The application of polymerase chain reaction-denaturing gradient ...

African Journals Online (AJOL)

Jane

2011-05-23

May 23, 2011 ... dominance in microbial ecology if the corresponding environment samples had been provided. This ... yeast peptone dextrose; PCR, polymerase chain reaction. method, DGGE method ..... Two nuclear mutations that block.

Polymerase chain reaction methods (PCR in agrobiotechnology

Directory of Open Access Journals (Sweden)

Taški-Ajduković Ksenija

2006-01-01

Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Identifikasi Cendawan Endofit Menggunakan Teknik Polymerase Chain Reaction (Detection of Endophytic Fungi Using Polymerase Chain Reaction Technique

Directory of Open Access Journals (Sweden)

Tuti Susanti Legiastuti

2013-04-01

Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction

Rapid establishment of polymerase chain reaction-restriction ...

African Journals Online (AJOL)

2012-03-30

Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...

Diagnostic performance of fecal quantitative real-time polymerase chain reaction for detection of Lawsonia intracellularis–associated proliferative enteropathy in nursery pigs

DEFF Research Database (Denmark)

Pedersen, Ken Steen; Stege, Helle; Jensen, Tim Kåre

2013-01-01

Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L. intrace......Quantitative polymerase chain reaction (qPCR) tests for detection and quantification of Lawsonia intracellularis in feces from pigs have been developed. The objective of the current study was to evaluate the diagnostic performance of a fecal qPCR test for detection of nursery pigs with L...

Determining Annealing Temperatures for Polymerase Chain Reaction

Science.gov (United States)

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

Science.gov (United States)

Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

2001-08-15

Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

The impact of meningococcal polymerase chain reaction testing on laboratory confirmation of invasive meningococcal disease.

LENUS (Irish Health Repository)

Drew, Richard J

2012-03-01

Laboratory methods of diagnosis were examined for 266 children with invasive meningococcal disease. Seventy-five (36%) of 207 cases with bloodstream infection had both positive blood culture and blood meningococcal polymerase chain reaction (PCR), 130 (63%) negative blood culture and positive blood PCR, and 2 (1%) had positive blood culture and negative blood PCR. Sixty-three percent of cases were diagnosed by PCR alone.

Identification of Meat Species by Polymerase Chain Reaction (PCR) Technique

OpenAIRE

İLHAK, O. İrfan; ARSLAN, Ali

2014-01-01

The origin of horse, dog, cat, bovine, sheep, porcine, and goat meat was determined by the polymerase chain reaction (PCR) technique, using species-specific primers. Test mixtures of meat were prepared by adding 5%, 2.5%, 1%, 0.5%, and 0.1% levels of pork, horse, cat, or dog meat to beef, sheep, and goat meat. Samples taken from those combinations were analyzed by PCR for species determination. Mitochondrial DNA (mt DNA) fragments of 439, 322, 274, 271, 225, 212, and 157 bp for horse, dog, ca...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Laboratory procedures recommended for... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.

Science.gov (United States)

Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum

2012-12-01

The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.

PEMERIKSAAN BAKTERI LEPTOSPIRA PADA SAMPEL DARAH MANUSIA SUSPECT LEPTOSPIROSIS MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Sefrita Tri Utami

2014-01-01

Full Text Available ABSTRACTLeptospirosis is a zoonotic disease, which is caused by leptospira. Leptospirosis cases often show no specificclinical symptoms and is difficult to diagnose without testing samples in the laboratory. Testing using PCR(Polymerase Chain Reaction is considered more accurate than the other methods. Components required in theexamination Leptospira bacteria in human blood samples using PCR method is DNA template, DNA polymeraseenzyme, forward primer (PU1 and SU1 and reverse primer (Lep R1, nuclease free water, Mg 2 +, and dNTPs.Examination of Leptospira bacteria in human blood samples include sampling, DNA isolation, examination byPCR, and electrophoresis running.Key words: leptospirosis, Leptospira, PCR methodsABSTRAKLeptospirosis adalah penyakit zoonosis yang disebabkan oleh bakteri Leptospira. Kasus leptospirosis seringtidak menunjukkan gejala klinis yang spesifik dan sulit didiagnosis tanpa pengujian sampel di laboratorium.Pengujian dengan menggunakan metode PCR (Polymerase Chain Reaction dinilai lebih akurat dibandingkandengan metode yang lain. Komponen-komponen yang dibutuhkan dalam pemeriksaan bakteri Leptospira padasampel darah manusia menggunakan metode PCR adalah DNA template, enzim polymerase, Primer PU 1 danPrimer SU 1, Primer Lep R1, air, Mg2+ , dan dNTP. Pemeriksaan bakteri Leptospira pada sampel darah manusiameliputi pengambilan sampel, isolasi DNA, pemeriksaan dengan metode PCR, dan running elektroforesis.Kata kunci: leptospirosis, Leptospira, metode PCR

Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

Science.gov (United States)

Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

2017-11-27

Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

Evaluation of multiplex polymerase chain reaction as an alternative to conventional antibiotic sensitivity test

Directory of Open Access Journals (Sweden)

K. Rathore

2018-04-01

Full Text Available Aim: This study was designed to evaluate the potential of the use of multiplex polymerase chain reaction (PCR as an alternative to conventional antibiotic sensitivity test. Materials and Methods: Isolates of Staphylococcus aureus (total = 36 from clinical cases presented to Teaching Veterinary Clinical Complex of College of Veterinary and Animal Sciences (CVAS, Navania, Udaipur, were characterized by morphological, cultural, and biochemical methods. Then, the isolates were further subjected to molecular characterization by PCR targeting S. aureus-specific sequence (107 bp. Phenotypic antibiotic sensitivity pattern was analyzed by Kirby Bauer disc diffusion method against 11 commonly used antibiotics in veterinary medicine in and around Udaipur region. The genotypic antibiotic sensitivity pattern was studied against methicillin, aminoglycosides, and tetracycline targeting the gene mecA, aacA-aphD, and tetK by multiplex PCR. Results: There was 100% correlation between the phenotype and genotype of aminoglycoside resistance, more than 90% correlation for methicillin resistance, and 58.3% in the case tetracycline resistance. Conclusion: As there is a good correlation between phenotype and genotype of antibiotic resistance, multiplex PCR can be used as an alternative to the conventional antibiotic susceptibility testing, as it can give a rapid and true prediction of antibiotic sensitivity pattern.

A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

Science.gov (United States)

Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

2017-01-01

To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

Estimation of the reaction efficiency in polymerase chain reaction

NARCIS (Netherlands)

Lalam, N.

2006-01-01

Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

Molecular relapse in chronic myelogenous leukemia patients after bone marrow transplantation detected by polymerase chain reaction

International Nuclear Information System (INIS)

Sawyers, C.L.; Timson, L.; Clark, S.S.; Witte, O.N.; Champlin, R.; Kawasaki, E.S.

1990-01-01

Relapse of chronic myelogenous leukemia after bone marrow transplantation can be detected by using clinical, cytogenetic, or molecular tools. A modification of the polymerase chain reaction can be used in patients to detect low levels of the BCR-ABL-encoded mRNA transcript, a specific marker for chronic myelogenous leukemia. Early detection of relapse after bone marrow transplantation could potentially alter treatment decisions. The authors prospectively evaluated 19 patients for evidence of molecular relapse, cytogenetic relapse, and clinical relapse after bone marrow transplantation. They used the polymerase chain reaction to detect residual BCR-ABL mRNA in patients followed up to 45 months after treatment and found 4 patients with BCR-ABL mRNA expression following bone marrow transplantation. Fifteen patients did not express detectable BCR-ABL mRNA. All 19 patients remain in clinical remission. In this prospective study of chronic myelogenous leukemia patients treated with bone marrow transplantation, molecular relapse preceded cytogenetic relapse in those patients who persistently express BCR-ABL mRNA. They recommend using standard clinical and cytogenetic testing to make patient care decisions until further follow-up determines the clinical outcome of those patients with residual BCR-ABL mRNA transcripts detected by polymerase chain reaction

Use of competitive polymerase chain reaction to determine HIV-1 levels in response to antiviral treatments

NARCIS (Netherlands)

Bruisten, S. M.; Koppelman, M. H.; Roos, M. T.; Loeliger, A. E.; Reiss, P.; Boucher, C. A.; Huisman, H. G.

1993-01-01

OBJECTIVE: To develop a competitive polymerase chain reaction technique with which to evaluate the usefulness of HIV-1 level as a marker of response to antiviral treatment. DESIGN: HIV-1 sequences were assessed by competitive polymerase chain reaction in four subjects participating in a double-blind

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

Science.gov (United States)

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

Science.gov (United States)

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

Optimizing polymerase chain reaction testing for the diagnosis of pertussis: current perspectives

Directory of Open Access Journals (Sweden)

Arbefeville S

2015-09-01

Full Text Available Sophie Arbefeville, Patricia Ferrieri Department of Laboratory Medicine and Pathology, University of Minnesota Medical School, Minneapolis, MN, USA Abstract: Nucleic acid testing has revolutionized the diagnosis of pertussis in the clinical microbiology laboratory and has become the main avenue of testing for pertussis infection. Real-time polymerase chain reaction (RT-PCR is an important tool for timely diagnosis of pertussis and is more sensitive than culture. The most commonly amplified targets are the insertion-sequence (IS genes, which are found in multiple copies in the genome of Bordetella species. Some strains of Bordetella pertussis have more than 200 copies of IS481 in their genome. This high number of repeats allows RT-PCR assays to be very sensitive and makes nucleic acid testing two to three times more sensitive than culture. Despite these advantages, RT-PCR can give inaccurate results due to contamination or lack of specificity. Contamination can easily happen during specimen collection, DNA extraction, or nucleic acid amplification steps. To avoid contamination, laboratories need to have quality controls and good workflows in place. The poor specificity of the nucleic acid assays amplifying the IS genes is because they are found in various Bordetella species and, thus, not unique to a specific species. Bordetella holmesii, a more recently described Bordetella species found to be responsible for respiratory symptoms similar to pertussis in adolescents and adults, can be misidentified as B. pertussis in RT-PCR assays that amplify only the IS481 target. Use of multiple targets may improve specificity of RT-PCR assays for pertussis. In the past few years, the US Food and Drug Administration has cleared three commercial assays for the detection of B. pertussis in respiratory specimens. Several commercial assays and analyte-specific reagents, which are not US Food and Drug Administration cleared, are available for the detection of one

Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction

Directory of Open Access Journals (Sweden)

Sundaran S. Tinky

2015-04-01

Full Text Available Aim: The present study was undertaken to detect the presence of canine parvovirus (CPV in fecal samples of diarrheic dogs by conventional polymerase chain reaction (PCR and immunochromatographic (IC strip test and to compare the diagnostic potential of these tests. Materials and Methods: A total of 50 fecal samples collected from diarrheic dogs suspected for CPV infection were subjected to PCR using CPV-555 primer amplifying the gene coding for the VP1 protein. These samples were also tested by IC strip test using a commercial rapid Ag test kit. The results were statistically analyzed using McNemar test. Results: A total of 22 samples (44% were detected as positive by PCR, which yielded a specific amplicon of 583 bp. In IC strip test, 18 (36% samples were found to be positive. The sensitivity of the test as compared to PCR was found to be 72.22% and specificity was 92.86%. Positive predictive value and negative predictive value of IC strip test was found to be 88.89% and 81.25%, respectively. Statistical analysis of the results of PCR and IC assay using McNemar test revealed no significant difference (p>0.05. Conclusion: The IC strip test could be employed as a rapid field level diagnostic tool for the diagnosis of canine parvoviral diarrhea.

Use of polymerase chain reaction for detection of Chlamydia trachomatis

DEFF Research Database (Denmark)

Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna

1990-01-01

A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

Science.gov (United States)

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

Science.gov (United States)

White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

2015-01-01

Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

Role of Polymerase Chain Reaction (PCR) in the detection of ...

African Journals Online (AJOL)

Background: Staphylococcus aureus is mainly acquired from hospital infections and demonstrated the ability of developing resistance to many antibiotics. Polymerase Chain Reaction (PCR) was used to identify antibiotic-resistant isolates. This study was conducted in Al-Mujtahed, Al-Mouwasat and the Children Hospitals in ...

Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

Directory of Open Access Journals (Sweden)

Людмила Мар’янівна Іщенко

2016-11-01

Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

Science.gov (United States)

Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

2016-04-01

A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

Development of the polymerase chain reaction for diagnosis of chancroid.

Science.gov (United States)

Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

1993-01-01

The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

Polymerase Chain Reaction (PCR) provides a superior tool for the ...

African Journals Online (AJOL)

Polymerase Chain Reaction (PCR) provides a superior tool for the diagnosis of Pneumococcal Infection in Burkina Faso. Y Chaibou, M Congo/Ouedraogo, I Sanou, H Somlare, K Ouattara, CM Kienou, H Belem, E Sampo, SA Traore, R Traore/Ouedraogo, C Hatcher, L Mayer, X Wang, L Sangare ...

Development of cytomegalovirus (CMV) disease may be predicted in HIV-infected patients by CMV polymerase chain reaction and the antigenemia test

DEFF Research Database (Denmark)

Dodt, K K; Jacobsen, P H; Hofmann, B

1997-01-01

; OR: CMV PCR 10.0, antigenemia test 4.4 and CMV cultures 4.3. No clinical parameters had any significant predictive value in the stepwise multivariate model. CONCLUSIONS: The CMV PCR and the CMV antigenemia tests are both sensitive methods that may predict development of CMV disease up to several...... evaluated PCR and the antigenemia tests as methods for early detection of CMV disease. METHODS: Two-hundred HIV-seropositive subjects with CD4 T-cell counts below 100 x 10(6)/l were monitored with CMV polymerase chain reaction (PCR), the antigenemia test, blood cultures and CMV immunoglobulin (Ig) G and Ig...... showed that the CMV PCR, the antigenemia test and blood cultures all had significant predictive values for subsequent development of CMV disease with odds ratios (OR) of 30, 22 and 20. CMV serology had no predictive value. Multivariate analysis showed that the PCR method was superior to the other tests...

Prognostic significance of bi/oligoclonality in childhood acute lymphoblastic leukemia as determined by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Carlos Alberto Scrideli

2001-09-01

Full Text Available CONTEXT: The CDR-3 region of heavy-chain immunoglobulin has been used as a clonal marker in the study of minimal residual disease in children with acute lymphoblastic leukemia. Southern blot and polymerase chain reaction studies have demonstrated the occurrence of bi/oligoclonality in a variable number of cases of B-lineage acute lymphoblastic leukemia, a fact that may strongly interfere with the detection of minimal residual disease. Oligoclonality has also been associated with a poorer prognosis and a higher chance of relapse. OBJECTIVES: To correlate bi/oligoclonality, detected by polymerase chain reaction in Brazilian children with B-lineage acute lymphoblastic leukemia with a chance of relapse, with immunophenotype, risk group, and disease-free survival. DESIGN: Prospective study of patients’ outcome. SETTING: Pediatric Oncology Unit of the University Hospital, Faculty of Medicine of Ribeirão Preto, University of São Paulo. PARTICIPANTS: 47 children with acute lymphoblastic leukemia DIAGNOSTIC TEST: Polymerase chain reaction using consensus primers for the CDR-3 region of heavy chain immunoglobulin (FR3A, LJH and VLJH for the detection of clonality. RESULTS: Bi/oligoclonality was detected in 15 patients (31.9%. There was no significant difference between the groups with monoclonality and biclonality in terms of the occurrence of a relapse (28.1% versus 26.1%, presence of CALLA+ (81.2% versus 80% or risk group (62.5% versus 60%. Disease-free survival was similar in both groups, with no significant difference (p: 0.7695. CONCLUSIONS: We conclude that bi/oligoclonality was not associated with the factors investigated in the present study and that its detection in 31.9% of the patients may be important for the study and monitoring of minimal residual disease.

UVB DNA dosimeters analyzed by polymerase chain reactors

International Nuclear Information System (INIS)

Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL

1997-01-01

Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)

Polymerase chain Reaction in molecular biotechnology; appropriate technology for developing countries

NARCIS (Netherlands)

Felice, A. E.; Alshinawi, C.

1996-01-01

The product of the Polymerase Chain Reaction (PCR) may be generically suitable for four types of investigations: Discovery PCR, Analytical PCR, Modification by PCR, and Synthetic PCR. Despite the potential problem of contamination with extraneous DNA, PCR is relatively simple and inexpensive, and

Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

Science.gov (United States)

Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

1992-04-01

Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

Real-time TaqMan polymerase chain reaction to quantify the effects ...

African Journals Online (AJOL)

TaqMan polymerase chain reaction was developed to quantify the number of Bifidobacterium. We used this assay to detect genomic DNA of Bifidobacterium in the intestinal tract digesta of piglets, including duodenum, jejunum, ileum, cecum and colon. Our results indicated that, developed new real-time quantitative PCR ...

Effects of Superparamagnetic Nanoparticle Clusters on the Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Toshiaki Higashi

2012-04-01

Full Text Available The polymerase chain reaction (PCR method is widely used for the reproduction and amplification of specific DNA segments, and a novel PCR method using nanomaterials such as gold nanoparticles has recently been reported. This paper reports on the effects of superparamagnetic nanoparticles on PCR amplification without an external magnetic field, and clarifies the mechanism behind the effects of superparamagnetic particle clusters on PCR efficiency by estimating the structures of such clusters in PCR. It was found that superparamagnetic nanoparticles tend to inhibit PCR amplification depending on the structure of the magnetic nanoparticle clusters. The paper also clarifies that Taq polymerase is captured in the spaces formed among magnetic nanoparticle clusters, and that it is captured more efficiently as a result of their motion from heat treatment in PCR thermal cycles. Consequently, Taq polymerase that should be used in PCR is reduced in the PCR solution. These outcomes will be applied to novel PCR techniques using magnetic particles in an external magnetic field.

Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

Directory of Open Access Journals (Sweden)

Kordo B. A. Saeed

2013-11-01

Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

Science.gov (United States)

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

Whole Blood Polymerase Chain Reaction in a Neonate with Disseminated Herpes Simplex Virus Infection and Liver Failure

Directory of Open Access Journals (Sweden)

Jennifer A. Scoble

2013-10-01

Full Text Available A late preterm neonate born by cesarean section with intact membranes presented at 9 days of life with shock and liver failure. Surface cultures were negative but whole blood polymerase chain reaction was positive for herpes simplex virus type 2, underscoring the value of this test in early diagnosis of perinatally acquired disseminated herpes simplex virus infection without skin lesions.

Detection of clarithromycin-resistant Helicobacter pylori by polymerase chain reaction using residual samples from rapid urease test

Directory of Open Access Journals (Sweden)

Jae-Sik Jeon

2017-01-01

Full Text Available Background: Approximately 50% of the world population is infected with Helicobacter pylori, which corresponds to a high infection rate. Furthermore, the incidence of antibiotic-resistant H. pylori has increased with the recent rise in use of antibiotics for H. pylori elimination, suggesting growing treatment failures. Aim: The study was aimed to assess the use of residual samples from rapid urease test (RUT for biomolecular testing as an effective and accurate method to detect antibiotic-resistant H. pylori. Settings and Design: This study was a retrospective study performed using data obtained from medical records of previously isolated H. pylori strains. Materials and Methods: RUT was conducted for 5440 biopsy samples from individuals who underwent health examination in South Korea. Subsequently, 469 RUT residual samples were randomly selected and subjected to polymerase chain reaction (PCR to detect antibiotic-resistant H. pylori. Statistical Analysis Used: The Chi-square test was used to analyse categorical data. P < 0.05 was considered statistically significant. Results: The results showed a concordance between the results of PCR and conventional RUT in 450 of 469 samples, suggesting that the H. pylori PCR test is a time- and cost-effective detection method. Conclusions: This study demonstrated that PCR test can aid physicians to prescribe the appropriate antibiotics at the time of diagnosis, thus preventing the reduction in H. pylori eradication due to antibiotic resistance, averting progression to serious diseases and increasing the treatment success rate.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Sharma, Shyam Sundar [Govt. women Engineering College, Ajmer (India); Agrawal, Kailash [Centre for Converging Technologies, University of Rajasthan, Jaipur 302004 (India); Department of Botany, University of Rajasthan, Jaipur 302004 (India)

2016-05-06

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

NARCIS (Netherlands)

Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

Polymerase chain reaction for detection of Mycobacterium leprae in nasal swab specimens

NARCIS (Netherlands)

de Wit, M. Y.; Douglas, J. T.; McFadden, J.; Klatser, P. R.

1993-01-01

The polymerase chain reaction based on the selective amplification of a 531-bp fragment of the gene encoding the proline-rich antigen of Mycobacterium leprae was applied to nasal swab specimens from leprosy patients, occupational contacts, and endemic and nonendemic controls. To prevent

Molecularly imprinted nanoparticles for inhibiting ribonuclease in reverse transcriptase polymerase chain reaction

DEFF Research Database (Denmark)

Feng, Xiaotong; Ashley, Jon; Zhou, Tongchang

2018-01-01

Molecularly imprinted nanoparticles (nanoMIPs) are synthesized via a solid-phase approach using RNase as the template. The feasibility of employing the nanoMIPs as RNase inhibitor is successfully demonstrated in reverse transcriptase polymerase chain reaction (RT-PCR) assays, suggesting the tailor...

Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

NARCIS (Netherlands)

Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

2003-01-01

Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

Development of Capillary Loop Convective Polymerase Chain Reaction Platform with Real-Time Fluorescence Detection

Directory of Open Access Journals (Sweden)

Wen-Pin Chou

2017-02-01

Full Text Available Polymerase chain reaction (PCR has been one of the principal techniques of molecular biology and diagnosis for decades. Conventional PCR platforms, which work by rapidly heating and cooling the whole vessel, need complicated hardware designs, and cause energy waste and high cost. On the other hand, partial heating on the various locations of vessels to induce convective solution flows by buoyancy have been used for DNA amplification in recent years. In this research, we develop a new convective PCR platform, capillary loop convective polymerase chain reaction (clcPCR, which can generate one direction flow and make the PCR reaction more stable. The U-shaped loop capillaries with 1.6 mm inner diameter are designed as PCR reagent containers. The clcPCR platform utilizes one isothermal heater for heating the bottom of the loop capillary and a CCD device for detecting real-time amplifying fluorescence signals. The stable flow was generated in the U-shaped container and the amplification process could be finished in 25 min. Our experiments with different initial concentrations of DNA templates demonstrate that clcPCR can be applied for precise quantification. Multiple sample testing and real-time quantification will be achieved in future studies.

Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis.

Science.gov (United States)

Shoughy, Samir S; Alkatan, Hind M; Al-Abdullah, Abdulelah A; El-Khani, Albarah; de Groot-Mijnes, Jolanda Df; Tabbara, Khalid F

2015-01-01

Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis. A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein-Barr virus, and rubella virus. There were six male and six female patients. The mean age was 43 years, with an age range of 11-82 years. All 12 cases presented with unilateral anterior uveitis. In four (33%) patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein-Barr virus. Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis.

Pathogen detection by the polymerase chain reaction

Energy Technology Data Exchange (ETDEWEB)

Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)

1994-05-01

In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

Science.gov (United States)

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Polymerase chain reaction: Theory, practice and application: A review

Directory of Open Access Journals (Sweden)

S E Atawodi

2010-01-01

Full Text Available Polymerase Chain Reaction (PCR is a rapid procedure for in vitro enzymatic amplification of specific DNA sequences using two oligonucleotide primers that hybridize to opposite strands and flank the region of interest in the target DNA. Repetitive cycles involving template denaturation, primer annealing and the extension of the annealed primers by DNA polymerase, result in the exponential accumulation of a specific fragment whose termini are defined by 5′ end of the primers. The primer extension products synthesized in one cycle can serve as a template in the next. Hence the number of target DNA copies approximately doubles at every cycle. Since its inception, PCR has had an enormous impact in both basic and diagnostic aspects of molecular biology. Like the PCR itself, the number of applications has been accumulating exponentially. It is therefore recommended that relevant scientists and laboratories in developing countries like Nigeria should acquire this simple and relatively inexpensive, but rather robust technology.

Building block synthesis using the polymerase chain assembly method.

Science.gov (United States)

Marchand, Julie A; Peccoud, Jean

2012-01-01

De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

Science.gov (United States)

Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

National Research Council Canada - National Science Library

McAvin, James C; Escamilla, Elizabeth M; Blow, James A; Turell, Micahel J; Quintana, Miguel; Bowles, David E; Swaby, James A; Barnes, William J; Huff, William B; Lahman, Kenton L

2005-01-01

...) reverse transcription-polymerase chain reaction assays were developed for screening and seroype identification of infected mosquito vectors and human sera using a field-deployable, fluorometric thermocycler...

Potential testing of reprocessing procedures by real-time polymerase chain reaction: A multicenter study of colonoscopy devices.

Science.gov (United States)

Valeriani, Federica; Agodi, Antonella; Casini, Beatrice; Cristina, Maria Luisa; D'Errico, Marcello Mario; Gianfranceschi, Gianluca; Liguori, Giorgio; Liguori, Renato; Mucci, Nicolina; Mura, Ida; Pasquarella, Cesira; Piana, Andrea; Sotgiu, Giovanni; Privitera, Gaetano; Protano, Carmela; Quattrocchi, Annalisa; Ripabelli, Giancarlo; Rossini, Angelo; Spagnolo, Anna Maria; Tamburro, Manuela; Tardivo, Stefano; Veronesi, Licia; Vitali, Matteo; Romano Spica, Vincenzo

2018-02-01

Reprocessing of endoscopes is key to preventing cross-infection after colonoscopy. Culture-based methods are recommended for monitoring, but alternative and rapid approaches are needed to improve surveillance and reduce turnover times. A molecular strategy based on detection of residual traces from gut microbiota was developed and tested using a multicenter survey. A simplified sampling and DNA extraction protocol using nylon-tipped flocked swabs was optimized. A multiplex real-time polymerase chain reaction (PCR) test was developed that targeted 6 bacteria genes that were amplified in 3 mixes. The method was validated by interlaboratory tests involving 5 reference laboratories. Colonoscopy devices (n = 111) were sampled in 10 Italian hospitals. Culture-based microbiology and metagenomic tests were performed to verify PCR data. The sampling method was easily applied in all 10 endoscopy units and the optimized DNA extraction and amplification protocol was successfully performed by all of the involved laboratories. This PCR-based method allowed identification of both contaminated (n = 59) and fully reprocessed endoscopes (n = 52) with high sensibility (98%) and specificity (98%), within 3-4 hours, in contrast to the 24-72 hours needed for a classic microbiology test. Results were confirmed by next-generation sequencing and classic microbiology. A novel approach for monitoring reprocessing of colonoscopy devices was developed and successfully applied in a multicenter survey. The general principle of tracing biological fluids through microflora DNA amplification was successfully applied and may represent a promising approach for hospital hygiene. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Assessing the accuracy of a polymerase chain reaction test for Ichthyophonus hoferi in Yukon River Chinook salmon Oncorhynchus tshawytscha.

Science.gov (United States)

Whipps, Christopher M; Burton, Tamara; Watral, Virginia G; St-Hilaire, Sophie; Kent, Michael L

2006-01-30

Ichthyophonus hoferi Plehn & Mulsow, 1911, is a cosmopolitan, protistan pathogen of marine fishes. It is prevalent in mature returning Chinook salmon Oncorhynchus tshawytscha in the Yukon River watershed, and may be associated with prespawning mortality. We developed and evaluated a polymerase chain reaction (PCR) test for I. hoferi using primers specific to the parasite's small subunit rDNA. The test has a minimum detection limit of approximately 10(-5) parasite spores per reaction and does not cross-react with the closely related salmon parasites Dermocystidium salmonis or Sphaerothecum destruens. Sensitivity and specificity of the PCR test used on somatic muscle and heart tissue for detecting infected fish were determined using 334 Chinook salmon collected from the Yukon River at 2 locations (Tanana and Emmonak) in 2003 and 2004. The true infection status of the fish was determined by testing somatic muscle, heart and kidney tissue using histological evaluation, culture, and PCR. The severity of infection was grouped into 2 categories, light and heavy infection. The probability of detecting a heavily infected fish (sensitivity of the test) was generally much higher than the probability of detecting light infection, suggesting that more than one tissue and/or method should be used to accurately detect light or early infection by I. hoferi. The probability of correctly identifying a negative fish (specificity of the test) was always greater than 94% regardless of the tissue used, infection severity, sampling site or year of collection.

Evidence of simian retrovirus type D by polymerase chain reaction.

Science.gov (United States)

Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

2017-06-01

Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Zika virus RNA polymerase chain reaction on the utility channel of a commercial nucleic acid testing system.

Science.gov (United States)

Boujnan, Mohamed; Duits, Ashley J; Koppelman, Marco H G M

2018-03-01

Several countries have implemented safety strategies to reduce the risk of Zika virus (ZIKV) transmission through blood transfusion. These strategies have included nucleic acid amplification testing (NAT) of blood donations. In this study, a new real-time polymerase chain reaction (PCR) assay including internal control for the detection of ZIKV on the cobas omni Utility Channel (UC) on the cobas 6800 system is presented. PCR conditions and primer/probe concentrations were optimized on the LightCycler 480 instrument. Optimized conditions were transferred to the cobas omni UC on the cobas 6800 system. Subsequently, the limit of detection (LOD) in plasma and urine, genotype inclusivity, specificity, cross-reactivity, and clinical sensitivity were determined. The 95% LOD of the ZIKV PCR assay on the cobas 6800 system was 23.0 IU/mL (95% confidence interval [CI], 16.5-37.5) in plasma and 24.5 IU/mL (95% CI, 13.4-92.9) in urine. The assay detected African and Asian lineages of ZIKV. The specificity was 100%. The clinical concordance between the newly developed ZIKV PCR assay and the investigational Roche cobas Zika NAT test was 83% (24/29). We developed a sensitive ZIKV PCR assay on the cobas omni UC on the cobas 6800 system. The assay can be used for large-scale screening of blood donations for ZIKV or for testing of blood donors returning from areas with ZIKV to avoid temporal deferral. This study also demonstrates that the cobas omni UC on the cobas 6800 system can be used for in-house-developed PCR assays. © 2018 AABB.

Babesia microti real-time polymerase chain reaction testing of Connecticut blood donors: potential implications for screening algorithms.

Science.gov (United States)

Johnson, Stephanie T; Van Tassell, Eric R; Tonnetti, Laura; Cable, Ritchard G; Berardi, Victor P; Leiby, David A

2013-11-01

Babesia microti, an intraerythrocytic parasite, has been implicated in transfusion transmission. B. microti seroprevalence in Connecticut (CT) blood donors is approximately 1%; however, it is not known what percentage of donors is parasitemic and poses a risk for transmitting infection. Therefore, we determined the prevalence of demonstrable B. microti DNA in donors from a highly endemic area of CT and compared observed rates with concurrent immunofluorescence assay (IFA) testing results. Blood samples from consenting donors in southeastern CT were collected from mid-August through early October 2009 and tested by IFA for immunoglobulin G antibodies and real-time polymerase chain reaction (PCR) for B. microti DNA. IFA specificity was determined using blood donor samples collected in northwestern Vermont (VT), an area nonendemic for Babesia. Of 1002 CT donors, 25 (2.5%) were IFA positive and three (0.3%) were real-time PCR positive. Among the three real-time PCR-positive donors, two were also IFA positive, while one was IFA negative and may represent a window period infection. The two IFA- and real-time PCR-positive donors appeared to subsequently clear infection. The other real-time PCR-positive donor did not provide follow-up samples. Of 1015 VT donors tested by IFA, only one (0.1%) was positive, but may have acquired infection during travel to an endemic area. We prospectively identified several real-time PCR-positive blood donors, including an IFA-negative real-time PCR-positive donor, in an area highly endemic for B. microti. These results suggest the need to include nucleic acid testing in planned mitigation strategies for B. microti. © 2013 American Association of Blood Banks.

Rapid Detection Of Escherichia coli Enterohemorragic (EHEC) Bacteria by PCR (Polymerase Chain Reaction) methods

International Nuclear Information System (INIS)

Sudrajat, Dadang; R, Maria Lina; Suhadi, F.

2000-01-01

A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment

Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK

Directory of Open Access Journals (Sweden)

Kosuke Nakamura

2016-06-01

Real-time polymerase chain reaction (PCR detection method for unauthorized genetically modified (GM papaya (Carica papaya L. line PRSV-YK (PRSV-YK detection method was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976. Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats.

