WorldWideScience

Sample records for test methods nf

  1. Testing NF-κB-based therapy in hemiparkinsonian monkeys

    OpenAIRE

    Mondal, Susanta; Roy, Avik; Jana, Arundhati; Ghosh, Sankar; Kordower, Jeffrey H.; Pahan, Kalipada

    2012-01-01

    Parkinson’s disease (PD) is the most common human neurodegenerative disorder affecting movement, balance, flexibility, and coordination. Despite intense investigation, no effective therapy is available to stop the onset PD or halt its progression. The primate model of PD is considered to be one of the best available models for human PD. Since neuroinflammation plays an important role in the pathogenesis of PD and NF-κB, a proinflammatory transcription factor, participates in the transcription...

  2. Flight Test of an Adaptive Controller and Simulated Failure/Damage on the NASA NF-15B

    Science.gov (United States)

    Buschbacher, Mark; Maliska, Heather

    2006-01-01

    The method of flight-testing the Intelligent Flight Control System (IFCS) Second Generation (Gen-2) project on the NASA NF-15B is herein described. The Gen-2 project objective includes flight-testing a dynamic inversion controller augmented by a direct adaptive neural network to demonstrate performance improvements in the presence of simulated failure/damage. The Gen-2 objectives as implemented on the NASA NF-15B created challenges for software design, structural loading limitations, and flight test operations. Simulated failure/damage is introduced by modifying control surface commands, therefore requiring structural loads measurements. Flight-testing began with the validation of a structural loads model. Flight-testing of the Gen-2 controller continued, using test maneuvers designed in a sequenced approach. Success would clear the new controller with respect to dynamic response, simulated failure/damage, and with adaptation on and off. A handling qualities evaluation was conducted on the capability of the Gen-2 controller to restore aircraft response in the presence of a simulated failure/damage. Control room monitoring of loads sensors, flight dynamics, and controller adaptation, in addition to postflight data comparison to the simulation, ensured a safe methodology of buildup testing. Flight-testing continued without major incident to accomplish the project objectives, successfully uncovering strengths and weaknesses of the Gen-2 control approach in flight.

  3. induced by NF-κB Decoy method

    African Journals Online (AJOL)

    immune system, which provides big risk of infectious diseases. Searching of new therapeutic methods for RA is necessary and important. Generally, the initiation of RA has been closely related with the abnormal antigen presenting cell (APC), which will result in the activation of T cells, especially Th1 and Th17 cells [3].

  4. Tools to Ensure Safe Medicines: New Monograph Tests in USP-NF

    Directory of Open Access Journals (Sweden)

    Catherine Sheehan

    2010-06-01

    Full Text Available This paper describes USP-NF compendial updates to six ‘high-priority” excipient monographs: Glycerin, Propylene Glycol, Sorbitol Solution, Sorbitol Sorbitan Solution, Noncrystallizing Sorbitol Solution and Maltitol Solution. The USP-NF revisions arose from the Food and Drug Administration’s (FDA’s requests to include, as part of each monograph’s Identification test, a limit test to detect the presence of Diethylene Glycol (DEG, a toxic adulterant. These revisions align with the 2007 FDA Guidance for Industry: Testing of Glycerin for Diethylene Glycol (1, that drug product manufacturers perform a specific identity test for DEG on all containers of all lots of glycerin before glycerin is used in the manufacture and preparation of drug products. This paper describes several risk factors due to a complex global excipient supply chain, nonspecific specifications, inadequate supply chain qualification, and poor understanding of regulations. Strengthening and conformance to compendial specifications is one of the tools necessary to mitigate risk and help prevent the next DEG adulteration that is part of USP’s efforts to ensure safe medicines.

  5. Nondestructive testing method

    International Nuclear Information System (INIS)

    Porter, J.F.

    1996-01-01

    Nondestructive testing (NDT) is the use of physical and chemical methods for evaluating material integrity without impairing its intended usefulness or continuing service. Nondestructive tests are used by manufaturer's for the following reasons: 1) to ensure product reliability; 2) to prevent accidents and save human lives; 3) to aid in better product design; 4) to control manufacturing processes; and 5) to maintain a uniform quality level. Nondestructive testing is used extensively on power plants, oil and chemical refineries, offshore oil rigs and pipeline (NDT can even be conducted underwater), welds on tanks, boilers, pressure vessels and heat exchengers. NDT is now being used for testing concrete and composite materials. Because of the criticality of its application, NDT should be performed and the results evaluated by qualified personnel. There are five basic nondestructive examination methods: 1) liquid penetrant testing - method used for detecting surface flaws in materials. This method can be used for metallic and nonmetallic materials, portable and relatively inexpensive. 2) magnetic particle testing - method used to detect surface and subsurface flaws in ferromagnetic materials; 3) radiographic testing - method used to detect internal flaws and significant variation in material composition and thickness; 4) ultrasonic testing - method used to detect internal and external flaws in materials. This method uses ultrasonics to measure thickness of a material or to examine the internal structure for discontinuities. 5) eddy current testing - method used to detect surface and subsurface flaws in conductive materials. Not one nondestructive examination method can find all discontinuities in all of the materials capable of being tested. The most important consideration is for the specifier of the test to be familiar with the test method and its applicability to the type and geometry of the material and the flaws to be detected

  6. Semiconductor testing method

    International Nuclear Information System (INIS)

    Brown, Stephen.

    1992-01-01

    In a method of avoiding use of nuclear radiation, eg gamma rays, X-rays, electron beams, for testing semiconductor components for resistance to hard radiation, which hard radiation causes data corruption in some memory devices and 'latch-up' in others, similar fault effects can be achieved using a xenon or other 'light' flash gun even though the penetration of light is significantly less than that of gamma rays. The method involves treating a device with gamma radiation, measuring a particular fault current at the onset of a fault event, repeating the test with light to confirm the occurrence of the fault event at the same measured fault current, and using the fault current value as a reference for future tests using light on similar devices. (author)

  7. Materials and test methods

    International Nuclear Information System (INIS)

    Kase, M.B.

    1985-01-01

    The objective of this study was to provide, in cooperation with ORNL and LANL, specimens required for studies to develop organic insulators having the cryogenic neutron irradiation resistance required for MFE systems utilizing superconducting magnetic confinement. To develop test methods and analytical procedures for assessing radiation damage. To stimulate and participate in international cooperation directed toward accomplishing these objectives. The system for producing uniaxially reinforced, 3-4 mm (0.125 in) diameter rod specimens has been refined and validated by production of excellent quality specimens using liquid-mix epoxy resin systems. The methodology is undergoing further modification to permit use of hot-melt epoxy and polyimide resin systems as will be required for the experimental program to be conducted in the NLTNIF reactor at ORNL. Preliminary studies indicate that short beam and torsional shear test methods will be useful in evaluating radiation degradation. Development of these and other applicable test methods are continuing. A cooperative program established with laboratories in Japan and in England has resulted in the production and testing of specimens having an identical configuration

  8. Coal - testing methods

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-04-01

    This Standard specifies the method for the particle-size analysis, the method for determination of the float and sink characteristics, the method for determination of Hardgrove grindability indices, the method for determination of the crucible swelling number, the method for determination of the swelling properties, the method for determination of the fluidity properties, the method for determination of the coking properties, the method for determination of the fusibility of ash, and the method for determination of Roga indices of coal.

  9. Development and Flight Testing of a Neural Network Based Flight Control System on the NF-15B Aircraft

    Science.gov (United States)

    Bomben, Craig R.; Smolka, James W.; Bosworth, John T.; Silliams-Hayes, Peggy S.; Burken, John J.; Larson, Richard R.; Buschbacher, Mark J.; Maliska, Heather A.

    2006-01-01

    The Intelligent Flight Control System (IFCS) project at the NASA Dryden Flight Research Center, Edwards AFB, CA, has been investigating the use of neural network based adaptive control on a unique NF-15B test aircraft. The IFCS neural network is a software processor that stores measured aircraft response information to dynamically alter flight control gains. In 2006, the neural network was engaged and allowed to learn in real time to dynamically alter the aircraft handling qualities characteristics in the presence of actual aerodynamic failure conditions injected into the aircraft through the flight control system. The use of neural network and similar adaptive technologies in the design of highly fault and damage tolerant flight control systems shows promise in making future aircraft far more survivable than current technology allows. This paper will present the results of the IFCS flight test program conducted at the NASA Dryden Flight Research Center in 2006, with emphasis on challenges encountered and lessons learned.

