignan glucosides (13-18), were isolated from the fruit of Arctium lappa L. (Asteraceae), commonly known as Arctii Fructus. Their structures were elucidated using spectroscopy (1D and 2D NMR, MS, IR, ORD, and UV) and on the basis of chemical evidence. The absolute configurations of compounds 1-12 were confirmed using rotating frame nuclear overhauser effect spectroscopy (ROESY), the circular dichroic (CD) exciton chirality method, and Rh2(OCOCF3)4-induced CD spectrum analysis. All of the isolated compounds were tested for hepatoprotective effects against D-galactosamine-induced cytotoxicity in HL-7702 hepatic cells. Compounds 1, 2, 7-12, and 17 showed significantly stronger hepatoprotective activity than the positive control bicyclol at a concentration of 1 × 10(-5) M.
Pulse radiolysis of solutions of trans-stilbene
International Nuclear Information System (INIS)
Langan, J.R.; Salmon, G.A.
1982-01-01
On pulse radiolysis of solutions of trans-stilbene (t-St) in THF the radical-anion of t-St is formed by reaction of e - sub(s) with t-St. The transient absorption spectrum observed with lambdasub(max) at 500 and 720 nm is attributed to the unassociated St - . The subsequent decay of the radical-anion is accounted for by reaction with the counter-cation of THF formed on radiolysis and with radiolytically generated radicals; rate constants for these processes are estimated. Addition of sodium tetrahydridoaluminate (NAH) results in the radical-anion being associated with Na + as a contact ion-pair and a shift of lambdasub(max) to 490 nm. In the presence of the lithium salt the absorption spectrum of the radical-anion reverts to 500 nm. On pulse radiolysis of solutions containing NAH the main reaction forming St - is that of (Na + , e - sub(s))ion pairs with t-St. In addition there is a delayed formation of St - over a period of microseconds. The presence of tetrahydridoaluminate salts also greatly enhances the stability of St - and at high doses per pulse little decay was observed over 700 μs. The variation of G(St - ) with [NAH] was studied and was found to attain a plateau value of 2.0 at the higher concentrations. (author)
International Nuclear Information System (INIS)
Ishikawa, M.; Itoga, T.; Okuji, T.; Nakhostin, M.; Shinohara, K.; Hayashi, T.; Sukegawa, A.; Baba, M.; Nishitani, T.
2006-01-01
A line-integrated neutron emission profile is routinely measured using the radial neutron collimator system in JT-60U tokamak. Stilbene neuron detectors (SNDs), which combine a stilbene organic crystal scintillation detector (SD) with an analog neutron-gamma pulse shape discrimination (PSD) circuit, have been used to measure collimated neutron flux. Although the SND has many advantages as a neutron detector, the maximum count rate is limited up to ∼1x10 5 counts/s due to the analog PSD circuit. To overcome this issue, a digital signal processing system (DSPS) using a flash analog-to-digital converter (Acqiris DC252, 8 GHz, 10 bits) has been developed at Cyclotron and Radioisotope Center in Tohoku University. In this system anode signals from photomultiplier of the SD are directory stored and digitized. Then, the PSD between neutrons and gamma rays is performed using software. The DSPS has been installed in the vertical neutron collimator system in JT-60U and applied to deuterium experiments. It is confirmed that the PSD is sufficiently performed and collimated neutron flux is successfully measured with count rate up to ∼5x10 5 counts/s without the effect of pileup of detected pulses. The performance of the DSPS as a neutron detector, which supersedes the SND, is demonstrated
Munafo, John P; Gianfagna, Thomas J
2015-05-20
The Easter lily (Lilium longiflorum Thunb.) is esteemed worldwide as an attractive ornamental plant, and the flower buds and bulbs are used for both culinary and medicinal purposes in many parts of the world. L. longiflorum contains significant amounts of phenylpropanoid glycerol glucosides, a group of compounds that may contribute to plant pathogen defense, ultraviolet/high-intensity visible light (UV/high light) protection, and the purported medicinal uses of lilies. To define the natural distribution of these compounds within the plant, a liquid chromatography-mass spectrometry (LC-MS) method performed in selected ion monitoring (SIM) mode was employed for the quantitative analysis of five phenylpropanoid glycerol glucosides, namely, (2S)-1-O-caffeoyl-2-O-β-D-glucopyranosylglycerol, 1; (2R)-1-O-β-D-glucopyranosyl-2-O-p-coumaroylglycerol, 2; (2S)-1-O-p-coumaroyl-2-O-β-D-glucopyranosylglycerol, 3; (2S)-1-O-caffeoyl-2-O-β-D-glucopyranosyl-3-O-acetylglycerol, 4; and (2S)-1-O-p-coumaroyl-2-O-β-D-glucopyranosyl-3-O-acetylglycerol, 5, in the different organs of L. longiflorum. The p-coumaroyl-based 3 and its acetylated derivative 5 were determined to be the most abundant of the phenylpropanoid glycerol glucosides found in Easter lily bulbs, at 776.3 ± 8.4 and 650.7 ± 32.6 μg/g dry weight, respectively. The acetylated p-coumaroyl- and caffeoyl-based derivatives, 5 and 4, accumulated to the highest concentration in the closed flower buds, at 4925.2 ± 512.8 and 3216.8 ± 406.4 μg/g dry weight, respectively. Compound 4, followed by 5 and 1, proved to be the most abundant in the mature flowers, occurring at 6006.2 ± 625.8, 2160.3 ± 556.5, and 1535.8 ± 174.1 μg/g dry weight, respectively. Total concentrations of the phenylpropanoid glycerol glucosides were 10-100-fold higher in the above-ground plant organs as compared to the bulbs and fleshy roots. Two of the five compounds, 1 and 2, were identified in L. longiflorum for the first time. The quantitative
Czech Academy of Sciences Publication Activity Database
De Winter, K.; Van Renterghem, L.; Wuyts, K.; Pelantová, Helena; Křen, Vladimír; Soetaert, W.; Desmet, T.
2015-01-01
Roč. 357, č. 8 (2015), s. 1961-1969 ISSN 1615-4150 R&D Projects: GA MŠk(CZ) LD13042; GA MŠk(CZ) 7E11011 Institutional support: RVO:61388971 Keywords : cellobiose phosphorylase * cross-linked enzyme aggregates * beta-glucosides Subject RIV: CE - Biochemistry Impact factor: 6.453, year: 2015
Rojas-Garbanzo, Carolina; Zimmermann, Benno F; Schulze-Kaysers, Nadine; Schieber, Andreas
2017-10-01
Pink guava (Psidium guajava L.) is a highly consumed fruit in tropical countries. Despite of interesting research on health effects of this fruit, investigations into the profile of secondary plant metabolites are scarce. In this study, the phenolic compounds in the peel and flesh of pink guava were characterized by ultra-high performance liquid chromatography with diode array and mass spectrometric detection. Sixty phenolic compounds were characterized by MS 2 and classified as ellagitannins, flavones, flavonols, flavanols, proanthocyanidins, dihydrochalcones, and anthocyanidins, and non-flavonoids such as phenolic acid derivatives, stilbenes, acetophenones, and benzophenones. Forty-two polyphenols are reported for the first time in both peel and flesh, and twenty-four compounds were detected for the first time in P. guajava, e.g., phlorizin, nothofagin, astringin, chrysin-C-glucoside, valoneic acid bilactone, cinnamoyl-glucoside, and two dimethoxycinnamoyl-hexosides. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chemotaxonomy of Plantago. Iridoid glucosides and caffeoyl phenylethanoid glycosides
DEFF Research Database (Denmark)
Rønsted, N.; Göbel, E.; Franzyk, Henrik
2000-01-01
Data for 34 species of Plantago (Plantaginaceae), including subgen. Littorella (=Littorella uniflora), have been collected with regard to their content of iridoid glucosides and caffeoyl phenylethanoid glycosides (CPGs). In the present work, 21 species were investigated for the first time and man...... in the family. Finally, the close relationship between Plantago and Veronica suggested by chloroplast DNA sequence analysis, could be corroborated by the common occurrence of the rare 8,9-unsaturated iridoids in these two genera. (C) 2000 Elsevier Science Ltd. All rights reserved....
Honeybees tolerate cyanogenic glucosides from clover nectar and flowers
DEFF Research Database (Denmark)
Lecocq, Antoine; Green, Amelia Ann; Pinheiro de Castro, Érika Cristina
2018-01-01
Honeybees (Apis mellifera) pollinate flowers and collect nectar from many important crops. White clover (Trifolium repens) is widely grown as a temperate forage crop, and requires honeybee pollination for seed set. In this study, using a quantitative LC-MS (Liquid Chromatography-Mass Spectrometry...... indicates that plant secondary metabolites found in nectar may protect pollinators from disease or predators. In a laboratory survival study with chronic feeding of secondary metabolites, we show that honeybees can ingest the cyanogenic glucosides linamarin and amygdalin at naturally occurring...
Directory of Open Access Journals (Sweden)
Clemens Schmeitzl
2015-08-01
Full Text Available Deoxynivalenol (DON is a protein synthesis inhibitor produced by the Fusarium species, which frequently contaminates grains used for human or animal consumption. We treated a wheat suspension culture with DON or one of its acetylated derivatives, 3-acetyl-DON (3-ADON, 15-acetyl-DON (15-ADON and 3,15-diacetyl-DON (3,15-diADON, and monitored the metabolization over a course of 96 h. Supernatant and cell extract samples were analyzed using a tailored LC-MS/MS method for the quantification of DON metabolites. We report the formation of tentatively identified DON-15-O-β-D-glucoside (D15G and of 15-acetyl-DON-3-sulfate (15-ADON3S as novel deoxynivalenol metabolites in wheat. Furthermore, we found that the recently identified 15-acetyl-DON-3-O-β-D-glucoside (15-ADON3G is the major metabolite produced after 15-ADON challenge. 3-ADON treatment led to a higher intracellular content of toxic metabolites after six hours compared to all other treatments. 3-ADON was exclusively metabolized into DON before phase II reactions occurred. In contrast, we found that 15-ADON was directly converted into 15-ADON3G and 15-ADON3S in addition to metabolization into deoxynivalenol-3-O-β-D-glucoside (D3G. This study highlights significant differences in the metabolization of DON and its acetylated derivatives.
Directory of Open Access Journals (Sweden)
Magdalena Czemplik
2016-08-01
Full Text Available Flax straw of flax varieties that are grown for oil production is a byproduct which represents a considerable biomass source. Therefore its potential application for human use is of high interest. Our research has revealed that flax straw is rich in flavonoid C-glucosides, including vitexin, orientin and isoorientin. The objective of this study was to evaluate the cytotoxicity and possible proapoptotic effect of flax straw derived C-glucosides of flavonoids in the human breast adenocarcinoma cell line (MCF-7. The effects of flax straw derived flavonoid C-glucosides on cell proliferation of MCF-7 cells were evaluated by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide (MTT and sulforhodamine B (SRB assays. The expression of apoptosis-related genes was assessed by real-time PCR. Our data revealed that flax C-glucosides as well as pure compounds are cytotoxic towards MCF-7 cells and inhibit their proliferation. Moreover, the induction of apoptosis was correlated with the changes in the mRNA level of pro-apoptotic genes. Increased expression of bax and caspase-7, -8, and -9 and decreased mRNA expression of bcl-2 was observed, whereas the mRNA levels of p53 and mdm2 were not altered. These results clearly demonstrated that flax straw metabolites effectively induced growth inhibition and apoptosis in human breast adenocarcinoma cells.
Quick, Martin; Dobryakov, Alexander L; Ioffe, Ilya N; Granovsky, Alex A; Kovalenko, Sergey A; Ernsting, Nikolaus P
2016-10-20
In the photoisomerization path of stilbene, a perpendicular state P on the S 1 potential energy surface is expected just before internal conversion through a conical intersection S 1 /S 0 . For decades the observation of P was thwarted by a short lifetime τ P in combination with slow population flow over a barrier. But these limitations can be overcome by ethylenic substitution. Following optical excitation of trans-1,1'-dicyanostilbene, P is populated significantly (τ P = 27 ps in n-hexane) and monitored by an exited-state absorption band at 370 nm. Here we report stimulated Raman lines of P. The strongest, at 1558 cm -1 , is attributed to stretching vibrations of the phenyl rings. Transient electronic states, resonance conditions, and corresponding Raman signals are discussed.
Jiao, Ze-Zhao; Yue, Su; Sun, Hong-Xiang; Jin, Tian-Yun; Wang, Hai-Na; Zhu, Rong-Xiu; Xiang, Lan
2015-11-25
A polyamide column chromatography method using an aqueous ammonia mobile phase was developed for large-scale accumulation of water-soluble indoline amide glucosides from a medicinal plant, Portulaca oleracea. Ten new [oleraceins H, I, K, L, N, O, P, Q, R, S (1-10)] and four known [oleraceins A-D (11-14)] indoline amide glucosides were further purified and structurally characterized by various chromatographic and spectroscopic methods. The DPPH radical scavenging activities of oleraceins K (5) and L (6), with EC50 values of 15.30 and 16.13 μM, respectively, were twice that of a natural antioxidant, vitamin C; the EC50 values of the 12 other indoline amides, which ranged from 29.05 to 43.52 μM, were similar to that of vitamin C. Structure-activity relationships indicated that the DPPH radical scavenging activities of these indoline amides correlate with the numbers and positions of the phenolic hydroxy groups.
Becker, Christine; Klaering, Hans-Peter; Kroh, Lothar W; Krumbein, Angelika
2014-03-01
Cultivating lettuce in greenhouses at low temperatures improves its CO2-balance and may increase its content of flavonoid glycosides and phenolic acids. We cultivated 5weeks old red leaf lettuce seedlings at 20/15°C (day/night) or 12/7°C until plants reached comparable growth stages: small heads were harvested after 13 (warm) and 26 (cool)days, while mature heads were harvested after 26 (warm) or 52 (cool)days. Additionally, some plants were cultivated first cool then warm and vice versa (39days). Cool-cultivated small heads had higher concentrations of cyanidin-3-O-(6″-O-malonyl)-glucoside and caffeoylmalic acid than warm-cultivated ones but we detected no differences concerning quercetin and luteolin glycosides or di-O-caffeoyltartaric and 5-O-caffeoylquinic acid. Regarding mature heads, there were only differences concerning cyanidin-3-O-(6″-O-malonyl)-glucoside. We therefore suggest that only cyanidin-3-O-(6″-O-malonyl)-glucoside was truly responsive to temperatures alone. Previously reported contrasting effects may rather be due to comparison of different growth stages or interactive effects with radiation. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.
DEFF Research Database (Denmark)
Opitz, Sebastian E. W.; Jensen, Søren Rosendal; Müller, Caroline
2010-01-01
In this study, the larval sequestration abilities and defense effectiveness of four sawfly species of the genus Athalia (Hymenoptera: Tenthredinidae) that feed as larvae either on members of the Brassicaceae or Plantaginaceae were investigated. Brassicaceae are characterized by glucosinolates (GLSs...... hemolymph of the GLSsequestering conspicuous A. rosae larvae. The results show that glucoside sequestration is widespread in the genus Athalia, but that the specific glucoside uptake can result in different defense effectiveness against a predator species....
Qin, Ying; Tian, Ya-ping
2011-01-01
Introduction We explored the protective effects of total glucosides of paeony (TGP) and the underlying mechanisms in carbon tetrachloride (CCl4)-induced experimental liver injury in mice. Material and methods Chronic liver damage was induced by intraperitoneal injection of CCl4 (0.5 µl/g) three times per week for 8 weeks. Mice also received 25, 50 or 100 mg/kg TGP. Liver sections were stained with haematoxylin/eosin. Serum amino transferases, lipid peroxidation and tumour necrosis factor-α (TNF-α) levels were determined using commercial assays. Quantitative real-time polymerase chain reaction was used to determine the changes in hepatic TNF-α, COX-2, iNOS and HO-1 expression. Protein levels of nitric oxide synthase, cyclooxygenase-2, haem oxygenase-1 and cytochrome P450 2E1 were determined by western blotting. Results Histological results showed that TGP improved the CCl4-induced changes in liver structure and alleviated lobular necrosis. The increases in serum protein and hepatic mRNA expression of TNF-α induced by CCl4 treatment were suppressed by TGP. Total glucosides of paeony also attenuated the increase the expression in iNOS and CYP2E1 but augmented the increase in HO-1.The mRNA and protein expression levels of inducible HO-1 increased significantly after CCl4 treatment. Conclusions Total glucosides of paeony protects hepatocytes from oxidative damage induced by CCl4. Total glucosides of paeony may achieve these effects by enhancing HO-1 expression and inhibiting the expression of proinflammatory mediators. PMID:22291795
13C CPMAS NMR Studies of Anthocyanidins and their Glucosides
International Nuclear Information System (INIS)
Wolniak, M.; Wawer, I.
2005-01-01
Anthocyanins are responsible for red, purple or blue colours of flower petals and can be found in red or black fruits and berries. Many foods, especially red grapes and wines, aronia or blueberries contain large amounts of anthocyanins. Their health beneficial effects are related to antioxidant and radical scavenging properties. Structural analysis of anthocyanins by NMR are few, owing to the difficulty in obtaining analysable spectra for unstable, interconverting compounds, available in small amounts. Compounds studied by us were isolated from fruits and berries. 13 C CPMAS NMR spectra were recorded on a Bruker DSX-400 spectrometer for solid chlorides of: cyanidin, cyanidin 3-O-glucoside, cyanidin 3,5-O-diglucoside, pelargonidin and pelargonidin 3-O-glucoside. Dipolar dephased and short contact pulse sequences were used as an aid in the assignment of resonances in CPMAS spectra of solids. Inspection of the spectra indicates that anthocyanidins are in the form of flavylium (cationic) and not in form of the chalcone.: the resonance of C2 appears at ca. 160 ppm and C3 at ca. 135 ppm, whereas C ring opening produces C2 = O, for which chemical shift of ca. 180 ppm can be expected. A comparison of experimental (CPMAS) and predicted (GIAO DFT) shielding constants for cyanidin provided information about the orientation of OH groups, twist angle of aromatic ring B and the localization of the chloride anion.(author)
Yamaguchi, Mineo; Kasamo, Kunihiro
2002-07-01
Tonoplast H(+)-ATPase purified from cultured rice cells (Oryza sativa L. var. Boro) was reconstituted into asolectin liposomes containing steryl glucoside (SG) or acyl steryl glucoside (ASG), and the effects of SG and ASG on proton pumping, ATP-hydrolysis activity and proton permeability of the proteoliposome membranes were investigated. In the proteoliposomes containing 10 mol% SG, proton pumping and ATP-hydrolysis activity were increased to around 140% of those in SG-free proteoliposomes. In the proteoliposomes containing ASG, proton pumping and ATP-hydrolysis activity were decreased to one-tenth of those in ASG-free proteoliposomes at 15 mol% ASG; however, activity increased again slightly in the range between 20 and 40 mol% ASG. The change in proton pumping across the proteoliposome membrane is not due to a change of proteoliposome size nor to the location of the catalytic site of the tonoplast H(+)-ATPase in the proteoliposomes. SG and ASG also reduced the passive proton permeability of the proteoliposomes. These results show that SG and ASG modulate proton pumping across the tonoplast toward stimulation and depression, respectively, and they reduce the passive proton permeability of the tonoplast.
Directory of Open Access Journals (Sweden)
Xiao-Xian Cui
2017-12-01
Full Text Available Hepatitis B virus (HBV infection is endemic in Asia and chronic hepatitis B (CHB is a major public health issue worldwide. Current treatment strategies for CHB are not satisfactory as they induce a low rate of hepatitis B surface antigen (HBsAg loss. Extracts were prepared from lettuce hydroponically cultivated in solutions containing glycine or nitrate as nitrogen sources. The lettuce extracts exerted potent anti-HBV effects in HepG2 cell lines in vitro, including significant HBsAg inhibition, HBV replication and transcription inhibition, without exerting cytotoxic effects. When used in combination interferon-alpha 2b (IFNα-2b or lamivudine (3TC, the lettuce extracts synergistically inhibited HBsAg expression and HBV replication. By using differential metabolomics analysis, Luteolin-7-O-glucoside was identified and confirmed as a functional component of the lettuce extracts and exhibited similar anti-HBV activity as the lettuce extracts in vitro. The inhibition rate on HBsAg was up to 77.4%. Moreover, both the lettuce extracts and luteolin-7-O-glucoside functioned as organic antioxidants and, significantly attenuated HBV-induced intracellular reactive oxygen species (ROS accumulation. Luteolin-7-O-glucoside also normalized ROS-induced mitochondrial membrane potential damage, which suggests luteolin-7-O-glucoside inhibits HBsAg and HBV replication via a mechanism involving the mitochondria. Our findings suggest luteolin-7-O-glucoside may have potential value for clinical application in CHB and may enhance HBsAg and HBV clearance when used as a combination therapy.
Schmidt, Bernd; Elizarov, Nelli; Berger, René; Hölter, Frank
2013-06-14
4-Phenol diazonium salts undergo Pd-catalyzed Heck reactions with various styrenes to 4'-hydroxy stilbenes. In almost all cases higher yields and fewer side products were observed, compared to the analogous 4-methoxy benzene diazonium salts. In contrast, the reaction fails completely with 2- and 3-phenol diazonium salts. For these substitution patterns the methoxy-substituted derivatives are superior.
Zagrobelny, Mika; Scheibye-Alsing, Karsten; Jensen, Niels Bjerg; Møller, Birger Lindberg; Gorodkin, Jan; Bak, Søren
2009-12-02
An essential driving component in the co-evolution of plants and insects is the ability to produce and handle bioactive compounds. Plants produce bioactive natural products for defense, but some insects detoxify and/or sequester the compounds, opening up for new niches with fewer competitors. To study the molecular mechanism behind the co-adaption in plant-insect interactions, we have investigated the interactions between Lotus corniculatus and Zygaena filipendulae. They both contain cyanogenic glucosides which liberate toxic hydrogen cyanide upon breakdown. Moths belonging to the Zygaena family are the only insects known, able to carry out both de novo biosynthesis and sequestration of the same cyanogenic glucosides as those from their feed plants. The biosynthetic pathway for cyanogenic glucoside biosynthesis in Z. filipendulae proceeds using the same intermediates as in the well known pathway from plants, but none of the enzymes responsible have been identified. A genomics strategy founded on 454 pyrosequencing of the Z. filipendulae transcriptome was undertaken to identify some of these enzymes in Z. filipendulae. Comparisons of the Z. filipendulae transcriptome with the sequenced genomes of Bombyx mori, Drosophila melanogaster, Tribolium castaneum, Apis mellifera and Anopheles gambiae indicate a high coverage of the Z. filipendulae transcriptome. 11% of the Z. filipendulae transcriptome sequences were assigned to Gene Ontology categories. Candidate genes for enzymes functioning in the biosynthesis of cyanogenic glucosides (cytochrome P450 and family 1 glycosyltransferases) were identified based on sequence length, number of copies and presence/absence of close homologs in D. melanogaster, B. mori and the cyanogenic butterfly Heliconius. Examination of biased codon usage, GC content and selection on gene candidates support the notion of cyanogenesis as an "old" trait within Ditrysia, as well as its origins being convergent between plants and insects
Directory of Open Access Journals (Sweden)
Jensen Niels
2009-12-01
Full Text Available Abstract Background An essential driving component in the co-evolution of plants and insects is the ability to produce and handle bioactive compounds. Plants produce bioactive natural products for defense, but some insects detoxify and/or sequester the compounds, opening up for new niches with fewer competitors. To study the molecular mechanism behind the co-adaption in plant-insect interactions, we have investigated the interactions between Lotus corniculatus and Zygaena filipendulae. They both contain cyanogenic glucosides which liberate toxic hydrogen cyanide upon breakdown. Moths belonging to the Zygaena family are the only insects known, able to carry out both de novo biosynthesis and sequestration of the same cyanogenic glucosides as those from their feed plants. The biosynthetic pathway for cyanogenic glucoside biosynthesis in Z. filipendulae proceeds using the same intermediates as in the well known pathway from plants, but none of the enzymes responsible have been identified. A genomics strategy founded on 454 pyrosequencing of the Z. filipendulae transcriptome was undertaken to identify some of these enzymes in Z. filipendulae. Results Comparisons of the Z. filipendulae transcriptome with the sequenced genomes of Bombyx mori, Drosophila melanogaster, Tribolium castaneum, Apis mellifera and Anopheles gambiae indicate a high coverage of the Z. filipendulae transcriptome. 11% of the Z. filipendulae transcriptome sequences were assigned to Gene Ontology categories. Candidate genes for enzymes functioning in the biosynthesis of cyanogenic glucosides (cytochrome P450 and family 1 glycosyltransferases were identified based on sequence length, number of copies and presence/absence of close homologs in D. melanogaster, B. mori and the cyanogenic butterfly Heliconius. Examination of biased codon usage, GC content and selection on gene candidates support the notion of cyanogenesis as an "old" trait within Ditrysia, as well as its origins being
Zheng, Yan; Dong, Li-Na; Liu, Min; Chen, Aiju; Feng, Shangcai; Wang, Bingquan; Sun, Dezhi
2014-01-08
The utilization of kaempferol and its glycosides in food and pharmaceutical industries could be improved by the formation of inclusion complexes with cyclodextrins at different pH. This study explores the complexation of kaempferol-4'-glucoside with sulfobutyl ether-β-cyclodextrin (SBE-β-CD), hydroxypropyl-β-cyclodextrin (HP-β-CD), and methylated-β-cyclodextrin (M-β-CD) in phosphate buffer solutions of different pH using isothermal titration calorimetry, UV-vis absorption and proton nuclear magnetic resonance spectroscopy at 298.2 K. Experimental results showed that kaempferol-4'-glucoside binds with the three β- cyclodextrins in the same 1:1 stoichiometry. The rank order of stability constants is SBE-β-CD > HP-β-CD > M-β-CD at the same pH level and pH 6.0 > pH 7.4 > pH 9.0 for the same cyclodextrin. The binding of kaempferol-4'-glucoside with the three β-cyclodextrin derivatives is synergistically driven by enthalpy and entropy at pH 6.0 and enthalpy-driven at pH 7.4 and 9.0. The possible inclusion mode was that in the cavity of β-CD is included the planar benzopyranic-4-one part of the kaempferol-4'-glucoside.
Energy Technology Data Exchange (ETDEWEB)
Vijayakumar, T.; Hubert Joe, I. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India); Reghunadhan Nair, C.P. [Polymers and Special Chemicals Division, Vikram Sarabhai Space Centre, Thiruvananthapuram 695 022, Kerala (India); Jayakumar, V.S. [Centre for Molecular and Biophysics Research, Department of Physics, Mar Ivanios College, Thiruvananthapuram 695 015, Kerala (India)], E-mail: vsjk@vsnl.net
2008-01-22
A comprehensive investigation on the intramolecular charge transfer (ICT) of an efficient {pi}-conjugated potential push-pull NLO chromophore, 4-[N,N-dimethylamino]-4'-nitro stilbene (DANS), from a strong electron-donor group (dimethylamino-N(CH{sub 3}){sub 2}) to a strong electron-acceptor group (nitro-NO{sub 2}) through the {pi}-conjugated bridge (trans-stilbene) has been carried out from their vibrational spectra. The NIR FT-Raman and FT-IR spectra supported by the density functional theory (DFT) quantum chemical computations have been employed to analyze the effects of intramolecular charge transfer on the geometries and the vibrational modes contributing to the linear electro-optic effect of the organic NLO material. It has been observed that the changes in the endocyclic and exocyclic angles result from the charge-transfer interaction of the phenyl ring and the amino group in the electron-donor side of the NLO chromophore. The strongest vibrational modes contributing to the electro-optic effect have been identified and examined from the concurrent IR and Raman activation of {nu}(C=C/C-C) mode, ring C=C stretching modes, in-plane deformation modes, nitro modes and the umbrella mode of methyl groups. Furthermore, the splitting of the vinyl stretching modes and the electronic effects such as hyperconjugation and backdonation on the methyl hydrogen atoms causing the decrease of stretching frequencies and infrared intensities have also been analyzed in detail. The effect of frontier orbitals transition of electron density transfer and the influence of planarity between the phenyl rings of the stilbene moiety on the first hyperpolarizability have also been discussed.
Terreaux, Christian; Wang, Qi; Ioset, Jean-Robert; Ndjoko, Karine; Grimminger, Wolf; Hostettmann, Kurt
2002-04-01
The hydroalcoholic extract of Tinnevelli senna is widely used as a laxative phytomedicine. In order to improve the knowledge of the chemical composition of this extract, LC/MS and LC/MS(n) studies were performed, allowing the on-line identification of most of the known constituents, i. e., flavonoids, anthraquinones and the typical dianthronic sennosides. However, the identity of four compounds could not be ascertained on-line under the given LC/MS conditions. These substances were isolated and their structures elucidated as kaempferol, the naphthalene derivative tinnevellin 8-glucoside and two new carboxylated benzophenone glucosides.
Mahdavi, Mohammad; Pedrood, Keyvan; Safavi, Maliheh; Saeedi, Mina; Pordeli, Mahboobeh; Ardestani, Sussan Kabudanian; Emami, Saeed; Adib, Mehdi; Foroumadi, Alireza; Shafiee, Abbas
2015-05-05
A novel series of 2-arylquinazolinones 7a-o bearing trans-stilbene moiety were designed, synthesized, and evaluated against human breast cancer cell lines including human breast adenocarcinoma (MCF-7 and MDA-MB-231) and human ductal breast epithelial tumor (T-47D). Among the tested compounds, the sec-butyl derivative 7h showed the best profile of activity (IC50 < 5 μM) against all cell lines, being 2-fold more potent than standard drug, etoposide. Our investigation revealed that the cytotoxic activity was significantly affected by N3-alkyl substituents. Furthermore, the morphological analysis by acridine orange/ethidium bromide double staining test and flow cytometry analysis indicated that the prototype compound 7h can induce apoptosis in MCF-7 and MDA-MB-231 cells. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Dai, Ru; Ge, Hui; Howard, Susanne; Qiu, Wenping
2012-12-01
Stilbenic compounds are natural phytoalexins that have antimicrobial activities in plant defense against pathogens. Stilbene synthase (STS) is the key enzyme that catalyzes the biosynthesis of stilbenic compounds. Grapevine genome contains a family of preliminarily annotated 35 STS genes, the regulation of each STS gene needs to be studied to define their roles. In this study, we selected eight STS genes, STS8, STS27/31, STS16/22, STS13/17/23, and applied quantitative polymerase chain reaction (qPCR) to characterize their transcriptional expression profiles in leaf tissues upon infection by the powdery mildew fungus (PM), Erysiphe necator (Schw.) Burr. Their transcripts were also compared in young and old leaves as well as in the berry skin at five developmental stages in Vitis vinifera 'Cabernet Sauvignon' and Vitis aestivalis 'Norton'. The results showed that transcripts of selected STS genes increased significantly in Cabernet Sauvignon leaves at 24 and 48 h post inoculation with PM spores and remained unchanged in Norton leaves in response to the PM infection. Transcripts of STS8, STS27/31 and STS13/17/23 were more abundant in the old leaves of Norton than in Cabernet Sauvignon. STS genes showed lower expression levels in young leaves than in old leaves. Transcript levels of the eight STS genes increased drastically in the berry skin of Cabernet Sauvignon and Norton post véraison. In addition, the content of trans-resveratrol in the berry skin rapidly increased post véraison and reached the highest level at harvest. These assays demonstrated that individual STS genes are regulated differentially in response to PM infection and during development in the two grape varieties. The present study yields basic knowledge for further investigation of the regulation and function of each STS gene in grapevine and provides experimental evidences for the functional annotation of the STS gene family in the grapevine genome. Copyright © 2012 Elsevier Ireland Ltd. All
Tokpohozin, Sedjro Emile; Fischer, Susann; Sacher, Bertram; Becker, Thomas
2016-11-01
Sorghum malt used during African beer processing contains a high level of cyanogenic glucoside (dhurrin), up to 1375 ppm. In traditional sorghum malting and mashing, dhurrin is not sufficiently hydrolyzed due to uncontrolled germination and a high gelatinization temperature. The cyanide content of traditional African beers (11 ppm) is higher than the minimum dose (1 ppm) required to form carcinogenic ethyl carbamate during alcoholic fermentation. In the detoxification process, aryl-β-d-glucosidase (dhurrinase) is the "key component". For significant dhurrin hydrolysis during mashing, optimizing dhurrinase synthesis during malting is a good solution to reduce dhurrin completely to below the harmful dose in the sorghum wort. Lactic acid bacteria which exhibit aryl-β-d-glucosidase prior to alcoholic fermentation may help to reduce ethyl carbamate content in alcoholic beverages. Moreover, some specific β-d-glucosidases have a dual property, being able to cleave and synthesize glucosides bonds and thereby generating good precursors for beer bioflavouring. Copyright © 2016 Elsevier Ltd. All rights reserved.
Enantiopure cyclopentane building blocks from iridoid glucosides
DEFF Research Database (Denmark)
Rasmussen, Jon Holbech
.e. S. albida, S. woronowic, S. subvelutina, S. lateriflora, S. altissima, were investigated. It was found that in the water-soluble part of an ethanolic extract, a cinnamic ester of catalpol, scutellarioside I (348), was extractable into EtOAc. A method was developed in which the preparation of a water......-soluble extract of the plant material, extraction of 348 into EtOAc and acetylation of the crude EtOAc-extract, gave an acetylated crude product, from which scutellarioside I pentaacetate (351) was crystallised. Thus, 351 was obtained without the use of chromatography. Conversely, the purification of 5 was only......, pentaacetate 351 was transformed into an iridoid glucoside diacetonide 371. Ozonolysis of 371 followed by a reductive work-up procedure (NaBH4) led to the partially protected cyclopentane derivative 352. The ozonolysis/reduction sequence constitutes a new method in iridoid chemistry to obtain cyclopentanoid...
Jiang, Hai; Xing, Xudong; Yan, Meiling; Guo, Xinyue; Yang, Lin; Yang, Liu
2018-06-01
Two new monoterpene glucosides: xanmonoter A (1) and xanmonoter B (2) were isolated from Xanthium strumarium. Their structures were elucidated on the basis of 1D and 2D NMR, MS and CD analysis. Compounds 1 and 2 were tested for their anti-inflammatory activity with IC 50 values of 17.4, 22.1 μM, respectively.
Wei, Yun; Xie, Qianqian; Fisher, Derek; Sutherland, Ian A
2011-09-09
Flaveria bidentis (L.) Kuntze is an annual alien weed of Flaveria Juss. (Asteraceae) in China. Bioactive compounds, mainly flavonol glycosides and flavones from F. bidentis (L.) Kuntze, have been studied in order to utilize this invasive weed, Analytical high-performance counter-current chromatography (HPCCC) was successfully used to separate patuletin-3-O-glucoside, a mixture of hyperoside (quercetin-3-O-galactoside) and 6-methoxykaempferol-3-O-galactoside, astragalin, quercetin, kaempferol and isorhamnetin using two runs with different solvent system. Ethyl acetate-methanol-water (10:1:10, v/v) was selected by analytical HPCCC as the optimum phase system for the separation of patuletin-3-O-glucoside, a mixture of hyperoside and 6-methoxykaempferol-3-O-galactoside, and astragalin. A Dichloromethane-methanol-water (5:3:2, v/v) was used for the separation of quercetin, kaempferol and isorhamnetin. The separation was then scaled up: the crude extract (ca 1.5 g) was separated by preparative HPCCC, yielding 12 mg of patuletin-3-O-glucoside at a purity of 98.3%, yielding 9 mg of a mixture of hyperoside and 6-methoxykaempferol-3-O-galactoside constituting over 98% of the fraction, and 16 mg of astragalin (kaempferol-3-O-glucoside) at a purity of over 99%. The pump-out peaks are isorhanetin (98% purity), kaemferol (93% purity) and quercitin (99% purity). The chemical structure of patuletin-3-O-glucoside and astragalin were confirmed by MS and ¹H, ¹³C NMR. Copyright © 2011 Elsevier B.V. All rights reserved.
Conversion of the Iridoid Glucoside Antirrhinoside into 3-Azabicyclo[3.3.0]-octane Building Blocks
DEFF Research Database (Denmark)
Franzyk, Henrik; Frederiksen, Signe Maria; Jensen, Søren Rosendal
2000-01-01
The iridoid glucoside antirrhinoside (1) was transformed into polysubstituted 3-azabicyclo[3.3.0]octanes 3, 12 and 13 in 4-5 steps. Ozonolysis of the diacetonide of 1 and of its 7-deoxy-derivative 8 afforded cyclopentanoids 2 and 10, respectively. Conditions for the selective conversion of 2 and 10...
Total glucosides of paeony prevents juxta-articular bone loss in experimental arthritis
Wei, Chen Chao; You, Fan Tian; Mei, Li Yu; Jian, Sun; Qiang, Chen Yong
2013-01-01
Background Total glucosides of paeony (TGP) is a biologically active compound extracted from Paeony root. TGP has been used in rheumatoid arthritis therapy for many years. However, the mechanism by which TGP prevents bone loss has been less explored. Methods TGP was orally administered for 3?months to New Zealand rabbits with antigen-induced arthritis (AIA). Digital x-ray knee images and bone mineral density (BMD) measurements of the subchondral knee bone were performed before sacrifice. Chon...
A new flavonol glucoside from the aerial parts of Sida glutinosa.
Das, Niranjan; Achari, Basudev; Harigaya, Yoshihiro; Dinda, Biswanath
2011-10-01
Phytochemical investigation on the dried aerial parts of Sida glutinosa has led to the isolation of a new flavonol glucoside, glutinoside (1), along with seven known compounds, 24(28)-dehydromakisterone A (2), 1,2,3,9-tetrahydropyrrolo[2,1-b]-quinazolin-3-amine (3), docosanoic acid, 1-triacontanol, campesterol, stigmasterol, and β-sitosterol. The structures of these compounds were elucidated by means of extensive spectroscopic techniques as well as GC/MS analysis (for sterols) and comparison with the literature data. All these seven known compounds are reported from this plant for the first time.
Ramirez-Lopez, L M; McGlynn, W; Goad, C L; Mireles Dewitt, C A
2014-04-15
Phenolic acids, flavanols, flavonols and stilbenes (PAFFS) were isolated from whole grapes, juice, or pomace and purified using enzymatic hydrolysis. Only anthocyanin mono-glucosides and a few of the oligomers from Cynthiana grape (Vitis aestivalis) were analysed. Flavonoid-anthocyanin mono-glucosides (FA) were isolated using methanol/0.1% hydrochloric acid extraction. In addition, crude extractions of phenolic compounds from Cynthiana grape using 50% methanol, 70% methanol, 50% acetone, 0.01% pectinase, or petroleum ether were also evaluated. Reverse phase high performance liquid chromatography (RP-HPLC) with photodiode array (PDA) detector was used to identify phenolic compounds. A method was developed for simultaneous separation, identification and quantification of both PAFFS and FA. Quantification was performed by the internal standard method using a five points regression graph of the UV-visible absorption data collected at the wavelength of maximum absorbance for each analyte. From whole grape samples nine phenolic compounds were tentatively identified and quantified. The individual phenolic compounds content varied from 3 to 875 mg kg⁻¹ dry weight. For juice, twelve phenolic compounds were identified and quantified. The content varied from 0.07 to 910 mg kg⁻¹ dry weight. For pomace, a total of fifteen phenolic compounds were tentatively identified and quantified. The content varied from 2 mg kg⁻¹ to 198 mg kg⁻¹ dry matter. Results from HPLC analysis of the samples showed that gallic acid and (+)-catechin hydrate were the major phenolic compounds in both whole grapes and pomace. Cyanidin and petunidin 3-O-glucoside were the major anthocyanin glucosides in the juice. Published by Elsevier Ltd.
Synthesis and biological evaluation of novel dioxa-bicycle C-aryl glucosides as SGLT2 inhibitors.
Yan, Qi; Ding, Ning; Li, Yingxia
2016-02-08
A series of novel C-aryl glucosides containing dioxa-bicycle were synthesized and evaluated for inhibition activity against hSGLT2. Among the compounds tested, compound 6a showed moderate SGLT2 inhibition activities at 700 nM. The results could benefit the discovery of new SGLT2 inhibitors. Copyright © 2015 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Rasmussen, P. H.; Nielsen, Kristian Fog; Ghorbani, F.
2012-01-01
toxin may again be released after hydrolysis in the digestive tracts of animals and humans. Today, our knowledge of the occurrence of these compounds in cereal grains is limited. In this paper, a LC-MS/MS method for the simultaneous determination of DON, deoxynivalenol-3-β-D-glucoside (DON-3-glucoside......), 3 acetyl-DON, nivalenol, fusarenon-X, diacetoxyscirpenol, HT-2 toxin, and T-2 toxin in naturally (n = 48) and artificially (n = 30) contaminated cereal grains (wheat, barley, oat, rye triticale) is reported. The method has also been applied to whole fresh maize plant intended for production of maize...
Terazawa, Saori; Uemura, Yuka; Koyama, Yuka; Kawakami, Susumu; Sugimoto, Sachiko; Matsunami, Katsuyoshi; Otsuka, Hideaki; Shinzato, Takakazu; Kawahata, Masatoshi; Yamaguchi, Kentaro
2017-01-01
Microtropins Q-W, (2S,3R)-2-ethyl-2,3-dihydroxybutyrate of various glucosides and glucose, as well as three ent-labdane diterpenoid glucosides, named microtropiosides G, H and I, an ursane-type triterpene diglucoside and a flavonoid glycoside were isolated from the MeOH extract of the leaves of Microtropis japonica. The structure of microtropioside A, also isolated from the branches of M. japonica, was elucidated spectroscopically in a previous experiment and was found to possess a rare seven-membered oxyrane ring. Its structure was confirmed by X-ray crystallographic analysis of its pentaacetate.
Leaching of cyanogenic glucosides and cyanide from white clover green manure
DEFF Research Database (Denmark)
Bjarnholt, Nanna; Lægdsmand, Mette; Hansen, Hans Chr. Bruun
2008-01-01
Use of crops for green manure as a substitute for chemical fertilizers and pesticides is an important approach towards more sustainable agricultural practices. Green manure from white clover is rich in nitrogen but white clover also produces the cyanogenic glucosides (CGs) linamarin...... and lotaustralin; CGs release toxic hydrogen cyanide (HCN) upon hydrolysis which may be utilized for pest control. We demonstrate that applying CGs in the form of a liquid extract of white clover to large columns of intact agricultural soils can result in leaching of toxic cyanide species to a depth of at least 1...
Synthetic yeast based cell factories for vanillin-glucoside production
DEFF Research Database (Denmark)
Strucko, Tomas
and controlled expression/overexpression of genes of interest. De novo biosynthetic pathway for vanillin-β-glucoside production was employed as a model system for several case studies in this project. In order to construct yeast cell factories fulfilling current demands of industrial biotechnology, methods......The yeast Saccharomyces cerevisiae is well a characterized microorganism and widely used as eukaryotic model organism as well as a key cell factory for bioproduction of various products. The latter comprise a large variety of scientifically and industrially relevant products such as low-value bulk...... chemicals and biofuels, food additives, high-value chemicals and recombinant proteins. Despite the recent achievements in the fields of systems biology and metabolic engineering together with availability of broad genetic engineering toolbox, the full potential of S. cerevisiae as a cell factory is not yet...
Knauf, Philip A; Law, Foon-Yee; Leung, Tze-Wah Vivian; Atherton, Stephen J
2004-09-28
Previous fluorescence resonance energy transfer (FRET) measurements, using BIDS (4-benzamido-4'-isothiocyanostilbene-2,2'-disulfonate) as a label for the disulfonic stilbene site and FM (fluorescein-5-maleimide) as a label for the cytoplasmic SH groups on band 3 (AE1), combined with data showing that the cytoplasmic SH groups lie about 40 A from the cytoplasmic surface of the lipid bilayer, would place the BIDS sites very near the membrane's inner surface, a location that seems to be inconsistent with current models of AE1 structure and mechanism. We reinvestigated the BIDS-FM distance, using laser single photon counting techniques as well as steady-state fluorescence of AE1, in its native membrane environment. Both techniques agree that there is very little energy transfer from BIDS to FM. The mean energy transfer (E), based on three-exponential fits to the fluorescence decay data, is 2.5 +/- 0.7% (SEM, N = 12). Steady-state fluorescence measurements also indicate BIDS to FM. These data indicate that the BIDS sites are probably over 63 A from the cytoplasmic SH groups, placing them near the middle or the external half of the lipid bilayer. This relocation of the BIDS sites fits with other evidence that the disulfonic stilbene sites are located farther toward the external membrane surface than Glu-681, a residue near the inner membrane surface whose modification affects the pH dependence and anion selectivity of band 3. The involvement of two relatively distant parts of the AE1 protein in transport function suggests that the transport mechanism requires coordinated large-scale conformational changes in the band 3 protein.
Directory of Open Access Journals (Sweden)
Jorge Del Cueto
2017-05-01
Full Text Available Almond and sweet cherry are two economically important species of the Prunus genus. They both produce the cyanogenic glucosides prunasin and amygdalin. As part of a two-component defense system, prunasin and amygdalin release toxic hydrogen cyanide upon cell disruption. In this study, we investigated the potential role within prunasin and amygdalin and some of its derivatives in endodormancy release of these two Prunus species. The content of prunasin and of endogenous prunasin turnover products in the course of flower development was examined in five almond cultivars – differing from very early to extra-late in flowering time – and in one sweet early cherry cultivar. In all cultivars, prunasin began to accumulate in the flower buds shortly after dormancy release and the levels dropped again just before flowering time. In almond and sweet cherry, the turnover of prunasin coincided with increased levels of prunasin amide whereas prunasin anitrile pentoside and β-D-glucose-1-benzoate were abundant in almond and cherry flower buds at certain developmental stages. These findings indicate a role for the turnover of cyanogenic glucosides in controlling flower development in Prunus species.
The multiple strategies of an insect herbivore to overcome plant cyanogenic glucoside defence
DEFF Research Database (Denmark)
Pentzold, Stefan; Zagrobelny, Mika; Roelsgaard, Pernille Sølvhøj
2014-01-01
Cyanogenic glucosides (CNglcs) are widespread plant defence compounds that release toxic hydrogen cyanide by plant bglucosidase activity after tissue damage. Specialised insect herbivores have evolved counter strategies and some sequester CNglcs, but the underlying mechanisms to keep CNglcs intact...... during feeding and digestion are unknown. We show that CNglc-sequestering Zygaena filipendulae larvae combine behavioural, morphological, physiological and biochemical strategies at different time points during feeding and digestion to avoid toxic hydrolysis of the CNglcs present in their Lotus food...
Mathis Ii, Stephan R; Golafale, Saki T; Bacsa, John; Steiner, Alexander; Ingram, Conrad W; Doty, F Patrick; Auden, Elizabeth; Hattar, Khalid
2017-01-03
Ultra large pore isostructural metal organic frameworks (MOFs) which exhibit both photoluminescence and scintillation properties, were synthesized from trans-4,4'-stilbenedicarboxylic acid (H 2 L) and trivalent lanthanide (Ln) metal salts under solvothermal conditions (Ln = Er 3+ (1) and Tm 3+ (2)). This new class of mesoporous materials is a non-interpenetrating network that features ultra-large diamond shaped pores of dimensions with approximate cross-sectional dimensions of 28 Å × 12 Å. The fully deprotonated ligand, L, is isolated and rigidified as it serves as the organic linker component of the MOF structure. Its low density unit cells possess asymmetric units with two crystallographically independent Ln 3+ ions in seven coordinate arrangements. A distinct feature of the structure is the bis-bidentate carboxylate groups. They serve as a ligand that coordinates two Ln(iii) ions while each L connects four Ln(iii) ions yielding an exceptionally large diamond-shaped rectangular network. The structure exhibits ligand-based photoluminescence with increased lifetime compared to free stilbene molecules on exposure to UV radiation, and also exhibits strong scintillation characteristics, comprising of both prompt and delayed radioluminescence features, on exposure to ionizing radiation.
Caffeoyl glucosides from Nandina domestica inhibit LPS-induced endothelial inflammatory responses.
Kulkarni, Roshan R; Lee, Wonhwa; Jang, Tae Su; Lee, JungIn; Kwak, Soyoung; Park, Mi Seon; Lee, Hyun-Shik; Bae, Jong-Sup; Na, MinKyun
2015-11-15
Endothelial dysfunction is a key pathological feature of many inflammatory diseases, including sepsis. In the present study, a new caffeoyl glucoside (1) and two known caffeoylated compounds (2 and 3) were isolated from the fruits of Nandina domestica Thunb. (Berberidaceae). The compounds were investigated for their effects against lipopolysaccharide (LPS)-mediated endothelial inflammatory responses. At 20 μM, 1 and 2 inhibited LPS-induced hyperpermeability, adhesion, and migration of leukocytes across a human endothelial cell monolayer in a dose-dependent manner suggesting that 1 and 2 may serve as potential scaffolds for the development of therapeutic agents to treat vascular inflammatory disorders. Copyright © 2015 Elsevier Ltd. All rights reserved.
Biological activity of quercetin-3-O-glucoside, a known plant flavonoid.
Razavi, Seyed Mehdi; Zahri, Saber; Zarrini, Gholamreza; Nazemiyeh, Hossein; Mohammadi, Sariyeh
2009-01-01
Cytotoxic, phytotoxic, antimicrobial and antioxidant effects of quercetin 3-O-glucoside (Q3G) isolated by HPLC from aerial parts of Prangos ferulaceae was studied by MTT assay, lettuce germination assay, disk diffusion and DPPH method. Our results showed that Q3G exhibits high antioxidant effect with RC(50) of 22 microg/mL, it has low cytotoxicity and no antibacterial effects. Q3G exhibits high phytotoxic effect with IC(50) value of 282.7 microg/ml, as well. It is assumed that Q3G does not play a defense role in plants and it may act as an allelopatic agent.
Zhang, Yi; Han, Lifeng; Ge, Dandan; Liu, Xuefeng; Liu, Erwei; Wu, Chunhua; Gao, Xiumei; Wang, Tao
2013-02-27
Seventy percent ethanol-water extract from the leaves of Mangifera indica L. (Anacardiaceae) was found to show an inhibitory effect on triglyceride (TG) accumulation in 3T3-L1 cells. From the active fraction, six new benzophenone C-glucosides, foliamangiferosides A(3) (1), A(4) (2), C(4) (3), C(5) (4), C(6) (5), and C(7) (6) together with 11 known benzophenone C-glucosides (7-17) were obtained. In this paper, isolation, structure elucidation (1-6), and MS fragment cleavage pathways of all 17 isolates were studied. 1-6 showed inhibitory effects on TG and free fatty acid accumulation in 3T3-L1 cells at 10 μM.
A method for the identification and quantification of citrus limonoid glucosides in juices based upon high performance liquid chromatography (HPLC) separation coupled to post-column reaction with Ehrlichs’s reagent has been developed. This method utilizes a phenyl stationary phase and an isocratic ...
Citrus limonoid glucosides are found in large quantities in citrus fruits and seeds. Characterization and quantification of these compounds is important because they contribute to citrus quality and are reported to be biologically active. Unlike other bioactive compounds (e.g., flavonoids) present...
Thalassiolin D: a new flavone O-glucoside Sulphate from the seagrass Thalassia hemprichii.