Science.gov (United States)

Lorch, Jeffrey M; Gargas, Andrea; Meteyer, Carol Uphoff; Berlowski-Zier, Brenda M; Green, D Earl; Shearn-Bochsler, Valerie; Thomas, Nancy J; Blehert, David S

2010-03-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

Science.gov (United States)

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

Science.gov (United States)

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

Directory of Open Access Journals (Sweden)

Vanessa Suin

2014-01-01

Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

Identifying of meat species using polymerase chain reaction (PCR)

International Nuclear Information System (INIS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-01-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing

Identifying of meat species using polymerase chain reaction (PCR)

Energy Technology Data Exchange (ETDEWEB)

Foong, Chow Ming; Sani, Norrakiah Abdullah [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600, Bangi, Selangor (Malaysia)

2013-11-27

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Detection of adenovirus hexon sequence in a cat by polymerase chain reaction(short communication)

NARCIS (Netherlands)

Horzinek, M.C.; Lakatos, B.; Farkas, J.; Egberink, H.F.; Vennema, H.; Benko, M.

1999-01-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in pharyngeal and rectal swab samples of a cat seropositive for adenovirus and suffering from transient hepatic failure. The samples were taken at a one-year interval, and both faecal samples as well as the second pharyngeal

Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Stephen Duffett

2012-01-01

Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

OpenAIRE

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-01-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the in...

Thermally multiplexed polymerase chain reaction.

Science.gov (United States)

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

International Nuclear Information System (INIS)

Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie

2009-01-01

Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

Science.gov (United States)

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Urine Nested Polymerase Chain Reaction in Neonatal Septicemia.

Science.gov (United States)

Das, B K; Suri, Shipra; Nath, Gopal; Prasad, Rajniti

2015-08-01

This cross-sectional study was done to evaluate diagnostic efficacy of urine nested polymerase chain reaction (PCR) using broad-range 16SrDNA PCR-based amplification, followed by restriction analysis and sequencing in neonatal septicemia. The study included 50 babies; 48% had vaginal delivery, 46% were preterm, 20% had a history of prolonged rupture of membranes and 56% were low birth weight (≤2500 g). Clinical presentations were lethargy (96%), respiratory distress (80%) and bleeding diathesis (16%). Absolute neutrophil count value, negative predictive value and accuracy of nested PCR were 100, 60, 78.9, 100 and 84%, respectively, compared with blood culture. Nested PCR can detect most bacteria in single assay and identify unusual and unexpected causal agents. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

Science.gov (United States)

Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

2016-06-01

We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

was performed. The sensitivity and specificity were 85 and 100% 934/40 and 77/77) respectively. A non-radioactive labelling system BluGENE was evaluated on all specimens, and found to be as effective as P32-labelling. To increase the speed and convenience of detection, a dot blot system was tested......To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls

OpenAIRE

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-01-01

Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...

Detection of Salmonella typhi by nested polymerase chain reaction in blood, urine, and stool samples

NARCIS (Netherlands)

Hatta, Mochammad; Smits, Henk L.

2007-01-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica serovar Typhi was used for the detection of the pathogen in blood, urine, and stool samples from 131 patients with clinical suspicion of typhoid fever. The sensitivity of blood culture, the PCRs with blood, urine, and feces,

STUDY OF UROGENITAL TRACT MICROFLORA OF DNEPROPETROVSK FEMALES BY POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Honcharova S.Y.

2015-08-01

Full Text Available We isolated and identified the pathogens from the urogenital tract in 100 women of 26-55 years in Diagnostic Center of Dnepropetrovsk Medical Academy by polymerase chain reaction. It was found that all investigated microflora was represented by HPV of high and low cancer risk - HSV type 1+2, Ureaplasma urealyticum, Chlamydia trachomatis, Trichomonas vaginalis, Mycoplasma hominis, and Candida yeast species. The most abundant pathogens from the urogenital tract were HPV, Ureaplasma urealyticum, and Chlamydia trachomatis.

Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

The Importance of IgG Avidity and the Polymerase Chain Reaction in Treating Toxoplasmosis during Pregnancy: Current Knowledge

Directory of Open Access Journals (Sweden)

João Bortoletti Filho

2013-01-01

Full Text Available A brief report on the nature and epidemiology of T. gondii infection is firstly presented. The importance of the specific IgG avidity test and polymerase chain reaction (PCR for toxoplasmosis is discussed, along with their significance and importance as auxiliary methods for determining the most likely time for the initial infection by this coccidian and for defining the therapeutic strategy. Lastly, practical comments are made in relation to the classical therapeutic regimens, with special attention to the indications for fetal treatment, when this is necessary.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

Science.gov (United States)

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY)

OpenAIRE

Susan Maphilindawati Noor; Pratiwi Pujilestari Sudarmono; Asmarani Kusumawati; Anis Karuniawati

2014-01-01

Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR) is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4), B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle...

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

Science.gov (United States)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Polymerase chain reaction as a tool for developing stress protein probes

Energy Technology Data Exchange (ETDEWEB)

Cochrane, B.J.; Mattley, Y.D. (Univ. of South Florida, Tampa, FL (United States). Dept. of Biology); Snell, T.W. (Georgia Inst. of Tech., Atlanta, GA (United States). Div. of Biology)

1994-08-01

Because of the high degree of evolutionary conservation of stress proteins, potential exists for the development of nucleic acid probes from particular species that could be used to monitor stress-related changes in mRNA abundance. The polymerase chain reaction (PCR) is a powerful tool that can be applied to the generation of these probes, provided that primer sequences can be identified that specifically amplify sequences of interest from a wide variety of organisms. The authors identified such sequences from multiple alignments of published chaperonin and stress-70 sequences, and tested their ability to amplify appropriately sized fragments from genomic DNA from a variety of vertebrates and invertebrates. Although no primer pair could be used successfully with all species, the authors were able to derive specific products from most species by testing different pairs. One primer pair for chaperonin proved particularly useful. Products were obtained from all tested species, and with a single exception (human), these primers appeared to amplify a single copy sequence. The authors determined the nucleotide sequence of the product obtained from the rotifer Brachionus plicatilis and determined by phylogenetic analysis of the inferred protein product that the product obtained is most likely derived from a rotifer DNA template. Finally, the authors show that this product can be used to detect changes in abundance of homologous mRNA in heat-stressed rotifers.

Rapid and specific identification of Yersinia pestis by using a nested polymerase chain reaction procedure.

OpenAIRE

Campbell, J; Lowe, J; Walz, S; Ezzell, J

1993-01-01

We developed a 4-h nested polymerase chain reaction assay that detected a region of the plasminogen activator gene of Yersinia pestis in 100% of 43 Y. pestis strains isolated from humans, rats, and fleas yet was unreactive with the closely related species Yersinia enterocolitica and Yersinia pseudotuberculosis.

Theory and applications of the polymerase chain reaction.

Science.gov (United States)

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Peripheral Blood Leukocytes and Serum Nested Polymerase Chain Reaction Are Complementary Methods for Monitoring Active Cytomegalovirus Infection in Transplant Patients

Directory of Open Access Journals (Sweden)

PD Andrade

2013-01-01

Full Text Available BACKGROUND: Human cytomegalovirus is an important cause of morbidity and mortality in immunocompromised patients. Qualitative polymerase chain reaction (PCR has proven to be a sensitive and effective technique in defining active cytomegalovirus infection, in addition to having low cost and being a useful test for situations in which there is no need for quantification. Real-time PCR has the advantage of quantification; however, the high cost of this methodology makes it impractical for routine use.

Development, validation, and standardization of polymerase chain reaction-based detection of E-coli O157

DEFF Research Database (Denmark)

Abdulmawjood, A.; Bulte, M.; Roth, S.

2004-01-01

A diagnostic polymerase chain reaction assay was developed for the detection of E. coli O157 as the first part of a multicenter validation and standardization project. The assay is based on amplification of sequences of the rfbE O157 gene and includes an internal amplification control. The select...

Accurate Digital Polymerase Chain Reaction Quantification of Challenging Samples Applying Inhibitor-Tolerant DNA Polymerases.

Science.gov (United States)

Sidstedt, Maja; Romsos, Erica L; Hedell, Ronny; Ansell, Ricky; Steffen, Carolyn R; Vallone, Peter M; Rådström, Peter; Hedman, Johannes

2017-02-07

Digital PCR (dPCR) enables absolute quantification of nucleic acids by partitioning of the sample into hundreds or thousands of minute reactions. By assuming a Poisson distribution for the number of DNA fragments present in each chamber, the DNA concentration is determined without the need for a standard curve. However, when analyzing nucleic acids from complex matrixes such as soil and blood, the dPCR quantification can be biased due to the presence of inhibitory compounds. In this study, we evaluated the impact of varying the DNA polymerase in chamber-based dPCR for both pure and impure samples using the common PCR inhibitor humic acid (HA) as a model. We compared the TaqMan Universal PCR Master Mix with two alternative DNA polymerases: ExTaq HS and Immolase. By using Bayesian modeling, we show that there is no difference among the tested DNA polymerases in terms of accuracy of absolute quantification for pure template samples, i.e., without HA present. For samples containing HA, there were great differences in performance: the TaqMan Universal PCR Master Mix failed to correctly quantify DNA with more than 13 pg/nL HA, whereas Immolase (1 U) could handle up to 375 pg/nL HA. Furthermore, we found that BSA had a moderate positive effect for the TaqMan Universal PCR Master Mix, enabling accurate quantification for 25 pg/nL HA. Increasing the amount of DNA polymerase from 1 to 5 U had a strong effect for ExTaq HS, elevating HA-tolerance four times. We also show that the average Cq values of positive reactions may be used as a measure of inhibition effects, e.g., to determine whether or not a dPCR quantification result is reliable. The statistical models developed to objectively analyze the data may also be applied in quality control. We conclude that the choice of DNA polymerase in dPCR is crucial for the accuracy of quantification when analyzing challenging samples.

DNA polymerase hybrids derived from the family-B enzymes of Pyrococcus furiosus and Thermococcus kodakarensis: improving performance in the polymerase chain reaction.

Science.gov (United States)

Elshawadfy, Ashraf M; Keith, Brian J; Ee Ooi, H'Ng; Kinsman, Thomas; Heslop, Pauline; Connolly, Bernard A

2014-01-01

The polymerase chain reaction (PCR) is widely applied across the biosciences, with archaeal Family-B DNA polymerases being preferred, due to their high thermostability and fidelity. The enzyme from Pyrococcus furiosus (Pfu-Pol) is more frequently used than the similar protein from Thermococcus kodakarensis (Tkod-Pol), despite the latter having better PCR performance. Here the two polymerases have been comprehensively compared, confirming that Tkod-Pol: (1) extends primer-templates more rapidly; (2) has higher processivity; (3) demonstrates superior performance in normal and real time PCR. However, Tkod-Pol is less thermostable than Pfu-Pol and both enzymes have equal fidelities. To understand the favorable properties of Tkod-Pol, hybrid proteins have been prepared. Single, double and triple mutations were used to site arginines, present at the "forked-point" (the junction of the exonuclease and polymerase channels) of Tkod-Pol, at the corresponding locations in Pfu-Pol, slightly improving PCR performance. The Pfu-Pol thumb domain, responsible for double-stranded DNA binding, has been entirely replaced with that from Tkod-Pol, again giving better PCR properties. Combining the "forked-point" and thumb swap mutations resulted in a marked increase in PCR capability, maintenance of high fidelity and retention of the superior thermostability associated with Pfu-Pol. However, even the arginine/thumb swap mutant falls short of Tkod-Pol in PCR, suggesting further improvement within the Pfu-Pol framework is attainable. The significance of this work is the observation that improvements in PCR performance are easily attainable by blending elements from closely related archaeal polymerases, an approach that may, in future, be extended by using more polymerases from these organisms.

Early Bronchus-Associated Lymphoid Tissue Lymphoma Diagnosed with Immunoglobulin Heavy Chain Molecular Testing

Directory of Open Access Journals (Sweden)

Pen Li

2016-01-01

Full Text Available When extranodal marginal zone B-cell lymphoma of mucosa associated lymphoid tissue (MALT, a low grade B-cell lymphoma, arises in the lung it is referred to as bronchus-associated lymphoid tissue (BALT lymphoma. We describe a patient with a history of Sjögren’s syndrome and rheumatoid arthritis with dyspnea and imaging consistent with lymphoid interstitial pneumonia (LIP. However, while histology and immunohistochemistry lacked definitive features of a lymphoma, immunoglobulin heavy chain (IgH polymerase chain reaction testing demonstrated B-cell monoclonality, consistent with an early BALT lymphoma.

Functionalized tetrapod-like ZnO nanostructures for plasmid DNA purification, polymerase chain reaction and delivery

International Nuclear Information System (INIS)

Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong

2007-01-01

Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

Science.gov (United States)

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Spread and epidemiology of Clostridium difficile polymerase chain reaction ribotype 027/toxinotype III in The Netherlands

NARCIS (Netherlands)

Goorhuis, A.; van der Kooi, T.; Vaessen, N.; Dekker, F. W.; van den Berg, R.; Harmanus, C.; van den Hof, S.; Notermans, D. W.; Kuijper, E. J.

2007-01-01

After reports of emerging outbreaks in Canada and the United States, Clostridium difficile-associated disease (CDAD) due to polymerase chain reaction ribotype 027 was detected in 2 medium-to-large hospitals in The Netherlands in 2005. National surveillance was initiated to investigate the spread and

Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

OpenAIRE

Harmey, Judith H.; Harmey, Matthew A.

1993-01-01

We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

The Role of Multiplex Polymerase Chain Reaction in Detecting Etiological Causes of Bacterial Prostatitis Associated Benign Prostatic Hyperplasia

Directory of Open Access Journals (Sweden)

Bramastha Rosadi

2015-01-01

Full Text Available Background: Benign Prostatic Hyperplasia (BPH has been correlated with chronic prostatitis according recent study. Chronic pelvic pain is the chief complain of BPH followed by prostatitis. The gold standard of the etiological diagnosis is urine culture, but the negativity rate is still high. Multiplex polymerase chain reaction (PCR as a diagnostic tool in search of etiological causes could identify microorganism on DNA level. This research aims to find out the role of multiplex polymerase chain reaction as diagnostic tools on prostatitis patients. Material and Method: A total of 12 samples collected during the TURP procedure in Sanglah General Hospital Denpasar – Bali from February until May 2015. All of the samples has been diagnosed prostatitis clinically and perform urine culture test. The prostate specimen taken was sent to the Pathological anatomy for histopathology diagnostic and underwent multiplex PCR for etiologic diagnostic. Result: 12 samples have been declared as prostatitis based on histopathology examination, and then were analyzed using multiplex PCR. 10 samples were positive (6 were E. coli, 2 were C. trachomatis, the rest were N. gonorrhea and P. aeruginosa. The urine culture revealed 9 positive, within the result 6 were E. coli, and the others were P. aeruginosa, M. morganii and A. haemolyticus. Conclusion: In prostatitis patient, the etiological diagnostic was important. Multiplex PCR as diagnostic tools could detect the microorganism on a negative urine culture. The combination of the urine culture test and multiplex PCR revealed a better result on etiologic diagnosis which leads to a better management of the disease. 

Development of nested polymerase chain reaction-based diagnosis of duck enteritis virus and detection of DNA polymerase gene from non-descriptive duck breeds of West Bengal, India

Directory of Open Access Journals (Sweden)

Partha Sarathi Mandal

2017-03-01

Full Text Available Aim: The study was undertaken to detect the clinical signs, postmortem lesions of embryonated duck plague (DP infected eggs, and histopathological changes of chorioallantoic membrane (CAM in non-descriptive ducks of West Bengal with special reference to standardize nested polymerase chain reaction (PCR. Materials and Methods: After postmortem of suspected carcasses, samples were collected for virus isolation and identification through specific pathogen free (Khaki Campbell embryonated duck eggs. PCR was also done as confirmatory test after doing postmortem of duck embryos. DP specific nested PCR was standardized for better confirmation of the disease. Sensitivity of nested primers was also tested for DP virus. Results: Gross, postmortem and histopathological changes were prominent in dead embryos. First set of primer was able to detect 602 bp fragments of DNA polymerase gene of duck enteritis virus from infected CAM. Subsequently, a DP specific nested PCR which was very much sensitive for very small amount of viral genome was successfully standardized. After NCBI blast nucleotide sequence of nested PCR product (Accession No. HG425076 showed homology with the sequences data available in GenBank. Conclusion: The study concludes that PCR assay is very much helpful to diagnose DP disease and developed nested PCR is a double confirmatory diagnostic tool for DP.

Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

International Nuclear Information System (INIS)

Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

1990-01-01

The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

Emergence of Clostridium difficile infection due to a new hypervirulent strain, polymerase chain reaction ribotype 078

NARCIS (Netherlands)

Goorhuis, Abraham; Bakker, Dennis; Corver, Jeroen; Debast, Sylvia B.; Harmanus, Celine; Notermans, Daan W.; Bergwerff, Aldert A.; Dekker, Frido W.; Kuijper, Ed J.

2008-01-01

Since 2005, an increase in the prevalence of Clostridium difficile infection (CDI) due to polymerase chain reaction ribotype 078 has been noticed in The Netherlands. This strain has also been identified as the predominant strain in pigs and calves. CDI caused by type 078 was studied in relation to

A SEROLOGIC AND POLYMERASE CHAIN REACTION SURVEY OF EQUINE HERPESVIRUS IN BURCHELL'S ZEBRAS (EQUUS QUAGGA), HARTMANN'S MOUNTAIN ZEBRAS (EQUUS ZEBRA HARTMANNAE), AND THOMSON'S GAZELLES (EUDORCAS THOMSONII) IN A MIXED SPECIES SAVANNAH EXHIBIT.

Science.gov (United States)

Lopez, Karen M; Fleming, Gregory J; Mylniczenko, Natalie D

2016-12-01

Reports of equine herpesvirus (EHV) 1 and EHV-9 causing clinical disease in a wide range of species have been well documented in the literature. It is thought that zebras are the natural hosts of EHV-9 both in the wild and in captive collections. Concerns about potential interspecies transmission of EHV-1 and EHV-9 in a mixed species savannah exhibit prompted serologic and polymerase chain reaction surveys. Eighteen Burchell's zebras ( Equus quagga ), 11 Hartmann's mountain zebras ( Equus zebra hartmannae), and 14 Thomson's gazelles ( Eudorcas thomsonii ) cohabitating the same exhibit were examined for EHV-1 virus neutralization titers, and evidence of virus via EHV 1-5 polymerase chain reactions. None of the animals had previous exposure to vaccination with EHV-1 or EHV-4. All tested zebras had positive EHV-1 titers, ranging from 4 to 384. All zebras and Thomson's gazelles had negative polymerase chain reaction results for all targeted equine herpesviruses. EHV-9-specific assays are not available but EHV-1, EHV-4, and EHV-9 cross-react serologically. Positive serology results indicate a potential latent equine herpesvirus in the zebra population, which prompted initiation of an equine herpesvirus vaccine protocol, changes in pregnant zebra mare management, and equine herpesvirus polymerase chain reaction screening prior to shipment to or from the study site.

Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

Science.gov (United States)

Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

2018-01-18

Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Low-Cost Temperature Logger for a Polymerase Chain Reaction Thermal Cycler

Directory of Open Access Journals (Sweden)

Chan-Young Park

2016-10-01

Full Text Available Polymerase chain reaction (PCR is a method of amplifying DNA which is normally carried out with a thermal cycler. To obtain more accurate and reliable PCR results, the temperature change within the chamber of the thermal cycler needs to be verified and calibrated regularly. Commercially available temperature loggers commonly used for temperature verification tests usually require a graphical user interface (GUI attached to the logger for convenience and straightforward understanding of the device. In this study, a host-local architecture for the temperature logger that significantly reduces the development time and cost is proposed. Employing standard computing devices as the host gives better development environment and user-friendly GUI. This paper presents the hardware and software design of the host-local temperature logger, and demonstrates the use of the local temperature logger connected to a personal computer with a Windows operating system. The probe design, thermistor resistance measurement, temperature filtering, and temperature calibration is described in detail. The thermistor self-heating problem was investigated in particular to determine the reference resistor that was serially connected to the thermistor. The temperature accuracy and temporal precision of the proposed system was 0.1 K.

α,β-D-constrained nucleic acids are strong terminators of thermostable DNA polymerases in polymerase chain reaction.

Directory of Open Access Journals (Sweden)

Olivier Martínez

Full Text Available (S(C5', R(P α,β-D- Constrained Nucleic Acids (CNA are dinucleotide building blocks that can feature either B-type torsional angle values or non-canonical values, depending on their 5'C and P absolute stereochemistry. These CNA are modified neither on the nucleobase nor on the sugar structure and therefore represent a new class of nucleotide with specific chemical and structural characteristics. They promote marked bending in a single stranded DNA so as to preorganize it into a loop-like structure, and they have been shown to induce rigidity within oligonucleotides. Following their synthesis, studies performed on CNA have only focused on the constraints that this family of nucleotides introduced into DNA. On the assumption that bending in a DNA template may produce a terminator structure, we investigated whether CNA could be used as a new strong terminator of polymerization in PCR. We therefore assessed the efficiency of CNA as a terminator in PCR, using triethylene glycol phosphate units as a control. Analyses were performed by denaturing gel electrophoresis and several PCR products were further analysed by sequencing. The results showed that the incorporation of only one CNA was always skipped by the polymerases tested. On the other hand, two CNA units always stopped proofreading polymerases, such as Pfu DNA polymerase, as expected for a strong replication terminator. Non-proofreading enzymes, e.g. Taq DNA polymerase, did not recognize this modification as a strong terminator although it was predominantly stopped by this structure. In conclusion, this first functional use of CNA units shows that these modified nucleotides can be used as novel polymerization terminators of proofreading polymerases. Furthermore, our results lead us to propose that CNA and their derivatives could be useful tools for investigating the behaviour of different classes of polymerases.

Evaluation of Amplification Targets for the Specific Detection of Bordetella pertussis Using Real-Time Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Mohammad Rubayet Hasan

2014-01-01

Full Text Available BACKGROUND: Bordetella pertussis infections continue to be a major public health challenge in Canada. Polymerase chain reaction (PCR assays to detect B pertussis are typically based on the multicopy insertion sequence IS481, which offers high sensitivity but lacks species specificity.

Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction

Science.gov (United States)

Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka

2005-01-01

AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152

Polymerase chain reaction: A molecular diagnostic tool in periodontology

Science.gov (United States)

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

DEFF Research Database (Denmark)

Blair, D.; Waycott, M.; Byrne, L.

2006-01-01

This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...

DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

Science.gov (United States)

Guthrie, J N; Moriarty, D J; Blackall, L L

2000-12-15

A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

Polymerase chain reaction in unilateral cases of presumed viral anterior uveitis

Directory of Open Access Journals (Sweden)

Shoughy SS

2015-12-01

Full Text Available Samir S Shoughy,1 Hind M Alkatan,2,4 Abdulelah A Al-Abdullah,2 Albarah El-Khani,2 Jolanda DF de Groot-Mijnes,3 Khalid F Tabbara1,4,5 1Department of Ophthalmology, The Eye Center and The Eye Foundation for Research in Ophthalmology, 2Department of Pathology & Laboratory Medicine and Uveitis Division, King Khaled Eye Specialist Hospital, Riyadh, Saudi Arabia; 3Department of Virology and Ophthalmology, University Medical Center Utrecht, Utrecht, the Netherlands; 4Department of Ophthalmology, College of Medicine, King Saud University, Riyadh, Saudi Arabia; 5The Wilmer Ophthalmological Institute of The Johns Hopkins University School of Medicine, Baltimore, MD, USA Background and objectives: Anterior uveitis is the most common form of intraocular inflammation. The main aim of this study was to determine the viral etiology in patients with unilateral cases of anterior uveitis.Patients and methods: A total of 12 consecutive patients with the diagnosis of idiopathic unilateral anterior uveitis were included prospectively. Aqueous specimens were obtained from each patient by anterior chamber paracentesis and subjected to the detection of viral DNA/RNA genome by polymerase chain reaction assay for herpes simplex virus, varicella zoster virus, cytomegalovirus, Epstein–Barr virus, and rubella virus.Results: There were six male and six female patients. The mean age was 43 years, with an age range of 11–82 years. All 12 cases presented with unilateral anterior uveitis. In four (33% patients, polymerase chain reaction was positive for viral genome. Two patients were positive for herpes simplex virus type 1, one patient was positive for cytomegalovirus and one for Epstein–Barr virus.Conclusion: Recent molecular diagnostic assays would help in the identification of the causative agent in patients with unilateral anterior uveitis. Keywords: viral anterior uveitis, PCR, herpes simplex virus, cytomegalovirus, diffuse keratic precipitates, anterior chamber

Impact of Fungicide Residues on Polymerase Chain Reaction and on Yeast Metabolism

Directory of Open Access Journals (Sweden)

Gildo Almeida da Silva

Full Text Available ABSTRACT The indiscriminate use of pesticides on grape crops is harmful for consumers´ healthin “in natura” consumption and in the ingestion of wine and grape juice. During winemaking, a rapid and efficient fermentation stage is critical to avoid proliferation of contaminating microorganisms and to guarantee the product´s quality. Polymerase chain reaction (PCR has the advantage of detecting these contaminants in the early stages of fermentation. However,this enzymatic reaction may also be susceptible to specific problems, reducing its efficiency. Agricultural practices, such as fungicide treatments, may be a source of PCR inhibiting factors and may also interfere in the normal course of fermentation.The action of the pesticides captan and folpet on PCR and on yeast metabolism was evaluated, once these phthalimide compounds are widely employed in Brazilian vineyards. DNA amplification was only observed at 75 and 37.5 µg/mL of captan concentrations, whereas with folpet, amplification was observed only in the two lowest concentrations tested (42.2 and 21.1µg/mL.Besides the strong inhibition on Taq polymerase activity, phthalimides also inhibited yeast metabolism at all concentrations analyzed.Grape must containing captan and folpet residues could not be transformed into wine due to stuck fermentation caused by the inhibition of yeast metabolism. Non-compliance with the waiting period for phthalimide fungicides may result in financial liabilities to the viticulture sector.The use of yeasts with high fungicide sensitivity should be selected for must fermentation as a strategy for sustainable wine production and to assure that products comply with health and food safety standards.

Validation of Geno-Sen's scrub typhus real time polymerase chain reaction kit by its comparison with a serological ELISA Test

Directory of Open Access Journals (Sweden)

Velmurugan Anitharaj

2017-01-01

Full Text Available Background: In the recent past, scrub typhus (ST has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA/indirect immunofluorescence assay (IFA. Molecular tests are applied only by a few researchers. Aims: Evaluation of a new commercial real time polymerase chain reaction (PCR kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. Settings and Design: ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. Materials and Methods: ST IgM ELISA (InBios Inc., USA was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015– September, 2016. All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India. Statistical Analysis: Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA. Chi-square test with Yates correction (Fisher's test was employed for a small number of samples. Results and Conclusion: Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

Science.gov (United States)

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

Science.gov (United States)

Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

2016-10-15

 The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

An In Vitro Model for Studying Neutrophil Activation During Cardiopulmonary Bypass by Using a Polymerase Chain Reaction Thermocycler

NARCIS (Netherlands)

Tang, Min; Zhao, Xiao-Gang; Gu, Y. John; Chen, Chang-Zhi

The accurate temperature control of a polymerase chain reaction (PCR) thermocycler was exploited in developing an in vitro model to study neutrophil activation during cardiopulmonary bypass. Neutrophils from 12 volunteers underwent temperature changes in a PCR thermocycler (37 degrees C for 30

Electrochemiluminescence polymerase chain reaction detection of genetically modified organisms

International Nuclear Information System (INIS)

Liu Jinfeng; Xing Da; Shen Xingyan; Zhu Debin

2005-01-01

With the development of biotechnology, more and more genetically modified organisms (GMOs) have entered commercial market. Because of the safety concerns, detection and characterization of GMOs have attracted much attention recently. Electrochemiluminescence (ECL) method is a chemiluminescent (CL) reaction of species generated electrochemically on an electrode surface. It is a highly efficient and accurate detection method. In this paper, ECL polymerase chain reaction (PCR) combined with two types of nucleic acid probes hybridization was applied to detect GMOs for the first time. Whether the organisms contain GM components was discriminated by detecting the cauliflower mosaic virus 35S (CaMV35S) promoter and nopaline synthase (NOS) terminator. The experiment results show that the detection limit is 100 fmol of PCR products. The promoter and the terminator can be clearly detected in GMOs. The method may provide a new means for the detection of GMOs due to its simplicity and high efficiency

Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

NARCIS (Netherlands)

Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

Science.gov (United States)

Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

2018-05-01

Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

Polymerase chain reaction for detection of invasive Shigella flexneri in food.

Science.gov (United States)

Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E

1990-06-01

The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.

Gynecological manifestations, histopathological findings, and schistosoma-specific polymerase chain reaction results among women with Schistosoma haematobium infection

DEFF Research Database (Denmark)

Randrianasolo, Bodo Sahondra; Jourdan, Peter Mark; Ravoniarimbinina, Pascaline

2015-01-01

BACKGROUND: The pathophysiology of female genital schistosomiasis (FGS) is only partially understood. This study aims to describe the histopathological findings, polymerase chain reaction (PCR) results, and gynecological manifestations of FGS in women with different intensities of Schistosoma hae...

Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

Science.gov (United States)

Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

2017-05-17

Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

A polymerase chain reaction strategy for the diagnosis of camelpox.

Science.gov (United States)

Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

2009-03-01

Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

Comparison between two commercially available serological tests and polymerase chain reaction in the diagnosis of Cryptosporidium in animals and diarrhoeic children.

Science.gov (United States)

Helmy, Yosra A; Krücken, Jürgen; Nöckler, Karsten; von Samson-Himmelstjerna, Georg; Zessin, Karl-H

2014-01-01

For the detection of Cryptosporidium species in 804 animals and 165 diarrhoeic children (tests, the RIDASCREEN® Cryptosporidium test [enzyme immunoassay (EIA)] and the RIDA®QUICK Cryptosporidium/Giardia Combi [immuno-chromatographic test (ICT)] as well as polymerase chain reaction (PCR) were used. Prevalence of Cryptosporidium was 15.0, 19.5 and 32.3% in animals and 2.4, 6.7 and 49.1% in children using EIA, ICT and PCR, respectively.Using PCR as reference method, animal samples sensitivity (Se) of the EIA was 46.5% when questionable samples were considered positive, whereas specificity (Sp) was 100%. Se of the ICT was 60.4% while Sp was 100%. Positive predictive values (PPVs) for both EIA and ICT test were 100%, and negative predictive values (NPVs) for EIA were 79.7 and 84.1% for ICT. For the children samples, the Se of EIA was 5%, Sp was 100%, PPV was 100% and NPV was 52.2%, while the Se of ICT was 13.6%, Sp was 100%, PPV was 100% and NPV was 54.6%.The Kappa score of agreement between PCR and ICT was 67.4%, 54.1% between PCR and EIA and 84.4% between ICT and EIA. Until the second serial dilution of the EIA and ICT test, 9 × 10(3) oocysts/μl of Cryptosporidia was detected, whereas in PCR, they were detected until the sixth serial dilution. Copro-antigen tests were easy to perform and less time-consuming but less sensitive compared to PCR. They obviously are best applicable for screening and epidemiological studies of large numbers of subjects, for batch specimen processing and in isolated or rural areas where reliable tests like PCR are unfeasible. When in children, a single stool sample is used for the diagnosis of clinical cases; better results can be obtained when non-standardized PCR due low specificity is coupled with copro-antigen tests.

Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

Directory of Open Access Journals (Sweden)

Carla Bertechini Faria

2012-03-01

Full Text Available The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

Five years' experience of classical swine fever polymerase chain reaction ring trials in France.