  10. Test system and method

    DEFF Research Database (Denmark)

    2012-01-01

    at a second distance from the centre, the second distance being larger than the first distance, one or more sensors arranged at each fluid channel, wherein the sensors each comprise at least one optical detectable member, the test apparatus further comprising one or more optical sensing devices arranged...... larger than the first distance, one or more sensors arranged at each fluid channel, wherein the sensors each comprise at least one optical detectable member, the test apparatus further comprising one or more optical sensing devices arranged for sensing the at least one optical detectable member...

  11. METHOD FOR TESTING COATINGS

    Science.gov (United States)

    Johns, I.B.; Newton, A.S.

    1958-09-01

    A method is described for detecting pin hole imperfections in coatings on uranium-metal objects. Such coated objects are contacted with a heated atmosphere of gaseous hydrogen and imperfections present in the coatings will allow the uranlum to react with the hydrogen to form uranium hydride. Since uranium hydride is less dense than uranium metal it will swell, causing enlargement of the coating defeot and rendering it visible.

  12. Neurofascin (NF155- and NF186-Specific T Cell Response in a Patient Developing a Central Pontocerebellar Demyelination after 10 Years of CIDP

    Directory of Open Access Journals (Sweden)

    Juliane Klehmet

    2017-12-01

    Full Text Available BackgroundInformation and pathobiological understanding about central demyelinating manifestation in patients, who primarily suffer from chronic inflammatory demyelinating polyneuropathy (CIDP, are scarce.MethodsIFN-γ-response as well as antibodies against the (paranodal antigens neurofascin (NF155 and NF 186 had been tested by Elispot assay and ELISA before clinical manifestation and at follow-up.Case description and resultsThe patient described here developed a subacute brainstem syndrome more than 10 years after diagnosis of CIDP under low-dose maintenance treatment of intravenous immunoglobulins (IVIG. MRI revealed enhancing right-sided pontocerebellar lesion. CSF examination showed mild pleocytosis and elevated protein, and negative oligoclonal bands. Further diagnostics exclude differential diagnoses such as tuberculoma, sarcoidosis, or metastasis. Specific IFN-γ response against NF155 and NF186 as measured by Elispot assay was elevated before clinical manifestation. NF155 and NF186 antibodies were negative. Escalation of IVIG treatment at 2 g/kg BW followed by 1.4 g/kg BW led to clinical remission albeit to a new asymptomatic central lesion. Follow-up NF155 and NF186-Elispot turned negative.ConclusionThe case reported here with a delayed central manifestation after an initially typical CIDP and NF155 and NF186 T cell responses does not resemble described cases of combined central and peripheral demyelination but may reflect a novel subtype within the great clinical heterogeneity of CIDP.

  13. Unidirectional Fabric Drape Testing Method.

    Science.gov (United States)

    Mei, Zaihuan; Shen, Wei; Wang, Yan; Yang, Jingzhi; Zhou, Ting; Zhou, Hua

    2015-01-01

    In most cases, fabrics such as curtains, skirts, suit pants and so on are draped under their own gravity parallel to fabric plane while the gravity is perpendicular to fabric plane in traditional drape testing method. As a result, it does not conform to actual situation and the test data is not convincing enough. To overcome this problem, this paper presents a novel method which simulates the real mechanical conditions and ensures the gravity is parallel to the fabric plane. This method applied a low-cost Kinect Sensor device to capture the 3-dimensional (3D) drape profile, thus we obtained the drape degree parameters and aesthetic parameters by 3D reconstruction and image processing and analysis techniques. The experiment was conducted on our self-devised drape-testing instrument by choosing different kinds of weave structure fabrics as our testing samples and the results were compared with those of traditional method and subjective evaluation. Through regression and correlation analysis we found that this novel testing method was significantly correlated with the traditional and subjective evaluation method. We achieved a new, non-contact 3D measurement method for drape testing, namely unidirectional fabric drape testing method. This method is more suitable for evaluating drape behavior because it is more in line with actual mechanical conditions of draped fabrics and has a well consistency with the requirements of visual and aesthetic style of fabrics.

  14. Standard Test Method for Sandwich Corrosion Test

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This test method defines the procedure for evaluating the corrosivity of aircraft maintenance chemicals, when present between faying surfaces (sandwich) of aluminum alloys commonly used for aircraft structures. This test method is intended to be used in the qualification and approval of compounds employed in aircraft maintenance operations. 1.2 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information. 1.3 This standard may involve hazardous materials, operations, and equipment. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. Specific hazard statements appear in Section 9.

  15. Testing framework for compression methods

    OpenAIRE

    Štoček, Ondřej

    2008-01-01

    There are many algorithms for data compression. These compression methods often achieve different compression rate and also use computer resources differently. In practice a combination of compression is usually used instead of standalone compression methods. The software tool can be evolved, where we can easily combine existing compression methods to new one and test it consequently. Main goal of this work is to propound such tool and implement it. Further goal is to implement basic library ...

  16. Test equating methods and practices

    CERN Document Server

    Kolen, Michael J

    1995-01-01

    In recent years, many researchers in the psychology and statistical communities have paid increasing attention to test equating as issues of using multiple test forms have arisen and in response to criticisms of traditional testing techniques This book provides a practically oriented introduction to test equating which both discusses the most frequently used equating methodologies and covers many of the practical issues involved The main themes are - the purpose of equating - distinguishing between equating and related methodologies - the importance of test equating to test development and quality control - the differences between equating properties, equating designs, and equating methods - equating error, and the underlying statistical assumptions for equating The authors are acknowledged experts in the field, and the book is based on numerous courses and seminars they have presented As a result, educators, psychometricians, professionals in measurement, statisticians, and students coming to the subject for...

  17. Methods for testing transport models

    International Nuclear Information System (INIS)

    Singer, C.; Cox, D.

    1991-01-01

    Substantial progress has been made over the past year on six aspects of the work supported by this grant. As a result, we have in hand for the first time a fairly complete set of transport models and improved statistical methods for testing them against large databases. We also have initial results of such tests. These results indicate that careful application of presently available transport theories can reasonably well produce a remarkably wide variety of tokamak data

  18. [Inappropriate test methods in allergy].

    Science.gov (United States)

    Kleine-Tebbe, J; Herold, D A

    2010-11-01

    Inappropriate test methods are increasingly utilized to diagnose allergy. They fall into two categories: I. Tests with obscure theoretical basis, missing validity and lacking reproducibility, such as bioresonance, electroacupuncture, applied kinesiology and the ALCAT-test. These methods lack both the technical and clinical validation needed to justify their use. II. Tests with real data, but misleading interpretation: Detection of IgG or IgG4-antibodies or lymphocyte proliferation tests to foods do not allow to separate healthy from diseased subjects, neither in case of food intolerance, allergy or other diagnoses. The absence of diagnostic specificity induces many false positive findings in healthy subjects. As a result unjustified diets might limit quality of life and lead to malnutrition. Proliferation of lymphocytes in response to foods can show elevated rates in patients with allergies. These values do not allow individual diagnosis of hypersensitivity due to their broad variation. Successful internet marketing, infiltration of academic programs and superficial reporting by the media promote the popularity of unqualified diagnostic tests; also in allergy. Therefore, critical observation and quick analysis of and clear comments to unqualified methods by the scientific medical societies are more important than ever.

  19. A dual-channel gas chromatography method for the quantitation of low and high concentrations of NF3 and CF4 to study membrane separation of the two compounds.