Hawas, Usama W; Abou El-Kassem, Lamia T
2017-10-01
Thalassiolin D, a new flavone O-glucoside sulphate along with three flavonoids, two steroids, p-hydroxybenzoic acid, 4,4'-dihydroxybenzophenone and nitrogen compound, octopamine were isolated from the seagrass Thalassia hemprichii, collected from the Saudi Red Sea coast. By extensive spectroscopic analysis including 1D and 2D NMR and MS data, the structure of the new compound was elucidated as diosmetin 7-O-β-glucosyl-2″-sulphate. The new compound displayed moderately in vitro antiviral HCV protease activity with IC 50 value 16 μM.
Tetrahydroxystilbene Glucoside Effectively Prevents Apoptosis Induced Hair Loss
Directory of Open Access Journals (Sweden)
Lulu Chen
2018-01-01
Full Text Available The effect of Polygonum multiflorum against hair loss has been widely recognized. 2,3,5,4′-Tetrahydroxystilbene-2-O-β-D-glucoside (TSG is the main component of Polygonum multiflorum; however, its role in hair regeneration has not been established. To evaluate the hair growth-promoting activity of TSG, depilated C57BL/6J mice were topically treated with normal saline, TSG, Pifithrin-α, Minoxidil for 2 weeks. In this study, we identified that p53, Caspase-3, Active Caspase-3, and Caspase-9 were obviously upregulated in the skin of human and mice with hair loss by western blot analysis. Depilated mice treated with TSG showed markedly hair regrowth. TUNEL+ cells were also reduced in mice with TSG. These changes were accompanied with inhibition of Fas, p53, Bax, Active Caspase-3, and Procaspase-9 activities. These results demonstrated that TSG exerts great hair regrowth effect on hair loss, which was probably mediated by inhibition of p53, Fas, and Bax induced apoptosis.
DEFF Research Database (Denmark)
Pentzold, Stefan; Jensen, Mikael Kryger; Matthes, Annemarie
2017-01-01
. Cyanogenic plants contain cyanogenic glucosides and release hydrogen cyanide due to such a well-characterized two-component system. Some arthropods are also cyanogenic, but comparatively little is known about their system. Here, we identify a specific β-glucosidase (ZfBGD2) involved in cyanogenesis from...... larvae of Zygaena filipendulae (Lepidoptera, Zygaenidae), and analyse the spatial organization of cyanide release in this specialized insect. High levels of ZfBGD2 mRNA and protein were found in haemocytes by transcriptomic and proteomic profiling. Heterologous expression in insect cells showed that Zf......BGD2 hydrolyses linamarin and lotaustralin, the two cyanogenic glucosides present in Z. filipendulae. Linamarin and lotaustralin as well as cyanide release were found exclusively in the haemoplasma. Phylogenetic analyses revealed that ZfBGD2 clusters with other insect β...
Guillois, Kevin
2012-02-01
The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda\\'s method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.
Guillois, Kevin; Burel, Laurence; Tuel, Alain; Caps, Valerie
2012-01-01
The kinetics of the heterogeneous gold-catalyzed aerobic epoxidation of stilbene in the liquid phase has been shown to be hindered by diffusion limitations, due to the use of supports which are unsuitable to apolar reaction media. The choice of these supports is generally dictated by the ability of standard methods of preparation to stabilize highly dispersed gold nanoparticles on them. Hence, new methods need to be designed in order to produce catalytically active gold nanoparticles on hydrophobic supports in general and on passivated silicas in particular. By investigating Tsukuda's method to produce colloidal solutions of gold nanoparticles upon reduction of the triphenylphosphine gold chloride complex in solution, we found that direct reduction of AuPPh3Cl in the presence of a commercially available silica support functionalized with dimethylsiloxane, Aerosil R972, leads, in a highly reproducible and potentially scalable way, to the best catalyst ever reported for this reaction. (C) 2011 Elsevier BM. All rights reserved.
Koyama, Junko; Morita, Izumi; Fujiyoshi, Hirotaka; Kobayashi, Norihiro
2005-05-01
The simultaneous separation and determination of major anthraquinones (emodin, chrysophanol, rhein and their glucosides, aloe-emodin, sennoside A, and sennoside B) of Rhei Rhizoma were achieved by cyclodextrin modified capillary zone electrophoresis. The running electrolyte used in this method was 0.005 M alpha-cyclodextrin in 0.03 M borate buffer (pH 10.0) containing 20% acetonitrile, with an applied voltage of 20 kV.
C-Aryl glucoside SGLT2 inhibitors containing a biphenyl motif as potential anti-diabetic agents.
Ding, Yuyang; Mao, Liufeng; Xu, Dengfeng; Xie, Hui; Yang, Ling; Xu, Hongjiang; Geng, Wenjun; Gao, Yong; Xia, Chunguang; Zhang, Xiquan; Meng, Qingyi; Wu, Donghai; Zhao, Junling; Hu, Wenhui
2015-07-15
A series of highly active C-aryl glucoside SGLT2 inhibitors containing a biphenyl motif were designed and synthesized for biological evaluation. Among the compounds tested, compound 16l demonstrated high inhibitory activity against SGLT2 (IC50=1.9 nM) with an excellent pharmacokinetic profile. Further study indicated that the in vivo efficacy of compound 16l was comparable to that of dapagliflozin, suggesting that further development would be worthwhile. Copyright © 2015 Elsevier Ltd. All rights reserved.
A new diterpenoid glucoside and two new diterpenoids from the fruit of Vitex agnus-castus.
Ono, Masateru; Eguchi, Keisuke; Konoshita, Masatarou; Furusawa, Chisato; Sakamoto, Junich; Yasuda, Shin; Ikeda, Tsuyoshi; Okawa, Masafumi; Kinjo, Junei; Yoshimitsu, Hitoshi; Nohara, Toshihiro
2011-01-01
A new labdane-type diterpenoid glucoside and two new labdane-type diterpenoids were isolated from the fruit (chasteberry) of Vitex agnus-castus L. (Verbenaceae) along with 14 known compounds comprising seven labdane-type diterpenoids, one halimane-type diterpenoid, two oleanane-type triterpenoids, two ursane-type triterpenoids, one aromadendrane-type sesquiterpenoid, and one flavonoid. Their structures were characterized on the basis of spectroscopic data as well as chemical evidence. Furthermore, the antioxidative activities of the flavonoid were evaluated using five different analyses.
International Nuclear Information System (INIS)
Salmah Moosa; Seri Chempaka Mohd Yusof; Ruzalina Bahrin; Maizatul Akmam Mohd Nasir
2014-01-01
Radiation processing of food materials by gamma-radiation is a well established method for microbial decontamination and insect disinfestation. Irradiation of spices at doses ranging from 10 to 30 kGy has been reported to result in complete elimination of microorganisms with negligible changes in the flavour quality. The effect of gamma-radiation on microflora and vanillin content of cured vanilla beans in the dose range of 5-50 kGy has been investigated, but its effect on other major aroma compounds and vanillin glucoside (vanillin aroma precursor) remaining after curing have not been studied so far. Vanillin (4-hydroxy-3-methoxybenzaldehyde) is one such compound used as a flavouring agent and as a dietary component. It is the major component of natural vanilla, which is one of the most widely used and important flavouring materials throughout the world. Vanillin is an antioxidant capable of protecting membrane against lipid peroxidation and DNA against strand breaks induced by reactive oxygen species. The present work was aimed to study the effect of gamma-radiation processing on the major aroma compounds of cured vanilla beans and also to investigate possible enhancement in vanillin content by the radiolytic breakdown of vanillin glucoside present already. Cured vanilla beans were irradiated (5, 10, 15, 20 and 30 kGy) and the vanillin content of control and irradiated samples were analysed, respectively for a possible enhancement of vanillin content by radiolysis of vanillin glucoside. Radiolytic breakdown of glycosidic precursors of aroma constituents and consequent release of free aroma was shown to result in the enhancement of aroma quality of these products. Since a considerable amount of vanillin exists as its glycosidic precursor in cured vanilla pods, a possible enhancement in yield of vanillin by radiation processing is thus expected. Hence the highly stable oxygen-carbon linkage between vanillin and glucose limits the possible enhancement of aroma
Directory of Open Access Journals (Sweden)
Pei Yin Tay
2014-08-01
Full Text Available The effects of ethanol concentration (0%–100%, v/v, solid-to-solvent ratio (1:10–1:60, w/v and extraction time (30–180 min on the extraction of polyphenols from agarwood (Aquilaria crassna were examined. Total phenolic content (TPC, total flavonoid content (TFC and total flavanol (TF assays and HPLC-DAD were used for the determination and quantification of polyphenols, flavanol gallates (epigallocatechin gallate—EGCG and epicatechin gallate—ECG and a benzophenone (iriflophenone 3-C-β-glucoside from the crude polyphenol extract (CPE of A. crassna. 2,2'-Diphenyl-1-picrylhydrazyl (DPPH radical scavenging activity was used to evaluate the antioxidant capacity of the CPE. Experimental results concluded that ethanol concentration and solid-to-solvent ratio had significant effects (p < 0.05 on the yields of polyphenol and antioxidant capacity. Extraction time had an insignificant influence on the recovery of EGCG, ECG and iriflophenone 3-C-β-glucoside, as well as radical scavenging capacity from the CPE. The extraction parameters that exhibited maximum yields were 40% (v/v ethanol, 1:60 (w/v for 30 min where the TPC, TFC, TF, DPPH, EGCG, ECG and iriflophenone 3-C-β-glucoside levels achieved were 183.5 mg GAE/g DW, 249.0 mg QE/g DW, 4.9 mg CE/g DW, 93.7%, 29.1 mg EGCG/g DW, 44.3 mg ECG/g DW and 39.9 mg iriflophenone 3-C-β-glucoside/g DW respectively. The IC50 of the CPE was 24.6 mg/L.
Jianxia Sun; Zhouxiong Mei; Yajuan Tang; Lijun Ding; Guichuan Jiang; Chi Zhang; Aidong Sun; Weibin Bai
2016-01-01
As an alternative preservation method to thermal treatment, ultrasound is a novel non-thermal processing technology that can significantly avoid undesirable nutritional changes. However, recently literature indicated that anthocyanin degradation occurred when high amplitude ultrasound was applied to juice. This work mainly studied the effect of ultrasound on the stability and antioxidant capacity of pelargonidin-3-glucoside (Pg-3-glu) and the correlation between anthocyanin degradation and •O...
Development and Evaluation of Monoclonal Antibodies for the Glucoside of T-2 Toxin (T2-Glc)
Maragos, Chris M.; Kurtzman, Cletus; Busman, Mark; Price, Neil; McCormick, Susan
2013-01-01
The interactions between fungi and plants can yield metabolites that are toxic in animal systems. Certain fungi are known to produce sesquiterpenoid trichothecenes, such as T-2 toxin, that are biotransformed by several mechanisms including glucosylation. The glucosylated forms have been found in grain and are of interest as potential reservoirs of T-2 toxin that are not detected by many analytical methods. Hence the glucosides of trichothecenes are often termed “masked” mycotoxins. The glucos...
Antiinflammatory and antioxidant flavonoids from Helichrysum kraussii and H. odoratissimum flowers.
Legoalea, Percival B; Mashimbyeb, Mahlori J; van Rec, Teunis
2013-10-01
Organic extracts of the flowers of Helichrysum kraussii and H. odoratissimum contain several bioactive flavonoids, characterized by 'H NMR, '3C NMR and mass spectrometry. Four flavonoids, 5,6-dihydroxy-3,7,8-trimethoxyflavone, 5,7-dihydroxy-3-methoxyflavone, 3',4',5,7-tetrahydroxy-3-methoxyflavone and 3',4',3,5-tetrahydroxy-7-methoxyflavone, have antioxidant activity by the DPPH free radical assay, while 5,6-dihydroxy-3,7,8-trimethoxyflavone and 3',4',3,5-tetrahydroxy-7-methoxyflavone have promising anti-inflammatory activity.
Li, Yushan; Ohizumi, Yasushi
2004-07-01
20 medicinal plants of Paraguay and 3 medicinal plants of Thailand were examined on nerve growth factor (NGF)-potentiating activities in PC12D cells. The trail results demonstrated that the methanol extracts of four plants, Verbena littoralis, Scoparia dulcis, Artemisia absinthium and Garcinia xanthochymus, markedly enhanced the neurite outgrowth induced by NGF from PC12D cells. Furthermore, utilizing the bioactivity-guided separation we successfully isolated 32, 4 and 5 constituents from V. littoralis, S. dulcis and G. xanthochymus, respectively, including nine iridoid and iridoid glucosides (1-9), two dihydrochalcone dimers (10 and 11), two flavonoids and three flavonoid glycosides (12-16), two sterols (17 and 18), ten triterpenoids (19-28), five xanthones (29-33), one naphthoquinone (34), one benzenepropanamide (35), four phenylethanoid glycosides (36-39) and two other compounds (40 and 41). Among which, 15 compounds (1-4, 10-11, 14-18, 29-31 and 34) were new natural products. The results of pharmacological trails verified that littoralisone (1), gelsemiol (5), 7a-hydroxysemperoside aglucone (6), verbenachalcone (10), littorachalcone (11), stigmast-5-ene 3beta,7alpha,22alpha-triol (18), ursolic acid (19), 3beta-hydroxyurs-11-en-28,13beta-olide (24), oleanolic acid (25), 2alpha,3beta-dihydroxyolean-12-en-28-oic acid (26), 1,4,5,6-tetrahydroxy-7,8-di(3-methylbut-2-enyl)xanthone (29), 1,2,6-trihydroxy-5-methoxy-7-(3-methylbut-2-enyl)xanthone (30), 1,3,5,6-tetrahydroxy-4,7,8-tri(3-methyl-2-butenyl)xanthone (31), 12b-hydroxy-des-D-garcigerrin A (32), garciniaxanthone E (33) and (4R)-4,9-dihydroxy-8-methoxy-alpha-lapachone (34) elicited marked enhancement of NGF-mediated neurite outgrowth in PC12D cells. These substances may contribute to the basic study and the medicinal development for the neurodegenerative disorder.
DEFF Research Database (Denmark)
Li, Bin; Bhandari, Dhaka Ram; Römpp, Andreas
2016-01-01
histochemical studies of tannins using unspecific staining reagents, individual gallotannin species were accurately localized and unequivocally discriminated from other phenolic components in the root tissues. High-quality ion images were obtained, providing significant clues for understanding the biosynthetic...... pathway of gallotannins and monoterpene glucosides and possibly helping to decipher the role of tannins in xylem cells differentiation and in the defence mechanisms of plants, as well as to investigate the interrelationship between tannins and lignins....
Bajcsik, Nicole; Pfab, Rudolf; Pietsch, Jörg
2017-05-01
A selective and sensitive analytical method for the simultaneous determination of cucurbitacin B, E, I and E-glucoside in plant material and body fluids by HPLC-MS was developed. After liquid-liquid extraction with dichlormethane, separation was achieved on a Phenomenex Luna Pentafluorophenyl Column (150mm×2mm, 5μm) using acetonitrile-water (90:10, v/v) as mobile phase system. Detection was performed using a 3200 Q Trap mass spectrometer (AB Sciex). For analysis Q1 Scans with negative ionisation were chosen. The method was validated for serum as the matrix of choice. Limits of detection are in the picogram range, limits of quantification are between 0.05 and 0.42ng/mL, recoveries are above 50%. The assay was linear in the calibration range from 1.0 to 50ng/mL for cucurbitacin E and from 0.10 to 50ng/mL for the cucurbitacins B, I and E-glucoside. The applicability of the method was demonstrated by the determination of cucurbitacins in zucchini plant material and body fluids from intoxication cases. Copyright © 2017 Elsevier B.V. All rights reserved.
Post-harvest UVC irradiation effect on anthocyanin profile of grape berries
International Nuclear Information System (INIS)
Rosas, I. de; Ponce, M.; Gargantini, R.; Martinez, L.
2010-01-01
Anthocyanins are a class of phenolic compounds that contribute to the color of red grapes and have shown nutraceutical properties for human health. UVC light irradiation has been proved to increase phenolic compounds such as stilbenes, but its effect on anthocyanins has not been reported. The aim of this work was to identify the best treatment conditions of UVC light irradiation on post-harvest berries of Malbec (M), Cabernet Sauvignon (CS) and Tempranillo (T) for anthocyanin increments. Grape berries were irradiated with 240 W at 20 and 40 cm from the light source, for 30, 60 and 120 seconds. Both, irradiated and control grapes were stored on darkness at 20 C degree until anthocyanin extraction with methanol/ClH. HPLC analysis were performed and nine anthocyanins were quantified. UVC light irradiation modified the anthocyanin profile of the three cultivars. All the glucoside anthocyanins derivates and peonidin-acetyl-glucoside, as well as total anthocyanins were increased when CS berries were exposed to UVC for 120 s at 40 cm. This suggests that UVC stimulated the entire biosynthetic pathway. The anthocyanin content of the control berries was always higher than the treatments with UVC on M and T, making necessary to evaluate less rigorous conditions for these varieties. (authors)
Mishra, Shashank K.; Mendez, Violaine; Jeanneau, Erwann; Caps, Valerie; Daniè le, Sté phane
2012-01-01
A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mishra, Shashank K.
2012-12-14
A new Mitsubishi-type of star-shaped homoleptic derivative of indium(III), In4(mdea)6 (2, mdeaH2 = N-methyldiethanolamine) , was synthesized by the chloro-aminoalkoxo exchange reaction of a heteroleptic complex In6Cl6(mdea)6 (1) and used as a facile single source molecular precursor for the sol-gel preparation of high surface area indium oxide. Successful deposition of gold nanoparticles (1 wt.-%) of average size 3.3 nm on the above metal oxide by using HAuCl4· 3H2O afforded a highly efficient Au/In2O3 catalyst for the aerobic epoxidation of trans-stilbene at low temperature. The above single source precursor approach was further extended to obtain other group 13 homo- and heterometallic oxides, namely, α-Ga2O 3, β-Ga2O3 and Al4Ga 2O9, as highly active supports for gold catalysts. The obtained Au/M2O3 (M = Ga, In) and Au/Al4Ga 2O9 catalysts were thoroughly characterized by using several physicochemical techniques such as XRD, high resolution transmission electron microscopy (HR-TEM), energy-dispersive X-ray (EDX) spectroscopy, and X-ray photoelectron spectroscopy (XPS). A comparative study of the above catalysts for the model aerobic oxidation of stilbene in methylcyclohexane was undertaken. Highly efficient catalysts for aerobic oxidation reactions were obtained by depositing gold nanoparticles on group 13 mono- or mixed metal oxides prepared from the hydrolysis of well-characterized homo- and heterometallic N-methyldiethanolaminate derivatives. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Pan, Xuan; Huan, Yi; Shen, Zhufang; Liu, Zhanzhu
2016-05-23
A series of novel tetrahydroisoquinoline-C-aryl glucosides has been synthesized and evaluated for the inhibition of human SGLT2. Compared with dapagliflozin, compound 13h exhibited equivalent in vitro inhibitory activity against SGLT2, which might become a promising candidate for the treatment of type 2 diabetes. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
DEFF Research Database (Denmark)
Thygesen, Lisbeth Garbrecht; Jørgensen, Kirsten; Møller, Birger Lindberg
2004-01-01
Cyanogenic glucosides were studied using Raman spectroscopy. Spectra of the crystal forms of linamarin, linustatin, neolinustatin, amygdalin, sambunigrin, and dhurrin were obtained using a Raman spectrograph microscope equipped with a 532 nm laser. The position of the signal from the CdropN tripl...
Energy Technology Data Exchange (ETDEWEB)
Cui, Mengchao; Tang, Ruikun; Li, Zijing; Jia, Hongmei; Liu, Boli [Beijing Normal Univ. (China). Key Laboratory of Radiopharmaceuticals; Zhang, Jinming; Zhang, Xiaojun [Chinese PLA General Hospital, Beijing (China). Dept. of Nuclear Medicine
2014-04-01
Four stilbene derivatives from natural products were screened as novel β-amyloid (Aβ) imaging ligands. In vitro binding assay showed that the methylated ligand, (E)-1-methoxy-4-styrylbenzene (8) displayed high binding affinity to Aβ{sub 1-42} aggregates (K{sub i} = 19.5 nM). Moreover, the {sup 11}C-labeled ligand, [{sup 11}C]8 was prepared through an O-methylation reaction using [{sup 11}C]CH{sub 3}OTf. In vitro autoradiography with sections of transgenic mouse brain also confirmed the high and specific binding of [{sup 11}C]8 to Aβ plaques. In vivo biodistribution experiments in normal mice indicated that [{sup 11}C]8 displayed high initial uptake (9.41 ± 0.51% ID/g at 5 min post-injection) into and rapid washout from the brain, with a brain{sub 5} {sub min}/brain{sub 30} {sub min} ratio of 6.63. These preliminary results suggest that [{sup 11}C]8 may be served as a novel Aβ imaging probe for PET. (orig.)
Directory of Open Access Journals (Sweden)
Eisuke Kato
2017-08-01
Full Text Available Higenamine is a tetrahydroisoquinoline present in several plants that has β-adrenergic receptor agonist activity. Study of the biosynthesis of higenamine has shown the participation of norcoclaurine synthase, which controls the stereochemistry to construct the (S-isomer. However, when isolated from nature, higenamine is found as the racemate, or even the (R-isomer. We recently reported the isolation of higenamine 4′-O-β-d-glucoside. Herein, its (R- and (S-isomers were synthesized and compared to precisely determine the stereochemistry of the isolate. Owing to their similar spectral properties, determination of the stereochemistry based on NMR data was considered inappropriate. Therefore, a high-performance liquid chromatography method was established to separate the isomers, and natural higenamine 4′-O-β-d-glucoside was determined to be a mixture of isomers.
Hua, Yanling; Ekkhara, Watsamon; Sansenya, Sompong; Srisomsap, Chantragan; Roytrakul, Sittiruk; Saburi, Wataru; Takeda, Ryosuke; Matsuura, Hideyuki; Mori, Haruhide; Ketudat Cairns, James R
2015-10-01
Gibberellin 1-O-β-d-glucose ester hydrolysis activity has been detected in rice seedling extracts, but no enzyme responsible for this activity has ever been purified and identified. Therefore, gibberellin A4 glucosyl ester (GA4-GE) β-d-glucosidase activity was purified from ten-day rice seedling stems and leaves. The family 1 glycoside hydrolase Os4BGlu13 was identified in the final purification fraction. The Os4BGlu13 cDNA was amplified from rice seedlings and expressed as an N-terminal thioredoxin-tagged fusion protein in Escherichia coli. The purified recombinant Os4BGlu13 protein (rOs4BGlu13) had an optimum pH of 4.5, for hydrolysis of p-nitrophenyl β-d-glucopyranoside (pNPGlc), which was the best substrate identified, with a kcat/Km of 637 mM(-1) s(-1). rOs4BGlu13 hydrolyzed helicin best among natural glycosides tested (kcat/Km of 74.4 mM(-1) s(-1)). Os4BGlu13 was previously designated tuberonic acid glucoside (TAG) β-glucosidase (TAGG), and here the kcat/Km of rOsBGlu13 for TAG was 6.68 mM(-1) s(-1), while that for GA4-GE was 3.63 mM(-1) s(-1) and for salicylic acid glucoside (SAG) is 0.88 mM(-1) s(-1). rOs4BGlu13 also hydrolyzed oligosaccharides, with preference for short β-(1 → 3)-linked over β-(1 → 4)-linked glucooligosaccharides. The enzymatic data suggests that Os4BGlu13 may contribute to TAG, SAG, oligosaccharide and GA4-GE hydrolysis in the rice plant, although helicin or a similar compound may be its primary target. Copyright © 2015 Elsevier Inc. All rights reserved.
Effect of heat/pressure on cyanidin-3-glucoside ethanol model solutions
International Nuclear Information System (INIS)
Corrales, M; Lindauer, R; Butz, P; Tauscher, B
2008-01-01
The stability of cyanidin-3-glucoside (Cy3gl) in 50% ethanol model solutions under heat/pressure treatments was investigated. Cy3gl was rapidly degraded when solutions were subjected to a heat/pressure treatment. The higher the pressure and the temperature used, the higher the degradation. Moreover, the degradation was increased according to increasing holding times. Parallel to the degradation of Cy3gl several hydrolytic products were formed and identified by LC-DAD/ESI-MS. The degradation of Cy3gl was well fitted to a first order reaction (R=0.99). This study pointed out the rate of susceptibility of Cy3gl in model solutions to degrade when exposed to a heat/pressure treatment and the trigger effect of high hydrostatic pressure to hydrolyse Cy3gl. By contrast, the degradation of anthocyanins in a food matrix (red grape extract solutions) was negligible after a heat/pressure process at 600MPa, 70 deg. C during 1h (P >0.05)
Rumpictuside A: Unusual 9,10-anthraquinone glucoside from Rumex pictus Forssk.
El-Kashak, Walaa A; Elshamy, Abdelsamed I; Mohamed, Tarik A; El Gendy, Abd El-Nasser G; Saleh, Ibrahim A; Umeyama, Akemi
2017-08-07
A new 8-ionized hydroxylated 9,10-anthraquinone namely, 1-hydroxy-3-methyl-9,10-anthraquinone-6-O-β-D-glucopyranoside-8-olate (Rumpictuside A, 1) along with five known flavonoids, apigenin 7-O-β-D-glucoside (2), vitexin (3), quercetin 3-O-β-D-glucouronide (4), orientin (5), and isorientin (6) were isolated from Rumex pictus. The structures of isolated compounds were identified by the extensive spectroscopic techniques such as, UV, FT-IR, 1D, 2D NMR and HR-FAB-ESI-MS. The ionized hydroxyl group in the new anthraquinone (1) was rarely found for anthraquinone glycosides isolated from natural sources. All the isolated compounds were found inactive against influenza A virus infection. Compounds 2-6 exhibited significant antioxidant activity against DPPH and ABTS + . The alcoholic extract exhibited moderate activity while the new anthraquinone 1 showed the lowest activity against both assays. Copyright © 2017 Elsevier Ltd. All rights reserved.
Total glucosides of peony attenuates experimental autoimmune encephalomyelitis in C57BL/6 mice.
Huang, Qiling; Ma, Xiaomeng; Zhu, Dong Liang; Chen, Li; Jiang, Ying; Zhou, Linli; Cen, Lei; Pi, Rongbiao; Chen, Xiaohong
2015-07-15
Total glucosides of peony (TGP), an active compound extracted from the roots of Paeonia lactiflora Pall, has wide pharmacological effects on nervous system. Here we examined the effects of TGP on experimental autoimmune encephalomyelitis (EAE), an established model of multiple sclerosis (MS). The results showed that TGP can reduce the severity and progression of EAE in C57 BL/6 mice. In addition, TGP also down-regulated the Th1/Th17 inflammatory response and prevented the reduced expression of brain-derived neurotrophic factor and 2',3'-cyclic nucleotide 3'-phosphodiesterase of EAE. These findings suggest that TGP could be a potential therapeutic agent for MS. Copyright © 2015 Elsevier B.V. All rights reserved.
Pati, Debasis; Feng, Xiaoshuang; Hadjichristidis, Nikolaos; Gnanou, Yves
2017-01-01
Two bicyclic glycocarbonates were synthesized in five steps from α-methyl-d-glucoside without resorting to phosgene or to its derivatives for the first time. The 4- and 6-positions of glucose were modified to introduce a six-membered carbonate ring, using CO as the carbonylating reagent; the 2- and 3-positions of the same glucoside substrate were first transformed into either methyl or triethylene glycol monomethyl ether groups to protect these positions from undesirable reactions and also to impart hydrophobicity in the first case and hydrophilicity in the second. The polymerization behavior of these bicyclic glycocarbonates was then investigated under different conditions. On the one hand, through ring-opening polymerization of the above monomers, linear polyglycocarbonate homopolymers and diblock copolymers were obtained initiated by p-methylbenzyl alcohol using 1,5,7-triazabicyclo[4.4.0]dec-5-ene (TBD) as catalyst; on the other hand, macrocyclic polyglycocarbonate homopolymers and diblock copolymers were grown using 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) which served as zwitterionic initiator. The various architectures derived were all thoroughly characterized by NMR, GPC, and MALDI-tof and shown to exhibit the expected structure. Finally, the self-assembly of linear and macrocyclic amphiphilic copolyglycocarbonates in water was investigated and characterized by cryo-TEM.
Pati, Debasis
2017-02-09
Two bicyclic glycocarbonates were synthesized in five steps from α-methyl-d-glucoside without resorting to phosgene or to its derivatives for the first time. The 4- and 6-positions of glucose were modified to introduce a six-membered carbonate ring, using CO as the carbonylating reagent; the 2- and 3-positions of the same glucoside substrate were first transformed into either methyl or triethylene glycol monomethyl ether groups to protect these positions from undesirable reactions and also to impart hydrophobicity in the first case and hydrophilicity in the second. The polymerization behavior of these bicyclic glycocarbonates was then investigated under different conditions. On the one hand, through ring-opening polymerization of the above monomers, linear polyglycocarbonate homopolymers and diblock copolymers were obtained initiated by p-methylbenzyl alcohol using 1,5,7-triazabicyclo[4.4.0]dec-5-ene (TBD) as catalyst; on the other hand, macrocyclic polyglycocarbonate homopolymers and diblock copolymers were grown using 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) which served as zwitterionic initiator. The various architectures derived were all thoroughly characterized by NMR, GPC, and MALDI-tof and shown to exhibit the expected structure. Finally, the self-assembly of linear and macrocyclic amphiphilic copolyglycocarbonates in water was investigated and characterized by cryo-TEM.
Directory of Open Access Journals (Sweden)
Muhammad Z. Ahmad
2017-05-01
Full Text Available Malonylated isoflavones are the major forms of isoflavonoids in soybean plants, the genes responsible for their biosyntheses are not well understood, nor their physiological functions. Here we report a new benzylalcohol O-acetyltransferase, anthocyanin O-hydroxycinnamoyltransferase, anthranilate N-hydroxycinnamoyl/benzoyltransferase, deacetylvindoline 4-O-acetyltransferase (BAHD family isoflavone glucoside malonyltransferase GmIMaT1, and GmIMaT3, which is allelic to the previously characterized GmMT7 and GmIF7MaT. Biochemical studies showed that recombinant GmIMaT1 and GmIMaT3 enzymes used malonyl-CoA and several isoflavone 7-O-glucosides as substrates. The Km values of GmIMaT1 for glycitin, genistin, and daidzin were 13.11, 23.04, and 36.28 μM, respectively, while these of GmIMaT3 were 12.94, 26.67, and 30.12 μM, respectively. Transgenic hairy roots overexpressing both GmIMaTs had increased levels of malonyldaidzin and malonylgenistin, and contents of daidzin and glycitin increased only in GmIMaT1-overexpression lines. The increased daidzein and genistein contents were detected only in GmIMaT3-overexpression lines. Knockdown of GmIMaT1 and GmIMaT3 reduced malonyldaidzin and malonylgenistin contents, and affected other isoflavonoids differently. GmIMaT1 is primarily localized to the endoplasmic reticulum while GmIMaT3 is primarily in the cytosol. By examining their transcript changes corresponding to the altered isoflavone metabolic profiles under various environmental and hormonal stresses, we probed the possible functions of GmIMaTs. Two GmIMaTs displayed distinct tissue expression patterns and respond differently to various factors in modifying isoflavone 7-O-glucosides under various stresses.
Directory of Open Access Journals (Sweden)
Weizhe Xu
2016-07-01
Full Text Available There is evidence suggesting that herbal extracts demonstrate greater bioactivities than their isolated constituents at an equivalent dose. This phenomenon could be attributed to the absence of interacting substances present in the extracts. By measuring the pharmacokinetic parameters of paeoniflorin (PF and albiflorin (AF after being orally administered to rats in isolated form, in combination with each other and within total peony glucosides (TPG, respectively, the current study aimed to identify positive pharmacokinetic interactions between components of peony radix extracts. Moreover, the pharmacokinetic profiles of PF and AF under normoxia and hypoxia were also investigated and compared. In order to achieve these goals, a highly sensitive and reproducible ultra-peformance liquid chromatography–mass spectrometry (UPLC-MS method was developed and validated for simultaneously quantitation of PF and AF in rat plasma. This study found that compared with that of single component (PF/AF, the exposure of PF in rat plasma after combination administration or TPG administration was significantly increased, meanwhile the elimination of PF/AF was remarkably reduced. It was also noticed that AUC and Cmax of PF in hypoxia rats were significantly decreased compared with that of normaxia rats, suggesting that there was a decreased exposure of PF in rats under hypoxia. The current study, for the first time, revealed the pharmacokinetic interactions between PF/AF and other constitutes in TGP and the pharmacokinetic profiles of PF and AF under hypoxia. In view of the current findings, it could be supposed that the clinical performance of total peony glucosides would be better than that of single constitute (PF/AF. The outcomes of this animal study are expected to serve as a basis for development of clinical guidelines on total peony glucosides usage.
Arceo-Medina, G N; Rosado-Aguilar, J A; Rodríguez-Vivas, R I; Borges-Argaez, R
2016-09-15
Six compounds in a methanolic extract of Petiveria alliacea stem (cis-stilbene; benzyl disulphide; benzyl trisulphide; and methyl esters of hexadecanoic acid, octadecadienoic acid and octadecenoic acid) are known to exercise acaricide activity against cattle tick Rhipicephalus microplus larvae and adults. The synergistic effect of 57 combinations of these six compounds on acaricide activity against R. microplus was evaluated. Larvae immersion tests produced the lethal concentrations needed to kill 50% (LC 50 ) and 99% (LC 99 ) of the population. Adult immersion tests produced rates (%) for mortality, oviposition inhibition and eclosion inhibition. Individually, none of the compounds (1% concentration) exhibited acaricide activity (mortality ≤2.3%). When combined, however, nine mixtures exhibited a synergistic increase in activity, with high mortality rates (≥92%) in larvae. Values for LC 50 ranged from 0.07 to 0.51% and those for LC 99 from 0.66 to 5.16%. Thirty six compound mixtures had no significant activity (mortality ≤30%) against larvae. Two mixtures exhibited synergism against adults, with high rates (≥92%) of oviposition inhibition. The mixtures based on the benzyl disulphide+benzyl trisulphide pairing produced a synergistic effect against acaricide-resistant R. microplus larva and adults, and are therefore the most promising combination for controlling this ubiquitous ectoparasite. Copyright © 2016 Elsevier B.V. All rights reserved.
Orbán-Gyapai, Orsolya; Liktor-Busa, Erika; Kúsz, Norbert; Stefkó, Dóra; Urbán, Edit; Hohmann, Judit; Vasas, Andrea
2017-04-01
Plants belonging to the genus Rumex (family Polygonaceae) are used worldwide in traditional medicine for the treatment of various diseases caused by different microorganisms (e.g. bacteria-related dermatologic conditions, dysentery and enteritis). The present study focused on the antibacterial screening of Rumex species native to the Carpathian Basin, and isolation of compounds from one of the most efficient species, Rumex aquaticus. The antibacterial effects of n-hexane, chloroform and aqueous fractions of methanol extracts prepared from different parts of 14 Rumex species (R. acetosella, R. acetosa, R. alpinus, R. aquaticus, R. conglomeratus, R. crispus, R. hydrolapathum, R. obtusifolius subsp. obtusifolius, R. obtusifolius subsp. subalpinus, R. patientia, R. pulcher, R. scutatus, R. stenophyllus and R. thyrsiflorus) were investigated against Staphylococcus epidermidis, S. aureus, MRSA, Bacillus subtilis, Moraxella catarrhalis, Streptococcus pyogenes, S. pneumoniae, S. agalactiae, Pseudomonas aeruginosa, Escherichia coli and Klebsiella pneumoniae using the disc diffusion method. Mainly the n-hexane and chloroform extracts prepared from the roots of the plants displayed high antibacterial activity (inhibition zones>15mm) against one or more bacterial strains. The highly active extracts of the aerial part and root of R. aquaticus were subjected to a multistep separation procedure. 19 Compounds, among them naphthalenes (musizin, and its glucoside, torachrysone-glucoside, 2-methoxystypandrone), anthraquinones (emodin, chrysophanol, physcion, citreorosein, chrysophanol-8-O-glucoside), flavonoids (quercetin, quercetin-3,3'-dimethylether, isokaempferide, quercetin 3-O-arabinoside, quercetin 3-O-galactoside, catechin), stilbenes (resveratrol, piceid), and 1-stearoylglycerol were isolated from the plant. The antibacterial activities of isolated compounds were determined, and it was observed that especially naphthalenes exerted remarkable antibacterial effects against
Probe the Binding Mode of Aristololactam-β-D-glucoside to Phenylalanine Transfer RNA in Silico
DEFF Research Database (Denmark)
Xiao, Xingqing; Zhao, Binwu; Yang, Li
2016-01-01
Understanding the interactions of drug molecules with biomacromolecules at a micro-scale level is essential to design potent drugs for the treatments of human genome diseases. To unravel the mechanism of binding of aristololactam-β-D-glucoside (ADG) and phenylalanine transfer RNA (t...... on the tRNAPhe, and atomistic MD simulations were conducted to examine the thermal stability of five predicted binding poses for the complex of ADG and the tRNAPhe. The binding free energies of the five complexes were then calculated using the molecular mechanics/generalized born surface area approach...
A Nitrile Glucoside and Biflavones from the Leaves of Campylospermum excavatum (Ochnaceae).
Njock, Gaétan Bayiha Ba; Grougnet, Raphaël; Efstathiou, Antonia; Smirlis, Despina; Genta-Jouve, Grégory; Michel, Sylvie; Mbing, Joséphine Ngo; Kritsanida, Marina
2017-11-01
The study of the MeOH extract of the leaves of Campylospermum excavatum led to the isolation of a nitrile glucoside, named campyloside C (1) and an original derivative of ochnaflavone, 7-O-methylochnaflavone (2), along with three known biflavonoids, amentoflavone, sequoiaflavone, and sotetsuflavone (3 - 5). The linkage site of the sub-units of 2 was confirmed by chemical correlation, after semi-synthesis of a trimethoxylated derivative of ochnaflavone (2a). The structures of these compounds as well as their relative and absolute configurations were assigned by 1D- and 2D-NMR experiments, HR-ESI-MS and Electronic Circular Dichroism (ECD) calculations. A low-pass J filter HMBC experiment was performed in order to define the configuration of the double bond of 1. All of the biflavonoids were evaluated against protozoan parasites. Amentoflavone moderately inhibited the promastigote form of Leishmania infantum. © 2017 Wiley-VHCA AG, Zurich, Switzerland.
Directory of Open Access Journals (Sweden)
Hee-jung Lim
2016-10-01
Full Text Available Background: Production of wheat bran (WB for human consumption is estimated to be about 90 million tons per year. WB contains an abundant source of dietary fiber, minerals, vitamins, and bioactive compounds. WB is a by-product of milling and contains an abundant source of carbohydrate (60%, protein (12%, fat (0.5%, minerals (2%, and bioactive compounds such as phenolic acids, arabinoxylans, flavonoids, caroteinoids alkylresorcinol and phytosterols. These are known for health promoting properties such as controlling glycemic index, reducing plasma cholesterol level, antioxidant, anti-inflammatory, and anticarcinogenic activities. Several terpene glycosides such as mogroside V, paenoiflorin, geniposide, rubusoside (Ru, stevioside (Ste, rebaudioside A (RebA, steviol monoside, and stevioside glucoside have been discovered to enhance the solubility of a number of pharmaceutically and medically important compounds that normally show poor solubility in water. Context and purpose of this study: In this study, in order to increase soluble extraction of polyphenol compounds of WB using Ru, the expression of β-galactosidase from Thermus thermophilus (T. thermophilus was optimized using different E. coli hosts and a different concentration of lactose inducer rather than of isopropyl-1- thio-β-D-galactopyranoside (IPTG for industrial production. Additionally, the effect of different steviol glucosides (Ru, Ste, RebA, and SG on the enhancement of polyphenol compounds extraction from wheat bran was studied. Results: β-galactosidase from T. thermophilus was used for the specific conversion of stevioside (Ste to rubusoside (Ru with 92% productivity. The enzyme was optimized to be expressed in E. coli. With 7 mM lactose, the β-galactosidase activity expressed was 34.3, 14.2, or 34.4 ± 0.5 U/mL in E. coli BL21(DE3pLysS, Rosetta(DE3pLysS, or BL21(DE3 at 37°C, and 9.8 ± 0.2, 7.0 ± 0.5, or 7.4 ± 0.2 U/mL at 28°C respectively. The expression of
Evidence for excited state intramolecular charge transfer in benzazole-based pseudo-stilbenes.
Santos, Fabiano da Silveira; Descalzo, Rodrigo Roceti; Gonçalves, Paulo Fernando Bruno; Benvenutti, Edilson Valmir; Rodembusch, Fabiano Severo
2012-08-21
Two azo compounds were obtained through the diazotization reaction of aminobenzazole derivatives and N,N-dimethylaniline using clay montmorillonite KSF as catalyst. The synthesized dyes were characterized using elemental analysis, Fourier transform infrared spectroscopy, and (13)C and (1)H NMR spectroscopy in solution. Their photophysical behavior was studied using UV-vis and steady-state fluorescence in solution. These dyes present intense absorption in the blue region. The spectral features of the azo compounds can be related to the pseudo-stilbene type as well as the E isomer of the dyes. Excitation at the absorption maxima does not produce emissive species in the excited state. However, excitation around 350 nm allowed dual emission of fluorescence, from both a locally excited (LE, short wavelength) and an intramolecular charge transfer (ICT, long wavelength) state, which was corroborated by a linear relation of the fluorescence maximum (ν(max)) versus the solvent polarity function (Δf) from the Lippert-Mataga correlation. Evidence of TICT in these dyes was discussed from the viscosity dependence of the fluorescence intensity in the ICT emission band. Theoretical calculations were also performed in order to study the geometry and charge distribution of the dyes in their ground and excited electronic states. Using DFT methods at the theoretical levels BLYP/Aug-cc-pVDZ, for geometry optimizations and frequency calculations, and B3LYP/6-311+G(2d), for single-point energy evaluations, the calculations revealed that the least energetic and most intense photon absorption leads to a very polar excited state that relaxes non-radioactively, which can be associated with photochemical isomerization.
Cao, Wenli; Wang, Xinguo; Li, Haojie; Shi, Xuliang; Fan, Wencheng; Zhao, Shaohua; Liu, Minyan; Niu, Liying
2015-11-01
Total glucosides of paeony are the active constituents of Paeoniae Radix Alba. In this study, a novel strategy was proposed to find more metabolites and the differences between paeoniflorin, albiflorin and total glucosides of paeony (TGP). This strategy was characterized as follows: firstly, the animals were divided into three groups (paeoniflorin, albiflorin and TGP) to identify the source of TGP metabolites from paeoniflorin or albiflorin; secondly, a generic information-dependent acquisition scan for the low-level metabolites was triggered by the multiple mass defect filter and dynamic background subtraction; thirdly, the metabolites were identified with a combination of data-processing methods including mass defect filtering, neutral loss filtering and product ion filtering; finally, a comparative study was used in the metabolism of paeoniflorin, albiflorin and TGP. Based on the strategy, 18 metabolites of TGP, 10 metabolites of paeoniflorin and 13 metabolites of albiflorin were identified respectively. The results indicated that the hydrolysis, conjugation reaction and oxidization were the major metabolic pathways, and the metabolic sites were the glycosidic linkage, the ester bond and the benzene ring. This study is first to explore the metabolism of TGP, and these findings enhance our understanding of the metabolism and the interactions of paeoniflrin and albiflorin in TGP. Copyright © 2015 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Wu-Yang Huang
2014-08-01
Full Text Available Blueberry fruits have a wide range of health benefits because of their abundant anthocyanins, which are natural antioxidants. The purpose of this study was to investigate the inhibitory effect of blueberry’s two main anthocyanins (malvidin-3-glucoside and malvidin-3-galactoside on inflammatory response in endothelial cells. These two malvidin glycosides could inhibit tumor necrosis factor-alpha (TNF-α induced increases of monocyte chemotactic protein-1 (MCP-1, intercellular adhesion molecule-1 (ICAM-1, and vascular cell adhesion molecule-1 (VCAM-1 production both in the protein and mRNA levels in a concentration-dependent manner. Mv-3-glc at the concentration of 1 μM could inhibit 35.9% increased MCP-1, 54.4% ICAM-1, and 44.7% VCAM-1 protein in supernatant, as well as 9.88% MCP-1 and 48.6% ICAM-1 mRNA expression (p < 0.05. In addition, they could decrease IκBα degradation (Mv-3-glc, Mv-3-gal, and their mixture at the concentration of 50 μM had the inhibition rate of 84.8%, 75.3%, and 43.2%, respectively, p < 0.01 and block the nuclear translocation of p65, which suggested their anti-inflammation mechanism was mediated by the nuclear factor-kappa B (NF-κB pathway. In general malvidin-3-glucoside had better anti-inflammatory effect than malvidin-3-galactoside. These results indicated that blueberry is good resource of anti-inflammatory anthocyanins, which can be promising molecules for the development of nutraceuticals to prevent chronic inflammation in many diseases.
Moze, Spela; Polak, Tomaz; Gasperlin, Lea; Koron, Darinka; Vanzo, Andreja; Poklar Ulrih, Natasa; Abram, Veronika
2011-07-13
Phenolics from bilberries ( Vaccinium myrtillus L.) sampled from seven different locations and highbush blueberries ( Vaccinium corymbosum L.) from one location in Slovenia were analyzed. In samples of both species 15 anthocyanins were identified by LC-MS/MS. Their contents were expressed as cyanidin 3-glucoside equivalents (C3GE); bilberries contained 1210.3 ± 111.5 mg C3GE/100 g fw and blueberries 212.4 ± 14.1 mg C3GE/100 g fw. Glycosides of delphinidin and cyanidin were predominant (488.5 vs 363.6 mg C3GE/100 g fw) in the bilberries and glycosides of malvidin (108.0 vs 100.8 mg C3GE/100 g fw) in the blueberries, whereas the contents of peonidin were lowest (74.5 vs 4.8 mg C3GE/100 g fw) in both berries. The contents of flavanols, flavonols, phenolic acids, and stilbenes were determined by LC-MS. For the first time, rutin was identified (bilberries, 0.2 ± 0.0 mg/100 g fw; blueberries, 3.1 ± 0.1 mg/100 g fw). Chlorogenic acid (as 3-caffeoylquinic acid) was the most abundant among the phenolic acids (23.1 ± 1.0 mg/100 g fw in bilberries and 70.0 ± 3.4 mg/100 g fw in blueberries). Statistical analysis shows that the content of 27 individual flavonoids, phenolic acids, and stilbenes can be used to identify the picking region of these Slovenian bilberries.
Cejudo-Bastante, María Jesús; Del Barrio-Galán, Rubén; Heredia, Francisco J; Medel-Marabolí, Marcela; Peña-Neira, Álvaro
2018-04-01
This paper reports on a study of chemical characterization and colour parameters of cv. Carignan red wines from six locations and two production years of the Chilean Maule valley. The chemical study was performed on polyphenolic composition (benzoic acids, hydroxycinnamic acid derivatives, stilbenes, flavan-3-ols, flavonols and anthocyanins) and several fractions of proanthocyanidins and polysaccharides. Results revealed that although significantly (p < 0.05) different content of anthocyanins were observed according to the production year, it could be possible to establish fingerprints of the different locations of the Maule valley wines. Thus, wines from zones closer to the Andes Mountains had higher content of procyanidin B3 (Caliboro), polysaccharides and cis-resveratrol-glucoside (Loncomilla and Melozal), whereas the proximity to the Pacific Ocean provoked a unifying effect in chemical and colorimetric terms (Cauquenes, Sauzal and Huerta del Maule). Copyright © 2018 Elsevier Ltd. All rights reserved.
A New 8′ ,9 ′ -Dinor 8,4 ′ -Oxy neolignan Glucoside from Dendrobium Aurantiacum var. Denneanum
Directory of Open Access Journals (Sweden)
Xiao-hong Li
2016-01-01
Full Text Available An investigation of n-BuOH extract of Dendrobium aurantiacum var. denneanum stems has led to the isolation of a new 8′,9′-dinor 8,4′-oxyneolignane glucoside, (–-(7 S ,8 S -4-hydroxy-3,3′,5,5′-tetramethoxy-8′,9′-dinor - 8,4′-oxyneolign a -7,9-diol- 7 ′-al 4-O-β-D-glucopyranoside (1, and four phenylpropanoid glycosides (2– 5 . The structures of the isolated compounds were elucidated by chemical and spectroscopic methods . This is the first report of norlignane from the genus Dendrobium.
Directory of Open Access Journals (Sweden)
Bischof Daniela F
2007-04-01
Full Text Available Abstract Background Contagious bovine pleuropneumonia (CBPP caused by Mycoplasma mycoides subsp. mycoides small-colony type (SC is among the most serious threats for livestock producers in Africa. Glycerol metabolism-associated H2O2 production seems to play a crucial role in virulence of this mycoplasma. A wide number of attenuated strains of M. mycoides subsp. mycoides SC are currently used in Africa as live vaccines. Glycerol metabolism is not affected in these vaccine strains and therefore it does not seem to be the determinant of their attenuation. A non-synonymous single nucleotide polymorphism (SNP in the bgl gene coding for the 6-phospho-β-glucosidase (Bgl has been described recently. The SNP differentiates virulent African strains isolated from outbreaks with severe CBPP, which express the Bgl isoform Val204, from strains to be considered less virulent isolated from CBPP outbreaks with low mortality and vaccine strains, which express the Bgl isoform Ala204. Results Strains of M. mycoides subsp. mycoides SC considered virulent and possessing the Bgl isoform Val204, but not strains with the Bgl isoform Ala204, do trigger elevated levels of damage to embryonic bovine lung (EBL cells upon incubation with the disaccharides (i.e., β-D-glucosides sucrose and lactose. However, strains expressing the Bgl isoform Val204 show a lower hydrolysing activity on the chromogenic substrate p-nitrophenyl-β-D-glucopyranoside (pNPbG when compared to strains that possess the Bgl isoform Ala204. Defective activity of Bgl in M. mycoides subsp. mycoides SC does not lead to H2O2 production. Rather, the viability during addition of β-D-glucosides in medium-free buffers is higher for strains harbouring the Bgl isoform Val204 than for those with the isoform Ala204. Conclusion Our results indicate that the studied SNP in the bgl gene is one possible cause of the difference in bacterial virulence among strains of M. mycoides subsp. mycoides SC. Bgl does not act as
Liu, E-Hu; Zhou, Ting; Li, Guo-Bin; Li, Jing; Huang, Xiu-Ning; Pan, Feng; Gao, Ning
2012-01-01
The multiple bioactive constituents in Hedyotis diffusa Willd. (H. diffusa) were extracted and characterized by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC-ESI-MS(n)). The optimized separation condition was obtained using an Agilent ZorBax SB-C18 column (4.6×150 mm, 5 μm) and gradient elution with water (containing 0.1% formic acid) and acetonitrile (containing 0.1% formic acid), under which baseline separation for the majority of compounds was achieved. Among the compounds detected, 14 iridoid glucosides, 10 flavonoids, 7 anthraquinones, 1 coumarin and 1 triterpene were unambiguously identified or tentatively characterized based on their retention times and mass spectra in comparison with the data from standards or references. The fragmentation behavior for different types of constituents was also investigated, which could contribute to the elucidation of these constituents in H. diffusa. The present study reveals that even more iridoid glycosides were found in H. diffusa than hitherto assumed. The occurrence of two iridoid glucosides and five flavonoids in particular has not yet been described. This paper marks the first report on the structural characterization of chemical compounds in H. diffusa by a developed HPLC-ESI-MS(n) method. Copyright © 2012 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.