Science.gov (United States)

Po, F; Le Dimna, M; Le Potier, M F

2011-12-01

Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

Bakteri Legionella pneumophila Terdeteksi pada Air Kolam Renang di Kota Surabaya dengan Nested Polymerase Chain Reaction (LEGIONELLA PNEUMOPHILA BACTERIADETECTED IN SWIMMING POOL WATER OF SURABAYA BY USING NESTED POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Eduardus Bimo Aksono

2017-06-01

Full Text Available Legionella pneumophila is a Gram-negative bacillus that causes nosocomial and community-acquired pneumonia. The aim of this research was to detect the presence of bacteria of L. pneumophila species in the swimming pools water of Surabaya city by using nested Polymerase Chain Reaction (PCR assay of a specific gene for L. pneumophila (mip gene. This study used purposive sampling method. A total of 10 water samples were collected from five swimming pools consisting of 200 mL water for each swimming pool. The results showed that of 10 samples tested by nested PCR, one sample was positive for L. pneumophila, and nine samples were negative. L. pneumophila were found in pool water samples with a higher temperature (>30ºC.Serogrouping analysis of positive sample that L. pneumophila bacteria detected in the water sample of swimming pool in Surabaya was L. pneumophila serogroup 9 (98% and serogroup 10 (98%. L. pneumophila detection of bacteria is expected to raise the awareness of physician and microbiologists about the transmission of L. pneumophila and will also be useful for controlling the agents. ABSTRAK Legionella pneumophila adalah bakteri Gram-negatif berbentuk batang yang dapat menyebabkan penyakit nosokomial dan pneumonia. Tujuan penelitian ini adalah untuk mendeteksi keberadaan bakteri L. pneumophila pada air kolam renang di Kota Surabaya dengan menggunakan nested Polymerase Chain Reaction (PCR berbasis gen spesifik L. pneumophila (mip gene. Penelitian ini menggunakan metode purposive sampling. Sebanyak sepuluh sampel diambil dari lima kolam renang. Sampel diambil sebanyak 200 mL dari air kolam renang di setiap lokasi. Hasil dari 10 sampel yang diuji menggunakan nested PCR, satu sampel menunjukkan hasil positif untuk L.pneumophila, dan sembilan sampel menunjukkan hasil negatif. Bakteri L. pneumophila ditemukan pada sampel air kolam dengan suhu yang lebih tinggi (>30ºC. Satu sampel positip tersebut ketika dilanjutkan terhadap analisis serogrup

Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

Science.gov (United States)

Lorenz, Todd C

2012-05-22

In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Directory of Open Access Journals (Sweden)

Laurent Dacheux

2016-07-01

Full Text Available The definitive diagnosis of lyssavirus infection (including rabies in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR and a second reaction using an intercalating dye (SYBR Green to detect other lyssavirus species (pan-lyssa RT-qPCR. The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135 including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5% and saliva (54% samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco. This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

Science.gov (United States)

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

Accuracy of real-time polymerase chain reaction for Toxoplasma gondii in amniotic fluid.

Science.gov (United States)

Wallon, Martine; Franck, Jacqueline; Thulliez, Philippe; Huissoud, Cyril; Peyron, François; Garcia-Meric, Patricia; Kieffer, François

2010-04-01

To provide clinicians with information about the accuracy of real-time polymerase chain reaction (PCR) analysis of amniotic fluid for the prenatal diagnosis of congenital Toxoplasma infection. This was a prospective cohort study of women with Toxoplasma infection identified by prenatal screening in three centers routinely carrying out real-time PCR for the detection of Toxoplasma gondii in amniotic fluid. The data available were gestational age at maternal infection, types and dates of maternal treatment, results of amniocentesis and neonatal work-up and definitive infectious status of the child. We estimated sensitivity, specificity and positive and negative predictive values both overall and per trimester of pregnancy at the time of maternal infection. Polymerase chain reaction analysis was carried out on amniotic fluid for 261 of the 377 patients included (69%). It was accurate with the exception of four negative results in children who were infected. Overall sensitivity and negative predictive value were 92.2% (95% confidence interval [CI] 81-98%) and 98.1% (95% CI 95-99.5%), respectively. There was no significant association with the trimester of pregnancy during which maternal infection occurred. Specificity and positive predictive values of 100% were obtained for all trimesters. Real-time PCR analysis significantly improves the detection of T. gondii on amniotic fluid. It provides an accurate tool to predict fetal infection and to decide on appropriate treatment and surveillance. However, postnatal follow-up remains necessary in the first year of life to fully exclude infection in children for whom PCR results were negative. III.

Rapid genomic fingerprinting of Lactococcus lactis strains by arbitrarily primed polymerase chain reaction with 32P and fluorescent labels.

OpenAIRE

Cancilla, M R; Powell, I B; Hillier, A J; Davidson, B E

1992-01-01

Arbitrarily primed polymerase chain reaction, with incorporation of either radioactive or fluorescent labels, was used as a rapid and sensitive method for obtaining genomic fingerprints of strains of Lactococcus lactis. Closely related strains produced almost identical fingerprints. Fingerprints of other strains showed only some similarities.

Multiplex polymerase chain reaction for the detection of high-risk-human papillomavirus types in formalin-fixed paraffin-embedded cervical tissues

Directory of Open Access Journals (Sweden)

Mini P Singh

2017-01-01

Full Text Available Detecting high-risk-human papillomavirus (HPV types has become an integral part of the cervical cancer screening programmes. This study aimed to develop a multiplex polymerase chain reaction (PCR for identification of HPV types 16 and 18 along with the beta globin gene in formalin-fixed and paraffin-embedded cervical biopsy specimens. A total of 59 samples from patients with cervical abnormalities were tested. HPV 16 positivity was 50% in cervical cancers and 52.9% in cervical intraepithelial neoplasia. Our multiplex PCR protocol can be used as a simple and cost-effective tool for high-risk-HPV detection in cervical cancer screening programmes.

Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

Science.gov (United States)

Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

2014-08-01

A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Multiplex reverse transcription-polymerase chain reaction combined with on-chip electrophoresis as a rapid screening tool for candidate gene sets

DEFF Research Database (Denmark)

Wittig, Rainer; Salowsky, Rüdiger; Blaich, Stephanie

2005-01-01

Combining multiplex reverse transcription-polymerase chain reaction (mRT-PCR) with microfluidic amplicon analysis, we developed an assay for the rapid and reliable semiquantitative expression screening of 11 candidate genes for drug resistance in human malignant melanoma. The functionality of thi...

In-house polymerase chain reaction for affordable and sustainable Chlamydia trachomatis detection in Trinidad and Tobago.

Science.gov (United States)

Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David

2007-11-01

To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.

Fluorescent antibody test, quantitative polymerase chain reaction pattern and clinical aspects of rabies virus strains isolated from main reservoirs in Brazil

Directory of Open Access Journals (Sweden)

Camila Appolinário

2015-09-01

Full Text Available Rabies virus (RABV isolated from different mammals seems to have unique characteristics that influence the outcome of infection. RABV circulates in nature and is maintained by reservoirs that are responsible for the persistence of the disease for almost 4000 years. Considering the different pattern of pathogenicity of RABV strains in naturally and experimentally infected animals, the aim of this study was to analyze the characteristics of RABV variants isolated from the main Brazilian reservoirs, being related to a dog (variant 2, Desmodus rotundus (variant 3, crab eating fox, marmoset, and Myotis spp. Viral replication in brain tissue of experimentally infected mouse was evaluated by two laboratory techniques and the results were compared to clinical evolution from five RABV variants. The presence of the RABV was investigated in brain samples by fluorescent antibody test (FAT and real time polymerase chain reaction (qRT-PCR for quantification of rabies virus nucleoprotein gene (N gene. Virus replication is not correlated with clinical signs and evolution. The pattern of FAT is associated with RABV replication levels. Virus isolates from crab eating fox and marmoset had a longer evolution period and higher survival rate suggesting that the evolution period may contribute to the outcome. RABV virus variants had independent characteristics that determine the clinical evolution and survival of the infected mice.

Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid

Science.gov (United States)

Pascho, Ronald J.; Chase, Dorothy M.; McKibben, Constance L.

1998-01-01

Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 × 109cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 × 104cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

Science.gov (United States)

Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

2012-11-16

The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

Diagnostic value of polymerase chain reaction analysis of skin biopsies in purpura fulminans.

Science.gov (United States)

Beau, Caroline; Vlassova, Natalia; Sarlangue, Jean; Brissaud, Olivier; Léauté-Labrèze, Christine; Boralevi, Franck

2013-01-01

Even though prompt diagnosis and treatment of purpura fulminans (PF) is essential to reduce mortality, early administration of antibiotics may preclude identification of the causative agent by standard bacterial cultures and thus render definitive diagnosis impossible. Here we present a case of an infant with PF and negative bacterial cultures for whom polymerase chain reaction (PCR) analysis of a cutaneous biopsy specimen obtained 4 days after initiation of antibiotics identified the genomic sequence of Neisseria meningitidis genogroup C. When bacterial cultures fail to provide useful information, PCR of skin biopsy specimens can be a valuable diagnostic tool in PF. © 2013 Wiley Periodicals, Inc.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

Science.gov (United States)

Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

2017-01-01

Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Samira Mohammadi

2017-01-01

Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

Quantitation of RHD by real-time polymerase chain reaction for determination of RHD zygosity and RHD mosaicism/chimerism

DEFF Research Database (Denmark)

Krog, Grethe Risum; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

2007-01-01

Determination of RHD zygosity of the spouse is crucial in preconception counseling of families with history of hemolytic disease of the fetus and newborn caused by anti-D. RHD zygosity can be determined by quantitative real-time polymerase chain reaction (PCR) basically by determining RHD dosage,......, and this feature is relevant in investigating RHD mosaicism and chimerism....

Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

Directory of Open Access Journals (Sweden)

Trioso Purnawarman

2014-04-01

Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

TEST KIT FOR THE DETECTION AND GENOTYPING OF HIGHLY PATHOGENIC INFLUENZA VIRUS A H5N1 BY REAL-TIME POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

S. V. Stepaniuk

2014-06-01

Full Text Available Results of the annual monitoring of epizooties indicate that highly pathogenic HPAI/H5N1 avian influenza widely circulated in Eurasian region. Over a period of 2010–2013 years more than 165 cases of outbreaks in 14 countries were found out. Ukraine became one of the first countries in Europe where in Autonomous Republic of Crimea in October 2005 outbreak of avian epizootic with HPAI/H5N1 was documented and until February 2008 more than 236,000 poultry were killed. Since then the question of monitoring of infected both migrating birds and poultry in places of cross contact in Ukraine remains of high priority. The test system is developed for identification and genotyping A H5N1 on three genes (M, H5 and N1 HPAI/H5N1 in real-time mode for polymerase chain reaction. Test kit capacity to detect HPAI/h5n1avian influenza virus and differentiate it from the other viral infection agents of birds and animals were studied by testing of HPAI/H5N1 virus isolated during mass infection outbreak in Crimea in 2005 and cultural specimens of other viral pathogens. It was established that the «DIA Real Avian Influenza» test kit was capable to detect RNA influenza A virus of high pathogenic H5N1 strains having high sensitivity (100% while RNA of the Crimean HPAI/H5N1 isolate studying and specificity (100% while RNA viruses of Newcastle birds disease, fowl powershift, syndrome of drop in egg production and horse influenza studying.

Quantification of Staphylococcus aureus and Staphylococcus epidermidis on the hands of health-care workers using a real-time polymerase chain reaction method

DEFF Research Database (Denmark)

Horn, P; Schouenborg, P Øland; Brandslund, I

2007-01-01

OBJECTIVE: The objective of this study was to test a polymerase chain reaction (PCR) assay intended as a tool for monitoring hand hygiene in hospital wards. METHODS: The hands of 20 health-care workers were sampled for 10 days using real-time PCR for quantification of Staphylococcus aureus and S....... epidermidis. Reference intervals (CI) and biological variation were evaluated using index of individuality (II) and critical difference (CD). RESULTS: 45% of the participants were positive for S. aureus on all 10 days. Intra-individual biological variation (CVI) was 129% for S. aureus and 62% for S...

Comparison of isoelectric focusing and polymerase chain reaction for the detection of β-lactamases

Directory of Open Access Journals (Sweden)

Sharma J

2010-01-01

Full Text Available Extended spectrum β-lactamases (ESBLs have been observed in virtually all the species of family Enterobacteriaceae. Threat posed by antibiotic resistance because of ESBLs is more serious as a number of technical problems are associated with the detection of these enzymes. Although a number of detection methods have been designed for ESBLs, every method has its own benefits and shortcomings as well. In earlier days, isoelectric focusing (IEF was used as the gold standard for ESBL detection. This study was undertaken to compare IEF with polymerase chain reaction, a method which has been extensively used for ESBL detection these days.

Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

Science.gov (United States)

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

Science.gov (United States)

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and

A primer on on-demand polymerase chain reaction technology.

Science.gov (United States)

Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

2015-10-01

Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

Science.gov (United States)

Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

2000-01-01

Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

Nasal methicillin-resistant Staphylococcus aureus polymerase chain reaction: a potential use in guiding antibiotic therapy for pneumonia.

Science.gov (United States)

Johnson, Jennifer A; Wright, Michael E; Sheperd, Lyndsay A; Musher, Daniel M; Dang, Bich N

2015-01-01

The role at admission of nasal polymerase chain reaction (PCR) for patients with methicillin-resistant Staphylococcus aureus (MRSA) in guiding antibiotic therapy for lower respiratory tract infection is unknown. To determine whether nasal MRSA PCR at admission can predict the absence of MRSA in lower respiratory tract secretions. We performed a retrospective study of adult patients admitted to a large urban hospital. Patients had a nasal MRSA PCR test and a lower respiratory tract culture obtained within 48 hours of admission and the culture yielded S aureus. Sensitivity, specificity, and positive and negative predictive values. Our results showed high sensitivity (93.3%) and negative predictive value (95.2%) of nasal PCR for MRSA in the lower respiratory tract. With its high sensitivity and negative predictive value, a nasal MRSA PCR test performed within 48 hours of hospital admission could help guide the discontinuation of MRSA-directed empiric antibiotic therapy in patients who are unlikely to be infected with this organism. A prospective study is needed to confirm these findings.

Bayesian estimation for quantification by real-time polymerase chain reaction under a branching process model of the DNA molecules amplification process

NARCIS (Netherlands)

Lalam, N.; Jacob, C.

2007-01-01

The aim of Quantitative Polymerase Chain Reaction is to determine the initial amount X0 of specific nucleic acids from an observed trajectory of the amplification process, the amplification being achieved through successive replication cycles. This process depends on the efficiency fpngn of

Clinical value of polymerase chain reaction in detecting group B streptococcus during labor.

Science.gov (United States)

Koppes, Dorothea Maria; Vriends, Antonius Arnoldus Cornelis Maria; van Rijn, Michiel; van Heesewijk, Antonine Dimphne

2017-06-01

To reduce the intrapartum use of antibiotics in women with prolonged rupture of the membranes (PROM) by restriction of antibiotics to women who are colonized with group B streptococci (GBS), as identified with the Cepheid Gene Xpert polymerase chain reaction (PCR) for detecting GBS. We conducted a randomized controlled trial among full-term delivering women with PROM. Fifty-four women were enrolled, based on a power calculation with a significance level of 5% and a power of 95%. Twenty-seven women received the standard treatment (rectovaginal swab [RVS] for bacterial culture and antibiotics). For another 27 women PCR was performed on the RVS and antibiotics were used only when the PCR was positive. The primary outcome was reduction in antibiotic use, defined as the percentage of women who received antibiotics during labor. 54 Women were enrolled in the study between 1 May and 18 November 2014. There were no significant differences in baseline characteristics. In total, 10 of the 54 women were GBS positive (18.5%). Of those 10 women, three were identified on bacterial culture and seven on PCR. In the bacterial culture group all the women received antibiotics. In the PCR group 10 women (37%) received antibiotics (P = 0.002). Two false-positive PCR tests were identified. There were no false-negative PCR tests. Real-time identification of GBS on PCR reduces the intrapartum use of antibiotics in women with PROM. © 2017 Japan Society of Obstetrics and Gynecology.

Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study

Directory of Open Access Journals (Sweden)

Clemencia Ovalle Bracho

2007-08-01

Full Text Available We validated the polymerase chain reaction (PCR with a composite reference standard in 61 patients clinically suspected of having mucosal leishmaniasis, 36 of which were cases and 25 were non-cases according to this reference standard. Patient classification and test application were carried out independently by two blind observers. One pair of primers was used to amplify a fragment of 120 bp in the conserved region of kDNA and another pair was used to amplify the internal transcript spacers (ITS rDNA. PCR showed 68.6% (95% CI 59.2-72.6 sensitivity and 92% (95% CI 78.9-97.7 specificity; positive likelihood ratio: 8.6 (95% CI 2.8-31.3 and negative likelihood ratio: 0.3 (95% CI 0.3-0.5, when kDNA molecular target was amplified. The test performed better on sensitivity using this target compared to the ITS rDNA molecular target which showed 40% (95% CI 31.5-42.3 sensitivity and 96% (95% CI 84.1-99.3 specificity; positive likelihood ratio: 10 (95% CI 2.0-58.8 and negative likelihood ratio: 0.6 (95% CI 0.6-0.8. The inter-observer agreement was excellent for both tests. Based upon results obtained and due to low performance of conventional methods for diagnosing mucosal leishmaniasis, we consider PCR with kDNA as molecular target is a useful diagnostic test and the ITS rDNA molecular target is useful when the aim is to identify species.

Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

Directory of Open Access Journals (Sweden)

Anupam Berwal

2017-01-01

Full Text Available Tuberculous meningitis (TBM is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1% patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM.

Polymerase chain reaction-based discrimination of viable from non-viable Mycoplasma gallisepticum

Directory of Open Access Journals (Sweden)

Ching Giap Tan

2014-09-01

Full Text Available The present study was based on the reverse transcription polymerase chain reaction (RT-PCR of the 16S ribosomal nucleic acid (rRNA of Mycoplasma for detection of viable Mycoplasma gallisepticum. To determine the stability of M. gallisepticum 16S rRNA in vitro, three inactivation methods were used and the suspensions were stored at different temperatures. The 16S rRNA of M. gallisepticum was detected up to approximately 20–25 h at 37 °C, 22–25 h at 16 °C, and 23–27 h at 4 °C. The test, therefore, could detect viable or recently dead M. gallisepticum (< 20 h. The RT-PCR method was applied during an in vivo study of drug efficacy under experimental conditions, where commercial broiler-breeder eggs were inoculated with M. gallisepticum into the yolk. Hatched chicks that had been inoculated in ovo were treated with Macrolide 1. The method was then applied in a flock of day 0 chicks with naturally acquired vertical transmission of M. gallisepticum, treated with Macrolide 2. Swabs of the respiratory tract were obtained for PCR and RT-PCR evaluations to determine the viability of M. gallisepticum. This study proved that the combination of both PCR and RT-PCR enables detection and differentiation of viable from non-viable M. gallisepticum.

Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction

DEFF Research Database (Denmark)

Zornhagen, K. W.; Kristensen, A. T.; Hansen, Anders Elias

2015-01-01

Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours....... The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm...

Polymerase chain reaction based epidemiological investigation of canine parvoviral disease in dogs at Bareilly region

Directory of Open Access Journals (Sweden)

Jobin Thomas

2014-11-01

Full Text Available Aim: The aim of this study was to screen the suspected samples by polymerase chain reaction (PCR and epidemiological analysis of positive cases of canine parvovirus type2. Materials and Methods: Fecal samples were collected from dogs suspected for canine parvovirus type 2 (CPV-2 and viral DNA was extracted. Primers were designed, and PCR was done with all extracted DNA samples. Age, sex and breed wise distribution of positive cases were analyzed. Results: Out of a total 44 collected fecal samples, 23 were found to be positive for CPV-2 by developed PCR. The disease was found to be more common in Labrador male pups of 3-6 months of age. The percentage of positive cases in vaccinated dogs was found to be around 17.4%. Conclusion: Almost half (52.3% of total collected samples were found to be positive by PCR. However, number of field samples are needed to further validate this test and additionally sequence analysis needs to be done to ensure the prevalent field strain of CPV-2.

Detection of Mycobacterium tuberculosis in clinical samples by two-step polymerase chain reaction and nonisotopic hybridization methods.

OpenAIRE

Shawar, R M; el-Zaatari, F A; Nataraj, A; Clarridge, J E

1993-01-01

Detection of Mycobacterium tuberculosis in clinical specimens by the polymerase chain reaction (PCR) was compared with detection by culture. A 317-bp segment within the M. tuberculosis-specific insertion sequence IS6110 was amplified. The detection limit of the PCR assay for cultured mycobacteria was 50 cells per reaction by ethidium bromide-stained agarose gel electrophoresis and 5 cells per reaction by hybridization with an oligonucleotide probe conjugated with either digoxigenin or alkalin...

A polymerase chain reaction-based methodology to detect gene doping.

Science.gov (United States)

Carter, Adam; Flueck, Martin

2012-04-01

The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

Limitations of the nested reverse transcriptase polymerase chain reaction on tyrosinase for the detection of malignant melanoma micrometastases in lymph nodes

NARCIS (Netherlands)

Calogero, A; Timmer-Bosscha, H; Tiebosch, ATMG; Mulder, NH; Hospers, GAP; Schraffordt Koops, H.

The specificity and sensitivity of the nested reverse transcriptase polymerase chain reaction (RT-PCR) on tyrosinase was studied, for the detection of micrometastases of malignant melanoma. The specificity was assessed in the blood of six healthy donors, four patients with non-melanoma cancers of

Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

Science.gov (United States)

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

Directory of Open Access Journals (Sweden)

U. Pagnini

2010-02-01

Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

The polymerase chain reaction and its application to clinical plastic surgery.

LENUS (Irish Health Repository)

Rea, S

2012-02-03

Molecular biology has become an essential component in many fields of modern medical research, including plastic surgery. Research into the molecular mechanisms underlying many disease processes offer increased understanding of the pathogenesis of disease and provide exciting therapeutic possibilities. Yet for many clinicians, the presentation of much research into molecular biological processes is couched in confusing terminology and based on scientific techniques, the basis of which are frequently difficult for the clinician to understand. The purpose of this review is to present an introduction to some of the molecular biological techniques currently in use, namely the polymerase chain reaction (PCR) and explore its applications to different aspects of plastic surgery. This review explores the role PCR now plays in all aspects of modern plastic surgery practise, with particular emphasis on normal and abnormal wound healing, the diagnosis of craniofacial anomalies, the diagnosis and treatment of cancer including melanoma and squamous cell carcinoma of the head and neck, and burns.

Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

Energy Technology Data Exchange (ETDEWEB)

Frank F. Roberto

2008-08-01

Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

Science.gov (United States)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Molecular detection of the carriage rate of four intestinal protozoa with real-time polymerase chain reaction

DEFF Research Database (Denmark)

Efunshile, Michael A; Ngwu, Bethrand A F; Kurtzhals, Jørgen A L

2015-01-01

Diarrhea remains the second largest killer of children worldwide, and Nigeria ranks number two on the list of global deaths attributable to diarrhea. Meanwhile, prevalence studies on potentially diarrheagenic protozoa in asymptomatic carriers using molecular detection methods remain scarce in sub......-Saharan countries. To overcome sensitivity issues related to microscopic detection and identification of cysts in stool concentrates, real-time polymerase chain reaction (PCR) was used to analyze genomic DNAs extracted from stool samples from 199 healthy school children for Entamoeba histolytica, E. dispar, Giardia...

Real-time polymerase chain reaction as a tool for evaluation of magnetic poly(glycidyl methacrylate)-based microspheres in molecular diagnostics

Czech Academy of Sciences Publication Activity Database

Trachtová, S.; Španová, A.; Horák, Daniel; Kozáková, Hana; Rittich, B.

2016-01-01

Roč. 22, č. 5 (2016), s. 639-646 ISSN 1381-6128 R&D Projects: GA ČR GA15-07268S Institutional support: RVO:61389013 ; RVO:61388971 Keywords : magnetic microspheres * inhibitory effect * real-time polymerase chain Subject RIV: CD - Macromolecular Chemistry; CD - Macromolecular Chemistry (MBU-M) Impact factor: 2.611, year: 2016

LOCALIZATION OF HUMAN PAPILLOMAVIRUS TYPE-16 DNA USING THE POLYMERASE CHAIN-REACTION IN THE CERVIX UTERI OF WOMEN WITH CERVICAL INTRAEPITHELIAL NEOPLASIA

NARCIS (Netherlands)

Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.

1989-01-01

The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained

Rapid Detection of Salmonella in Food and Beverage Samples by Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Radji, M.

2010-01-01

Full Text Available Polymerase chain reaction (PCR assay had been used to detect Salmonella in food and beverage samples using suitable primers which are based on specific invA gene of Salmonella. Twenty nine samples were collected from street food counters and some canteens in Margonda Street, Depok, West Java, Indonesia. It was found that five of twenty nine samples were detected to contain Salmonella and showed the presence of the amplified product of the size 244 bp. The method of PCR demonstrated the specificity of invA primers for detection of Salmonella as confirmed by biochemical and serological assay. The results of this study revealed that PCR was a rapid and useful tool for detection of Salmonella in food and beverage samples.

The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

Science.gov (United States)

Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

2018-03-15

To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (pClostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

Value of Candida polymerase chain reaction and vaginal cytokine analysis for the differential diagnosis of women with recurrent vulvovaginitis.

Science.gov (United States)

Weissenbacher, S; Witkin, S S; Tolbert, V; Giraldo, P; Linhares, I; Haas, A; Weissenbacher, E R; Ledger, W J

2000-01-01

OBJECTIVES: Recurrent vulvovaginitis remains difficult to diagnose accurately and to treat. The present investigation evaluated the utility of testing vaginal specimens from women with symptomatic recurrent vulvovaginitis for Candida species by polymerase chain reaction (PCR) and for cytokine responses. METHODS: Sixty-one consecutive symptomatic women with pruritus, erythema, and/or a thick white discharge and a history of recurrent vulvovaginitis and 31 asymptomatic women with no such history were studied. Vaginal swabs were tested for Candida species by PCR, for the antiinflammatory cytokine interleukin (IL)-10, and for the proinflammatory cytokine IL-12. RESULTS: C. albicans was detected in 19 (31.1%) of the patients as well as in three (9.7%) controls (P = 0.03). Both IL-10 (31.1% vs. 0%) and IL-12 (42.6% vs. 6.5%) were also more prevalent in the recurrent vulvovaginitis patients (P vulvovaginitis are not infected with Candida. Testing for Candida should be required in this population. Treatment with only anti-Candida medication will clearly be inadequate for the majority of women with this condition. PMID:11220486

Metode Direct Polymerase Chain Reaction untuk Melacak Campylobacter sp. pada Daging Ayam (DIRECT POLYMERASE CHAIN REACTION METHOD FOR DETECTION CAMPYLOBACTER SP. OF POULTRY MEAT

Directory of Open Access Journals (Sweden)

Andriani .

2013-08-01

Full Text Available Campylobacter sp. is the most commonly reported as agent of foodborne zoonosis causing acutegastroenteritis in humans. Poultry meat is considered as a major source of C. jejuni infection in human.The conventional methods for detecting foodborne bacteria is time-consuming which rely on the of thebacteria in culture media, followed by biochemical identification. In this study polymerase chain reaction(PCR technique was used for rapid identification of the pathogenic Campylobacter sp. The samples usedwere 298 chicken carcass with sold in supermarkets and traditional markets, and were carried out inaccordance the isolation protocol ISO/ DIS 10272-1994. Identification was performed using biochemicalAPI Campy. The direct PCR (DPCR assay with two sets of primers was employed for isolation andidentification of C. jejuni and C. coli. The result of the isolation and identification both by conventional orPCR methods showed that chicken carcasses both from supermarket and traditional market werecontaminated with C. jejuni and or C. coli. Prevalence of Campylobacter sp. contamination in chicken meatwas higher by DPCR (62.6% than by conventional (19.8%, indicating that DPCR technique was moresensitive than conventional method with detection limit for C. jejuni was103 cfu/ml.

Detection of Legionella by quantitative-polymerase chain reaction (qPCR) for monitoring and risk assessment

DEFF Research Database (Denmark)

Krøjgaard, Louise H.; Krogfelt, Karen A.; Albrechtsen, Hans-Jorgen

2011-01-01

Background: Culture and quantitative polymerase chain reaction (qPCR) assays for the detection of Legionella were compared on samples from a residential area before and after two interventions. A total of 84 samples were collected from shower hoses and taps as first flush samples and at constant...... temperature. Samples were grouped according to the origin of the sample, a) circulation water b) water from empty apartments c) water from shower hoses. The aims were to investigate the usefulness of qPCR compared to culture for monitoring remedial actions for elimination of Legionella bacteria and as a tool...

Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

Directory of Open Access Journals (Sweden)

Pooja H. Gupta

2015-05-01

Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

Detecting beef meatball contamination with polymerase chain reaction

Directory of Open Access Journals (Sweden)

Hoda A.

2017-10-01

Full Text Available The objective of the study was to describe how much rat and swine primer developed from cytochrome b could detect rat and pork in processed beef products sold in North Maluku. The settings of the study were the traditional markets and supermarkets in several cities in North Maluku such as Ternate, Tidore Kepulauan, West Halmahera, North Halmahera, Central Halmahera, South Halmahera, East Halmahera, Sula Island and Morotai Island. The data collection lasted between May and June, 2015. The samples were analyzed in the Biotechnology Lab of Unkhair in July, 2015. To detect rat and swine DNA, the researchers used the PCR (Polymerase Chain Reaction method with Top Taq master mix Kit kit (250 (Catalog no. 200403 Swine Primer: Forward: 5'CTA CAT AAG ATAT ATC CAC CAC A 3 'Reverse: 5' ACA TTG TGG GAT CTT CTA GGT 3 'Product size: 290 bp. Rat Primer: forward SIM (5'-GACCTCCCAGCTCCATCAAACATCTCATCTTGATGAAA-3'. Reverse (5'GAATGGGATTTT GTTGGAGTTT-3 '. Out of 41 samples, sample 3, 4 and 5 taken in Jailolo contained rat DNA (positive; the samples were amplified with 499 base pair length (bp. In addition, sample 2, 7, 8 and 10 from Ternate as well as sample 4 from Morotai Island was also found positive (containing rat DNA. In terms of swine DNA, all of the samples came back negative. The amplification showed that none of the meatball samples contained pork. No pig DNA was amplified in the gel.

Helicobacter-negative gastritis: polymerase chain reaction for Helicobacter DNA is a valuable tool to elucidate the diagnosis.

Science.gov (United States)

Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G

2016-04-01

Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.

Detection of Ampicillin Resistance Genes (bla in Clinical Isolates of Escherichia coli with Polymerase Chain Reaction Method

Directory of Open Access Journals (Sweden)

Tiana Milanda

2014-09-01

Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms

Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

Science.gov (United States)

Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

2018-02-26

Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

Science.gov (United States)

Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

1995-06-01

A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

Science.gov (United States)

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Results of Multiplex Polymerase Chain Reaction Assay to Identify Urethritis Pathogens

Directory of Open Access Journals (Sweden)

Mehmet Sarıer

2017-03-01

Full Text Available Objective: The purpose of this study was to evaluate the results of multiplex polymerase chain reaction (PCR test applied to identify the pathogens in male patients who attended our urology clinic with a pre-diagnosis of urethritis related with sexual intercourse. Materials and Methods: In this study, we included a total of 91 male patients, who sought medical advice in our clinic between August 2015 and October 2016 due to complaints of urethral discharge, dysuria and urethral itching, having a visible urethral discharge during the physical examination or a positive leukocyte esterase test (Combur-Test®-Roche in the first urine sample. In the urethral swab samples of these patients, urethritis pathogens were searched with a multiplex PCR test. The multiplex PCR kit, which is able to identify nine pathogens and produced by PathoFinder® (Holland, was used in the process. The pathogens that could be detected by the kit were Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma urealyticum, Gardnerella vaginalis, Trichomonas vaginalis, Treponema pallidum, and Candida albicans. Results: The average age of the subjects was 35.1 (19-57 years. Sixty one out of 91 patients (67% were found to have a pathogen in the urethral swab sample. In 45 patients (49.4%, only one pathogen, in 12 (13.1% - two different pathogens and in 4 (4.3% patients, 3 different pathogens were detected. The pathogens found were as follows: Ureaplasma urealyticum in 22 patients (27.1%, Gardnerella vaginalis in 15 (18.6%, Neisseria gonorrhoeae in 13 (16.1%, Mycoplasma genitalium (10 patients; 12.3%, Mycoplasma hominis (8 patients; 9.9%, Chlamydia trachomatis (8 patients; 9.9%, Trichomonas vaginalis (3 patients; 3.8%, and Candida albicans (2 patients; 2.4%. None of the patients were identified with Treponema pallidum. None of the pathogens were identified in 30 patients (32.9% whose samples were examined by PCR method. Conclusion

Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Dastur P

2004-01-01

Full Text Available The diagnosis of Duchenna Muscular Dystrophy (DMD and Becker Muscular Dystorphy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hot spot′ regions allowing determinations of deletion end points. Intragenic deletions were detected in 74 patients indicating that the use of PCR- based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

Diagnosis of visceral leishmaniasis by the polymerase chain reaction using blood, bone marrow and lymph node samples from patients from the Sudan

DEFF Research Database (Denmark)

Andresen, K; Gasim, S; Elhassan, A M

1997-01-01

We have evaluated the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool for Leishmania donovani using blood, bone marrow and lymph node samples from Sudanese patients with a confirmed infection. Forty patients were diagnosed by microscopic examination of bone marrow or lymph...