    Science.gov (United States)

    Branken, D J; le Roux, J P; Krieg, H M; Lachmann, G

    2013-09-13

    A dual-channel gas chromatographic method is described in this paper that can be conveniently used for quantitation of NF3/CF4 mixtures with a thermal conductivity detector (TCD) on one channel for the quantitation of high-concentrations, and a pulsed discharge helium ionization detector (PDHID) on a second channel for the quantitation of low concentrations. It is shown that adequate separation is achieved on both channels with this dual single-column setup in which column switching as used for NF3/CF4 analysis in industrial chromatographic methods are not required, thus yielding an effective analysis method for laboratory-scale investigations. In addition, the use of packed columns with purified divinylbenzene-styrene co-polymers as the sole stationary phase yields satisfactory resolution between NF3 and CF4 at isothermal conditions of 30°C, with elution times of less than 8min on the TCD channel and less than 4min on the PDHID channel. Consequently, this method allows for reliable, straight-forward quantitation of NF3/CF4 mixtures, which is necessary when studying the commercially important problem of NF3 and CF4 separation by different methods. Therefore, the applicability of the method to studying membrane separation of NF3 and CF4 is briefly discussed and illustrated, for which the dual-channel setup is especially beneficial. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. NF ISO 10270. Corrosion of metals and alloys. Aqueous corrosion tests of zirconium alloys used in nuclear reactors

    International Nuclear Information System (INIS)

    2002-06-01

    This international standard prescribes the determination of the mass gain and the superficial control of zirconium and zirconium alloy products after a corrosion test performed in water at 360 deg. C and in steam at 400 deg. C or more. A pressure of 10.3 MPa (1500 psi) is applied during the tests performed in vapor. This standard applies to welded and molded products, to powder metallurgy products and to filler metals for welding application. The method has been widely used in the development of new alloys and new techniques of thermal treatment and in the evaluation of welding techniques. (J.S.)

  1. Automatic Testing with Formal Methods

    NARCIS (Netherlands)

    Tretmans, G.J.; Belinfante, Axel

    1999-01-01

    The use of formal system specifications makes it possible to automate the derivation of test cases from specifications. This allows to automate the whole testing process, not only the test execution part of it. This paper presents the state of the art and future perspectives in testing based on

  2. Telemetry test methods. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Bowers, J.L.; Bullard, D.L.; Schelp, T.R.

    1978-04-01

    A flexible test system is studied and proposed to provide an extensive evaluation and testing capability for telemetry products. A distributed computer controlled, modular unit test system using Computer Automated Measurement and Control (CAMAC) standard hardware and compatible software is selected because of its flexibility of application and long term cost effectiveness.

  3. Error response test system and method using test mask variable

    Science.gov (United States)

    Gender, Thomas K. (Inventor)

    2006-01-01

    An error response test system and method with increased functionality and improved performance is provided. The error response test system provides the ability to inject errors into the application under test to test the error response of the application under test in an automated and efficient manner. The error response system injects errors into the application through a test mask variable. The test mask variable is added to the application under test. During normal operation, the test mask variable is set to allow the application under test to operate normally. During testing, the error response test system can change the test mask variable to introduce an error into the application under test. The error response system can then monitor the application under test to determine whether the application has the correct response to the error.

  4. Standard test method for creep-fatigue testing

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This test method covers the determination of mechanical properties pertaining to creep-fatigue deformation or crack formation in nominally homogeneous materials, or both by the use of test specimens subjected to uniaxial forces under isothermal conditions. It concerns fatigue testing at strain rates or with cycles involving sufficiently long hold times to be responsible for the cyclic deformation response and cycles to crack formation to be affected by creep (and oxidation). It is intended as a test method for fatigue testing performed in support of such activities as materials research and development, mechanical design, process and quality control, product performance, and failure analysis. The cyclic conditions responsible for creep-fatigue deformation and cracking vary with material and with temperature for a given material. 1.2 The use of this test method is limited to specimens and does not cover testing of full-scale components, structures, or consumer products. 1.3 This test method is primarily ...

  5. Automated analysis of NF-κB nuclear translocation kinetics in high-throughput screening.

    Directory of Open Access Journals (Sweden)

    Zi Di

    Full Text Available Nuclear entry and exit of the NF-κB family of dimeric transcription factors plays an essential role in regulating cellular responses to inflammatory stress. The dynamics of this nuclear translocation can vary significantly within a cell population and may dramatically change e.g. upon drug exposure. Furthermore, there is significant heterogeneity in individual cell response upon stress signaling. In order to systematically determine factors that define NF-κB translocation dynamics, high-throughput screens that enable the analysis of dynamic NF-κB responses in individual cells in real time are essential. Thus far, only NF-κB downstream signaling responses of whole cell populations at the transcriptional level are in high-throughput mode. In this study, we developed a fully automated image analysis method to determine the time-course of NF-κB translocation in individual cells, suitable for high-throughput screenings in the context of compound screening and functional genomics. Two novel segmentation methods were used for defining the individual nuclear and cytoplasmic regions: watershed masked clustering (WMC and best-fit ellipse of Voronoi cell (BEVC. The dynamic NFκB oscillatory response at the single cell and population level was coupled to automated extraction of 26 analogue translocation parameters including number of peaks, time to reach each peak, and amplitude of each peak. Our automated image analysis method was validated through a series of statistical tests demonstrating computational efficient and accurate NF-κB translocation dynamics quantification of our algorithm. Both pharmacological inhibition of NF-κB and short interfering RNAs targeting the inhibitor of NFκB, IκBα, demonstrated the ability of our method to identify compounds and genetic players that interfere with the nuclear transition of NF-κB.

  6. Development of Dissolution Test Method for Drotaverine ...

    African Journals Online (AJOL)

    Methods: Sink conditions, drug stability and specificity in different dissolution media were tested to optimize a dissolution test method using a USP paddle type dissolution test apparatus set at a speed of. 50 rpm. The dissolution medium consisted of 900 ml of phosphate buffer (pH 6.8) containing 0.25% w/v cetrimide at 37 ...

  7. The WST method, a fracture mechanics test method for FRC

    DEFF Research Database (Denmark)

    Lofgren, I.; Stang, Henrik; Olesen, John Forbes

    2008-01-01

    The applicability of the wedge-splitting test method (WST), for determining fracture properties of fibre-reinforced concrete, is discussed. Experimental results, using the WST method, are compared with results from uniaxial tension tests (UTT) and three-point bending tests (3PBT) for five differe...

  8. Radon barrier: Method of testing airtightness

    DEFF Research Database (Denmark)

    Rasmussen, Torben Valdbjørn; Buch-Hansen, Thomas Cornelius

    2017-01-01

    to the test method were suggested. A digital stirring and control system, and a method for determining the mean air pressure difference, as well as a method for testing barriers with a very low air infiltration, were provided. The digital stirring and control system ensured automatic control and measuring...

  9. New Graphical Methods and Test Statistics for Testing Composite Normality

    Directory of Open Access Journals (Sweden)

    Marc S. Paolella

    2015-07-01

    Full Text Available Several graphical methods for testing univariate composite normality from an i.i.d. sample are presented. They are endowed with correct simultaneous error bounds and yield size-correct tests. As all are based on the empirical CDF, they are also consistent for all alternatives. For one test, called the modified stabilized probability test, or MSP, a highly simplified computational method is derived, which delivers the test statistic and also a highly accurate p-value approximation, essentially instantaneously. The MSP test is demonstrated to have higher power against asymmetric alternatives than the well-known and powerful Jarque-Bera test. A further size-correct test, based on combining two test statistics, is shown to have yet higher power. The methodology employed is fully general and can be applied to any i.i.d. univariate continuous distribution setting.

  10. Standard Testing Methods for Satellite Communication Systems

    OpenAIRE

    Stoner, Jerry

    2005-01-01

    University space programs continue to push the envelope of small satellite technology. Because budgets are often limited, and equipment costs can often be prohibitive to even well-established space programs, it becomes necessary to maximize the benefit/cost ratio of testing methods. Expensive testing is often not an option, nor is it realistic. Traditional methods such as anechoic chambers or antenna test ranges are not options, and testing the craft on the ground is not practical. Because of...

  11. Contribution to the improvement of the sodium chloride air filter test method

    International Nuclear Information System (INIS)

    Delhaye, J.; Michel, J.