Formation of flavone di-O-glucosides using a glycosyltransferase from Bacillus cereus.
Ahn, Byoung Chan; Kim, Bong Gyu; Jeon, Young Min; Lee, Eun Jeong; Lim, Yoongho; Ahn, Joong-Hoon
2009-04-01
Microbial UDP-glycosyltransferases can convert many small lipophilic compounds into glycons using uridinediphosphate- activated sugars. The glycosylation of flavonoids affects solubility, stability, and bioavailability. The gene encoding the UDP-glycosyltransferase from Bacillus cereus, BcGT-3, was cloned by PCR and sequenced. BcGT-3 was expressed in Escherichia coli BL21 (DE3) with a glutathione S-transferase tag and purified using a glutathione Stransferase affinity column. BcGT-3 was tested for activity on several substrates including genistein, kaempferol, luteolin, naringenin, and quercetin. Flavonols were the best substrates for BcGT-3. The enzyme dominantly glycosylated the 3-hydroxyl group, but the 7-hydroxyl group was glycosylated when the 3-hydroxyl group was not available. The kaempferol reaction products were identified as kaempferol-3-O-glucoside and kaempferol- 3,7-O-diglucoside. Kaempferol was the most effective substrate tested. Based on HPLC, LC/MS, and NMR analyses of the reaction products, we conclude that BcGT-3 can be used for the synthesis of kaempferol 3,7-O-diglucose.
Sgorbini, Barbara; Cagliero, Cecilia; Pagani, Alberto; Sganzerla, Marla; Boggia, Lorenzo; Bicchi, Carlo; Rubiolo, Patrizia
2015-09-01
This study arises from both the today's trend towards exploiting plant resources exhaustively, and the wide quantitative discrepancy between the amounts of commercially-valuable markers in aromatic plants and those recovered from the related essential oil. The study addresses the determination of both the qualitative composition and the exhaustive distribution of free and glucosidically-bound L-menthol in peppermint aerial parts (Mentha x piperita L., Lamiaceae) and of eugenol in dried cloves (Syzygium aromaticum (L.) Merr. & L.M.Perry, Myrtaceae), two plants known to provide widely ranging essential oil yields. The two markers were investigated in essential oils and residual hydrodistillation waters, before and after enzymatic hydrolysis. Their amounts were related to those in the headspace taken as reference. The results showed that the difference between marker compound in headspace and in essential oil amounted to 22.8% for L-menthol in peppermint, and 16.5% for eugenol in cloves. The aglycones solubilised in the residual hydrodistillation waters were 7.2% of the headspace reference amount for L-menthol, and 13.3% for eugenol, respectively representing 9.3% and 15.9% of their amounts in the essential oil. The amount of L-menthol from its glucoside in residual hydrodistillation waters was 20.6% of that in the related essential oil, while eugenol from its glucoside accounted for 7.7% of the amount in clove essential oil. The yield of L-menthol, after submitting the plant material to enzymatic hydrolysis before hydrodistillation, increased by 23.1%, and for eugenol the increase was 8.1%, compared to the amount in the respective conventional essential oils. This study also aimed to evaluate the reliability of recently-introduced techniques that are little applied, if at all, in this field. The simultaneous use of high-concentration-capacity sample preparation techniques (SBSE, and HS-SPME and in-solution SPME) to run quali-quantitative analysis without sample
Zhang, Jinglong; Moore, Michael E; Wang, Zhonghai; Rong, Zhou; Yang, Chaowen; Hayward, Jason P
2017-10-01
Choosing a digitizer with an appropriate sampling rate is often a trade-off between performance and economy. The influence of sampling rates on the neutron-gamma Pulse Shape Discrimination (PSD) with a solid stilbene scintillator coupled to a Silicon Photomultiplier was investigated in this work. Sampling rates from 125MSPS to 2GSPS from a 10-bit digitizer were used to collect detector pulses produced by the interactions of a Cf-252 source. Due to the decreased signal-to-noise ratio (SNR), the PSD performance degraded with reduced sampling rates. The reason of PSD performance degradation was discussed. Then, an efficient combination of filtering and digital signal processing (DSP) was then applied to suppress the timing noise and electronic background noise. The results demonstrate an improved PSD performance especially at low sampling rates, down to 125MSPS. Using filtering and DSP, the ascribed Figure of Merit (FOM) at 125keV ee (± 10keV ee ) increased from 0.95 to 1.02 at 125MSPS. At 300keV ee and above, all the FOMs are better than 2.00. Our study suggests that 250MSPS is a good enough sampling rate for neutron-gamma discrimination in this system in order to be sensitive to neutrons at and above ~ 125keV ee . Copyright © 2017 Elsevier Ltd. All rights reserved.
Nakagawa, Hiroyuki; Matsuo, Yosuke; McCormick, Susan; Lim, Chee Wei
2018-05-01
A determination method previously validated for trichothecenes and zearalenone by means of liquid chromatography-tandem mass spectrometry (LC-MS/MS) was adapted for the quantification of T-2 toxin (T-2) as well as its glucoside and acetyl derivatives, T-2-3-glucoside (T-2-3G) and 3-acetyl-T-2 (3A-T-2). HT-2 toxin (HT-2) and its acetyl derivative 3-acetyl-HT-2 (3A-HT-2) were also included as the target chemicals. Staple flours (56 samples collected from the Singapore market) were examined for contamination from T-2 and/or HT-2 and their derivatives. Among them, 16 flours were found to be contaminated with T-2 and/or HT-2, whereas none was contaminated with T-2-3G and 3A-HT-2, except for trace 3A-T-2 detected in 2 rye samples. Rye flour samples were frequently contaminated with both T-2 and HT-2. Some of the reference materials (RMs) were further analyzed, and T-2-3G and 3A-T-2 were quantitatively detected in corn and wheat RMs. The ratio of T-2-3G to T-2 in the RMs seemed to be much lower than the ratio of deoxynivalenol-3-glucoside to deoxynivalenol usually reported in former studies. To the best of our knowledge, the natural contamination of 3A-T-2 in staple flour is reported here for the first time.
Muthusamy, Karthikeyan; Chinnasamy, Sathishkumar; Nagarajan, Subbiah; Sivaraman, Thirunavukkarasu
2017-12-14
Ikshusterol3-O-glucoside was isolated from Clematis gouriana Roxb. ex DC. root. A structure of the isolated compound was determined on the basis of various spectroscopic interpretations (UV, NMR, FTIR, and GC-MS-EI). This structure was submitted in the PubChem compound database (SID 249494133). SID 249494133 was carried out by density functional theory calculation to observe the chemical stability and electrostatic potential of this compound. The absorption, distribution, metabolism, and excretion property of this compound was predicted to evaluate the drug likeness and toxicity. In addition, molecular docking, quantum polarized ligand docking, prime MMGBSA calculation, and induced fit docking were performed to predict the binding status of SID 249494133 with the active site of phospholipase A 2 (PLA 2 ) (PDB ID: 1A3D). The stability of the compound in the active site of PLA 2 was carried out using molecular dynamics simulation. Further, the anti-venom activity of the compound was assessed using the PLA 2 assay against Naja naja (Indian cobra) crude venom. The results strongly show that Ikshusterol3-O-glucoside has a potent snake-venom neutralizing capacity and it might be a potential molecule for the therapeutic treatment for snakebites.
Swami, Saurabh; Muzammil, Raunaq; Saha, Supradip; Shabeer, Ahammed; Oulkar, Dasharath; Banerjee, Kaushik; Singh, Shashi Bala
2016-05-01
Ozonated water dip technique was evaluated for the detoxification of six pesticides, i.e., chlorpyrifos, cypermethrin, azoxystrobin, hexaconazole, methyl parathion, and chlorothalonil from apple fruits. Results revealed that ozonation was better than washing alone. Ozonation for 15 min decreased residues of the test pesticides in the range of from 26.91 to 73.58%, while ozonation for 30 min could remove the pesticide residues by 39.39-95.14 % compared to 19.05-72.80 % by washing. Cypermethrin was the least removed pesticide by washing as well as by ozonation. Chlorothalonil, chlorpyrifos, and azoxystrobin were removed up to 71.45-95.14 % in a 30-min ozonation period. In case of methyl parathion removal, no extra advantage could be obtained by ozonation. The HPLC analysis indicated that ozonation also affected adversely the ascorbic acid and cyanidin-3-glucoside content of apples. However, 11 polyphenols studied showed a mixed trend. Gallic acid, 3,4-dihydroxybenzoic acid, catechin, epicatechin, p-coumaric acid, quercetin-3-O-glucoside, quercetin, and kaempferol were found to decrease while syringic acid, rutin, and resveratrol were found to increase in 30-min ozonation.
Energy Technology Data Exchange (ETDEWEB)
Nwachukwu, E C; Mbanaso, E N.A.; Ene, L S.O. [Plant Breeding Div., National Root Crops Research Inst., Umudike, Umuahia (Nigeria)
1997-07-01
Cassava (Manihot esculenta Crantz) is an important food in Nigeria. One drawback in its use as a staple food is the presence of cyanogenic glucosides which on hydrolysis produce the very toxic hydrogen cyanide (HCN). To reduce the cyanogenic levels by mutation induction, three locally adopted and high yielding varieties of cassava, TMS 30572, NR 8817 and NR 84111 were irradiated with 20, 25 and 30 Gy gamma rays. There were a wide variation in HCN, dry matter and starch content of irradiated cassava plants, screened in the MV{sub 2} propagation. Fourteen cassavavariant lines were selected for low HCN content, and 22 lines for high dry matter content. These will be further tested for yield in replicated field trials. (author). 7 refs, 3 tabs.
International Nuclear Information System (INIS)
Nwachukwu, E.C.; Mbanaso, E.N.A.; Ene, L.S.O.
1997-01-01
Cassava (Manihot esculenta Crantz) is an important food in Nigeria. One drawback in its use as a staple food is the presence of cyanogenic glucosides which on hydrolysis produce the very toxic hydrogen cyanide (HCN). To reduce the cyanogenic levels by mutation induction, three locally adopted and high yielding varieties of cassava, TMS 30572, NR 8817 and NR 84111 were irradiated with 20, 25 and 30 Gy gamma rays. There were a wide variation in HCN, dry matter and starch content of irradiated cassava plants, screened in the MV 2 propagation. Fourteen cassavavariant lines were selected for low HCN content, and 22 lines for high dry matter content. These will be further tested for yield in replicated field trials. (author). 7 refs, 3 tabs
Zheng, Lin-Ying; Pan, Jing-Qiang; Lv, Jun-Hua
2008-10-01
To study the pathological changes of blood glucose, serum lipid, insulin resistance, liver function, liver cell denaturalization of total glucosides of paeony on nonalcoholic fatty liver rats caused by insulin resistance and discuss the acting mechanism. Adult SD rats were maintained on high-fat-sugar-salt diet for 56 days. In the 57th day, their fasting blood glucose (FBG) and 2-hours blood glucose after oral glucose tolerance test (OGTT-2 hBG) were mensurated, according to which and the weight the rats were divided randomly into nonalcoholic fatty liver model group, metformin group (0.2 g x kg(-1)) and total glucosides of paeony group (high dosage 0.15 g x kg(-1), low dosage 0.05 g x kg(-1)). All the rats were still administered the same diet and given different drugs by intragastric administration for 28 days. In the 29th day, all of them were killed and the blood was sampled to measure the levels of blood glucose [FBG, OGTT-2 hBG, fasting insulin (Fins)] and serum lipid [free fatty acids (FFA), triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C) and high-density lipoprotein cholesterol (HDL-C)], then the HOMA insulin resistance index (HOMA-IRI, fasting glucosexinsulin) and insulin sensitivity index (ISI) were counted. The activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), cholinesterase (ChE), superoxide dismutase (SOD) and the contents of malondialdehyde (MDA) were measured also. Livers were weighed and collected to be observed the pathological changes. Compared with normal group, in nonalcoholic fatty liver model group the levels of Fins and IRI were increased obviously (P insulin resistence were resisted (P insulin resistance, and its action mechanism may be concerned with enhancing insulin sensitivity and antioxidative ability, decreasing serum lipid.
Kanehira, Yuka; Kawakami, Susumu; Sugimoto, Sachiko; Matsunami, Katsuyoshi; Otsuka, Hideaki
2016-10-01
Extensive isolation work on the 1-BuOH-soluble fraction of a MeOH extract of the aerial parts of Dianthus japonicus afforded three further triterpene glycosyl estsers, termed dianthosaponins G-I, an anthranilic acid amide glucoside and a C-glycosyl flavonoid along with one known triterpene saponin. Their structures were elucidated from spectroscopic evidence. The cytotoxicity of the isolated compounds toward A549 cells was evaluated.
Gastaminza, Pablo; Pitram, Suresh M.; Dreux, Marlene; Krasnova, Larissa B.; Whitten-Bauer, Christina; Dong, Jiajia; Chung, Josan; Fokin, Valery V.; Sharpless, K. Barry; Chisari, Francis V.
2011-01-01
The recent development of a cell culture model of hepatitis C virus (HCV) infection based on the JFH-1 molecular clone has enabled discovery of new antiviral agents. Using a cell-based colorimetric screening assay to interrogate a 1,200-compound chemical library for anti-HCV activity, we identified a family of 1,2-diamines derived from trans-stilbene oxide that prevent HCV infection at nontoxic, low micromolar concentrations in cell culture. Structure-activity relationship analysis of ∼300 derivatives synthesized using click chemistry yielded compounds with greatly enhanced low nanomolar potency and a >1,000:1 therapeutic ratio. Using surrogate models of HCV infection, we showed that the compounds selectively block the initiation of replication of incoming HCV RNA but have no impact on viral entry, primary translation, or ongoing HCV RNA replication, nor do they suppress persistent HCV infection. Selection of an escape variant revealed that NS5A is directly or indirectly targeted by this compound. In summary, we have identified a family of HCV inhibitors that target a critical step in the establishment of HCV infection in which NS5A translated de novo from an incoming genomic HCV RNA template is required to initiate the replication of this important human pathogen. PMID:21430055
Kunsági-Máté, Sándor; Ortmann, Erika; Kollár, László; Nikfardjam, Martin Pour
2008-09-01
The complex formation of malvidin-3- O-glucoside with several polyphenols, the so-called "copigmentation" phenomenon, was studied in aqueous solutions. To simulate the copigmentation process during fermentation, the stability of the formed complexes was examined in dependence of the ethanol content of the aqueous solution. Results indicate that stronger and larger complexes are formed, when the ethanol content exceeds a critical margin of 8 vol.% However, the size of complexes of malvidin/procyanidin and malvidin/epicatechin is drastically reduced above this critical concentration. Fluorescence lifetime and solvent relaxation measurements give insight into the particular processes at molecular level and will help us comprehend the first important steps during winemaking in order to recommend an optimized winemaking technology to ensure extraordinary colour stability in red wines.
Directory of Open Access Journals (Sweden)
Shuang Ling
2016-01-01
Full Text Available 2,3,5,4′-Tetrahydroxystilbene-2-O-β-D-glucoside (THSG is active component of the Chinese medicinal plant Polygonum multiflorum Thunb. (THSG. Pharmacological studies have demonstrated that THSG exhibits numerous biological functions in treating atherosclerosis, lipid metabolism, vascular and cardiac remodeling, vascular fibrosis, cardiac-cerebral ischemia, learning and memory disorders, neuroinflammation, Alzheimer and Parkinson diseases, diabetic complications, hair growth problems, and numerous other conditions. This review focuses on the biological effects of THSG in antiaging and antiaging-related disease treatments and discusses its molecular mechanisms.
Bruno, Federica; Castelli, Germano; Vitale, Fabrizio; Giacomini, Elisa; Roberti, Marinella; Colomba, Claudia; Cascio, Antonio; Tolomeo, Manlio
2018-01-01
Most of the antileishmanial modern therapies are not satisfactory due to high toxicity or emergence of resistance and high cost of treatment. Previously, we observed that two compounds of a small library of trans-stilbene and terphenyl derivatives, ST18 and TR4, presented the best activity and safety profiles against Leishmania infantum promastigotes and amastigotes. In the present study we evaluated the effects of ST18 and the TR4 in 6 different species of Leishmania and the modifications induced by these two compounds in the production of 8 different cytokines from infected macrophages. We observed that TR4 was potently active in all Leishmania species tested in the study showing a leishmanicidal activity higher than that of ST18 and meglumine antimoniate in the most of the species. Moreover, TR4 was able to decrease the levels of IL-10, a cytokine able to render the host macrophage inactive allowing the persistence of parasites inside its phagolysosome, and increase the levels of IL-1β, a cytokine important for host resistance to Leishmania infection by inducible iNOS-mediated production of NO, and IL-18, a cytokine implicated in the development of Th1-type immune response. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Martin Moos
2013-07-01
Full Text Available Methanolic extract from lyophilized roots of Impatiens glandulifera Royle was analyzed by high performance liquid chromatography using DAD and FLD detection and this revealed one dominant highly fluorescent very unstable substance. The stability of this derivative is strongly dependent on the plant material drying procedure and extraction procedure used. The structure of the substance was established as 1,2,4-trihydroxynaphthalene-1-O-glucoside (THNG according LC-MS and NMR measurements. When lyophilized plant material was extracted with methanol an almost four times higher amount of THNG was found in the extract, compared to the amount of 2-hydroxy-1,4-naphthoquinone obtained, while in the case of the same lyophilized plant material extracted with water there was no THNG in the extract. The main compounds in this case was 2-hydroxy-1,4-naphthoquinone. In the plant material dried at the laboratory temperature and extracted by methanol there are only traces of THNG.
New anthraquinone derivatives from Geosmithia lavendula.
Malak, Lourin G; Bishay, Daoud W; Abdel-Baky, Afaf M; Moharram, Ahmed M; Cutler, Stephen J; Ross, Samir A
2013-02-01
A phytochemical study of Geosmithia lavendula Pitt led to the isolation of three new anthraquinones: 1-acetyl-2,4,6,8-tetrahydroxy-9,10-anthraquinone (1), 2-acetyl-1,4,5,7-tetrahydroxy-9,10-anthraquinone (2), and 1-acetyl-2,4,5,6,7-pentahydroxy-9,10-anthraquinone (3), as well as another new compound named didodecyl thiodipropionate (propionic acid, 3,3-sulfinyl di-1,1'-didodecyl ester) (4), along with ten known compounds: 1-acetyl-2,4,5,7-tetrahydroxy-9,10-anthraquinone (rhodolamprometrin) (5), 1-acetyl-2,4,5,7,8-pentahydroxy-9,10-anthraquinone (6), (22E)-ergosta-6,22-diene-3beta,5alpha,8alpha-triol, p-hydroxybenzyl alcohol, oleic acid, D-mannitol, palmitic acid, stearic acid, cis-vaccenic acid and 2-decenal. The structures of the isolated metabolites were elucidated based on NMR spectroscopic and mass spectrometric data. Compound 1 exhibited moderate activity against methicillin resistant Staphylococcus aureus with an IC50 value of 16.1 microg/mL.
Georgakopoulou, S.; Gogdell, R.J.; Grondelle, van R.; Amerongen, van H.
2003-01-01
We have applied linear-dichroism experiments to determine the orientation of the transition dipole moment, corresponding to the main absorption band of the carotenoid, rhodopin glucoside, in the light-harvesting complex LH2 from Rhodopseudomonas acidophila strain 10050. The crystal structure of this
Ojwang, Leonnard O; Yang, Liyi; Dykes, Linda; Awika, Joseph
2013-08-15
Proanthocyanidin (PA) profile and content can have important nutritional and health implications on plant foods. Six diverse cowpea phenotypes (black, red, green, white, light-brown and golden-brown) were investigated for PA composition using normal-phase HPLC and reversed-phase UPLC-TQD-MS. Catechin and (epi)afzelechin were the major flavan-3-ol units. Unusual composition was observed in all cowpea phenotypes with significant degrees of glycosylation in the monomers and dimers. The PA content of cowpea (dry basis) ranged between 2.2 and 6.3 mg/g. Monomeric flavan-3-ols were the largest group of PA (36-69%) in cowpea, with catechin-7-O-glucoside accounting for most (about 88%) of the monomers. The oligomers with degree of polymerization (DP) 2-4 ranged from 0.41 to 1.3 mg/g (15-20%), whereas DP>10 polymers accounted for only 13.5% of PA. Future studies that highlight the impact of the unusual cowpea PA profile on nutritional and bioactive properties of this important legume are warranted. Copyright © 2013 Elsevier Ltd. All rights reserved.
Piwowarski, Jakub P; Kiss, Anna K
2013-01-01
Lythri herba, a pharmacopoeial plant material (European Pharmacopoea), is obtained from flowering parts of purple loosestrife (Lythrum salicaria L.). Although extracts from this plant material have been proven to possess some interesting biological activities and its pharmacopoeial standardisation is based on total tannin content determination, the phytochemical characterisation of this main group of compounds has not yet been fully conducted. To isolate ellagitannins from Lythri herba, determine their structures and develop chromatographic methods for their qualitative analysis. Five C-glucosidic ellagitannins - monomeric- vescalagin and castalagin together with new dimeric structures - salicarinins A-C, composed of vescalagin and stachyurin, vescalagin and casuarinin, castalagin and casuarinin units connected via formation of valoneoyl group, were isolated using column chromatography and preparative HPLC. Structures were determined according to (1) H and (13) C-NMR (one- and two-dimensional), electrospray ionisation-time of flight (ESI-TOF), electrospray ionisation-ion trap (ESI-MS(n) ) and circular dichroism (CD) spectra, together with acidic hydrolysis products analysis. HPTLC on RP-18 modified plates and HPLC-DAD-MS(n) on RP-18 column methods were developed for separation of the five main ellagitannins. Copyright © 2012 John Wiley & Sons, Ltd.
Deng, Hui; Yan, Chunlin; Xiao, Tian; Yuan, Dingfen; Xu, Jinhua
2010-02-17
To evaluate the anti-angiogenesis effect of total glucosides of Paeonia lactiflora Pall. In this study, we determined the effect of TGP on the proliferation of human vascular endothelial cells through 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and fluorescence-activated cell sorting analysis. A migration assay and a tube formation assay were used to investigate the migration properties and tube formation abilities of human vascular endothelial cells after being treated with TGP. Furthermore, the in vivo anti-angiogenic ability of TGP was determined through a chick chorioallantoic membrane assay. TGP (12.5, 62.5, and 312.5 microg/ml) resulted in a dose-dependent reduction in the proliferation of endothelial cells. This inhibition effect began 6h after treatment and lasted at least 24h. Fluorescence-activated cell sorting analysis data showed an accumulation of cells in the G0/G1 phase of the cell cycle, which exhibited apoptotic features indicative of cell death. The migration properties and tube forming abilities of endothelial cells were dramatically inhibited by the TGP extract. Our results show that TGP can inhibit angiogenesis in vitro and in vivo. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.
Anxiolytic effects of orcinol glucoside and orcinol monohydrate in mice.
Wang, Xiaohong; Li, Guiyun; Li, Peng; Huang, Linyuan; Huang, Jianmei; Zhai, Haifeng
2015-06-01
Anxiety is a common psychological disorder, often occurring in combination with depression, but therapeutic drugs with high efficacy and safety are lacking. Orcinol glucoside (OG) was recently found to have an antidepressive action. To study the therapeutic potential of OG and orcinol monohydrate (OM) as anxiolytic agents. Anxiolytic effects in mice were measured using the elevated plus-maze, hole-board, and open-field tests. Eight groups of mice were included in each test. Thirty minutes before each test, mice in each group received one oral administration of OG (5, 10, or 20 mg/kg), OM (2.5, 5, or 10 mg/kg), the positive control diazepam (1 or 5 mg/kg), or control vehicle. Each mouse underwent only one test. Uptake of orcinol (5 mg/kg) in the brain was qualitatively detected using the HPLC-MS method. OG (5, 10, and 20 mg/kg) and OM (2.5 and 5 mg/kg) increased the time spent in open arms and the number of entries into open arms in the elevated plus-maze test. OG (5 and 10 mg/kg) and OM (2.5 and 5 mg/kg) increased the number of head-dips in the hole-board test. At all tested doses, OG and OM did not significantly affect the locomotion of mice in the open-field test. Orcinol could be detected in the mouse brain homogenates 30 min after oral OM administration, having confirmed that OM is centrally active. The results demonstrated that OG and OM are anxiolytic agents without sedative effects, indicating their therapeutic potential for anxiety.
International Nuclear Information System (INIS)
Tomasello, Gaia; Altoe, Piero; Garavelli, Marco; Orlandi, Giorgio
2007-01-01
Stilbene photoexcitation and consequent decay to the ground state has been investigated by mapping the Minimum Energy Path (MEP) from S 1 spectroscopic state triggering an almost barrierless reaction pathway to an S 1 /S 0 degenerate region. The particular influence of the σ-π excitation on the S 1 wave function, dominated by a π→π* character, reveals how the non-dynamical correlation energy was important to correctly describe the excited state behaviour and the topological aspect of its potential energy surface. Several strategies of calculations, by using CASSCF//CASPT2 methods, were performed trying to improve the photochemical description nowadays known. Both symmetry and non symmetry preserving computations were performed; systematically was concluded that, because of the limit of CASSCF description enables only to introduce the correlation effect such as the ones due to σ-π excitations, CASSCF and CASPT2 topologies are probably often not in agreement. Thus CC2 methodology was adopted o optimize the S 1 geometries and obtain reasonable structures for the minima. Two S 1 /S 0 accessible conical intersections featured by pyramidalized carbons were located on the first excited state explaining the ultrafast radiationless decay to the ground state and the photoproducts observed within the timescale of ps
Directory of Open Access Journals (Sweden)
MERCEDES CONCÓRDIA CARRÃO-PANIZZI
2000-05-01
Full Text Available The enzyme beta-glucosidase hydrolyses the isoflavone glucosides developing aglycones, which are compounds with anticancer effects, that are also related with the astringency observed in soybean flavor. Due to the importance of this enzyme, a study was carried out to determine beta-glucosidase activity in soybean (Glycine max (L. Merrill cultivars with different contents of isoflavone glucosides (enzyme substrate. The enzyme activity was determined in 51 soybean cultivars sowed in Londrina (latitude 23ºS, in Paraná State, Brazil, and in the cultivar IAS 5 from soybean production regions of different Brazilian states. Among the cultivars, a range of variability of 176.1 to 96.3 units of enzyme activity (cultivars IAC-2 and Embrapa 2, respectively was observed. A significant variability among cultivars could suggest genetic differences. In the states of Rio Grande do Sul, Paraná and Mato Grosso do Sul, the cultivar IAS 5 presented similar average of beta-glucosidase activity: 132.1, 131.9 and 132.5 units, respectively. Among locations in the states, the cultivar IAS 5 presented a variability for enzyme activity from 138.8 to 124.8 units, which were statistically different. In spite of statistics, the numerical values were not too different to assume that environmental conditions affected enzyme activity. A non-significative correlation for isoflavone glucoside concentrations and enzyme activity was observed among cultivars.
Moreira, Fabiana G.; Lenartovicz, Veridiana; Souza, Cristina G.M. de; Ramos, Edivan P.; Peralta, Rosane M.
2001-01-01
The use of a methyl-D-glucoside (alphaMG), a synthetic analogue of maltose, as carbon source and inducer of amylase synthesis to several species of Aspergillus was studied in submerged and solid-state fermentations. Among a group of ten species, A. tamarii, A. fumigatus and A. flavus were able to produce biomass and high specific amylolytic activity in submerged cultures containing alphaMG as the only carbon source. In solid state fermentation, the enrichment of basal wheat bran or corn cob m...
Suzuki, Mami; Nakabayashi, Ryo; Ogata, Yoshiyuki; Sakurai, Nozomu; Tokimatsu, Toshiaki; Goto, Susumu; Suzuki, Makoto; Jasinski, Michal; Martinoia, Enrico; Otagaki, Shungo; Matsumoto, Shogo; Saito, Kazuki; Shiratake, Katsuhiro
2015-01-01
Grape (Vitis vinifera) accumulates various polyphenolic compounds, which protect against environmental stresses, including ultraviolet-C (UV-C) light and pathogens. In this study, we looked at the transcriptome and metabolome in grape berry skin after UV-C irradiation, which demonstrated the effectiveness of omics approaches to clarify important traits of grape. We performed transcriptome analysis using a genome-wide microarray, which revealed 238 genes up-regulated more than 5-fold by UV-C light. Enrichment analysis of Gene Ontology terms showed that genes encoding stilbene synthase, a key enzyme for resveratrol synthesis, were enriched in the up-regulated genes. We performed metabolome analysis using liquid chromatography-quadrupole time-of-flight mass spectrometry, and 2,012 metabolite peaks, including unidentified peaks, were detected. Principal component analysis using the peaks showed that only one metabolite peak, identified as resveratrol, was highly induced by UV-C light. We updated the metabolic pathway map of grape in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and in the KaPPA-View 4 KEGG system, then projected the transcriptome and metabolome data on a metabolic pathway map. The map showed specific induction of the resveratrol synthetic pathway by UV-C light. Our results showed that multiomics is a powerful tool to elucidate the accumulation mechanisms of secondary metabolites, and updated systems, such as KEGG and KaPPA-View 4 KEGG for grape, can support such studies. PMID:25761715
Effects of total glucosides of paeony for delaying onset of Sjogren's syndrome: an animal study.
Li, Chun Lei; He, Jing; Li, Zhan Guo; Zheng, Li Wu; Hua, Hong
2013-10-01
To investigate the effectiveness of total glucosides of paeony (TGP) on Sjogren's syndrome (SS) using non-obese diabetic (NOD) mice model. Twenty-seven 8-week-old female NOD mice were assigned into TGP group, hydroxychloroquine (HCQ) group and normal saline (NS) group, receiving corresponding drugs respectively and sacrificed at 24-week-old. Saliva flow rate (SFR), ration of regulatory T cells, level of anti-SSA/SSB, histological changes in submandibular glands (SMG) and microarray analysis were assessed. The data were analyzed using SPSS. Compared to NS group, in TGP group, SFR, SMG index and the ration of regulatory T cells were significantly higher, while anti-SSA/SSB and lymphocytic foci were significantly lower. HCQ group demonstrated similar results except SMG index. Altered gene expression was found in 10.71% of TGP and 13.09% of HCQ of the profile. TGP demonstrated a similar effectiveness as HCQ in delaying the onset of SS-like disease in NOD mice. Copyright © 2012 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.
Prophylactic Efficacy of Quercetin 3-β-O-d-Glucoside against Ebola Virus Infection.
Qiu, Xiangguo; Kroeker, Andrea; He, Shihua; Kozak, Robert; Audet, Jonathan; Mbikay, Majambu; Chrétien, Michel
2016-09-01
Ebola outbreaks occur on a frequent basis, with the 2014-2015 outbreak in West Africa being the largest one ever recorded. This outbreak has resulted in over 11,000 deaths in four African countries and has received international attention and intervention. Although there are currently no approved therapies or vaccines, many promising candidates are undergoing clinical trials, and several have had success in promoting recovery from Ebola. However, these prophylactics and therapeutics have been designed and tested only against the same species of Ebola virus as the one causing the current outbreak. Future outbreaks involving other species would require reformulation and possibly redevelopment. Therefore, a broad-spectrum alternative is highly desirable. We have found that a flavonoid derivative called quercetin 3-β-O-d-glucoside (Q3G) has the ability to protect mice from Ebola even when given as little as 30 min prior to infection. Furthermore, we have demonstrated that this compound targets the early steps of viral entry. Most promisingly, antiviral activity against two distinct species of Ebola virus was seen. This study serves as a proof of principle that Q3G has potential as a prophylactic against Ebola virus infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Pterostilbene 4′-β-Glucoside Protects against DSS-Induced Colitis via Induction of Tristetraprolin
Directory of Open Access Journals (Sweden)
Yingqing Chen
2017-01-01
Full Text Available Pterostilbene, a dimethyl ester analog of resveratrol, has anti-inflammatory and antioxidative effects and alters cell proliferation. Tristetraprolin (TTP promotes the degradation of proinflammatory mediators via binding to adenosine and uridine- (AU- rich elements (ARE located in the 3′-untranslated regions of mRNAs. Here, we utilized pterostilbene 4′-β-glucoside (4-PG, a compound derived from pterostilbene, to investigate whether it has anti-inflammatory effects on dextran sulfate sodium- (DSS- induced colitis via TTP enhancement. TTP expression was increased in 4-PG dose- and time-dependent manners in RAW264.7 cells. The production of proinflammatory cytokine, such as TNF-α, was reduced by 4-PG in vitro. To investigate the role of TTP in the anti-inflammatory effects of 4-PG, we used DSS-induced colitis in TTP WT and KO mice as models. The expression levels of TTP and proinflammatory cytokines were determined in serum and colon tissue. 4-PG increased the expression of TTP while suppressing proinflammatory cytokines both in vitro and in vivo. These findings suggest that treatment with 4-PG mediates the anti-inflammatory effects of 4-PG on DSS-induced colitis via enhancing TTP expression.
Daenen, L; Saison, D; Sterckx, F; Delvaux, F R; Verachtert, H; Derdelinckx, G
2008-02-01
The aim of this study was to select and examine Saccharomyces and Brettanomyces brewing yeasts for hydrolase activity towards glycosidically bound volatile compounds. A screening for glucoside hydrolase activity of 58 brewing yeasts belonging to the genera Saccharomyces and Brettanomyces was performed. The studied Saccharomyces brewing yeasts did not show 1,4-beta-glucosidase activity, but a strain dependent beta-glucanase activity was observed. Some Brettanomyces species did show 1,4-beta-glucosidase activity. The highest constitutive activity was found in Brettanomyces custersii. For the most interesting strains the substrate specificity was studied and their activity was evaluated in fermentation experiments with added hop glycosides. Fermentations with Br. custersii led to the highest release of aglycones. Pronounced exo-beta-glucanase activity in Saccharomyces brewing yeasts leads to a higher release of certain aglycones. Certain Brettanomyces brewing yeasts, however, are more interesting for hydrolysis of glycosidically bound volatiles of hops. The release of flavour active compounds from hop glycosides opens perspectives for the bioflavouring and product diversification of beverages like beer. The release can be enhanced by using Saccharomyces strains with high exo-beta-glucanase activity. Higher activities can be found in Brettanomyces species with beta-glucosidase activity.
Directory of Open Access Journals (Sweden)
Therese Ellendorff
2015-05-01
Full Text Available Naphthoquinones (NQs occur naturally in a large variety of plants. Several NQs are highly active against protozoans, amongst them the causative pathogens of neglected tropical diseases such as human African trypanosomiasis (sleeping sickness, Chagas disease and leishmaniasis. Prominent NQ-producing plants can be found among Juglans spp. (Juglandaceae with juglone derivatives as known constituents. In this study, 36 highly variable extracts were prepared from different plant parts of J. regia, J. cinerea and J. nigra. For all extracts, antiprotozoal activity was determined against the protozoans Trypanosoma cruzi, T. brucei rhodesiense and Leishmania donovani. In addition, an LC-MS fingerprint was recorded for each extract. With each extract’s fingerprint and the data on in vitro growth inhibitory activity against T. brucei rhodesiense a Partial Least Squares (PLS regression model was calculated in order to obtain an indication of compounds responsible for the differences in bioactivity between the 36 extracts. By means of PLS, hydrojuglone glucoside was predicted as an active compound against T. brucei and consequently isolated and tested in vitro. In fact, the pure compound showed activity against T. brucei at a significantly lower cytotoxicity towards mammalian cells than established antiprotozoal NQs such as lapachol.
Identification of Vitis vinifera L. grape berry skin color mutants and polyphenolic profile.
Ferreira, Vanessa; Fernandes, Fátima; Pinto-Carnide, Olinda; Valentão, Patrícia; Falco, Virgílio; Martín, Juan Pedro; Ortiz, Jesús María; Arroyo-García, Rosa; Andrade, Paula B; Castro, Isaura
2016-03-01
A germplasm set of twenty-five grapevine accessions, forming eleven groups of possible berry skin color mutants, were genotyped with twelve microsatellite loci, being eleven of them identified as true color mutants. The polyphenolic profiling of the confirmed mutant cultivars revealed a total of twenty-four polyphenols, comprising non-colored compounds (phenolic acids, flavan-3-ols, flavonols and a stilbene) and anthocyanins. Results showed differences in the contribution of malvidin-3-O-glucoside to the characteristic Pinot Noir anthocyanins profile. Regarding the two Pique-Poul colored variants, the lighter variant was richer than the darker one in all classes of compounds, excepting anthocyanins. In Moscatel Galego Roxo the F3'H pathway seems to be more active than F3'5'H, resulting in higher amounts of cyanidin, precursor of the cyanidin derivatives. As far as we are aware, this is the first time that a relationship between the content of polyphenolic compounds is established in groups of grape berry skin color mutant cultivars. Copyright © 2015 Elsevier Ltd. All rights reserved.
Shimasaki, Toshiaki; Kato, Shin-ichiro; Ideta, Keiko; Goto, Kenta; Shinmyozu, Teruo
2007-02-16
Novel photoswitchable chiral hosts having an axis chiral 2,2'-dihydroxy-1,1'-binaphthyl (BINOL)-appended stiff-stilbene, trans-(R,R)- and -(S,S)-1, were synthesized by palladium-catalyzed Suzuki-Miyaura coupling and low-valence titanium-catalyzed McMurry coupling as key steps, and they were fully characterized by various NMR spectral techniques. The enantiomers of trans-1 showed almost complete mirror images in the CD spectra, where two split Cotton effects (exciton coupling) were observed in the beta-transitions of the naphthyl chromophore at 222 and 235 nm, but no Cotton effect was observed in the stiff-stilbene chromophore at 365 nm. The structures of (R)-10 and trans-(R,R)-1 were confirmed by X-ray structural analysis. The optimized structure of cis-1 by MO calculations has a wide chiral cavity of 7-8 A in diameter, whereas trans-1 cannot form an intramolecular cavity based on the X-ray data. Irradiation of (R,R)-trans-1 with black light (lambda = 365 nm) in CH3CN or benzene at 23 degrees C led to the conversion to the corresponding cis-isomer, as was monitored by 1H NMR, UV-vis, and CD spectra. At the photostationary state, the cis-1/trans-1 ratio was 86/14 in benzene or 75/25 in CH3CN. On the other hand, irradiation of the cis-1/trans-1 (75/25) mixture in CH3CN with an ultra-high-pressure Hg lamp at 23 degrees C (lambda = 410 nm) led to the photostationary state, where the cis-1/trans-1 ratio was estimated to be 9/91 on the basis of the 1H NMR spectra. The cis-trans and trans-cis interconversions could be repeated 10 times without decomposition of the C=C double bond. Thus, a new type of photoswitchable molecule has been developed, and trans-1 and cis-1 were quite durable under irradiation conditions. The guest binding properties of the BINOL moieties of trans- and cis-(R,R)-1 with F-, Cl-, and H2PO4- were examined by 1H NMR titration in CDCl3. Similar interaction with F- and Cl- was observed in trans-1 (host/guest = 1/1, Kassoc = (1.0 +/- 0.13) x 103 for F
Azevedo, Joana; Fernandes, Ana; Oliveira, Joana; Brás, Natércia F; Reis, Sofia; Lopes, Paulo; Roseira, Isabel; Cabral, Miguel; Mateus, Nuno; de Freitas, Victor
2017-10-04
The aim of this study was to evaluate the reactivity of phenolic compounds extracted from cork stoppers to wine model solutions with two major wine components, namely, (+)-catechin and malvidin-3-O-glucoside. Besides the formation of some compounds already described in the literature, these reactions also yielded a new family of ellagitannin-derived compounds, named herein as corklins. This new family of compounds that were found to result from the interaction between ellagitannins in alcoholic solutions and (+)-catechin were structurally characterized by mass spectroscopy, nuclear magnetic resonance, and computational methods.
Wang, Qing-Tong; Zhang, Ling-Ling; Wu, Hua-Xun; Wei, Wei
2011-01-27
To investigate the expression of β-arrestins in fibroblast-like synoviocytes (FLS) from collagen-induced arthritis (CIA) rats and the effect of total glucosides of paeony (TGP). TGP and glucosides of tripterygium wilfordii (GTW) were intragastriclly administrated to collagen-induced arthritis (CIA) rats after immunization. The secondary inflammatory reaction was evaluated by hind paw swelling, polyarthritis index and histopathological changes. Antibodies to type II collagen (CII) were determined by enzyme-linked immunosorbent assay (ELISA). Synoviocyte proliferations were determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl (MTT) assay. The expression of β-arrestins in synoviocytes from CIA rats was measured by western blot. The administration of TGP (25, 50, 100 mg/kg) depressed hind paw swelling and decreased the arthritis scores of CIA rats. TGP improved the pathologic manifestations of CIA. Serum anti-CII antibodies level increased significantly in CIA rats, while TGP had no effect on it. Fibroblast-like synoviocytes (FLS) proliferation was inhibited by TGP (50, 100 mg/kg). On d14, d28 after immunization, β-arrestins expression greatly up-regulated in synoviocytes from CIA rats and then returned to baseline levels on d42 after immunization. TGP (50, 100 mg/kg) significantly reduced the expression of β-arrestins. An inflammatory process in vivo induces an up-regulation of β-arrestins in synoviocytes from CIA rats while TGP can inhibit this change, which might be one of the important mechanisms for TGP to produce a marked therapeutic effect on RA. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Glass transition behavior of octyl β-D-glucoside and octyl β-D-thioglucoside/water binary mixtures.
Ogawa, Shigesaburo; Asakura, Kouichi; Osanai, Shuichi
2010-11-22
The lyotropic behavior and glass-forming properties of octyl β-D-glucoside (C8Glu) and octyl β-D-thioglucoside (C8SGlu)/water binary mixtures were evaluated using differential scanning calorimetry (DSC) and polarizing optical microscopy (POM). The results clearly indicate that the mixture forms a glass in the supercooling state of liquid crystalline phases such as cubic, lamellar, and smectic. The glass transition temperature (T(g)) of the mixture was strongly dependent on solute concentration, with a higher concentration correlating with a higher T(g). The experimental T(g) was consistent with the predicted value calculated using the Couchman-Karasz equation in both the C8Glu and C8SGlu/water mixtures. The change of heat capacity at T(g) showed the two bending points under variation of concentrations. And the highest temperature of phase transition from lamellar to isotropic solution was observed at around 50% molar concentration. It was expected that non-percolated state of water existed in extremely higher concentration ranges. Copyright © 2010 Elsevier Ltd. All rights reserved.
[Study on total glucosides of peony preventing non-obese diabetic mice from sialoadenitis].
Li, Chun-Lei; He, Jing; Hua, Hong
2011-04-01
To investigate the immunosuppressive effect of total glucosides of peony (TGP) on sialoadenitis in non-obese diabetic mice (NOD mice) and explore its possible mechanism. 27 female five-week-old NOD mice were randomly divided into three groups: TGP, hydroxychloroquine (HCQ) and normal saline (NS) group. One week later, they were administered intragastrically in TGP, HCQ and NS respectively. Three mice from each group were sacrificed at the age of 10, 15 and 20 weeks. The saliva flow, serum and submandibular glands were collected at these time points. Histological changes of submandibular glands were examined by HE staining. The expression of autoantibodies (SSA, SSB and anti-alpha-fodrin) and associated cytokines in serum were detected by enzyme-linked immunosorbent assay (ELISA). Compared with the NS group, salivary flow was significantly increased, the extent of the histological changes were ameliorated, the autoantibodies in serum were significantly decreased and the imbalance of Th1/Th2 cytokines was remedied in the mice treated with TGP and HCQ. There were no significant differences between the two groups treated with TGP and HCQ (P > 0.05). TGP can effectively ameliorate sialoadenitis on NOD mice. The mechanism was thought to be associated with the protection of submandibular gland from intense inflammation and the correction of Th1/Th2 cytokines imbalance.
Effects of glyceryl glucoside on AQP3 expression, barrier function and hydration of human skin.
Schrader, A; Siefken, W; Kueper, T; Breitenbach, U; Gatermann, C; Sperling, G; Biernoth, T; Scherner, C; Stäb, F; Wenck, H; Wittern, K-P; Blatt, T
2012-01-01
Aquaporins (AQPs) present in the epidermis are essential hydration-regulating elements controlling cellular water and glycerol transport. In this study, the potential of glyceryl glucoside [GG; alpha-D-glucopyranosyl-alpha-(1->2)-glycerol], an enhanced glycerol derivative, to increase the expression of AQP3 in vitro and ex vivo was evaluated. In vitro studies with real-time RT-PCR and FACS measurements were performed to test the induction by GG (3% w/v) of AQP3 mRNA and protein in cultured human keratinocytes. GG-containing formulations were applied topically to volunteer subjects and suction blister biopsies were analyzed to assess whether GG (5%) could penetrate the epidermis of intact skin, and subsequently upregulate AQP3 mRNA expression and improve barrier function. AQP3 mRNA and protein levels were significantly increased in cultured human keratinocytes. In the studies on volunteer subjects, GG significantly increased AQP3 mRNA levels in the skin and reduced transepidermal water loss compared with vehicle-controlled areas. GG promotes AQP3 mRNA and protein upregulation and improves skin barrier function, and may thus offer an effective treatment option for dehydrated skin. Copyright © 2012 S. Karger AG, Basel.
Vedernikov, Artem I; Ushakov, Evgeny N; Efremova, Asya A; Kuz'mina, Lyudmila G; Moiseeva, Anna A; Lobova, Natalia A; Churakov, Andrei V; Strelenko, Yuri A; Alfimov, Michael V; Howard, Judith A K; Gromov, Sergey P
2011-08-19
4,4'-Bipyridine and 2,7-diazapyrene derivatives (A) having two ammonioalkyl N-substituents were synthesized. The complex formation of these compounds with bis(18-crown-6)stilbene (D) was studied by spectrophotometry, cyclic voltammetry, (1)H NMR spectroscopy, and X-ray diffraction analysis. In MeCN, π-donor D and π-acceptors A form supramolecular 1:1 (D·A) and 2:1 (D·A·D) charge-transfer complexes. The D·A complexes have a pseudocyclic structure as a result of ditopic binding of the ammonium groups to the crown-ether fragments. The better the geometric matching between the components, the higher the stability of the D·A complexes (log K up to 9.39). A key driving force of the D·A·D complex formation is the excessive steric strain in the precursor D·A complexes. The pseudocyclic D·A complexes involving the ammoniopropyl derivative of 4,4'-bipyridine were obtained as single crystals. Crystallization of the related ammonioethyl derivative was accompanied by transition of the D·A complexes to a structure of the (D·A)(m) coordination polymer type.
Slavin, Margaret; Lu, Yingjian; Kaplan, Nicholas; Yu, Liangli Lucy
2013-11-15
Black soybean is a potential functional food ingredient with high anthocyanin content, but the ability to maintain anthocyanin content under dry heat processing has not been reported. This study investigated the effects of soybean seed coat colour and baking time-temperature combinations on the extractable antioxidant properties of a soy cracker food model. Crackers prepared with black soybeans had significantly higher TPC, total isoflavones, and peroxyl, hydroxyl, and ABTS(+) radical scavenging abilities than their yellow counterparts, at all time-temperature combinations. Cyanidin-3-glucoside (C3G) was detected only in black soybean crackers, and all baking treatments significantly decreased C3G. The greatest losses occurred at the low temperature×long time and high temperature×short time, the smallest loss with moderate temperature×short/medium time. The high temperature treatment altered phenolic acid and isoflavone profiles; however, total isoflavones were unaffected. Overall results suggest that moderate baking temperature at minimal time may best preserve anthocyanin and other phenolics in baked black soybean crackers. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Jianxia Sun
2016-08-01
Full Text Available As an alternative preservation method to thermal treatment, ultrasound is a novel non-thermal processing technology that can significantly avoid undesirable nutritional changes. However, recently literature indicated that anthocyanin degradation occurred when high amplitude ultrasound was applied to juice. This work mainly studied the effect of ultrasound on the stability and antioxidant capacity of pelargonidin-3-glucoside (Pg-3-glu and the correlation between anthocyanin degradation and •OH generation in a simulated system. Results indicated that the spectral intensities of Pg-3-glu decreased with increasing ultrasound power (200–500 W and treatment time (0–60 min. The degradation trend was consistent with first-order reaction kinetics (R2 > 0.9100. Further study showed that there was a good linear correlation between Pg-3-glu degradation and •OH production (R2 = 0.8790, which indicated the important role of •OH in the degradation of anthocyanin during ultrasound exposure. Moreover, a decrease in the antioxidant activity of solution(s containing Pg-3-glu as evaluated by the DPPH and FRAP methods was observed after ultrasound treatment.
Sun, Jianxia; Mei, Zhouxiong; Tang, Yajuan; Ding, Lijun; Jiang, Guichuan; Zhang, Chi; Sun, Aidong; Bai, Weibin
2016-08-24
As an alternative preservation method to thermal treatment, ultrasound is a novel non-thermal processing technology that can significantly avoid undesirable nutritional changes. However, recently literature indicated that anthocyanin degradation occurred when high amplitude ultrasound was applied to juice. This work mainly studied the effect of ultrasound on the stability and antioxidant capacity of pelargonidin-3-glucoside (Pg-3-glu) and the correlation between anthocyanin degradation and •OH generation in a simulated system. Results indicated that the spectral intensities of Pg-3-glu decreased with increasing ultrasound power (200-500 W) and treatment time (0-60 min). The degradation trend was consistent with first-order reaction kinetics (R² > 0.9100). Further study showed that there was a good linear correlation between Pg-3-glu degradation and •OH production (R² = 0.8790), which indicated the important role of •OH in the degradation of anthocyanin during ultrasound exposure. Moreover, a decrease in the antioxidant activity of solution(s) containing Pg-3-glu as evaluated by the DPPH and FRAP methods was observed after ultrasound treatment.
Maatouk, Mouna; Mustapha, Nadia; Mokdad-Bzeouich, Imen; Chaaban, Hind; Abed, Besma; Iaonnou, Irina; Ghedira, Kamel; Ghoul, Mohamed; Ghedira, Leila Chekir
2017-11-01
Phytochemicals extracted from flowers, roots and bark, leaves, and other plant sources have been used extensively throughout human history with varying levels of efficacy in prevention and treatment of disease. Recently, advanced methods for characterization and clinical use of these materials have allowed modern understanding of their properties to be used as immunomodulatory agents that act by enhancement of endogenous cytoprotective mechanisms, avoiding interference with normal physiologic signaling and highly effective medical treatment with minimal adverse side effects. Simple methods have been identified for improving their biological effects, such as thermal conditioning by heating or freezing-prominent example being heat treatment of lycopene and tetrahydrocannabinol. The present investigation shows improvement of the ability of heat to augment splenocyte proliferation, natural killer (NK) cell activities, and antioxidant capacity of the flavonoid luteolin-7-O-β-glucoside (L7G) in comparison with the native (non heat-treated) molecule, while further demonstrating that both the native and the heat-treated variants exhibit comparable antioxidant properties, as evidenced by their effects in macrophages by inhibition of nitric oxide production and lysosomal enzyme activity in experiments that strengthen lysosomal membrane integrity. Outcomes of these studies suggest that heat-treated L7G shows promise for use in immunotherapy, including anti-cancer regimens, as shown by its improvement of NK cell cytotoxicity.