Detection of Mycoplasma pneumoniae by two polymerase chain reactions and role of M. pneumoniae in acute respiratory tract infections in pediatric patients

NARCIS (Netherlands)

Ieven, M; Ursi, D; Van Bever, H; Quint, W; Niesters, H G; Goossens, H

Mycoplasma pneumoniae and viruses in acute respiratory tract infections in children were studied during the winter of 1992-1993 in Antwerp, Belgium. M. pneumoniae was diagnosed in nasopharyngeal aspirates by culture and polymerase chain reaction (PCR). For this, amplification of a fragment of the PI

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

Science.gov (United States)

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

OpenAIRE

ÖZKUL, Aykut

2002-01-01

In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

Frequency of Chlamydia trachomatis among male patients with urethritis in northeast of Iran detected by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Kiarash Ghazvini

2012-01-01

Full Text Available Planning for appropriate preventive measures against Chlamydia trachomatis, a common cause of sexually transmitted disease, requires knowledge of prevalence of infection so that interventions can be targeted in a cost-effective manner. This study was performed on 178 male patients presenting with urethritis in the Mashhad province to determine the prevalence of chlamydial infection in Northeast Iran. A cotton swab and first voided urine specimen were collected according to standard procedures. Polymerase chain reaction (PCR tests were used for the detection of C. trachomatis in the specimens collected and the results were analyzed using SPSS program. Results showed that 10.6% of male patients in this group were infected with C. trachomatis. This study provides strong evidence that prevalence of Chlamydia in the Northeast Iran is high and suggests that Chlamydia screening as a routine part of STD investigations is highly necessary in this area.

Shortening Isolation of Patients With Suspected Tuberculosis by Using Polymerase Chain Reaction Analysis

DEFF Research Database (Denmark)

Fløe, Andreas; Hilberg, Ole; Thomsen, Vibeke Østergaard

2015-01-01

Background. Isolation of patients suspected for pulmonary tuberculosis is guided by serial sputum smears. This can result in isolation for days for patients with noncontagious tuberculosis. To determine whether a single sample negative for Mycobacterium tuberculosis complex at polymerase chain...... reaction (PCR) can guide isolation. Methods. We retrospectively evaluated sputum samples analyzed for M. tuberculosis complex at the International Reference Laboratory of Mycobacteriology, Copenhagen, Denmark in 2002–2011. We selected culture-confirmed tuberculosis cases with ≥3 samples within 14 days...... before or after the initial culture-positive sample. We repeated the process for those with ≥2 samples within 28 days. The primary outcome was PCR-negative, smear-positive patients. Results. We included 53 533 sputum samples from 20 928 individuals; 1636 had culture-confirmed tuberculosis. Of these, 856...

Identification of duck plague virus by polymerase chain reaction

Science.gov (United States)

Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

1999-01-01

A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India

Directory of Open Access Journals (Sweden)

K. Nithin Prabhu

2018-02-01

Full Text Available Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT, as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR, have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat and wild (leopard, wolf and jackal animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

Science.gov (United States)

Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

2018-02-28

Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

LENUS (Irish Health Repository)

Meyler, Kenneth L

2012-12-01

Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies\\/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and\\/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF.

Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

Science.gov (United States)

Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

2012-12-01

Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. Copyright © 2012 Elsevier Inc. All rights reserved.

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Science.gov (United States)

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

International Nuclear Information System (INIS)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

1994-01-01

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

Energy Technology Data Exchange (ETDEWEB)

Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

1994-07-15

This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

Pneumocystis carinii in bronchoalveolar lavage and induced sputum: detection with a nested polymerase chain reaction

DEFF Research Database (Denmark)

Skøt, J; Lerche, A G; Kolmos, H J

1995-01-01

To evaluate polymerase chain reaction (PCR) for detection of Pneumocystis carinii, 117 bronchoalveolar lavage (BAL) specimens, from HIV-infected patients undergoing a diagnostic bronchoscopy, were processed and a nested PCR, followed by Southern blot and hybridization with a P32-labelled probe......, but sensitivity dropped markedly with this system. A further 33 patients had both induced sputum and bronchoalveolar lavage performed and the induced sputum was analysed using PCR and routine microbiological methods. The PCR sensitivity on induced sputum was equal to that of routine methods. At present...... the evaluated PCR cannot replace routine microbiological methods for detection of Pneumocystis carinii, on either BAL fluid or induced sputum....

Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.

Science.gov (United States)

Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A

2002-10-01

ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.

[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

Science.gov (United States)

Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

2015-01-01

Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027

Directory of Open Access Journals (Sweden)

Gabriel Adrian Popescu

2018-03-01

Full Text Available Aims: To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. Methods: A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. Results: The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years; 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%. Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL, and the majority were polymerase chain reaction ribotype 027 (p<0.0001. Conclusion: The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

Science.gov (United States)

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Multiplex Reverse Transcription-Polymerase Chain Reaction untuk Deteksi Cepat Virus Flu Burung H5N1 (MULTIPLEX REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION FOR RAPID DETECTION OF H5N1 AVIAN INFLUENZA VIRUS

Directory of Open Access Journals (Sweden)

Raden Wasito

2015-05-01

Full Text Available Avian influenza virus subtype H5N1 (AIV H5N1 is highly pathogenic and fatal in poultry. The virusis still endemic with low virulence rate, although it may play a critical role in causing high morbidity andmortality rates in poultry in Indonesia. In general, diagnostic approach for AIV H5N1 is based onconventional serological and viral isolation methods that have the potential to produce consumings oftime and relatively expensive cost within the laboratory without compromising test utility. Thus, amolecular approach of multiplex reverse transcription-polymerase chain reaction (mRT-PCR was developedand applied for the detection of matrix gene type A influenza viruses, AIV subtype subtype H5hemagglutinin gene with simultaneous detection of N1 nucleoprotein gene. Thirty sera specimens fromthe diseased commercial chickens that were specifically amplified positive-RT-PCR for AIV H5N1 wereselected for mRT-PCR. The mRT-PCR products were visualized by agarose gel electrophoresis and consistedof DNA fragments of AIV of 245 bp, 545 bp and 343 bp for M, H5 and N1 genes, respectively. Thus, themRT-PCR that can rapidly differentiate simultaneously between these genes is very important for thecontrol and even eradication of AIV transmission in poultry in Indonesia.

Application of polymerase chain reaction to differentiate herpes simplex virus 1 and 2 serotypes in culture negative intraocular aspirates

Directory of Open Access Journals (Sweden)

Shyamal G

2005-01-01

Full Text Available Purpose: To standardize and apply a polymerase chain reaction (PCR on the glycoprotein D gene to differentiate Herpes simplex virus (HSV 1 & 2 serotypes in culture negative intraocular specimens. Methods: Twenty-one intraocular fluids collected from 19 patients were subjected to cultures for HSV and uniplex PCR (uPCR for DNA polymerase gene. To differentiate HSV serotypes, as 1 & 2, a seminested PCR (snPCR targeting the glycoprotein D gene was standardised and applied onto 21 intraocular fluids. The specificity of the snPCR was verified by application onto ATCC strains of HSV 1 and 2, clinical isolates and DNA sequencing of the amplified products. All specimens were also tested for the presence of cytomegalovirus (CMV and varicella zoster virus (VZV by nucleic acid amplification methods. Results: Four of the 21 intraocular fluids were positive for HSV by uPCR. snPCR detected HSV in three additional specimens (total of seven specimens, and identified three as HSV 1 and four as HSV 2. DNA sequencing of PCR products showed 100% homology with the standard strains of HSV 1 and 2 respectively. None of the samples were positive in culture. Among the other patients, CMV DNA was detected in two and VZV DNA in five others. Conclusions: The standardized snPCR can be applied directly onto the culture negative specimens for rapid differentiation of HSV serotypes.

Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

International Nuclear Information System (INIS)

Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.

2014-01-01

Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

Science.gov (United States)

Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

2011-01-03

In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

Interobserver variability and feasibility of polymerase chain reaction-based assay in distinguishing ischemic colitis from Clostridium difficile colitis in endoscopic mucosal biopsies.

Science.gov (United States)

Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T

2013-06-01

Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.

Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

Directory of Open Access Journals (Sweden)

Mayara C. Lombardi

2014-12-01

Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

Science.gov (United States)

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

DETEKSI MENGGUNAKAN PCR (POLYMERASE CHAIN REACTION CANDIDATUS LIBERIBACTER ASIATICUS, PENYEBAB HUANGLONGBING PADA JERUK SIEM DENGAN BEBERAPA TIPE GEJALA PADA DAUN

Directory of Open Access Journals (Sweden)

Achmad Himawan, Yohanes Berchmans umardiyono, Susamto Somowiyarjo, Yohanes Andi Trisyono & Andrew Beattie.

2011-11-01

Full Text Available Detection using PCR (Polymerase Chain Reaction Candidatus Liberibacter asiaticus, Huanglongbing causal Organism on Siem Mandarin with different types of symptoms.  Huanglongbing (HLB or Citrus Vein Phloem Degeration (CVPD is one of major diseases on Siem mandarin in Indonesia. HLB is caused by bacteria Candidatus liberibacter asiatus (LAS. The bacteria only live in the phloem cells of host tree and only recently it was reported to be successfully cultured on agar medium. Early detection method of LAS is needed to support healthy Siem mandarin cultivation program. This research was conducted to detect LAS in different types of HLB leaf symptoms based on Polymerase Chain Reaction (PCR method with specific primer forward MHO 353 and reverse MHO 354.  The results suggested that 8 types of HLB leaf symptoms were found on the samples used in this experiment. LAS was detected at 60% on the leaves without any symptom followed by the leaves with completely chlorosis symptom at 66%. The leaves with unevenly yellow showing higher percentage of LAS detection ranged from 80-86%. PCR technique successfully amplified DNA of LAS with the size target of 600 bp.

Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

Science.gov (United States)

Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

2016-01-01

Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review.

Science.gov (United States)

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances.

Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM-PCR)

NARCIS (Netherlands)

Rubio, J.M.; Post, R.J.; Docters van Leeuwen, W.M.; Henry, M.C.; Lindergard, G.; Hommel, M.

2002-01-01

A simplified protocol for the identification of Plasmodium species by semi-nested multiplex polymerase chain reaction (SnM-PCR) in human blood samples is compared with microscopical examination of thin and thick blood films in 2 field trials in Côte d'Ivoire and Cameroon. Also, dried blood spots or

Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

Science.gov (United States)

James, Ameh; Macdonald, Joanne

2015-01-01

Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

Evaluation of the polymerase chain reaction in the diagnosis of cutaneous leishmaniasis due to Leishmania major: a comparison with direct microscopy of smears and sections from lesions

DEFF Research Database (Denmark)

Andresen, K; Gaafar, A; El-Hassan, A M

1996-01-01

We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed by microscopi......We have compared the sensitivity of the polymerase chain reaction (PCR) as a diagnostic tool against conventional microscopical diagnostic techniques in patients with cutaneous leishmaniasis from the Sudan. Twenty-eight patients were diagnosed according to clinical criteria followed......%, respectively. The PCR should be considered as a valuable and sensitive diagnostic tool in the diagnosis of cutaneous leishmaniasis; it has the added advantage of identification of the species of Leishmania causing the lesion....

Identifikasi Brucella abortus Isolat Lokal dengan Brucella abortus Strain Specific-Polymerase Chain Reaction (IDENTIFICATION OF LOCAL ISOLATES OF BRUCELLA ABORTUS USING BRUCELLA ABORTUS STRAIN SPECIFIC-POLYMERASE CHAIN REACTION ASSAY

Directory of Open Access Journals (Sweden)

Susan Maphilindawati Noor

2014-10-01

Full Text Available Brucella abortus Strain Specific-Polymerase Chain Reaction (BaSS-PCR is a single multiplex PCRtechnique which able to identify and differentiate between Brucella abortus field strains (biovar 1, 2, and4, B. abortus vaccine strains, Brucella species, and non-Brucella species. In this study, BaSS-PCR wasapplied to identify local isolates of B. abortus in order to investigate the B. abortus strains that infectedcattle in Indonesia. Fifty local strains of B.abortus isolated from infected cattle in Java (Jakarta andBandung, South Sulawesi (Maros, East Nusa Tenggara (Kupang and Belu were used in this study. TheDNA bands were observed by agarose gel in the presence of ethidium bromide. Identification was performedbased on the size and number of DNA products amplified by PCR from each isolates. The results showedthat the 50 isolates were of B. abortus field strains. This finding showed that the cause of bovine brucellosisin Indonesia is B. abortus field strains.

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

Science.gov (United States)

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

Science.gov (United States)

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

Science.gov (United States)

Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

2009-08-01

A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

Science.gov (United States)

Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

2013-06-01

A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

Science.gov (United States)

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

OpenAIRE

Almy, Frederic S.; Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic.

Polymerase chain reaction of peripheral blood as a tool for the diagnosis of visceral leishmaniasis in children

Directory of Open Access Journals (Sweden)

Thiago Leite Fraga

2010-05-01

Full Text Available The diagnosis of visceral leishmaniasis (VL generally requires the use of invasive tests for the collection of infected tissue (aspirates of bone marrow, spleen, liver or lymph nodes. This difficulty has led to the search for safer and less painful techniques to confirm the occurrence of the disease in children. Polymerase chain reaction (PCR is a method that is advantageous in that it allows the use of peripheral blood samples for diagnosis. This paper reports the utilisation of PCR on peripheral blood samples to diagnose VL in 45 children in Mato Grosso do Sul, Brazil. This technique is compared with methods carried out using tissue collected by invasive procedures, including direct microscopy, culture and detection of Leishmania DNA by PCR in bone marrow aspirates. The results show that PCR of peripheral blood provides great sensitivity (95.6% that is similar to that from the PCR of bone marrow aspirates (91.1% and higher than that achieved with microscopy (80% or culture (26.7% methods. PCR of peripheral blood proved to be a suitable tool for the diagnosis of VL in children because it is highly sensitive and safe, with tissue collection being less invasive than in traditional tests.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Deletion Analysis Of The Duchenne/Becker Muscular Dystrophy Gene Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Dastur R

2003-01-01

Full Text Available The diagnosis of Duchenne Muscular Dystrophy (DMD and Becker Muscular Dystrophy (BMD is mainly based on clinical profile, serum CPK values, muscle biopsy and immunostaining for dystrophin. Most recent and accurate method for diagnosing DMD/BMD is by detection of mutations in the DMD gene. This was done in 100 unrelated patients using 19 exons including the promoter region in two sets of multiplex polymerase chain reaction (PCR. These primers amplify most of the exons in the deletion prone ′hotspot′ regions allowing determination of deletion end point. Intragenic deletions were detected in 74 patients indicating that the use of PCR-based assays will allow deletion detection help in prenatal diagnosis for most of the DMD/BMD patients. The frequency of deletions observed in the present study was 74%.

Isolation and polymerase chain reaction-based identification of Riemerella anatipestifer from ducks in Kerala, India

Directory of Open Access Journals (Sweden)

Manju Soman

2014-10-01

Full Text Available Aim: The aim was to isolate and characterize Riemerella anatipestifer organisms from disease outbreaks in ducks in Kerala. Materials and Methods: Ducklings, suspected of Riemerella infection, were sacrificed and subjected to post-mortem examination. Heart blood smears and impression smears from liver and spleen were examined for the presence of pathogenic organisms. Heart blood, lung, liver, and spleen collected aseptically from the birds were subjected to isolation trials in brain heart infusion agar and 10% bovine blood agar. The isolates were characterized based on morphology, cultural characteristics and biochemical tests, and their identity were confirmed by polymerase chain reaction (PCR and the PCR amplified DNA was sequenced. The antibiotic sensitivity testing of the isolates were carried out using six antibiotics viz ciprofloxacin, chloramphenicol, enrofloxacin, amoxycillin, cotrimoxazole, and gentamicin. Results: Colonies suggestive of Riemerella organisms could be isolated on blood agar. Biochemical characterization and PCR confirmed the identity of isolates as R. anatipestifer. The nucleotide sequence of the PCR product showed 99% homology to the R. anatipestifer sequences in the NCBI. The antibiogram revealed that the organisms were sensitive to ciprofloxacin, enrofloxacin, and gentamicin. Conclusion: The present study suggests that the PCR assay can facilitate fast and proper identification of R. anatipestifer infection in ducks. The assay can also differentiate between R. anatipestifer and Pasteurella multocida and can replace the traditional methods of differentiation which are cumbersome and time-consuming.

Detection of Vibrio spp. in shrimp from aquaculture sites in Iran using polymerase chain reaction (PCR)

OpenAIRE

Faham Khamesipour; Esmat Noshadi; Mitra Moradi; Mehdi Raissy

2014-01-01

Shrimp is one of the most important fishery products of the coastal provinces in the Persian Gulf in Iran. Vibriosis has been an important cause of production loss due to bacterial disease in shrimp farms in south Iran in recent years. The objective of this study was to detect the prevalence of Vibrio spp. in shrimp samples from farms in the southern provinces of Iran by polymerase chain reaction (PCR). A total number of 36 shrimp were caught from south coast of Iran and were stud...

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

Science.gov (United States)

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus.

Science.gov (United States)

Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi

2017-11-01

Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.

Development of the nested polymerase chain reaction (PCR) for detection of hepatitis C virus RNA in blood derivatives. Final report for the period 15 December 1994 - 15 December 1995

International Nuclear Information System (INIS)

Pavelic, J.

1996-07-01

Testing for the presence of hepatitis C virus (HCV) in blood derivatives used in clinical medicine is important to ensure the safety of such preparations. A reliable and reproducible method is described for the isolation of HCV RNA, subsequent reverse transcription and nested polymerase chain reaction (PCR) from blood derivatives. Of 17 batches of blood derivatives (14 negative for anti-HCV and 3 of unknown anti-HCV status) five were found to be positive in the nested PCR. (author). 4 refs, 3 figs, 1 tab

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

Science.gov (United States)

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

Science.gov (United States)

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

Science.gov (United States)

Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

2013-11-27

The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

Detection of tet(M) and tet(O) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease.

Science.gov (United States)

Olsvik, B; Olsen, I; Tenover, F C

1995-04-01

The polymerase chain reaction was used to examine 114 tetracycline-resistant anaerobic and facultative anaerobic bacterial isolates from patients with periodontal disease for the tet(M) and tet(O) genes. A 740-base-pair fragment of the tet(M) gene was amplified from 84 of 114 isolates, and a 519-base-pair fragment of the tet(O) gene was amplified from 13 streptococcal isolates. Six of 7 tetracycline-resistant isolates of Veillonella spp. and tetracycline-resistant isolates of Eubacterium spp. (n = 3), Eubacterium saburreum (n = 1), Streptococcus intermedius (n = 5) and Gemella morbillorum (n = 2) all harbored the tet(M) gene. The tet(M) and tet(O) negative as well as selected positive isolates were tested for the tet(K) and tet(L) genes using DNA probes. All isolates of Staphylococcus spp. (n = 11) hybridized with the tet(K) probe. None of the isolates tested hybridized with the probe for tet(L). This is the first report of the tet(M) gene in the facultative bacterium G. morbillorum and in E. saburreum.

Method and apparatus for purifying nucleic acids and performing polymerase chain reaction assays using an immiscible fluid

Energy Technology Data Exchange (ETDEWEB)

Koh, Chung-Yan; Light, Yooli Kim; Piccini, Matthew Ernest; Singh, Anup K.

2017-10-31

Embodiments of the present invention are directed toward devices, systems, and methods for purifying nucleic acids to conduct polymerase chain reaction (PCR) assays. In one example, a method includes generating complexes of silica beads and nucleic acids in a lysis buffer, transporting the complexes through an immiscible fluid to remove interfering compounds from the complexes, further transporting the complexes into a density medium containing components required for PCR where the nucleic acids disassociate from the silica beads, and thermocycling the contents of the density medium to achieve PCR. Signal may be detected from labeling agents in the components required for PCR.

Field expansion of DNA polymerase chain reaction for early infant diagnosis of HIV-1: The Ethiopian experience

Directory of Open Access Journals (Sweden)

Peter Fonjungo

2013-05-01

Full Text Available Background: Early diagnosis of infants infected with HIV (EID and early initiation of treatment significantly reduces the rate of disease progression and mortality. One of the challengesto identification of HIV-1-infected infants is availability and/or access to quality molecular laboratory facilities which perform molecular virologic assays suitable for accurate identificationof the HIV status of infants. Method: We conducted a joint site assessment and designed laboratories for the expansion of DNA polymerase chain reaction (PCR testing based on dried blood spot (DBS for EID insix regions of Ethiopia. Training of appropriate laboratory technologists and development of required documentation including standard operating procedures (SOPs was carried out. The impact of the expansion of EID laboratories was assessed by the number of tests performed as well as the turn-around time. Results: DNA PCR for EID was introduced in 2008 in six regions. From April 2006 to April 2008, a total of 2848 infants had been tested centrally at the Ethiopian Health and Nutrition Research Institute (EHNRI in Addis Ababa, and which was then the only laboratory with the capability to perform EID; 546 (19.2% of the samples were positive. By November 2010, EHNRI and the six laboratories had tested an additional 16 985 HIV-exposed infants, of which 1915 (11.3% were positive. The median turn-around time for test results was 14 days (range 14−21 days. Conclusion: Expansion of HIV DNA PCR testing facilities that can provide quality and reliable results is feasible in resource-limited settings. Regular supervision and monitoring for quality assurance of these laboratories is essential to maintain accuracy of testing.

Comparison between specific and multiplex reverse transcription-polymerase chain reaction for detection of hepatitis A virus, poliovirus and rotavirus in experimentally seeded oysters

Directory of Open Access Journals (Sweden)

C Coelho

2003-06-01

Full Text Available Outbreaks of gastroenteritis have occurred among consumers of raw or undercooked shellfish harvested from faecally polluted waters. A multiplex reverse transcription-polymerase chain reaction (RT-PCR was applied for the simultaneous detection of hepatitis A virus (HAV, poliovirus (PV and simian rotavirus (RV-SA11 and compared with specific primers for each genome sequence. Three amplified DNA products representing HAV (192 bp, PV (394 bp and RV (278 bp were identified when positive controls were used. However, when tested on experimentally contaminated raw oysters, this method was not able to detect the three viruses simultaneously. This is probably due to the low concentration of viral RNAs present in oyster extract which were partially lost during the extracts preparation.

Polymerase chain reaction fingerprints of methicillin-resistant Staphylococcus aureus clinical isolates in Greece are related to certain antibiotypes.

Science.gov (United States)

Bartzavali-Louki, Christina; Dimitracopoulos, George; Spiliopoulou, Iris

2003-06-01

Characterization of clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA) and representatives of three MRSA clones from other hospitals was performed by arbitrarily primed polymerase chain reaction (AP-PCR) and antibiotic susceptibility patterns. All isolates were mecA-positive and two main antibiotypes have been characterized. Two major clones were identified with AP-PCR related to the aforementioned antibiotypes. The combination of antibiotypes with AP-PCR patterns successfully identified the two major clones in our hospital, which are identical with the MRSA clones previously characterized in Athens and in Central and North Greece.

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

Science.gov (United States)

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

Impetigo-like tinea faciei around the nostrils caused by Arthroderma vanbreuseghemii identified using polymerase chain reaction-based sequencing of crusts.

Science.gov (United States)

Kang, Daoxian; Ran, Yuping; Li, Conghui; Dai, Yaling; Lama, Jebina

2013-01-01

We report a case of Arthroderma vanbreuseghemii (a teleomorph of Trichophyton interdigitale) infection around the nostrils in a 3-year-old girl. The culture was negative, so the pathogenic agent was identified using polymerase chain reaction-based sequencing of the crusts taken from the lesion on the nostril. Treatment with oral itraconazole and topical 1% naftifine/0.25% ketoconazole cream after a topical wash with ketoconazole shampoo was effective. © 2012 Wiley Periodicals, Inc.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

The generation of radiolabeled DNA and RNA probes with polymerase chain reaction

International Nuclear Information System (INIS)

Schowalter, D.B.; Sommer, S.S.

1989-01-01

By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Powerful strategy for polymerase chain reaction-based clonality assessment in T-cell malignancies Report of the BIOMED-2 Concerted Action BHM4 CT98-3936

NARCIS (Netherlands)

Brüggemann, M.; White, H.; Gaulard, P.; Garcia-Sanz, R.; Gameiro, P.; Oeschger, S.; Jasani, B.; Ott, M.; Delsol, G.; Orfao, A.; Tiemann, M.; Herbst, H.; Langerak, A. W.; Spaargaren, M.; Moreau, E.; Groenen, P. J. T. A.; Sambade, C.; Foroni, L.; Carter, G. I.; Hummel, M.; Bastard, C.; Davi, F.; Delfau-Larue, M.-H.; Kneba, M.; van Dongen, J. J. M.; Beldjord, K.; Molina, T. J.

2007-01-01

Polymerase chain reaction (PCR) assessment of clonal T-cell receptor (TCR) and immunoglobulin (Ig) gene rearrangements is an important diagnostic tool in mature T-cell neoplasms. However, lack of standardized primers and PCR protocols has hampered comparability of data in previous clonality studies.

Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics.

Science.gov (United States)

Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio

2017-05-01

Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

Internal control for real-time polymerase chain reaction based on MS2 bacteriophage for RNA viruses diagnostics

Directory of Open Access Journals (Sweden)

Miriam Ribas Zambenedetti

Full Text Available BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV, hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+ plasmid, generating pET47b(+-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.

Galactomannan and Polymerase Chain Reaction-Based Screening for Invasive Aspergillosis Among High-Risk Hematology Patients: A Diagnostic Meta-analysis.

Science.gov (United States)

Arvanitis, Marios; Anagnostou, Theodora; Mylonakis, Eleftherios

2015-10-15

Screening of high-risk patients for invasive aspergillosis (IA) has the potential to decrease the use of empiric antifungal agents. However, the performance of different screening methods has not been studied. We performed a meta-analysis of published studies to assess the diagnostic performance of galactomannan (GM) and polymerase chain reaction (PCR) as weekly screening tests in high-risk populations. The sensitivity and specificity of 6 approaches combining GM and PCR were estimated using the bivariate model. Thirteen studies with 1670 patients met our inclusion criteria. Single positive test results had modest sensitivity and specificity for screening (respectively, 92% and 90% for GM; 84% and 76% for PCR). The screening approach with the highest sensitivity was the one that used at least 1 GM- or PCR-positive result to define a positive episode, achieving a sensitivity of 99%, significantly higher than any single test (P = .0018 compared with GM and P value of 100%, whereas the presence of at least 2 positive results is highly suggestive of an active infection with a positive predictive value of 88%. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Evaluation of a polymerase chain reaction reverse hybridization line probe assay for the detection and identification of medically important fungi in bronchoalveolar lavage fluids.

NARCIS (Netherlands)

Meletiadis, J.; Melchers, W.J.G.; Meis, J.F.G.M.; Hurk, P.J.J.C. van den; Jannes, G.; Verweij, P.E.

2003-01-01

An assay system in which polymerase chain reaction (PCR) amplification of the ITS-1 region of ribosomal DNA (rDNA) is combined with a reverse-hybridization line probe assay (LiPA) was used for the identification of six Candida species and four Aspergillus species in pure cultures of clinical

A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems

Directory of Open Access Journals (Sweden)

Elisa Morganti

2011-01-01

Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.

Saliva Polymerase-Chain-Reaction Assay for Cytomegalovirus Screening in Newborns

Science.gov (United States)

Boppana, Suresh B.; Ross, Shannon A.; Shimamura, Masako; Palmer, April L.; Ahmed, Amina; Michaels, Marian G.; Sánchez, Pablo J.; Bernstein, David I.; Tolan, Robert W.; Novak, Zdenek; Chowdhury, Nazma; Britt, William J.; Fowler, Karen B.

2011-01-01

BACKGROUND Congenital cytomegalovirus (CMV) infection is an important cause of hearing loss, and most infants at risk for CMV-associated hearing loss are not identified early in life because of failure to test for the infection. The standard assay for newborn CMV screening is rapid culture performed on saliva specimens obtained at birth, but this assay cannot be automated. Two alternatives — real-time polymerase-chain-reaction (PCR)–based testing of a liquid-saliva or dried-saliva specimen obtained at birth — have been developed. METHODS In our prospective, multicenter screening study of newborns, we compared real-time PCR assays of liquid-saliva and dried-saliva specimens with rapid culture of saliva specimens obtained at birth. RESULTS A total of 177 of 34,989 infants (0.5%; 95% confidence interval [CI], 0.4 to 0.6) were positive for CMV, according to at least one of the three methods. Of 17,662 newborns screened with the use of the liquid-saliva PCR assay, 17,569 were negative for CMV, and the remaining 85 infants (0.5%; 95% CI, 0.4 to 0.6) had positive results on both culture and PCR assay. The sensitivity and specificity of the liquid-saliva PCR assay were 100% (95% CI, 95.8 to 100) and 99.9% (95% CI, 99.9 to 100), respectively, and the positive and negative predictive values were 91.4% (95% CI, 83.8 to 96.2) and 100% (95% CI, 99.9 to 100), respectively. Of 17,327 newborns screened by means of the dried-saliva PCR assay, 74 were positive for CMV, whereas 76 (0.4%; 95% CI, 0.3 to 0.5) were found to be CMV-positive on rapid culture. Sensitivity and specificity of the dried-saliva PCR assay were 97.4% (95% CI, 90.8 to 99.7) and 99.9% (95% CI, 99.9 to 100), respectively. The positive and negative predictive values were 90.2% (95% CI, 81.7 to 95.7) and 99.9% (95% CI, 99.9 to 100), respectively. CONCLUSIONS Real-time PCR assays of both liquid- and dried-saliva specimens showed high sensitivity and specificity for detecting CMV infection and should be

Performance of polymerase chain reaction for the diagnosis of cystic echinococcosis using serum, urine, and cyst fluid samples.

Science.gov (United States)

Chaya, Dr; Parija, Subhash Chandra

2014-01-01

Cystic echinococcosis (CE) is a chronic zoonosis which presents with variable clinical manifestations. Currently the diagnosis of this disease is based on radiological findings and serological tests which lack specificity. Although antigen detection from the cyst fluid is the most specific, it is seldom done due to the complications involved. Detecting the presence of Echinococcus granulosus specific deoxyribonucleic acid (DNA) by the polymerase chain reaction (PCR) could provide a definitive diagnosis of CE. An in-house PCR assay was devised to detect E. granulosus specific DNA in serum, urine and hydatid cyst fluid. The ability of the PCR to detect E. granulosus in the above mentioned samples were observed in comparison with other antigen and antibody detection tests. Serum samples from surgically confirmed patients of CE with ruptured cysts contained the corresponding DNA while the in the majority of cases who had an intact cyst had no DNA of E. granulosus in their serum. DNA of E. granulosus was not found to be excreted in urine. PCR performed equal to antigen detection ELISA while testing hydatid cyst fluid samples. Serum and urine might not serve as useful samples for the molecular diagnosis of cystic echinococcosis. However, PCR can be useful on serum samples to detect ruptured hydatid cysts and on hydatid cyst fluid to confirm the parasitic diagnosis.

Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

Science.gov (United States)

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

DEFF Research Database (Denmark)

Høgdall, Estrid; Vuust, Jens; Lind, Peter

2000-01-01

of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

Directory of Open Access Journals (Sweden)

Cheng-Yao eChen

2014-06-01

Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

Quantitative 16S rDNA-targeted polymerase chain reaction and oligonucleotide hybridization for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere

NARCIS (Netherlands)

Rosado, A.S.; Seldin, L.; Wolters, A.; Elsas, van J.D.

1996-01-01

A molecular method for the detection of Paenibacillus azotofixans in soil and the wheat rhizosphere was developed. The system consisted of polymerase chain reaction (PCR) amplification of part of the variable V1 to V4 regions of the 16S ribosomal RNA gene, followed by hybridization with a specific

Comparison of Real Time Polymerase Chain Reaction with Microscopy and Antigen Detection Assay for the Diagnosis of Malaria

International Nuclear Information System (INIS)

Khan, S. A.; Ahmed, S.; Khan, F. A.; Shamshad, G. U.; Joyia, Z.; Mushahid, N.; Saeed, S.