    1977-01-01

    The essential feature of the test method initially developed by the Porton Down Chemical Defence Establishment and modified subsequently by the Atomic Energy Research Establishment at Harwell have been adopted for the testing of high efficiency filters by the European Committee of Manufacturers of Equipment for Air Treatment (EUROVENT). The method has also been studied in the context of the ISO. The Heating and Ventilation Industries, Technical Centre (CETIAT), which uses this method, has drawn attention to a number of imperfections which affect reproductibility. It proposes changes which should have the effect of making the method reproducible not only in a given laboratory but also from one laboratory to another. It will then be possible to carry out studies to compare this method with other similar ones, in particular the fluorescin method (Standard NF X 44 011). The work carried out by CETIAT was concerned mainly with the following: aerosol generation, the velocity spectra in sampling sections, photometer calibration

  12. Testing the Role of p21 Activated Kinases in Schwannoma Formation Using a Novel Genetically Engineered Murine Model that Closely Phenocopies Human NF2 Disease

    Science.gov (United States)

    2017-06-01

    Kinases in Schwannoma Formation Using a Novel Genetically Engineered Murine Model that Closely Phenocopies Human NF2 Disease The views, opinions and...Role of p21 Activated Kinases in Schwannoma Formation Using a Novel Genetically Engineered Murine Model that Closely Phenocopies Human NF2 Disease Form...autosomal dominant genetic disease characterized by benign schwannomas that grow on the cranial and spinal nerves. While technically benign, the tumors are

  13. Helium leak testing methods in nuclear applications

    International Nuclear Information System (INIS)

    Ahmad, Anis

    2004-01-01

    Helium mass-spectrometer leak test is the most sensitive leak test method. It gives very reliable and sensitive test results. In last few years application of helium leak testing has gained more importance due to increased public awareness of safety and environment pollution caused by number of growing chemical and other such industries. Helium leak testing is carried out and specified in most of the critical area applications like nuclear, space, chemical and petrochemical industries

  14. Flight Test Results from the NF-15B Intelligent Flight Control System (IFCS) Project with Adaptation to a Simulated Stabilator Failure

    Science.gov (United States)

    Bosworth, John T.; Williams-Hayes, Peggy S.

    2010-01-01

    Adaptive flight control systems have the potential to be more resilient to extreme changes in airplane behavior. Extreme changes could be a result of a system failure or of damage to the airplane. A direct adaptive neural-network-based flight control system was developed for the National Aeronautics and Space Administration NF-15B Intelligent Flight Control System airplane and subjected to an inflight simulation of a failed (frozen) (unmovable) stabilator. Formation flight handling qualities evaluations were performed with and without neural network adaptation. The results of these flight tests are presented. Comparison with simulation predictions and analysis of the performance of the adaptation system are discussed. The performance of the adaptation system is assessed in terms of its ability to decouple the roll and pitch response and reestablish good onboard model tracking. Flight evaluation with the simulated stabilator failure and adaptation engaged showed that there was generally improvement in the pitch response; however, a tendency for roll pilot-induced oscillation was experienced. A detailed discussion of the cause of the mixed results is presented.

  15. Test Methods for Robot Agility in Manufacturing.

    Science.gov (United States)

    Downs, Anthony; Harrison, William; Schlenoff, Craig

    2016-01-01

    The paper aims to define and describe test methods and metrics to assess industrial robot system agility in both simulation and in reality. The paper describes test methods and associated quantitative and qualitative metrics for assessing robot system efficiency and effectiveness which can then be used for the assessment of system agility. The paper describes how the test methods were implemented in a simulation environment and real world environment. It also shows how the metrics are measured and assessed as they would be in a future competition. The test methods described in this paper will push forward the state of the art in software agility for manufacturing robots, allowing small and medium manufacturers to better utilize robotic systems. The paper fulfills the identified need for standard test methods to measure and allow for improvement in software agility for manufacturing robots.

  16. Influence of 17β-estradiol treatment on the expression of NF-κB in complete hydatidiform mole culture

    Directory of Open Access Journals (Sweden)

    Tatit Nurseta

    2013-12-01

    Full Text Available Background:  Genetic evidence has established a role of nuclear factor kappa B (NF-κB signaling in oncogenesis. However, activity of NF-κB in complete hydatidiform mole (CHM cell culture under 17β-estradiol (E2 treatment is not yet known. Recently, a positive cross-talk between estrogen receptor (ER and NF-κB to promote survival and progress of cancer cells to a more aggressive phenotype was established. In the present study, we examined the influence of E2 treatment on the NF-κB expression in CHM’s culture.Methods:  This experimental study measured the expression of NF-κB in CHM culture treated with E2: 10, 100, 300, 600, and 1000 pg/mL and without E2. Imunohistochemistry staining was used to assess the expression of NF-κB. Microphotographs were taken using 400x magnification. Adobe photoshop CS2 was used to assess the NF-κB expression in cell nucleus. The lower the color intensity of cell RGBbv, is the higher the expression of NF-κB in cells. ANOVA test was performed to compare the expression of NF-κB.Results: NF-κB expression as indicated by color intensity in control group was 114.84 ± 9.02. NF-κB expression in E2 treatment groups were respectively: E2 10 pg/mL: 106.30 ± 13.95; E2 100 pg/mL: 82.47 ± 4.72; E2 300 pg/mL: 82.24 ± 2.67; E2 600 pg/mL: 69.05 ± 6.47; E2 1000 pg/mL: 68.49 ± 2.37. There was progressive decline in color intensity of cells with E2 treatment indicating the increase expression of NF-κB. Significant differences with the control group occurred in doses of E2 100, 300, 600, dan 1000 pg/mL.Conclusion: Treatment of CHM trophoblast culture with escalating doses of E2 was associated with the increase of NF-κB expression in a dose dependent manner. (Med J Indones. 2013;22:197-201. doi: 10.13181/mji.v22i4.599Keywords: 17-β Estradiol, Hydatidiform mole, NF-κB

  17. Absorbing Software Testing into the Scrum Method

    Science.gov (United States)

    Tuomikoski, Janne; Tervonen, Ilkka

    In this paper we study, how to absorb software testing into the Scrum method. We conducted the research as an action research during the years 2007-2008 with three iterations. The result showed that testing can and even should be absorbed to the Scrum method. The testing team was merged into the Scrum teams. The teams can now deliver better working software in a shorter time, because testing keeps track of the progress of the development. Also the team spirit is higher, because the Scrum team members are committed to the same goal. The biggest change from test manager’s point of view was the organized Product Owner Team. Test manager don’t have testing team anymore, and in the future all the testing tasks have to be assigned through the Product Backlog.

  18. Method and apparatus for testing microfilaments

    Science.gov (United States)

    Schleitweiler, Patrick M.; Merten, Jr., Charles W.

    1995-08-01

    A method and apparatus are disclosed for testing tensile strength of microfilaments. Fibers as small as 0.001 inch in diameter and 0.04 inches in length have been tested, although the method and apparatus of the invention are capable of testing fibers of smaller diameter and length. The invention utilizes a method wherein one or both ends of a microfilament is gripped using resin which is softened sufficiently to accept an end of the microfilament and then allowed to harden. The invention also employs the use of a translation stage capable of controlled three-dimensional movement suited to facilitating gripping of the microfilament.

  19. Method and apparatus for testing microfilaments

    Energy Technology Data Exchange (ETDEWEB)

    Schleitweiler, P.M.; Merten, C.W. Jr.

    1995-08-01

    A method and apparatus are disclosed for testing tensile strength of microfilaments. Fibers as small as 0.001 inch in diameter and 0.04 inches in length have been tested, although the method and apparatus of the invention are capable of testing fibers of smaller diameter and length. The invention utilizes a method wherein one or both ends of a microfilament is gripped using resin which is softened sufficiently to accept an end of the microfilament and then allowed to harden. The invention also employs the use of a translation stage capable of controlled three-dimensional movement suited to facilitating gripping of the microfilament. 2 figs.

  20. Comparison of testing methods for particulate filters

    International Nuclear Information System (INIS)

    Ullmann, W.; Przyborowski, S.

    1983-01-01

    Four testing methods for particulate filters were compared by using the test rigs of the National Board of Nuclear Safety and Radiation Protection: 1) Measurement of filter penetration P as a function of particle size d by using a polydisperse NaC1 test aerosol and a scintillation particle counter; 2) Modified sodium flame test for measurement of total filter penetration P for various polydisperse NaC1 test aerosols; 3) Measurement of total filter penetration P for a polydisperse NaC1 test aerosol labelled with short-lived radon daughter products; 4) Measurement of total filter penetration P for a special paraffin oil test aerosol (oil fog test used in FRG according DIN 24 184, test aerosol A). The investigations were carried out on sheets of glass fibre paper (five grades of paper). Detailed information about the four testing methods and the used particle size distributions is given. The different results of the various methods are the base for the discussion of the most important parameters which influence the filter penetration P. The course of the function P=f(d) shows the great influence of the particle size. As expected there was also found a great dependence both from the test aerosol as well as from the principle and the measuring range of the aerosol-measuring device. The differences between the results of the various test methods are greater the lower the penetration. The use of NaCl test aerosol with various particle size distributions gives great differences for the respective penetration values. On the basis of these results and the values given by Dorman conclusions are made about the investigation of particulate filters both for the determination of filter penetration P as well as for the leak test of installed filters

  1. Test Methods for Effects on Organisms

    DEFF Research Database (Denmark)

    Krogh, P. H.