Zuo, Zhi-Yan; Zhan, Shu-Yu; Huang, Xuan; Ding, Bao-Yue; Liu, Yu-Qian; Ruan, Yu-Er; Jiang, Ning-Hua
2017-10-01
Total glucosides of peony (TGP), containing the effective components of paeoniflorin (Pae), albiflorin (Alb) and so on, are effective parts of Radix Paeoniae Alba. And it possesses extensive pharmacological actions, one of which is hepatoprotective effect. In recent years, abundant of pharmacokinetics and pharmacodynamics research of TGP in hepatoprotective effects have been performed. However, the relative medicine of TGP in hepatoprotective effect has not been developed for clinical application. In order to provide reference for the development and rational clinical application of TGP, the research progresses of pharmacokinetics and pharmacodynamics of TGP in hepatoprotective effect were summarized in this paper. Pharmacokinetics research has clarified the process of absorption, distribution, metabolism and excretion of TGP in vivo, and liver injury disease can significantly influence its metabolic processes. Pharmacodynamics studies suggested that TGP can protect against acute liver injury, non-alcoholic fatty liver diseases (NAFLD), chronic liver fibrosis and liver cancer. However, the action mechanism and in vivo process about hepatoprotective effects of TGP have not been clearly revealed. How liver injury influences the metabolism of TGP and its integrated regulation through multiple targets need to be further studied. The combined pharmacokinetics and pharmacodynamics studies should be performed in favour of medicine development and clinical application of TGP in hepatoprotective effects. Copyright© by the Chinese Pharmaceutical Association.
[Therapeutic effect of total glucosides of paeony on lupus nephritis in MRL/lpr mice].
Ding, Zhao-Xia; Yang, Shao-Feng; Wu, Qi-Fu; Lu, Ying; Chen, Yu-Yao; Nie, Xiao-Li; Jie, Hong-Yu; Qi, Jing-Min; Wang, Fan-Sheng
2011-04-01
To observe the therapeutic effect of total glucosides of paeony (TGP) on lupus nephritis (LN) in MRL/lpr mice. MRL/lpr mice with lupus nephritis were randomized into model group and TGP group. The urinary protein content was detected using Coomassie brilliant blue, and the serum levels of IgG anti-double-stranded DNA (dsDNA) antibodies and antinuclear antibodies (ANA) were measured by enzyme-linked immunosorbent assay (ELISA). The changes in the renal pathology were examined microscopically, and the spleen and thymus were weighed to calculate the spleen and thymus indexes. At 15 and 30 days after TGP administration, the urinary protein content in the TGP group was significantly lower than that in the model group (PTGP treatment significantly lowered the serum levels of anti-dsDNA antibodies and ANA and the weight and index of spleen (PTGP treatment, the urinary protein content and the levels of anti-dsDNA antibodies and ANA decreased significantly at 15 and 30 days after TGP administration (PTGP administration, the urinary protein content was significantly lowered in the TGP group as compared to that at 15 days (PTGP can reduce urinary protein content and serum levels of anti-dsDNA antibodies and ANA, and lessen renal pathology in MRL/lpr mice with lupus nephritis, suggesting its therapeutic effect on lupus nephritis.
Directory of Open Access Journals (Sweden)
Gyungse Park
2008-07-01
Full Text Available In the title compound, [Cd3(C16H10O43(C3H7NO2]n or [Cd3(SDA3(DMF2]n (H2SDA is trans-stilbene-4,4′-dicarboxylic acid and DMF is dimethylformamide, the linear dicarboxylate ligand forms a two-dimensionally layered metal–organic network with the relatively uncommon 36 topology. The structure reveals trinuclear secondary building units and has an octahedral geometry at a central metal ion (occupying a overline{3} symmetry site and tetrahedral geometries at two surrounding symmetrically equivalent metal ions lying on a threefold axis. The six-connected planar trinuclear CdII centers, Cd3(O2CR6, play a role as potential nodes in generation of the relatively uncommon 36 topology. The coordinated DMF unit is disordered around the threefold axis.
Wang, Jun; Huang, Jing; Du, Likai; Lan, Zhenggang
2015-07-09
The photoinduced intramolecular excited-state energy-transfer (EET) process in conjugated polymers has received a great deal of research interest because of its important role in the light harvesting and energy transport of organic photovoltaic materials in photoelectric devices. In this work, the silylene-bridged biphenyl and stilbene (SBS) system was chosen as a simplified model system to obtain physical insight into the photoinduced intramolecular energy transfer between the different building units of the SBS copolymer. In the SBS system, the vinylbiphenyl and vinylstilbene moieties serve as the donor (D) unit and the acceptor (A) unit, respectively. The ultrafast excited-state dynamics of the SBS system was investigated from the point of view of nonadiabatic dynamics with the surface-hopping method at the TDDFT level. The first two excited states (S1 and S2) are characterized by local excitations at the acceptor (vinylstilbene) and donor (vinylbiphenyl) units, respectively. Ultrafast S2-S1 decay is responsible for the intramolecular D-A excitonic energy transfer. The geometric distortion of the D moiety play an essential role in this EET process, whereas the A moiety remains unchanged during the nonadiabatic dynamics simulation. The present work provides a direct dynamical approach to understand the ultrafast intramolecular energy-transfer dynamics in SBS copolymers and other similar organic photovoltaic copolymers.
Zhu, Lijun; Sun, Shanshan; Hu, Yanxi; Liu, Yufeng
2018-04-01
A clear understanding of the metabolism of Traditional Chinese Medicines is extremely important in their rational clinical application and effective material foundation research. A novel and reliable strategy was performed to find more metabolites of paeoniflorin, determine the metabolites of total paeony glucosides (TPG) by means of determining those metabolites of paeoniflorin, and compare the metabolism differences between paeoniflorin and TPG by intragastric administration. This strategy was characterized as follows. Firstly, the rats were divided into two groups (the paeoniflorin group and the TPG group) to find differences in metabolism mechanisms between paeoniflorin and TPG. Secondly, UPLC-FT-ICR MS and UPLC-Q-TOF MS 2 were applied to obtain accurate molecular weight and structural information, respectively. Thirdly, the metabolites were tentatively identified by a combination of data-processing methods including mass defect screening, characteristic neutral loss screening and product ion screening. Finally, a comparative study was employed in the metabolism of paeoniflorin and TPG. Based on the strategy, 18 metabolites of paeoniflorin (including four new compounds) and 11 metabolites of TPG (including two new compounds) were identified. In all of the identified metabolites of paeoniflorin, two metabolites in rat plasma, four metabolites in rat urine and six metabolites in rat feces were found for the first time after paeoniflorin administration. The results indicate that hydrolyzation of the ester bond and glucosidic band and conjugation with glucuronide were the major metabolic pathways of paeoniflorin. The metabolites of paeoniflorin and TPG in rat plasma, urine and feces have been detected for the first time after intragastric administration. The results may contribute to a better understanding of the metabolism mechanism and provide a scientific rationale for researching the material basis of paeoniflorin and TPG in vivo. Copyright © 2017 John Wiley
Azevedo, Marisa F; Camsari, Cagri; Sá, Carla M; Lima, Cristovao F; Fernandes-Ferreira, Manuel; Pereira-Wilson, Cristina
2010-06-01
In the present study, two phytochemicals - ursolic acid (UA) and luteolin-7-glucoside (L7G) - were assessed in vivo in healthy rats regarding effects on plasma glucose and lipid profile (total cholesterol, HDL and LDL), as well as liver glycogen content, in view of their importance in the aetiology of diabetes and associated complications. Both UA and L7G significantly decreased plasma glucose concentration. UA also significantly increased liver glycogen levels accompanied by phosphorylation of glycogen synthase kinase-3 (GSK3). The increase in glycogen deposition induced by UA (mediated by GSK3) could have contributed to the lower plasma glucose levels observed. Both compounds significantly lowered total plasma cholesterol and low-density lipoprotein levels, and, in addition, UA increased plasma high-density lipoprotein levels. Our results show that UA particularly may be useful in preventable strategies for people at risk of developing diabetes and associated cardiovascular complications by improving plasma glucose levels and lipid profile, as well as by promoting liver glycogen deposition.
Total glucosides of paeony prevents juxta-articular bone loss in experimental arthritis.
Wei, Chen Chao; You, Fan Tian; Mei, Li Yu; Jian, Sun; Qiang, Chen Yong
2013-07-21
Total glucosides of paeony (TGP) is a biologically active compound extracted from Paeony root. TGP has been used in rheumatoid arthritis therapy for many years. However, the mechanism by which TGP prevents bone loss has been less explored. TGP was orally administered for 3 months to New Zealand rabbits with antigen-induced arthritis (AIA). Digital x-ray knee images and bone mineral density (BMD) measurements of the subchondral knee bone were performed before sacrifice. Chondrocytes were observed using transmission electron microscopy (TEM). Histological analysis and mRNA expression of receptor activator of nuclear factor-B ligand (RANKL) and osteoprotegerin (OPG) were evaluated in joint tissues. The BMD value in TGP rabbits was significantly higher compared with that seen in the AIA model rabbits. In addition, the subchondral bone plate was almost completely preserved by TGP treatment, while there was a decrease in bone plate integrity in AIA rabbits. There was less damage to the chondrocytes of the TGP treated group. Immunohistochemical examination of the TGP group showed that a higher percentage of TGP treated chondrocytes expressed OPG as compared to the chondrocytes isolated from AIA treated animals. In contrast, RANKL expression was significantly decreased in the TGP treated group compared to the AIA group. In support of the immunohistochemistry data, the expression of RANKL mRNA was decreased and OPG mRNA expression was enhanced in the TGP group when compared to that of the AIA model group. These results reveal that TGP suppresses juxta-articular osteoporosis and prevents subchondral bone loss. The decreased RANKL and increased OPG expression seen in TGP treated animals could explain how administration of TGP maintains higher BMD.
DEFF Research Database (Denmark)
Lai, Daniela; Abou Hachem, Maher; Robson, Fran
2014-01-01
has the dominant physiological role in rhodiocyanoside degradation. Structural modelling, site-directed mutagenesis and activity assays establish that a glycine residue (G211) in the aglycone binding site of BGD2 is essential for its ability to hydrolyse the endogenous cyanogenic glucosides...... with the Lotus corniculatus clade within the Lotus genus. This suggests the evolutionary scenario that substrate specialization for rhodiocyanosides evolved from a promiscuous activity of a progenitor cyanogenic beta-glucosidase, resembling BGD2, and required no more than a single amino acid substitution....
Wu, Sheng; Tian, Li
2018-03-03
A new flavone glucoside tricetin 4'-O-β-glucopyranoside (1) and four known ellagitannins and flavones tricetin (2), luteolin (3), ellagic acid (4), and granatin B (5) were isolated from the flowers of Punica granatum L. (Lythraceae). Their structures were established by 1D and 2D NMR as well as mass spectrometry analyses. Among all tested compounds, tricetin (2) exhibited the strongest α-glucosidase inhibitory activity that was comparable to the anti-diabetic drug acarbose. Comparative structure-function analysis of tri-, tetra-, and pentahydroxy flavones [apigenin, luteolin (3), and tricetin (2), respectively] suggested that a greater number of hydroxyl groups on the flavone molecule enhanced its suppression of α-glucosidase, α-amylase, and lipase activities.
Lin, Jinpiao; Xiao, Lianbo; Ouyang, Guilin; Shen, Yu; Huo, Rongfen; Zhou, Zhou; Sun, Yue; Zhu, Xianjin; Zhang, Jie; Shen, Baihua; Li, Ningli
2012-12-01
Total glucoside of paeony (TGP), an active compound extracted from paeony root, has been used in therapy for rheumatoid arthritis (RA). Th1 and Th17 cells are now believed to play crucial roles in the lesions of RA. However, the molecular mechanism of TGP in inhibition of Th1 and Th17 cells remains unclear. In this study, we found that TGP treatment significantly decreased percentage and number of Th1 and Th17 cells in collagen induced arthritis (CIA) mice. Consistently, treatment with TGP decreased expression of T-bet and RORγt as well as phosphorylation of STAT1 and STAT3. In particular, TGP treatment inhibited dendritic cells (DCs) maturation and reduced production of IL-12 and IL-6. Moreover, TGP-treatment RA patients showed shank population of matured DCs and IFN-γ-, IL-17-producing cells. Taken together, our results demonstrated that TGP inhibited maturation and activation of DCs, which led to impaired Th1 and Th17 differentiation in vivo. Copyright © 2013 Elsevier Inc. All rights reserved.
Effects of Power Ultrasound on Stability of Cyanidin-3-glucoside Obtained from Blueberry
Directory of Open Access Journals (Sweden)
Guang-Long Yao
2016-11-01
Full Text Available Power ultrasound (US could potentially be used in the food industry in the future. However, the extent of anthocyanin degradation by US requires investigation. Cyanidin-3-glucoside (Cy-3-glu obtained from blueberry extracts was used as research material to investigate the effect of power ultrasound on food processing of anthocyanin-rich raw materials. The effects of ultrasonic waves on the stability of Cy-3-glu and on the corresponding changes in UV-Vis spectrum and antioxidant activity were investigated, and the mechanisms of anthocyanin degradation induced by ultrasonic waves were discussed. To explore Cy-3-glu degradation in different environments, we kept the Cy-3-glu solution treated with ultrasonic waves in four concentrations (0%, 10%, 20%, and 50% of ethanol aqueous solutions to simulate water, beer, wine, and liquor storage environment according to the chemical kinetics method. Results show that the basic spectral characteristics of Cy-3-glu did not significantly change after power ultrasound cell crusher application at 30 °C. However, with anthocyanin degradation, the intensity of the peak for Cy-3-glu at 504 nm significantly decreased (p < 0.05. The degradation kinetics of Cy-3-glu by ultrasonic waves (200–500 W frequency fitted well to first-order reaction kinetics, and the degradation rate constant of Cy-3-glu under power ultrasound was considerably larger than that under thermal degradation (p < 0.05. The sensitivity of the anthocyanins of blueberry to temperature increased with increasing ethanol concentration, and the longest half-life was observed in 20% ethanol aqueous solution.
Characterization of antiproliferative activity constituents from Artocarpus heterophyllus.
Zheng, Zong-Ping; Xu, Yang; Qin, Chuan; Zhang, Shuang; Gu, Xiaohong; Lin, Yingying; Xie, Guobin; Wang, Mingfu; Chen, Jie
2014-06-18
Artocarpus heterophyllus is an evergreen fruit tree cultivated in many tropical regions. Previous studies have shown that some of its compositions exhibited potential tyrosinase inhibition activities. This study indentified 8 new phenolic compounds, artoheterophyllins E-J (1-6), 4-geranyl-2',3,4',5-tetrahydroxy-cis-stilbene (7), and 5-methoxymorican M (8) and 2 new natural compounds (9 and 10), 2,3-dihydro-5,7-dihydroxy-2-(2-hydroxy-4-methoxyphenyl)-4H-benzopyran-4-one and 6-[(1S,2S)-1,2-dihydroxy-3-methylbutyl]-2-(2,4-dihydroxyphenyl)-5-hydroxy-7-methoxy-3-(3-methyl-2-buten-1-yl)-4H-1-benzopyran-4-one, together with 23 known compounds (11-33), from the ethanol extract of the wood of A. heterophyllus. The structures of the eight new compounds (1-8) and two new natural compounds were established by extensive 1D- and 2D-NMR experiments. The anticancer effects of the isolated compounds were examined in MCF-7, H460, and SMMC-7721 human cancer cell lines by MTT assay. Compounds 5, 11, 12, and 30 significantly reduced the cell viabilities of these cell lines. Especially, compounds 11 and 30 resulted in more potent cytotoxicity than the positive control, 5-fluorouracil (5-Fu), in SMMC-7721 cell line, with IC50 values of 15.85 and 12.06 μM, whereas compound 30 exhibited more potent cytotoxicity than 5-Fu in NCI-H460 cell line, with an IC50 value of 5.19 μM. In addition, this study suggests that compounds 11 and 30 from the wood of A. heterophyllus have anticancer potential via MAPK pathways.
Wu, Yonggui; Ren, Kejun; Liang, Chao; Yuan, Liang; Qi, Xiangming; Dong, Jing; Shen, Jijia; Lin, Shanyan
2009-01-01
Total glucosides of paeony (TGP), extracted from the root of Paeonia lactiflora pall, has been shown to have ant-inflammatory and antioxidative actions. The aims of this study were to elucidate the renoprotective effect of TGP and its mechanism in experimental diabetes. Streptozotocin-induced diabetic rats were treated with TGP for 8 weeks. Treatment with TGP at 50, 100, and 200 mg/kg significantly lowered 24-h urinary albumin excretion rate in diabetic rats. TGP treatment in all doses markedly attenuated glomerular volume, and treatment with TGP at 100 and 200 mg/kg markedly reduced indices for tubulointerstitial injury in diabetic rats. Western blot analysis showed that the expressions of 1 alpha (IV) collagen, intercellular adhesion molecule (ICAM)-1, interleukin (IL)-1, tumor necrosis factor (TNF)-alpha, NF-kappaB p65, and 3-nitrotyrosine (3-NT) protein were increased in the kidneys of diabetic rats; the increases in these proteins were all dose-dependently and significantly inhibited by TGP treatment. The expression of nephrin protein was significantly reduced in the kidneys from diabetic rats and markedly increased by TGP treatment. The expression of transforming growth factor (TGF)-beta1 protein in the kidney was also significantly increased in diabetic rats, which was significantly inhibited by treatment with TGP at all doses. Our data suggest that TGP treatment ameliorates early renal injury via the inhibition of expression of ICAM-1, IL-1, TNF-alpha, and 3-NT in the kidneys of diabetic rats.
Generotti, Silvia; Cirlini, Martina; Malachova, Alexandra; Sulyok, Michael; Berthiller, Franz; Dall’Asta, Chiara; Suman, Michele
2015-01-01
In the scientific field, there is a progressive awareness about the potential implications of food processing on mycotoxins especially concerning thermal treatments. High temperatures may cause, in fact, transformation or degradation of these compounds. This work is aimed to study the fate of mycotoxins during bakery processing, focusing on deoxynivalenol (DON) and deoxynivalenol-3-glucoside (DON3Glc), along the chain of industrial rusk production. Starting from naturally contaminated bran, we studied how concentrations of DON and DON3Glc are influenced by modifying ingredients and operative conditions. The experiments were performed using statistical Design of Experiment (DoE) schemes to synergistically explore the relationship between mycotoxin reduction and the indicated processing transformation parameters. All samples collected during pilot plant experiments were analyzed with an LC-MS/MS multimycotoxin method. The obtained model shows a good fitting, giving back relevant information in terms of optimization of the industrial production process, in particular suggesting that time and temperature in baking and toasting steps are highly relevant for minimizing mycotoxin level in rusks. A reduction up to 30% for DON and DON3Glc content in the finished product was observed within an acceptable technological range. PMID:26213969
Directory of Open Access Journals (Sweden)
Silvia Generotti
2015-07-01
Full Text Available In the scientific field, there is a progressive awareness about the potential implications of food processing on mycotoxins especially concerning thermal treatments. High temperatures may cause, in fact, transformation or degradation of these compounds. This work is aimed to study the fate of mycotoxins during bakery processing, focusing on deoxynivalenol (DON and deoxynivalenol-3-glucoside (DON3Glc, along the chain of industrial rusk production. Starting from naturally contaminated bran, we studied how concentrations of DON and DON3Glc are influenced by modifying ingredients and operative conditions. The experiments were performed using statistical Design of Experiment (DoE schemes to synergistically explore the relationship between mycotoxin reduction and the indicated processing transformation parameters. All samples collected during pilot plant experiments were analyzed with an LC-MS/MS multimycotoxin method. The obtained model shows a good fitting, giving back relevant information in terms of optimization of the industrial production process, in particular suggesting that time and temperature in baking and toasting steps are highly relevant for minimizing mycotoxin level in rusks. A reduction up to 30% for DON and DON3Glc content in the finished product was observed within an acceptable technological range.
Generotti, Silvia; Cirlini, Martina; Malachova, Alexandra; Sulyok, Michael; Berthiller, Franz; Dall'Asta, Chiara; Suman, Michele
2015-07-24
In the scientific field, there is a progressive awareness about the potential implications of food processing on mycotoxins especially concerning thermal treatments. High temperatures may cause, in fact, transformation or degradation of these compounds. This work is aimed to study the fate of mycotoxins during bakery processing, focusing on deoxynivalenol (DON) and deoxynivalenol-3-glucoside (DON3Glc), along the chain of industrial rusk production. Starting from naturally contaminated bran, we studied how concentrations of DON and DON3Glc are influenced by modifying ingredients and operative conditions. The experiments were performed using statistical Design of Experiment (DoE) schemes to synergistically explore the relationship between mycotoxin reduction and the indicated processing transformation parameters. All samples collected during pilot plant experiments were analyzed with an LC-MS/MS multimycotoxin method. The obtained model shows a good fitting, giving back relevant information in terms of optimization of the industrial production process, in particular suggesting that time and temperature in baking and toasting steps are highly relevant for minimizing mycotoxin level in rusks. A reduction up to 30% for DON and DON3Glc content in the finished product was observed within an acceptable technological range.
Total glucosides of peony ameliorates Sjögren's syndrome by affecting Th1/Th2 cytokine balance.
Wu, Guolin; Wu, Nayuan; Li, Tianyi; Lu, Wenwen; Yu, Guoyou
2016-03-01
The present study aimed to investigate the molecular mechanisms underlying the effects of total glucosides of peony (TGP) in the treatment of Sjögren's syndrome (SS). A total of 40 mice with SS were evenly assigned into four groups, including: Control group; TGP group, receiving 1 mg TGP daily; hydroxychloroquine (HCQ) group, receiving 0.25 mg HCQ daily; and a combined group, receiving 1 mg TGP and 0.25 mg HCQ daily. After 8 weeks, quantitative polymerase chain reaction and an enzyme-linked immunosorbent assay were used to detect the levels of interferon-γ (IFN-γ), interleukin-4 (IL-4), Fas and FasL in each group of mice. In addition, immunohistochemical analysis was used to determine the expression levels of IFN-γ and IL-4. IFN-γ, IL-4, Fas and FasL levels were significantly increased in the control group compared with the other three groups (PTGP and combined groups compared with the control group (PTGP ameliorates SS by affecting the Th1/Th2 cytokine balance and decreasing the expression levels of IFN-γ, IL-4, Fas and FasL. Therefore, TGP may represent a potential novel therapeutic agent for the treatment of SS.
Nguyen, Thi Thanh Hanh; Si, Jinbeom; Kang, Choongil; Chung, Byoungsang; Chung, Donghwa; Kim, Doman
2017-01-01
Curcuminoids from rhizomes of Curcuma longa possess various biological activities. However, low aqueous solubility and consequent poor bioavailability of curcuminoids are major limitations to their use. In this study, curcuminoids extracted from turmeric powder using stevioside (Ste), rebaudioside A (RebA), or steviol glucosides (SG) were solubilized in water. The optimum extraction condition by Ste, RebA, or SG resulted in 11.3, 9.7, or 6.7mg/ml water soluble curcuminoids. Curcuminoids solubilized in water showed 80% stability at pH from 6.0 to 10.0 after 1week of storage at 25°C. The particle sizes of curcuminoids prepared with Ste, RebA, and SG were 110.8, 95.7, and 32.7nm, respectively. The water soluble turmeric extracts prepared with Ste, RebA, and SG showed the 2,2-diphenyl-1-picrylhydrazyl radical scavenging (SC50) activities of 127.6, 105.4, and 109.8μg/ml, and the inhibition activities (IC50) against NS2B-NS3(pro) from dengue virus type IV of 14.1, 24.0 and 15.3μg/ml, respectively. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
Yujie Dai
2017-12-01
Full Text Available The data presented in this article are related to the research article entitled âThe mechanism for cleavage of three typical glucosidic bonds induced by hydroxyl free radicalâ (Dai et al., 2017 [1]. This article includes the structures of three kinds of disaccharides such as maltose, fructose and cellobiose, the diagrammatic sketch of the hydrogen abstraction reaction of the disaccharides by hydroxyl radical, the structure of the transition states for pyran ring opening of moiety A and cleavage of α(1â2 glycosidic bond starting from the hydrogen abstraction of C6âH in moiety A of sucrose, the transition state structure for cleavage of α(1â2 glycosidic bond starting from the hydrogen abstraction of C1â²-H in moiety B of sucrose, the transition state structure, sketch for the reaction process and relative energy change of the reaction pathway for direct cleavage of α(1â4 glycosidic bond starting from hydrogen abstraction of C6â²âH of moiety B of maltose.
Directory of Open Access Journals (Sweden)
Fabiana G. Moreira
2001-03-01
Full Text Available The use of a methyl-D-glucoside (alphaMG, a synthetic analogue of maltose, as carbon source and inducer of amylase synthesis to several species of Aspergillus was studied in submerged and solid-state fermentations. Among a group of ten species, A. tamarii, A. fumigatus and A. flavus were able to produce biomass and high specific amylolytic activity in submerged cultures containing alphaMG as the only carbon source. In solid state fermentation, the enrichment of basal wheat bran or corn cob medium with alphaMG increased up to 3 times the production of amylases. In both submerged and solid state fermentations, alphaMG was more effective inducer of amylases than maltose and starch.
Directory of Open Access Journals (Sweden)
Moreira Fabiana G.
2001-01-01
Full Text Available The use of a methyl-D-glucoside (alphaMG, a synthetic analogue of maltose, as carbon source and inducer of amylase synthesis to several species of Aspergillus was studied in submerged and solid-state fermentations. Among a group of ten species, A. tamarii, A. fumigatus and A. flavus were able to produce biomass and high specific amylolytic activity in submerged cultures containing alphaMG as the only carbon source. In solid state fermentation, the enrichment of basal wheat bran or corn cob medium with alphaMG increased up to 3 times the production of amylases. In both submerged and solid state fermentations, alphaMG was more effective inducer of amylases than maltose and starch.
Directory of Open Access Journals (Sweden)
Mingming Lv
2017-01-01
Full Text Available Semen Strychni have been shown to have therapeutic effect in improving blood circulation, relieving rheumatic pain, and treating cancer. However, Semen Strychni could cause severe nephrotoxicity. The present study was designed to evaluate whether treatment with total glucosides from paeony (TGP has renoprotective effect against nephrotoxicity induced by total alkaloids from Semen Strychni (TAS. The levels of blood urea nitrogen (BUN and creatinine (Cr were determined and histopathological changes were also examined to evaluate renal injury. Moreover, a HPLC-MS method was developed and validated to investigate the comparative toxicokinetics of strychnine and brucine in rats plasma after oral administration of TAS and pretreatment with TGP. Results demonstrated that the levels of BUN and Cr were significantly increased (p<0.05 in TAS group, together with tubule epithelium cloudy swelling, degeneration, and glomerular atrophy in rats’ kidneys. The TAS-induced kidney damage was alleviated after pretreatment with TGP. Besides, Tmax of strychnine and brucine were increased and T1/2 of strychnine and brucine were decreased after pretreatment with TGP. The toxicokinetics study showed that pretreatment with TGP could attenuate the absorption of strychnine and brucine, as well as accelerate their elimination. These results suggest that TGP possesses renoprotective effects.
Hammerbacher, Almuth; Ralph, Steven G; Bohlmann, Joerg; Fenning, Trevor M; Gershenzon, Jonathan; Schmidt, Axel
2011-10-01
Stilbenes are dibenzyl polyphenolic compounds produced in several unrelated plant families that appear to protect against various biotic and abiotic stresses. Stilbene biosynthesis has been well described in economically important plants, such as grape (Vitis vinifera), peanut (Arachis hypogaea), and pine (Pinus species). However, very little is known about the biosynthesis and ecological role of stilbenes in spruce (Picea), an important gymnosperm tree genus in temperate and boreal forests. To investigate the biosynthesis of stilbenes in spruce, we identified two similar stilbene synthase (STS) genes in Norway spruce (Picea abies), PaSTS1 and PaSTS2, which had orthologs with high sequence identity in sitka (Picea sitchensis) and white (Picea glauca) spruce. Despite the conservation of STS sequences in these three spruce species, they differed substantially from angiosperm STSs. Several types of in vitro and in vivo assays revealed that the P. abies STSs catalyze the condensation of p-coumaroyl-coenzyme A and three molecules of malonyl-coenzyme A to yield the trihydroxystilbene resveratrol but do not directly form the dominant spruce stilbenes, which are tetrahydroxylated. However, in transgenic Norway spruce overexpressing PaSTS1, significantly higher amounts of the tetrahydroxystilbene glycosides, astringin and isorhapontin, were produced. This result suggests that the first step of stilbene biosynthesis in spruce is the formation of resveratrol, which is further modified by hydroxylation, O-methylation, and O-glucosylation to yield astringin and isorhapontin. Inoculating spruce with fungal mycelium increased STS transcript abundance and tetrahydroxystilbene glycoside production. Extracts from STS-overexpressing lines significantly inhibited fungal growth in vitro compared with extracts from control lines, suggesting that spruce stilbenes have a role in antifungal defense.
Cytotoxic and Apoptogenic Effects of Cyanidin-3-Glucoside on the Glioblastoma Cell Line.
Hosseini, Masoumeh Mansoubi; Karimi, Aliasghar; Behroozaghdam, Mitra; Javidi, Mohammad Amin; Ghiasvand, Saeedeh; Bereimipour, Ahmad; Aryan, Hoda; Nassiri, Farbod; Jangholi, Ehsan
2017-12-01
Glioblastoma multiforme (GBM) is the most prevalent and aggressive primary cerebral tumor. The median survival time is 15 months despite maximum treatment because the tumor is resistant to most therapeutic modalities. Several studies have indicated chemopreventive and chemotherapeutic activity of cyanidin-3-glucoside (C3G) as an anthocyanin component. We aimed to illustrate the cytotoxic and apoptogenic effects of C3G in the U87 cell line (human GBM cell line). Cytotoxic activity was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide tetrazolium assay after treatment with C3G at different concentrations in the U87 cell line. Cisplatin was used as a positive control for 24 and 48 hours. The percentage of apoptotic cells was determined using an Annexin V/propidium iodide assay, and the expression of bax, bcl2, and p53 genes was assessed using real-time polymerase chain reaction. Treatment of U87 cells with 40 μg/mL of C3G resulted in 32% apoptotic cells after 24 hours. To further confirm that C3G treatment induced apoptosis in U87 cells, RNA expression of bax, bcl2, and p53 genes was investigated after treatment. Real-time polymerase chain reaction indicated that the expression of bax and p53 increased, whereas the expression of bcl2 decreased. C3G had an apoptogenic effect in the GBM cell line. New information regarding the therapeutic effects of C3G in GBM could ultimately lead to the production of new drugs. Copyright © 2017 Elsevier Inc. All rights reserved.
Hepatoprotective effect of peony total glucosides and the underlying mechanisms in diabetic rats.
Xia, Ling-Ling; Zhu, Qi-Jin; Wu, Yong-Gui
2017-12-01
Total glucosides of peony (TGP), compounds extracted from the dried roots of Paeonia lactiflora Pall, have been reported to have anti-inflammatory and antioxidative activities. However, the protective effect of TGP on liver injury and the underlying mechanisms remains unknown in diabetic rats. Current study investigates prevention of liver injury by TGP in diabetic rats and its mechanism was related to the inhibition of endoplasmic reticulum stress (ERS). Fifty adult male rats were randomly divided into: Normal group, diabetic group, TGP (50, 100 and 200 mg/kg/day) treatment groups (n = 10 per group). At the end of the 8th week, the liver was removed for biochemical and histological examinations. Compared with the diabetic group, administration of TGP at doses of 50, 100 and 200 mg/kg significantly prevented the increase of hepatic fibrosis score (ED 50 139.4 mg/kg). Compared with diabetic group, TGP at doses of 50, 100 and 200 mg/kg showed an inhibition on the increased macrophage infiltration. MCP-1 and TNF-α mRNA and protein expression were significantly increased in diabetic group compared with normal group; TGP administration caused significant reduction of high levels of MCP-1 and TNF-α mRNA as well as protein levels. Also, TGP at all doses showed an inhibition on the increased GRP78 levels, p-Perk levels and p-Eif2α levels in liver from diabetic group. Our results indicate that TGP has potential as a treatment for diabetic liver injury attenuating liver lipid accumulation and inflammation as well as ERS induced by diabetic condition.
Luo, Jing; Jin, Di-Er; Yang, Guo-Yan; Zhang, Ying-Ze; Wang, Jian-Ming; Kong, Wei-Ping; Tao, Qing-Wen
2017-10-01
Total glucosides of paeony (TGP) is commonly used to treat rheumatoid arthritis (RA) in China. However, clinical practice hasn't been well informed by evidence from appropriately conducted systematic reviews. This PRISMA-compliant systematic review aims at examining the effectiveness and safety of TGP for RA. Randomized controlled trials (RCTs) comparing TGP with placebo, no treatment, or disease-modifying antirheumatic drugs (DMARDs) for patients with RA were retrieved by searching seven databases. Primary outcomes included disease improvement and disease remission. Secondary outcomes included adverse effects, pain, health-related quality of life, C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR). Data extraction and analyses were conducted according to the Cochrane standards. We assessed risk of bias for each included studies and quality of evidence on pre-specified outcomes. Eight studies enrolling 1209 patients with active RA were included in this systematic review. On the basis of traditional DMARD(s), TGP might be beneficial for patients with RA in improvement of American College of Rheumatology (ACR) 20 response rate, ACR 50 response rate, ACR70 response rate, and in reduction of adverse effects, compared with no treatment. The overall methodological quality of included studies and the quality of evidence for each outcome were limited. Current trials suggested potential benefits of TGP for RA on the basis of traditional DMARD(s). Therefore, TGP may be a good choice for RA as an adjuvant therapy. However, considering the limited methodological quality and strength of evidence, high-quality RCTs are warranted to support the use of TGP for RA. Copyright © 2017. Published by Elsevier Ltd.
CoMFA and CoMSIA studies on C-aryl glucoside SGLT2 inhibitors as potential anti-diabetic agents.
Vyas, V K; Bhatt, H G; Patel, P K; Jalu, J; Chintha, C; Gupta, N; Ghate, M
2013-01-01
SGLT2 has become a target of therapeutic interest in diabetes research. CoMFA and CoMSIA studies were performed on C-aryl glucoside SGLT2 inhibitors (180 analogues) as potential anti-diabetic agents. Three different alignment strategies were used for the compounds. The best CoMFA and CoMSIA models were obtained by means of Distill rigid body alignment of training and test sets, and found statistically significant with cross-validated coefficients (q²) of 0.602 and 0.618, respectively, and conventional coefficients (r²) of 0.905 and 0.902, respectively. Both models were validated by a test set of 36 compounds giving satisfactory predicted correlation coefficients (r² pred) of 0.622 and 0.584 for CoMFA and CoMSIA models, respectively. A comparison was made with earlier 3D QSAR study on SGLT2 inhibitors, which shows that our 3D QSAR models are better than earlier models to predict good inhibitory activity. CoMFA and CoMSIA models generated in this work can provide useful information to design new compounds and helped in prediction of activity prior to synthesis.
Directory of Open Access Journals (Sweden)
Ana Cristina Miranda Senna Gouvêa
2012-03-01
Full Text Available Availability of analytical standards is a critical aspect in developing methods for quantitative analysis of anthocyanins. The anthocyanins cyanidin-3-O-glucoside and cyanidin-3-O-rutinoside were isolated from samples of freeze-dried açaí (Euterpe oleraceae Mart., which is a round and purple well-known palm fruit in Brazil, and then used as standards. The isolation of the anthocyanins was performed by High Performance Liquid Chromatography (HPLC, using an adapted six-channel selection valve. The identification of anthocyanin pigments in açaí was based on mass spectrometric data for molecular ions and MS-MS product ions and on previous published data. After the collection procedure, standards with a high purity grade were obtained and an external standard curve of each anthocyanin was plotted.
Wu, Qinghua; Kuča, Kamil; Humpf, Hans-Ulrich; Klímová, Blanka; Cramer, Benedikt
2017-02-01
Deoxynivalenol (DON), the most commonly occurring trichothecene in nature, may affect animal and human health through causing diarrhea, vomiting, gastrointestinal inflammation, and immunomodulation. DON-3-glucoside (DON-3G) as a major plant metabolite of the mycotoxin is another "emerging" food safety issue in recent years. Humans may experience potential health risks by consuming DON-contaminated food products. Thus, it is crucial for human and animal health to study also the degradation of DON and DON-3G during thermal food processing. Baking, boiling, steaming, frying, and extrusion cooking are commonly used during thermal food processing and have promising effects on the reduction of mycotoxins in food. For DON, however, the observed effects of these methods, as reported in numerous studies, are ambiguous and do not present a clear picture with regard to reduction or transformation. This review summarized the influence of thermal processing on the stability of DON and the formation of degradation/conversion products. Besides this, also a release of DON and DON-3G from food matrix as well as the release of DON from DON-3G during processing is discussed. In addition, some conflicting findings as reported from the studies on thermal processing as well as cause-effect relationships of the different thermal procedures are explored. Finally, the potential toxic profiles of DON degradation products are discussed as well when data are available.
Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury
International Nuclear Information System (INIS)
Jing, Xu; Ren, Dongmei; Wei, Xinbing; Shi, Huanying; Zhang, Xiumei; Perez, Ruth G.; Lou, Haiyan; Lou, Hongxiang
2013-01-01
Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury
Eriodictyol-7-O-glucoside activates Nrf2 and protects against cerebral ischemic injury
Energy Technology Data Exchange (ETDEWEB)
Jing, Xu [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Ren, Dongmei [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China); Wei, Xinbing; Shi, Huanying; Zhang, Xiumei [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Perez, Ruth G. [Health Science Center, Paul L. Foster School of Medicine, Texas Tech University, El Paso, TX, 79905 (United States); Lou, Haiyan, E-mail: louhaiyan@sdu.edu.cn [Department of Pharmacology, School of Medicine, Shandong University, Jinan 250012 (China); Lou, Hongxiang [Department of Natural Product Chemistry, Key Lab of Chemical Biology of Ministry of Education, Shandong University, Jinan 250012 (China)
2013-12-15
Stroke is a complex disease that may involve oxidative stress-related pathways in its pathogenesis. The nuclear factor erythroid-2-related factor 2/antioxidant response element (Nrf2/ARE) pathway plays an important role in inducing phase II detoxifying enzymes and antioxidant proteins and thus has been considered a potential target for neuroprotection in stroke. The aim of the present study was to determine whether eriodictyol-7-O-glucoside (E7G), a novel Nrf2 activator, can protect against cerebral ischemic injury and to understand the role of the Nrf2/ARE pathway in neuroprotection. In primary cultured astrocytes, E7G increased the nuclear localization of Nrf2 and induced the expression of the Nrf2/ARE-dependent genes. Exposure of astrocytes to E7G provided protection against oxygen and glucose deprivation (OGD)-induced oxidative insult. The protective effect of E7G was abolished by RNA interference-mediated knockdown of Nrf2 expression. In vivo administration of E7G in a rat model of focal cerebral ischemia significantly reduced the amount of brain damage and ameliorated neurological deficits. These data demonstrate that activation of Nrf2/ARE signaling by E7G is directly associated with its neuroprotection against oxidative stress-induced ischemic injury and suggest that targeting the Nrf2/ARE pathway may be a promising approach for therapeutic intervention in stroke. - Highlights: • E7G activates Nrf2 in astrocytes. • E7G stimulates expression of Nrf2-mediated cytoprotective proteins in astrocytes. • E7G protects astrocytes against OGD-induced cell death and apoptosis. • The neuroprotective effect of E7G involves the Nrf2/ARE pathway. • E7G protects rats against cerebral ischemic injury.
Energy Technology Data Exchange (ETDEWEB)
Stanic, Vesna [Brazilian Synchrotron Light Source, Campinas (Brazil); Broadbent, Charlotte [Columbia Univ., New York, NY (United States). Engineering Dept.; DiMasi, Elaine [Brookhaven National Lab. (BNL), Upton, NY (United States). Photon Sciences Division; Galleguillos, Ramiro [Lubrizol Advanced Materials, Cleveland, OH (United States); Woodward, Valerie [Lubrizol Advanced Materials, Cleveland, OH (United States)
2016-11-14
The interactions of mixtures of anionic and amphoteric surfactants with sugar amphiphiles were studied via high throughput small angle x-ray scattering (SAXS). The sugar amphiphile was composed of Caprate, Caprylate, and Oleate mixed ester of methyl glucoside, MeGCCO. Optimal surfactant interactions are sought which have desirable physical properties, which must be identified in a cost effective manner that can access the large phase space of possible molecular combinations. X-ray scattering patterns obtained via high throughput SAXS can probe a combinatorial sample space and reveal the incorporation of MeGCCO into the micelles and the molecular associations between surfactant molecules. Such data make it possible to efficiently assess the effects of the new amphiphiles in the formulation. A specific finding of this study is that formulations containing comparatively monodisperse and homogeneous surfactant mixtures can be reliably tuned by addition of NaCl, which swells the surfactant micelles with a monotonic dependence on salt concentration. In contrast, the presence of multiple different surfactants destroys clear correlations with NaCl concentration, even in otherwise similar series of formulations.
Yin, Xiaomin; Chen, Chen; Xu, Ting; Li, Lin; Zhang, Lan
2018-01-01
Alternative splicing of amyloid precursor protein (APP) exon 7 generates the isoforms containing a Kunitz protease inhibitor (KPI) domain. APP-KPI levels in the brain are correlated with amyloid beta (Aβ) production. Here, we determined the effect of Tetrahydroxystilbene glucoside (TSG) on the AKT-GSK3β pathway. We found GSK3β increased APP-KPI inclusion level and interacted with the splicing factor ASF. TSG was intragastrically administered to 5-month-old APP/PS1 transgenic mice for 12 months. We found that the activated the AKT-GSK3β signaling pathway suppressed APP-KPI inclusion. Moreover, TSG treatment attenuated amyloid deposition in APP/PS1 mice. This study demonstrates the neuroprotective effect of TSG on APP expression, suggesting that TSG may be beneficial for AD prevention and treatment. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yu-Tang Chin
2016-01-01
Full Text Available Periodontitis, a chronic infection by periodontopathic bacteria, induces uncontrolled inflammation, which leads to periodontal tissue destruction. 2,3,5,4′-Tetrahydroxystilbene-2-O-beta-glucoside (THSG, a polyphenol extracted from Polygoni Multiflori, reportedly has anti-inflammatory properties. In this study, we investigated the mechanisms of THSG on the Porphyromonas gingivalis-induced inflammatory responses in human gingival fibroblasts and animal modeling of ligature-induced periodontitis. Human gingival fibroblast cells were treated with lipopolysaccharide (LPS extracted from P. gingivalis in the presence of resveratrol or THSG to analyze the expression of TNF-α, IL-1β, and IL-6 genes. Increased AMP-activated protein kinase (AMPK activation and SirT1 expression were induced by THSG. Treatment of THSG decreased the expression of LPS-induced inflammatory cytokines, enhanced AMPK activation, and increased the expression of SirT1. In addition, it suppressed the activation of NF-κB when cells were stimulated with P. gingivalis LPS. The anti-inflammatory effect of THSG and P. Multiflori crude extracts was reproduced in ligature-induced periodontitis animal modeling. In conclusion, THSG inhibited the inflammatory responses of P. gingivalis-stimulated human gingival fibroblasts and ameliorated ligature-induced periodontitis in animal model.
Directory of Open Access Journals (Sweden)
Changsen Zhan
2016-05-01
Full Text Available Danning Tablets are a traditional Chinese formula showing broad clinical applications in hepatobiliary diseases and containing a diversity of bioactive chemicals. However, the chemical profiling of the formula, which serves as the material foundation of its efficacy, is really a big challenge as Danning Tablets consist of seven herbs from different origins. An ultra-performance liquid chromatography coupled to diode array detection and electrospray ionization mass spectrometry (UPLC-DAD-ESI-MS/MS approach was developed to characterize the principal polyphenol constituents in the formula. As a result, a total of 32 constituents, including 14 anthraquinones and their glucosides, four anthrones, two naphthalene glycosides, two stilbenes and 10 flavonoids were identified based on their retention time, UV absorption and MS/MS fragmentation patterns. The sources of these compounds were also illustrated. Most of the bioactive anthraquinone derivatives were found in Rhei Radix et Rhizoma or Polygoni Cuspidati Rhizoma et Radix, which are the Emperor drugs in the formula for its clinic usage. These findings indicate the merit of using this integrated UPLC-DAD-ESI-MS/MS approach to rapidly illustrate the chemical foundation of complex formulas. The present study will facilitate the quality control of Danning Tablet formulas as well as the individual herbs.
Resveratrol: How Much Wine Do You Have to Drink to Stay Healthy?123
Weiskirchen, Sabine; Weiskirchen, Ralf
2016-01-01
Resveratrol is a naturally occurring stilbene endowed with multiple health-promoting effects. It is produced by certain plants including several dietary sources such as grapes, apples, raspberries, blueberries, plums, peanuts, and products derived therefrom (e.g., wine). Resveratrol can be isolated and purified from these biological sources or synthesized in a few steps with an overall high yield. This compound and its glucoside, the trans-polydatin piceid, have received worldwide attention for their beneficial effects on cardiovascular, inflammatory, neurodegenerative, metabolic, and age-related diseases. These health-promoting effects are particularly attractive given the prevalence of resveratrol-based nutraceuticals and the paradoxical epidemiologic observation that wine consumption is inversely correlated to the incidence of coronary heart disease. However, the notion of resveratrol as a “magic bullet" was recently challenged by clinical trials showing that this polyphenol does not have a substantial influence on health status and mortality risk. In the present review, we discuss the proposed therapeutic attributes and the mode of molecular actions of resveratrol. We also cover recent pharmacologic efforts to improve the poor bioavailability of resveratrol and influence the transition between body systems in humans. We conclude with some thoughts about future research directions that might be meaningful for resolving controversies surrounding resveratrol. PMID:27422505
Directory of Open Access Journals (Sweden)
Lei Zhu
2012-03-01
Full Text Available In order to analyze and compare the phenolic characteristics of red wine grapes with diverse genetic backgrounds, skin phenolics among 21 different cultivars belonging to Vitis vinifera L., East Asian and North American Vitis species and hybrids, as well as 2 varieties of muscadine grapes were estimated by HPLC-MS/MS. There were 45 anthocyanins, 28 flavonols, 8 flavan-3-ols, 9 cinnamic acids, 5 benzoic acids, 5 ellagic acids and 2 stilbenes detected in all the samples. Total contents of each phenolic type varied significantly among the different grape cultivars investigated. There was also a large variability in the phenolic compositions of different grape groups. The differences in anthocyanin composition were obvious between V. vinifera and non-V. vinifera grapes and also between the grapes originating from Eurasia and North America. Quercetin-3-glucuronide and quercetin-3-glucoside were marker flavonol compounds for Euvitis grape skins. Flavan-3-ol monomers were dominant in the skins of muscadine and non-V. amurensis East Asian grapes, whereas polymers were more common in V. vinifera and North American grapes. The muscadine grapes were very rich in flavonols, flavan-3-ols and ellagic acids. Via principal component analysis, these grape cultivars were clustered into three groups according to their characteristic phenolic content and composition.
Extraction of antioxidants from spruce (Picea abies) bark using eco-friendly solvents.
Co, Michelle; Fagerlund, Amelie; Engman, Lars; Sunnerheim, Kerstin; Sjöberg, Per J R; Turner, Charlotta
2012-01-01
Antioxidants are known to avert oxidation processes and they are found in trees and other plant materials. Tree bark is a major waste product from paper pulp industries; hence it is worthwhile to develop an extraction technique to extract the antioxidants. To develop a fast and environmentally sustainable extraction technique for the extraction of antioxidants from bark of spruce (Picea abies) and also to identify the extracted antioxidants that are abundant in spruce bark. A screening experiment that involved three different techniques was conducted to determine the best technique to extract antioxidants. The antioxidant capacity of the extracts was determined with DPPH (2,2-diphenyl-1-picrylhydrazyl) assay. Pressurised fluid extraction (PFE) turned out to be the best technique and a response surface design was therefore utilised to optimise PFE. Furthermore, NMR and HPLC-DAD-MS/MS were applied to identify the extracted antioxidants. PFE using water and ethanol as solvent at 160 and 180°C, respectively, gave extracts of the highest antioxidant capacity. Stilbene glucosides such as isorhapontin, piceid and astringin were identified in the extracts. The study has shown that PFE is a fast and environmentally sustainable technique, using water and ethanol as solvent for the extraction of antioxidants from spruce bark. Copyright © 2011 John Wiley & Sons, Ltd.
Yao, Wenjuan; Gu, Chengjing; Shao, Haoran; Meng, Guoliang; Wang, Huiming; Jing, Xiang; Zhang, Wei
2015-01-01
Endothelial dysfunction plays an important role in the pathogenesis of atherogenesis. 2,3,5,4'-tetrahydroxystilbene-2-O-β-D-glucoside (TSG), an active component of the rhizome extract from Polygonum multiflorum (PM), exhibits significant anti-atherosclerotic activity. Here, we used human umbilical vein endothelial cells (HUVECs) induced by tumor necrosis factor-α (TNF-α) in vitro to investigate the cytoprotective effects of TSG on TNF-α-induced endothelial injury and the related mechanisms. Pretreatment with 50 and 100 μM TSG markedly attenuated TNF-α-induced loss of cell viability and release of lactate dehydrogenase (LDH) and inhibited TNF-α-induced cell apoptosis. The inhibition of vimentin expression was involved in the cytoprotection afforded by TSG. Using inhibitors for PI3K and TGFβ or siRNA for Akt and Smad2, we found that vimentin production in HUVECs is regulated by TGFβ/Smad signaling, but not by PI3K-Akt-mTOR signaling. Meanwhile, TSG inhibited both the expression of TGFβ1 and the phosphorylation of Smad2 and Smad3, and TSG suppressed the nuclear translocation of Smad4 induced by TNF-α. These results suggest that TSG protects HUVECs against TNF-α-induced cell damage by inhibiting vimentin expression via the interruption of the TGFβ/Smad signaling pathway.
Directory of Open Access Journals (Sweden)
Daniela Ferrari
2017-01-01
Full Text Available Intestinal epithelium represents a protective physical barrier and actively contributes to the mucosal immune system. Polarized basolateral intestinal secretion of inflammatory mediators, followed by activation of NF-κB signaling and inflammatory pathways in endothelial cells, efficiently triggers extravasation of neutrophils from the vasculature, therefore contributing to the development and maintenance of intestinal inflammation. Proper regulation of NF-κB activation at the epithelial interface is crucial for the maintenance of physiological tissue homeostasis. Many papers reported that anthocyanins, a group of compounds belonging to flavonoids, possess anti-inflammatory effects and modulate NF-κB activity. In this study, by using a coculture in vitro system, we aimed to evaluate the effects of TNF-α-stimulated intestinal cells on endothelial cells activation, as well as the protective effects of cyanidin-3-glucoside (C3G. In this model, TNF-α induced nuclear translocation of NF-κB and TNF-α and IL-8 gene expression in Caco-2 cells, whereas C3G pretreatment dose-dependently reduced these effects. Furthermore, TNF-α-stimulated Caco-2 cells induced endothelial cells activation with increased E-selectin and VCAM-1 mRNA, leukocyte adhesion, and NF-κB levels in HUVECs, which were inhibited by C3G. We demonstrated that selective inhibition of the NF-κB pathway in epithelial cells represents the main mechanism by which C3G exerts these protective effects. Thus, anthocyanins could contribute to the management of chronic gut inflammatory diseases.