2013-01-01

Objective: To determine the sensitivity of a real time polymerase chain reaction (PCR) for malaria diagnosis and to compare its accuracy with microscopy and an antigen based rapid diagnostic test (OptiMal). Study Design: Cross-sectional analytical study. Place and Duration of Study: Military Hospital, Armed Forces Institute of Transfusion and Armed Forces Institute of Pathology, Rawalpindi, from July to December 2011. Methodology: Venous blood samples of 300 clinically suspected patients of malaria were tested for malaria parasite by microscopy and OptiMal; and malaria parasite index was calculated for the positive samples. Plasmodium genus specific real time PCR was performed on all specimens, targeting small subunit rRNA gene. Diagnostic accuracy of three tests was compared and cost analysis was done. Results: Out of 300 patients, malaria parasite was detected in 110, 106 and 123 patients by microscopy, OptiMAL and PCR respectively. Real time PCR was 100% sensitive while microscopy and OptiMal had sensitivity of 89.4% and 86.2% respectively. All methods were 100% specific. The cost per test was calculated to be 0.2, 2.75 and 3.30 US dollar by microscopy, OptiMal and PCR respectively, excluding the once capital cost on PCR equipment. Conclusion: Genus specific real time PCR for the diagnosis of malaria was successfully established as a highly sensitive and affordable technology that should be incorporated in the diagnostic algorithm in this country. (author)

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

OpenAIRE

Marcos Lázaro Moreli; Ricardo Luiz Moro de Sousa; Luiz Tadeu Moraes Figueiredo

2004-01-01

We report a nested reverse transcription-polymerase chain reaction (RT-PCR) assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS) patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity) and in all 9 blood samples (100% positi...

Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?

Directory of Open Access Journals (Sweden)

Yoo Jin Lee

2016-11-01

Full Text Available Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB, but it is time-consuming. Polymerase chain reaction (PCR is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA, acid-fast bacilli (AFB staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1% and a high specificity (86.3% based on the culture results of other studies. The sensitivity was higher (65.5% in cases with necrotizing granuloma but showed the highest sensitivity (66.7% in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis.

Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems

Directory of Open Access Journals (Sweden)

Camila Ximenes

2014-12-01

Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

Science.gov (United States)

Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

2018-01-01

Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430

A quantitative real time polymerase chain reaction approach for estimating processed animal proteins in feed: preliminary data

Directory of Open Access Journals (Sweden)

Maria Cesarina Abete

2013-04-01

Full Text Available Lifting of the ban on the use of processed animal proteins (PAPs from non-ruminants in non-ruminant feed is in the wind, avoiding intraspecies recycling. Discrimination of species will be performed through polymerase chain reaction (PCR, which is at a moment a merely qualitative method. Nevertheless, quantification of PAPs in feed is needed. The aim of this study was to approach the quantitative determination of PAPs in feed through Real Time (RT-PCR technique; three different protocols picked up from the literature were tested. Three different kind of matrices were examined: pure animal meals (bovine, chicken and pork; one feed sample certified by the European reference laboratory on animal proteins (EURL AP in feed spiked with 0.1% bovine meal; and genomic DNAs from bovine, chicken and pork muscles. The limit of detection (LOD of the three protocols was set up. All the results obtained from the three protocols considered failed in the quantification process, most likely due to the uncertain copy numbers of the analytical targets chosen. This preliminary study will allow us to address further investigations, with the purpose of developing a RT-PCR quantitative method.

Automation and integration of polymerase chain reaction with capillary electrophoresis for high throughput genotyping and disease diagnosis

Energy Technology Data Exchange (ETDEWEB)

Zhang, N.

1999-02-12

Genotyping is to detect specific loci in the human genome. These loci provide important information for forensic testing, construction of genetic linkage maps, gene related disease diagnosis and pharmacogenetic research. Genotyping is becoming more and more popular after these loci can be easily amplified by polymerase chain reaction (PCR). Capillary electrophoresis has its unique advantages for DNA analysis due to its fast heat dissipation and ease of automation. Four projects are described in which genotyping is performed by capillary electrophoresis emphasizing different aspects. First, the author demonstrates a principle to determine the genotype based on capillary electrophoresis system. VNTR polymorphism in the human D1S80 locus was studied. Second, the separation of four short tandem repeat (STR) loci vWF, THO1, TPOX and CSF1PO (CTTv) by using poly(ethylene oxide) (PEO) was studied in achieving high resolution and preventing rehybridization of the DNA fragments. Separation under denaturing, non-denaturing conditions and at elevated temperature was discussed. Third, a 250 {micro}m i.d., 365 {micro}m o.d. fused silica capillary was used as the microreactor for PCR. Fourth, direct PCR from blood was studied to simplify the sample preparation for genotyping to minimum.

Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

DEFF Research Database (Denmark)

Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper

2007-01-01

OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

Science.gov (United States)

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Rapid Identification of a Cooling Tower-Associated Legionnaires' Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014-2015.

Science.gov (United States)

Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

2018-04-01

We investigated an outbreak of eight Legionnaires' disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings.

Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

Science.gov (United States)

Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

2007-09-01

To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

The Advance of Technology of Reverse Transcriptase-Polymerase Chain Reaction in Identifying the Genome of Avian Influenza and Newcastle Diseases

Directory of Open Access Journals (Sweden)

Dyah Ayu Hewajuli

2014-03-01

Full Text Available Avian Influenza (AI viruses are zoonotic and caused death in humans. Newcastle Diseases (ND virus has an economical impact in poultry. Therefore, the identification and characterization of AI and ND viruses that are appropriate, accurate and quick are important to protect human and poultry health. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR was the latest gold standard to detect the genome of AI and ND viruses. Recently, RT-PCR was developed in routine diagnosis and research. RT-PCR is a method to amplify the sequences of DNA genome, preceded by reverse transcriptase process with the primer-mediated enzymatic. Some factors that influenced detection of AI and ND are design primer and probe, types of samples, enzyme, reagent composition, amplification temperature and cycles, technical and non-technical factors such as contamination and trained staff. Modified conventional and real time RT-PCR are able to improve the specificity and sensitivity of the test.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

Energy Technology Data Exchange (ETDEWEB)

Jovanovic, Jelena V. [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom); Rennie, Kristian [GSTS Pathology, Guy’s Hospital, London (United Kingdom); Culligan, Dominic [Department of Haematology, Aberdeen Royal Infirmary, Aberdeen (United Kingdom); Peniket, Andrew [Department of Haematology, John Radcliffe Hospital, Oxford (United Kingdom); Lennard, Anne [Department of Haematology, Royal Victoria Infirmary, Newcastle (United Kingdom); Harrison, Justin [Department of Haematology, Hemel Hempstead Hospital, Hemel Hempstead (United Kingdom); Vyas, Paresh [Medical Research Council Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, Oxford (United Kingdom); Grimwade, David, E-mail: david.grimwade@genetics.kcl.ac.uk [Cancer Genetics Laboratory, Department of Medical and Molecular Genetics, King’s College London School of Medicine, London (United Kingdom)

2011-10-25

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10{sup 4}−10{sup 5}. Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Development of Real-Time Quantitative Polymerase Chain Reaction Assays to Track Treatment Response in Retinoid Resistant Acute Promyelocytic Leukemia

International Nuclear Information System (INIS)

Jovanovic, Jelena V.; Rennie, Kristian; Culligan, Dominic; Peniket, Andrew; Lennard, Anne; Harrison, Justin; Vyas, Paresh; Grimwade, David

2011-01-01

Molecular detection of minimal residual disease (MRD) has become established to assess remission status and guide therapy in patients with ProMyelocytic Leukemia–RARA+ acute promyelocytic leukemia (APL). However, there are few data on tracking disease response in patients with rarer retinoid resistant subtypes of APL, characterized by PLZF–RARA and STAT5b–RARA. Despite their rarity (<1% of APL) we identified 6 cases (PLZF–RARA, n = 5; STAT5b–RARA, n = 1), established the respective breakpoint junction regions and designed reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) assays to detect leukemic transcripts. The relative level of fusion gene expression in diagnostic samples was comparable to that observed in t(15;17) – associated APL, affording assay sensitivities of ∼1 in 10 4 −10 5 . Serial samples were available from two PLZF–RARA APL patients. One showed persistent polymerase chain reaction positivity, predicting subsequent relapse, and remains in CR2, ∼11 years post-autograft. The other, achieved molecular remission (CRm) with combination chemotherapy, remaining in CR1 at 6 years. The STAT5b–RARA patient failed to achieve CRm following frontline combination chemotherapy and ultimately proceeded to allogeneic transplant on the basis of a steadily rising fusion transcript level. These data highlight the potential of RT-qPCR detection of MRD to facilitate development of more individualized approaches to the management of rarer molecularly defined subsets of acute leukemia.

Susceptibility of Biomphalaria tenagophila and Biomphalaria straminea to Schistosoma mansoni infection detected by low stringency polymerase chain reaction

Directory of Open Access Journals (Sweden)

JANNOTTI-PASSOS Liana Konovaloff

2000-01-01

Full Text Available In order to determine Schistosoma mansoni infection rates in Biomphalaria tenagophila and B. straminea, low stringency polymerase chain reaction (LS-PCR technique was used as a complementary method to light exposure technique. LS-PCR has already been standardized in our laboratory to detect the trematode DNA in B. glabrata. Higher S. mansoni infection rates were detected using conventional method and LS-PCR. The parasite DNA profile was detected in both species after 7-day exposure to miracidia, using LS-PCR. This technique enables early detection of schistosomiasis transmission focuses, in endemic areas, before the beginning of cercariae shedding.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

Science.gov (United States)

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

Loop mediated isothermal amplification assay using hydroxy naphthol blue, conventional polymerase chain reaction and real-time PCR in the diagnosis of intraocular tuberculosis

Directory of Open Access Journals (Sweden)

P K Balne

2015-01-01

Full Text Available This study is a comparative evaluation (Chi-square test of a closed tube loop mediated isothermal amplification assay using hydroxy naphthol blue dye (HNB-LAMP, real-time polymerase chain reaction (PCR and conventional PCR in the diagnosis of intraocular tuberculosis. Considering clinical presentation as the gold standard in 33 patients, the sensitivity of HNB-LAMP assay (75.8% was higher (not significant, P value 0.2 than conventional PCR (57.6% and lower than real-time PCR (90.9%. Specificity was 100% by all three methods. No amplification was observed in negative controls (n = 20 by all three methods. The cost of the HNB-LAMP assay was Rs. 500.00 and it does not require thermocycler, therefore, it can be used as an alternative to conventional PCR in resource-poor settings.

Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates.

Science.gov (United States)

Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho

2012-07-01

Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

Temporal relationships between colds, upper respiratory viruses detected by polymerase chain reaction, and otitis media in young children followed through a typical cold season.

Science.gov (United States)

Winther, Birgit; Alper, Cuneyt M; Mandel, Ellen M; Doyle, William J; Hendley, J Owen

2007-06-01

Otitis media is a frequent complication of a viral upper respiratory tract infection, and the reported co-incidence of those diseases increases with assay sensitivity and sampling density. We determined the incidence of otitis-media complications in young children when referenced to cold-like illnesses and to concurrent virus recovery from the nasopharynx. A total of 60 children from 24 families were followed from October 2003 through April 30, 2004, by daily parental recording of illness signs, weekly pneumatic otoscopic examinations, and periodic polymerase chain reaction assay of collected nasal fluids for common viruses. One hundred ninety-nine cold-like illnesses were observed, but a sample for virus assay was not collected concurrent with 71 episodes. Of the remainder, 73% of cold-like illnesses were temporally related to recovery of 1 or a combination of the assayed viruses, with rhinovirus predominating. For non-cold-like illness periods, 54 (18%) of 297 assays were positive for virus, and the virus frequency distribution was similar to that for cold-like illnesses. There were 93 diagnosed otitis-media episodes; 65 (70%) of these occurred during a cold-like illness. For the 79 otitis-media episodes with available nasal samples, 61 (77%) were associated with a positive virus result. In this population, the otitis-media complication rate for a cold-like illness was 33%. A cold-like illness was not a prerequisite for polymerase chain reaction detection of viruses in the nose and nasopharynx of young children. Viral detection by polymerase chain reaction in the absence of a cold-like illness is associated with complications in some subjects. Otitis media is a complication of viral infection both with and without concurrent cold-like illnesses, thus downwardly biasing coincidence estimates that use cold-based illnesses as the denominator.

Identification of aflatoxigenic fungi using polymerase chain reaction-based assay

Directory of Open Access Journals (Sweden)

Šošo Vladislava M.

2014-01-01

Full Text Available As the aflatoxins represent a health-risk for humans because of their proven carcinogenicity, food-borne fungi that produce them as secondary metabolites, mainly Aspergillus flavus and Aspergillus parasiticus, have to be isolated and identified. The best argument for identifying problem fungi is that it indicates control points within the food system as part of a hazard analysis critical control point (HACCP approach. This assumes there is a close link between fungus and toxin. Conventional methods for isolation and identification of fungi are time consuming and require admirably dedicated taxonomists. Hence, it is imperative to develop methodologies that are relatively rapid, highly specific and as an alternative to the existing methods. The polymerase chain reaction (PCR facilitates the in vitro amplification of the target sequence. The main advantages of PCR is that organisms need not be cultured, at least not for a long time, prior to their detection, target DNA can be detected even in a complex mixture, no radioactive probes are required, it is rapid, sensitive and highly versatile. The gene afl-2 has been isolated and shown to regulate aflatoxin biosynthesis in A. flavus. Also, the PCR reaction was targeted against aflatoxin synthesis regulatory gene (aflR1 since these genes are nearly identical in A. flavus and A. parasiticus in order to indicate the possibility of detection of both the species with the same PCR system (primers/reaction. [Projekat Ministarstva nauke Republike Srbije, br. III46009

Polymerase chain reaction (PCR) for rapid diagnosis and differentiation of parapoxvirus and orthopoxvirus infections in camels

International Nuclear Information System (INIS)

Khalafalla, A.I.; Buettner, M.; Rziha, H.-J.

2005-01-01

Rapid identification and differentiation of camel pox (CMP) and camel contagious ecthyma (CCE) were achieved by polymerase chain reaction (PCR) with primers that distinguish Orthopoxvirus (OPV) and Parapovirus (PPV). Forty scab specimens collected from sick camels and sheep were treated by 3 different DNA extraction procedures and examined by PCR. The sensitivity of the PCR was compared with that of electron microscopy and virus isolation in cell culture. Procedure 1, in which viral DNA was extracted directly from scab specimens followed by PCR, proved to be superior and more sensitive. Procedure 2 enables a fast specific diagnosis of PPV and OPV infections directly from scab materials without the need for DNA extraction. These assays provide a rapid and feasible alternative to electron microscopy and virus isolation. (author)

Specific Identification of Biomphalaria tenagophila and Biomphalaria occidentalis Populations by the Low Stringency Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Edina Rodrigues Pires

1997-01-01

Full Text Available Although Biomphalaria occidentalis and B. tenagophila are indistinguishable on the basis of shell morphology and the majority of their genital organs, only the latter is susceptible to infection with Schistosoma mansoni. Thus, the identification of these species is fundamental to epidemiological studies of schistosomiasis. Here we describe a simple and rapid method for differentiating B. tenagophila from B. occidentalis based on low stringency polymerase chain reaction and using a pair of primers specific for the amplification of the 18S rRNA gene. Analysis of the low stringency product profiles of populations of these snails from different geographical regions confirmed this approach as being applicable to the identification of B. tenagophila and B. occidentalis in cases where classical morphology is inconclusive

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

Science.gov (United States)

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction.

Science.gov (United States)

Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C

2002-01-01

Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

Directory of Open Access Journals (Sweden)

Herintha Coeto Neitzke-Abreu

Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

Science.gov (United States)

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Porcine reproductive and respiratory syndrome virus: Interlaboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction detection methods

DEFF Research Database (Denmark)

Wernike, Kerstin; Bonilauri, Paolo; Dauber, Malte

2012-01-01

To compare the real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays used for the diagnosis of Porcine reproductive and respiratory syndrome virus (PRRSV), a Europe-wide interlaboratory ring trial was conducted. A variety of PRRSV strains including North American...... (NA) and European (EU) genotype isolates were analyzed by the participants. Great differences regarding qualitative diagnostics as well as analytical sensitivity were observed between the individual RT-qPCR systems, especially when investigating strains from the EU genotype. None of the assays...

A Simple Reverse Transcription-Polymerase Chain Reaction for Dengue Type 2 Virus Identification

Directory of Open Access Journals (Sweden)

Luiz Tadeu M Figueiredo

1997-05-01

Full Text Available We show here a simplified reverse transcription-polymerase chain reaction (RT-PCR for identification of dengue type 2 virus. Three dengue type 2 virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD, as a negative control, were used in this study. C6/36 cells were infected with the virus, and tissue culture fluids were collected after 7 days of infection period. The RT-PCR, a combination of RT and PCR done after a single addition of reagents in a single reaction vessel was carried out following a digestion of virus with 1% Nonidet P-40. The 50ml assay reaction mixture included 50 pmol of a dengue type 2 specific primer pair amplifying a 210 base pair sequence of the envelope protein gene, 0.1 mM of the four deoxynucleoside triphosphates, 7.5U of reverse transcriptase, and 1U of thermostable Taq DNA polymerase. The reagent mixture was incubated for 15 min at 37oC for RT followed by a variable amount of cycles of two-step PCR amplification (92oC for 60 sec, 53oC for 60 sec with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized with UV light after gel incubation in ethidium bromide solution. DNA bands were observed after 25 and 30 cycles of PCR. Virus amount as low as 102.8 TCID50/ml was detected by RT-PCR. Specific DNA amplification was observed with the three dengue type 2 strains. This assay has advantages compared to other RT-PCRs: it avoids laborious extraction of virus RNA; the combination of RT and PCR reduces assay time, facilitates the performance and reduces risk of contamination; the two-step PCR cycle produces a clear DNA amplification, saves assay time and simplifies the technique

An investigation of genital ulcers in Jackson, Mississippi, with use of a multiplex polymerase chain reaction assay: high prevalence of chancroid and human immunodeficiency virus infection.

Science.gov (United States)

Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E

1998-10-01

In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P chancroid were significantly more likely than male patients without ulcers to report sex with a crack cocaine user, exchange of money or drugs for sex, and multiple sex partners. The strong association between genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.

Effect of surface functionalisation on the interaction of iron oxide nanoparticles with polymerase chain reaction.

Science.gov (United States)

Aysan, Ayse Beyza; Knejzlík, Zdeněk; Ulbrich, Pavel; Šoltys, Marek; Zadražil, Aleš; Štěpánek, František

2017-05-01

The combination of nanoparticles with the polymerase chain reaction (PCR) can have benefits such as easier sample handling or higher sensitivity, but also drawbacks such as loss of colloidal stability or inhibition of the PCR. The present work systematically investigates the interaction of magnetic iron oxide nanoparticles (MIONs) with the PCR in terms of colloidal stability and potential PCR inhibition due to interaction between the PCR components and the nanoparticle surface. Several types of MIONs with and without surface functionalisation by sodium citrate, dextran and 3-aminopropyl-triethoxysilane (APTES) were prepared and characterised by Transmission Electron Microscopy (TEM), dynamic light scattering (DLS) and Fourier Transform Infrared (FT-IR) spectroscopy. Colloidal stability in the presence of the PCR components was investigated both at room temperature and under PCR thermo-cycling. Dextran-stabilized MIONs show the best colloidal stability in the PCR mix at both room and elevated temperatures. Citrate- and APTES-stabilised as well as uncoated MIONs show a comparable PCR inhibition near the concentration 0.1mgml -1 while the inhibition of dextran stabilized MIONs became apparent near 0.5mgml -1 . It was demonstrated that the PCR could be effectively carried out even in the presence of elevated concentration of MIONs up to 2mgml -1 by choosing the right coating approach and supplementing the reaction mix by critical components, Taq DNA polymerase and Mg 2+ ions. Copyright © 2017 Elsevier B.V. All rights reserved.

Reference genes for gene expression analysis by real-time reverse transcription polymerase chain reaction of renal cell carcinoma.

Science.gov (United States)

Bjerregaard, Henriette; Pedersen, Shona; Kristensen, Søren Risom; Marcussen, Niels

2011-12-01

Differentiation between malignant renal cell carcinoma and benign oncocytoma is of great importance to choose the optimal treatment. Accurate preoperative diagnosis of renal tumor is therefore crucial; however, existing imaging techniques and histologic examinations are incapable of providing an optimal differentiation profile. Analysis of gene expression of molecular markers is a new possibility but relies on appropriate standardization to compare different samples. The aim of this study was to identify stably expressed reference genes suitable for the normalization of results extracted from gene expression analysis of renal tumors. Expression levels of 8 potential reference genes (ATP5J, HMBS, HPRT1, PPIA, TBP, 18S, GAPDH, and POLR2A) were examined by real-time reverse transcription polymerase chain reaction in tumor and normal tissue from removed kidneys from 13 patients with renal cell carcinoma and 5 patients with oncocytoma. The expression levels of genes were compared by gene stability value M, average gene stability M, pairwise variation V, and coefficient of variation CV. More candidates were not suitable for the purpose, but a combination of HMBS, PPIA, ATP5J, and TBP was found to be the best combination with an average gene stability value M of 0.9 and a CV of 0.4 in the 18 tumors and normal tissues. A combination of 4 genes, HMBS, PPIA, ATP5J, and TBP, is a possible reference in renal tumor gene expression analysis by reverse transcription polymerase chain reaction. A combination of four genes, HMBS, PPIA, ATP5J and TBP, being stably expressed in tissues from RCC is possible reference genes for gene expression analysis.

Evaluation of nested polymerase chain reaction for the early detection of Leptospira spp. DNA in serum samples from patients with leptospirosis.

Science.gov (United States)

Blanco, Roberta Morozetti; Romero, Eliete Caló

2014-04-01

The aim of this study was to analyse the nested polymerase chain reaction (nested PCR) in human serum samples of patients with clinical manifestations of leptospirosis. The cases of leptospirosis were defined by the microagglutination test (MAT). The samples were collected in 2010. Of 1042 serum samples collected from 521 patients, 28 (5.4%) were considered positive cases of leptospirosis, and 493 (94.6%) were negative. Twenty-three confirmed cases had no MAT-detectable antibodies in the acute sample (mean of 5.6 days after onset). Nested PCR was positive in 22/23 (95.7%) patients during the acute phase of the disease, with negative results by MAT. Nested PCR was negative in all convalescent serum samples with positive results by MAT. All negative cases of leptospirosis were negative by nested PCR. The nested PCR is an alternative diagnostic tool for early detection of leptospires in sera during the first 7 days of the disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Rapid Identification of a Cooling Tower-Associated Legionnaires’ Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014–2015

Science.gov (United States)

Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

2018-01-01

We investigated an outbreak of eight Legionnaires’ disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings. PMID:29780175

Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

Science.gov (United States)

Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

2000-05-01

We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

Relative efficiency of polymerase chain reaction and enzyme-linked immunosorbant assay in determination of viral etiology in congenital cataract in infants

Directory of Open Access Journals (Sweden)

Shyamala G

2008-01-01

Full Text Available Background: Perinatal viral infections of fetus are among the leading causes of congenital cataract and identifying the viral etiology is important. Objectives: To detect the presence of Rubella virus (RV, herpes simplex virus (HSV and cytomegalovirus (CMV in lens aspirate specimens obtained from patients with congenital cataract and relate the results with serology. Setting and Design: Prospective study carried out in tertiary care hospital. Materials and Methods: Fifty lens aspirates from 50 infants with congenital cataract were subjected to HSV, RV isolation and polymerase chain reaction (PCR for detection of HSV and CMV. Reverse transcription polymerase chain reaction (RT-PCR was applied for RV detection. Peripheral blood specimens were screened for anti-HSV, RV and CMV antibodies by enzyme-linked immunosorbant assay (ELISA. Results: Rubella virus was detected in nine (18% lens aspirates, by nRT-PCR which includes six positive by culture. HSV-2 DNA was detected in nine other lens aspirates, while CMV was not detected by PCR. Serological results did not correlate with the presence of viruses in the lens aspirates. This is the first report of detection of HSV-2 DNA in cases of congenital cataract. Conclusions: Cytomegalovirus may not be playing a significant role in causation of congenital cataract. The role of serology in identifying causative viral infection for congenital cataract needs to be re-evaluated.

Molecular diagnosis of eosinophilic meningitis due to Angiostrongylus cantonensis (Nematoda: Metastrongyloidea by polymerase chain reaction-DNA sequencing of cerebrospinal fluids of patients

Directory of Open Access Journals (Sweden)

Praphathip Eamsobhana

2013-02-01

Full Text Available Cerebrospinal fluid (CSF samples from clinically diagnosed patients with detectable Angiostrongylus canto-nensis-specific antibodies (n = 10, patients with clinically suspected cases that tested negative for A. cantonensis-an-tibodies (n = 5 and patients with cerebral gnathostomiasis (n = 2 and neurocysticercosis (n = 2 were examined by a single-step polymerase chain reaction (PCR method using the AC primers for the 66-kDa native protein gene. The PCR method detected A. cantonensis DNA in CSF samples from four of 10 serologically confirmed angiostrongyliasis cases. The PCR results were negative for the remaining CSF samples. The nucleotide sequences of three positive CSF-PCR samples shared 98.8-99.2% similarity with the reference sequence of A. cantonensis. These results indicate the potential application of this PCR assay with clinical CSF samples for additional support in the confirmation of eosinophilic meningitis due to A. cantonensis.

Duration of polymerase chain reaction-detectable DNA after treatment of Chlamydia trachomatis, Neisseria gonorrhoeae, and Trichomonas vaginalis infections in women.

Science.gov (United States)

Williams, James A; Ofner, Susan; Batteiger, Byron E; Fortenberry, J Dennis; Van Der Pol, Barbara

2014-03-01

To avoid positive results attributable to residual DNA, the Centers for Disease Control and Prevention recommends avoiding repeat testing with nucleic-acid based tests within 3 weeks after treatment of chlamydial (Chlamydia trachomatis [CT]) or gonococcal (Neisseria gonorrhoeae [GC]) infection. We retrospectively analyzed the duration of detectable DNA from a longitudinal cohort of adolescent women after diagnosis and treatment of infection with CT, GC, or Trichomonas vaginalis (TV). Vaginal swabs were obtained weekly from young women for up to 12 weeks (observation period) after treatment of CT, GC and TV infections. Swabs were tested using a commercially available first generation nucleic acid amplification test (NAAT) for CT and GC, and a laboratory developed NAAT for TV. Kaplan-Meier statistics were used to estimate median time to the first negative DNA-based polymerase chain reaction (PCR) result. Observation periods were available for analysis for 195, 82 and 102 treatments for CT, GC, and TV infection, respectively. Median time to a first negative PCR result for CT, GC, and TV was 9 (range 0-84), 6 (0-76), and 7 (0-84) days, and by day 21, 89%, 95%, and 85% were negative, respectively. Data from this retrospective analysis indicate that greater than 85% of these young women did not have detectable CT, GC, or TV DNA by day 21 post-treatment. This data may be useful to clinicians for patient management and post-treatment testing purposes.

Use of Brucella abortus species specific polymerase chain reaction assay for the diagnosis of bovine brucellosis.

Science.gov (United States)

Chisi, Songelwayo L; Schmidt, Tracy; Akol, George W; Van Heerden, Henriette

2017-09-27

Serology is primarily used in the diagnosis of bovine brucellosis. Bacterial culture and isolation is the gold standard in diagnosing brucellosis but, like serology, it does not offer complete (100%) diagnostic sensitivity and specificity. Polymerase chain reaction (PCR) has been suggested to offer better specificity and sensitivity. In this study, we evaluated the performance of Brucella abortus species specific (BaSS) PCR directly from different samples in the diagnosis of bovine brucellosis in naturally infected cattle in KwaZulu-Natal province of South Africa with known infectious status from culture. The BaSS PCR had a low diagnostic sensitivity (DSe) of 70%, but was able to identify vaccine strains using abomasal fluid from aborted foetuses and detect Brucella DNA from decomposing samples. The best sample for the BaSS PCR was abomasal fluid.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

Science.gov (United States)

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

Critical analysis: use of polymerase chain reaction to diagnose leprosy

Directory of Open Access Journals (Sweden)

Flaviane Granero Maltempe

Full Text Available ABSTRACT Leprosy is a neglected tropical disease and an important public health problem, especially in developing countries. It is a chronic infectious disease that is caused by Mycobacterium leprae, which has a predilection for the skin and peripheral nerves. Although it has low sensitivity, slit-skin smear (SSS remains the conventional auxiliary laboratory technique for the clinical diagnosis of leprosy. Polymerase chain reaction (PCR is a molecular biology technique that holds promise as a simple and sensitive diagnostic tool. In the present study, the performance of two PCR methods, using different targets, PCR-LP and PCR-P, were compared with SSS with regard to leprosy diagnosis in a reference laboratory. M. leprae DNA was extracted from 106 lymph samples of 40 patients who had clinical suspicion of leprosy. The samples were subjected to both PCR techniques and SSS. Amplification of the human b-globin gene was used as PCR inhibitor control. The specificity of both PCR techniques was 100%, and sensitivity was 0.007 and 0.015 µg/ml for PCR-LP and PCR-P, respectively. No significant difference was found between either the PCR-LP or PCR-P results and SSS results (p > 0.05. Although PCR is not yet a replacement for SSS in the diagnosis of leprosy, this technique may be used as an efficient auxiliary tool for early detection of the disease, especially in endemic regions. This strategy may also be useful in cases in which SSS results are negative (e.g., in paucibacillary patients and cases in which skin biopsy cannot be performed.

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

Science.gov (United States)

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Introduction of a dermatophyte polymerase chain reaction assay to the diagnostic mycology service in Scotland.

Science.gov (United States)

Alexander, C L; Shankland, G S; Carman, W; Williams, C

2011-05-01

Dermatophytes are the major cause of superficial mycoses in samples submitted to Clinical Mycology, Glasgow. The most prevalent species is Trichophyton rubrum as identified classically by microscopy and culture. Recent advances in polymerase chain reaction (PCR) technology were examined for the feasibility of introducing a T. rubrum real-time PCR assay into a routine diagnostic service. To improve the diagnostic mycology service by the introduction of a real-time PCR test for T. rubrum. The DNA from 4972 nail and skin samples was obtained using the Qiagen QIAsymphony automated extractor. This DNA was subjected to real-time PCR using T. rubrum-specific primers and a probe. During phase 1 of the study, 862 samples were analysed; 446 of 470 specimens that grew T. rubrum were detected by PCR. Out of 4110 samples analysed during phase 2, 753 T. rubrum infections were diagnosed and reported within 72 h. A total of 3357 samples were negative for a fungal infection by PCR and microscopy; these were also reported within 72 h. A vast reduction in the turnaround times can be achieved using this technique as opposed to classical methods. Samples which are PCR negative but microscopy positive are still subjected to culture. Screening samples for their suitability for PCR prior to processing eliminates the application of PCR for T. rubrum on inappropriate samples such those from the scalp or pityriasis versicolor. © 2011 The Authors. BJD © 2011 British Association of Dermatologists.

DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

International Nuclear Information System (INIS)

Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

2004-01-01

The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

Science.gov (United States)

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

Science.gov (United States)

Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

2016-05-01

Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment. © 2016 Wiley Periodicals, Inc.

Trends and advances in food analysis by real-time polymerase chain reaction.

Science.gov (United States)

Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

2016-05-01

Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

Toxin genotyping of Clostridium perfringens strains using a polymerase chain reaction protocol

Directory of Open Access Journals (Sweden)

Elisabetta Di Giannatale

2010-03-01

Full Text Available A polymerase chain reaction protocol consisting of a multiplex to identify the cpa, cpb1, cpetx, cpi genes and a duplex to identify the cpe and cpb2 genes encoding for a, b1, e, i, enterotoxin and b2 toxins, respectively, was applied to DNA extracted from two collections of Clostridium perfringens strains. The first collection involved 19 isolates from rabbits. The second collection of 41 isolates came from routine necropsies. The cpa gene alone, or in association with the cpb2 gene, was detected in all DNA samples examined. The cpa gene, together with cpb2 gene, were detected in seven of the rabbit C. perfringens strains (36.8% and in nine isolates from necropsies (21.9%. The cpa gene was found in 63.2% of rabbit strains and 76.9% of strains from other animal species. In rabbits, the pathological lesions associated with C. perfringens detection were predominantly forms of non-inflammatory enteropathies. In other species, C. perfringens was mainly associated with congestive-haemorrhagic enteropathy, but also with fatal traumatic lesions, degenerative diseases and organs with post-mortem autolysis. No clear correlation was observed between detection of b2 toxin gene and species-specific pathological features.

Novel TaqMan real-time polymerase chain reaction assay for verifying the authenticity of meat and commercial meat products from game birds.