    1997-01-01

    NORD-UTTE er Nordisk koordineringsgrupp för utvekling av testmetoder inom toxicologi och ekotoxicology. The Nordic Co-ordination Group for the Development of Test Methods for Toxicology and Ecotoxicology...

  2. Accelerated Test Method for Corrosion Protective Coatings

    Data.gov (United States)

    National Aeronautics and Space Administration — This project seeks to develop a new accelerated corrosion test method that predicts the long-term corrosion protection performance of spaceport structure coatings as...

  3. testing a consensus conference method by discussing

    African Journals Online (AJOL)

    hi-tech

    2000-10-10

    Oct 10, 2000 ... TESTING A CONSENSUS CONFERENCE METHOD BY DISCUSSING THE MANAGEMENT OF TRAUMATIC DENTAL INJURIES IN TANZANIA ... treatment modalities of traumatic dental injuries recommended in western countries in the. Tanzanian situation. ..... fractured crown, leave alone a fractured.

  4. Testing the Role of p21-Activated Kinases in Schwannoma Formation Using a Novel Genetically Engineered Murine Model that Closely Phenocopies Human NF2 Disease

    Science.gov (United States)

    2016-06-01

    debilitating symptoms seen in subsets of NF1 patients. Specific Aim I: To determine the neural networks and molecular mechanisms involved in the social...the neural networks and molecular mechanisms involved in the social and communication deficits seen with NF1 mutation Aim 1A: Map the brain networks...Boumber, UNMCC) 9/15/2015 - 9/14/2017 2.0% DOD No Salary 0.24 calendar Msi2 Regulates the Aggressiveness of Non-Small Cell Lung Cancer (NSCLC

  5. Desflurane preconditioning induces oscillation of NF-κB in human umbilical vein endothelial cells.

    Directory of Open Access Journals (Sweden)

    Juan Yi

    Full Text Available BACKGROUND: Nuclear factor kappa B (NF-κB has been implicated in anesthetic preconditioning (APC induced protection against anoxia and reoxygenation (A/R injury. The authors hypothesized that desflurane preconditioning would induce NF-κB oscillation and prevent endothelial cells apoptosis. METHODS: A human umbilical vein endothelial cells (HUVECs A/R injury model was used. A 30 minute desflurane treatment was initiated before anoxia. NF-κB inhibitor BAY11-7082 was administered in some experiments before desflurane preconditioning. Cells apoptosis was analyzed by flow cytometry using annexin V-fluorescein isothiocyanate staining and cell viability was evaluated by modified tertrozalium salt (MTT assay. The cellular superoxide dismutases (SOD activitiy were tested by water-soluble tetrazolium salt (WST-1 assay. NF-κB p65 subunit nuclear translocation was detected by immunofluorescence staining. Expression of inhibitor of NF-κB-α (IκBα, NF-κB p65 and cellular inhibitor of apoptosis 1 (c-IAP1, B-cell leukemia/lymphoma 2 (Bcl-2, cysteine containing aspartate specific protease 3 (caspases-3 and second mitochondrial-derived activator of caspase (SMAC/DIABLO were determined by western blot. RESULTS: Desflurane preconditioning caused phosphorylation and nuclear translocation of NF-κB before anoxia, on the contrary, induced the synthesis of IκBα and inhibition of NF-κB after reoxygenation. Desflurane preconditioning up-regulated the expression of c-IAP1 and Bcl-2, blocked the cleavage of caspase-3 and reduced SMAC release, and decreased the cell death of HUVECs after A/R. The protective effect was abolished by BAY11-7082 administered before desflurane. CONCLUSIONS: The results demonstrated that desflurane activated NF-κB during the preconditioning period and inhibited excessive activation of NF-κB in reperfusion. And the oscillation of NF-κB induced by desflurane preconditioning finally up-regulated antiapoptotic proteins expression and

  6. The Operational Testing Effectiveness Evaluation Method

    Science.gov (United States)

    1988-04-01

    objective evaluation method. 3 CHAPTER TWO HISTORICAL OT&E: A RESTLESS SEARCH We regard the creation of the testing and eva ]uation group as of the utmost...supervise it? Tracing the organiza- tional development of operational testing leads through a bewildering maze of command and staff structures. This chapter

  7. MODERN METHODS OF FOOD INTOLERANCE TESTING

    OpenAIRE

    M. Yu. Rosensteyn; A. Z. Rosensteyn; S. E. Kondakov; N. A. Cherevko

    2016-01-01

    Аn analytical review of modern methods of food intolerance diagnostics based on interpretation of markers used in the various tests is рresented. It is shown that tests based on observation of the reaction of specific antibodies of the immune system to food antigens tested, are the most accurate, reliable and representative for the diagnosis of food intolerance.

  8. Powder Flow Testing: Judicious Choice of Test Methods.

    Science.gov (United States)

    Tay, Justin Yong Soon; Liew, Celine Valeria; Heng, Paul Wan Sia

    2017-07-01

    Flow property of pharmaceutical powders can be assessed by various flow testers and test methods. In this study, eight commercially available lactose grades were sourced and tested for angles of repose, tapping studies, shear cell measurements, stirred powder rheometry, and avalanching powder measurements. The relationships between various flow parameters and particle size were analyzed. Deviations from the general trend could be attributed to either the insensitivity of the test or differences in particle shape. The basic flowability energy of the powder rheometer was unable to reconcile the effects of shape and particle size on powder flowability. Avalanche time of the revolving drum powder analyzer and angle of repose exhibited good correlation with each other (r = 0.92) but experienced poor resolution for samples of smaller particle sizes due to powder cohesiveness and the propensity for agglomerative flow. Flow test parameters could be categorized into three broad types, based on their relationship with particle size: (i) linear relationship, (ii) test parameter more sensitive to smaller sized particles, and (iii) test parameter more sensitive to larger sized particles. Choice of test parameters used to represent powder flow should be dependent on the sensitivity of the selected flow test methods to the sample types.

  9. Standard test methods of tension testing of metallic foil

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1993-01-01

    1.1 These test methods cover the tension testing of metallic foil at room temperature in thicknesses less than 0.006 in. (0.150 mm). Note 1—Exception to these methods may be necessary in individual specifications or test methods for a particular material. 1.2 Units—The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  10. Standard test method for instrumented impact testing of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This standard establishes the requirements for performing instrumented Charpy V-Notch (CVN) and instrumented Miniaturized Charpy V-Notch (MCVN) impact tests on metallic materials. This method, which is based on experience developed testing steels, provides further information (in addition to the total absorbed energy) on the fracture behavior of the tested materials. Minimum requirements are given for measurement and recording equipment such that similar sensitivity and comparable total absorbed energy measurements to those obtained in Test Methods E 23 and E 2248 are achieved. 1.2 The values stated in SI units are to be regarded as the standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  11. ASTM Validates Air Pollution Test Methods

    Science.gov (United States)

    Chemical and Engineering News, 1973

    1973-01-01

    The American Society for Testing and Materials (ASTM) has validated six basic methods for measuring pollutants in ambient air as the first part of its Project Threshold. Aim of the project is to establish nationwide consistency in measuring pollutants; determining precision, accuracy and reproducibility of 35 standard measuring methods. (BL)

  12. Measurement of fission yields for 232-Th (n,f) at 14,7 MeV by direct gamma spectrometric method

    International Nuclear Information System (INIS)

    Chouak, K.; Berrada, M.; Embarech, K.