Amarasinghe, Chami C; Simsek, Senay; Brûlé-Babel, Anita; Fernando, W G Dilantha
2016-07-01
Contamination of wheat grains with Fusarium mycotoxins and their modified forms is an important issue in wheat industry. The objective of this study was to analyse the deoxynivalenol (DON) and deoxynivalenol-3-glucosides (D3G) content in Canadian spring wheat cultivars grown in two locations, inoculated with a mixture of 3-acetyldeoxynivalenol (3-ADON)-producing Fusarium graminearum strains and a mixture of 15-acetlyldeoxynivalenol (15-ADON)-producing F. graminearum strains. According to the analysis of variance, significant differences were observed among the cultivars for Fusarium head blight (FHB) disease index, Fusarium-damaged kernel percentage (%FDK), DON content and D3G content. When the effect of chemotype was considered, significant differences were observed for FHB disease index, FDK percentage and DON content. The D3G content and D3G/DON ratio were not significantly different between the chemotypes, except for D3G content at the Winnipeg location. The Pearson correlation coefficient between DON and D3G was 0.84 and 0.77 at Winnipeg and Carman respectively. The highest D3G/DON ratio was observed in cultivars Carberry (44%) in Carman and CDC Kernen (63.8%) in Winnipeg. The susceptible cultivars showed lower D3G/DON ratio compared with the cultivars rated as moderately resistant and intermediate. The current study indicated that Canadian spring cultivars produce D3G upon Fusarium infection.
A new C-methylated flavonoid glycoside from Pinus densiflora.
Jung, M J; Choi, J H; Chung, H Y; Jung, J H; Choi, J S
2001-12-01
A new C-methyl flavonol glycoside, 5,7,8,4'-tetrahydroxy-3-methoxy-6-methylflavone 8-O-beta-D-glucopyranoside (1), has been isolated from the needles of Pinus densiflora, together with kaempferol 3-O-beta-(6"-acetyl)-galactopyranoside.
Directory of Open Access Journals (Sweden)
Yongsong Cai
2016-01-01
Full Text Available Juvenile idiopathic arthritis (JIA is the most common rheumatic disease in children; some clinical trials have reported the effects of total glucosides of peony (TGP in the treatment of JIA. However, no systematic review has yet been conducted. In this study, we assessed the efficacy and safety in patients with JIA enrolled in randomized controlled trials (RCTs of TGP. We extracted data for studies searched from 8 electronic databases that were searched and also evaluated the methodological quality of the included studies. We assessed the following outcome measures: overall response rate, pain, tender joint count (TJC, swollen joint count (SJC, duration of morning stiffness (DMS, grip strength (GS, rheumatoid factor (RF, erythrocyte sedimentation rate (ESR, C-reactive protein (CRP, and adverse effects (AEs in short term (4–8 weeks, intermediate term (9–26 weeks, and long term (>26 weeks. The final analysis showed that TGP acted as a unique nonbiologic disease-modifying antirheumatic drug (nonbiologic DMARD, and its therapeutic effects were safe and efficacious for the treatment of JIA with few AEs. However, more high-quality RCTs are needed to confirm these therapeutic effects.
Cai, Yongsong; Yuan, Qiling; Xu, Ke; Zhu, Jialin; Li, Yuanbo; Wu, Xiaoqing; Yang, Le
2016-01-01
Juvenile idiopathic arthritis (JIA) is the most common rheumatic disease in children; some clinical trials have reported the effects of total glucosides of peony (TGP) in the treatment of JIA. However, no systematic review has yet been conducted. In this study, we assessed the efficacy and safety in patients with JIA enrolled in randomized controlled trials (RCTs) of TGP. We extracted data for studies searched from 8 electronic databases that were searched and also evaluated the methodological quality of the included studies. We assessed the following outcome measures: overall response rate, pain, tender joint count (TJC), swollen joint count (SJC), duration of morning stiffness (DMS), grip strength (GS), rheumatoid factor (RF), erythrocyte sedimentation rate (ESR), C-reactive protein (CRP), and adverse effects (AEs) in short term (4–8 weeks), intermediate term (9–26 weeks), and long term (>26 weeks). The final analysis showed that TGP acted as a unique nonbiologic disease-modifying antirheumatic drug (nonbiologic DMARD), and its therapeutic effects were safe and efficacious for the treatment of JIA with few AEs. However, more high-quality RCTs are needed to confirm these therapeutic effects. PMID:27525026
Occurrence and fate of the norsesquiterpene glucoside ptaquiloside (PTA) in soils
Zaccone, Claudio; Cavoski, Ivana; Costi, Roberta; Sarais, Giorgia; Caboni, Pierluigi; Miano, Teodoro M.; Lattanzio, Vincenzo
2014-05-01
The bracken fern Pteridium aquilinum (L.) Kuhn, one of the most common plant species on Earth, produces a wide range of secondary metabolites including the norsesquiterpene glucoside ptaquiloside (PTA). This bracken constituent causes acute poisoning, blindness and cancer in animals, and can be transferred to man when bracken is utilized as food. Also milk from cows eating bracken is thought to be the vector for the transfer of PTA to humans, as well as PTA-contaminated drinking waters. Although some studies on the effect of growth conditions and soil properties on the production and mobility of PTA have been carried out (mainly in the North of Europe), results are sometimes conflicting and further investigations are needed. The aim of the present work is to study the occurrence and the fate of PTA in soils showing different physico-chemical features, collected in different pedoclimatic areas (from the South of Italy), but having the extensive ("wild") livestock farming as common denominator. The PTA content was determined in both soil and fern samples by GC-MS; both the extraction protocol and recovery were previously tested through incubation studies. Soils samples were also characterizes from the physical and chemical point of view (pH, EC, texture, total carbonates, cation exchange capacity, organic C, total N, available nutrients and heavy metal concentration) in order to correlate the possible influence of soil parameters on PTA production, occurrence and mobility. PTA concentration in soil samples was always
Total glucosides of paeony for rheumatoid arthritis: a protocol for a systematic review.
Luo, Jing; Jin, Di-Er; Yang, Guo-Yan; Zhang, Ying-Ze; Wang, Jian-Ming; Kong, Wei-Ping; Tao, Qing-Wen
2016-03-09
Total glucosides of paeony (TGP) is a natural plant extract, which is widely used in China for treating rheumatoid arthritis (RA). Many relevant randomised controlled trials (RCTs) of TGP for RA are available, but they have not been systematically reviewed. This systematic review aims to examine the effectiveness and safety of TGP in patients with RA. We will search for RCTs of TGP in the treatment of RA, performed up until February 2016, in PubMed, Embase, Cochrane Central Register of Controlled Trials, and four Chinese databases (Chinese Biomedical Database, China National Knowledge Infrastructure, Wanfang Database and Chinese Scientific Journal Database). Trial registers and reference lists of retrieved articles will also be searched to identify potential articles. RCTs comparing TGP with placebo, no treatment, or disease-modifying antirheumatic drugs for patients with RA will be retrieved. The primary outcomes will be disease improvement and disease remission. The secondary outcomes will be surrogate outcomes, symptoms, adverse effects, and quality of life. Two reviewers will independently extract data on participants, interventions, comparisons, outcomes, etc. The methodological quality of each included study will be evaluated using the Cochrane risk of bias tool, and the strength of evidence on prespecified outcomes will be assessed in accordance with the GRADE (Grading of Recommendations Assessment, Development and Evaluation) approach. Review Manager 5.3 software will be used for data analyses. Meta-analyses will be performed if the data are sufficiently homogeneous, both statistically and clinically. Possible publication bias will also be checked using funnel plots once the number of included studies is sufficient. Ethics approval is not required, as this study will not involve patients. The results of this study will be submitted to a peer-reviewed journal for publication, to inform both clinical practice and further research. CRD42015026345. Published by
Directory of Open Access Journals (Sweden)
Rouvrais C
2017-02-01
Full Text Available Céline Rouvrais,1,* Daniel Bacqueville,2,* Patrick Bogdanowicz,2,* Marie-José Haure,2 Laure Duprat,2 Christine Coutanceau,3 Nathalie Castex-Rizzi,2 Hélène Duplan,2 Valérie Mengeaud,1 Sandrine Bessou-Touya2 1Clinical Skin Research Center, 2Department of Pharmacology, Pierre Fabre Dermo-Cosmétique, Toulouse, 3Laboratoire Dermatologique Avène, Lavaur, France *These authors contributed equally to this work Introduction: Natural aging of skin tissues, the addition of the cumulative action of the time and radiation exposure result in skin atrophy, wrinkles and degeneration of the extracellular matrix (ECM. The aim of the study was to investigate the beneficial effect of a combination containing retinaldehyde (RAL, delta-tocopherol glucoside (delta-TC and glycylglycine oleamide (GGO and of a dermocosmetic containing the combination. Materials and methods: The protective effect of the combination was assessed through in vitro gene expression of ultraviolet (UV-irradiated fibroblasts. A skin aging assay using UV light on ex vivo skin samples and a clinical study conducted in 36 women aged from 35 to 55 years with a minimum of level 4 to a maximum of level 6 on the crow’s feet photoscale assessed the antiaging effect of the dermocosmetic. Results: When added to UV-irradiated fibroblasts, the combination substantially improved the ECM in activating the elastin fiber production (fibrillin 2, fibulin 1 and 5 and lysyl oxidase-like 2 as well as that of proteins involved in the cellular ECM interactions (integrin β1, paxillin and actin a2. An ex vivo photodamaged human skin model showed that the dermocosmetic formulation containing the combination of the active ingredients protected the elastic network against UV-induced alterations including both elastin and fibrillin-rich fibers in the dermis. A daily application of the dermocosmetic for 2 months on naturally aged skin resulted in a statistically significant improvement (p<0.05 of visible
Nasri, Sima; Roghani, Mehrdad; Baluchnejadmojarad, Tourandokht; Balvardi, Mahboubeh; Rabani, Tahereh
2012-08-01
This research study was conducted to evaluate the efficacy of chronic cyanidin-3-glucoside (C3G) on alleviation of learning and memory deficits in diabetic rats as a result of the observed antidiabetic and antioxidant activity of C3G. Male Wistar rats were divided into control, diabetic, C3G-treated-control and -diabetic groups. The C3G was administered i.p. at a dose of 10 mg/kg on alternate days for eight weeks. For evaluation of learning and memory, initial latency (IL) and step-through latency (STL) were determined at the end of study using passive avoidance test. Meanwhile, spatial recognition memory was assessed as alternation in the Y-maze task. Oxidative stress markers in brain tissue were also measured. It was found that the alternation score of the diabetic rats was lower than that of control (p chronic C3G could improve short-term spatial recognition memory disturbance in the Y-maze test but not retention and recall capability in passive avoidance test in STZ-diabetic rats. Copyright © 2012 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Prima, E C; Yuliarto, B; Suyatman; Dipojono, H K
2016-01-01
This paper reports the novel efficiency achievement of black rice-based natural dye- sensitized solar cells. The higher dye concentration, the longer dye extraction as well as dye immersion onto a TiO 2 film, and the co-adsorption addition are key strategies for improved-cell performance compared to the highest previous achievement. The black rice dye containing 1.38 mM cyanidin-3-O-glucoside has been extracted without purification for 3 weeks at dark condition and room temperature. The anatase TiO 2 photoanode was dipped into dye solution within 4 days. Its electrode was firmly sealed to be a cell and was filled by I - /I 3 - electrolyte using vacuum technique. As a result, the overall solar-to-energy conversion efficiency was 1.49% at AM 1.5 illumination (100 mW.cm -2 ). The voltametric analysis has reported the interfacial electronic band edges of TiO 2 -Dye-Electrolyte. Furthermore, electrochemical impedance spectroscopy has shown the kinetic of interfacial electron transfer dynamics among TiO 2 -dye-electrolyte. The cell has the transfer resistance (Rt) of 12.5 ω, the recombination resistance (Rr) of 266.8 ω, effective electron diffusion coefficients (Dn) of 1.4 × 10 -3 cm 2 /s, Dye-TiO 2 effective electron transfer (τ d ) of 26.6 μs, effective diffusion length (L n )of 33.78 μm, chemical capacitance (C μ ) of 12.43 μF, and electron lifetime (τ n ) of 3.32 ms. (paper)
Josino Soares, Denise; Pignitter, Marc; Ehrnhöfer-Ressler, Miriam Margit; Walker, Jessica; Montenegro Brasil, Isabella; Somoza, Veronika
2015-01-01
The pulp of pitanga (Eugenia uniflora L.) is used to prepare pitanga juice. However, there are no reports on the identification and quantification of the main constituents in pitanga pulp. The aim of this study was to identify and quantify the major volatile and non-volatile low-molecular-weight constituents of the pulp. Isolation of volatile compounds was performed by solvent-assisted flavor evaporation technique. Characterization of the main volatile and non-volatile constituents was performed by GC-MS, LC-MS and NMR spectroscopy. For quantitative measurements, the main volatile compound needed to be isolated from pitanga pulp to obtain a commercially not available reference standard. Cyanidin-3-glucoside was determined as one of the most abundant non-volatile pulp compound yielding 53.8% of the sum of the intensities of all ions detected by LC-MS. Quantification of cyanidin-3-glucoside in pitanga pulp resulted in a concentration of 344 ± 66.4 μg/mL corresponding to 688 ± 133 μg/g dried pulp and 530 ± 102 μg/g fruit. For the volatile fraction, oxidoselina-1,3,7(11)-trien-8-one was identified as the main volatile pulp constituent (27.7% of the sum of the intensities of all ions detected by GC-MS), reaching a concentration of 89.0 ± 16.9 μg/mL corresponding to 1.34 ± 0.25 μg/g fresh pulp and 1.03 ± 0.19 μg/g fruit. The results provide quantitative evidence for the occurrence of an anthocyanin and an oxygenated sesquiterpene as one of the major volatile and non-volatile low-molecular-weight compounds in pitanga pulp.
Zhou, Zhou; Lin, Jinpiao; Huo, Rongfen; Huang, Wenkang; Zhang, Jian; Wang, Li; Sun, Yue; Shen, Baihua; Li, Ningli
2012-11-01
It is well known that dendritic cells (DCs) play a critical role in the initiation and development of an immune response. Inhibitory effect on DC maturation alters immune-mediated inflammatory reaction in vivo. Total glucosides of paeony (TGP) are active compounds extracted from the roots of Paeonia lactiflora and have been widely used to ameliorate inflammation in therapy for autoimmune diseases. However, whether TGP act on DC maturation remains unknown. In this study, we investigated the effect of TGP on DC maturation in ovalbumin (OVA) immunized mice. Ear inflammation was inhibited by TGP (150 mgkg(-1), i.p.×11 days) obviously. The antigen presenting capacity of DC derived from TGP-treated mice was arrested. Meanwhile, OVA specific T cell proliferation was inhibited. In addition, we found that maturation of DCs was decreased by TGP treatment. Furthermore, OVA specific T cell proliferation was rescued by the adoptive transfer of mature DCs (mDCs) into TGP treated OVA-challenged mice. The research on the mechanism showed that TGP significantly inhibited activation of TLR4/5 singling. All these results demonstrated that TGP inhibited DC maturation and function by selectively blocking TLR4/5 activation in vivo, which in turn leads to reduce immune-mediated inflammation in vivo, adding a novel mechanism and therapeutic target of TGP for inflammatory and autoimmune disease treatment. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Zhi-Hui Zhang
Full Text Available Previous studies demonstrated that inflammatory microenvironment promoted prostate cancer progression. This study investigated whether total glucosides of paeony (TGP, the active constituents extracted from the root of Paeonia Lactiflora Pall, suppressed lipopolysaccharide (LPS-stimulated proliferation, migration and invasion in androgen insensitive prostate cancer cells. PC-3 cells were incubated with LPS (2.0 μg/mL in the absence or presence of TGP (312.5 μg /mL. As expected, cells at S phase and nuclear CyclinD1, the markers of cell proliferation, were increased in LPS-stimulated PC-3 cells. Migration activity, as determined by wound-healing assay and transwell migration assay, and invasion activity, as determined by transwell invasion assay, were elevated in LPS-stimulated PC-3 cells. Interestingly, TGP suppressed LPS-stimulated PC-3 cells proliferation. Moreover, TGP inhibited LPS-stimulated migration and invasion of PC-3 cells. Additional experiment showed that TGP inhibited activation of nuclear factor kappa B (NF-κB and mitogen-activated protein kinase (MAPK/p38 in LPS-stimulated PC-3 cells. Correspondingly, TGP attenuated upregulation of interleukin (IL-6 and IL-8 in LPS-stimulated PC-3 cells. In addition, TGP inhibited nuclear translocation of signal transducer and activator of transcription 3 (STAT3 in LPS-stimulated PC-3 cells. These results suggest that TGP inhibits inflammation-associated STAT3 activation and proliferation, migration and invasion in androgen insensitive prostate cancer cells.
Estrogenic activity of constituents from the rhizomes of Rheum undulatum Linné.
Park, SeonJu; Kim, Yun Na; Kwak, Hee Jae; Jeong, Eun Ju; Kim, Seung Hyun
2018-02-15
Stilbenes have been reported to be phytoestrogen compounds owing to its structural similarity to the estrogenic agent diethylstilbestrol. To find new stilbene-derivative phytoestrogens, isolation of stilbene-rich R. undulatum was performed and led to identify six new compounds (1-5 and 28), one newly determined absolute configurations compound (27) together with 21 previously reported compounds (6-26). The structures of compounds were determined on the basis of extensive spectroscopic methods including 1D and 2D NMR and CD spectra data. All the isolated compounds were tested for their estrogenic activities in HepG2 cells transiently transfected with ERα, ERβ and ERE-reporter plasmid. Among them, stilbene-derivatives, piceatannol 3'-O-β-d-xylopyranoside (12), cis-rhaponticin (16) and rhapontigenin 3'-O-β-d-glucopyranoside (17), showed the more potent binding affinity for estrogen receptors than 17β-estrodiol. Copyright © 2018 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Sayin, Serkan; Ozcan, Fatih; Yilmaz, Mustafa; Cengeloglu, Yunus [Department of Chemistry, Selcuk University, Konya (Turkey); Tor, Ali [Department of Environmental Engineering, Selcuk University, Konya (Turkey); Memon, Shahabuddin [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro (Pakistan)
2010-07-15
In this study, 5,17-bis-[(4-benzylpiperidine)methyl]-25,26,27,28-tetrahydroxy-calix[4]arene (3) has been prepared by the treatment of calix[4]arene with a secondary amine (4-benzylpiperidine) and formaldehyde by means of Mannich reaction. The prepared Mannich base (3) has been grafted onto [3-(2,3-epoxypropoxy)-propyl]-trimethoxysilane-modified Fe{sub 3}O{sub 4} magnetite nanoparticles (EPPTMS-MN) in order to obtain 5,17-bis-[(4-benzylpiperidine)methyl]-25,26,27,28-tetrahydroxy calix[4]arene-grafted EPPTMS-MN (BP-calix[4]arene-grafted Fe{sub 3}O{sub 4}). All new compounds were characterized by a combination of FTIR and {sup 1}H-NMR analyses. The morphology of the magnetic nanoparticles was examined by transmission electron microscopy. Moreover, the studies regarding the removal of arsenate and dichromate ions from the aqueous solutions were also carried out by using 5,17-bis-[(4-benzylpiperidine)methyl]-25,26,27,28-tetrahydroxy-calix[4]arene in liquid-liquid extraction and BP-calix[4]arene-grafted Fe{sub 3}O{sub 4} (4) in solid-liquid extraction experiments. The extraction results indicated that 3 is protonated at proton-switchable binding sites in acidic conditions. Hence, facilitating binding of arsenate and dichromate is resulted from both electrostatic interactions and hydrogen bonding. To understand the selectivity of 3, the retention of dichromate anions in the presence of Cl{sup -}, NO{sub 3}{sup -}, and SO{sub 4}{sup 2-} anions at pH 1.5 was also examined. (Abstract Copyright [2010], Wiley Periodicals, Inc.)
Interrogating Planar Cyclooctatetraenes
DEFF Research Database (Denmark)
Hensel, Thomas
]circulenes were established. The antiaromaticity of the formal COT core of the hetero[8]circulenes was interrogated by comparison of the respective 13C-NMR carbon shifts with those of 3,6-dimethoxycarbazole (the starting material), tetrahydroxy intermediate and literature values. No uniform paratropic...
Miura, Yousuke; Momotake, Atsuya; Takeuchi, Keiichirou; Arai, Tatsuo
2011-01-01
A series of stilbene-cored poly(benzyl ether) dendrimers with benzophenone peripheries were synthesized and their photophysical and photochemical properties were studied. Fluorescence studies revealed that singlet-singlet energy transfer (SSET) from the stilbene core to the benzophenone units took place efficiently in dendrimers of all generations. Similarly, phosphorescence and time-resolved spectroscopic measurements indicated efficient triplet-triplet energy transfer (TTET) from the benzophenone periphery to the stilbene core. Upon excitation at 310 nm, the stilbene core isomerizes via an energy round trip within the dendrimer shell. The quantum yields for the energy round trip (Φ(ERT)), defined as the product of the quantum yields of SSET, intersystem crossing, and TTET (Φ(ERT) = Φ(SS)Φ(isc)Φ(TT)), were extremely high for all generations--99%, 95% and 94% for G1, G2, and G3, respectively--which means that the excitation energy of the dendrimer core was transferred to the dendrimer periphery and back to the core almost quantitatively. The quantum yield for photoisomerization of G1-G3 via an energy round trip was higher than for other stilbene-cored dendrimers, which mainly isomerize from the excited singlet state. Photostability in the dendrimers was also demonstrated and discussed.
Tan, Chengyu; Meng, Fantong; Reece, E Albert; Zhao, Zhiyong
2018-05-04
Diabetes mellitus in early pregnancy increases the risk of birth defects in infants. Maternal hyperglycemia stimulates the expression of nitric oxide (NO) synthase 2 (NOS2), which can be regulated by transcription factors of the nuclear factor-κB (NF-κB) family. Increases in reactive nitrogen species (RNS) generate intracellular stress conditions, including nitrosative, oxidative, and endoplasmic reticulum (ER) stresses, and trigger programmed cell death (or apoptosis) in the neural folds, resulting in neural tube defects (NTDs) in the embryo. Inhibiting NOS2 can reduce NTDs; however, the underlying mechanisms require further delineation. Targeting NOS2 and associated nitrosative stress using naturally occurring phytochemicals is a potential approach to preventing birth defects in diabetic pregnancies. This study aims to investigate the effect of quercetin-3-glucoside (Q3G), a polyphenol flavonoid found in fruit, in reducing maternal diabetes-induced NTDs in an animal model, and to delineate the molecular mechanisms underlying Q3G action in regulating NOS2 expression. Female mice (C57BL/6) were induced to develop diabetes using streptozotocin before pregnancy. Diabetic pregnant mice were administered Q3G (100 mg/kg) daily via gavage feeding, introduction of drug to the stomach directly via a feeding needle, during neurulation from embryonic (E) day 6.5 to E9.5. After treatment, E10.5 embryos were collected and examined for the presence of NTDs and apoptosis in the neural tube. Expression of Nos2 and superoxide dismutase 1 (Sod1; an antioxidative enzyme) was quantified using Western blot assay. Nitrosative, oxidative, and endoplasmic reticulum (ER) stress conditions were assessed using specific biomarkers. Expression and posttranslational modification of factors in the NF-κB system were investigated. Treatment with Q3G (suspended in water) significantly decreased NTD rate (24.7%) and apoptosis in the embryos of diabetic mice, compared with those in the water
Li, Jing; Chen, Chang Xun; Shen, Yun Hui
2011-05-17
Total glucosides of paeony (TGP), compounds extracted from the roots of Paeonia lactiflora Pall, have been used as an anti-inflammatory drug for the treatment of rheumatoid arthritis (RA) in China. Inflammation plays a critical role in the development of atherosclerotic vascular disease. Risk of cardiovascular diseases is significantly higher in patients with RA than in normal population. It has a great significance to study the effects of TGP on atherosclerosis. To investigate the effects of TGP on atherosclerosis induced by excessive administration of vitamin D and cholesterol in rats and study the mechanisms involved. Atherosclerosis was induced by excessive administration of vitamin D and cholesterol in rats. TGP was intragastrically administered for 15 weeks. The serum concentrations of total cholesterol (TC), triglyceride (TG), low density lipoprotein-cholesterol (LDL-C) and high density lipoprotein-cholesterol (HDL-C) were measured by automatic biochemistry analyzer. Apolipoprotein A1 (ApoA1) and apolipoprotein B (ApoB) were determined by immunoturbidimetry method, tumor necrosis factor-alpha (TNF-alpha), interleukin-6 (IL-6) and C-reactive protein (CRP) were measured by enzyme-linked immunosorbent assay (ELISA) method. The morphological changes of aorta were observed with optical microscopy. Compared to controls, TGP significantly lowered the serum level of TC, TG, LDL-C, ApoB, TNF-alpha, IL-6 and CRP, increased the ratios of HDL-C/LDL-C and ApoA1/ApoB, decreased the intima-media thickness (IMT) of abdominal aortal wall and improved the morphological change of the aorta. TGP may attenuate the development of atherosclerotic disease. The beneficial effects are associated with its lowering blood lipids and inhibiting the expression of inflammatory cytokines. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Zhao, Ming; Liang, Gong-ping; Tang, Mei-ni; Luo, Shuang-yan; Zhang, Jing; Cheng, Wen-jing; Chan, Tak-mao; Lu, Qian-jin
2012-05-01
Total glucosides of paeony (TGP), an active compound extracted from Paeony root, has been used in therapy for autoimmune diseases. However the molecular mechanism of TGP in the prevention of autoimmune response remains unclear. In this study, we found that TGP treatment significantly increased the percentage and number of Treg cells in lupus CD4(+) T cells. Further investigation revealed that treatment with TGP increased the expression of Foxp3 in lupus CD4(+) T cells by down-regulating Foxp3 promoter methylation levels. However, we couldn't observe similar results in healthy control CD4(+) T cells treated by TGP. Moreover, our results also showed that IFN-γ and IL-2 expression was enhanced in TGP-treated lupus CD4(+) T cells. These findings indicate that TGP inhibits autoimmunity in SLE patients possibly by inducing Treg cell differentiation, which may in turn be due to its ability to regulate the methylation status of the Foxp3 promoter and activate IFN-γ and IL-2 signaling. Copyright © 2012 Elsevier Inc. All rights reserved.
Aerobic Epoxidation of Olefins Catalyzed by the Cobalt‐Based Metal–Organic Framework STA‐12(Co)
DEFF Research Database (Denmark)
Beier, Matthias Josef; Kleist, Wolfgang; Wharmby, Michael T.
2012-01-01
, (E)‐stilbene was converted with high selectivities between 80 and 90 %. Leaching of Co was low and the reaction was found to proceed mainly heterogeneously. The catalyst was reusable with only a small loss of activity. The catalytic epoxidation of stilbene with the MOF featured an induction period...
Haslewood, G A; Tökés, L
1972-03-01
1. Arapaima gigas bile salts were hydrolysed by alkali or cleaved with dioxan-trichloroacetic acid to give cholic acid, arapaimic acid, arapaimol-A and arapaimol-B. 2. I.r., n.m.r. and mass spectroscopy and [alpha](D) measurements indicated that arapaimic acid and arapaimol-A and -B are respectively 2alpha,3alpha,7alpha,12alpha-tetrahydroxy-5beta,25in-cholestan-26-oic acid, 5beta,25R-cholestane-2beta,3alpha,7alpha,12alpha,26-pentol and 5beta-cholestane-2beta,3alpha,7alpha,12alpha,26,27-hexol. 3. Partial synthesis of 2beta,3alpha,7alpha,12alpha-tetrahydroxy-5alpha- and -5beta-cholan-24-oic acid and their spectral examination fully confirmed these conclusions. 4. A. gigas bile salts show primitive features in that they comprise alcohol sulphates and a C(27) acid; they are also specialized in showing 2beta-hydroxylation.
Directory of Open Access Journals (Sweden)
Hendrik Pollmann
2017-02-01
Full Text Available The red yeast Xanthophyllomyces dendrorhous is an established platform for the synthesis of carotenoids. It was used for the generation of novel multi oxygenated carotenoid structures. This was achieved by a combinatorial approach starting with the selection of a β-carotene accumulating mutant, stepwise pathway engineering by integration of three microbial genes into the genome and finally the chemical reduction of the resulting 4,4’-diketo-nostoxanthin (2,3,2’,3’-tetrahydroxy-4,4’-diketo-β-carotene and 4-keto-nostoxanthin (2,3,2’,3’-tetrahydroxy-4-monoketo-β-carotene. Both keto carotenoids and the resulting 4,4’-dihydroxy-nostoxanthin (2,3,4,2’,3’,4’-hexahydroxy-β-carotene and 4-hydroxy-nostoxanthin (2,3,4,2’3’-pentahydroxy-β-carotene were separated by high-performance liquid chromatography (HPLC and analyzed by mass spectrometry. Their molecular masses and fragmentation patterns allowed the unequivocal identification of all four carotenoids.
Directory of Open Access Journals (Sweden)
Denise Josino Soares
Full Text Available The pulp of pitanga (Eugenia uniflora L. is used to prepare pitanga juice. However, there are no reports on the identification and quantification of the main constituents in pitanga pulp. The aim of this study was to identify and quantify the major volatile and non-volatile low-molecular-weight constituents of the pulp. Isolation of volatile compounds was performed by solvent-assisted flavor evaporation technique. Characterization of the main volatile and non-volatile constituents was performed by GC-MS, LC-MS and NMR spectroscopy. For quantitative measurements, the main volatile compound needed to be isolated from pitanga pulp to obtain a commercially not available reference standard. Cyanidin-3-glucoside was determined as one of the most abundant non-volatile pulp compound yielding 53.8% of the sum of the intensities of all ions detected by LC-MS. Quantification of cyanidin-3-glucoside in pitanga pulp resulted in a concentration of 344 ± 66.4 μg/mL corresponding to 688 ± 133 μg/g dried pulp and 530 ± 102 μg/g fruit. For the volatile fraction, oxidoselina-1,3,7(11-trien-8-one was identified as the main volatile pulp constituent (27.7% of the sum of the intensities of all ions detected by GC-MS, reaching a concentration of 89.0 ± 16.9 μg/mL corresponding to 1.34 ± 0.25 μg/g fresh pulp and 1.03 ± 0.19 μg/g fruit. The results provide quantitative evidence for the occurrence of an anthocyanin and an oxygenated sesquiterpene as one of the major volatile and non-volatile low-molecular-weight compounds in pitanga pulp.
Zhao, Ping; Zhou, Wen-Cheng; Li, De-Lin; Mo, Xiao-Ting; Xu, Liang; Li, Liu-Cheng; Cui, Wen-Hui; Gao, Jian
2015-01-01
Pulmonary fibrosis (PF) is a serious chronic lung disease with unknown pathogenesis. Researches have confirmed that oxidative stress which is regulated by NADPH oxidase-4 (NOX4), a main source of reactive oxygen species (ROS), is an important molecular mechanism underlying PF. Previous studies showed that total glucosides of Danggui Buxue Tang (DBTG), an extract from a classical traditional Chinese herbal formula, Danggui Buxue Tang (DBT), attenuated bleomycin-induced PF in rats. However, the mechanisms of DBTG are still not clear. We hypothesize that DBTG attenuates PF through regulating the level of oxidative stress by inhibiting NOX4. And we found that fibrosis indexes hydroxyproline (HYP) and type I collagen (Col-I) were lower in DBTG groups compared with the model group. In addition, the expression of transforming growth factor-β1 (TGF-β1) and expression of alpha smooth muscle actin (α-SMA) were also much more decreased than the model group. For oxidative stress indicators, DBTG blunted the decrease of superoxide dismutase (SOD) activity, total antioxidant capacity (T-AOC), and the increase in malondialdehyde (MDA), 8-iso-prostaglandin in lung homogenates. Treatment with DBTG restrained the expression of NOX4 compared to the model group. Present study confirms that DBTG inhibits BLM-induced PF by modulating the level of oxidative stress via suppressing NOX4. PMID:26347805
Flavonoids of Helichrysum compactum and their antioxidant and antibacterial activity.
Süzgeç, Sevda; Meriçli, Ali H; Houghton, Peter J; Cubukçu, Bayhan
2005-03-01
From the capitula of Helichrysum compactum, the flavonoids apigenin, kaempferol, luteolin, naringenin, 3,5-dihydroxy-6,7,8-trimethoxyflavone, kaempferol-3-O-glucoside, luteolin-7-O-glucoside and luteolin-4',7-di-O-glucoside and from the leafy stems apigenin, kaempferol, luteolin, quercetin, apigenin-7-O-glucoside, luteolin-7-O-glucoside, and quercetin-3-O-glucoside were isolated. Extracts of the capitula of H. compactum show antioxidant activity by inhibition of lipid peroxidation and also show antibacterial activity.
A comparison of flavonoid glycosides by electrospray tandem mass spectrometry
March, Raymond E.; Lewars, Errol G.; Stadey, Christopher J.; Miao, Xiu-Sheng; Zhao, Xiaoming; Metcalfe, Chris D.
2006-01-01
A comparison is presented of product ion mass spectra of protonated and deprotonated molecules of kaempferol-3-O-glucoside, quercitin-3-O-glucoside (isoquercitrin), quercitin-3-O-galactoside (hyperoin), apigenin-7-O-glucoside, luteolin-7-O-glucoside, genistein-7-O-glucoside, naringenin-7-O-glucoside (prunin), luteolin-4'-O-glucoside, luteolin-6-C-glucoside (homoorientin, known also as isoorientin), apigenin-8-C-glucoside (vitexin), and luteolin-8-C-glucoside (orientin) together with the product ion mass spectrum of deprotonated kaempferol-7-O-glucoside. All isomeric ions were distinguishable on the basis of their product ion mass spectra. For protonated 3-O-, 7-O-, and 4'-O-glycosides at a collision energy of 46-47 eV, homolytic cleavage of the O-glycosidic bond yielded aglycon Y+ ions, whereas in deprotonated 3-O-, 7-O-, and 4'-O-glycosides, heterolytic and homolytic cleavage of the O-glycosidic bond yielded radical aglycon (Y-H)- and aglycon (Y-) ions. In each case, fragmentation of either the glycan or the aglycon or both was observed. For 6-C- and 8-C-glycosides at a collision energy of 46-47 eV, fragmentation was restricted almost exclusively to the glycan. For luteolin-6-C-glucoside, the integrity of the aglycon structure is preserved at the expense of the glycan for which some 30 fragmentations were observed. Breakdown curves were determined as a function of collision energy for protonated and deprotonated luteolin-6-C-glucoside. An attempt has been made to rationalize the product ion mass spectra derived from C-O- and C-C-luteolin glucosides in terms of computed structures that indicate significant intramolecular hydrogen bonding and rotation of the B-ring to form a coplanar luteolin structure. It is proposed that protonated and deprotonated luteolin-6-C-glucoside may afford examples of cooperative interactive bonding that plays a major role in directing fragmentation.
McNee, William R; Bonello, Pierluigi; Storer, Andrew J; Wood, David L; Gordon, Thomas R
2003-05-01
In studies of feeding by the bark beetle, Ips paraconfusus, two pine stilbenes (pinosylvin and pinosylvin methyl ether), ferulic acid glucoside, and enantiomers of the four most common sugars present in ponderosa pine phloem (sucrose, glucose, fructose, and raffinose) did not stimulate or reduce male feeding when assayed on wet alpha-cellulose with or without stimulatory phloem extractives present. When allowed to feed on wet alpha-cellulose containing sequential extracts (hexane, methanol, and water) of ponderosa pine phloem, methanol and water extractives stimulated feeding, but hexane extractives did not. Males confined in wet alpha-cellulose containing aqueous or organic extracts of culture broths derived from phloem tissue and containing the root pathogen. Heterobasidion annosum, ingested less substrate than beetles confined to control preparations. In an assay using logs from uninoculated ponderosa pines, the mean lengths of phloem in the digestive tracts increased as time spent feeding increased. Males confined to the phloem of basal logs cut from ponderosa pines artificially inoculated with H. annosum ingested significantly less phloem than beetles in logs cut from trees that were (combined) mock-inoculated or uninoculated and did not contain the pathogen. However, individual pathogen-containing treatments were not significantly different from uninoculated controls. It was concluded that altered feeding rates are not a major factor which may explain why diseased ponderosa pines are colonized by I. paraconfusus.
Tříska, Jan; Vrchotová, Naděžda; Balík, Josef; Soural, Ivo; Sotolář, Radek
2017-06-03
Grape canes are a waste product from viticulture that show potential as an industrially extractable source of stilbenes, which are valuable for medical and other purposes. In this work, grape canes collected in three consecutive years (2014-2016) at six different places in South Moravia, Czech Republic were extracted, and the contents of trans -resveratrol, trans -ε-viniferin, and r2-viniferin were determined by high-performance liquid chromatography. The study included three blue grape varieties of Vitis vinifera L. (Cabernet Moravia, Blaufränkisch, and Piwi variety Laurot) and four white grape varieties (Chardonnay, Green Veltliner, Piwi variety Hibernal, and Piwi variety Malverina). From the viewpoint of producing extracts with high stilbenes content, the Hibernal variety is clearly the best. The mean amounts of the stilbenes for this variety at all localities and for all three years were 4.99 g/kg for trans -resveratrol, 3.24 g/kg for trans -ε-viniferin, and 1.73 g/kg for r2-viniferin. The influence of vintage, locality, and variety on the amounts of stilbenes was studied using PCA analysis. In contrast to expectations, there was no strong impact of locality on stilbenes content. The differences were varietal for most varieties, regardless of the area of cultivation. Laurot and Hibernal varieties did differ significantly in that respect, however, as they exhibited clear dependence on location.
Institute of Scientific and Technical Information of China (English)
LI Cun-man; XIAO Yuan-sheng; XUE Xing-ya; FENG Jia-tao; ZHANG Xiu-li; LIANG Xin-miao
2011-01-01
An efficient preparative method was successfully developed for isolation and purification of unstable components from medicinal plant extracts, using a combined method of preparative high performance liquid chro matography(HPLC) and solid-phase extraction(SPE). The aim of this study was to obtain an effective method with high preparative efficiency and importantly to avoid the transformation of unstable compounds. The preparative HPLC system was based on an LC/MS controlled four-channel autopurification system. The SPE method was per formed with a C1s packing material to trap the target compounds and to remove the acidic additive derived from the mobile phase. Using this method, the unstable iridoid glucosides(IGs) as model compounds were successfully iso lated and purified from the extract of Hedyotis diffusa Willd. Six IGs(including one new minor IG) and one nucleo tide compound were simultaneously obtained, each with a purity of >91% as determined by HPLC. The structures of the isolated compounds were identified by UPLC/Q-TOF MS, UV, ID and/or 2D NMR. It was demonstrated that the combination of preparative HPLC with SPE is a versatile tool for preparative purification of unstable compounds from complex natural products.
Xiudong, Xia; Ying, Wang; Xiaoli, Liu; Ying, Li; Jianzhong, Zhou
2016-01-01
Cell immobilization is an alternative to microencapsulation for the maintenance of cells in a liquid medium. However, artificial immobilization carriers are expensive and pose a high safety risk. Okara, a food-grade byproduct from soymilk production, is rich in prebiotics. Lactobacilli could provide health enhancing effects to the host. This study aimed to evaluate the potential of okara as a natural immobilizer for L. plantarum 70810 cells. The study also aimed to evaluate the effects of okara-immobilized L. plantarum 70810 cells (IL) on soymilk fermentation, glucosidic isoflavone bioconversion, and cell resistance to simulated gastric and intestinal stresses. Scanning electron microscopy (SEM) was used to show cells adherence to the surface of okara. Lactic acid, acetic acid and isoflavone analyses in unfermented and fermented soymilk were performed by HPLC with UV detection. Viability and growth kinetics of immobilized and free L. plantarum 70810 cells (FL) were followed during soymilk fermentation. Moreover, changes in pH, titrable acidity and viscosity were measured by conventional methods. For in vitro testing of simulated gastrointestinal resistance, fermented soymilk was inoculated with FL or IL and an aliquot incubated into acidic MRS broth which was conveniently prepared to simulate gastric, pancreatic juices and bile salts. Survival to simulated gastric and intestinal stresses was evaluated by plate count of colony forming units on MRS agar. SEM revealed that the lactobacilli cells attached and bound to the surface of okara. Compared with FL, IL exhibited a significantly higher specific growth rate, shorter lag phase of growth, higher productions of lactic and acetic acids, a faster decrease in pH and increase in titrable acidity, and a higher soymilk viscosity. Similarly, IL in soymilk showed higher productions of daizein and genistein compared with the control. Compared with FL, IL showed reinforced resistance to simulatedgastric and intestinal
Directory of Open Access Journals (Sweden)
Xia Xiudong
2016-11-01
Full Text Available Cell immobilization is an alternative to microencapsulation for the maintenance of cells in a liquid medium. However, artificial immobilization carriers are expensive and pose a high safety risk. Okara, a food-grade byproduct from soymilk production, is rich in prebiotics. Lactobacilli could provide health enhancing effects to the host. This study aimed to evaluate the potential of okara as a natural immobilizer for L. plantarum 70810 cells. The study also aimed to evaluate the effects of okara-immobilized L. plantarum 70810 cells (IL on soymilk fermentation, glucosidic isoflavone bioconversion, and cell resistance to simulated gastric and intestinal stresses. Scanning electron microscopy (SEM was used to show cells adherence to the surface of okara. Lactic acid, acetic acid and isoflavone analyses in unfermented and fermented soymilk were performed by HPLC with UV detection. Viability and growth kinetics of immobilized and free L. plantarum 70810 cells (FL were followed during soymilk fermentation. Moreover, changes in pH, titrable acidity and viscosity were measured by conventional methods. For in vitro testing of simulated gastrointestinal resistance, fermented soymilk was inoculated with FL or IL and an aliquot incubated into acidic MRS broth which was conveniently prepared to simulate gastric, pancreatic juices and bile salts. Survival to simulated gastric and intestinal stresses was evaluated by plate count of colony forming units on MRS agar. SEM revealed that the lactobacilli cells attached and bound to the surface of okara. Compared with FL, IL exhibited a significantly higher specific growth rate, shorter lag phase of growth, higher productions of lactic and acetic acids, a faster decrease in pH and increase in titrable acidity, and a higher soymilk viscosity. Similarly, IL in soymilk showed higher productions of daizein and genistein compared with the control. Compared with FL, IL showed reinforced resistance to simulatedgastric and
Safeguards Technology Development Program 1st Quarter FY 2018 Report
Energy Technology Data Exchange (ETDEWEB)
Prasad, Manoj K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2018-01-10
LLNL will evaluate the performance of a stilbene-based scintillation detector array for IAEA neutron multiplicity counting (NMC) applications. This effort will combine newly developed modeling methodologies and recently acquired high-efficiency stilbene detector units to quantitatively compare the prototype system performance with the conventional He-3 counters and liquid scintillator alternatives.
Antimicrobial Activity of Resveratrol Analogues
Directory of Open Access Journals (Sweden)
Malik Chalal
2014-06-01
Full Text Available Stilbenes, especially resveratrol and its derivatives, have become famous for their positive effects on a wide range of medical disorders, as indicated by a huge number of published studies. A less investigated area of research is their antimicrobial properties. A series of 13 trans-resveratrol analogues was synthesized via Wittig or Heck reactions, and their antimicrobial activity assessed on two different grapevine pathogens responsible for severe diseases in the vineyard. The entire series, together with resveratrol, was first evaluated on the zoospore mobility and sporulation level of Plasmopara viticola (the oomycete responsible for downy mildew. Stilbenes displayed a spectrum of activity ranging from low to high. Six of them, including the most active ones, were subsequently tested on the development of Botrytis cinerea (fungus responsible for grey mold. The results obtained allowed us to identify the most active stilbenes against both grapevine pathogens, to compare the antimicrobial activity of the evaluated series of stilbenes, and to discuss the relationship between their chemical structure (number and position of methoxy and hydroxy groups and antimicrobial activity.
Yao, Wenjuan; Huang, Lei; Sun, Qinju; Yang, Lifeng; Tang, Lian; Meng, Guoliang; Xu, Xiaole; Zhang, Wei
2016-10-01
Macrophage foam cell formation triggered by oxLDL is an important event that occurs during the development of atherosclerosis. 2,3,5,4'-Tetrahydroxystilbene-2-O-β-d-glucoside (TSG) exhibits significant anti-atherosclerotic activity. Herein we used U937 cells induced by PMA and oxLDL in vitro to investigate the inhibitory effects of TSG on U937 differentiation and macrophage foam cell formation. TSG pretreatment markedly inhibited cell differentiation induced by PMA, macrophage apoptosis and foam cell formation induced by oxLDL. The inhibition of vimentin expression and cleavage was involved in these inhibitory effects of TSG. The suppression of vimentin by siRNA in U937 significantly inhibited cell differentiation, apoptosis and foam cell formation. Using inhibitors for TGFβR1 and PI3K, we found that vimentin production in U937 cells is regulated by TGFβ/Smad signaling, but not by PI3K-Akt-mTOR signaling. Meanwhile, TSG pretreatment inhibited both the expression of TGFβ1 and the phosphorylation of Smad2 and Smad3, and TSG suppressed the nuclear translocation of Smad4 induced by PMA and oxLDL. Furthermore, TSG attenuated the induced caspase-3 activation and adhesion molecules levels by PMA and oxLDL. PMA and oxLDL increased the co-localization of vimentin with ICAM-1, which was attenuated by pretreatment with TSG. These results suggest that TSG inhibits macrophage foam cell formation through suppressing vimentin expression and cleavage, adhesion molecules expression and vimentin-ICAM-1 co-localization. The interruption of TGFβ/Smad pathway and caspase-3 activation is responsible for the downregulation of TSG on vimentin expression and degradation, respectively. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Zhu, L; Wei, W; Zheng, Y-Q; Jia, X-Y
2005-05-01
To investigate the therapeutic effects and mechanisms of total glucosides of paeony (TGP), an effective compound of Chinese traditional herbal medicine (CTM), on collagen -induced arthritis (CIA) in rats. CIA was induced in male Sprague-Dawley rats immunized with chicken type II collagen in Freund's complete adjuvant. TGP (25, 50, 100 mg/kg/d) was orally administered to rats from day 14 to 28 after immunization. Arthritis was evaluated by hind paw swelling, polyarthritis index, and histological examination. Activities of interleukin-1 (IL-1) and tumor necrosis factor alpha (TNFalpha) were determined and the ultrastructure of synoviocytes was observed. The proliferation and the production of vascular epidermal growth factor (VEGF), basic fibroblast growth factor (bFGF), matrix metalloproteinase 1 (MMP-1) and MMP-3 in fibroblast-like synoviocytes (FLS) were detected. The administration of TGP (25, 50, 100 mg/kg, ig x 14 days) suppressed secondary inflammatory reactions and histological changes in CIA model. The ultrastructure of synoviocytes from CIA rats was changed, and the level of IL-1 and TNF alpha produced by macrophage-like synoviocytes (MLS) from CIA rats was elevated. TGP (50, 100 mg/kg, ig x 14 days) inhibited above changes significantly. The MLS supernatants of CIA rats induced more cell proliferation and more production of VEGF, bFGF, MMP-1 and MMP-3 in FLS of CIA than those supernatants from CIA rats treated with TGP (50, 100 mg/kg, ig x 14 days). These results indicate that TGP exerts a suppressive effect on joint destruction in rat CIA. The therapeutic effect of TGP could be associated with its ability to ameliorate the secretion and metabolism of synoviocytes and to inhibit the abnormal proliferation and VEGF, bFGF, MMP-1 and MMP-3 production by FLS.
Zhang, Juan; Lv, Chen; Wang, Hai-na; Cao, Yi
2013-04-01
Shaoyao Gancao Decoction (SGD), a famous herbal medicine, consists of two herbs (Paeoniae Radix and Glycyrrhizae Radix) and is traditionally used for the treatment of pain. To investigate the synergistic potential of total glucosides of Paeoniae Radix (TGP) and total flavonoids of Glycyrrhizae Radix (TFL). Oral administration of TGP and TFL alone at the doses of 60,120 and 240 mg/kg or in combination were given only one time to the neuropathic pain rat induced by chronic constriction injury. Paw pressure and heat immersion tests were performed to assess degrees of mechanical allodynia and thermal hyperalgesia, respectively. Synergistic interactions between TGP and TFL were characterized using isobolographic analysis. Expressions of Sirt1 protein were detected by immunohistochemistry. On day 14 after surgery, single oral administration of TGP and TFL both produced significant anti-allodynic and anti-hyperalgesic effects in dose-dependent and time-dependent manners. The ED(50) value of TGP was 249.4 ± 10.8 mg/kg while TFL was 871.4 ± 30.5 mg/kg. Isobolographic analysis revealed that the combination of TGP with TFL at the fixed ratios of 3:1 exerted the highest sub-additive (synergistic) interaction, of which the experimental ED(50) value was 95.1 ± 9.0 mg/kg. SGD could also downregulate Sirt1 protein expression, which was 4.2-fold higher than that of model rats in dorsal root ganglion. Analgesic effects of SGD may contribute to simultaneous inhibition of Sirt1 overexpression and could warrant further evaluation as a possible agent for the treatment of neuropathic pain.
Wang, Kun; Wu, Yong-Gui; Su, Jing; Zhang, Jing-Jing; Zhang, Pei; Qi, Xiang-Ming
2012-01-01
Total glucosides of paeony (TGP) is the major active constituent of Paeonia lactiflora Pall., which has shown renoprotection in experimental diabetic nephropathy. Activation of Janus kinase/signal transducers and activators of transcription (JAK/STAT) is an important mechanism by which hyperglycemia contributes to renal damage. Macrophages also play an essential role in the pathogenesis of diabetic nephropathy. Herein, we investigated the ability of TGP to modulate JAK2/STAT3 activation and macrophage proliferation in rats with streptozotocin (STZ)-induced diabetes. TGP (50, 100, and 200 mg/kg) was administered orally once a day for eight weeks. Levels of p-JAK2 and p-STAT3 were determined by Western blot analysis. Immunohistochemistry and double immunohistochemistry were used to identify p-STAT3, ED-1, PCNA/ED-1, and p-STAT3/ED-1-positive (+) cells. The elevated 24-h urinary albumin excretion rate was markedly attenuated by treatment with 50, 100, and 200 mg/kg TGP. Western blot analysis showed that the significantly increased levels of p-JAK2, p-STAT3 proteins in the kidneys of diabetic rats were significantly inhibited by 50, 100, and 200 mg/kg TGP treatment. The marked accumulation and proliferation of macrophages in diabetic kidneys were significantly inhibited by TGP treatment. ED-1+/p-STAT3+ cells were significantly increased in the kidneys from the model group but were significantly inhibited by TGP treatment. These results show that TGP significantly inhibited diabetic nephropathy progression and suggest that these protective effects are associated with the ability of TGP to inhibit the JAK2/STAT3 pathway and macrophage proliferation and action.
He, Zhiyong; Xu, Mingzhu; Zeng, Maomao; Qin, Fang; Chen, Jie
2016-05-15
The interactions of α- and β-casein with malvidin-3-O-glucoside (MG), the major anthocyanin in grape skin anthocyanin extracts (GSAE), were examined at pH 6.3 by fluorescence, fourier transform infrared (FTIR) and circular dichroism (CD) spectroscopy. The binding constant (KS), binding force and effects of the interactions on the caseins conformation and GSAE stability were investigated. The results showed that α- and β-casein bound with MG via hydrophilic (van der Waals forces or hydrogen bonding) and hydrophobic interactions, respectively. α-Casein had a slightly stronger binding affinity toward MG than β-casein, with respective KS values of 0.51×10(3)M(-1) and 0.46×10(3)M(-1) at 297K. The secondary structures of α- and β-casein were changed by MG binding, with a decrease in α-helix and an increase in turn for α-casein and no change in α-helix and a decrease in turn for β-casein. The casein-anthocyanin interaction appeared to have a positive effect on the thermal, oxidation and photo stability of GSAE. Copyright © 2015 Elsevier Ltd. All rights reserved.