Science.gov (United States)

Rojas, María; González, Isabel; Pavón, Miguel Angel; Pegels, Nicolette; Lago, Adriana; Hernández, Pablo E; García, Teresa; Martín, Rosario

2010-06-01

Species-specific real-time polymerase chain reaction (PCR) assays using TaqMan probes have been developed for verifying the labeling of meat and commercial meat products from game birds, including quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock and song thrush. The method combines the use of species-specific primers and TaqMan probes that amplify small fragments (amplicons meat products from the target species demonstrated the suitability of the assay for the detection of the target DNAs.

Polymerase Chain Reaction targeting insertion sequence IS6110 for the diagnosis of pulmonary tuberculosis among Sudanese children and young adults

Directory of Open Access Journals (Sweden)

Ahmed L Osman

2014-01-01

All children participating in the study were subjected to the Mantoux test after obtaining appropriate consent injected by 5 tuberculin units of tuberculin purified protein derivative, and the results were recorded after three days. Specimens were decontaminated and inoculated on Lowenstein–Jensen media according to the modified Petroff's method. Two smears were prepared and stained by Ziehl–Neelsen stain and Auramine fluorescent dye; bacterial DNA was extracted from each specimen by using phenol chloroform method, and then the Polymerase Chain Reaction technique was adopted to detect Insertion Sequence IS6110 gene of MTB in these specimens. This study showed that the positive results for TST, ZN, Auramine, Culture and PCR were 86 (43.7%, 16 (8.1%, 22 (11.2%, 32 (16.2% and 35(17.8%, respectively. The study concluded that the PCR technique is the most sensitive and specific technique for a quick identification of MTB in gastric lavage and sputum from children who are unable to expectorate a good quality sputum sample or who are diagnosed as negative using conventional diagnostic methods.

Detection of Brazilian hantavirus by reverse transcription polymerase chain reaction amplification of N gene in patients with hantavirus cardiopulmonary syndrome

Directory of Open Access Journals (Sweden)

Marcos Lázaro Moreli

2004-10-01

Full Text Available We report a nested reverse transcription-polymerase chain reaction (RT-PCR assay for hantavirus using primers selected to match high homology regions of hantavirus genomes detected from the whole blood of hantavirus cardiopulmonary syndrome (HCPS patients from Brazil, also including the N gene nucleotide sequence of Araraquara virus. Hantavirus genomes were detected in eight out of nine blood samples from the HCPS patients by RT-PCR (88.9% positivity and in all 9 blood samples (100% positivity by nested-PCR. The eight amplicons obtained by RT-PCR (P1, P3-P9, including one obtained by nested-PCR (P-2 and not obtained by RT-PCR, were sequenced and showed high homology (94.8% to 99.1% with the N gene of Araraquara hantavirus. Although the serologic method ELISA is the most appropriate test for HCPS diagnosis, the use of nested RT-PCR for hantavirus in Brazil would contribute to the diagnosis of acute hantavirus disease detecting viral genomes in patient specimens as well as initial genomic characterization of circulating hantaviruses.

Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

Science.gov (United States)

Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

2015-12-01

Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

Science.gov (United States)

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

Clinical application of polymerase chain reaction to diagnose Clostridium difficile in hospitalized patients with diarrhea.

Science.gov (United States)

Morelli, Michael S; Rouster, Susan D; Giannella, Ralph A; Sherman, Kenneth E

2004-08-01

Clostridium difficile is a common cause of diarrhea in hospitalized patients and is associated with significant morbidity and cost. The current diagnostic standard, enzyme immunoassay (EIA), has low sensitivity, leading to duplicate testing and empiric treatment. We sought to show the usefulness and potential cost effectiveness of polymerase chain reaction (PCR) amplification of toxin B gene for diagnosis of C. difficile-induced diarrhea. A total of 148 stool samples from academic and community-based hospitals were sent for EIA testing and were evaluated prospectively for the presence of toxin B gene by PCR. Results were compared with EIA regarding sensitivity, specificity, and predictive values. Medical charts were reviewed to determine the following: (1) number of EIAs sent per admission, (2) number sent within a 24-hour time period, and (3) how caregivers practiced based on EIA results. The mean age of 130 patients was 55 years. EIA and PCR were positive in 6.8% and 13.6% of patients, respectively. EIA sensitivity was 40%, specificity was 98%, and positive and negative predictive values were 80% and 91%, respectively. The cost of the PCR was $22/sample. Empiric treatment for C. difficile was given unnecessarily in 42% of EIA-negative results. Thirty percent of patients had 3 or more EIAs sent during their hospital admission. Of patients with multiple samples sent, 57% had more than 1 sample sent in a 24-hour period. Many physicians do not conform to practice guidelines regarding recommended diagnosis and empiric treatment of C. difficile. Toxin B gene PCR represents a more sensitive and potentially cost-effective method to diagnose C. difficile-induced diarrhea than EIA and should be considered for use as an alternative diagnostic standard.

Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

Science.gov (United States)

Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

2015-10-01

The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

Science.gov (United States)

Fahrimal, Y; Goff, W L; Jasmer, D P

1992-01-01

Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

[Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

Science.gov (United States)

Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

2016-02-01

Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

Science.gov (United States)

Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

2009-10-01

Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

Use of spontaneously mutated human DNA as competitive internal standard for nucleic acid quantification by reverse transcription-polymerase chain reaction (RT-PCR)

International Nuclear Information System (INIS)

Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.

1995-01-01

Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs

Real-Time Polymerase Chain Reaction Quantification of Phytophthora capsici in Different Pepper Genotypes.

Science.gov (United States)

Silvar, C; Díaz, J; Merino, F

2005-12-01

ABSTRACT Reliable and sensitive quantification of Phytophthora capsici in pepper plants is of crucial importance in managing the multiple syndromes caused by this pathogen. A real-time polymerase chain reaction (PCR) assay was developed for the determination of P. capsici in pepper tissues. DNA levels of a highly virulent and a less virulent isolate were measured in different pepper genotypes with varying degrees of resistance. Using SYBR Green and specific primers for P. capsici, the minimal amount of pathogen DNA quantified was 10 pg. Pathogen DNA was recorded as early as 8 h postinoculation. Thereafter, the increase was rapid in susceptible cultivars and slower in resistant ones. The amount of pathogen DNA quantified in each pepper genotype correlated with susceptibility to Phytophthora root rot. Likewise, there was a relationship between the virulence of the pathogen and the degree of colonization. Differences also were found in oomycete amount among pepper tissues, with maximal pathogen biomass occurring in stems. The real-time PCR technique developed in this study was sensitive and robust enough to assess both pathogen development and resistance to Phytophthora root rot in different pepper genotypes.

Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

Science.gov (United States)

Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

2017-09-01

The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

Construction, Expression, and Characterization of Recombinant Pfu DNA Polymerase in Escherichia coli.

Science.gov (United States)

Zheng, Wenjun; Wang, Qingsong; Bi, Qun

2016-04-01

Pfu DNA polymerase (Pfu) is a DNA polymerase isolated from the hyperthermophilic archaeon Pyrococcus furiosus. With its excellent thermostability and high fidelity, Pfu is well known as one of the enzymes widely used in the polymerase chain reaction. In this study, the recombinant plasmid pLysS His6-tagged Pfu-pET28a was constructed. His-tagged Pfu was expressed in Escherichia coli BL21 (DE3) competent cells and then successfully purified with the ÄKTAprime plus compact one-step purification system by Ni(2+) chelating affinity chromatography after optimization of the purification conditions. The authenticity of the purified Pfu was further confirmed by peptide mass fingerprinting. A bio-assay indicated that its activity in the polymerase chain reaction was equivalent to that of commercial Pfu and its isoelectric point was found to be between 6.85 and 7.35. These results will be useful for further studies on Pfu and its wide application in the future.

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

Science.gov (United States)

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

Directory of Open Access Journals (Sweden)

Aline Lavado Tolardo

2016-06-01

Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

Science.gov (United States)

Focke, Felix; Haase, Ilka; Fischer, Markus

2011-01-26

Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

International Nuclear Information System (INIS)

Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.

1998-01-01

The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage

Energy Technology Data Exchange (ETDEWEB)

Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences

1998-07-01

The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)

Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1991-01-01

A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

Directory of Open Access Journals (Sweden)

Ji Yeon Kwon

2013-09-01

Full Text Available A detection system based on a multiplex reverse transcription (RT polymerase chain reaction (PCR was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV, lily mottle virus (LMoV, lily symptomless virus (LSV. Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility.

Clonality assessment of lymphoproliferative lesions using the polymerase chain reaction: An analysis of two methods

Directory of Open Access Journals (Sweden)

Nikhil Moorchung

2011-01-01

Full Text Available Background: Lymphoid malignancies are a heterogeneous group of disorders which may be difficult to differentiate from reactive proliferations even after immunohistochemistry. Polymerase chain reaction (PCR is believed to be a good adjunct tool for diagnosis. Materials and Methods: We examined 24 cases of neoplastic and non-neoplastic lymphoproliferative lesions in this study and evaluated the PCR as an additional tool in the confirmation of the diagnosis. Two different PCR methodologies were evaluated. Results: In the evaluation of the T-cell PCR, it was seen that the correlation using both the commercial kits and the custom-synthesized primers was highly significant at a P value of 0.05. Conclusions: Both the methods showed an excellent concordance for T-cell γ gene rearrangements, However, the same was not seen in the B-cell receptor rearrangements. This may be because of the small sample size or the inability of consensus V primers to recognize complementary DNA sequences in all of the V segments.

Analysis of hepcidin expression: in situ hybridization and quantitative polymerase chain reaction from paraffin sections.

Science.gov (United States)

Sakuraoka, Yuhki; Sawada, Tokihiko; Shiraki, Takayuki; Park, Kyunghwa; Sakurai, Yuhichiro; Tomosugi, Naohisa; Kubota, Keiichi

2012-07-28

To establish methods for quantitative polymerase chain reaction (PCR) for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of hepatocellular carcinoma (HCC). Total RNA from paraffin-embedded sections was isolated from 68 paraffin-embedded samples of HCC. Samples came from 54 male and 14 female patients with a mean age of 66.8 ± 7.8 years. Quantitative PCR was performed. Immunohistochemistry and in situ hybridization for hepcidin were also performed. Quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections of HCC was performed successfully. The expression level of hepcidin mRNA in cancer tissues was significantly higher than that in non-cancer tissues. A method of in situ hybridization for hepcidin was established successfully, and this demonstrated that hepcidin mRNA was expressed in non-cancerous tissue but absent in cancerous tissue. We have established novel methods for quantitative PCR for hepcidin using RNAs isolated from paraffin-embedded sections and in situ hybridization of HCC.

The value of routine polymerase chain reaction analysis of intraocular fluid specimens in the diagnosis of infectious posterior uveitis.

Science.gov (United States)

Scheepers, Marius A; Lecuona, Karin A; Rogers, Graeme; Bunce, Catey; Corcoran, Craig; Michaelides, Michel

2013-01-01

To assess the value of routine polymerase chain reaction (PCR) analysis on intraocular fluid from patients presenting with a first episode of suspected active infectious posterior uveitis in a population with a high prevalence of human immunodeficiency virus infection. Retrospective, interventional case series. Participants. 159 consecutive patients presenting at a tertiary care hospital over a five-year period. PCR analysis was performed for cytomegalovirus, varicella zoster virus, herpes simplex virus types 1 and 2, Toxoplasma gondii, and Mycobacterium tuberculosis. PCR analysis confirmed the initial clinical diagnosis in 55 patients (35%) and altered the initial clinical diagnosis in 36 patients (23%). The clinical diagnosis prior to PCR testing was nonspecific (uncertain) in 51 patients (32%), with PCR providing a definitive final diagnosis in 20 of these patients (39%); necrotizing herpetic retinopathy and ocular toxoplasmosis were particularly difficult to diagnose correctly without the use of PCR analysis. The clinical phenotype alone was unreliable in diagnosing the underlying infectious cause in a quarter of patients in this study. Since the outcome of incorrectly treated infective uveitis can be blinding, PCR analysis of ocular fluids is recommended early in the disease even in resource poor settings.

A temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; Perch-Nielsen, Ivan R.; Sørensen, Karen Skotte

2013-01-01

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature-dependent fluorescence......We present a temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with an external heater and a temperature sensor. The method employs optimized temperature overshooting and undershooting...

Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction.

Science.gov (United States)

Pournajaf, Abazar; Rajabnia, Ramazan; Sedighi, Mansour; Kassani, Aziz; Moqarabzadeh, Vahid; Lotfollahi, Lida; Ardebilli, Abdollah; Emadi, Behzad; Irajian, Gholamreza

2016-01-01

This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR). A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. L. monocytogenes was detected in 46 (7.45%) of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

Sensitivity and specificity of a nested polymerase chain reaction for detection of lentivirus infection in lions (Panthera leo).

Science.gov (United States)

Adams, Hayley; van Vuuren, Moritz; Kania, Stephen; Bosman, Anna-Mari; Keet, Dewald; New, John; Kennedy, Melissa

2010-12-01

Feline immunodeficiency virus (FIV) is a lentivirus in the Retroviridae family that causes lifelong infection in domestic cats. The lentivirus of African lions (Panthera leo), referred to as FIVple, is endemic in certain lion populations in eastern and southern Africa. Lentivirus infection leads to immunologic dysfunction and immunosuppressive disease in domestic cats; however, little is known about the pathogenic effects of infection in lions, nor about the epidemiologic impact on free-ranging and captive populations. Whole blood and serum samples were collected opportunistically from free-ranging lions in Kruger National Park, Republic of South Africa (RSA). Whole blood and serum samples were also collected from captive wild lions in the RSA. A nested polymerase chain reaction (PCR) assay for detection of FIV was performed on all whole blood samples. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and puma lentivirus synthetic envelope peptide antigen. The PCR assay successfully amplified the lion lentivirus from African lions. The relative sensitivity and relative specificity were 79% and 100%, respectively, and the positive and negative predictive values were 100% and 67%, respectively. This research represents the first study to compare genetic material with antibody-based methods of lentivirus detection on lions in RSA. Using PCR as an additional diagnostic test for FIV in lions will increase screening sensitivity and will allow viral characterization among circulating isolates and monitoring of changes in the viral epidemiology within geographic regions and populations over time.

Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA.

Science.gov (United States)

Oates, A C; Wollberg, P; Achen, M G; Wilks, A F

1998-08-28

The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges

Science.gov (United States)

Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

2016-01-01

Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

Science.gov (United States)

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

Science.gov (United States)

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Randomized controlled clinical trial evaluating multiplex polymerase chain reaction for pathogen identification and therapy adaptation in critical care patients with pulmonary or abdominal sepsis.

Science.gov (United States)

Tafelski, Sascha; Nachtigall, Irit; Adam, Thomas; Bereswill, Stefan; Faust, Jana; Tamarkin, Andrey; Trefzer, Tanja; Deja, Maria; Idelevich, Evgeny A; Wernecke, Klaus-Dieter; Becker, Karsten; Spies, Claudia

2015-06-01

To determine whether a multiplex polymerase chain reaction (PCR)-based test could reduce the time required for initial pathogen identification in patients in an intensive care unit (ICU) setting. This double-blind, parallel-group randomized controlled trial** enrolled adults with suspected pulmonary or abdominal sepsis caused by an unknown pathogen. Both the intervention and control groups underwent the standard blood culture (BC) testing, but additional pathogen identification, based on the results of a LightCycler® SeptiFast PCR test, were provided in the intervention group. The study enrolled 37 patients in the control group and 41 in the intervention group. Baseline clinical and demographic characteristics were similar in both groups. The PCR-based test identified a pathogen in 10 out of 41 (24.4%) patients in the intervention group, with a mean duration from sampling to providing the information to the ICU of 15.9 h. In the control group, BC results were available after a significantly longer period (38.1 h). The LightCycler® SeptiFast PCR test demonstrated a significant reduction in the time required for initial pathogen identification, compared with standard BC. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

9 CFR 146.13 - Testing.

Science.gov (United States)

2010-01-01

...) Enzyme-linked immunosorbent assay (ELISA). ELISA must be conducted using test kits approved by the... conducted on all ELISA-positive samples. (B) The AGID test must be conducted using reagents approved by the... time reverse transcriptase/polymerase chain reaction (RRT-PCR) assay. (A) The RRT-PCR tests must be...

Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

Science.gov (United States)

Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

2008-05-15

Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

International Nuclear Information System (INIS)

Gokahmetoglu, S.; Deniz, E.

2007-01-01

To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

A novel temperature control method for shortening thermal cycling time to achieve rapid polymerase chain reaction (PCR) in a disposable polymer microfluidic device

DEFF Research Database (Denmark)

Bu, Minqiang; R. Perch-Nielsen, Ivan; Sørensen, Karen Skotte

steps to achieve a rapid ramping between the temperature steps for DNA denaturation, annealing and extension. The temperature dynamics within the microfluidic PCR chamber was characterized and the overshooting and undershooting parameters were optimized using the temperature dependent fluorescence......We present a new temperature control method capable of effectively shortening the thermal cycling time of polymerase chain reaction (PCR) in a disposable polymer microfluidic device with external heater and temperature sensor. The method employs optimized temperature overshooting and undershooting...

Postinduction minimal residual disease monitoring by polymerase chain reaction in children with acute lymphoblastic leukemia.

Science.gov (United States)

Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe

2014-11-01

Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.

Using a bayesian latent class model to evaluate the utility of investigating persons with negative polymerase chain reaction results for pertussis.

Science.gov (United States)

Tarr, Gillian A M; Eickhoff, Jens C; Koepke, Ruth; Hopfensperger, Daniel J; Davis, Jeffrey P; Conway, James H

2013-07-15

Pertussis remains difficult to control. Imperfect sensitivity of diagnostic tests and lack of specific guidance regarding interpretation of negative test results among patients with compatible symptoms may contribute to its spread. In this study, we examined whether additional pertussis cases could be identified if persons with negative pertussis test results were routinely investigated. We conducted interviews among 250 subjects aged ≤18 years with pertussis polymerase chain reaction (PCR) results reported from 2 reference laboratories in Wisconsin during July-September 2010 to determine whether their illnesses met the Centers for Disease Control and Prevention's clinical case definition (CCD) for pertussis. PCR validity measures were calculated using the CCD as the standard for pertussis disease. Two Bayesian latent class models were used to adjust the validity measures for pertussis detectable by 1) culture alone and 2) culture and/or more sensitive measures such as serology. Among 190 PCR-negative subjects, 54 (28%) had illnesses meeting the CCD. In adjusted analyses, PCR sensitivity and the negative predictive value were 1) 94% and 99% and 2) 43% and 87% in the 2 types of models, respectively. The models suggested that public health follow-up of reported pertussis patients with PCR-negative results leads to the detection of more true pertussis cases than follow-up of PCR-positive persons alone. The results also suggest a need for a more specific pertussis CCD.

Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Caldeira Roberta Lima

1998-01-01

Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

Value of the polymerase chain reaction method for detecting tuberculosis in the bronchial tissue involved by anthracosis.

Science.gov (United States)

Mirsadraee, Majid; Shafahie, Ahmad; Reza Khakzad, Mohammad; Sankian, Mojtaba

2014-04-01

Anthracofibrosis is the black discoloration of the bronchial mucosa with deformity and obstruction. Association of this disease with tuberculosis (TB) was approved. The objective of this study was to find the additional benefit of assessment of TB by the polymerase chain reaction (PCR) method. Bronchoscopy was performed on 103 subjects (54 anthracofibrosis and 49 control subjects) who required bronchoscopy for their pulmonary problems. According to bronchoscopic findings, participants were classified to anthracofibrosis and nonanthracotic groups. They were examined for TB with traditional methods such as direct smear (Ziehl-Neelsen staining), Löwenstein-Jensen culture, and histopathology and the new method "PCR" for Mycobacterium tuberculosis genome (IS6110). Age, sex, smoking, and clinical findings were not significantly different in the TB and the non-TB groups. Acid-fast bacilli could be detected by a direct smear in 12 (25%) of the anthracofibrosis subjects, and adding the results of culture and histopathology traditional tests indicated TB in 27 (31%) of the cases. Mycobacterium tuberculosis was diagnosed by PCR in 18 (33%) patients, but the difference was not significant. Detection of acid-fast bacilli in control nonanthracosis subjects was significantly lower (3, 6%), but PCR (20, 40%) and accumulation of results from all traditional methods (22, 44%) showed a nonsignificant difference. The PCR method showed a result equal to traditional methods including accumulation of smear, culture, and histopathology.

Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi) cases in slaughtered sheep in India.

Science.gov (United States)

Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa

2017-11-01

The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.

Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

Directory of Open Access Journals (Sweden)

Daniela Camargos Costa

2014-02-01

Full Text Available The polymerase chain reaction (PCR-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34 of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

Science.gov (United States)

Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

2001-05-01

A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

DEFF Research Database (Denmark)

Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

1992-01-01

We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

Typing of Poultry Influenza Virus (H5 and H7 by Reverse Transcription- Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Cesare Bonacina

2010-01-01

Full Text Available The ability of the influenza Orthomixovirus to undergo to continually antigenically changes that can affect its pathogenicity and its diffusion, explains the growing seriousness of this disease and the recent epizoozies in various parts of the world. There have been 15 HA and 9 NA type A sub-types of the influenza virus identified all of which are present in birds. Until now the very virulent avian influenza viruses identified were all included to the H5 and H7 sub-types. We here show that is possible to identify the H5 and H7 sub-types with reverse transcription-polymerase chain reaction (RT-PCR by using a set of specific primers for each HA sub-type. The RT-PCR is a quick and sensitive method of identifying the HA sub-types of the influenza virus directly from homogenised organs.

Brucella contamination in raw milk by polymerase chain reaction

Directory of Open Access Journals (Sweden)

Mohammad Khalili

2016-10-01

Full Text Available Background: Human brucellosis is a significant public health problem in many middle east countries including Iran. Brucella organisms, which are small aerobic, facultative intracellular coccobacilli, localize in the reproductive organs of host animals, causing abortions and sterility. They are shed in large numbers in the animal’s urine, milk, placental fluid, and other fluids. Dairy product from raw milk are a potential threat to public health in endemic developing countries. The gold standard for the diagnosis of brucellosis is isolation of Brucella species. However, isolation Brucella species is time consuming and needed to level 3 biocontainment facilities and highly skilled technical personnel to handle samples and live bacteria for eventual identification. Handling Brucella species increase risk of laboratory infection. Polymerase chain reaction (PCR with high sensitivity and specifity overcomed to these disadvantages. The aim of this study was to detect Brucella species in milk from dairy cattle farms in Kerman province, Iran by PCR technique. Methods: Forty and eight bulk tank milk (BTM were collected from October 2015 to March 2016 from 48 dairy cattle farm including 4200 cows. DNA of milk samples extracted by lysis buffer and proteinase K method. All milk samples were examined by PCR to detect Brucella-specific DNA targeting IS 711. Positive samples must be showed 317 bp amplified, corresponding to the expected size of the IS 711 genome region in all Brucella species. Results: Using IS711 primer were detected in 4 samples (8.3% Brucella spp. from 48 BTM samples in this area. Conclusion: The results indicate that brucellosis by Brucella species is endemic in the Kerman province dairy farms. Consumption of raw milk dairy products by individual farmers operating under poor hygienic conditions represents an high risk to public health. The need for implementing control measures and raising public awareness on zoonotic transmission of

Comparison of different methods of RNA isolation for plum pox virus detection by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Faggioli, F; Pasquini, G; Barba, M

1998-09-01

The diagnosis of plum pox virus (PPV) is still considered one of the most important aspects of the "sharka" problem. In fact, different studies demonstrated an uneven distribution of the virus in infected trees due to a high variability in virus concentration. These aspects complicate the PPV diagnosis. To date, biological, serological and molecular assays have been successively developed in order to obtain sensitive and efficient PPV detection techniques. In particular, the polymerase chain reaction (PCR) technique seems to be promising and can be considered the most sensitive and reliable one. Preparation of viral RNA is still a fundamental step in reverse transcription-PCR (RT-PCR) technique, especially when applied to large scale testing, i.e., for certification purposes. In order to find the most rapid and efficient procedure, we have compared three different procedures of extraction of viral RNA to be processed RT-PCR. Their common characteristics is their capacity to extract the RNA from a small amount of plant tissue without organic solvents in the extraction fluid. The procedures were as follows: an immuno-capture (IC) method using a specific antiserum, a silica-capture (SC) method using a non-specific matrix, and a simple and rapid RNA extraction (RE) method. They all were followed by one-tube RT-PCR. The obtained results show that all the three techniques allowed a successful amplification and detection of PPV in tested samples except the SC-PCR method which proved less effective. In fact, the IC-PCR and RE-PCR methods amplified and detected PPV in all isolates tested, while the SC-PCR method was able to reveal the presence of the virus in apricot and infected control samples only.

Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

Science.gov (United States)

Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

2015-11-01

Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

DNA polymerase preference determines PCR priming efficiency.

Science.gov (United States)

Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

2014-01-30

Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

Prevalence, and virulence determination of Listeria monocytogenes strains isolated from clinical and non-clinical samples by multiplex polymerase chain reaction

Directory of Open Access Journals (Sweden)

Abazar Pournajaf

Full Text Available Abstract INTRODUCTION: This study aimed to determine the prevalence, and virulence factors of Listeria monocytogenes isolated from various samples by multiplex polymerase chain reaction (MPCR. METHODS: A total of 617 isolates were obtained and MPCR was employed for detection of the inlA, inlC, and inlJ genes. RESULTS: L. monocytogenes was detected in 46 (7.45% of the 617 specimens. inlA, inlC, and inlJ were detected in 100%, 76.26%, and 71% isolates, respectively. CONCLUSIONS: This study validated MPCR in the analysis and rapid detection of L. monocytogenes. The role of the genes in pathogenesis of the strains can also be affirmed.

Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

Science.gov (United States)

Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

2003-02-01

A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

Progesterone receptor isoform analysis by quantitative real-time polymerase chain reaction in formalin-fixed, paraffin-embedded canine mammary dysplasias and tumors

DEFF Research Database (Denmark)

Guil-Luna, S.; Stenvang, Jan; Brünner, Nils

2014-01-01

and its isoforms in formalin-fixed, paraffin-embedded tissue samples from canine mammary lesions (4 dysplasias, 10 benign tumors, and 46 carcinomas) using 1-step SYBR Green quantitative real-time polymerase chain reaction (RT-qPCR). Progesterone receptor was expressed in 75% of dysplasias, all benign...... in the expression of isoform A versus B. Analysis of progesterone receptor mRNA isoforms by RT-qPCR was successful in routinely formalin-fixed, paraffin-embedded tissue samples and enabled the distribution of isoforms A and B to be identified for the first time in dysplasias, benign tumors, and malignant tumors...

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

Science.gov (United States)

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

Science.gov (United States)

Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

2007-01-01

We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis.

Science.gov (United States)

Peeters, M; Huang, C L; Vonk, L A; Lu, Z F; Bank, R A; Helder, M N; Doulabi, B Zandieh

2016-11-01

Studies which consider the molecular mechanisms of degeneration and regeneration of cartilaginous tissues are seriously hampered by problematic ribonucleic acid (RNA) isolations due to low cell density and the dense, proteoglycan-rich extracellular matrix of cartilage. Proteoglycans tend to co-purify with RNA, they can absorb the full spectrum of UV light and they are potent inhibitors of polymerase chain reaction (PCR). Therefore, the objective of the present study is to compare and optimise different homogenisation methods and RNA isolation kits for an array of cartilaginous tissues. Tissue samples such as the nucleus pulposus (NP), annulus fibrosus (AF), articular cartilage (AC) and meniscus, were collected from goats and homogenised by either the MagNA Lyser or Freezer Mill. RNA of duplicate samples was subsequently isolated by either TRIzol (benchmark), or the RNeasy Lipid Tissue, RNeasy Fibrous Tissue, or Aurum Total RNA Fatty and Fibrous Tissue kits. RNA yield, purity, and integrity were determined and gene expression levels of type II collagen and aggrecan were measured by real-time PCR. No differences between the two homogenisation methods were found. RNA isolation using the RNeasy Fibrous and Lipid kits resulted in the purest RNA (A260/A280 ratio), whereas TRIzol isolations resulted in RNA that is not as pure, and show a larger difference in gene expression of duplicate samples compared with both RNeasy kits. The Aurum kit showed low reproducibility. For the extraction of high-quality RNA from cartilaginous structures, we suggest homogenisation of the samples by the MagNA Lyser. For AC, NP and AF we recommend the RNeasy Fibrous kit, whereas for the meniscus the RNeasy Lipid kit is advised.Cite this article: M. Peeters, C. L. Huang, L. A. Vonk, Z. F. Lu, R. A. Bank, M. N. Helder, B. Zandieh Doulabi. Optimisation of high-quality total ribonucleic acid isolation from cartilaginous tissues for real-time polymerase chain reaction analysis. Bone Joint Res 2016

Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

Directory of Open Access Journals (Sweden)

Lai-yu Kwok

Full Text Available The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.

Science.gov (United States)

Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay

2018-01-10

Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.

An improved electrochemiluminescence polymerase chain reaction method for highly sensitive detection of plant viruses

International Nuclear Information System (INIS)

Tang Yabing; Xing Da; Zhu Debin; Liu Jinfeng

2007-01-01

Recently, we have reported an electrochemiluminescence polymerase chain reaction (ECL-PCR) method for detection of genetically modified organisms. The ECL-PCR method was further improved in the current study by introducing a multi-purpose nucleic acid sequence that was specific to the tris(bipyridine) ruthenium (TBR) labeled probe, into the 5' terminal of the primers. The method was applied to detect plant viruses. Conserved sequence of the plant viruses was amplified by PCR. The product was hybridized with a biotin labeled probe and a TBR labeled probe. The hybridization product was separated by streptavidin-coated magnetic beads, and detected by measuring the ECL signals of the TBR labeled. Under the optimized conditions, the experiment results show that the detection limit is 50 fmol of PCR products, and the signal-to-noise ratio is in excess of 14.6. The method was used to detect banana streak virus, banana bunchy top virus, and papaya leaf curl virus. The experiment results show that this method could reliably identity viruses infected plant samples. The improved ECL-PCR approach has higher sensitivity and lower cost than previous approach. It can effectively detect the plant viruses with simplicity, stability, and high sensitivity

The TEL-AML1 real-time quantitative polymerase chain reaction (PCR) might replace the antigen receptor-based genomic PCR in clinical minimal residual disease studies in children with acute lymphoblastic leukaemia

NARCIS (Netherlands)

de Haas, V.; Breunis, W. B.; dee, R.; Verhagen, O. J. H. M.; Kroes, W.; van Wering, E. R.; van Dongen, J. J. M.; van den Berg, H.; van der Schoot, C. E.

2002-01-01

Prospective studies in children with B-precursor acute lymphoblastic leukaemia (ALL) have shown that polymerase chain reaction (PCR)-based detection of minimal residual disease (MRD) using immunoglobin (Ig) and T-cell receptor (TCR) gene rearrangements as targets can be used to identify patients

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Richard Atherton

2013-06-01

Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

Evaluation of six nucleic acid amplification tests used for diagnosis of Neisseria gonorrhoeae in Russia compared with an international strictly validated real-time porA pseudogene polymerase chain reaction.

Science.gov (United States)

Shipitsyna, E; Zolotoverkhaya, E; Hjelmevoll, S O; Maximova, A; Savicheva, A; Sokolovsky, E; Skogen, V; Domeika, M; Unemo, M

2009-11-01

In Russia, laboratory diagnosis of gonorrhoea has been mainly based on microscopy only and, in some settings, relatively rare suboptimal culturing. In recent years, Russian developed and manufactured nucleic acid amplification tests (NAAT) have been implemented for routine diagnosis of Neisseria gonorrhoeae. However, these NAATs have never been validated to any international well-recognized diagnostic NAAT. This study aims to evaluate the performance characteristics of six Russian NAATs for N. gonorrhoeae diagnostics. In total, 496 symptomatic patients were included. Five polymerase chain reaction (PCR) assays and one real-time nucleic acid sequence based amplification (NASBA) assay, developed by three Russian companies, were evaluated on urogenital samples, i.e. cervical and first voided urine (FVU) samples from females (n = 319), urethral and FVU samples from males (n = 127), and extragenital samples, i.e. rectal and pharyngeal samples, from 50 additional female patients with suspicion of gonorrhoea. As reference method, an international strictly validated real-time porA pseudogene PCR was applied. The prevalence of N. gonorrhoeae was 2.7% and 16% among the patients providing urogenital and extragenital samples, respectively. The Russian NAATs and the reference method displayed high level of concordance (99.4-100%). The sensitivities, specificities, positive predictive values and negative predictive values of the Russian tests in different specimens were 66.7-100%, 100%, 100%, and 99.4-100%, respectively. Russian N. gonorrhoeae diagnostic NAATs comprise relatively good performance characteristics. However, larger studies are crucial and, beneficially, the Russian assays should also be evaluated to other international highly sensitive and specific, and ideally Food and Drug Administration approved, NAATs such as Aptima Combo 2 (Gen-Probe).