    1994-01-01

    Fission yields for the reaction 232-Th (n,f) were measured at 14,7 MeV using the activation technique with direct gamma spectrometric method. Neutrons were produced via the T(d,n) sup 4 He reaction. The neutron fluences were determined relative to the well-known sup 2 sup 7 Al(n,p) sup 2 sup 7 Mg or sup 2 sup 7 Al(n,alpha) sup 2 sup 4 Na cross section, according to the irradiation time. Yields of fission products were determined by measuring the induced gamma ray activities of the irradiated Th foils, using a calibrated Ge(Li) detector. All necessary corrections were taken into account: self absorption, coincidence losses and natural gamma rays. Fifty six cumulative yields were measured and only twenty one corresponding results were found in the literature (Crouch,1977). A satisfactory agreement is observed between our results and the published data with the exception of the masses:A=134 and A=140. 1 tab., 2 refs. (author)

  13. Standard test method for dynamic tear testing of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1983-01-01

    1.1 This test method covers the dynamic tear (DT) test using specimens that are 3/16 in. to 5/8 in. (5 mm to 16 mm) inclusive in thickness. 1.2 This test method is applicable to materials with a minimum thickness of 3/16 in. (5 mm). 1.3 The pressed-knife procedure described for sharpening the notch tip generally limits this test method to materials with a hardness level less than 36 HRC. Note 1—The designation 36 HRC is a Rockwell hardness number of 36 on Rockwell C scale as defined in Test Methods E 18. 1.4 The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. 1.5 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  14. Functional Analysis of Human NF1 in Drosophila

    Science.gov (United States)

    2007-01-01

    Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific mutagenesis...identified by examining the phenotypes of mutated human gene expressed in Drosophila NF1 null mutants. We also propose that Gsα/NF1-activated AC...With this paradigm established, we further tested the effects of different hNF1 deletion mutations our lab created have on the stimulation event. We

  15. Testing the Role of p21-Activated Kinases in Schwannoma Formation Using a Novel Genetically Engineered Murine Model that Closely Phenocopies Human NF2 Disease

    Science.gov (United States)

    2015-06-01

    0.91 calendar Genetic Therapy for Fanconi Anemia Goals: The goals of this application are to develop lentiviral mediated vectors applicable for...NF1 and unaffected adult control macrophage migration, de novo synthesis of cytokines and neoangiogenic promoting activity in HUVECS. b) Transplant

  16. Cephalometry in adults and children with neurofibromatosis type 1: implications for the pathogenesis of sphenoid wing dysplasia and the “NF1 facies”

    Science.gov (United States)

    Cung, Winnie; Friedman, Laura; Khan, Nicholas E.; Romberg, Elaine E.; Gardner, Pamela J.; Bassim, Carol W.; Baldwin, Andrea M.; Widemann, Brigitte C.; Stewart, Douglas R.

    2015-01-01

    Background Neurofibromatosis type 1 (NF1) is a common, autosomal dominant tumor-predisposition disorder that arises secondary to mutations in the tumor suppressor gene NF1. Cephalometry is an inexpensive, readily available and non-invasive technique that is under-utilized in studying the NF1 craniofacial phenotype. An analysis of NF1 cephalometry was first published by Heervä et al. in 2011. We expand here on that first investigation with a larger cohort of adult and pediatric patients affected with NF1 and sought objective insight into the NF1 facies, said to feature hypertelorism and a broad nasal base, from cephalometric analysis. Methods We obtained cephalograms from 101 patients with NF1 (78 adults and 23 children) from two NF1 protocols at the National Institutes of Health. Each subject had an age-, gender- and ethnicity-matched control. We used Dolphin software to make the cephalometric measurements. We assessed the normality of differences between paired samples using the Shapiro-Wilk test and evaluated the significance of mean differences using paired t-tests and adjusted for multiple testing. We explored the relationship between the cephalometric measurements and height, head circumference and interpupillary distance. Results In this dataset of American whites with NF1, we confirmed in a modestly larger sample many of the findings found by Heerva et al. in an NF1 Finnish cohort. We found a shorter maxilla, mandible, cranial base, (especially anteriorly, p = 0.0001) and diminished facial height in adults, but not children, with NF1. Only one adult exhibited hypertelorism. Conclusions The cephalometric differences in adults arise in part from cranial base shortening and thus result in a shorter face, mid-face hypoplasia, reduced facial projection, smaller jaw, and increased braincase globularity. In addition, we suggest that NF1 sphenoid bone shortening, a common event, is consistent with an intrinsic NF1 bone cell defect, which renders the bone more

  17. Advanced Testing Method for Ground Thermal Conductivity

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Xiaobing [ORNL; Clemenzi, Rick [Geothermal Design Center Inc.; Liu, Su [University of Tennessee (UT)

    2017-04-01

    A new method is developed that can quickly and more accurately determine the effective ground thermal conductivity (GTC) based on thermal response test (TRT) results. Ground thermal conductivity is an important parameter for sizing ground heat exchangers (GHEXs) used by geothermal heat pump systems. The conventional GTC test method usually requires a TRT for 48 hours with a very stable electric power supply throughout the entire test. In contrast, the new method reduces the required test time by 40%–60% or more, and it can determine GTC even with an unstable or intermittent power supply. Consequently, it can significantly reduce the cost of GTC testing and increase its use, which will enable optimal design of geothermal heat pump systems. Further, this new method provides more information about the thermal properties of the GHEX and the ground than previous techniques. It can verify the installation quality of GHEXs and has the potential, if developed, to characterize the heterogeneous thermal properties of the ground formation surrounding the GHEXs.

  18. Review of test methods for coating adhesion

    International Nuclear Information System (INIS)

    Maxwell, A.S.

    2001-01-01

    The following report summarises the results of a literature search and a series of industrial surveys that have been conducted to determine the current status of test methods for the measurement of coating adhesion. The review consists of: a list of test methods that have been identified from current scientific literature; a short description of the methodologies used in industry; a review of applicable standards; a summary of recent scientific reviews; and the results from two recent industrial surveys conducted by the National Physical Laboratory (NPL) and the National Institute of Standards and Technology (NIST) into current industrial practice. (author)

  19. Alternative Test Methods for Developmental Neurotoxicity: A ...

    Science.gov (United States)

    Exposure to environmental contaminants is well documented to adversely impact the development of the nervous system. However, the time, animal and resource intensive EPA and OECD testing guideline methods for developmental neurotoxicity (DNT) are not a viable solution to characterizing potential chemical hazards for the thousands of untested chemicals currently in commerce. Thus, research efforts over the past decade have endeavored to develop cost-effective alternative DNT testing methods. These efforts have begun to generate data that can inform regulatory decisions. Yet there are major challenges to both the acceptance and use of this data. Major scientific challenges for DNT include development of new methods and models that are “fit for purpose”, development of a decision-use framework, and regulatory acceptance of the methods. It is critical to understand that use of data from these methods will be driven mainly by the regulatory problems being addressed. Some problems may be addressed with limited datasets, while others may require data for large numbers of chemicals, or require the development and use of new biological and computational models. For example mechanistic information derived from in vitro DNT assays can be used to inform weight of evidence (WoE) or integrated approaches to testing and assessment (IATA) approaches for chemical-specific assessments. Alternatively, in vitro data can be used to prioritize (for further testing) the thousands

  20. Combined nondestructive testing method for ceramic products

    International Nuclear Information System (INIS)

    Baranov, V.M.; Ermolaev, S.M.; Zhukova, L.M.; Kudryavtsev, E.M.; Kozlov, V.V.; Samokhvalov, A.N.

    1990-01-01

    Methods of defectoscopy of ceramic products based on joint application of ultrasonic resonance spectroscopy and gamma-absorption radiometry are suggested. Due to joint process of data it is possible to establish both the presence and the type of available defects. The conclusion about the character of defects is made on the basis of getting into one or another region of change in complex testing parameters of informative feature impact recorded in tests. The results of ceramography confirming data on nondestructive testing are presented

  1. Test strip and method for its use

    International Nuclear Information System (INIS)

    1981-01-01

    A test strip device is described which is useful in performing binding assays involving antigens, antibodies, hormones, vitamins, metabolites or pharmacological agents. The device is capable of application to analytical methods in which a set of sequential test reactions is involved and in which a minute sample size may be used. This test strip is particularly useful in radioimmunoassays. The use of the device is illustrated in radioimmunoassays for 1) thyroxine in serum, 2) the triiodothyronine binding capacity of serum and 3) folic acid and its analogues in serum. (U.K.)