Yang, Ji Seon; Perveen, Shazia; Ha, Tae Joung; Kim, Seong Yun; Yoon, Shin Hee
2015-05-05
Cyanidin-3-glucoside (C3G), a member of the anthocyanin family, is a potent natural antioxidant. However, effects of C3G on glutamate-induced [Zn(2+)]i increase and neuronal cell death remain unknown. We studied the effects of C3G on glutamate-induced [Zn(2+)]i increase and cell death in cultured rat hippocampal neurons from embryonic day 17 maternal Sprague-Dawley rats using digital imaging methods for Zn(2+), Ca(2+), reactive oxygen species (ROS), mitochondrial membrane potential and a MTT assay for cell survival. Treatment with glutamate (100 µM) for 7 min induces reproducible [Zn(2+)]i increase at 35 min interval in cultured rat hippocampal neurons. The intracellular Zn(2+)-chelator TPEN markedly blocked glutamate-induced [Zn(2+)]i increase, but the extracellular Zn(2+) chelator CaEDTA did not affect glutamate-induced [Zn(2+)]i increase. C3G inhibited the glutamate-induced [Zn(2+)]i response in a concentration-dependent manner (IC50 of 14.1 ± 1.1 µg/ml). C3G also significantly inhibited glutamate-induced [Ca(2+)]i increase. Two antioxidants such as Trolox and DTT significantly inhibited the glutamate-induced [Zn(2+)]i response, but they did not affect the [Ca(2+)]i responses. C3G blocked glutamate-induced formation of ROS. Trolox and DTT also inhibited the formation of ROS. C3G significantly inhibited glutamate-induced mitochondrial depolarization. However, TPEN, Trolox and DTT did not affect the mitochondrial depolarization. C3G, Trolox and DTT attenuated glutamate-induced neuronal cell death in cultured rat hippocampal neurons, respectively. Taken together, all these results suggest that cyanidin-3-glucoside inhibits glutamate-induced [Zn(2+)]i increase through a release of Zn(2+) from intracellular sources in cultured rat hippocampal neurons by inhibiting Ca(2+)-induced mitochondrial depolarization and formation of ROS, which is involved in neuroprotection against glutamate-induced cell death. Copyright © 2015 Elsevier B.V. All rights reserved.
The O-methyltransferase PMT2 mediates methylation of pinosylvin in Scots pine.
Paasela, Tanja; Lim, Kean-Jin; Pietiäinen, Milla; Teeri, Teemu H
2017-06-01
Heartwood extractives are important determinants of the natural durability of pine heartwood. The most important phenolic compounds affecting durability are the stilbenes pinosylvin and its monomethylether, which in addition have important functions as phytoalexins in active defense. A substantial portion of the synthesized pinosylvin is 3-methoxylated but the O-methyltransferase responsible for this modification has not been correctly identified. We studied the expression of the stilbene pathway during heartwood development as well as in response to wounding of xylem and UV-C treatment of needles. We isolated and enzymatically characterized a novel O-methyltransferase, PMT2. The methylated product was verified as pinosylvin monomethylether using ultra performance liquid chromatography-tandem mass spectrometry and high performance liquid chromatography analyses. The PMT2 enzyme was highly specific for stilbenes as substrate, in contrast to caffeoyl-CoA O-methyltransferase (CCoAOMT) and PMT1 that were multifunctional. Expression profile and multifunctional activity of CCoAOMT suggest that it might have additional roles outside lignin biosynthesis. PMT1 is not involved in the stilbene pathway and its biological function remains an open question. We isolated a new specific O-methyltransferase responsible for 3-methoxylation of pinosylvin. Expression of PMT2 closely follows stilbene biosynthesis during developmental and stress induction. We propose that PMT2 is responsible for pinosylvin methylation in Scots pine (Pinus sylvestris), instead of the previously characterized methyltransferase, PMT1. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Hou, Kexin; Chen, Fengli; Zu, Yuangang; Yang, Lei
2016-01-29
An efficient method for the extraction of vitexin, vitexin-4″-O-glucoside, and vitexin-2″-O-rhamnoside from Phyllostachys edulis leaves comprises heat treatment using an ionic liquid-lithium salt mixture (using 1-butyl-3-methylimidazolium bromide as the solvent and lithium chloride as the additive), followed by ultrasound-assisted extraction. To obtain higher extraction yields, the effects of the relevant experimental parameters (including heat treatment temperature and time, relative amounts of 1-butyl-3-methylimidazolium bromide and lithium chloride, power and time of the ultrasound irradiation, and the liquid-solid ratio) are evaluated and response surface methodology is used to optimize the significant factors. The morphologies of the treated and untreated P. edulis leaves are studied by scanning electron microscopy. The improved extraction method proposed provides high extraction yield, good repeatability and precision, and has wide potential applications in the analysis of plant samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Song, S S; Yuan, P F; Li, P P; Wu, H X; Ni, W J; Lu, J T; Wei, W
2015-01-01
Total glucoside of paeony (TGP), extracted from the root of Paeonia Lactiflora, has been known to show anti-inflammatory, anti-oxidative, hepato-protective and immuno-regulatory activities. The aim of this present study was to determine the anti-tumor effect of TGP against N-nitrosodiethylamine (DEN)-induced hepatocellular carcinoma (HCC) in rats, and to find the related mechanisms. Rat HCC model was established by intragastrically administrating with DEN (8 mg/kg). We found the number of tumor nodules and the index of liver and spleen were increased in the model group compared with the normal group, and was significantly decreased by TGP. Additionally, TGP obviously improved the hepatic pathological lesions induced by DEN, and decreased the elevated levels of serum alanine aminotransferase (ALT), glutamic oxalacetic transaminase (AST), alkaline phosphatase (ALP) and alpha fetoprotein (AFP) by DEN. Moreover, TGP decreased the level of B cell-activating factor (BAFF) and the proportion of IL-10-producing regulatory B cells (Bregs), and the decrease of BAFF by TGP is positively correlated to the decrease of IL-10-producing Bregs by TGP. These results suggest that TGP had a good therapeutic action on DEN-induced HCC rats, which might be due to its down-regulation of Bregs through reducing the level of BAFF.
Calabriso, Nadia; Scoditti, Egeria; Massaro, Marika; Pellegrino, Mariangela; Storelli, Carlo; Ingrosso, Ilaria; Giovinazzo, Giovanna; Carluccio, Maria Annunziata
2016-03-01
The aim of the study was to evaluate the vascular anti-inflammatory effects of polyphenolic extracts from two typical South Italy red wines, the specific contribution of individual polyphenols and the underlying mechanisms of action. Human endothelial cells were incubated with increasing concentrations (1-50 μg/mL) of Primitivo and Negroamaro polyphenolic extracts (PWPE and NWPE, respectively) or pure polyphenols (1-25 μmol/L), including hydroxycinnamic acids (p-coumaric, caffeic and caftaric acids), flavonols (kaempferol, quercetin, myricetin) or stilbenes (trans-resveratrol, trans-piceid) before stimulation with lipopolysaccharide. Through multiple assays, we analyzed the endothelial-monocyte adhesion, the endothelial expression of adhesion molecules (ICAM-1, VCAM-1 and E-Selectin), monocyte chemoattractant protein-1 (MCP-1) and macrophage colony-stimulating factor (M-CSF), as well as ROS intracellular levels and the activation of NF-κB and AP-1. Both PWPE and NWPE, already at 1 μg/mL, inhibited monocyte adhesion to stimulated endothelial cells, a key event in triggering vascular inflammation. They down-regulated the expression of adhesion molecules, ICAM-1, VCAM-1, E-Selectin, as well as MCP-1 and M-CSF, at mRNA and protein levels. All polyphenols reduced intracellular ROS, and everything, except caftaric acid, inhibited the endothelial expression of adhesion molecules and MCP-1, although with different potency. Flavonols and resveratrol significantly reduced also the endothelial expression and release of M-CSF. The decrease in endothelial inflammatory gene expression was related to the inhibition of NF-κB and AP-1 activation but not to intracellular oxidative stress. This study showed multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts and indentified specific bioactive polyphenols which could counteract inflammatory diseases including atherosclerosis.
Four anti-protozoal and anti-bacterial compounds from Tapirira guianensis.
Roumy, Vincent; Fabre, Nicolas; Portet, Bénédicte; Bourdy, Geneviève; Acebey, Lucia; Vigor, Claire; Valentin, Alexis; Moulis, Claude
2009-01-01
Tapirira guianensis is a common tree used in traditional medicine in French Guiana against several infectious diseases (malaria, leishmaniasis, bacteria, etc.). The bioassay-guided purification of CH(2)Cl(2) bark extract led to the isolation of four cyclic alkyl polyol derivatives: 4,6,2'-trihydroxy-6-[10'(Z)-heptadecenyl]-1-cyclohexen-2-one (1a), 1,4,6-trihydroxy-1,2'-epoxy-6-[10'(Z)-heptadecenyl]-2-cyclohexene (1b), 1,4,5,2'-tetrahydroxy-1-[10'(Z)-heptadecenyl]-2-cyclohexene (2), and 1,3,4,6-tetrahydroxy-1,2'-epoxy-6-[10'(Z)-heptadecenyl]-cyclohexane (3). The structures were established on the basis of 1D and 2D NMR analyses. The anti-leishmanial, anti-plasmodial, anti-bacterial (on Staphylococcus aureus, Staphylococcus epidermidis and Escherichia coli), and anti-fungal (on Candida albicans) activities of the extracts and of these original compounds were evaluated. Two showed medicinal interest supporting the traditional uses of the plant. The structures were established through spectral analyses of the isolates and their derivatives.
Novel Photochrome Aptamer Switch Assay (PHASA) for adaptive binding to aptamers.
Papper, Vladislav; Pokholenko, Oleksandr; Wu, Yuanyuan; Zhou, Yubin; Jianfeng, Ping; Steele, Terry W J; Marks, Robert S
2014-11-01
A novel Photochrome-Aptamer Switch Assay (PHASA) for the detection and quantification of small environmentally important molecules such as toxins, explosives, drugs and pollutants, which are difficult to detect using antibodies-based assays with high sensitivity and specificity, has been developed. The assay is based on the conjugation of a particular stilbene-analyte derivative to any aptamer of interest. A unique feature of the stilbene molecule is its reporting power via trans-cis photoisomerisation (from fluorescent trans-isomer to non-fluorescent cis-isomer) upon irradiation with the excitation light. The resulting fluorescence decay rate for the trans-isomer of the stilbene-analyte depends on viscosity and spatial freedom to rotate in the surrounding medium and can be used to indicate the presence of the analyte. Quantification of the assay is achieved by calibration of the fluorescence decay rate for the amount of the tested analyte. Two different formats of PHASA have been recently developed: direct conjugation and adaptive binding. New stilbene-maleimide derivatives used in the adaptive binding format have been prepared and characterised. They demonstrate effective binding to the model thiol compound and to the thiolated Malachite Green aptamer.
Iridoid glycosides from Eucnide bartonioides
DEFF Research Database (Denmark)
Rodriguez, Veronica; Schripsema, Jan; Jensen, Søren Rosendal
1997-01-01
Eucnide bartonioides yielded morroniside as the main iridoid constituent. In addition, six minor iridoid glucosides were isolated namely the known glucosides: kingiside, sweroside, secologanol, 8-epi-loganin and loganin as well as a novel iridoid glucoside, which Ly spectroscopic methods was assi......Eucnide bartonioides yielded morroniside as the main iridoid constituent. In addition, six minor iridoid glucosides were isolated namely the known glucosides: kingiside, sweroside, secologanol, 8-epi-loganin and loganin as well as a novel iridoid glucoside, which Ly spectroscopic methods...... was assigned to be 5-hydroxyloganin. The compound 8-epi-loganin has so far been reported only from Scrophulariaceae and related families and it is rather unexpected in Loasaceae. (C) 1997 Elsevier Science Ltd. All rights reserved....
Directory of Open Access Journals (Sweden)
Feiye Zhu
Full Text Available Using an atropine-diphenoxylate-induced slow transit constipation (STC model, this study explored the effects of the total glucosides of paeony (TGP in the treatment of STC and the possible mechanisms.A prospective experimental animal study.The constipation model was set up in rats with an oral gavage of atropine-diphenoxylate and then treated with the TGP. The volume and moisture content of the faeces were observed and the intestinal kinetic power was evaluated. Meanwhile, the colorimetric method and enzyme linked immunosorbent assay (ELISA were employed to determine the changes of nitric oxide (NO, nitric oxide synthase (NOS, vasoative intestinal peptide (VIP and the P substance (SP in the serum, respectively. The protein expressions of c-kit and stem cell factor (SCF were assessed by immunohistochemical analysis and western blot, respectively, and the mRNA level of c-kit was measured by a reverse transcription polymerase chain reaction (RT-PCR.The TGP attenuated STC responses in terms of an increase in the fecal volume and moisture content, an enhancement of intestinal transit rate and the reduction of NO, NOS and VIP in the serum. In addition, the c-kit, a labeling of interstitial cells of Cajal (ICC increased at both protein and mRNA levels. SCF, which serves as a ligand of c-kit also increased at protein level.The analysis of our data indicated that the TGP could obviously attenuate STC through improving the function of ICC and blocking the inhibitory neurotransmitters such as NO, NOS and VIP.
Zhu, Feiye; Xu, Shan; Zhang, Yongsheng; Chen, Fangming; Ji, Jinjun; Xie, Guanqun
2016-01-01
Objectives Using an atropine-diphenoxylate-induced slow transit constipation (STC) model, this study explored the effects of the total glucosides of paeony (TGP) in the treatment of STC and the possible mechanisms. Study Design A prospective experimental animal study. Methods The constipation model was set up in rats with an oral gavage of atropine-diphenoxylate and then treated with the TGP. The volume and moisture content of the faeces were observed and the intestinal kinetic power was evaluated. Meanwhile, the colorimetric method and enzyme linked immunosorbent assay (ELISA) were employed to determine the changes of nitric oxide (NO), nitric oxide synthase (NOS), vasoative intestinal peptide (VIP) and the P substance (SP) in the serum, respectively. The protein expressions of c-kit and stem cell factor (SCF) were assessed by immunohistochemical analysis and western blot, respectively, and the mRNA level of c-kit was measured by a reverse transcription polymerase chain reaction (RT-PCR). Results The TGP attenuated STC responses in terms of an increase in the fecal volume and moisture content, an enhancement of intestinal transit rate and the reduction of NO, NOS and VIP in the serum. In addition, the c-kit, a labeling of interstitial cells of Cajal (ICC) increased at both protein and mRNA levels. SCF, which serves as a ligand of c-kit also increased at protein level. Conclusion The analysis of our data indicated that the TGP could obviously attenuate STC through improving the function of ICC and blocking the inhibitory neurotransmitters such as NO, NOS and VIP. PMID:27478893
Zhang, Wei; Zhao, Li; Su, Shuang-Quan; Xu, Xing-Xin; Wu, Yong-Gui
2014-01-01
Accumulating evidence suggested that macrophages induce tubulointerstitial injury. Total glucosides of paeony (TGP), extracted from Paeonia lactiflora, has presented anti-inflammatory activities in diabetic kidney disease. This research will investigate the protective effect of TGP on renal tubulointerstitium and its mechanism in streptozotocin-induced diabetic rats. TGP was administered orally at a dose of 50, 100, and 200 mg·kg(-1)·d(-1) for 8 weeks. Tubulointerstitial injury was quantified, followed by immunohistochemistry analysis of renal α-smooth muscle actin (α-SMA), E-cadherin (E-cad) expression, nuclear factor kappa B (NF-κB)-p-p-65(+), Toll-like receptor (TLR)2(+), and ED-1(+) cell infiltration in renal tubulointerstitium. Renal TLR2(+) macrophages were detected by double immunohistochemical staining. Western blotting was used to detect the TLR2 expression. Histologically, there was marked accumulation of TLR2(+), NF-κB-p-p-65(+), ED-1(+) cells, and ED-1(+)TLR2(+) cells (macrophages) in the diabetic kidney and TGP treatment could alleviate it. Accompanying with that, the tubulointerstitial injury was ameliorated, α-SMA expression was lower, and E-cad expression was higher compared with the diabetic rats. Western blot analysis showed that the expression of TLR2 protein was significantly increased in the kidney of the diabetic rats, whereas TGP treatment reduced it. Our study showed that TGP could prevent renal tubulointerstitium injury in diabetic rats through a mechanism that may be at least partly correlated with suppression of increased macrophage infiltration and the expression of TLR2.
Feng, Zhi-Tao; Xu, Juan; He, Guo-Chao; Cai, San-Jin; Li, Juan; Mei, Zhi-Gang
2018-01-01
To assess the efficacy and safety of the combination of total glucoside of peony (TGP) and methotrexate (MTX) for the treatment of rheumatoid arthritis (RA). Randomized controlled trial (RCT) data on the traditional Chinese active component TGP combined with MTX vs. MTX alone for the treatment of RA was collected by searching the Pubmed, Embase, Cochrane Library, CNKI, VIP Journals database, and Wanfang database up to February 2017. Study selection, data extraction, data synthesis, and data analyses were performed according to the Cochrane standards. A total of eight RCTs involving 522 participants were included in this meta-analysis. Compared with MTX alone, the use of TGP combined with MTX exhibited better therapeutic effects for the treatment of RA (P = 0.004). In addition, TGP combined with MTX caused a more significant decrease in erythrocyte sedimentation rate (ESR) (P TGP and MTX combination group (P = 0.0007). Our study demonstrates that TGP combined with MTX is more effective than MTX alone for the treatment of RA. Nevertheless, the adverse effects of the combination of TGP and MTX need to be further assessed. Due to the poor methodological quality of included trials, well-designed, multi-center, and large-scale RCTs are necessary to draw a more definitive conclusion.
Directory of Open Access Journals (Sweden)
Haojie Li
2017-01-01
Full Text Available Total glucosides of paeony (TGP have been confirmed to be hepatoprotective. However, the underlying mechanism is largely unclear. In this study, we investigated the metabolic profiles of urine and serum in rats with carbon tetrachloride- (CCl4- induced experimental liver injury and TGP administration by using ultra-performance liquid chromatography-mass spectrometry (UPLC-MS. The vehicle or a single dose of TGP was intragastrically administered to Wistar rats once a day for 14 consecutive days. To induce ALI, 50% CCl4 was injected intraperitoneally into these rats 2 hours after the last time administration of saline of TGP at the 14th day. The results indicated that TGP administration could protect rats from CCl4-induced ALI and alanine aminotransferase (ALT and aspartate aminotransferase (AST elevation, as well as hepatocyte apoptosis and inflammation. Furthermore, metabolomics analysis showed that TGP treatment significantly attenuated CCl4-triggered deregulation of multiple metabolites in both urine and serum, including glycine, alanine, proline, and glutamine. Metabolite set enrichment and pathway analyses demonstrated that amino acid cycling and glutathione metabolism were two main pathways involved in CCl4-induced experimental liver injury and TGP administration. Taken together, these findings revealed that regulation of metabolites potentially plays a pivotal role in the protective effect of TGP on ALI.
Gordillo, Belén; Rodríguez-Pulido, Francisco J; González-Miret, M Lourdes; Quijada-Morín, Natalia; Rivas-Gonzalo, Julián C; García-Estévez, Ignacio; Heredia, Francisco J; Escribano-Bailón, M Teresa
2015-09-09
The combined effect of anthocyanin-flavanol-flavonol ternary interactions on the colorimetric and chemical stability of malvidin-3-glucoside has been studied. Model solutions with fixed malvidin-3-glucoside/(+)-catechin ratio (MC) and variable quercetin-3-β-d-glucoside concentration (MC+Q) and solutions with fixed malvidin-3-glucoside/quercetin-3-β-d-glucoside ratio (MQ) and variable (+)-catechin concentration (MQ+C) were tested at levels closer to those existing in wines. Color variations during storage were evaluated by differential colorimetry. Changes in the anthocyanin concentration were monitored by HPLC-DAD. CIELAB color-difference formulas were demonstrated to be of practical interest to assess the stronger and more stable interaction of quercetin-3-β-d-glucoside with MC binary mixture than (+)-catechin with MQ mixture. The results imply that MC+Q ternary solutions kept their intensity and bluish tonalities for a longer time in comparison to MQ+C solutions. The stability of malvidin-3-glucoside improves when the concentration of quercetin-3-β-d-glucoside increases in MC+Q mixtures, whereas the addition of (+)-catechin in MQ+C mixtures resulted in an opposite effect.
Directory of Open Access Journals (Sweden)
Neuza Mariko Aymoto Hassimotto
2013-01-01
Full Text Available Anthocyanins are flavonoids which demonstrated biological activities in in vivo and in vitro models. Here in the anti-inflammatory properties of an anthocyanin-enriched fraction (AF extracted from wild mulberry and the cyanidin-3-glucoside (C3G, the most abundant anthocyanin in diet, were studied in two acute inflammation experimental models, in the peritonitis and in the paw oedema assays, both of which were induced by carrageenan (cg in mice. In each trial, AF and C3G (4 mg/100 g/animal were orally administered in two distinct protocols: 30 min before and 1 h after cg stimulus. The administration of both AF and C3G suppresses the paw oedema in both administration times (P<0.05. In the peritonitis, AF and C3G reduced the polymorphonuclear leukocytes (PMN influx in the peritoneal exudates when administered 1 h after cg injection. AF was more efficient reducing the PMN when administered 30 min before cg. Both AF and C3G were found to suppress mRNA as well as protein levels of COX-2 upregulated by cg in both protocols, but the inhibitory effect on PGE2 production in the peritoneal exudates was observed when administered 30 min before cg (P<0.05. Our findings suggest that AF and C3G minimize acute inflammation and they present positive contributions as dietary supplements.
Malachova, Alexandra; Dzuman, Zbynek; Veprikova, Zdenka; Vaclavikova, Marta; Zachariasova, Milena; Hajslova, Jana
2011-12-28
Fusarium toxins, Alternaria toxins, and ergot alkaloids represent common groups of mycotoxins that can be found in cereals grown under temperate climatic conditions. Because most of them are chemically and thermally stable, these toxic fungal secondary metabolites might be transferred from grains into the final products. To get information on the commensurate contamination of various cereal-based products collected from the Czech retail market in 2010, the occurrence of "traditional" mycotoxins such as groups of A and B trichothecenes and zearalenone, less routinely determined Alternaria toxins (alternariol, alternariol monomethyl ether and altenuene), ergot alkaloids (ergosine, ergocryptine, ergocristine, and ergocornine) and "emerging" mycotoxins (enniatins A, A1, B, and B1 and beauvericin) were monitored. In a total 116 samples derived from white flour and mixed flour, breakfast cereals, snacks, and flour, only trichothecenes A and B and enniatins were found. Deoxynivalenol was detected in 75% of samples with concentrations ranging from 13 to 594 μg/kg, but its masked form, deoxynivalenol-3-β-d-glucoside, has an even higher incidence of 80% of samples, and concentrations ranging between 5 and 72 μg/kg were detected. Nivalenol was found only in three samples at levels of 30 μg/kg. For enniatins, all of the samples investigated were contaminated with at least one of four target enniatins. Enniatin A was detected in 97% of samples (concentration range of 20-2532 μg/kg) followed by enniatin B with an incidence in 91% of the samples (concentration range of 13-941 μg/kg) and enniatin B1 with an incidence of 80% in the samples tested (concentration range of 8-785 μg/kg). Enniatin A1 was found only in 44% of samples at levels ranging between 8 and 851 μg/kg.
Energy Technology Data Exchange (ETDEWEB)
Luridiana, Alberto; Pretta, Gianluca; Secci, Francesco; Frongia, Angelo [Dipartimento di Scienze Chimiche e Geologiche, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Chiriu, Daniele; Carbonaro, Carlo Maria; Corpino, Riccardo [Dipartimento di Fisica, Università degli Studi di Cagliari, Complesso universitario di Monserrato, SS 554, bivio per Sestu, Monserrato (Canada) (Italy); Ricci, Pier Carlo, E-mail: carlo.ricci@dsf.unica.it [Dipartimento di Fisica, Universitá degli Studi di Cagliari, S.P. Monserrato-Sestu Km 0,700, 09042 Monserrato (Canada) (Italy)
2014-10-21
It is well known that stilbene with a trans conformation is highly fluorescent. From the viewpoint of molecular structure, coumarins bear a carbon-carbon double bond which is fixed as trans conformation as in trans-stilbene through a lactone structure. This can help to avoid the trans-cis transformation of the double bond under ultraviolet (UV) irradiation as observed in stilbene compounds and results in strong fluorescence and high fluorescence quantum yield and photostability in most of coumarin derivatives. Herein we report some preliminary results about the synthesis and spectroscopic characterization of tunable coumarins and the development of a new linkage protocol for the obtainment of monolayer coumarin-covalently linked glasses. The resulting organic/inorganic coumarin/silica based Self-Assembled Monolayer (SMA) film is proposed as new phosphors for the substituting of critical raw materials, like rare earths, in photonics applications.
Xiang, Nan; Li, Xiao-Mei; Zhang, Miao-Jia; Zhao, Dong-Bao; Zhu, Ping; Zuo, Xiao-Xia; Yang, Min; Su, Yin; Li, Zhan-Guo; Chen, Zhu; Li, Xiang-Pei
2015-09-01
Total glucosides of paeony (TGP) have been confirmed to exert anti-inflammatory and hepatoprotective effects. Methotrexate (MTX) and Leflunomide (LEF) combination has a better efficacy in the treatment of active rheumatoid arthritis (RA), but hepatotoxicity was observed. In this study, we investigated the effect of TGP on hepatic dysfunction caused by MTX and LEF in patients with active RA. A total of 268 patients with active RA (disease activity score in 28 joints, DAS28>3.2) were enrolled in this study. All patients were randomly assigned to two groups, the therapeutic group in which patients were treated with TGP (1.8 g/day) combined with MTX and LEF (MTX 10mg/week plus LEF 20mg/day) while in the control group, patients were treated without TGP up to 12 weeks. The efficacy and liver abnormalities were observed. The incidence of abnormal liver function within 12 weeks in TGP group was significantly lower than that in control group (11.38% vs 23.26%, P=0.013). The proportion of patients with ALT/AST >3 times ULN (upper limits of normal) was significantly lower in TGP group than control group (1.63% vs 7.75%, P=0.022). More patients achieved remission, good and moderate response in TGP group than control group at 4, 8 and 12 weeks, but the difference was not significant (P>0.05). The proportions of all adverse events were comparable in the two groups except for diarrhea. Our study demonstrates that TGP can significantly reduce the incidence and severity of liver damage caused by MTX+LEF in the treatment of active RA patients. Copyright © 2015 Elsevier B.V. All rights reserved.
Yang, Jun; Liu, Rui Hai
2009-09-23
Breast cancer is the most frequently diagnosed cancer in women. An alternative strategy to reduce the risk of cancer is through dietary modification. Although phytochemicals naturally occur as complex mixtures, little information is available regarding possible additive, synergistic, or antagonistic interactions among compounds. The antiproliferative activity of apple extracts and quercetin 3-beta-d-glucoside (Q3G) was assessed by measurement of the inhibition of MCF-7 human breast cancer cell proliferation. Cell cytotoxicity was determined by the methylene blue assay. The two-way combination of apple plus Q3G was conducted. In this two-way combination, the EC(50) values of apple extracts and Q3G were 2- and 4-fold lower, respectively, than those of apple extracts and Q3G alone. The combination index (CI) values at 50 and 95% inhibition rates were 0.76 +/- 0.16 and 0.42 +/- 0.10, respectively. The dose-reduction index (DRI) values of the apple extracts and Q3G to achieve a 50% inhibition effect were reduced by 2.03 +/- 0.55 and 4.28 +/- 0.39-fold, respectively. The results suggest that the apple extracts plus Q3G combination possesses a synergistic effect in MCF-7 cell proliferation.
Zhao, Ming; Liang, Gongping; Luo, Shuangyan; Lu, Qianjin
2012-05-01
To investigate the effect of total glucosides of peony (TGP) on expression and DNA methylation status of ITGAL gene (CD11a) in CD4(+) T cells from patients with systemic lupus erythematosus (SLE). CD4(+) T cells were isolated by positive selection using CD4 beads. CD4(+) T cells were treated by TGP at 0, 62.5, 312.5 and 1562.5 mg/L for 48 h. The MTT method was used to assess cell viability; mRNA expression level was measured by realtime-PCR; protein level of CD11a was measured by flow cytometric analysis; DNA methylation status was assayed by bisulfite sequencing. No significant change in cell viability was found in CD4(+) T cells among the different concentration groups (P>0.05). Compared with control, the mRNA and protein levels of ITGAL were down-regulated significantly in SLE CD4(+) T cells treated with TGP (1562.5 mg/L) (PTGP (1562.5 mg/L) treated CD4(+) T cells compared with control group (PTGP can repress CD11a gene expression through enhancing DNA methylation of ITGAL promoter in CD4(+) T cells from patients with SLE. This observation represents a preliminary step in understanding the mechanism of TGP in SLE therapy.
Gouvêa, Ana Cristina M S; Melo, Armindo; Santiago, Manuela C P A; Peixoto, Fernanda M; Freitas, Vitor; Godoy, Ronoel L O; Ferreira, Isabel M P L V O
2015-10-15
Neomitranthes obscura (DC.) N. Silveira is a Brazilian fruit belonging to the Myrtaceae family that contains anthocyanins in the peel and was studied for the first time in this work. Delphinidin-3-O-galactoside, delphinidin-3-O-glucoside, cyanidin-3-O-galactoside, cyanidin-3-O-glucoside, cyanidin-3-O-arabinoside, petunidin-3-O-glucoside, pelargonidin-3-O-glucoside, peonidin-3-O-galactoside, peonidin-3-O-glucoside, cyanidin-3-O-xyloside were separated and identified by LC/DAD/MS and by co-elution with standards. Reliable quantification of anthocyanins in the mature fruits was performed by HPLC/DAD using weighted linear regression model from 0.05 to 50mg of cyaniding-3-O-glucoside L(-1) because it gave better fit quality than least squares linear regression. Good precision and accuracy were obtained. The total anthocyanin content of mature fruits was 263.6 ± 8.2 mg of cyanidin-3-O-glucoside equivalents 100 g(-1) fresh weight, which was in the same range found in literature for anthocyanin rich fruits. Copyright © 2015. Published by Elsevier Ltd.
Feng, Zhitao; Xu, Juan; He, Guochao; Cao, Meiqun; Duan, Lihong; Chen, Liguo; Wu, Zhengzhi
2016-01-01
Objective. To evaluate the efficacy and safety of the total glucosides of peony (TGP) and leflunomide (LEF) for the treatment of rheumatoid arthritis (RA). Methods. Randomized controlled trials (RCTs) on the efficacy and safety of the combination of TGP and LEF versus LEF alone for the treatment of RA were retrieved by searching PubMed, EMBASE, Cochrane Library, the China National Knowledge Infrastructure database, and Wanfang database. Results. Eight RCTs including 643 RA patients were included in the present meta-analysis. The quality of included studies was poor. The levels of ESR (P TGP and LEF were significantly lower than RA patients who received LEF therapy alone. The pooled results suggest that the combination of TGP and LEF caused less abnormal liver function than LEF alone (P = 0.02). No significant difference in the gastrointestinal discomfort was identified between the combination of TGP and LEF and LEF alone groups (P = 0.18). Conclusion. The combination of TGP and LEF in treatment of RA presented the characteristics of notably decreasing the levels of laboratory indexes and higher safety in terms of liver function. However, this conclusion should be further investigated based on a larger sample size.
Adam, Waldemar; Roschmann, Konrad J; Saha-Möller, Chantu R; Seebach, Dieter
2002-05-08
cis-Stilbene (1) has been epoxidized by a set of diverse oxygen donors [OxD], catalyzed by the Mn(III)(salen)X complexes 3 (X = Cl, PF(6)), to afford a mixture of cis- and trans-epoxides 2. The cis/trans ratios range from 29:71 (extensive isomerization) to 92:8, which depends both on the oxygen source [OxD] and on the counterion X of the catalyst. When (1 alpha,2 beta,3 alpha)-(2-ethenyl-3-methoxycyclopropyl)-benzene (4) is used as substrate, a mechanistic probe which differentiates between radical and cationic intermediates, no cationic ring-opening products are found in this epoxidation reaction; thus, isomerized epoxide product arises from intermediary radicals. The dependence of the diastereoselectivity on the oxygen source is rationalized in terms of a bifurcation step in the catalytic cycle, in which concerted Lewis-acid-activated oxygen transfer competes with stepwise epoxidation by the established Mn(V)(oxo) species. The experimental counterion effect is attributed to the computationally assessed ligand-dependent reaction profiles and stereoselectivities of the singlet, triplet, and quintet spin states available to the manganese species.
Wang, Yanni; Zhang, Han; Du, Guanhuan; Wang, Yufeng; Cao, Tianyi; Luo, Qingqiong; Chen, Junjun; Chen, Fuxiang; Tang, Guoyao
2016-07-01
Total glucosides of paeony (TGP) is a bioactive compound extracted from paeony roots and has been widely used to ameliorate inflammation in several autoimmune and inflammatory diseases. However, the anti-inflammatory effect of TGP on oral lichen planus (OLP), a chronic inflammatory oral condition characterized by T-cell infiltration and abnormal epithelial keratinization cycle remains unclear. In this study, we found that TLR4 was highly expressed and activation of the NF-κB signaling pathway was obviously observed in the OLP tissues. Moreover, there was significant higher mRNA expression of inflammatory cytokines interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) in OLP keratinocytes than normal oral epithelial keratinocytes. With the help of the cell culture model by stimulating the keratinocyte HaCaT cells with lipopolysaccharides (LPS), we mimicked the local inflammatory environment of OLP. And we further confirmed that TGP could inhibit LPS-induced production of IL-6 and TNF-α in HaCaT cells via a dose-dependent manner. TGP treatment decreased the phosphorylation of IκBα and NF-κB p65 proteins, thus leading to less nuclear translocation of NF-κB p65 in HaCaT cells. Therefore, our data suggested that TGP may be a new potential candidate for the therapy of OLP. Copyright © 2016 Elsevier B.V. All rights reserved.
Effect of total glucosides of paeony on the expression of nephrin in the kidneys from diabetic rats.
Zhang, Pei; Zhang, Jing-Jing; Su, Jing; Qi, Xiang-Ming; Wu, Yong-Gui; Shen, Ji-Jia
2009-01-01
Total glucosides of paeony (TGP), extracted from the traditional Chinese herb root of Paeonia lactiflora pall, have been shown to have a therapeutic role in experimental diabetic nephropathy including albuminuria. Recent investigation has identified nephrin, a podocyte-specific transmembrane protein, as a key regulator in the pathogenesis of diabetic albuminuria. The aim of this study was to investigate whether TGP can attenuate albuminuria through prevention of nephrin loss in the experimental diabetic nephropathy. Fifty male Munich-Wistar rats were obtained from the Experimental Animal Center of Anhui Medical University. These rats were divided into 5 groups (n = 10); normal group, control diabetic group, and 3 TGP treated diabetic groups at different concentrations. Diabetes was induced by streptozotocin, and TGP (50, 100, 200 mg/kg) was orally administered to the 3 TGP treated diabetic groups once a day for 8 weeks, respectively. Blood glucose and 24 hour urinary albumin excretion rate (AER) were measured. The expressions of nephrin, tumor necrosis factor-alpha (TNF-alpha), NF-kappaB p65 and 3-nitrotyrosine (3-NT) protein were determined by immunoinfluorescence or Western blot analysis in the kidneys. Elevated AER was markedly attenuated by TGP treatment in diabetic rats. There was a finely dotted linear epithelial staining of nephrin in normal group glomeruli. In contrast, the staining of glomeruli from untreated diabetic rats was attenuated, more diapersed, and clustered. This diabetic-induced loss of glomerular nephrin expression was prevented in a large degree in TGP-treated diabetic rats. Western blot analysis showed that the expression of nephrin protein was reduced in the kidneys of diabetic rats, but significantly increased in the TGP treatment groups. The expressions of TNF-alpha, NF-kappaB p65 and 3-NT protein were significantly increased in the kidneys of diabetic rats, which were all significantly inhibited by TGP treatment. Our results showed that
Directory of Open Access Journals (Sweden)
Liang Jin
2017-01-01
Full Text Available Objective. To evaluate the clinical efficacy and safety of total glucosides of paeony (TGP for primary Sjögren’s syndrome (pSS. Methods. Eight electronic databases were searched from their inception to July 2016. Clinical randomized controlled trials (RCTs were included. The study quality was evaluated according to the standard suggested in the Cochrane Handbook. RevMan 5.1 was used for statistical analysis. Results. Seven RCTs involving 443 patients were included. The results showed that TGP combined with an immunosuppressant (IS showed greater efficacy for improving the saliva flow test of pSS compared to immunosuppressant alone (WMD −6.88, 95% CI −9.02 to −4.74, and P<0.00001. And the same trend favouring TGP-IS dual combination was found in Schirmer test (WMD 1.63, 95% CI 0.26 to 3.01, and P=0.02, ESR (WMD 7.33, 95% CI −10.08 to −4.59, and P<0.00001, CRP (WMD −6.00, 95% CI −7.17 to −4.83, and P<0.00001, IgM (WMD = −0.42, 95% CI −0.70 to 0.13, and P=0.004, and IgG (WMD −3.22, 95% CI −4.32 to −2.12, and P<0.00001 analysis. However, TGP did not affect IgA (WMD 0.53, 95% CI −1.34 to −0.29, and P=0.20. The adverse events manifested no significant differences between the two groups. Conclusions. The TGP-IS combination is superior to IS alone in the treatment of pSS. However, due to the low quality of included studies, high-quality RCTs are needed to confirm the beneficial effects of TGP.
Lifescience Database Archive (English)
Full Text Available D06725 Crude ... Drug Calumba (JP17); Powdered calumba (JP17); Colombo (TN) Palmat..., Columbinyl glucoside, Jateorinyl glucoside, Isojateorinyl glucoside, (Palmatoside A-F | Palmatoside G [CPD... E00097 Therapeutic category: 5100 ... Menispermaceae (moonseed family) Jateorhiza columba root Major component: Palmatine [CPD:C05315] ... PubChem: 47208376 ...
Zhou, Mo; Chen, Qinqin; Bi, Jinfeng; Wang, Yixiu; Wu, Xinye
2017-08-15
The aim of this study is to ascertain the degradation kinetic of anthocyanin in dehydration process of solid food system. Mulberry fruit was treated by hot air and vacuum drying at 60 and 75°C. The contents of cyanidin 3-O-glucoside and cyanidin 3-O-rutinoside were determined by using high performance liquid chromatography. Kinetic and thermodynamic parameters were calculated for analysing the degradation characteristics. Model fitting results showed monomeric anthocyanin degradations were followed the second-order kinetic. Vacuum drying presented high kinetic rate constants and low t 1/2 values. Thermodynamic parameters including the activation energy, enthalpy change and entropy change appeared significant differences between hot air and vacuum drying. Both heating techniques showed similar effects on polyphenol oxidase activities. These results indicate the anthocyanin degradation kinetic in solid food system is different from that in liquid and the oxygen can be regarded as a catalyst to accelerate the degradation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Li, Shujuan; Chu, Yanjie; Zhang, Ruowen; Sun, Linjia; Chen, Xiaohui
2018-04-20
Strychnos alkaloids (SAs) are the main toxic constituents in Semen Strychni, a traditional Chinese medicine, which is known for its fatal neurotoxicity. Hence, the present study was carried out to evaluate the neurotoxicity induced by SAs and the pre-protective effects of the total glucosides of Paeoniae Radix Alba (TGP). An SA brain damage model was firstly established. The neurotoxicity induced by SAs and the pre-protective effects of TGP were confirmed by physical and behavioral testing, biochemical assay, and histological examination. Then, a liquid chromatography-tandem mass spectrometry method was developed and validated to investigate the time-course change and distribution of strychnine and brucine (two main SAs) in the brain after oral SA administration with or without TGP pretreatment. Biochemical analysis results indicated that TGP could ameliorate the oxidative stress status caused by SAs. Time-course change and distribution studies demonstrated that strychnine and brucine were rapidly absorbed into the brain, peaked early at 0.5 h, and were mainly located in the hippocampus and cerebellum. TGP showed a pre-protective effect against neurotoxicity by reducing the absorption of toxic alkaloids into the brain. These findings could provide beneficial information in facilitating future studies of Semen Strychni neurotoxicity and developing herbal medicines to alleviate neurotoxicity in the clinic.
Directory of Open Access Journals (Sweden)
Shujuan Li
2018-04-01
Full Text Available Strychnos alkaloids (SAs are the main toxic constituents in Semen Strychni, a traditional Chinese medicine, which is known for its fatal neurotoxicity. Hence, the present study was carried out to evaluate the neurotoxicity induced by SAs and the pre-protective effects of the total glucosides of Paeoniae Radix Alba (TGP. An SA brain damage model was firstly established. The neurotoxicity induced by SAs and the pre-protective effects of TGP were confirmed by physical and behavioral testing, biochemical assay, and histological examination. Then, a liquid chromatography-tandem mass spectrometry method was developed and validated to investigate the time-course change and distribution of strychnine and brucine (two main SAs in the brain after oral SA administration with or without TGP pretreatment. Biochemical analysis results indicated that TGP could ameliorate the oxidative stress status caused by SAs. Time-course change and distribution studies demonstrated that strychnine and brucine were rapidly absorbed into the brain, peaked early at 0.5 h, and were mainly located in the hippocampus and cerebellum. TGP showed a pre-protective effect against neurotoxicity by reducing the absorption of toxic alkaloids into the brain. These findings could provide beneficial information in facilitating future studies of Semen Strychni neurotoxicity and developing herbal medicines to alleviate neurotoxicity in the clinic.
Fast neutron spectrometer with pulse shape discrimination
International Nuclear Information System (INIS)
Verbitsky, S.S.
1978-01-01
A fast neutron spectrometer with a stilbene single crystal designed to operate at high pulsed count rate has been described. Making use of identification and rejection of events, accompanied by pile-up, allowed to increase permissible count rates by an order of magnitude. The results of energy dependence of signal amplitude and shape relative anisotropy in stilbene in the range 4-10 and 2-8 MeV respectively have been presented. Taking into account anisotropy of the detector-scintillation properties allowed to improve particle discrimination. (Auth.)
Graphene oxide catalyzed cis-trans isomerization of azobenzene
Directory of Open Access Journals (Sweden)
Dongha Shin
2014-09-01
Full Text Available We report the fast cis-trans isomerization of an amine-substituted azobenzene catalyzed by graphene oxide (GO, where the amine functionality facilitates the charge transfer from azobenzene to graphene oxide in contrast to non-substituted azobenzene. This catalytic effect was not observed in stilbene analogues, which strongly supports the existence of different isomerization pathways between azobenzene and stilbene. The graphene oxide catalyzed isomerization is expected to be useful as a new photoisomerization based sensing platform complementary to GO-based fluorescence quenching methods.
Chen, Tao; Li, Hongmei; Zou, Denglang; Liu, Yongling; Chen, Chen; Zhou, Guoying; Li, Yulin
2016-08-01
Anthraquinone glycosides, such as chrysophanol 1-O-β-d-glucoside, chrysophanol 8-O-β-d-glucoside, and physion 8-O-β-d-glucoside, are the accepted important active components of Rheum tanguticum Maxim. ex Balf. due to their pharmacological properties: antifungal, antimicrobial, cytotoxic, and antioxidant activities. However, an effective method for the separation of the above-mentioned anthraquinone glycosides from this herb is not currently available. Especially, greater difficulty existed in the separation of the two isomers chrysophanol 1-O-β-d-glucoside and chrysophanol 8-O-β-d-glucoside. This study demonstrated an efficient strategy based on preparative high-performance liquid chromatography and high-speed countercurrent chromatography for the separation of the above-mentioned anthraquinone glycosides from Rheum tanguticum Maxim.ex Balf. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Li Huang
2016-09-01
Full Text Available Stilbene synthase (STS is a key gene in the biosynthesis of various stilbenoids, including resveratrol and its derivative glucosides (such as piceid, that has been shown to contribute to disease resistance in plants. However, the mechanism behind such a role has yet to be elucidated. Furthermore, the function of STS genes in osmotic stress tolerance remains unclear. As such, we sought to elucidate the role of STS genes in the defense against biotic and abiotic stress in the model plant Arabidopsis thaliana. Expression profiling of 31 VqSTS genes from Vitis quinquangularis revealed that VqSTS21 was up-regulated in response to powdery mildew (PM infection. To provide a deeper understanding of the function of this gene, we cloned the full-length coding sequence of VqSTS21 and overexpressed it in Arabidopsis thaliana via Agrobacterium-mediated transformation. The resulting VqSTS21 Arabidopsis lines produced trans-piceid rather than resveratrol as their main stilbenoid product and exhibited improved disease resistance to PM and Pseudomonas syringae pv. tomato DC3000, but displayed increased susceptibility to Botrytis cinerea. In addition, transgenic Arabidopsis lines were found to confer tolerance to salt and drought stress from seed germination through plant maturity. Intriguingly, qPCR assays of defense-related genes involved in salicylic acid, jasmonic acid, and abscisic acid-induced signaling pathways in these transgenic lines suggested that VqSTS21 plays a role in various phytohormone-related pathways, providing insight into the mechanism behind VqSTS21-mediated resistance to biotic and abiotic stress.
Beelders, Theresa; de Beer, Dalene; Joubert, Elizabeth
2015-06-10
Degradation of the major benzophenones, iriflophenone-3-C-glucoside-4-O-glucoside and iriflophenone-3-C-glucoside, and the major xanthones, mangiferin and isomangiferin, of Cyclopia genistoides followed first-order reaction kinetics during high-temperature oxidation of the plant material at 80 and 90 °C. Iriflophenone-3-C-glucoside-4-O-glucoside was shown to be the most thermally stable compound. Isomangiferin was the second most stable compound at 80 °C, while its degradation rate constant was influenced the most by increased temperature. Mangiferin and iriflophenone-3-C-glucoside had comparable degradation rate constants at 80 °C. The thermal degradation kinetic model was subsequently evaluated by subjecting different batches of plant material to oxidative conditions (90 °C/16 h). The model accurately predicted the individual contents of three of the compounds in aqueous extracts prepared from oxidized plant material. The impact of benzophenone and xanthone degradation was reflected in the decreased total antioxidant capacity of the aqueous extracts, as determined using the oxygen radical absorbance capacity and DPPH(•) scavenging assays.
Morimoto, Kinuyo; Satake, Honoo
2013-01-01
Lignans of Forsythia spp. are essential components of various Chinese medicines and health diets. However, the seasonal alteration in lignan amounts and the gene expression profile of lignan-biosynthetic enzymes has yet to be investigated. In this study, we have assessed seasonal alteration in amounts of major lignans, such as pinoresinol, matairesinol, and arctigenin, and examined the gene expression profile of pinoresinol/lariciresinol reductase (PLR), pinoresinol-glucosylating enzyme (UGT71A18), and secoisolariciresinol dehydrogenase (SIRD) in the leaf of Forsythia suspense from April to November. All of the lignans in the leaf continuously increased from April to June, reached the maximal level in June, and then decreased. Ninety percent of pinoresinol and matairesinol was converted into glucosides, while approximately 50% of arctigenin was aglycone. PLR was stably expressed from April to August, whereas the PLR expression was not detected from September to November. In contrast, the UGT71A18 expression was found from August to November, but not from April to July. The SIRD expression was prominent from April to May, not detected in June to July, and then increased again from September to November. These expression profiles of the lignan-synthetic enzymes are largely compatible with the alteration in lignan contents. Furthermore, such seasonal lignan profiles are in good agreement with the fact that the Forsythia leaves for Chinese medicinal tea are harvested in June. This is the first report on seasonal alteration in lignans and the relevant biosynthetic enzyme genes in the leaf of Forsythia species.
Chen, Zhu; Li, Xiang-Pei; Li, Zhi-Jun; Xu, Liang; Li, Xiao-Mei
2013-03-01
Combination use of methotrexate (MTX) and leflunomide (LEF) has been proved effective in the treatment of active rheumatoid arthritis (RA). However, previous trials have documented that both are associated with increased incidence of liver toxicity. As active compounds extracted from the roots of the traditional Chinese herb Paeonia lactiflora Pall, total glucosides of paeony (TGP) have been shown to have anti-inflammatory, hepatoprotective and immuno-regulatory activities, without evident toxicity or side effects. In this 24-week, open label, randomized multicenter clinical trial, we investigated the efficacy of TGP and the protective effect on hepatotoxicity in the combination treatment with LEF and MTX for patients with active RA. A total of 204 patients with active RA (DAS28>3.2) recruited from 3 regional referral centers were enrolled and received MTX and LEF combination therapy (MTX 10 mg/week plus LEF 20 mg/day) with or without TGP for up to 24 weeks by randomization. Hepatotoxicity was defined as an increase of at least 1.5-fold the upper limits of normal (ULN) of alanine aminotransferase (ALT) or aspartate aminotransferase (AST). Significantly less frequent hepatotoxicity was observed in patients with TGP than those without (9.5% vs 34.8%, p 1.5 to ≤2 times and >2 to ≤3 times the ULN were lower in TGP group than the control (1.9% vs 10.1%, 2.9% vs 12.4%, p TGP group achieved a European League Against Rheumatism (EULAR) good response or moderate response at 12 weeks, although there is no statistical significance. Similar results were observed at 24 weeks. Our preliminary study demonstrates the hepatoprotective and additive role of TGP in combination with MTX and LEF in the treatment of active RA. Copyright © 2013 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Fischbach, R.J.; Kossmann, B.; Panten, H.; Steinbrecher, R.; Heller, W.; Seidlitz, H.K.; Sandermann, H.; Hertkorn, N.; Schnitzler, J.P.
1999-01-01
Conifer needles are highly effective in screening ultraviolet-B radiation (280–320 nm). This ability is mainly attributed to the presence of flavonoids and hydroxycinnamic acids in the epidermal tissue. In two field cabinet experiments with two different clones of Norway spruce we assessed the seasonal accumulation of UV-B screening pigments under near-ambient, and close-to-zero UV-B irradiation. At the beginning of needle development, i.e. in June, kaempferol 3-O-glucoside was the dominant UV-B screening pigment. It was replaced during needle differentiation by the more effective diacylated flavonol glucosides, particulary kaempferol 3-O-(3 , 6 - O-di-p-coumaroyl)-glucoside, which reached highest concentrations in July. In addition to the soluble pool of diacylated flavonol glucoside derivatives, a cell wall-bound UV-B screen in the epidermal cell walls was formed during needle differentiation, consisting mainly of p-coumaric acid and kaempferol 3-O-glucoside. An effect of UV-B radiation on the accumulation of diacylated flavonol glucosides was only observed in 1996 with clone 2, when the concentrations of kaempferol 3-O-(3 , 6 - O-di-p-coumaroyl)-glucoside were significantly higher in July and August under field, and near-ambient than under close-to-zero UV-B irradiance. For wall-bound p-coumaric acid and kaempferol 3-O-glucoside UV-B radiation enhanced the concentrations of these compounds by approximately 20% in relation to the concentrations in close-to-zero UV-B-treated plants in both field cabinet experiments. (author)
Zhu, Yang; Morisato, Kei; Hasegawa, George; Moitra, Nirmalya; Kiyomura, Tsutomu; Kurata, Hiroki; Kanamori, Kazuyoshi; Nakanishi, Kazuki
2015-08-01
The optimization of a porous structure to ensure good separation performances is always a significant issue in high-performance liquid chromatography column design. Recently we reported the homogeneous embedment of Ag nanoparticles in periodic mesoporous silica monolith and the application of such Ag nanoparticles embedded silica monolith for the high-performance liquid chromatography separation of polyaromatic hydrocarbons. However, the separation performance remains to be improved and the retention mechanism as compared with the Ag ion high-performance liquid chromatography technique still needs to be clarified. In this research, Ag nanoparticles were introduced into a macro/mesoporous silica monolith with optimized pore parameters for high-performance liquid chromatography separations. Baseline separation of benzene, naphthalene, anthracene, and pyrene was achieved with the theoretical plate number for analyte naphthalene as 36,000 m(-1). Its separation function was further extended to cis/trans isomers of aromatic compounds where cis/trans stilbenes were chosen as a benchmark. Good separation of cis/trans-stilbene with separation factor as 7 and theoretical plate number as 76,000 m(-1) for cis-stilbene was obtained. The trans isomer, however, is retained more strongly, which contradicts the long- established retention rule of Ag ion chromatography. Such behavior of Ag nanoparticles embedded in a silica column can be attributed to the differences in the molecular geometric configuration of cis/trans stilbenes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Neutron spectrometry with organic scintillation detector
International Nuclear Information System (INIS)
Butragueno Casado, J. L.