Acid-fast Smear and Histopathology Results Provide Guidance for the Appropriate Use of Broad-Range Polymerase Chain Reaction and Sequencing for Mycobacteria.

Science.gov (United States)

Miller, Kennon; Harrington, Susan M; Procop, Gary W

2015-08-01

New molecular diagnostic tests are attractive because of the potential they hold for improving diagnostics in microbiology. The value of these tests, which is often assumed, should be investigated to determine the best use of these potentially powerful tools. To investigate the usefulness of broad-range polymerase chain reaction (PCR), followed by sequencing, in mycobacterial infections. We reviewed the test performance of acid-fast bacilli (AFB) PCR and traditional diagnostic methods (histopathology, AFB smear, and culture). We assessed the diagnostic effect and cost of the unrestricted ordering of broad-range PCR for the detection and identification of mycobacteria in clinical specimens. The AFB PCR was less sensitive than culture and histopathology and was less specific than culture, AFB smear, and histopathology. During 18 months, $93 063 was spent on 183 patient specimens for broad-range PCR and DNA sequencing for mycobacteria to confirm one culture-proven Mycobacterium tuberculosis infection that was also known to be positive by AFB smear and histopathology. In this cohort, there was a false-negative AFB PCR for M tuberculosis and a false-positive AFB PCR for Mycobacterium lentiflavum . Testing of AFB smear-negative specimens from patients without an inflammatory response supportive of a mycobacterial infection is costly and has not been proven to improve patient care. Traditional diagnostics (histopathology, AFB smear, and culture) should remain the primary methods for the detection of mycobacteria in clinical specimens.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Value of polymerase chain reaction in patients with presumptively diagnosed and treated as tuberculous pericardial effusion

International Nuclear Information System (INIS)

Rehman, H.; Hafizullah, M.; Shah, S.T.; Khan, S.B.; Hadi, A.; Ahmad, F.; Shah, I.; Gul, A.M.

2012-01-01

Objective: To know the sensitivity of polymerase chain reaction (PCR) in pericardial fluid and response to antituberculous treatment (ATT) in PCR positive patients who were presumptively diagnosed and treated as tuberculous pericardial effusion. Methodology: This was a descriptive cross sectional study carried out from June 1, 2009 to 31 May 2010 at Cardiology Department, Lady Reading Hospital, Peshawar. Patients with presumptive diagnosis and receiving treatment for tuberculous pericardial effusion were included. Pericardial fluid sample was aspirated under fluoroscopy for the routine work up. The specimens were subjected to PCR detection of mycobacterium tuberculous DNA. Results: During 12 month study period, a total of 54 patients with large pericardial effusion presented to Cardiology department, Lady Reading Hospital, Peshawar. Of them, 46 patients fulfilled the criteria for presumptive diagnosis of tuberculous pericardial effusion. PCR for mycobacterium tuberculous DNA in pericardial fluid was positive in 45.7%(21). Patients were followed for three months. In PCR positive group, 01 patient while in PCR negative group 3 patients were lost to follow up. Among PCR positive patients 17(85%) while in PCR negative group 11(47.82%) patient responded to ATT both clinically and echo-cardio graphically. We found that patients who were PCR positive responded better to therapy than those who were PCR negative and this finding was statistically significant (p=0.035). Conclusion: PCR, with all its limitations, is potentially a useful diagnostic test in patients with presumptively diagnosed tuberculous pericardial effusion. A PCR positive patient responds better to therapy as compared to PCR negative patient. (author)

Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi cases in slaughtered sheep in India

Directory of Open Access Journals (Sweden)

Rahul Singh

2017-11-01

Full Text Available Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR. In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at -20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV.

Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi) cases in slaughtered sheep in India

Science.gov (United States)

Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa

2017-01-01

Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at −20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV. PMID:29263606

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

Science.gov (United States)

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

Directory of Open Access Journals (Sweden)

Tiana Milanda

2014-12-01

Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

Science.gov (United States)

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Detection of high-risk subtypes of human papillomavirus in cervical swabs: routine use of the Digene Hybrid Capture assay and polymerase chain reaction analysis.

LENUS (Irish Health Repository)

Brennan, M M

2012-02-03

Human papillomaviruses (HPVs) are major causative agents in the pathogenesis of cervical cancer, and more than twenty types are associated with its development. With the introduction of liquid-based preparation systems, it is envisaged that large-scale HPV testing will be established in the near future. Preliminary studies demonstrate the accessibility of these samples for DNA testing using both the Digene Hybrid Capture assay (DHCA) and polymerase chain reaction (PCR) techniques. This study aims to assess the validity and sensitivity of the DHCA system to detect high-risk HPV DNA, using two sets of HPV consensus primers (Gp5+\\/Gp6+ and MY09\\/MY11) in tandem with routine assessment of cervical smear and biopsy samples. Results indicate that the combination of DHCA and PCR detects more high-grade lesions than does the DHCA alone. DHCA-negative cases were categorised by subsequent PCR amplification into low-grade HPV-negative (12\\/16) cervical lesions and high-grade HPV-positive (7\\/9) cervical lesions. Gp5+\\/Gp6+ primers were less sensitive in detecting HPV-positive samples than was the MY09\\/MY11 primer set. These results support the use of high-risk HPV testing by DHCA, with subsequent analysis of DHCA-negative samples by PCR using the MY09\\/MY11 primers.

Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

Science.gov (United States)

Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

2013-04-01

Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

Rapid screening of spontaneous and radiation-induced structural changes at the vestigial gene of Drosophila melanogaster by polymerase chain reaction

International Nuclear Information System (INIS)

Aleksandrov, I.D.; Lapidus, I.L.; Aleksandrova, M.V.; Karpovskij, A.L.; Korablinova, S.V.; Levkovich, N.V.

1998-01-01

A total of 27 independent isolated spontaneous and gamma-ray-induced heritable mutations at the vestigial gene of Drosophila melanogaster were analysed by a rapid deletion screening method with polymerase chain reaction (PCR) amplification. According to the results obtained 36.4% (4 of 11) of spontaneous mutants and 62.5% (10 of 16) of gamma-ray-induced ones have revealed deficiency of one or more fragments studied. The rest of spontaneous and radiation mutants showed no alterations in the PCR patterns, indicating possible small scale changes (point mutations) inside the gene region studied or, probably, the gross lesions situated elsewhere. The distribution of the mutation damages in the gene region studied are discussed

Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

Science.gov (United States)

Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

2004-01-01

We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Natália Malaguti

2015-01-01

Full Text Available Bacterial vaginosis (BV is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%, and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer

Science.gov (United States)

Madadelahi, M.; Kalan, K.; Shamloo, A.

2018-05-01

Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

Exact goodness-of-fit tests for Markov chains.

Science.gov (United States)

Besag, J; Mondal, D

2013-06-01

Goodness-of-fit tests are useful in assessing whether a statistical model is consistent with available data. However, the usual χ² asymptotics often fail, either because of the paucity of the data or because a nonstandard test statistic is of interest. In this article, we describe exact goodness-of-fit tests for first- and higher order Markov chains, with particular attention given to time-reversible ones. The tests are obtained by conditioning on the sufficient statistics for the transition probabilities and are implemented by simple Monte Carlo sampling or by Markov chain Monte Carlo. They apply both to single and to multiple sequences and allow a free choice of test statistic. Three examples are given. The first concerns multiple sequences of dry and wet January days for the years 1948-1983 at Snoqualmie Falls, Washington State, and suggests that standard analysis may be misleading. The second one is for a four-state DNA sequence and lends support to the original conclusion that a second-order Markov chain provides an adequate fit to the data. The last one is six-state atomistic data arising in molecular conformational dynamics simulation of solvated alanine dipeptide and points to strong evidence against a first-order reversible Markov chain at 6 picosecond time steps. © 2013, The International Biometric Society.

Studies on Parameters Influencing the Performance of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR in Detecting Prunus Necrotic Ringpot Virus (PNRSV

Directory of Open Access Journals (Sweden)

M. Usta

2005-08-01

Full Text Available In order to have a more detailed understanding of the various factors influencing a reverse transcriptase polymerase chain reaction (RT-PCR, a number of important parameters such as Mg+2, primer, enzyme concentration and others were optimized for the detection of Prunus necrotic ringspot virus (PNRSV. Using a PNRSV isolate with a pair of primers, complementary DNA of viral genome as template, and an appropriate enzyme together with magnesium chloride, the following optimal conditions were identified: primer concentration between 0.2 and 0.0002 pmol µl-1 and 0.06–2 units µl-1 for Taq DNA polymerase enzyme for a 50 µl reaction volume when other parameters were optimum; magnesium chloride concentration less than 2.5 mM; dNTP concentration between 1 and 10 mM. The optimum cDNA amount should be ~360 ng for a 50 µl reaction mixture. When these optimized concentrations and/or values of the main PCR parameters were brought together for a new RT-PCR, a clear and a reliable PNRSV detection having no background was performed from both growth-chamber and field-grown PNRSV-infected plants.

Pelacakan Kasus Flu Burung pada Ayam dengan Reverse Transcriptase Polymerase Chain Reaction* (DETECTION OF AVIAN INFLUENZA IN CHICKENS BY REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION

Directory of Open Access Journals (Sweden)

Gusti Ayu Yuniati Kencana

2013-07-01

Full Text Available Avian Influenza (AI or Bird Flu is a fatal zoonotic disease caused by highly pathogenic avian influenza(HPAI virus of H5N1 sub-type. The disease is still endemic in Indonesia. This study was conducted toinvestigate AI cases in chickens in Bali. Virus isolation was performed in 9 day-old embryonated chickeneggs, and then followed by serologic testing by haemaglutination (HA and Haemaglutination Inhibition(HI assay using standard microtiter procedure. All of the samples were further tested with reversetrancriptasepolymerase chain reaction (RT-PCR. All work has been done in the Biomedical and MolecularBiology Laboratory, Faculty of Veterinary Medicine, Udayana University, Denpasar, during the period2009-2011. A total of ten samples were examined A total of ten chicken samples consisting of 6 fieldsamples and 4 meat samples have been confirmed to be AIV H5N1. All field cases showed clinical signsand gross pathology that were typical to the infection of avian influenza. The result indicates that AI casesare still prevalent among chickens in Bali.

Following DNA chain extension and protein conformational changes in crystals of a Y-family DNA polymerase via Raman crystallography.

Science.gov (United States)

Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R

2013-07-23

Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.

Development of a Tandem Repeat-Based Polymerase Chain Displacement Reaction Method for Highly Sensitive Detection of 'Candidatus Liberibacter asiaticus'.

Science.gov (United States)

Lou, Binghai; Song, Yaqin; RoyChowdhury, Moytri; Deng, Chongling; Niu, Ying; Fan, Qijun; Tang, Yan; Zhou, Changyong

2018-02-01

Huanglongbing (HLB) is one of the most destructive diseases in citrus production worldwide. Early detection of HLB pathogens can facilitate timely removal of infected citrus trees in the field. However, low titer and uneven distribution of HLB pathogens in host plants make reliable detection challenging. Therefore, the development of effective detection methods with high sensitivity is imperative. This study reports the development of a novel method, tandem repeat-based polymerase chain displacement reaction (TR-PCDR), for the detection of 'Candidatus Liberibacter asiaticus', a widely distributed HLB-associated bacterium. A uniquely designed primer set (TR2-PCDR-F/TR2-PCDR-1R) and a thermostable Taq DNA polymerase mutant with strand displacement activity were used for TR-PCDR amplification. Performed in a regular thermal cycler, TR-PCDR could produce more than two amplicons after each amplification cycle. Sensitivity of the developed TR-PCDR was 10 copies of target DNA fragment. The sensitive level was proven to be 100× higher than conventional PCR and similar to real-time PCR. Data from the detection of 'Ca. L. asiaticus' with filed samples using the above three methods also showed similar results. No false-positive TR-PCDR amplification was observed from healthy citrus samples and water controls. These results thereby illustrated that the developed TR-PCDR method can be applied to the reliable, highly sensitive, and cost-effective detection of 'Ca. L. asiaticus'.

Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

Science.gov (United States)

Barbara, D J; Morton, A; Spence, N J; Miller, A

1995-09-01

Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

Science.gov (United States)

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

International Nuclear Information System (INIS)

Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

1989-01-01

Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

[Using the polymerase chain reaction to Borrelia burgdorferi infection in localized scleroderma injure (morphea), in Venezuelan patients].

Science.gov (United States)

Espinoza-León, Fabiola; Arocha, Francisco; Hassanhi, Manzur; Arévalo, Julio

2010-09-01

Borrelia burgdorferi is the causative agent of Lyme Borreliosis, an infectious multisystemic disease transmitted to humans by the Ixodes ticks bite. A possible association of Borrelia burgdorferi with localized scleroderma has been postulated. However, published data do not provide unequivocal results. Previous serologic analysis of patients with localized scleroderma in South American countries (including Venezuela), have been reported as yielding some reactivity. The present study looked for evidence of Borrelia burgdorferi infection in venezuelan patients with localized scleroderma, using the polymerase chain reaction to analyze 21 skin samples of patients with this skin condition. The results were negative in all the samples studied. Our data do not support an association of Borrelia burgdorferi infection and the sclerotic lesions of localized scleroderma; but do not rule out the possibility of a relationship between localized scleroderma and an unknown geno-specie of Borrelia burgdorferi sensu lato complex, a different Borrelia specie or a different spirochetal organism, as the etiological agents of the skin lesions in this area.

Full-scale load tests of Pearl-Chain arches

DEFF Research Database (Denmark)

Halding, Philip Skov; Hertz, Kristian Dahl; Schmidt, Jacob Wittrup

2017-01-01

-Decks: First an investigation of the system’s elastic response (maximum load of 648kN), and second a demonstration of its collapse mechanism and ultimate capacity (maximum load of 970kN). The full-scale test showed formation of plastic hinges and clear warning signs are observed at 84% of the failure load......A full-scale load test is made of two Pearl-Chain (PC) concrete arches in order to evaluate the structural response and assess the design safety. Pearl-Chain structures and Pearl-Chain arches are invented and patented at the Technical University of Denmark. PC-Arches consist of specially designed....... The ultimate, experimental load capacity is 14% higher than the calculated mainly due to the assumed static system used for the calculation. In addition to the full-scale test bridge the first ever permanent PC-Bridge is erected in Denmark in 2015....

Pouched Rats’ Detection of Tuberculosis in Human Sputum: Comparison to Culturing and Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Amanda Mahoney

2012-01-01

Full Text Available Setting. Tanzania. Objective. To compare microscopy as conducted in direct observation of treatment, short course centers to pouched rats as detectors of Mycobacterium tuberculosis. Design. Ten pouched rats were trained to detect tuberculosis in sputum using operant conditioning techniques. The rats evaluated 910 samples previously evaluated by smear microscopy. All samples were also evaluated through culturing and multiplex polymerase chain reaction was performed on culture growths to classify the bacteria. Results. The patientwise sensitivity of microscopy was 58.0%, and the patient-wise specificity was 97.3%. Used as a group of 10 with a cutoff (defined as the number of rat indications to classify a sample as positive for Mycobacterium tuberculosis of 1, the rats increased new case detection by 46.8% relative to microscopy alone. The average samplewise sensitivity of the individual rats was 68.4% (range 61.1–73.8%, and the mean specificity was 87.3% (range 84.7–90.3%. Conclusion. These results suggest that pouched rats are a valuable adjunct to, and may be a viable substitute for, sputum smear microscopy as a tuberculosis diagnostic in resource-poor countries.

Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

Science.gov (United States)

Xia, Minghui; Qi, Qingguo

2013-01-01

We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

Prenatal Group B Streptococcus Test Using Real-Time Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Chi-Feng Wei

2009-06-01

Conclusion: It is necessary to perform a GBS test 4 weeks after an initial negative GBS culture at 35–37 weeks of gestation. RT-PCR provides a simple and rapid alternative method for detecting rectovaginal GBS colonization at the time of labor.

Immunomagnetic separation combined with polymerase chain reaction for the detection of Alicyclobacillus acidoterrestris in apple juice.

Directory of Open Access Journals (Sweden)

Zhouli Wang

Full Text Available A combination of immunomagnetic separation (IMS and polymerase chain reaction (PCR was used to detect Alicyclobacillus acidoterrestris (A. acidoterrestris in apple juice. The optimum technological parameters of the IMS system were investigated. The results indicated that the immunocapture reactions could be finished in 60 min and the quantity of IMPs used for IMS was 2.5 mg/mL. Then the combined IMS-PCR procedure was assessed by detecting A. acidoterrestris in apple juice samples. The agarose gel electrophoresis results of 20 different strains showed that the IMS-PCR procedure presented high specificity to the A. acidoterrestris. The sensitivity of the IMS-PCR was 2×10(1 CFU/mL and the total detection time was 3 to 4 h. Of the 78 naturally contaminated apple juice samples examined, the sensitivity, specificity and accuracy of IMS-PCR compared with the standardized pour plate method were 90.9%, 97.0% and 96.2%, respectively. The results exhibited that the developed IMS-PCR method will be a valuable tool for detecting A. acidoterrestris and improving food quality in juice samples.

Detection of clonal T-cell receptor beta and gamma chain gene rearrangement by polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although established diagnostic criteria exist for mature T-cell neoplasms, a definitive diagnosis of a T-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because T-cell malignancies contain identically rearranged T-cell receptor gamma (TCRG) and/or beta (TCRB) genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal T-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal TCRB and TCRG gene rearrangements (TCRB and TCRG PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol for the TCRB assay involves the use of three separate multiplex master mix tubes. Tubes A and B target the framework regions within the variable and joining regions of the TCRB gene, and Tube C targets the diversity and joining regions of the TCRB gene. The core protocol for the TCRG assay utilizes two multiplex master mix tubes (Tubes A and B) that target the variable and joining regions of the TCRG gene. Use of the five BIOMED-2 TCRB and TCRG PCR multiplex tubes in parallel can detect approximately 94% of clonal TCR gene rearrangements.

Assessment of litter prevalence of Mycoplasma hyopneumoniae in preweaned piglets utilizing an antemortem tracheobronchial mucus collection technique and a real-time polymerase chain reaction assay.

Science.gov (United States)

Vangroenweghe, Frédéric; Karriker, Locke; Main, Rodger; Christianson, Eric; Marsteller, Thomas; Hammen, Kristin; Bates, Jessica; Thomas, Paul; Ellingson, Josh; Harmon, Karen; Abate, Sarah; Crawford, Kimberly

2015-09-01

The swine industry currently lacks validated antemortem methods of detecting baseline herd prevalence of Mycoplasma hyopneumoniae. The focus of our study was to evaluate alternative antemortem detection techniques and to determine baseline litter prevalence in preweaned pig populations utilizing the selected technique and a real-time polymerase chain reaction (qPCR) assay. Preliminary data was analyzed on weaned piglets with evidence of respiratory disease (n = 32). Five sample types (antemortem nasal swab, tracheobronchial mucus, postmortem deep airway swab, bronchoalveolar lavage, and lung tissue) were collected from each pig. Individual samples were tested for M. hyopneumoniae using qPCR. Compared to nasal swabs, tracheobronchial mucus demonstrated higher test sensitivity (P hyopneumoniae. Two out of 180 litters revealed a positive result (1.1%). Individual qPCR assays were run on the samples collected from sow farm 4. Five out of 30 samples revealed a positive result (16.7%). Tracheobronchial mucus collection in combination with qPCR is a sensitive antemortem sampling technique that can be used to estimate the prevalence of M. hyopneumoniae in preweaned pigs, thus providing insight into the infection dynamics across the entire farrow-to-finish process. © 2015 The Author(s).

Molecular typing for blood group antigens within 40 min by direct polymerase chain reaction from plasma or serum.

Science.gov (United States)

Wagner, Franz F; Flegel, Willy A; Bittner, Rita; Döscher, Andrea

2017-03-01

Determining blood group antigens by serological methods may be unreliable in certain situations, such as in patients after chronic or massive transfusion. Red cell genotyping offers a complementary approach, but current methods may take much longer than conventional serological typing, limiting their utility in urgent situations. To narrow this gap, we devised a rapid method using direct polymerase chain reaction (PCR) amplification while avoiding the DNA extraction step. DNA was amplified by PCR directly from plasma or serum of blood donors followed by a melting curve analysis in a capillary rapid-cycle PCR assay. We evaluated the single nucleotide polymorphisms underlying the clinically relevant Fy a , Fy b , Jk a and Jk b antigens, with our analysis being completed within 40 min of receiving a plasma or serum sample. The positive predictive value was 100% and the negative predictive value at least 84%. Direct PCR with melting point analysis allowed faster red cell genotyping to predict blood group antigens than any previous molecular method. Our assay may be used as a screening tool with subsequent confirmatory testing, within the limitations of the false-negative rate. With fast turnaround times, the rapid-cycle PCR assay may eventually be developed and applied to red cell genotyping in the hospital setting. © 2016 John Wiley & Sons Ltd.

Detection of Theileria annulata carriers in Holstein–Friesian (Bos taurus taurus) and Sistani (Bos taurus indicus) cattle breeds by polymerase chain reaction in Sistan region, Iran

OpenAIRE

Majidiani, Hamidreza; Nabavi, Reza; Ganjali, Maryam; Saadati, Dariush

2015-01-01

Theileria annulata is common in tropical and subtropical regions especially in Iran and causes great economic losses in cattle industry. In Iran the epidemiological aspects of bovine theileriosis in different breeds of cattle is poorly understood. The aim of present study is comparison of the number of T. annulata carriers in the two major cattle breeds (Holstein–Friesian and Sistani) in Sistan of Iran by giemsa and polymerase chain reaction (PCR) methods. During winter 2013, 160 native cattl...

Detection of mycoplasmas in urethral swabs from HIV-1 infected patients and control individuals using culture techniques and polymerase chain reaction

Directory of Open Access Journals (Sweden)

CUNHA Regina Ayr Florio da

1998-01-01

Full Text Available The objective of the present study was to determine the prevalence of certain mycoplasma species, i.e., Mycoplasma hominis, Ureaplasma urealyticum and Mycoplasma penetrans, in urethral swabs from HIV-1 infected patients compared to swabs from a control group. Mycoplasmas were detected by routine culture techniques and by the Polymerase Chain Reaction (PCR technique, using 16SrRNA generic primers of conserved region and Mycoplasma penetrans specific primers. The positivity rates obtained with the two methods were comparable. Nevertheless, PCR was more sensitive, while the culture techniques allowed the quantification of the isolates. The results showed no significant difference (p < 0.05 in positivity rates between the methods used for mycoplasma detection.

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

Science.gov (United States)

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

Evaluation of polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis for the detection of the rpoB mutations associated with resistance to rifampicin in Mycobacterium tuberculosis

International Nuclear Information System (INIS)

Lee, H.; Cho, S.-N.; Bang, H.-E.; Kim, S.-C.; Victor, T.C.; Jordaan, A.; Suffys, P.N.; Gomes, H.M.; Singh, U.; Suresh, V.N.; Khan, B.K.

2003-01-01

Resistance of Mycobacterium tuberculosis to rifampicin (RIF) has been associated with mutations of the rpoB gene, which encodes for the RNA polymerase B subunit. Based on this information, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) has been suggested as a sensitive and rapid screening test for the detection of RIF-resistant M. tuberculosis from clinical isolates. PCR-SSCP analyses with radioisotopes and without radioisotopes were employed to detect mutations of the rpoB gene associated with resistance to RIF in four laboratories, and results were compared with those of sequence analysis and the conventional proportion method of drug susceptibility test between laboratories. Radioisotopic PCR-SSCP showed an excellent correlation with sequence analysis of the 157 bp region of the rpoB gene by identifying correctly all 32 isolates analyzed in this study, with a high resolution of the banding patterns obtained. In a separate study, non-radioisotopic PCR-SSCP also gave a good correlation with sequence analysis in 22 isolates, but two (9.1%) isolates were classified as resistant by PCR-SSCP despite wild type sequences. When PCR-SSCP was compared with the results obtained using the proportion method, sensitivity of 44% to 85% were obtained in the 4 laboratories that participated in this study. Possible reasons for discordant results are discussed. It has been concluded that despite discordant results, which were sometimes observed, depending on the experimental conditions, PCR-SSCP appears to be an effective and promising method for the rapid detection of RIF-resistant M. tuberculosis, a marker of multidrug resistant tuberculosis. (author)

Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

Science.gov (United States)

Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

2018-04-01

The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

Science.gov (United States)

Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

2012-08-01

Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; pcritical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

Comparison of hybrid capture and reverse transcriptase polymerase chain reaction methods in terms of diagnosing human cytomegalovirus infection in patients following hematopoietic stem cell transplantation

International Nuclear Information System (INIS)

Orsal, Arif S.; Ozsan, M.; Dolapci, I.; Tekeli, A.; Becksac, M.

2006-01-01

Human cytomegalovirus (CMV) is a life threatening cause of infection among hematopoietic stem cell recipients. Developing reliable methods in detecting the CMV infection is important to identify the patients at risk of CMV infection and disease. The aim of this study was to compare the 2 tests- hybrid capture test, which is routinely used in the diagnosis of CMV infection among hematopoietic stem cell recipients, and reverse transcriptase polymerase chain reaction (RT-PCR) detecting UL21.5 mRNA transcripts of the active virus. In this prospective study, a total of 178 blood samples obtained 35 patients following allogeneic hematopoietic stem cell transplantation at the Bone Marrow Transplantation Unit of the Hematology Department, Ibn-i-Sina Hospital of Ankara University School of Medicine, Turkey between January 2003 and September 2003 were analyzed. Hybrid capture and RT-PCR using UL21.5 gene transcript method to investigate HCMV in blood samples were performed at the department of Microbiology and Clinic Microbiology, Ankara University School of Medicine, Turkey. When Hybrid capture test was accepted as the golden standard, the sensitivity of Rt-PCR was 3%, specificity 100%, false negativity 67%, false positivity 0%, positive predictive value 100%, negative predictive value 74%, and accuracy was 77%. Improving this test by quantification, and application of additional gene transcripts, primarily the late gene transcripts can help increase the sensitivity and feasibility. (author)

Multiplex polymerase chain reaction to identify and determine the toxigenicity of Corynebacterium spp with zoonotic potential and an overview of human and animal infections

Directory of Open Access Journals (Sweden)

Luciene de Fátima Costa Torres

2013-05-01

Full Text Available Corynebacterium diphtheriae, Corynebacterium ulcerans and Corynebacterium pseudotuberculosis constitute a group of potentially toxigenic microorganisms that are related to different infectious processes in animal and human hosts. Currently, there is a lack of information on the prevalence of disease caused by these pathogens, which is partially due to a reduction in the frequency of routine laboratory testing. In this study, a multiplex polymerase chain reaction (mPCR assay that can simultaneously identify and determine the toxigenicity of these corynebacterial species with zoonotic potential was developed. This assay uses five primer pairs targeting the following genes: rpoB (Corynebacterium spp, 16S rRNA (C. ulcerans and C. pseudotuberculosis, pld (C. pseudotuberculosis, dtxR (C. diphtheriae and tox [diphtheria toxin (DT ]. In addition to describing this assay, we review the literature regarding the diseases caused by these pathogens. Of the 213 coryneform strains tested, the mPCR results for all toxigenic and non-toxigenic strains of C . diphtheriae, C. ulcerans and C. pseudotuberculosis were in 100% agreement with the results of standard biochemical tests and PCR-DT. As an alternative to conventional methods, due to its advantages of specificity and speed, the mPCR assay used in this study may successfully be applied for the diagnosis of human and/or animal diseases caused by potentially toxigenic corynebacterial species.

Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

Directory of Open Access Journals (Sweden)

Xu Q

2015-06-01

Full Text Available Qing Xu,1,* Yazhen Zhu,2,* Yali Bai,1 Xiumin Wei,1 Xirun Zheng,2 Mao Mao,1 Guangjuan Zheng21Translational Bioscience and Diagnostics, WuXi AppTec, Shanghai, 2Department of Pathology, Guangdong Provincial Hospital of TCM, Guangzhou University of Chinese Medicine, Guangdong Provincial Academy of Chinese Medical Sciences, Guangzhou, People’s Republic of China*These authors contributed equally to this workBackground: Two types of epidermal growth factor receptor (EGFR mutations in exon 19 and exon 21 (ex19del and L858R are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR method in detecting the three EGFR mutations in patients with lung cancer.Methods: Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR.Results: The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect

Role of polymerase chain reaction in the diagnosis of Trichomonas vaginalis infection in human immunodeficiency virus-infected individuals from India (South

Directory of Open Access Journals (Sweden)

Hema Paul

2012-01-01

Full Text Available Background: Trichomonas vaginalis is a protozoan parasite and an etiological agent for trichomoniasis, a sexually transmitted infection (STI. Fifty to eighty percentage of women with trichomoniasis are asymptomatic and in the absence of treatment the infection persists longer. Aim: To evaluate the role of polymerase chain reaction (PCR in the diagnosis of trichomoniasis and also to look at the frequency of infection among human immunodeficiency virus (HIV infected women. Methods: A non-nested PCR was standardized to detect 102 bp size amplified product of the adhesin gene of T. vaginalis. The real time performance of this assay was performed with vaginal swab samples from 198 HIV-seropositive women who attended the infectious disease clinic and compared with wet mount and culture in Diamond′s modified media. Results: Among the prospectively studied 198 HIV-infected women, 1 (0.51% was positive by wet mount, 6 (3.03% were positive by culture and 10 (5.02% were positive by the PCR. There was a significant observed agreement between the PCR and culture (k=0.74, Z=10.7, P<0.0000. Conclusion: Our study showed that the PCR assay for the amplification of adhesion gene is a highly sensitive method to screen the high risk group individuals like HIV-positive women for Trichomonas vaginalis compared to the culture. Testing algorithm should be, wet mount and if negative, test by PCR as it is rapid compared to culture which takes 7 days.

Design of Test Wrapper Scan Chain Based on Differential Evolution

Directory of Open Access Journals (Sweden)

Aijun Zhu

2013-08-01

Full Text Available Integrated Circuit has entered the era of design of the IP-based SoC (System on Chip, which makes the IP core reuse become a key issue. SoC test wrapper design for scan chain is a NP Hard problem, we propose an algorithm based on Differential Evolution (DE to design wrapper scan chain. Through group’s mutation, crossover and selection operations, the design of test wrapper scan chain is achieved. Experimental verification is carried out according to the international standard benchmark ITC’02. The results show that the algorithm can obtain shorter longest wrapper scan chains, compared with other algorithms.

Miltenberger blood group typing by real-time polymerase chain reaction (qPCR) melting curve analysis in Thai population.

Science.gov (United States)

Vongsakulyanon, A; Kitpoka, P; Kunakorn, M; Srikhirin, T

2015-12-01

To develop reliable and convenient methods for Miltenberger (Mi(a) ) blood group typing. To apply real-time polymerase chain reaction (qPCR) melting curve analysis to Mi(a) blood group typing. The Mi(a) blood group is the collective set of glycophorin hybrids in the MNS blood group system. Mi(a+) blood is common among East Asians and is also found in the Thai population. Incompatible Mi(a) blood transfusions pose the risk of life-threatening haemolysis; therefore, Mi(a) blood group typing is necessary in ethnicities where the Mi(a) blood group is prevalent. One hundred and forty-three blood samples from Thai blood donors were used in the study. The samples included 50 Mi(a+) samples and 93 Mi(a-) samples, which were defined by serology. The samples were typed by Mi(a) typing qPCR, and 50 Mi(a+) samples were sequenced to identify the Mi(a) subtypes. Mi(a) subtyping qPCR was performed to define GP.Mur. Both Mi(a) typing and Mi(a) subtyping were tested on a conventional PCR platform. The results of Mi(a) typing qPCR were all concordant with serology. Sequencing of the 50 Mi(a+) samples revealed 47 GP.Mur samples and 3 GP.Hop or Bun samples. Mi(a) subtyping qPCR was the supplementary test used to further define GP.Mur from other Mi(a) subtypes. Both Mi(a) typing and Mi(a) subtyping performed well using a conventional PCR platform. Mi(a) typing qPCR correctly identified Mi(a) blood groups in a Thai population with the feasibility of Mi(a) subtype discrimination, and Mi(a) subtyping qPCR was able to further define GP.Mur from other Mi(a) subtypes. © 2015 British Blood Transfusion Society.

Bubble-free on-chip continuous-flow polymerase chain reaction: concept and application.