  2. A dual-channel gas chromatography method for the quantitation of low and high concentrations of NF3 and CF4 to study membrane separation of the two compounds

    OpenAIRE

    Branken, D.J.; Le Roux, J.P.; Krieg, H.M.; Lachmann, G.

    2013-01-01

    A dual-channel gas chromatographic method is described in this paper that can be conveniently used for quantitation of NF3/CF4 mixtures with a thermal conductivity detector (TCD) on one channel for the quantitation of high-concentrations, and a pulsed discharge helium ionization detector (PDHID) on a second channel for the quantitation of low concentrations. It is shown that adequate separation is achieved on both channels with this dual single-column setup in which column switchi...

  3. Standard test methods for bend testing of material for ductility

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 These test methods cover bend testing for ductility of materials. Included in the procedures are four conditions of constraint on the bent portion of the specimen; a guided-bend test using a mandrel or plunger of defined dimensions to force the mid-length of the specimen between two supports separated by a defined space; a semi-guided bend test in which the specimen is bent, while in contact with a mandrel, through a specified angle or to a specified inside radius (r) of curvature, measured while under the bending force; a free-bend test in which the ends of the specimen are brought toward each other, but in which no transverse force is applied to the bend itself and there is no contact of the concave inside surface of the bend with other material; a bend and flatten test, in which a transverse force is applied to the bend such that the legs make contact with each other over the length of the specimen. 1.2 After bending, the convex surface of the bend is examined for evidence of a crack or surface irregu...

  4. Validation of qualitative microbiological test methods

    NARCIS (Netherlands)

    IJzerman-Boon, Pieta C.; van den Heuvel, Edwin R.

    2015-01-01

    This paper considers a statistical model for the detection mechanism of qualitative microbiological test methods with a parameter for the detection proportion (the probability to detect a single organism) and a parameter for the false positive rate. It is demonstrated that the detection proportion

  5. Standard test method for creep-fatigue crack growth testing

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers the determination of creep-fatigue crack growth properties of nominally homogeneous materials by use of pre-cracked compact type, C(T), test specimens subjected to uniaxial cyclic forces. It concerns fatigue cycling with sufficiently long loading/unloading rates or hold-times, or both, to cause creep deformation at the crack tip and the creep deformation be responsible for enhanced crack growth per loading cycle. It is intended as a guide for creep-fatigue testing performed in support of such activities as materials research and development, mechanical design, process and quality control, product performance, and failure analysis. Therefore, this method requires testing of at least two specimens that yield overlapping crack growth rate data. The cyclic conditions responsible for creep-fatigue deformation and enhanced crack growth vary with material and with temperature for a given material. The effects of environment such as time-dependent oxidation in enhancing the crack growth ra...

  6. ``Retests'': A better method of test corrections

    Science.gov (United States)

    McManus, Jeff

    2011-02-01

    Physics instructors at all levels employ a variety of techniques to encourage students to reflect on and correct mistakes made on quizzes, unit tests, or exams. A thorough analysis of several methods was recently published in these pages that compared several variations of quiz corrections in college courses. One common method is to have students rewrite the solutions to the questions or problems that they missed, with the goal of earning some part of the missed points. While this method is helpful for some students, it often discourages students with already decent grades to reflect on their work. I use a method called "retesting" with my AP® Physics C students that I learned from my high school geometry teacher, Bill Kramer. I feel his clever method offers significant advantages over more traditional approaches.

  7. Spinal NF-κB and chemokine ligand 5 expression during spinal glial cell activation in a neuropathic pain model.

    Directory of Open Access Journals (Sweden)

    Qin Yin

    Full Text Available BACKGROUND: The NF-κB pathway and chemokine (C-C motif ligand 5 (CCL5 are involved in pain modulation; however, the precise mechanisms of their interactions in chronic neuropathic pain have yet to be established. METHODS: The present study examined the roles of spinal NF-κB and CCL5 in a neuropathic pain model after chronic constriction injury (CCI surgery. CCI-induced pain facilitation was evaluated using the Plantar and von Frey tests. The changes in NF-κB and CCL5 expression were analyzed by immunohistochemistry and Western blot analyses. RESULTS: Spinal NF-κB and CCL5 expression increased after CCI surgery. Repeated intrathecal infusions of pyrrolidine dithiocarbamate (PDTC, a NF-κB inhibitor decreased CCL5 expression, inhibited the activation of microglia and astrocytes, and attenuated CCI-induced allodynia and hyperalgesia. Intrathecal injection of a CCL5-neutralizing antibody attenuated CCI-induced pain facilitation and also suppressed spinal glial cell activation after CCI surgery. However, the CCL5-neutralizing antibody did not affect NF-κB expression. Furthermore, selective glial inhibitors, minocycline and fluorocitrate, attenuated the hyperalgesia induced by intrathecal CCL5. CONCLUSIONS: The inhibition of spinal CCL5 expression may provide a new method to prevent and treat nerve injury-induced neuropathic pain.

  8. Characterization methods for ultrasonic test systems

    International Nuclear Information System (INIS)

    Busse, L.J.; Becker, F.L.; Bowey, R.E.; Doctor, S.R.; Gribble, R.P.; Posakony, G.J.

    1982-07-01

    Methods for the characterization of ultrasonic transducers (search units) and instruments are presented. The instrument system is considered as three separate components consisting of a transducer, a receiver-display, and a pulser. The operation of each component is assessed independently. The methods presented were chosen because they provide the greatest amount of information about component operation and were not chosen based upon such conditions as cost, ease of operation, field implementation, etc. The results of evaluating a number of commercially available ultrasonic test instruments are presented

  9. Methods and instruments for materials testing

    Science.gov (United States)

    Hansma, Paul (Inventor); Drake, Barney (Inventor); Rehn, Douglas (Inventor); Adams, Jonathan (Inventor); Lulejian, Jason (Inventor)

    2011-01-01

    Methods and instruments for characterizing a material, such as the properties of bone in a living human subject, using a test probe constructed for insertion into the material and a reference probe aligned with the test probe in a housing. The housing is hand held or placed so that the reference probe contacts the surface of the material under pressure applied either by hand or by the weight of the housing. The test probe is inserted into the material to indent the material while maintaining the reference probe substantially under the hand pressure or weight of the housing allowing evaluation of a property of the material related to indentation of the material by the probe. Force can be generated by a voice coil in a magnet structure to the end of which the test probe is connected and supported in the magnet structure by a flexure, opposing flexures, a linear translation stage, or a linear bearing. Optionally, a measurement unit containing the test probe and reference probe is connected to a base unit with a wireless connection, allowing in the field material testing.

  10. Automated Test Methods for XML Metadata

    Science.gov (United States)

    2017-12-28

    definition (XSD) format and other standards and conventions. This method should be of interest primarily to parties having tools or applications that...consume RCC metadata standard documents, and may be of interest to developers of tools or applications that produce RCC metadata standard documents...instance document and encodings to verify that the rules engines and other tools work together. 1. Initialize the programming environment. 2. Write test

  11. Thermal Testing Methods for Solar Dryers

    DEFF Research Database (Denmark)

    Singh, Shobhana

    2017-01-01

    of the dryer system. Since commercial growth and acceptance of any solar dryer system momentously depend on its performance guarantee, the development of a standard methodology for their thermal testing has become necessary. The standard testing method not only provides better performance management......Solar food drying is a complex heat and mass transfer phenomena which depend on a number of drying process-dependent parameters such as operating conditions and characteristics of the food product to be dried. The variation in these parameters significantly affects the overall performance...... of the dryer system but allows the manufacturers to achieve competitive efficiency and good product quality by comparing the available designs. In this chapter, an extensive review of solar dryer performance evaluation has been carried out. Furthermore, the chapter describes the existing testing procedures...