1972-01-01
This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D 2 (d,n)He 3 , and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs
Energy Technology Data Exchange (ETDEWEB)
Butragueno Casdo, J L
1972-07-01
This work describes a fast neutron spectrometer using a stilbene crystal as head detector with pulse shape discrimination (P.S.D.) to reject gamma background. Tre experimental procedure involves the P.S.D., the measurements to calibrate the spectrometer and the corrections for several factors, mainly the non-linear response of the stilbene. Results of the measurements with the reaction D{sup 2}(d,n)He{sup 3}, and with an Am-Be neutron source are presented. It is also presented the measurement of the spectrum of the fast reactor CCRAl-1. (Author) 17 refs.
Mangiferin: a natural miracle bioactive compound against lifestyle related disorders
Imran, Muhammad; Arshad, Muhammad Sajid; Butt, Masood Sadiq; Kwon, Joong-Ho; Arshad, Muhammad Umair; Sultan, Muhammad Tauseef
2017-01-01
The current review article is an attempt to explain the therapeutic potential of mangiferin, a bioactive compound of the mango, against lifestyle-related disorders. Mangiferin (2-?-D-glucopyranosyl-1,3,6,7-tetrahydroxy-9H-xanthen-9-one) can be isolated from higher plants as well as the mango fruit and their byproducts (i.e. peel, seed, and kernel). It possesses several health endorsing properties such as antioxidant, antimicrobial, antidiabetic, antiallergic, anticancer, hypocholesterolemic, ...
Directory of Open Access Journals (Sweden)
Kei Shimoda
2010-01-01
Full Text Available Fluorophenols are used as agrochemicals and released into environment as pollutants. Cultured marine microalga Amphidinium crassum ( Gymnodinium glucosylated 2-fluorophenol ( 1 , 3-fluorophenol ( 2 , and 4-fluorophenol ( 3 to the corresponding β-D-glucosides, ie, 2-fluorophenyl β-D-glucoside ( 4 , 60 μg/g cells, 3-fluorophenyl β-D-glucoside ( 5 , 20 μg/g cells, and 4-fluorophenyl β-D-glucoside ( 6 , 40 μg/g cells. On the other hand, 2-, 3-, and 4-fluorophenols were efficiently converted by immobilized A. crassum in sodium alginate gel to give their β-D-glucosides in higher yields ( 4 : 140 μg/g cells; 5 : 60 μg/g cells; 6 : 100 μg/g cells. In repetitive batch use, the immobilized cells of A. crassum maintained the potential for the glucosylation of the substrate fluorophenol after 5 times of usage.
Rouvrais, Céline; Bacqueville, Daniel; Bogdanowicz, Patrick; Haure, Marie-José; Duprat, Laure; Coutanceau, Christine; Castex-Rizzi, Nathalie; Duplan, Hélène; Mengeaud, Valérie; Bessou-Touya, Sandrine
2017-01-01
Natural aging of skin tissues, the addition of the cumulative action of the time and radiation exposure result in skin atrophy, wrinkles and degeneration of the extracellular matrix (ECM). The aim of the study was to investigate the beneficial effect of a combination containing retinaldehyde (RAL), delta-tocopherol glucoside (delta-TC) and glycylglycine ole-amide (GGO) and of a dermocosmetic containing the combination. The protective effect of the combination was assessed through in vitro gene expression of ultraviolet (UV)-irradiated fibroblasts. A skin aging assay using UV light on ex vivo skin samples and a clinical study conducted in 36 women aged from 35 to 55 years with a minimum of level 4 to a maximum of level 6 on the crow's feet photoscale assessed the antiaging effect of the dermocosmetic. When added to UV-irradiated fibroblasts, the combination substantially improved the ECM in activating the elastin fiber production ( fibrillin 2 , fibulin 1 and 5 and lysyl oxidase-like 2 ) as well as that of proteins involved in the cellular ECM interactions ( integrin b1 , paxillin and actin a2 ). An ex vivo photodamaged human skin model showed that the dermocosmetic formulation containing the combination of the active ingredients protected the elastic network against UV-induced alterations including both elastin and fibrillin-rich fibers in the dermis. A daily application of the dermocosmetic for 2 months on naturally aged skin resulted in a statistically significant improvement ( p care of naturally aged skin in women aged 35-55 years.
Wu, G-L; Pu, X-H; Yu, G-Y; Li, T-Y
2015-01-01
The aim of this study was to observe the effects of total glucosides of peony (TGP) on pathological change, Aquaporin-5 (AQP-5) and its mRNA expression in submandibular glands of non-obese diabetic (NOD) mice with Sjogren's Syndrome, to investigate its regulation on secretion of salivary glands. 40 NOD mice were randomly divided into model group, TGP group, hydroxychloroquine group, combination group (n = 10). For TGP group, the mice were intragastrically administrated with 0.4 ml TGP dilution per day in accordance with 300 g/kg dose; for hydroxychloroquine group, the mice were intragastrically administrated with 0.4 ml hydroxychloroquine per day in accordance with 60 mg/kg dose; for the combination group, the mice were intragastrically administrated with 0.4 ml TGP dilution and 0.4 ml hydroxychloroquine. 8 weeks later, the mice were sacrificed, and submandibular glands were collected by anatomy. Pathological changes of submandibular gland were observed under a light microscope; AQP-5 protein in submandibular glands was detected by immunohistochemical staining; and AQP-5 mRNA expression in submandibular glands was detected by RT-PCR. The lymphocytic infiltration score of model mice was significantly higher than that of other groups. The pathological morphology and score of NOD mice were significantly improved after administration, and the combination group was superior to the hydroxychloroquine group and TGP group (p TGP group and the combination group were higher than the hydroxychloroquine group (p TGP may improve pathological damage of submandibular glands of NOD mouse with Sjogren's syndrome by upregulating AQP-5 and its mRNA expression in submandibular glands.
Directory of Open Access Journals (Sweden)
Hiroki Hamada
2010-07-01
Full Text Available The production of β-maltooligosaccharides of glycitein and daidzein using Lactobacillus delbrueckii and cyclodextrin glucanotransferase (CGTase as biocatalysts was investigated. The cells of L. delbrueckii glucosylated glycitein and daidzein to give their corresponding 4'- and 7-O-β-glucosides. The β-glucosides of glycitein and daidzein were converted into the corresponding β-maltooligosides by CGTase. The 7-O-β-glucosides of glycitein and daidzein and 7-O-β-maltoside of glycitein showed inhibitory effects on IgE antibody production. On the other hand, β-glucosides of glycitein and daidzein exerted 2,2-diphenyl-1-picrylhydrazyl (DPPH free-radical scavenging activity and supeoxide-radical scavenging activity.
DuPont, M S; Mondin, Z; Williamson, G; Price, K R
2000-09-01
Eight varieties of lettuce (Lactuca sativum) and three varieties of endive (Cichorium endivia) were analyzed for flavonoid composition and content. Total flavonoid contents, expressed as units of aglycon for fresh material, were in the ranges of 0.3-229 microg/g for lettuce and 44-248 microg/g for endive. Five quercetin conjugates [quercetin 3-O-galactoside, quercetin 3-O-glucoside, quercetin 3-O-glucuronide, quercetin 3-O-(6-O-malonyl)glucoside, and quercetin 3-O-rhamnoside] and luteolin 7-O-glucuronide were measured in the green-leafed lettuce and an additional two cyanidin conjugates [cyanidin 3-O-glucoside and cyanidin 3-O-[(6-O-malonyl)glucoside
Cyanogenesis in Arthropods: From Chemical Warfare to Nuptial Gifts
Directory of Open Access Journals (Sweden)
Mika Zagrobelny
2018-05-01
Full Text Available Chemical defences are key components in insect–plant interactions, as insects continuously learn to overcome plant defence systems by, e.g., detoxification, excretion or sequestration. Cyanogenic glucosides are natural products widespread in the plant kingdom, and also known to be present in arthropods. They are stabilised by a glucoside linkage, which is hydrolysed by the action of β-glucosidase enzymes, resulting in the release of toxic hydrogen cyanide and deterrent aldehydes or ketones. Such a binary system of components that are chemically inert when spatially separated provides an immediate defence against predators that cause tissue damage. Further roles in nitrogen metabolism and inter- and intraspecific communication has also been suggested for cyanogenic glucosides. In arthropods, cyanogenic glucosides are found in millipedes, centipedes, mites, beetles and bugs, and particularly within butterflies and moths. Cyanogenic glucosides may be even more widespread since many arthropod taxa have not yet been analysed for the presence of this class of natural products. In many instances, arthropods sequester cyanogenic glucosides or their precursors from food plants, thereby avoiding the demand for de novo biosynthesis and minimising the energy spent for defence. Nevertheless, several species of butterflies, moths and millipedes have been shown to biosynthesise cyanogenic glucosides de novo, and even more species have been hypothesised to do so. As for higher plant species, the specific steps in the pathway is catalysed by three enzymes, two cytochromes P450, a glycosyl transferase, and a general P450 oxidoreductase providing electrons to the P450s. The pathway for biosynthesis of cyanogenic glucosides in arthropods has most likely been assembled by recruitment of enzymes, which could most easily be adapted to acquire the required catalytic properties for manufacturing these compounds. The scattered phylogenetic distribution of cyanogenic
Hybrid metal organic scintillator materials system and particle detector
Bauer, Christina A.; Allendorf, Mark D.; Doty, F. Patrick; Simmons, Blake A.
2011-07-26
We describe the preparation and characterization of two zinc hybrid luminescent structures based on the flexible and emissive linker molecule, trans-(4-R,4'-R') stilbene, where R and R' are mono- or poly-coordinating groups, which retain their luminescence within these solid materials. For example, reaction of trans-4,4'-stilbenedicarboxylic acid and zinc nitrate in the solvent dimethylformamide (DMF) yielded a dense 2-D network featuring zinc in both octahedral and tetrahedral coordination environments connected by trans-stilbene links. Similar reaction in diethylformamide (DEF) at higher temperatures resulted in a porous, 3-D framework structure consisting of two interpenetrating cubic lattices, each featuring basic to zinc carboxylate vertices joined by trans-stilbene, analogous to the isoreticular MOF (IRMOF) series. We demonstrate that the optical properties of both embodiments correlate directly with the local ligand environments observed in the crystal structures. We further demonstrate that these materials produce high luminescent response to proton radiation and high radiation tolerance relative to prior scintillators. These features can be used to create sophisticated scintillating detection sensors.
Pozzesi, N; Pierangeli, S; Vacca, C; Falchi, L; Pettorossi, V; Martelli, M P; Thuy, T T; Ninh, P T; Liberati, A M; Riccardi, C; Sung, T V; Delfino, D V
2011-06-01
The leaves of Artocarpus tonkinensis are used in Vietnamese traditional medicine for treatment of arthritis, and the compound maesopsin 4-O-β-D-glucoside (TAT-2), isolated from them, inhibits the proliferation of activated T cells. Our goal was to test the anti-proliferative activity of TAT-2 on the T-cell leukemia, Jurkat, and on the acute myeloid leukemia, OCI-AML. TAT-2 inhibited the growth of OCI-AML (and additional acute myeloid leukemia cells) but not Jurkat cells. Growth inhibition was shown to be due to inhibition of proliferation rather than increase in cell death. Analysis of cytokine release showed that TAT-2 stimulated the release of TGF-β, yet TGF-β neutralization did not reverse the maesopsin-dependent effect. Gene expression profiling determined that maesopsin modulated 19 identifiable genes. Transcription factor CP2 was the gene most significantly modulated. Real-time PCR validated that up-regulation of sulphiredoxin 1 homolog (SRXN1), hemeoxygenase 1 (HMOX1), and breast carcinoma amplified sequence 3 (BCAS3) were consistently modulated.
Directory of Open Access Journals (Sweden)
Zhitao Feng
2016-01-01
Full Text Available Objective. To evaluate the efficacy and safety of the total glucosides of peony (TGP and leflunomide (LEF for the treatment of rheumatoid arthritis (RA. Methods. Randomized controlled trials (RCTs on the efficacy and safety of the combination of TGP and LEF versus LEF alone for the treatment of RA were retrieved by searching PubMed, EMBASE, Cochrane Library, the China National Knowledge Infrastructure database, and Wanfang database. Results. Eight RCTs including 643 RA patients were included in the present meta-analysis. The quality of included studies was poor. The levels of ESR (P<0.0001, CRP (P<0.0001, and RF (P<0.0001 in RA patients who received the combination of TGP and LEF were significantly lower than RA patients who received LEF therapy alone. The pooled results suggest that the combination of TGP and LEF caused less abnormal liver function than LEF alone (P=0.02. No significant difference in the gastrointestinal discomfort was identified between the combination of TGP and LEF and LEF alone groups (P=0.18. Conclusion. The combination of TGP and LEF in treatment of RA presented the characteristics of notably decreasing the levels of laboratory indexes and higher safety in terms of liver function. However, this conclusion should be further investigated based on a larger sample size.
The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme
Diaz-Sanchez, V.; F. Estrada, A.; Limon, M. C.; Al-Babili, Salim; Avalos, J.
2013-01-01
The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.
The Oxygenase CAO-1 of Neurospora crassa Is a Resveratrol Cleavage Enzyme
Diaz-Sanchez, V.
2013-07-26
The genome of the ascomycete Neurospora crassa encodes CAO-1 and CAO-2, two members of the carotenoid cleavage oxygenase family that target double bonds in different substrates. Previous studies demonstrated the role of CAO-2 in cleaving the C40 carotene torulene, a key step in the synthesis of the C35 apocarotenoid pigment neurosporaxanthin. In this work, we investigated the activity of CAO-1, assuming that it may provide retinal, the chromophore of the NOP-1 rhodopsin, by cleaving β-carotene. For this purpose, we tested CAO-1 activity with carotenoid substrates that were, however, not converted. In contrast and consistent with its sequence similarity to family members that act on stilbenes, CAO-1 cleaved the interphenyl Cα-Cβ double bond of resveratrol and its derivative piceatannol. CAO-1 did not convert five other similar stilbenes, indicating a requirement for a minimal number of unmodified hydroxyl groups in the stilbene background. Confirming its biological function in converting stilbenes, adding resveratrol led to a pronounced increase in cao-1 mRNA levels, while light, a key regulator of carotenoid metabolism, did not alter them. Targeted Δcao-1 mutants were not impaired by the presence of resveratrol, a phytoalexin active against different fungi, which did not significantly affect the growth and development of wild-type Neurospora. However, under partial sorbose toxicity, the Δcao-1 colonies exhibited faster radial growth than control strains in the presence of resveratrol, suggesting a moderate toxic effect of resveratrol cleavage products.
Directory of Open Access Journals (Sweden)
Ali Liazid
2014-12-01
Full Text Available The stability of anthocyanins from grape skins after applying different extraction techniques has been determined. The following compounds, previously extracted from real samples, were assessed: delphinidin 3-glucoside, cyanidin 3-glucoside, petunidin 3-glucoside, peonidin 3-glucoside, malvidin 3-glucoside, peonidin 3-acetylglucoside, malvidin 3-acetylglucoside, malvidin 3-caffeoylglucoside, petunidin 3-p-coumaroylglucoside and malvidin 3-p-coumaroylglucoside (trans. The techniques used were ultrasound-assisted extraction and pressurized liquid extraction. In ultrasound-assisted extraction, temperatures up to 75 °C can be applied without degradation of the aforementioned compounds. In pressurized liquid extraction the anthocyanins were found to be stable up to 100 °C. The relative stabilities of both the glycosidic and acylated forms were evaluated. Acylated derivatives were more stable than non-acylated forms. The differences between the two groups of compounds became more marked on working at higher temperatures and on using extraction techniques with higher levels of oxygen in the extraction media.
Phenolic compounds in external leaves of tronchuda cabbage (Brassica oleracea L. var. costata DC)
Ferreres, F.; Valentão, P.; Llorach, R.; Pinheiro, C.; Cardoso, L.; Pereira, J.A.; Seabra, R.M.; Andrade, P.B.
2005-01-01
Glycosylated kaempferol derivatives from the external leaves of tronchuda cabbage ( Brassica oleracea L. var. costataDC) characterized by reversed-phase HPLC-DAD-MS/MS-ESI were kaempferol 3- Osophorotrioside- 7-O-glucoside, kaempferol 3-O- (methoxycaffeoyl/caffeoyl)sophoroside-7- O-glucoside, kaempferol 3-O-sophoroside-7-O-glucoside, kaempferol 3-O-sophorotrioside-7-O-sophoroside, kaempferol 3- O-sophoroside-7- O-sophoroside, kaempferol 3- O-tetraglucoside-7- O-sophoroside, kaempf...
Metabolism of Zearalenone and Its Major Modified Forms in Pigs
Directory of Open Access Journals (Sweden)
Sabina B. Binder
2017-02-01
Full Text Available The Fusarium mycotoxin zearalenone (ZEN can be conjugated with polar molecules, like sugars or sulfates, by plants and fungi. To date, the fate of these modified forms of ZEN has not yet been elucidated in animals. In order to investigate whether ZEN conjugates contribute to the total ZEN exposure of an individual, ZEN (10 µg/kg b.w. and equimolar amounts of two of its plant metabolites (ZEN-14-O-β-glucoside, ZEN-16-O-β-glucoside and of one fungal metabolite (ZEN-14-sulfate were orally administered to four pigs as a single bolus using a repeated measures design. The concentrations of ZEN, its modified forms and its mammalian metabolites ZEN-14-glucuronide, α-zearalenol (α-ZEL and α-ZEL-14-glucuronide in excreta were analyzed by high-performance liquid chromatography tandem mass spectrometry (HPLC-MS/MS based methods. The biological recovery of ZEN in urine was 26% ± 10%, the total biological recovery in excreta was 40% ± 8%. Intact ZEN-14-sulfate, ZEN-14-O-β-glucoside and ZEN-16-O-β-glucoside were neither detected in urine nor in feces. After ZEN-14-sulfate application, 19% ± 5% of the administered dose was recovered in urine. In feces, no ZEN metabolites were detected. The total biological recoveries of ZEN-14-O-β-glucoside and ZEN-16-O-β-glucoside in the form of their metabolites in urine were 19% ± 11% and 13% ± 7%, respectively. The total biological recoveries in urine and feces amounted to 48% ± 7% and 34 ± 3%. An explanation for the low biological recoveries could be extensive metabolization by intestinal bacteria to yet unknown metabolites. In summary, ZEN-14-sulfate, ZEN-14-O-β-glucoside, and ZEN-16-O-β-glucoside were completely hydrolyzed in the gastrointestinal tract of swine, thus contributing to the overall toxicity of ZEN.
The Complexity of Bioactive Natural Products in Plants
DEFF Research Database (Denmark)
Frisch, Tina
Plants produce a diverse range of bioactive natural products promoting their fitness. These specialized metabolites may serve as chemical defence against herbivores and pathogens and may inhibit the growth and development of competing species. Hydroxynitrile glucosides and glucosinolates are two...... classes of defence compounds, which have diverging properties, but also share common biosynthetic features. Hydroxynitrile glucosides are produced in species across the plant kingdom, whereas glucosinolates are found almost exclusively within the Brassicales, which generally does not contain...... hydroxynitrile glucosides. This division has raised questions regarding possible evolutionary relationships between the biosynthetic pathways. The very rare co-occurrence of hydroxynitrile glucosides and glucosinolates found in Alliaria petiolata (garlic mustard, løgkarse) and Carica papaya (papaya) makes...
Directory of Open Access Journals (Sweden)
Weihua Liu
Full Text Available Overexpressed Human epidermal growth factor receptor 2 (HER2 drives the biology of 20% breast cancer and is a prediction of a poor prognosis for patients. HER2-targeted therapies significantly improve outcomes for HER2-positive patients. Traditional Chinese herbs/medicines have been used to treat breast cancer patients including HER2-positive patients in Asia for decades. Although the traditional medicines demonstrate efficacy in clinics for HER2-positive patients, the mechanism is largely unknown. In this article, we screened a 10,000 natural product library in 6 different cell lines representing breast cancer, and assessed the ability of each drug to cause cytotoxicity through a high-throughput screening approach. We have identified eight natural compounds that selectively inhibit the proliferation of HER2-positive cells. Two of the hit compounds, peonidin-3-glucoside and cyaniding-3-glucoside, are both extracts from black rice. They inhibit the phospho-HER2 and phospho-AKT and were confirmed to induce HER2-psotive breast cancer cells apoptosis both in vitro and in vivo. Peonidin-3-glucoside and cyaniding-3-glucoside treatments significantly reduced the tumor size and volume in vivo compared to the control group. There is no significant difference of antitumorgenic effects between peonidin-3-glucoside and cyaniding-3-glucoside treatments.
Jia, Xiao-Yi; Chang, Yan; Sun, Xiao-Jing; Wu, Hua-Xun; Wang, Chun; Xu, Hong-Mei; Zhang, Lei; Zhang, Ling-Ling; Zheng, Yong-Qiu; Song, Li-Hua; Wei, Wei
2014-01-01
The aim of this study was to investigate the expression of G proteins in fibroblast-like synoviocytes (FLSs) from rats with collagen-induced arthritis (CIA) and to determine the effect of total glucosides of paeony (TGP). CIA rats were induced with chicken type II collagen (CCII) in Freund's complete adjuvant. The rats with experimental arthritis were randomly separated into five groups and then treated with TGP (25, 50, and 100mg/kg) from days 14 to 35 after immunization. The secondary inflammatory reactions were evaluated through the polyarthritis index and histopathological changes. The level of cyclic adenosine monophosphate (cAMP) was measured by radioimmunoassay. The FLS proliferation response was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The toxin-catalyzed ADP-ribosylation of G proteins was performed through autoradiography. The results show that TGP (25, 50, and 100mg/kg) significantly decreased the arthritis scores of CIA rats and improved the histopathological changes. TGP inhibited the proliferation of FLSs and increased the level of cAMP. Moreover, the FLS proliferation and the level of Gαi expression were significantly increased, but the level of Gαs expression was decreased after stimulation with IL-1β (10ng/ml) in vitro. TGP (12.5 and 62.5μg/ml) significantly inhibited the FLS proliferation and regulated the balance between Gαi and Gαs. These results demonstrate that TGP may exert its anti-inflammatory effects through the suppression of FLS proliferation, which may be associated with its ability to regulate the balance of G proteins. Thus, TGP may have potential as a therapeutic agent for the treatment of rheumatoid arthritis. © 2013.
Huang, Xue-Tao; Wang, Bin; Zhang, Wen-Hua; Peng, Man-Qiang; Lin, Ding
2018-01-01
Total glucosides of paeony (TGP) are active components extracted from the roots of Paeonia lactiflora Pall. In this study, we investigated the role and mechanisms of TGP in experimental autoimmune uveitis (EAU) model of mice. The C57BL/6 mice were randomly divided into three groups: sham group, EAU-control group, and EAU-TGP group. Clinical score of images of the eye fundus were taken on 7, 14, 21, and 28 days after induction of EAU. The concentrations of proinflammatory cytokines in intraocular fluid were measured at 14 days after EAU induction with the use of a multiplex assay system. Flow cytometry was used to analyze the frequency of CD4+, CD8+, interferon-gamma (IFN-γ), and CD4+/CD8+ ratio in spleen and lymph nodes. Western blotting was used to measure expressions of mitogen-activated protein kinase (MAPK) pathway-related proteins in retina. Clinical scores for uveitis were lower in TGP-treated EAU mice than those without TGP treatment. Importantly, the concentrations of cytokines induced by T-helper 1 (Th1) and T-helper 2 (Th2) cells in intraocular fluid were reduced in EAU mice treated with TGP. Furthermore, the frequency of CD4+, IFN-γ, and CD4+/CD8+ ratio was decreased and the frequency of CD8+ was increased in spleen and lymph nodes of mice treated with TGP. The anti-inflammatory effects of TGP were mediated by inhibiting the MAPK signaling pathways. Our results showed that TGP suppressed uveitis in mice via the inhibition of Th1 and Th2 cell function. Thus, TGP may be a promising therapeutic strategy for uveitis, as well as other ocular inflammatory diseases.
Diversified glucosinolate metabolism
DEFF Research Database (Denmark)
Frisch, Tina; Motawie, Mohammed Saddik; Olsen, Carl Erik
2015-01-01
glucosides in A. petiolata. However, we detected hydrogen cyanide (HCN) release from sinigrin and added thiocyanate ion and benzyl thiocyanate in A. petiolata indicating an enzymatic pathway from glucosinolates via allyl thiocyanate and indole glucosinolate derived thiocyanate ion to HCN. Alliarinoside......Alliaria petiolata (garlic mustard, Brassicaceae) contains the glucosinolate sinigrin as well as alliarinoside, a γ-hydroxynitrile glucoside structurally related to cyanogenic glucosides. Sinigrin may defend this plant against a broad range of enemies, while alliarinoside confers resistance...... to specialized (glucosinolate-adapted) herbivores. Hydroxynitrile glucosides and glucosinolates are two classes of specialized metabolites, which generally do not occur in the same plant species. Administration of [UL-14C]-methionine to excised leaves of A. petiolata showed that both alliarinoside and sinigrin...
Alcalde-Eon, Cristina; Saavedra, Gloria; de Pascual-Teresa, Sonia; Rivas-Gonzalo, Julián C
2004-10-29
High-performance liquid chromatography (HPLC)-diode array detection (DAD)-mass spectrometry (MS) techniques have been successfully employed in the identification of the anthocyanins of the coloured tubers of isla oca (Oxalis tuberosa), the second most cultivated tuber in the Andean region. Tubers underwent a pre-treatment step in order to inhibit enzymatic reactions and to obtain a stable powder or "concentrate". This concentrate was dissolved, purified and then analysed. Eight different compounds were found. The major peaks were malvidin glucosides (malvidin 3-O-glucoside and 3,5-O-diglucoside). The rest of the peaks were 3,5-O-diglucosides of petunidin and peonidin, and 3-O-glucosides of delphinidin, petunidin and peonidin. Only malvidin 3-O-acetylglucoside-5-O-glucoside was found as an acylated anthocyanin.
Photosensitizing anthraquinones from Heterophyllaea lycioides (Rubiaceae).
Dimmer, Jesica A; Núñez Montoya, Susana C; Mendoza, Caterine S; Cabrera, José L
2017-05-01
Seven anthraquinones were isolated from aerial parts of Heterophyllaea lycioides (Rusby) Sandwith (Rubiaceae), including three derivatives that have not been described before: a hetero-bianthraquinone identified as (R)-2-hydroxymethyl-2'methyl-1,1',6,6'-tetrahydroxy-5,5' bianthraquinone (lycionine), and two mono-chlorinated derivatives related to soranjidiol. One of them is a homo-bianthraquinone: (R)-7-chloro-2,2'-dimethyl-1,1',6,6'-tetrahydroxy-5,5' bianthraquinone (7-chlorobisoranjidiol), whereas the second halogenated derivative corresponds to a monomeric structure: 5-chloro-1,6-dihydroxy-2-methyl anthraquinone (5-chlorosoranjidiol). The four known compounds were already isolated from another species of this genus, H. pustulata, and they were identified as 5,5'-bisoranjidiol, soranjidiol, pustuline and heterophylline. Structural elucidation was performed by means of an extensive spectroscopic analysis, including 1D and 2D NMR data as well as by HRMS analysis. Chemical structures of 7-chlorobisoranjidiol and 5-chlorosoranjidiol were confirmed by their synthesis from 5,5'-bisoranjidiol and soranjidiol, respectively. Type I photosensitizing properties (superoxide anion radical generation, O 2 - ) were assessed by using the nitroblue tetrazolium assay. When lycionine and chlorinated derivatives were irradiated, they enhanced the O 2 - production with respect to the control; 7-chlorobisoranjidiol stood out by generating an increase of 20%, whereas the other anthraquinones only produced a slight increase of 7%. Copyright © 2017 Elsevier Ltd. All rights reserved.
Inhibitory Effects of Anthocyanins on Secretion of Helicobacter pylori CagA and VacA Toxins
Sa-Hyun Kim, Min Park, Hyunjun Woo, Nagendran Tharmalingam, Gyusang Lee, Ki-Jong Rhee, Yong Bin Eom, Sang Ik Han, Woo Duck Seo, Jong Bae Kim
2012-01-01
Anthocyanins have been studied as potential antimicrobial agents against Helicobacter pylori. We investigated whether the biosynthesis and secretion of cytotoxin-associated protein A (CagA) and vacuolating cytotoxin A (VacA) could be suppressed by anthocyanin treatment in vitro. H. pylori reference strain 60190 (CagA+/VacA+) was used in this study to investigate the inhibitory effects of anthocyanins; cyanidin 3-O-glucoside (C3G), peonidin 3-O-glucoside (Peo3G), pelargonidin 3-O-glucoside (Pe...
The Intracellular Localization of the Vanillin Biosynthetic Machinery in Pods of Vanilla planifolia.
Gallage, Nethaji J; Jørgensen, Kirsten; Janfelt, Christian; Nielsen, Agnieszka J Z; Naake, Thomas; Dunski, Eryk; Dalsten, Lene; Grisoni, Michel; Møller, Birger Lindberg
2018-02-01
Vanillin is the most important flavor compound in the vanilla pod. Vanilla planifolia vanillin synthase (VpVAN) catalyzes the conversion of ferulic acid and ferulic acid glucoside into vanillin and vanillin glucoside, respectively. Desorption electrospray ionization mass spectrometry imaging (DESI-MSI) of vanilla pod sections demonstrates that vanillin glucoside is preferentially localized within the mesocarp and placental laminae whereas vanillin is preferentially localized within the mesocarp. VpVAN is present as the mature form (25 kDa) but, depending on the tissue and isolation procedure, small amounts of the immature unprocessed form (40 kDa) and putative oligomers (50, 75 and 100 kDa) may be observed by immunoblotting using an antibody specific to the C-terminal sequence of VpVAN. The VpVAN protein is localized within chloroplasts and re-differentiated chloroplasts termed phenyloplasts, as monitored during the process of pod development. Isolated chloroplasts were shown to convert [14C]phenylalanine and [14C]cinnamic acid into [14C]vanillin glucoside, indicating that the entire vanillin de novo biosynthetic machinery converting phenylalanine to vanillin glucoside is present in the chloroplast.
Directory of Open Access Journals (Sweden)
Yuan-Ming Sun
2012-05-01
Full Text Available Anthocyanins are naturally occurring polyphenols that impart bright color to fruits, vegetables and plants. In this study, the extraction of anthocyanins from freeze-dried fruit skin of downy rose-myrtle (Rhodomyrtus tomentosa (Ait. Hassk var. Gangren was optimized using response surface methodology (RSM. Using 60% ethanol containing 0.1% (v/v hydrochloric acid as extraction solvent, the optimal conditions for maximum yields of anthocyanin (4.358 ± 0.045 mg/g were 15.7:1 (v/w liquid to solid ratio, 64.38 °C with a 116.88 min extraction time. The results showed good fits with the proposed model for the anthocyanin extraction (R2 = 0.9944. Furthermore, the results of high-performance liquid chromatography-electrospray ionization-mass spectrometry (HPLC-ESI-MS analysis of the anthocyanins extracted from the fruit skin of downy rose-myrtle revealed the presence of five anthocyanin components, which were tentatively identified as delphinidin-3-glucoside, cyanidin-3-glucoside, peonidin-3-glucoside, petunidin-3-glucoside and malvidin-3-glucoside.
Directory of Open Access Journals (Sweden)
Guillaume Marti
2014-09-01
Full Text Available UV-C radiation is known to induce metabolic modifications in plants, particularly to secondary metabolite biosynthesis. To assess these modifications from a global and untargeted perspective, the effects of the UV-C radiation of the leaves of three different model plant species, Cissus antarctica Vent. (Vitaceae, Vitis vinifera L. (Vitaceae and Cannabis sativa L. (Cannabaceae, were evaluated by an LC-HRMS-based metabolomic approach. The approach enabled the detection of significant metabolite modifications in the three species studied. For all species, clear modifications of phenylpropanoid metabolism were detected that led to an increased level of stilbene derivatives. Interestingly, resveratrol and piceid levels were strongly induced by the UV-C treatment of C. antarctica leaves. In contrast, both flavonoids and stilbene polymers were upregulated in UV-C-treated Vitis leaves. In Cannabis, important changes in cinnamic acid amides and stilbene-related compounds were also detected. Overall, our results highlighted phytoalexin induction upon UV-C radiation. To evaluate whether UV-C stress radiation could enhance the biosynthesis of bioactive compounds, the antioxidant activity of extracts from control and UV-C-treated leaves was measured. The results showed increased antioxidant activity in UV-C-treated V. vinifera extracts.
Physical characteristics of tetrahydroxy and acylated derivatives of jojoba liquid wax
Jojoba liquid wax is a mixture of esters of long chain fatty acids and fatty alcohols, mainly (C38:2-C46:2). The oil exhibits excellent emolliency on the skin and therefore is a component in many personal care cosmetic formulations. The virgin oil is a component of the seed of the Jojoba (Simmondsia...
International Nuclear Information System (INIS)
Makarious, A.S.; Maayouf, R.M.A.; Megahid, R.
1978-01-01
Measurements of both angular and energy distributions of secondary gamma resulting from interactions of neutrons emerging from one of the ET-RR-1 reactor beam holes, in barriers from iron, lead and water are reported. The measurements were carried out, both with a bare neutron beam and with the beam being transmitted through a B4C. Filter, using a stilbene crystal gamma spectrometer. The spectrometer applies discrimination between neutrons and gammas according to the difference in decay times of the scintillations produced by them in stilbene. The described angular distributions resulted from measurements made at different angles of neutron incidence and with three different thicknesses of each sample
[Studies on flavone constituents of Erigeron breviscapus (Vant.) Hand.-Mazz].
Zhang, W D; Chen, W S; Wang, Y H; Liu, W Y; Kong, D Y; Li, H T
2000-09-01
To study the chemical constituents of Erigeron breviscapus. The constituents were separated and purified by column chromatography with silica gel, and identified by IR, MS, NMR and physical data. Five compounds were isolated and identified as 3, 5, 6, 4'-tetrahydroxy-7-methoxy flavonoid(I); 5, 7, 4'-trihydroxy flavonoid(II); 3, 5, 6, 7, 4'-pentahydroxy flavonoid(III); scutellarein (IV) and 5, 7, 4'-trihydroxy flavanone(V). Compounds I, III and V were isolated from this plant for the first time.
Chang, Bao-Chao; Chen, Wei-Dong; Zhang, Yan; Yang, Ping; Liu, Lei; Wang, Jing
2014-10-01
The study is to explore the effect of total glucosides of paeony (TGP)on Wnt/β-catenin signal transduction pathway expression in kidney of diabetic rats, and discuss the protection of TGP in diabetic nephropathy and possible mechanism. Ninety male SD rats of 8 weeks age were randomly divided into normal control group (n = 10) and model group (n = 80). Rats of the normal control group were fed with regular diet, while rats of the model group were fed with high-fat high-sugar diet and 4 weeks later were given an intraperitoneal injection of 35 mg x kg(-1) streptozotocin (STZ). The successfully induced type 2 diabetic rat models were then randomly divided into DM group, three TGP (50, 100, 200 mg x kg(-1) x d(-1)) treatment group and tripterygium wilfordii glycosides (8 mg x kg(-1) x d(-1)) control group. Rats of DM group and each treatment group were given high-fat high-sugar diet. At week 14, the levels of blood sugar, 24 hour urine protein, serum creatinine and blood urea nitrogen were tested. The rats were then sacrificed. Renal pathological changes were examined. Renal tissue Wnt-1 and β-catenin expressions were detected by immunohistochemical assay. Wnt-1 mRNA and β-catenin mRNA expression was semi-quantified by RT-PCR. Wnt-1 protein and β-catenin protein expression was semi-quantified by Western blot. The Result show that Wnt-1 and β-catenin expression increased in kidney of high-fat high-sugar induced type 2 diabetic rats. Compared with diabetic group, the level of serum creatinine, blood urea nitrogen, 24 h urine protein, mean glomerular area and mean glomerular volume were decreased, renal histopathology were improved, expression of Wnt-1 and β-catenin mRNA and protein was reduced in TGP group. Tripterygium wilfordii glycosides had the similar effect. In conclusion, these results showed that Wnt/β-catenin abnormal activation in kidney of type 2 diabetic rats, TGP can improve kidney damage in diabetic rats and delay the development of diabetic
Benzoxazolinone detoxification by N-Glucosylation: The multi-compartment-network of Zea mays L.
Schulz, Margot; Filary, Barbara; Kühn, Sabine; Colby, Thomas; Harzen, Anne; Schmidt, Jürgen; Sicker, Dieter; Hennig, Lothar; Hofmann, Diana; Disko, Ulrich; Anders, Nico
2016-01-01
The major detoxification product in maize roots after 24 h benzoxazolin-2(3H)-one (BOA) exposure was identified as glucoside carbamate resulting from rearrangement of BOA-N-glucoside, but the pathway of N-glucosylation, enzymes involved and the site of synthesis were previously unknown. Assaying whole cell proteins revealed the necessity of H2O2 and Fe(2+) ions for glucoside carbamate production. Peroxidase produced BOA radicals are apparently formed within the extraplastic space of the young maize root. Radicals seem to be the preferred substrate for N-glucosylation, either by direct reaction with glucose or, more likely, the N-glucoside is released by glucanase/glucosidase catalyzed hydrolysis from cell wall components harboring fixed BOA. The processes are accompanied by alterations of cell wall polymers. Glucoside carbamate accumulation could be suppressed by the oxireductase inhibitor 2-bromo-4´-nitroacetophenone and by peroxidase inhibitor 2,3-butanedione. Alternatively, activated BOA molecules with an open heterocycle may be produced by microorganisms (e.g., endophyte Fusarium verticillioides) and channeled for enzymatic N-glucosylation. Experiments with transgenic Arabidopsis lines indicate a role of maize glucosyltransferase BX9 in BOA-N-glycosylation. Western blots with BX9 antibody demonstrate the presence of BX9 in the extraplastic space. Proteomic analyses verified a high BOA responsiveness of multiple peroxidases in the apoplast/cell wall. BOA incubations led to shifting, altered abundances and identities of the apoplast and cell wall located peroxidases, glucanases, glucosidases and glutathione transferases (GSTs). GSTs could function as glucoside carbamate transporters. The highly complex, compartment spanning and redox-regulated glucoside carbamate pathway seems to be mainly realized in Poaceae. In maize, carbamate production is independent from benzoxazinone synthesis.
Directory of Open Access Journals (Sweden)
Hisashi Katsuragi
2010-03-01
Full Text Available The enzymatic synthesis of capsaicin glycosides and 8-nordihydrocapsaicin glycosides was investigated using almond β-glucosidase and cyclodextrin glucanotransferase (CGTase. Capsaicin and 8-nordihydrocapsaicin were converted into their β-glucoside and β-maltooligosaccharide (amylose conjugate, i.e. β-maltoside and β-maltotrioside, by sequencial glycosylation with almond β-glucosidase and CGTase. The β-glucoside and β-maltoside of capsaicin and β-glucoside of 8-nordihydrocapsaicin showed inhibitory effects on high-fat-diet-induced elevations in body weight of mice.
Directory of Open Access Journals (Sweden)
Hisashi Katsuragi
2010-01-01
Full Text Available The enzymatic synthesis of capsaicin glycosides and 8-nordihydrocapsaicin glycosides was investigated using almond β-glucosidase and cyclodextrin glucanotransferase (CGTase. Capsaicin and 8-nordihydrocapsaicin were converted into their β-glucoside and β-maltooligosaccharide (amylose conjugate, i.e. β-maltoside and β-maltotrioside, by sequencial glycosylation with almond β-glucosidase and CGTase. The β-glucoside and β-maltoside of capsaicin and β-glucoside of 8-nordihydrocapsaicin showed inhibitory effects on high-fat-diet-induced elevations in body weight of mice.
Watanabe, Takashi; Ito, Tomoharu; Goda, Hatsumi M; Ishibashi, Yohei; Miyamoto, Tomofumi; Ikeda, Kazutaka; Taguchi, Ryo; Okino, Nozomu; Ito, Makoto
2015-01-09
Cryptococcosis is an infectious disease caused by pathogenic fungi, such as Cryptococcus neoformans and Cryptococcus gattii. The ceramide structure (methyl-d18:2/h18:0) of C. neoformans glucosylceramide (GlcCer) is characteristic and strongly related to its pathogenicity. We recently identified endoglycoceramidase-related protein 1 (EGCrP1) as a glucocerebrosidase in C. neoformans and showed that it was involved in the quality control of GlcCer by eliminating immature GlcCer during the synthesis of GlcCer (Ishibashi, Y., Ikeda, K., Sakaguchi, K., Okino, N., Taguchi, R., and Ito, M. (2012) Quality control of fungus-specific glucosylceramide in Cryptococcus neoformans by endoglycoceramidase-related protein 1 (EGCrP1). J. Biol. Chem. 287, 368-381). We herein identified and characterized EGCrP2, a homologue of EGCrP1, as the enzyme responsible for sterylglucoside catabolism in C. neoformans. In contrast to EGCrP1, which is specific to GlcCer, EGCrP2 hydrolyzed various β-glucosides, including GlcCer, cholesteryl-β-glucoside, ergosteryl-β-glucoside, sitosteryl-β-glucoside, and para-nitrophenyl-β-glucoside, but not α-glucosides or β-galactosides, under acidic conditions. Disruption of the EGCrP2 gene (egcrp2) resulted in the accumulation of a glycolipid, the structure of which was determined following purification to ergosteryl-3β-glucoside, a major sterylglucoside in fungi, by mass spectrometric and two-dimensional nuclear magnetic resonance analyses. This glycolipid accumulated in vacuoles and EGCrP2 was detected in vacuole-enriched fraction. These results indicated that EGCrP2 was involved in the catabolism of ergosteryl-β-glucoside in the vacuoles of C. neoformans. Distinct growth arrest, a dysfunction in cell budding, and an abnormal vacuole morphology were detected in the egcrp2-disrupted mutants, suggesting that EGCrP2 may be a promising target for anti-cryptococcal drugs. EGCrP2, classified into glycohydrolase family 5, is the first steryl
Studies on the preparative isolation and stability of seven main anthocyanins from Yan 73 grape.
Tang, Ke; Li, Yang; Han, Yehui; Han, Fuliang; Li, Jiming; Nie, Yao; Xu, Yan
2014-09-01
[corrected] Seven anthocyanin monomers of Yan 73 grape were separated using preparative HPLC and identified by UPLC-ESI-MS/MS. The stabilities of the seven isolated anthocyanins to light, temperature and pH were also investigated. Seven anthocyanin monomers were successfully isolated with an Xbridge Prep C18 column on a preparative scale. The pigments delphinidin-3-O-glucoside, malvidin-3-O-acetylglucoside and malvidin-3-O-coumarylglucoside were yielded in a one-step separation by preparative HPLC, with purities up to 99.9%, 91.7% and 95.5%, respectively. The pigments cyanidin-3-O-glucoside, petunidin-3-O-glucoside, peonidin-3-O-glucoside, and malvidin-3-O-glucoside were further purified with another elution method and their purities were all improved up to 99.9%. Monomeric anthocyanin degradation fitted a first-order reaction model. The seven isolated anthocyanins were significantly more stable in the dark than under light. High temperature was also unfavourable for the stability of anthocyanins. The anthocyanins were more stable at lower pH than at higher pH. In addition, among these anthocyanins, delphinidin-3-O-glucoside, malvidin-3-O-acetylglucoside and malvidin-3-O-coumarylglucoside were more susceptible to light, heat, and pH than the others. A simple and clean isolation method of seven anthocyanin monomers from Yan 73 grape was established. The stabilities of the seven anthocyanin monomers to light, temperature and pH were different, but the trends in changes were similar. © 2014 Society of Chemical Industry.
First evidences of interaction between pyranoanthocyanins and salivary proline-rich proteins.
García-Estévez, Ignacio; Cruz, Luís; Oliveira, Joana; Mateus, Nuno; de Freitas, Victor; Soares, Susana
2017-08-01
The contribution of other classes of polyphenol compounds besides tannins to the overall perception of astringency is still poorly understood. So, this work aimed to study the interaction between a family of salivary proline-rich proteins (aPRPs) and representative pyranoanthocyanins in red wines [pyranomalvidin-3-glucoside (vitisin B), pyranomalvidin-3-glucoside-catechol, and pyranomalvidin-3-glucoside-epicatechin] using saturation transfer difference-NMR and MALDI-TOF. For vitisin B K D was of 1.74mM; for pyranomalvidin-3-glucoside-catechol was 1.17mM and for pyranomalvidin-3-glucoside-epicatechin it was 0.87mM. The presence of the flavanol structural unit in the pyranoanthocyanins led to an increase in their interaction with aPRPs. Further, it is also interesting that the values obtained were in the range of K D obtained previously reported for the interaction between the human saliva proline-rich peptides (IB7 14 and IB9 37 ) and procyanidins. Overall, the results obtained suggest that, along with tannins, other polyphenols present in red wine, namely pyranoanthocyanins, could actively contribute to red wine global astringency. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nam, Seung-Hee; Park, Jeongjin; Jun, Woojin; Kim, Doman; Ko, Jin-A; Abd El-Aty, A M; Choi, Jin Young; Kim, Do-Ik; Yang, Kwang-Yeol
2017-12-22
Gallic acid glycoside was enzymatically synthesized by using dextransucrase and sucrose from gallic acid. After purification by butanol partitioning and preparative HPLC, gallic acid glucoside was detected at m/z 355 (C 13 , H 16 , O 10 , Na) + by matrix-assisted laser desorption ionization time-of-flight mass spectrometry. The yield of gallic acid glucoside was found to be 35.7% (114 mM) by response surface methodology using a reaction mixture of 319 mM gallic acid, 355 mM sucrose, and 930 mU/mL dextransucrase. The gallic acid glucoside obtained showed 31% higher anti-lipid peroxidation and stronger inhibition (Ki = 1.23 mM) against tyrosinase than that shown by gallic acid (Ki = 1.98 mM). In UVB-irradiated human fibroblast cells, gallic acid glucoside lowered matrix metalloproteinase-1 levels and increased the collagen content, which was indicative of a stronger anti-aging effect than that of gallic acid or arbutin. These results indicated that gallic acid glucoside is likely a superior cosmetic ingredient with skin-whitening and anti-aging functions.
Novak, Ivana; Janeiro, Patricia; Seruga, Marijan; Oliveira-Brett, Ana Maria
2008-12-23
Several flavonoids present in red grape skins from four varieties of Portuguese grapes were determined by reverse-phase high-performance liquid chromatography (RP-HPLC) with electrochemical detection (ECD). Extraction of flavonoids from red grape skins was performed by ultrasonication, and hydrochloric acid in methanol was used as extraction solvent. The developed RP-HPLC method used combined isocratic and gradient elution with amperometric detection with a glassy carbon-working electrode. Good peak resolution was obtained following direct injection of a sample of red grape extract in a pH 2.20 mobile phase. Eleven different flavonoids: cyanidin-3-O-glucoside (kuromanin), delphinidin-3-O-glucoside (myrtillin), petunidin-3-O-glucoside, peonidin-3-O-glucoside, malvidin-3-O-glucoside (oenin), (+)-catechin, rutin, fisetin, myricetin, morin and quercetin, can be separated in a single run by direct injection of sample solution. The limit of detection obtained for these compounds by ECD was 20-90 pg/L, 1000 times lower when compared with photodiode array (PDA) limit of detection of 12-55 ng/L. RP-HPLC-ECD was characterized by an excellent sensitivity and selectivity, and appropriate for the simultaneous determination of these electroactive phenolic compounds present in red grape skins.
Variation of quercetin glycoside derivatives in three onion (Allium cepa L. varieties
Directory of Open Access Journals (Sweden)
Jung-Ho Kwak
2017-09-01
Full Text Available The aim of this study was to quantify the contents of individual quercetin glycosides in red, yellow and chartreuse onion by High Performance Liquid Chromatography (HPLC analysis. Acid hydrolysis of individual quercetin glycosides using 6 M hydrochloric acid guided to identify and separate quercetin 7,4′-diglucoside, quercetin 3-glucoside, quercetin 4′-glucoside, and quercetin. The contents of total quercetin glycosides varied extensively among three varieties (ranged from 16.10 to 103.93 mg/g DW. Quercetin was the predominant compound that accounted mean 32.21 mg/g DW in red onion (43.6% of the total and 127.92 mg/g DW in chartreuse onion (78.3% of the total followed by quercetin 3-glucoside (28.83 and 24.16 mg/g DW respectively. Quercetin 3-glucoside levels were much higher in yellow onion (43.85 mg/g DW followed by quercetin 30.08 mg/g DW. Quercetin 4′-glucoside documented the lowest amount that documented mean 2.4% of the total glycosides. The varied contents of glycosides present in the different onion varieties were significant.
Directory of Open Access Journals (Sweden)
Mingshun Chen
2016-06-01
Full Text Available Three polyphenols were isolated and purified from sugar beet molasses by ultrasonic-aid extraction and various chromatographic techniques, and their structures were elucidated by spectral analysis. Cytotoxicity and the molecular mechanism were measured by methyl thiazolyl tetrazolium (MTT assay, flow cytometry, caspase-3 activity assay and Western blot assay. The results showed that gallic acid, cyanidin-3-O-glucoside chloride and epicatechin have cytotoxicity to the human colon, hepatocellular and breast cancer cells. Cyanidin-3-O-glucoside chloride showed its cytotoxicity against various tumor cell lines, particularly against colon cancer Caco-2 cells with half maximal inhibitory concentration (IC50 value of 23.21 ± 0.14 μg/mL in vitro. Cyanidin-3-O-glucoside chloride may be a potential candidate for the treatment of colon cancer. In the mechanism study, cyanidin-3-O-glucoside chloride increased the ratio of cell cycle at G0/G1 phase and reduced cyclin D1 expression on Caco-2 cells. Cyanidin-3-O-glucoside chloride decreased mutant p21 expression, and increased the ratio of Bax/Bcl-2 and the activation of caspase-3 to induce apoptosis.