Science.gov (United States)

Wu, Wenming; Kang, Kyung-Tae; Lee, Nae Yoon

2011-06-07

Bubble formation inside a microscale channel is a significant problem in general microfluidic experiments. The problem becomes especially crucial when performing a polymerase chain reaction (PCR) on a chip which is subject to repetitive temperature changes. In this paper, we propose a bubble-free sample injection scheme applicable for continuous-flow PCR inside a glass/PDMS hybrid microfluidic chip, and attempt to provide a theoretical basis concerning bubble formation and elimination. Highly viscous paraffin oil plugs are employed in both the anterior and posterior ends of a sample plug, completely encapsulating the sample and eliminating possible nucleation sites for bubbles. In this way, internal channel pressure is increased, and vaporization of the sample is prevented, suppressing bubble formation. Use of an oil plug in the posterior end of the sample plug aids in maintaining a stable flow of a sample at a constant rate inside a heated microchannel throughout the entire reaction, as compared to using an air plug. By adopting the proposed sample injection scheme, we demonstrate various practical applications. On-chip continuous-flow PCR is performed employing genomic DNA extracted from a clinical single hair root sample, and its D1S80 locus is successfully amplified. Also, chip reusability is assessed using a plasmid vector. A single chip is used up to 10 times repeatedly without being destroyed, maintaining almost equal intensities of the resulting amplicons after each run, ensuring the reliability and reproducibility of the proposed sample injection scheme. In addition, the use of a commercially-available and highly cost-effective hot plate as a potential candidate for the heating source is investigated.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

Directory of Open Access Journals (Sweden)

Yuny Erwanto

2014-10-01

Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

Science.gov (United States)

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Maedi in slaughtered sheep: a pathology and polymerase chain reaction study in southwestern Iran.

Science.gov (United States)

Azizi, Shahrzad; Tajbakhsh, Elahe; Fathi, Farzad; Oryan, Ahmad; Momtaz, Hassan; Goodarzi, Mehdi

2012-01-01

Maedi-visna (MV) is an important slow viral disease of sheep leading to a progressive lymphoproliferative disease. It affects multiple organs primarily the lungs, where it causes interstitial pneumonia (maedi). In this study, the lungs of 1,000 sheep carcasses were grossly inspected and those suspected to have maedi were studied at histopathological and molecular levels. A polymerase chain reaction (PCR) technique that amplified a 291-base pair DNA in the long terminal repeat (LTR) sequence of MV provirus was conducted on all the 50 suspected lungs together with 10 normal appearing lungs as controls. Amplicons of the expected size were detected in 11 (n=11/50) suspected sheep, and one of the 10 control sheep. Histopathologic study of the pulmonary lesions of all 11 (n=11/11) positive sheep showed MV lesions, including hyperplasia of the perivascular and peribronchiolar lymphoid cells, interstitial lymphoplasmacytic infiltration and smooth muscle hyperplasia and the histopathologic findings were correlated with PCR results. In contrast, the tissue sections of control animals were almost normal at histopathological level; however, PCR technique demonstrated that one of them was affected by maedi. This study showed that the LTR-PCR had high specificity and sensitivity in diagnosis of this viral infection. This study is the first to evaluate the prevalence of MV virus infection in sheep in Iran.

Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA

International Nuclear Information System (INIS)

Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

2012-01-01

Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

Detection of Coxiella burnetii in Aborted Fetuses of Cattle and Sheep Using Polymerase Chain Reaction Assay in Mashhad City, Iran

Directory of Open Access Journals (Sweden)

Zeinab Abiri

2016-02-01

Full Text Available Background: Coxiella burnetii is an important intracellular pathogen that ruminants can act as primary reservoirs. Reservoirs may excrete the bacterium into the placenta, vaginal mucus and feces. Objectives: The aim of this study was to detect C. burnetii in aborted samples from ruminant flocks in Mashhad city, northeast of Iran, using the polymerase chain reaction (PCR assay. Materials and Methods: A total number of 154 fetal tissue samples of cattle, sheep and goat were subjected to nested PCR assay. Results: Sixteen (17.3% out of 92 samples from sheep and 15 (25% from 60 cattle fetuses were positive. Conclusions: The results of this study indicate the presence of C. burnetii in aborted ruminants and these can be the potential reservoirs of C. burnetii in the mentioned area.

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR technique among various cell types of bulls

Directory of Open Access Journals (Sweden)

Carroll Bernie

2010-03-01

Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

Science.gov (United States)

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

Science.gov (United States)

Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

2017-09-01

Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

Multiplex polymerase chain reaction-based prognostic models in diffuse large B-cell lymphoma patients treated with R-CHOP

DEFF Research Database (Denmark)

Green, Tina M; Jensen, Andreas K; Holst, René

2016-01-01

We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de...... models. The best model was validated in data from an online available R-CHOP treated cohort. With progression-free survival (PFS) as primary endpoint, the best performing IPI independent model incorporated the LMO2 and HLADQA1 as well as gene interactions for GCSAMxMIB1, GCSAMxCTGF and FOXP1xPDE4B....... This model assigned 33% of patients (n = 60) to poor outcome with an estimated 3-year PFS of 40% vs. 87% for low risk (n = 61) and intermediate (n = 60) risk groups (P model incorporated LMO2 and BCL2 and assigned 33% of the patients with a 3-year PFS of 35% vs...

Detection by reverse transcriptase-polymerase chain reaction and molecular characterization of subtype B avian metapneumovirus isolated in Brazil.

Science.gov (United States)

Chacón, Jorge Luis; Brandão, Paulo E; Buim, Marcos; Villarreal, Laura; Ferreira, Antonio J Piantino

2007-10-01

Subtype B avian metapneumovirus (aMPV) was isolated and detected by reverse transcriptase-polymerase chain reaction (RT-PCR) in Brazilian commercial laying chicken flocks with no history of vaccination against aMPV and presenting respiratory signs and decreased egg production. RT-PCR results from samples from three affected flocks revealed that the three isolates were subtype B. Partial sequence analysis of the G glycoprotein gene confirmed that the samples belonged to subtype B and were not of the vaccine type. Comparison of nucleotide and amino acid sequences of the G gene of the three Brazilian aMPV samples with subtype B isolates from other countries revealed 95.1% to 96.1% identity. Nucleotide sequences showed 100% identity among the Brazilian subtype B samples and 95.6% identity with the subtype B vaccine strain used in Brazil. This work describes the circulation of subtype B aMPV in Brazil and discusses its importance in terms of disease epidemiology.

Cost analysis of real-time polymerase chain reaction microbiological diagnosis in patients with septic shock.

Science.gov (United States)

Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B

2012-11-01

Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

Science.gov (United States)

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

Directory of Open Access Journals (Sweden)

Fábio Takenori Higa

2013-04-01

Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.

Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

Energy Technology Data Exchange (ETDEWEB)

Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

2008-12-01

We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.

Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

Directory of Open Access Journals (Sweden)

Azzedine Bounamous

2014-07-01

Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

Science.gov (United States)

Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

2014-01-01

Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

16S Ribosomal Ribonucleic Acid Gene Polymerase Chain Reaction in the Diagnosis of Bloodstream Infections: A Systematic Review and Meta-Analysis.

Science.gov (United States)

Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing

2015-01-01

We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.

Quantitative real-time polymerase chain reaction for Streptococcus mutans and Streptococcus sobrinus in dental plaque samples and its association with early childhood caries.

Science.gov (United States)

Choi, Eun-Jung; Lee, Sung-Hoon; Kim, Young-Jae

2009-03-01

Streptococcus mutans and Streptococcus sobrinus are closely associated with the development of early childhood caries (ECC). Recently, quantitative real-time polymerase chain reaction (qRT-PCR) has been used for rapid and accurate quantification of these bacterial species. This study aims to detect quantitatively the levels of S. mutans and S. sobrinus in plaque samples by qRT-PCR, and to assess their association with the prevalence of ECC in Korean preschool children. One hundred and five children (71 months old or younger) were examined and classified into three groups (caries-free, ECC, severe ECC). Dental plaque samples were collected and qRT-PCR was conducted using oligonucleotide primers specific for glucosyltransferase gene (S. mutans-gtfB, S. sobrinus-gtfU) and universal primer. Pearson's correlation test was conducted to evaluate the relationship between the dmfs (decayed, missing, or filled surfaces primary teeth) scores and the microbiological findings. There was a significant difference between the levels of S. mutans and S. sobrinus in the plaque samples of the three groups (P plaque samples. The children with higher ratio of S. sobrinus to S. mutans in their dental plaque showed higher incidence of ECC.

Determination of real-time polymerase chain reaction uncertainty of measurement using replicate analysis and a graphical user interface with Fieller's theorem.

Science.gov (United States)

Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George

2014-07-01

Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller's theorem) and PCR efficiency. The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

Science.gov (United States)

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Rapid detection of cytomegalovirus in bronchoalveolar lavage fluid and serum samples by polymerase chain reaction: correlation of virus isolation and clinical outcome for patients with human immunodeficiency virus infection

DEFF Research Database (Denmark)

Hansen, K K; Vestbo, Jørgen; Benfield, T

1997-01-01

Bronchoalveolar lavage (BAL) fluids and serum samples from 153 patients with pulmonary symptoms who were infected with human immunodeficiency virus (HIV) and underwent BAL were examined for the presence of cytomegalovirus (CMV) by conventional culture and by polymerase chain reaction (PCR...... technique than conventional culture. Detection of CMV DNA in BAL fluid or serum predicted subsequent development of extrapulmonary CMV disease but not death for HIV-infected patients with pulmonary symptoms....

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

Directory of Open Access Journals (Sweden)

Meng Shuang

2010-06-01

Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

Science.gov (United States)

Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

2002-12-01

The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

IDENTIFICATION OF MYCOBACTERIUM GENAVENSE IN A DIANA MONKEY (CERCOPITHECUS DIANA) BY POLYMERASE CHAIN REACTION AND HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY.

Science.gov (United States)

Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J

2015-06-01

A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.

Highly efficient capillary polymerase chain reaction using an oscillation droplet microreactor

International Nuclear Information System (INIS)

Liu Dayu; Liang Guangtie; Lei Xiuxia; Chen Bin; Wang Wei; Zhou Xiaomian

2012-01-01

Graphical abstract: An oscillation-flow approach using a droplet reactor was developed to fully explore the potential of continuous-flow PCR. By fully utilizing interfacial chemistry, a water-in-oil (w/o) droplet was automatically generated by allowing an oil–water plug to flow through a polytetrafluoroethylene (PTFE) capillary. Due to the movement of aqueous phase relative to the oil phase, the droplet moves further into the middle of the oil plug with increase in migration distance. The resulting droplet was transported spanning the two heating zones and was employed as the reactor of oscillating-flow PCR. Highlights: ► Droplet formation in a capillary. ► Transport the droplet using oscillation-flow. ► Oscillation droplet PCR. ► Improved reaction efficiency. - Abstract: The current work presents the development of a capillary-based oscillation droplet approach to maximize the potential of a continuous-flow polymerase chain reaction (PCR). Through the full utilization of interfacial chemistry, a water-in-oil (w/o) droplet was generated by allowing an oil–water plug to flow along a polytetrafluoroethylene (PTFE) capillary. The w/o droplet functioned as the reactor for oscillating-flow PCR to provide a stable reaction environment, accelerate reagent mixing, and eliminate surface adsorption. The capillary PCR approach proposed in the current research offers high amplification efficiency, fast reaction speed, and easy system control attributable to the oscillation droplet reactor. Experimental results show that the droplet-based micro-PCR assay requires lower reaction volume (2 μL) and shorter reaction time (12 min) compared with conventional PCR methods. Taking the amplification of the New Delhi metallo-beta-lactamase (NDM-1) gene as an example, the present work demonstrates that the oscillation droplet PCR assay is capable of achieving high efficiency up to 89.5% and a detection limit of 10 DNA copies. The miniature PCR protocol developed in the current

Testing for Genetically Modified Foods Using PCR

Science.gov (United States)

Taylor, Ann; Sajan, Samin

2005-01-01

The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

Comparison of four polymerase chain reaction assays for the detection of Brucella spp. in clinical samples from dogs

Directory of Open Access Journals (Sweden)

Eduardo J. Boeri

2018-02-01

Full Text Available Aim: This study aimed to compare the sensitivity (S, specificity (Sp, and positive likelihood ratios (LR+ of four polymerase chain reaction (PCR assays for the detection of Brucella spp. in dog's clinical samples. Materials and Methods: A total of 595 samples of whole blood, urine, and genital fluids were evaluated between October 2014 and November 2016. To compare PCR assays, the gold standard was defined using a combination of different serological and microbiological test. Bacterial isolation from urine and blood cultures was carried out. Serological methods such as rapid slide agglutination test, indirect enzyme-linked immunosorbent assay, agar gel immunodiffusion test, and buffered plate antigen test were performed. Four genes were evaluated: (i The gene coding for the BCSP31 protein, (ii the ribosomal gene coding for the 16S-23S intergenic spacer region, (iii the gene coding for porins omp2a/omp2b, and (iv the gene coding for the insertion sequence IS711. Results: The results obtained were as follows: (1 For the primers that amplify the gene coding for the BCSP31 protein: S: 45.64% (confidence interval [CI] 39.81-51.46, Sp: 95.62% (CI 93.13-98.12, and LR+: 10.43 (CI 6.04-18; (2 for the primers that amplify the ribosomal gene of the 16S-23S rDNA intergenic spacer region: S: 69.80% (CI 64.42-75.18, Sp: 95.62 % (CI 93.13-98.12, and LR+: 11.52 (CI 7.31-18.13; (3 for the primers that amplify the omp2a and omp2b genes: S: 39.26% (CI 33.55-44.97, Sp: 97.31% (CI 95.30-99.32, and LR+ 14.58 (CI 7.25-29.29; and (4 for the primers that amplify the insertion sequence IS711: S: 22.82% (CI 17.89 - 27.75, Sp: 99.66% (CI 98.84-100, and LR+ 67.77 (CI 9.47-484.89. Conclusion: We concluded that the gene coding for the 16S-23S rDNA intergenic spacer region was the one that best detected Brucella spp. in canine clinical samples.

Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

Directory of Open Access Journals (Sweden)

C. Latha

2017-08-01

Full Text Available Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349, chicken (n=325, pork (n=310, chevon (n=50, and meat products (n=100 were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7% was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost.

Interlaboratory comparison of three microbial source tracking quantitative polymerase chain reaction (qPCR) assays from fecal-source and environmental samples

Science.gov (United States)

Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.

2012-01-01

During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.

Evaluation of antigen detection and polymerase chain reaction for diagnosis of amoebic liver abscess in patients on anti-amoebic treatment

Directory of Open Access Journals (Sweden)

Jaiswal Virendra

2012-08-01

Full Text Available Abstract Background Diagnosis of amoebic liver abscess (ALA in patients on anti-amoebic drugs is difficult. There is scanty data on this issue using Entamoeba histolytica (E. histolytica lectin antigen and polymerase chain reaction (PCR. We studied utility of lectin antigen, PCR, and IgG antibody in diagnosis of liver abscess in patients on anti-amoebic treatment. Liver aspirate of 200 patients, of which 170 had anti-amoebic drug prior to drainage, was tested for E. histolytica lectin antigen by (ELISA, PCR, bacterial culture, and serum IgG antibody by (ELISA. Classification of abscesses was based on result of anti-amoebic IgG antibody and bacterial culture, E. histolytica PCR and bacterial culture, and E. histolytica lectin antigen and bacterial culture. Findings Using anti-amoebic IgG antibody and bacterial culture, 136/200 (68.0% were classified as ALA, 12/200 (6.0% as pyogenic liver abscess (PLA, 29/200 (14.5% as mixed infection, and 23/200 (11.5% remained unclassified. Using amoebic PCR and bacterial culture 151/200 (75.5% were classified as ALA, 25/200 (12.5% as PLA, 16/200 (8.0% as mixed infection, and 8/200 (4.0% remained unclassified. With E. histolytica lectin antigen and bacterial culture, 22/200 (11.0% patients were classified as ALA, 39/200 (19.5% as PLA, 2/200 (1.0% as mixed infection, and 137/200 (68.5% remained unclassified. Conclusions E. histolytica lectin antigen was not suitable for classification of ALA patients who had prior anti-amoebic treatment. However, PCR may be used as alternative test to anti-amoebic antibody in diagnosis of ALA.

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

OpenAIRE

Alessandro, Pancrazzi; Paola, Guglielmelli; Vanessa, Ponziani; Gaetano, Bergamaschi; Alberto, Bosi; Giovanni, Barosi; Alessandro M, Vannucchi

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves we...

Linear-after-the-exponential polymerase chain reaction and allied technologies. Real-time detection strategies for rapid, reliable diagnosis from single cells.

Science.gov (United States)

Pierce, Kenneth E; Wangh, Lawrence J

2007-01-01

Accurate detection of gene sequences in single cells is the ultimate challenge to polymerase chain reaction (PCR) sensitivity. Unfortunately, commonly used conventional and real-time PCR techniques are often too unreliable at that level to provide the accuracy needed for clinical diagnosis. Here we provide details of linear-after-the-exponential-PCR (LATE-PCR), a method similar to asymmetric PCR in the use of primers at different concentrations, but with novel design criteria to ensure high efficiency and specificity. Compared with conventional PCR, LATE-PCR increases the signal strength and allele discrimination capability of oligonucleotide probes such as molecular beacons and reduces variability among replicate samples. The analysis of real-time kinetics of LATE-PCR signals provides a means for improving the accuracy of single cell genetic diagnosis.

Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA

Directory of Open Access Journals (Sweden)

Ana Lisa do Vale Gomes

2006-10-01

Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.

Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

Science.gov (United States)

Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

2016-01-01

Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

Science.gov (United States)

Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

2014-12-10

A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

Science.gov (United States)

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

Directory of Open Access Journals (Sweden)

Maria Frølund

Full Text Available A novel multiplex quantitative real-time polymerase chain reaction (qPCR for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

Enzyme-linked immunosorbent assay and polymerase chain reaction performance using Mexican and Guatemalan discrete typing unit I strains of Trypanosoma cruzi.

Science.gov (United States)

Ballinas-Verdugo, Martha; Reyes, Pedro Antonio; Mejia-Dominguez, Ana; López, Ruth; Matta, Vivian; Monteón, Victor M

2011-12-01

Thirteen Trypanosoma cruzi isolates from different geographic regions of Mexico and Guatemala belonging to discrete typing unit (DTU) I and a reference CL-Brener (DTU VI) strain were used to perform enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR). A panel of 57 Mexican serum samples of patients with chronic chagasic cardiopathy and asymptomatic infected subjects (blood bank donors) were used in this study. DNA from the above 14 T. cruzi strains were extracted and analyzed by PCR using different sets of primers designed from minicircle and satellite T. cruzi DNA. The chronic chagasic cardiopathy serum samples were easily recognized with ELISA regardless of the source of antigenic extract used, even with the CL-Brener TcVI, but positive serum samples from blood bank donors in some cases were not recognized by some Mexican antigenic extracts. On the other hand, PCR showed an excellent performance despite the set of primers used, since all Mexican and Guatemalan T. cruzi strains were correctly amplified. In general terms, Mexican, Guatemalan, and CL-Brener T. cruzi strains are equally good sources of antigen when using the ELISA test to detect Mexican serum samples. However, there are some strains with poor performance. The DTU I strains are easily detected using either kinetoplast or satellite DNA target designed from DTU VI strains.

Real-time polymerase chain reaction detection of parvovirus B19 DNA in blood donations using a commercial and an in-house assay.

Science.gov (United States)

Koppelman, M H G M; van Swieten, P; Cuijpers, H T M

2011-06-01

European regulations require testing of manufacturing plasma for parvovirus B19 (B19) DNA to limit the load of this virus to a maximum acceptable level of 10 IU/µL. To meet this requirement, most manufacturers introduced a test algorithm to identify and eliminate high-load donations before making large manufacturing pools of plasma units. Sanquin screens all donations using a commercial assay from Roche and an in-house assay. Between 2006 and 2009, 6.2 million donations were screened using two different polymerase chain reaction (PCR) assays targeting B19 DNA. Donations with B19 DNA loads of greater than 1 × 10(6) IU/mL showing significant differences in viral load between the two assays were further analyzed by sequencing analysis. A total of 396 donations with B19 DNA loads of greater than 1 × 10(6) IU/mL were identified. Fifteen samples (3.8%) had discordant test results; 10 samples (2.5%) were underquantified by the Roche assay, two samples (0.5%) were underquantified by the in-house assay, and three samples (0.8%) were not detected by the Roche assay. Sequencing analysis revealed mismatches in primer and probe-binding regions. Phylogenetic analysis showed that 12 samples were B19 Genotype 1. The three samples not detected by the Roche assay were B19 Genotype 2. This study shows that 3.8% of the viremic B19 DNA-positive donations are not quantified correctly by the Roche or in-house B19 DNA assays. B19 Genotype 1 isolates showing incorrect test results are more common than B19 Genotype 2 or 3 isolates. Newly designed B19 PCR assays for blood screening should preferably have multiplexed formats targeting multiple regions of the B19 genome. © 2010 American Association of Blood Banks.

Determination of real-time polymerase chain reaction uncertainty of measurement using replicate analysis and a graphical user interface with Fieller’s theorem

Science.gov (United States)

Stuart, James Ian; Delport, Johan; Lannigan, Robert; Zahariadis, George

2014-01-01

BACKGROUND: Disease monitoring of viruses using real-time polymerase chain reaction (PCR) requires knowledge of the precision of the test to determine what constitutes a significant change. Calculation of quantitative PCR confidence limits requires bivariate statistical methods. OBJECTIVE: To develop a simple-to-use graphical user interface to determine the uncertainty of measurement (UOM) of BK virus, cytomegalovirus (CMV) and Epstein-Barr virus (EBV) real-time PCR assays. METHODS: Thirty positive clinical samples for each of the three viral assays were repeated once. A graphical user interface was developed using a spreadsheet (Excel, Microsoft Corporation, USA) to enable data entry and calculation of the UOM (according to Fieller’s theorem) and PCR efficiency. RESULTS: The confidence limits for the BK virus, CMV and EBV tests were ∼0.5 log, 0.5 log to 1.0 log, and 0.5 log to 1.0 log, respectively. The efficiencies of these assays, in the same order were 105%, 119% and 90%. The confidence limits remained stable over the linear range of all three tests. DISCUSSION: A >5 fold (0.7 log) and a >3-fold (0.5 log) change in viral load were significant for CMV and EBV when the results were ≤1000 copies/mL and >1000 copies/mL, respectively. A >3-fold (0.5 log) change in viral load was significant for BK virus over its entire linear range. PCR efficiency was ideal for BK virus and EBV but not CMV. Standardized international reference materials and shared reporting of UOM among laboratories are required for the development of treatment guidelines for BK virus, CMV and EBV in the context of changes in viral load. PMID:25285125

Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction

Directory of Open Access Journals (Sweden)

Trisadee Khamlor

2014-10-01

Full Text Available Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP gene and sex-determining region Y (SRY were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99% comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05. The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90% as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

Continuous Excretion of Leptospira borgpetersenii Ballum in Mice Assessed by Viability Quantitative Polymerase Chain Reaction.

Science.gov (United States)

Soupé-Gilbert, Marie-Estelle; Bierque, Emilie; Geroult, Sophie; Teurlai, Magali; Goarant, Cyrille

2017-10-01

Rodents are the main reservoir animals of leptospirosis. In this study, we characterized and quantified the urinary excretion dynamics of Leptospira by Mus musculus infected with 2 × 10 8 virulent Leptospira borgpetersenii serogroup Ballum. Each micturition was collected separately in metabolic cages, at 12 time points from 7 to 117 days post-infection (dpi). We detected Leptospira in all urine samples collected (up to 8 per time point per mouse) proving that Leptospira excretion is continuous with ca. 90% live L. borgpetersenii Ballum, revealed by viability quantitative polymerase chain reaction. Microscopic visualization by Live/Dead fluorescence confirmed this high proportion of live bacteria and demonstrated that L. borgpetersenii Ballum are excreted, at least partly, as bacterial aggregates. We observed two distinct phases in the excretion dynamics, first an increase in Leptospira concentration shed in the urine between 7 and 63 dpi followed by a plateau phase from 63 dpi onward, with up to 3 × 10 7 Leptospira per mL of urine. These two phases seem to correspond to progressive colonization of renal tubules first, then to stable cell survival and maintenance in kidneys. Therefore, chronically infected adult mice are able to contaminate the environment via urine at each micturition event throughout their lifetime. Because Leptospira excretion reached its maximum 2 months after infection, older rodents have a greater risk of contaminating their surrounding environment.

Self-testing protocols based on the chained Bell inequalities

International Nuclear Information System (INIS)

Šupić, I; Augusiak, R; Salavrakos, A; Acín, A

2016-01-01

Self-testing is a device-independent technique based on non-local correlations whose aim is to certify the effective uniqueness of the quantum state and measurements needed to produce these correlations. It is known that the maximal violation of some Bell inequalities suffices for this purpose. However, most of the existing self-testing protocols for two devices exploit the well-known Clauser–Horne–Shimony–Holt Bell inequality or modifications of it, and always with two measurements per party. Here, we generalize the previous results by demonstrating that one can construct self-testing protocols based on the chained Bell inequalities, defined for two devices implementing an arbitrary number of two-output measurements. On the one hand, this proves that the quantum state and measurements leading to the maximal violation of the chained Bell inequality are unique. On the other hand, in the limit of a large number of measurements, our approach allows one to self-test the entire plane of measurements spanned by the Pauli matrices X and Z. Our results also imply that the chained Bell inequalities can be used to certify two bits of perfect randomness. (paper)

Evaluation of three 5' exonuclease-based real-time polymerase chain reaction assays for detection of pathogenic Leptospira species in canine urine.

Science.gov (United States)

Fink, Jamie M; Moore, George E; Landau, Ruth; Vemulapalli, Ramesh

2015-03-01

Leptospirosis is caused by several pathogenic Leptospira species, and is an important infectious disease of dogs. Early detection of infection is crucial for an effective antibiotic treatment of the disease. Though different polymerase chain reaction (PCR) assays have been developed for detection of pathogenic Leptospira spp., thorough evaluation of the performance of these assays using dog urine samples has not been carried out. In the current study, the performance of 3 real-time PCR (qPCR) assays was assessed, 1 targeting the 16S ribosomal RNA (rRNA) gene and the other 2 targeting the lipL32 gene, a gene for the LipL32 outer membrane protein. With DNA extracted from laboratory-cultured pathogenic Leptospira spp., all 3 qPCR assays showed 100% specificity and had identical lower limits of detection. Compared to a conventional, gel-based PCR assay, all 3 qPCR assays were 100-fold more sensitive. There was a 100% agreement in the results of the 3 assays when tested on urine samples collected aseptically from 30 dogs suspected for leptospirosis. However, when tested on 30 urine samples that were collected by the free-catch method, the 16S rRNA-based assay falsely detected 13.3% of the samples as positive for pathogenic Leptospira spp. Nucleotide sequence analysis of the amplified DNA fragments showed that the assay resulted in false positives because of unrelated bacteria. All urine samples collected from 100 apparently healthy dogs at a local animal shelter tested negative for pathogenic Leptospira spp. These results highlight the importance of sample-specific validation of PCR-based diagnostic assays and the application of appropriately validated assays for more reliable pathogen detection. © 2015 The Author(s).

Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

Science.gov (United States)

Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

2001-01-01

A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

Science.gov (United States)

Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

2014-01-01

Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

Science.gov (United States)

Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

2015-10-01

We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Detection of retinoblastoma gene deletions in spontaneous and radiation-induced mouse lung adenocarcinomas by polymerase chain reaction

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1994-01-01

A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs

Babesia bovis and B. bigemina DNA detected in cattle and ticks from Zimbabwe by polymerase chain reaction

Directory of Open Access Journals (Sweden)

I. Smeenk

2000-07-01

Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.

Large-scale multiplex polymerase chain reaction assay for diagnosis of viral reactivations after allogeneic hematopoietic stem cell transplantation.

Science.gov (United States)

Inazawa, Natsuko; Hori, Tsukasa; Hatakeyama, Naoki; Yamamoto, Masaki; Yoto, Yuko; Nojima, Masanori; Suzuki, Nobuhiro; Shimizu, Norio; Tsutsumi, Hiroyuki

2015-08-01

Viral reactivations following hematopoietic stem cell transplantation are thought to result from the breakdown of both cell-mediated and humoral immunity. As a result, many viruses could be reactivated individually or simultaneously. Using a multiplex polymerase chain reaction (PCR), we prospectively examined many kinds of viral DNAs at a time in 105 patients who underwent allogeneic hematopoietic stem cell transplantation. In total, 591 whole blood samples were collected weekly from pre- to 42 days post-transplantation and the following 13 viruses were tested; herpes simplex virus 1 (HSV-1), HSV-2, varicella-zoster virus (VZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpes virus 6 (HHV-6), HHV-7, HHV-8, adenovirus, BK virus (BKV), JC virus (JCV), parvovirus B19, and hepatitis B virus (HBV). Several viral DNAs were detected in 12 patients before hematopoietic stem cell transplantation. The detection rate gradually increased after transplantation and peaked at 21 days. The most frequently detected virus was HHV-6 (n = 63; 60.0%), followed by EBV (n = 11; 10.5%), CMV (n = 11; 10.5%), and HHV-7 (n = 9; 8.6%). Adenovirus and HBV were each detected in one patient (1.0%). Detection of HHV-6 DNA was significantly more common among patients undergoing cord blood transplantation or with steroid treatment. EBV DNA tended to be more common in patients treated with anti-thymocyte globulin. Multiplex PCR was useful for detecting many viral reactivations after hematopoietic stem cell transplantation, simultaneously. Cord blood transplantation, steroid treatment, or anti-thymocyte globulin use was confirmed to be risk factors after transplantation. © 2015 Wiley Periodicals, Inc.

Polymerase Chain Reaction, Bacteriologic Detection and Antibiogram of Bacteria Isolated from Otitis Media with Effusion in Children, Shiraz, Iran

Directory of Open Access Journals (Sweden)

Mahmood Shishegar

2011-12-01

Full Text Available Background: Otitis media with effusion is one of the leading causes of hearing loss in children. Effective treatment of effusion in the middle ear requires appropriate empirical treatment and characterization of responsible pathogens. Objective of the present study was to detect pathogens in clinical samples from patients with otitis media with effusion in our area and to determine the sensitivity profile of isolated organisms to commonly used antibiotics. Methods: Sixty three samples of middle ear effusion were aseptically obtained from 36 children, who had been treated up to at least two weeks before sampling. They were analyzed using standard bacteriological and multiplex polymerase chain reaction (PCR assays. Antibiotic susceptibility tests were also performed. Results: PCR analysis showed that DNA of Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis were present in 60 (95.2% of the samples. The culture-positive effusion for Streptococcus Pneumoniae, HaemophilusInfluenzae and Moraxella catarrhalis was 34.9%. Almost all isolates of Streptococcus pneumoniaee were sensitive to ciprofloxacin and erythromycin, and none of them was sensitive to co-trimoxazole. None of H. Influenzae isolates was sensitive to erythromycin, cefixim, co-trimoxazole, ampicillin and amoxicillin. None of M. Catarrhalis isolates was sensitive to ceftriaxone, co-trimoxazole, ampicillin and amoxicillin. Conclusion: Compared with other studies using PCR method, the number of H. influenza isolates was in higher in the present study (95.2%. Antibiotic sensitivity profiles of pathogens isolated in this study were different from others. Thus, we can determine empirical antibiotic therapy based on sensi-tivity profile in our geographic area.

A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters.

Science.gov (United States)

Kolm, Claudia; Martzy, Roland; Brunner, Kurt; Mach, Robert L; Krska, Rudolf; Heinze, Georg; Sommer, Regina; Reischer, Georg H; Farnleitner, Andreas H

2017-06-20

We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

Science.gov (United States)

Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

Report on waterborne diseases: The polymerase chain reaction for the identification of enteric viruses in water; Rapporto sulle malattie infettive di origine idricamerizzazione a catena per l`identificazione dei virus enterici nell`acqua

Energy Technology Data Exchange (ETDEWEB)

Muscillo, M; La Rosa, G [Istituto Superiore di Sanita, Rome (Italy). Lab. di Igiene Ambientale

1995-12-01

A variety of human infectious diseases are associated with the pollution of water by enteric viruses. The epidemiological data on cases associated with drinking and recreational water show Norwalk, hepatitis A and E viruses, rotavirus and enteroviruses as the etiological agents. The polymerase chain reaction (PCR) is certainly the most reliable technique available for the rapid identification of these viruses in water samples.

Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

Science.gov (United States)

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.