Flavonoids from leaves of Mauritia flexuosa
Directory of Open Access Journals (Sweden)
Djalma M. de Oliveira
2013-09-01
Full Text Available The chromatographic fractionation of the Mauritia flexuosa L. f., Arecaceae, leaves extract, a plant known by the name of buriti palm tree, resulted in the isolation of six flavonoids: tricin-7-O-rutinoside, apigenin-6-C-arabinoside, 8-C-glucoside (isoschaftoside, kaempferol-3-O-rutinoside (nicotiflorine, quercetin-3-O-rutinoside (rutin, luteolin-8-C-glucoside (orientin and luteolin-6-C-glucoside (isoorientin. The flavonoids were found out and previously reported as constituents of the Arecaceae family plants, but the occurrence of C-glucoside flavonoids, in the species being analyzed, is described for the first time on this study. The structural elucidations of all of the isolated compounds were performed by means of the comparison of their spectral data (¹H and 13C NMR, UV and ESI-MS with those ones of the literature.
Three New Lanostanoids from the Mushroom Ganoderma tropicum
Directory of Open Access Journals (Sweden)
Shuang-Shuang Zhang
2015-02-01
Full Text Available Three new lanostanoid triterpenes—ganotropic acid (1, 3β,7β,15α,24-tetra- hydroxy-11,23-dioxo-lanost-8-en-26-oic acid (2 and 3β,7β,15α,28-tetrahydroxy-11,23- dioxo-lanost-8,16-dien-26-oic acid (3—were isolated from the n-BuOH extract of the fruiting bodies of the mushroom Ganoderma tropicum. Their structures were elucidated by 1D and 2D NMR spectroscopy, as well as HR-EI-MS data.
PHYTOCHEMICAL STUDY ON THE ETHYLACETATE EXTRACT OF THE LEAVES OF Mesua ferrea LINN
Directory of Open Access Journals (Sweden)
S. M. Mizanur Rahman
2010-06-01
Full Text Available Furano-napthyl-hydroxy cyclohexyl type of compound was isolated first times in plant from the ethyl extracts of the leaves of Mesua ferrea. The structure of the compound has been established by the modern spectroscopic techniques such as UV, IR, 1H-NMR, 13C-NMR and mass spectroscopy and identified as 12, 13-furano-8-hydroxy napthyl-6-0-b-2',3',4',6' tetrahydroxy-5',5' dimethyl cyclohexyl ether. Keywords: Mesua ferrea Linn; Euphorbiaceae; Medicinal plant; new compound; spectral analysis
A new kaempferol triglycoside from Fagonia taeckholmiana: cytotoxic activity of its extracts.
Ibrahim, Lamyaa F; Kawashty, Salwa A; El-Hagrassy, Ali M; Nassar, Mahmoud I; Mabry, Tom J
2008-01-14
In addition to apigenin, apigenin 7-O-glucoside, kaempferol 3-O-glucoside, kaempferol 3,7-di-O-rhamnoside, quercetin, and quercetin 3-O-glucoside, the methanolic extract of Fagonia taeckholmiana afforded a new compound identified as kaempferol 3-O-beta-l-arabinopyranosyl-(1-->4)-alpha-l-rhamnopyranoside-7-O-alpha-l-rhamnopyranoside. Identification of the isolated compounds was based on chemical and spectroscopic analyses including UV, FABMS, (1)H, (13)C and 2D NMR, and DEPT. The cytotoxic activities of the compounds against several cancer cell lines were determined.
DEFF Research Database (Denmark)
Pinheiro de Castro, Érika Cristina; Zagrobelny, Mika; Cardoso, Márcio Z.
2018-01-01
, are morphological defences reported in this plant genus. Moreover, Passiflora plants are well protected chemically, not only by cyanogenic glucosides, but also by other compounds such as alkaloids, flavonoids, saponins, tannins and phenolics. Heliconiines can synthesize cyanogenic glucosides themselves...
Sales, Jocelyn M; Resurreccion, Anna V A
2014-01-01
Peanuts are important dietary food source of resveratrol with potent antioxidant properties implicated in reducing risk of cancer, cardiovascular and Alzheimer's disease, and delaying aging. Resveratrol is a naturally occurring stilbene phytoalexin phenolic compound produced in response to a variety of biotic and abiotic stresses. This paper is a review of trans-resveratrol and related stilbenes from peanuts--their chemical structures, mechanisms for their biosynthesis, and concentrations in comparison with other major food sources. It will also discuss trans-resveratrol's absorption, bioavailability, and major health benefits; processes to enhance their biosynthesis in peanuts by biotic and abiotic stresses; process optimization for enhanced levels in peanuts and their potential food applications; and methods used for its extraction and analysis.
Resveratrol anti-ultraviolet-induced guinea pig skin injury
International Nuclear Information System (INIS)
Li Wenxing; Zhao Ying
2014-01-01
Objective: To Estimate on the protection effect of Stilbene on skin damage induced by ultraviolet radiation. Methods: After the normal skin in guinea pig under the intervene of Resveratrol was irradiated with over- dose of ultraviolet rays (UVB and UVA), the samples in every group were matched and compared. Results: The skin tissue in the Resveratrol intervene group irradiated by ultraviolet rays didn't change obviously as compared with that in the self-control group. But, the damage skin tissue in the control group irradiated by ultraviolet did change significantly as compared with that in the Stilbene intervene group. Conclusion: Resveratrol is a good material to protect the skin from damage effect by ultraviolet radiation. (authors)
Directory of Open Access Journals (Sweden)
Antônio M. Da Silva Jr.
2009-01-01
Full Text Available Structure and first hyperpolarizability for a series of armchair a(5,5 chemically modified carbon nanotubes (CNT were calculated at semiempirical and density functional levels of theory. The 4,4´-substituted stilbenes were selected as chromophore with substituents at position 4´ set to X=NO2, H, Cl, OH and NH2. The calculated values for static first hyperpolarizability (β were almost linearly dependent on the electronic effect of the group X, increasing from NO2 to NH2. At DFT level the effect of inserting the chromophore in the CNT surface was to enhance the β value up to 70% relative to the free 4,4´-substituted stilbene.
Struijs, K.; Vincken, J.P.; Verhoef, R.P.; Voragen, A.G.J.; Gruppen, H.
2008-01-01
In flaxseed hulls, lignans are present in an oligomeric structure. Secoisolariciresinol diglucoside (SDG), ester-linked to hydroxy-methyl-glutaric acid (HMGA), forms the backbone of this lignan macromolecule. The hydroxycinnamic acids p-coumaric acid glucoside (CouAG) and ferulic acid glucoside
A new phenylethanoid triglycoside in Veronica beccabunga L
DEFF Research Database (Denmark)
Jensen, Søren Rosendal; Opitz, Sebastian Ed. Wieland; Gotfredsen, Charlotte Held
2011-01-01
Besides the expected iridoid glucosides aucubin and catalpol as well as three known esters of the latter, Veronica beccabunga (brooklime) was shown to contain five carboxylated iridoid glucosides, namely gardoside, mussaenosidic acid, 8-epiloganic acid, arborescosidic acid and alpinoside. In addi...
Directory of Open Access Journals (Sweden)
Enass Y. A. Salih
2017-12-01
Full Text Available Decoctions and macerations of the stem bark and wood of Terminalia brownii Fresen. are used in traditional medicine for fungal infections and as fungicides on field crops and in traditional granaries in Sudan. In addition, T. brownii water extracts are commonly used as sprays for protecting wooden houses and furniture. Therefore, using agar disc diffusion and macrodilution methods, eight extracts of various polarities from the stem wood and bark were screened for their growth-inhibitory effects against filamentous fungi commonly causing fruit, vegetable, grain and wood decay, as well as infections in the immunocompromised host. Ethyl acetate extracts of the stem wood and bark gave the best antifungal activities, with MIC values of 250 µg/mL against Nattrassia mangiferae and Fusarium verticillioides, and 500 µg/mL against Aspergillus niger and Aspergillus flavus. Aqueous extracts gave almost as potent effects as the ethyl acetate extracts against the Aspergillus and Fusarium strains, and were slightly more active than the ethyl acetate extracts against Nattrassia mangiferae. Thin layer chromatography, RP-HPLC-DAD and tandem mass spectrometry (LC-MS/MS, were employed to identify the chemical constituents in the ethyl acetate fractions of the stem bark and wood. The stem bark and wood were found to have a similar qualitative composition of polyphenols and triterpenoids, but differed quantitatively from each other. The stilbene derivatives, cis- (3 and trans- resveratrol-3-O-β-galloylglucoside (4, were identified for the first time in T. brownii. Moreover, methyl-(S-flavogallonate (5, quercetin-7-β-O-di-glucoside (8, quercetin-7-O-galloyl-glucoside (10, naringenin-4′-methoxy-7-pyranoside (7, 5,6-dihydroxy-3′,4′,7-tri-methoxy flavone (12, gallagic acid dilactone (terminalin (6, a corilagin derivative (9 and two oleanane type triterpenoids (1 and (2 were characterized. The flavonoids, a corilagin derivative and terminalin, have not been
A gene horizontally transferred from bacteria protects arthropods from host plant cyanide poisoning
Wybouw, N.; Dermauw, W.; Tirry, L.; Stevens, C.; Grbić, M.; Feyereisen, R.; Van Leeuwen, T.
2014-01-01
Cyanogenic glucosides are among the most widespread defense chemicals of plants. Upon plant tissue disruption, these glucosides are hydrolyzed to a reactive hydroxynitrile that releases toxic hydrogen cyanide (HCN). Yet many mite and lepidopteran species can thrive on plants defended by cyanogenic
Wang, Chun; Yuan, Jun; Wu, Hua-Xun; Chang, Yan; Wang, Qing-Tong; Wu, Yu-Jing; Zhou, Peng; Yang, Xiao-Dan; Yu, Jun; Wei, Wei
2015-02-01
The present study aimed to investigate the regulation exerted by the total glucosides of paeony (TGP) on the production of interleukin-2 (IL-2), IL-4, IL-10 and IL-17 in the serum and lymphocytes of mice with allergic contact dermatitis (ACD). ACD in mice was induced by the repeated application of 2,4-dinitrochlorobenzene (DNCB) to their skins. The mice were orally administered TGP (35, 70, and 140mg/kg/d) and prednisone (Pre, 5mg/kg/d) from day 1 to day 7 after immunization. The inflammatory responses were evaluated by ear swelling and histological examination. Thymocyte proliferation was assayed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H tetrazolium bromide assay. The cytokine production in the serum and lymphocytes supernatant was measured by enzyme-linked immunosorbent assay. The results indicated that the topical application of DNCB to the skin provoked obvious inflammatory responses. The oral administration of TGP (70 and 140mg/kg/d) and Pre (5mg/kg/d) significantly inhibited skin inflammation, decreased the thymus and spleen indices, and inhibited thymocyte proliferation in mice treated with DNCB. Further study indicated that TGP increased IL-4 and IL-10 production but decreased the production of IL-2 and IL-17 in the serum and lymphocyte supernatant. The correlation analysis suggested significantly positive correlations between IL-2 and IL-17 production and the severity of skin inflammation, whereas negative correlations were obtained for IL-4 and IL-10 production and skin inflammation. In summary, these results suggest that the therapeutic effects of TGP on ACD may result from its regulation of the imbalanced secretion of IL-2/IL-4 and IL-10/IL-17. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
E. ERDEM
2014-07-01
Full Text Available Diazonium derivative of calix[4]arene has been synthesized using three different synthetic steps. Initially p-tert-butylcalix[4]arene was synthesized with the condensation reaction of p-tert-butylphenol and formaldehyde in basic conditions. Calix[4]arene was obtained after the debutylation reaction of p-tert-butylcalix[4]arene with AlCl3. Calix[4]arene reacted with diazonium salt of Böniger acid to yield the 5,17-[(Bis(azo-bis(5-hydroxy-2,7-naphthalenedisulfonicacid]-25,26,27,28-tetrahydroxy calix[4]arene which has eight free phenolic hydroxyl group. Reaction steps were shown in Fig.1.2,7-naphthalenedisulfonicacid]-25,26,27,28-tetrahydroxy calix[4]arene The antioxidant activity of the Böniger acid and calix[4]aren derivative were determined using β-karotene-linoleic acid system. Moreover, the free radical scavenging activity values were tested with DPPH free radical. The two compounds showed strong antioxidant activity. Total antioxidant activity of Böniger acid and calix[4]aren derivative was determined using β–carotenelinoleic acid model system and was found the antioxidant activity of 84.00% and 85.60 % respectively. The free radical scavenging activities were determined as 83.05% and 84.69 %. Results show that, two compounds has the antioxidant activity. The calix[4]aren derivaties has more higher activity then Boniger acid because of calix[4]aren derivative has much hydroxl groups.
Schütz, Katrin; Persike, Markus; Carle, Reinhold; Schieber, Andreas
2006-04-01
The anthocyanin pattern of artichoke heads (Cynara scolymus L.) has been investigated by high-performance liquid chromatography-electrospray ionization mass spectrometry. For this purpose a suitable extraction and liquid chromatographic method was developed. Besides the main anthocyanins-cyanidin 3,5-diglucoside, cyanidin 3-glucoside, cyanidin 3,5-malonyldiglucoside, cyanidin 3-(3''-malonyl)glucoside, and cyanidin 3-(6''-malonyl)glucoside-several minor compounds were identified. Among these, two peonidin derivatives and one delphinidin derivative were characterized on the basis of their fragmentation patterns. To the best of our knowledge this is the first report on anthocyanins in artichoke heads consisting of aglycones other than those of cyanidin. Quantification of individual compounds was performed by external calibration. Cyanidin 3-(6''-malonyl)glucoside was found to be the major anthocyanin in all the samples analyzed. Total anthocyanin content ranged from 8.4 to 1,705.4 mg kg(-1) dry mass.
International Nuclear Information System (INIS)
Singh, Praveen K.; Malhotra, Poonam; Gupta, Ashutosh; Chhachhia, Neha; Singh, Shravan K.; Kumar, Raj; Dubey, Kashyap Kumar
2014-01-01
Ionizing radiation causes reversible/irreversible damages to the testis by inducing oxidative stress through reactive oxygen species lead to impotency in young cancer patients undergoing lower abdomen radiotherapy. Therefore, protection of testicular cells against gamma radiation is of utmost significance. Present study was focused to evaluate radioprotective efficacy of a semiquinone rich fraction isolated from radioresistant bacterium Bacillus sp. INM-1. In the present study, mice were pre-treated with semiquinone glucoside derivative (SQGD; 50 mg/ kg.b.wt. i.p.) 2h before irradiation (5Gy) and various radioprotective cellular parameters including histology, quantitative analysis of spermatids, spermatocytes, sperm counts, sperm abnormalities, structural and morphological analysis of seminiferous tubules were observed for complete two cycles (70 days) of spermatogenesis and compared with irradiated (5 Gy) control group. Results of the study demonstrated that untreated control and SQGD treated groups showed no significant difference in sperm counts even after 70 days post treatment time. However, whole body irradiation reduced the sperm count significantly (p<0.05%) from the day 1 st to day 70 th . SQGD treatment to irradiated mice significantly increased the sperm count, reduced morphological abnormality in the sperms as compared to irradiated group. Untreated control mice showed a higher seminiferous tubular area compared to irradiation control at 35 th and 70 th day post irradiation time. SQGD pretreatment to irradiated mice led to significant increase in seminiferous tubule area compared to irradiated control. Concomitantly, seminiferous lumen size increases in radiation control mice compared to SQGD pre-treated mice at 35 th and 70 th day due to germ cells depletion. Qualitative histological study of testis at all tested time points suggests that drug treatment protects the spermatogenesis by enhancing the spermatogonial proliferation, enhancing the stem cell
Zhang, Bo; Yang, Xue-Shan; Li, Ning-Ning; Zhu, Xia; Sheng, Wen-Jun; He, Fei; Duan, Chang-Qing; Han, Shun-Yu
2017-12-01
In the recent research, the copigmentations of malvidin-3-O-glucoside with eight types of phenolic copigments have been investigated. The influence of the pigment/copigment molar ratio, the reaction temperature, the pH and the ethanol content of solutions has been examined. The results showed that the copigmentation effect was dependent on not only the particular structures of the phenolic compounds but also the factors of the reaction systems. The increase of the copigment concentration can strengthen the copigmentation effect, improve the solution color, and enhance the red-purple features. Different temperatures had different influences on the copigmentation reactions. The destruction of the copigmentation complexes can result in the hypsochromic shift of the reaction solution when the temperature was higher than 20°C. The bathochromic shift of the solution gradually progressed with the increase of the pH value. A significant copigmentation feature was spotted when pH reached 3.0, which demonstrates obvious red-purple characterization. The addition of the ethanol weakened the copigmentation effect. According to measurement through color analysis, it was found that the color differences caused by ethanol in red wine were typically attributed to quantitative changes. Remarkably, all of the above delicate color deviations caused by the structural or environmental factors can be precisely and conveniently depicted via the CIELAB space analysis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Abdulla, Rahima; Mansur, Sanawar; Lai, Haizhong; Ubul, Ablikim; Sun, Guangying; Huang, Guozheng; Aisa, Haji Akber
2017-09-01
Pomegranate (Punica granatum L.) husk is a traditional herbal medicine abundant in phenolic compounds and plays some roles in the treatment of oxidative stress, bacterial and viral infection, diabetes mellitus, and acute and chronic inflammation. Identification and determination of polyphenols in macroporous resin pretreated pomegranate husk extract by high performance liquid chromatography coupled with quadrupole time-of-flight tandem mass spectrometry (HPLC-QTOF-MS). The total polyphenols of pomegranate husk were prepared by ethanol extraction followed by pretreatment with HPD-300 macroporous resin. The polyphenolic compounds were qualitatively analysed by HPLC-QTOF-MS in negative electrospray ionisation (ESI) mode at different collision energy (CE) values. A total of 50 polyphenols were detected in the extract of pomegranate husk, including 35 hydrolysable tannins and 15 flavonoids with distinct retention time, fragmentation behaviours and characteristics, and the accurate mass-to-charge ratios at low, moderate and high CE values. Of these, we identified nine compounds for the first time in the pomegranate husk, including hexahydroxydiphenoyl-valoneoyl-glucoside (HHDP-valoneyl-glucoside), galloyl-O-punicalin, rutin, hyperoside, quercimeritrin, kaempferol-7-O-rhahmano-glucoside, luteolin-3'-O-arabinoside, luteolin-3'-O-glucoside, and luteolin-4'-O-glucoside. To validate the specificity and accuracy of mass spectrometry in the detection of polyphenols, as compared to the fragmentation pathways of granatin B in detail, including the HHDP-valoneyl- glucoside was first identified from pomegranate husk. The study provides evidence for the quality control and development of novel drugs based on polyphenols from the pomegranate husk. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Molecular systematics and phytochemistry of Rehmannia (Scrophulariaceae)
DEFF Research Database (Denmark)
Albach, Dirk C.; Li, Hong-Qing; Zhao, Nan
2007-01-01
The relationships between the six known species of Rehmannia were investigated. With regard to the content of iridoid glucosides, caffeoyl phenylethanoid glycosides (CPGs) and ionone glucosides, no conclusions could be drawn. Phylogenetic analysis of DNA sequence data (ITS region, trnL-F region a...
Directory of Open Access Journals (Sweden)
Hubert Antolak
2016-01-01
Full Text Available The aim of the study was to evaluate the activity of high-polyphenolic black currant (Ribes nigrum L. and bilberry (Vaccinium myrtillus L. juices against bacterial strains Asaia lannensis and Asaia bogorensis isolated as spoilage of commercial soft drinks. The composition of fruit juices was evaluated using chromatographic techniques HPLC and LC-MS. The adhesion to glass, polystyrene, and polyethylene terephthalate in two different culture media was evaluated by luminometry and the plate count method. The major anthocyanins in the V. myrtillus were petunidin-3-glucoside, malvidin-3-glucoside, cyanidin-3-glucoside, and delphinidin-3-glucoside, while in R. nigrum delphinidin-3-rutinoside and cyanidin-3-rutinoside were detected. The LC-MS analysis showed presence of anthocyanins (delphinidin, cyanidin, petunidin, and malvidin derivatives, phenolic acids (chlorogenic and neochlorogenic acids, flavonols (quercetin-3-glucoside, quercetin-3-rutinoside, and flavanols (procyanidin B2 and procyanidin type A2. Additionally, in the bilberry juice A type procyanidin trimer was detected. The adhesion of Asaia spp. cells depended on the type of medium, carbon sources, and the type of abiotic surfaces. We noted that the adhesion was significantly stronger in minimal medium containing sucrose. The addition of bilberry and black currant juices notably reduced bacterial growth as well as cell adhesion to polyethylene terephthalate surfaces.
African Journals Online (AJOL)
3,7-disulphates of kaempferol and isorhamnetin have been reported (3). RESULTS AND DISCUSSION. The flavonoids isolated from C. alexandrina were apigenin-7-glucoside, luteolin-7-glucoside, quercetin-3,7-disulphate as well as a number of methylated flavonols and C-glycosides, Preliminary results indicated that ...
Het cyanophore karakter van witte klaver (Trifolium repens L.)
Waal, de D.
1942-01-01
The positive correlation found in New Zealand between quality of white clover and its hydrocyanic acid content, could not be confirmed for Dutch white clover in the Netherlands. HCN occurred bound to an incompletely identified glucoside. As Weevers and Treub et al. found the glucoside and HCN
Profile of the Phenolic Compounds of Rosa rugosa Petals
Directory of Open Access Journals (Sweden)
Andrzej Cendrowski
2017-01-01
Full Text Available Rosa rugosa petals are a rich source of phenolic compounds, which determined their antioxidant properties. The aim of this study was to determine the polyphenolic composition of not processed petals of Rosa rugosa collected from the commodity crops and to determine the variability of the contained therein polyphenols between harvesting seasons. Twenty polyphenols were identified by UPLC-ESI-MS. The main fraction of polyphenols was ellagitannins, which are 69 to 74% of the total polyphenols of the petals. In the petals of Rosa rugosa, four anthocyanins have been identified: cyanidin 3,5-di-O-glucoside, peonidin 3-O-sophoroside, peonidin 3,5-di-O-glucoside, and peonidin 3-O-glucoside, of which the predominant peonidin 3,5-di-O-glucoside represented approx. 85% of all the determined anthocyanin compounds. It was found that the petals of Rosa rugosa are a valuable source of bioactive compounds and can be considered as a healthy valuable resource.
Jan, Sumira; Kamili, Azra N; Parray, Javid A; Bedi, Yashbir S
2016-01-01
Herbs adapted to diverse climates exhibit distinct variability to fluctuating temperatures and demonstrate various metabolic and physiological adaptations to harsh environments. In this research, Rumex dentatus L. and Lavandula officinalis L. were collected before snowfall in September-November to evaluate variability in major phytoconstituents to diverse seasonal regime. LC-MS was used for simultaneous determination of eight anthraquinone derivatives in R. dentatus, i.e. emodin, physcion, chrysophanol, physcion glucoside, endocrocin, emodin glucoside, chrysophanol glucoside and chromone derivatives and monoterpenes in L. officinalis i.e. (Z)-β-ocimene, (E)-β-ocimene, terpene alcohol, terpin-4-ol, acetate ester-linalyl acetate and bicyclic sesquiterpene (E)-caryophyllene. The correlation analysis confirmed significant variation in anthraquinone glucoside and terpene content within Rumex and Lavender, respectively, and altitude was established as the determinant factor in secondary metabolism of both herbs. The study concludes the propagation of herbs in bioclimatic belts which favour accumulation of major constituents and validate their greater pharmacological activity.
Water-Soluble Constituents of Cudrania tricuspidata (Carr.) Bur.
Institute of Scientific and Technical Information of China (English)
Zong-Ping Zheng; Jing-Yu Liang; Li-Hong Hu
2006-01-01
In order to find new structural and biologically active compounds, the constituents of the bark of Cudrania tricuspidata (Carr.) Bur. were investigated and a new 6-p-hydroxybenzyltaxifolin glucoside, named tricusposide (compound 1), together with 16 known compounds, was isolated by solvent partition,macroporous adsorption resin AB-8, silica gel, Sephadex LH-20 chromatography. Using spectroscopic methods, the structures of the compounds were elucidated as 6-p-hydroxybenzyl taxifolin-7-O-β-D-glucoside (compound 1), dihydroquerctin-7-O-β-D-glucoside (compound 2), dihydrokaempferol-3-O-β-D-glucoside (compound 3), dihydroquercetin (compound 4), peonoside (compound 5), sphaerobioside (compound 6), quercimeritrin (compound 7), genistein (compound 8), aromadendrin (compound 9), kaempferol (compound 10), genistin (compound 11), 3,4-dihydroxystyryl alcohol (compound 12), sucrose (compound 13), 1,3,5,6-tetrahydroxyxanthone (compound 14), gericudranin E (compound 15), gericudranin C (compound 16),and orobol (compound 17). Compounds 2-6, 8, 9, 12-14, and 17 were isolated from this genus for the first time.
Sun, Yongming; Xia, Biqi; Chen, Xiangzhun; Duanmu, Chuansong; Li, Denghao; Han, Chao
2015-01-01
The identification and quantification of four anthocyanins (cyanidin-3-O-glucoside, peonidin-3-O-glucoside, delphinidin-3-O-glucoside, and malvidin-3-O-glucoside) in red grape wine were carried out by hydrophilic interaction liquid chromatography/triple quadrupole linear ion trap MS (HILIC/QTrap-MS/MS). Samples were diluted directly and separated on a Merck ZIC HILIC column with 20 mM ammonium acetate solution-acetonitrile mobile phase. Quantitative data acquisition was carried out in the multiple reaction monitoring mode. Additional identification and confirmation of target compounds were performed using the enhanced product ion mode of the linear ion trap. The LOQs were in the range 0.05-1.0 ng/mL. The average recoveries were in the range 94.6 to 104.5%. The HILIC/QTrap-MS/MS platform offers the best sensitivity and specificity for characterization and quantitative determination of the four anthocyanins in red grape wines and fulfills the quality criteria for routine laboratory application.
Yanaka, Kaoru; Takebayashi, Jun; Matsumoto, Teruki; Ishimi, Yoshiko
2012-04-25
Soy isoflavone is the generic name for the isoflavones found in soy. We determined the concentrations of 15 soy isoflavone species, including 3 succinyl glucosides, in 22 soy foods and isoflavone supplements by high-performance liquid chromatography (HPLC). The total isoflavone contents in 14 soy foods and 8 supplements ranged from 45 to 735 μg/g and from 1,304 to 90,224 μg/g, respectively. Higher amounts of succinyl glucosides were detected in natto, a typical fermented soy product in Japan; these ranged from 30 to 80 μg/g and comprised 4.1-10.9% of the total isoflavone content. In soy powder, 59 μg/g of succinyl glucosides were detected, equivalent to 4.6% of the total isoflavone content. These data suggest that the total isoflavone contents may be underestimated in the previous studies that have not included succinyl glucosides, especially for Bacillus subtilis -fermented soy food products.
The contribution of wine-derived monoterpene glycosides to retronasal odour during tasting.
Parker, Mango; Black, Cory A; Barker, Alice; Pearson, Wes; Hayasaka, Yoji; Francis, I Leigh
2017-10-01
This study investigated the sensory significance of monoterpene glycosides during tasting, by retronasal perception of odorant aglycones released in-mouth. Monoterpene glycosides were isolated from Gewürztraminer and Riesling juices and wines, chemically characterised and studied using sensory time-intensity methodology, together with a synthesised monoterpene glucoside. When assessed in model wine at five times wine-like concentration, Gewürztraminer glycosides and geranyl glucoside gave significant fruity flavour, although at wine-like concentrations, or in the presence of wine volatiles, the effect was not significant. Gewürztraminer glycosides, geranyl glucoside and guaiacyl glucoside were investigated using a sensory panel (n=39), revealing large inter-individual variability, with 77% of panellists responding to at least one glycoside. The study showed for the first time that grape-derived glycosides can contribute perceptible fruity flavour, providing a means of enhancing flavour in wines, and confirms the results of previous studies that the effect is highly variable across individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mass spectrometry and tandem mass spectrometry of citrus limonoids.
Tian, Qingguo; Schwartz, Steven J
2003-10-15
Methods for atmospheric pressure chemical ionization tandem mass spectrometry (APCI-MS/MS) of citrus limonoid aglycones and electrospray ionization tandem mass spectrometry (ESI-MS/MS) of limonoid glucosides are reported. The fragmentation patterns of four citrus limonoid aglycones (limonin, nomilin, obacunone, and deacetylnomilin) and six limonoid glucosides, that is, limonin 17-beta-D-glucopyranoside (LG), nomilin 17-beta-D-glucopyranoside (NG), nomilinic acid 17-beta-D-glucopyranoside (NAG), deacetyl nomilinic acid 17-beta-D-glucopyranoside (DNAG), obacunone 17-beta-D-glucopyranoside (OG), and obacunoic acid 17-beta-D-glucopyranoside (OAG) were investigated using a quadruple mass spectrometer in low-energy collisionally activated dissociation (CAD). The four limonoid aglycones and four limonoid glucosides (LG, OG, NAG, and DNAG) were purified from citrus seeds; the other two limonoid glucosides (NG and OAG) were tentatively identified in the crude extract of grapefruit seeds by ESI mass spectrometry in both positive and negative ion analysis. Ammonium hydroxide or acetic acid was added to the mobile phase to facilitate ionization. During positive ion APCI analysis of limonoid aglycones, protonated molecular ion, [M + H]+, or adduct ion, [M + NH3 + H]-, was formed as base peaks when ammonium hydroxide was added to the mobile phase. Molecular anions or adduct ions with acetic acid ([M + HOAc - H] and [M + HOAc]-) or a deprotonated molecular ion were produced during negative ion APCI analysis of limonoid aglycones, depending on the mobile-phase modifier used. Positive ion ESI-MS of limonoid glucosides produced adduct ions of [M + H + NH3]+, [M + Na]+, and [M + K]+ when ammonium hydroxide was added to the mobile phase. After collisionally activated dissociation (CAD) of the limonoid aglycone molecular ions in negative ion APCI analysis, fragment ions indicated structural information of the precursor ions, showing the presence of methyl, carboxyl, and oxygenated ring
Pterostilbene Is a Potential Candidate for Control of Blackleg in Canola.
Directory of Open Access Journals (Sweden)
Joshua C O Koh
Full Text Available Two stilbenes, resveratrol and pterostilbene, exhibit antifungal activity against Leptosphaeria maculans, the fungal pathogen responsible for blackleg (stem canker in canola (Brassica napus. In vitro studies on the effect of these stilbenes on L. maculans mycelial growth and conidia germination showed that pterostilbene is a potent fungicide and sporicide, but resveratrol only exerted minor inhibition on L. maculans. Cell viability of hyphae cultures was markedly reduced by pterostilbene and SYTOX green staining showed that cell membrane integrity was compromised. We demonstrate that pterostilbene exerts fungicidal activity across 10 different L. maculans isolates and the compound confers protection to the blackleg-susceptible canola cv. Westar seedlings. The potential of pterostilbene as a control agent against blackleg in canola is discussed.
Targeting Mycobacterium tuberculosis nucleoid-associated protein HU with structure-based inhibitors
Bhowmick, Tuhin; Ghosh, Soumitra; Dixit, Karuna; Ganesan, Varsha; Ramagopal, Udupi A.; Dey, Debayan; Sarma, Siddhartha P.; Ramakumar, Suryanarayanarao; Nagaraja, Valakunja
2014-06-01
The nucleoid-associated protein HU plays an important role in maintenance of chromosomal architecture and in global regulation of DNA transactions in bacteria. Although HU is essential for growth in Mycobacterium tuberculosis (Mtb), there have been no reported attempts to perturb HU function with small molecules. Here we report the crystal structure of the N-terminal domain of HU from Mtb. We identify a core region within the HU-DNA interface that can be targeted using stilbene derivatives. These small molecules specifically inhibit HU-DNA binding, disrupt nucleoid architecture and reduce Mtb growth. The stilbene inhibitors induce gene expression changes in Mtb that resemble those induced by HU deficiency. Our results indicate that HU is a potential target for the development of therapies against tuberculosis.
Zhang, Yabing; Zhou, Rui; Zhou, Feng; Cheng, Hong; Xia, Bing
2014-01-01
The present study is to investigate effects of total glucosides of peony (TGP) on 2,4,6-trinitrobenzene sulfonic acid (TNBS)/ethanol-induced colitis in rats and to explore potential clinical use of TGP for treatment of inflammatory bowel disease. Sixty Sprague-Dawley rats were randomly grouped into normal controls, model controls, sulfasalazine (SASP) controls (100 mg/kg/day), and low, medium, and high-dose TGP groups (25, 50, and 100 mg/kg/day, respectively). 24 h following colonic instillation of TNBS, TGP, and SASP were given by gastric gavage three times a day for 7 days. Disease activity index (DAI), colon macroscopic damage index (CMDI), histopathological score (HPS), and myeloperoxidase (MPO) activity were evaluated. Levels of serum TNF-α, IL-1β, and IL-10 were measured by ELISA, and expression of TNF-α, IL-1β, and IL-10 mRNA and protein in colonic tissues was detected by RT-PCR and western blot, respectively. Compared with rats in the model controls, TGP (50 or 100 mg/kg/day)-treated rats with TNBS/ethanol-induced colitis showed significant improvements of DAI, CMDI, HPS, and MPO activity. Moreover, administration of TGP (50 or 100 mg/kg/day) decreased the up-regulated levels of serum TNF-α and IL-1β, and expression of TNF-α and IL-1β mRNA and protein in colonic tissues, and increased the serum IL-10 and colonic IL-10 mRNA and protein level. And there was no significant difference compared with administration of SASP (P > 0.05). TGP attenuates TNBS/ethanol-induced colitis in rats and its efficacy is similar to SASP, the potential mechanism might be related to the adjustment of Th1/Th2 cytokines polarization by decreasing pro-inflammatory cytokine TNF-α and IL-1β, and increasing anti-inflammatory cytokine IL-10.
Directory of Open Access Journals (Sweden)
Hiroki Hamada
2013-01-01
Full Text Available Taxol is recognized as one of the most potent anticancer agents used in the treatment of breast and ovarian cancers, which are common cancers in women. To overcome its shortcomings, that is, its low water-solubility that reduces drug loading capacity of DDS carriers when incorporating taxol, chemo-enzymatic synthesis of ester-linked taxol-glucose conjugate, i.e., 7-propionyltaxol 2′- O -α-D-glucoside, as a water soluble taxol prodrug was achieved by using a-glucosidase as a glucosylation catalyst. The water-solubility of 7-propionyltaxol 2′- O -α-D-glucoside (25 mM was 63 fold higher than that of taxol (0.4 mM. The pre-S1 peptide which displays on the surface of bio-nanocapsules, which are nanoparticles composed of the hepatitis B virus surface antigen, was replaced with the antibody affinity motif of protein A. Conjugation of such bio-nanocapsules with anti-human epidermal growth factor receptor antibody gave hybrid bio-nanocapsules. The hybrid bio-nanocapsules were effective for delivering 7-propionyltaxol 2′- O -α-D-glucoside to human brain glioma cells. 7-Propionyltaxol 2′- O -α-D-glucoside was effectively hydrolyzed to give taxol in 95% by human glioma cells. The drug loading capacity of hybrid bio-nanocapsules incorporating 7-propionyltaxol 2′- O -α-D-glucoside was 120 times higher than that incorporating taxol itself.
Directory of Open Access Journals (Sweden)
Zoran Zorić
2014-01-01
Full Text Available The effect of heating temperature (80–120 °C and processing time (5–50 min on the stability of anthocyanins (cyanidin-3-glucosylrutinoside, cyanidin-3-rutinoside and cyanidin- 3-glucoside, quercetin-3-glucoside and phenolic acids (chlorogenic, neochlorogenic, p-coumaric and ferulic acids in freeze-dried Marasca sour cherry pastes was studied. The degradation rates of individual anthocyanins, quercetin-3-glucoside and phenolic acids followed the first order reaction kinetics. Cyanidin-3-glucoside was found to be the most unstable among the anthocyanins, together with p-coumaric and neochlorogenic acids among other phenols. Activation energies for anthocyanin degradation ranged from 42 (cyanidin-3-glucosylrutinoside to 55 kJ/mol (cyanidin-3-glucoside, and for other phenols from 8.12 (chlorogenic acid to 27 kJ/mol (neochlorogenic acid. By increasing the temperature from 80 to 120 °C, the reaction rate constant of cyanidin-3-glucosylrutinoside increased from 2.2·10–2 to 8.5·10–2 min–1, of p-coumaric acid from 1.12·10–2 to 2.5·10–2 min–1 and of quercetin-3-glucoside from 1.5·10–2 to 2.6·10–2 min–1. The obtained results demonstrate that at 80°C the half-life of anthocyanins ranges from 32.10 min for cyanidin-3-glucosylrutinoside to 45.69 min for cyanidin-3-rutinoside, and of other phenolic compounds from 43.39 for neochlorogenic acid to 66.99 min for chlorogenic acid. The results show that the heating temperature and duration affect the anthocyanins considerably more than the other phenols in terms of degradation.
Maiyo, Fiona C; Moodley, Roshila; Singh, Moganavelli
2016-01-01
Moringa oleifera, from the family Moringaceae, is used as a source of vegetable and herbal medicine and in the treatment of various cancers in many African countries, including Kenya. The present study involved the phytochemical analyses of the crude extracts of M.oleifera and biological activities (antioxidant, cytotoxicity and induction of apoptosis in-vitro) of selected isolated compounds. The compounds isolated from the leaves and seeds of the plant were quercetin-3-O-glucoside (1), 4-(β-D-glucopyranosyl-1→4-α-L-rhamnopyranosyloxy)-benzyl isothiocyanate (2), lutein (3), and sitosterol (4). Antioxidant activity of compound 1 was significant when compared to that of the control, while compound 2 showed moderate activity. The cytotoxicity of compounds 1 and 2 were tested in three cell lines, viz. liver hepatocellular carcinoma (HepG2), colon carcinoma (Caco-2) and a non-cancer cell line Human Embryonic Kidney (HEK293), using the MTT cell viability assay and compared against a standard anticancer drug, 5-fluorouracil. Apoptosis studies were carried out using the acridine orange/ethidium bromide dual staining method. The isolated compounds showed selective in vitro cytotoxic and apoptotic activity against human cancer and non-cancer cell lines, respectively. Compound 1 showed significant cytotoxicity against the Caco-2 cell line with an IC50 of 79 μg mL(-1) and moderate cytotoxicity against the HepG2 cell line with an IC50 of 150 μg mL(-1), while compound 2 showed significant cytotoxicity against the Caco- 2 and HepG2 cell lines with an IC50 of 45 μg mL(-1) and 60 μg mL(-1), respectively. Comparatively both compounds showed much lower cytotoxicity against the HEK293 cell line with IC50 values of 186 μg mL(-1) and 224 μg mL(-1), respectively.
African Journals Online (AJOL)
Prevalence of Non-Gonccoccal Urethritis (NGU) within Owerri and its environment. Abstract · Vol 3, No 3 (2001) - Articles Effect of cyanogenic glucoside of cassava on the fertility and maternal body weight in Wistar rats. Abstract · Vol 3, No 3 (2001) - Articles Possible effect of cyanogenic glucoside of cassava on the foetal ...
Heinsbroek, R.; Brederode, J. van; Nigtevecht, G. van; Maas, J.; Kamsteeg, J.; Besson, E.; Chopin, J.
1980-01-01
Two separate genes, Fg and Vg, which govern the presence of isovitexin 2″-O-glucoside and vitexin 2″-O-glucoside respectively in the petals of Silene alba control different glucosyltransferases. In Vg/Vg,fg/fg plants no isovitexin 2″-O-glucosyltransferase was present and in vg/vg,Fg/Fg plants no
ORF Alignment: NC_002655 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available f|NP_289264.1| PTS system enzyme II ABC (asc), ... cryptic, transports specific beta-glucosides ... ...ABC (asc), cryptic, transports specific ... beta-glucosides [Escherichia coli O157:H7 EDL933] ... ... NC_002655 gi|15803232 >1iba0 1 77 8 85 7e-10 ... gb|AAG57822.1| PTS system enzyme II
ORF Alignment: NC_000913 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available f|NP_289264.1| PTS system enzyme II ABC (asc), ... cryptic, transports specific beta-glucosides ... ...ABC (asc), cryptic, transports specific ... beta-glucosides [Escherichia coli O157:H7 EDL933] ... ... NC_000913 gi|49176263 >1iba0 1 77 8 85 7e-10 ... gb|AAG57822.1| PTS system enzyme II
ORF Alignment: NC_002695 [GENIUS II[Archive
Lifescience Database Archive (English)
Full Text Available f|NP_289264.1| PTS system enzyme II ABC (asc), ... cryptic, transports specific beta-glucosides ... ...ABC (asc), cryptic, transports specific ... beta-glucosides [Escherichia coli O157:H7 EDL933] ... ... NC_002695 gi|15832825 >1iba0 1 77 8 85 7e-10 ... gb|AAG57822.1| PTS system enzyme II
Vidal, Arnau; Sanchis, Vicente; Ramos, Antonio J; Marín, Sonia
2015-07-01
The stability of deoxynivalenol (DON), deoxynivalenol-3-glucoside (DON-3-glucoside), 3-acetyldeoxynivalenol (3-ADON), 15-acetyldeoxynivalenol (15-ADON), de-epoxy-deoxynivalenol (DOM-1) and ochratoxin A (OTA) during thermal processing has been studied. Baking temperature, time and initial mycotoxin concentration in the raw materials were assayed as factors. An improved UPLC-MS/MS method to detect DON, DON-3-glucoside, 3-ADON, 15-ADON and DOM-1 in wheat baked products was developed in the present assay. The results highlighted the importance of temperature and time in mycotoxin stability in heat treatments. OTA is more stable than DON in a baking treatment. Interestingly, the DON-3-glucoside concentrations increased (>300%) under mild baking conditions. On the other hand, it was rapidly reduced under harsh conditions. The 3-ADON decreased during the heat treatment; while DOM-1 increased after the heating process. Finally, the data followed first order kinetics for analysed mycotoxins and thermal constant rates (k) were calculated. This parameter can be a useful tool for prediction of mycotoxin levels. Copyright © 2015 Elsevier Ltd. All rights reserved.
Braunberger, Christina; Zehl, Martin; Conrad, Jürgen; Fischer, Sonja; Adhami, Hamid-Reza; Beifuss, Uwe; Krenn, Liselotte
2013-08-01
The herb of Drosera peltata, commonly named the shield sundew, is used as an antitussive in phytotherapy, although the plants' composition has not been determined in detail so far. Hence, in this study, we present a validated, sensitive, reliable, and cheap narrow-bore LC-DAD method for the simultaneous quantification of flavonoids and ellagic acid derivatives in this herbal drug. In addition, the structures of 13 compounds have been elucidated by LC-MS, LC-NMR, and offline NMR experiments after isolation: herbacetin-3-O-glucoside (1), gossypitrin (2), ellagic acid (3), quercetin-7-O-glucoside (4), isoquercitrin (5), kaempferol-3-O-(6″-O-galloyl)-glucoside (6), herbacetin-7-O-glucoside (7), astragalin (8), gossypetin (9), herbacetin (10), quercetin (11), 3,3'-di-O-methyl ellagic acid (12), and kaempferol (13). Compounds 1, 2, 4, 5, 6, 7, and 10 have been identified in D. peltata for the first time, and compounds 1, 4, 6, 7, and 10 have not been detected in any Drosera species before. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rebecca E. Stein-Chisholm
2017-11-01
Full Text Available Blueberry juice processing includes multiple steps and each one affects the chemical composition of the berries, including thermal degradation of anthocyanins. Not-from-concentrate juice was made by heating and enzyme processing blueberries before pressing, followed by ultrafiltration and pasteurization. Using LC–MS/MS, major and minor anthocyanins were identified and semi-quantified at various steps through the process. Ten anthocyanins were identified, including 5 arabinoside and 5 pyrannoside anthocyanins. Three minor anthocyanins were also identified, which apparently have not been previously reported in rabbiteye blueberries. These were delphinidin-3-(p-coumaroyl-glucoside, cyanidin-3-(p-coumaroyl-glucoside, and petunidin-3-(p-coumaroyl-glucoside. Delphinidin-3-(p-coumaroyl-glucoside significantly increased 50% after pressing. The five known anthocyanidins—cyanidin, delphinidin, malvidin, peonidin, and petunidin—were also quantitated using UPLC–UV. Raw berries and press cake contained the highest anthocyanidin contents and contribute to the value and interest of press cake for use in other food and non-food products. Losses of 75.7% after pressing and 12% after pasteurization were determined for anthocyanidins during not-from-concentrate juice processing.
Effect of erythropoietin on the glucose transport of rat erythrocytes and bone marrow cells
International Nuclear Information System (INIS)
Ghosal, J.; Chakraborty, M.; Biswas, T.; Ganguly, C.K.; Datta, A.G.
1987-01-01
The effect of Ep on radioactive glucose and methyl-alpha-D-glucoside transport by rat erythrocytes and bone marrow cells were studied. There is initial linearity followed by saturation kinetics of [ 14 C]glucose transport by the erythrocytes of starved and starved plus Ep-treated rats at different concentrations of glucose. Starvation caused slight inhibition of glucose transport which increased markedly on Ep administration to starved rats. Normal animals failed to show any significant change in glucose transport after Ep treatment. Methyl-alpha-D-glucoside inhibited the Ep-stimulated glucose transport significantly. Ep also stimulated the transport of radioactive methyl-alpha-D-glucoside which was competitively inhibited in presence of D-glucose. Glucose transport in erythrocytes was found to be sensitive to metabolic inhibitors like azide and DNP. A sulfhydryl reagent and ouabain also inhibited the transport process. Ep stimulated glucose and methyl-alpha-D-glucoside transport in the bone marrow cells of starved rats. The sugar analog competitively inhibited the glucose transport in bone marrow cells and vice versa
Antihepatotoxic activity and chemical constituents of Buddleja asiatica Lour.
El-Domiaty, Maher M; Wink, Michael; Abdel Aal, Mahmoud M; Abou-Hashem, Maged M; Abd-Alla, Rehab H
2009-01-01
A new natural compound, named 6-O-(3",4"-dimethoxycinnamoyl) catalpol, was isolated from the defatted alcoholic extract of the flowering parts of Buddleja asiatica Lour. (family Scrophulariaceae). Other separated known compounds included steroids (beta-sitosterol, stigmasterol, stigmasterol-O-glucoside, beta-sitosterol-O-glucoside), iridoid glucosides (methyl catalpol, catalpol, aucubin), phenylpropanoids (isoacteoside and acteoside), a triterpene saponin (mimengoside A), flavonoids (diosmin and linarin) in addition to the free sugars mannitol and sucrose. The structures of the isolated compounds were established by 1H and 13C NMR and mass spectrometry. Furthermore, the polar fraction of the flowering parts and the roots showed substantial antihepatotoxic activity comparable to that of the lignan silymarin.
Isolation and investigation of antimicrobial effect of 3,4,3'-tri-O ...
African Journals Online (AJOL)
3,4,3'-Tri-O-methylflavellagic acid and its glucoside (reported for the first time) were isolated from Anogeissus leocarpus. These compounds were analysed by GC-MS, IR, 1D and 2D-NMR, and also as acetates. Antimicrobial effect of the glucoside on S. aureus, E. coli, Ps. aeruginosa and C. albicans show that it possesses ...
Koshioka, Masaji; Umegaki, Naoko; Boontiang, Kriangsuk; Pornchuti, Witayaporn; Thammasiri, Kanchit; Yamaguchi, Satoshi; Tatsuzawa, Fumi; Nakayama, Masayoshi; Tateishi, Akira; Kubota, Satoshi
2015-03-01
Five anthocyanins, delphinidin 3-O-rutinoside, cyanidin 3-O-rutinoside, petunidin 3-O-rutinoside, malvidin 3-O-glucoside and malvidin 3-O-rutinoside, were identified. Three anthocyanins, delphinidin 3-O-glucoside, cyanidin 3-O-glucoside and pelargonidin 3-O-rutinoside, were putatively identified based on C18 HPLC retention time, absorption spectrum, including λmax, and comparisons with those of corresponding standard anthocyanins, as the compounds responsible for the pink to purple-red pigmentation of the bracts of Curcuma alismatifolia and five related species. Cluster analysis based on four major anthocyanins formed two clusters. One consisted of only one species, C. alismatifolia, and the other consisted of five. Each cluster further formed sub-clusters depending on either species or habitats.
Bioavailability is improved by enzymatic modification of the citrus flavonoid hesperidin in humans
DEFF Research Database (Denmark)
Nielsen, Inge Lise F; Chee, Winnie S S; Poulsen, Lea
2006-01-01
Hesperidin is the predominant polyphenol consumed from citrus fruits and juices. However, hesperidin is proposed to have limited bioavailability due to the rutinoside moiety attached to the flavonoid. The aim of this study was to demonstrate in human subjects that the removal of the rhamnose group...... to yield the corresponding flavonoid glucoside (i.e., hesperetin-7-glucoside) will improve the bioavailability of the aglycone hesperetin. Healthy volunteers (n=16) completed the double-blind, randomized, crossover study. Subjects randomly consumed hesperetin equivalents supplied as orange juice...... that the bioavailability of hesperidin was modulated by enzymatic conversion to hesperetin-7-glucoside, thus changing the absorption site from the colon to the small intestine. This may affect future interventions concerning the health benefits of citrus flavonoids....
Zhou, Yuanyuan; Yang, Bingyou; Jiang, Yanqiu; Liu, Zhaoxi; Liu, Yuxin; Wang, Xiaoli; Kuang, Haixue
2015-08-26
Twenty-seven naphthoquinones and their derivatives, including four new naphthalenyl glucosides and twenty-three known compounds, were isolated from green walnut husks, which came from Juglans mandshurica Maxim. The structures of four new naphthalenyl glucosides were elucidated based on extensive spectroscopic analyses. All of these compounds were evaluated for their cytotoxic activities against the growth of human cancer cells lines HepG-2 by MTT [3-(4,5-dimethylthiazo l-2-yl)-2,5 diphenyl tetrazolium bromide] assay. The results were shown that most naphthoquinones in an aglycone form exhibited better cytotoxicity in vitro than naphthalenyl glucosides with IC50 values in the range of 7.33-88.23 μM. Meanwhile, preliminary structure-activity relationships for these compounds were discussed.
Excited state dynamics & optical control of molecular motors
Wiley, Ted; Sension, Roseanne
2014-03-01
Chiral overcrowded alkenes are likely candidates for light driven rotary molecular motors. At their core, these molecular motors are based on the chromophore stilbene, undergoing ultrafast cis/trans photoisomerization about their central double bond. Unlike stilbene, the photochemistry of molecular motors proceeds in one direction only. This unidirectional rotation is a result of helicity in the molecule induced by steric hindrance. However, the steric hindrance which ensures unidirectional excited state rotation, has the unfortunate consequence of producing large ground state barriers which dramatically decrease the overall rate of rotation. These molecular scale ultrafast motors have only recently been studied by ultrafast spectroscopy. Our lab has studied the photochemistry and photophysics of a ``first generation'' molecular motor with UV-visible transient absorption spectroscopy. We hope to use optical pulse shaping to enhance the efficiency and turnover rate of these molecular motors.
Tree nuts contain an array of phytochemicals including carotenoids, phenolic acids, phytosterols and polyphenolic compounds such as flavonoids, proanthocyanidins (PAC) and stilbenes, all of which are included in nutrient databases, as well as phytates, sphingolipids, alkylphenols and lignans, which ...