  12. Improved method for fluorescence cytometric immunohematology testing.

    Science.gov (United States)

    Roback, John D; Barclay, Sheilagh; Hillyer, Christopher D

    2004-02-01

    A method for accurate immunohematology testing by fluorescence cytometry (FC) was previously described. Nevertheless, the use of vacuum filtration to wash RBCs and a standard-flow cytometer for data acquisition hindered efforts to incorporate this method into an automated platform. A modified procedure was developed that used low-speed centrifugation of 96-well filter plates for RBC staining. Small-footprint benchtop capillary cytometers (PCA and PCA-96, Guava Technologies, Inc.) were used for data acquisition. Authentic clinical samples from hospitalized patients were tested for ABO group and the presence of D antigen (n = 749) as well as for the presence of RBC alloantibodies (n = 428). Challenging samples with mixed-field reactions and weak antibodies were included. Results were compared to those obtained by column agglutination technology (CAT), and discrepancies were resolved by standard tube methods. Detailed investigations of FC sensitivity and reproducibility were also performed. The modified FC method with the PCA determined the correct ABO group and D type for 98.7 percent of 520 samples, compared to 98.8 percent for CAT (p > 0.05). No-type-determined (NTD) rates were 1.2 percent for both methods. In testing for unexpected alloantibodies, FC determined the correct result for 98.6 percent of 215 samples, compared to 96.3 percent for CAT (p > 0.05). When samples were automatically acquired in the 96-well plate format with the PCA-96, 98.7 percent of 229 samples had correct ABO group and D type determined by FC, compared to 97.4 percent for CAT (p > 0.05). NTD rates were 0.9 and 2.6 percent, respectively. Antibody screens were accurate for 99.1 percent of 213 samples with the PCA-96, compared to 99.5 percent for CAT (p > 0.05). Further investigations demonstrated that FC with the PCA-96 was better than CAT at detecting weak anti-A (p < 0.0001) and alloantibodies. An improved method for FC immunohematology testing has been described. This assay was comparable

  13. Cervical neurofibromas in children with NF-1

    International Nuclear Information System (INIS)

    Chung, C.J.; Mukherji, S.K.; Fordham, L.A.; Armfield, K.B.; Krause, W.L.

    1999-01-01

    Background. Children with neurofibromatosis type 1 (NF1) are at increased risk of developing plexiform neurofibroma throughout the body, including the cervical soft tissues. However, the incidence of cervical soft tissue tumors and the value of screening MR for children with NF1 are not known. Purpose. The purposes of this study were to determine the incidence and clinical significance of cervical tumors seen on MR imaging in children with NF1. Materials and methods. A retrospective review of the brain and orbit MR with cervical images obtained on 95 children who meet the NIH consensus criteria for NF1 and who are followed at our neurofibromatosis clinic was carried out. Results. Cervical tumors were found on MR imaging in 21 of 95 (22 %) children. Of 21 children with cervical tumors, 14 children were determined to be surgical candidates. In nine children, MR imaging altered the clinical management by demonstrating tumors for which surgery was indicated, but the tumors were not suspected prior to MR imaging. Conclusion. Cervical tumors are commonly seen in children with NF1. MR imaging may demonstrate a significant number of tumors that require surgery, but were not suspected prior to MR imaging. (orig.)

  14. Improved grindability test: essential refinements to method

    Energy Technology Data Exchange (ETDEWEB)

    Dick Sanders [QCC Resources (Australia)

    2007-01-15

    Under Project C12063 a test was developed and demonstrated which overcame all of the deficiencies of the Standard Hardgrove Grindability Index (HGI) Test. It used a standard volume of a representative 'by zero' sample, and expressed the results of the standard grind in terms of the Sauter mean diameter, SMD (in {mu}m). The test was named the Improved Grindability Test (IGT). In Project C13065 a steady state IGT was developed. A modification to the method was needed to overcome the effect of prior breakage and this was the basis for this project. Six coals of widely varying type were sampled at exposed coal faces i.e. with no prior breakage history. These were dropped repeatedly, crushed to pass 50 mm, and divided into A and B streams. A was 'gently' crushed to pass 8 mm (jaw crusher), while B was 'vigorously' crushed to pass 8 mm. Each -8 mm sample was then crushed to pass 2 mm by passing about ten times through a plate mill with progressively closer settings. The results have shown that the effects of prior breakage history can be substantially minimised, although not completely eliminated (especially for the softest coals), by increasing the starting sample top size from 4.75 to 8 mm and crushing all of the sample each time, for a large number of passes, to the 2 mm top size for the IGT test. Testing outcomes, and the interpretation of results, have been significantly compromised by sample losses during preparation and testing. Precision at a given laboratory seems acceptable, although agreement between laboratories is disappointing. The Steady State version of the IGT shows great promise, with the mass% of -75 {mu}m produced by grinding, under 'steady state' conditions (5 minutes) being a useful indicator of a coal's grindability.

  15. Simplified pressure method for respirator fit testing.

    Science.gov (United States)

    Han, D; Xu, M; Foo, S; Pilacinski, W; Willeke, K

    1991-08-01

    A simplified pressure method has been developed for fit testing air-purifying respirators. In this method, the air-purifying cartridges are replaced by a pressure-sensing attachment and a valve. While wearers hold their breath, a small pump extracts air from the respirator cavity until a steady-state pressure is reached in 1 to 2 sec. The flow rate through the face seal leak is a unique function of this pressure, which is determined once for all respirators, regardless of the respirator's cavity volume or deformation because of pliability. The contaminant concentration inside the respirator depends on the degree of dilution by the flow through the cartridges. The cartridge flow varies among different brands and is measured once for each brand. The ratio of cartridge to leakflow is a measure of fit. This flow ratio has been measured on human subjects and has been compared to fit factors determined on the same subjects by means of photometric and particle count tests. The aerosol tests gave higher values of fit.

  16. Veriflow Campylobacter. Performance tested method 101201.

    Science.gov (United States)

    Joelsson, Adam C; Brown, Ashley S; Puri, Amrita; Keough, Martin P; Pascal, Benjamin J; Gaudioso, Zara E

    2014-01-01

    Veriflow Campylobacter is a molecular based assay for the presumptive and qualitative detection of the most common occurring foodborne Campylobacter species: C. jejuni and C. coli. The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post PCR amplification and requires only 24 h of non-specialized enrichment for maximum sensitivity. The Veriflow Campylobacter system eliminates the need for microaerobic chambers, gel electrophoresis or fluorophore based detection of target amplification, and does not require complex data analysis. This Performance Tested Method validation study demonstrated the ability of the Veriflow method to detect naturally occurring Campylobacterfrom chicken carcass rinsates. In the reference comparison study, Chi-square and probability of detection analyses of two unpaired studies indicated that there was no significant difference between the Veriflow Campylobacter method and the U.S. Department of Agriculture (USDA)/Food Safety and Inspection Service (FSIS) reference method. There was no indication of false positive or false negative detection in the reference comparison study, and all 50 C. jejuni and C. coli strains were detected, while 35 nonspecific organisms were undetected in the exclusivity/ inclusivity study. The study results show that Veriflow Campylobacter is a sensitive, selective and robust assay for the detection of C. jejuni and C. coli in chicken carcass rinsates.

  17. Noise-abatement method for explosives testing.

    Science.gov (United States)

    Pfeifer, H E; Odell, B N; Arganbright, V E

    1980-09-01

    When Lawrence Livermore Laboratory started detonating explosives at its Site 300 test location in the sparsely populated hills east of the Laboratory, residents in neighboring areas complained of sudden loud noises. A combined literature and research study, coupled with an experimental test program, indicated the combination of air temperatures and winds at various elevations was primarily responsible for blast or sound waves being returned to the surface. To solve the noise problem, the Laboratory devised a method for determining the maximum amount of explosives that could be detonated aboveground under various atmospheric conditions without creating excessive noise in populated areas. This method for predicting explosives weight limits using pressure-distance-weight nomograms and the slope of a sound-velocity curve is described in this paper. The sound-velocity curve is computed with temperature information from the U.S. Weather Bureau and wind data from a target-acquisition radar system. By following this method, the Laboratory has been able to detonate thousands of shots without creating excessive noise in nearby communities.

  18. 2-d Simulations of Test Methods

    DEFF Research Database (Denmark)

    Thrane, Lars Nyholm

    2004-01-01

    using both a Newton and Bingham model for characterisation of the rheological properties of the concrete. From the results, it is expected that both the slump flow and L-box can be simulated quite accurately when the model is extended to 3-d and the concrete is characterised according to the Bingham......One of the main obstacles for the further development of self-compacting concrete is to relate the fresh concrete properties to the form filling ability. Therefore, simulation of the form filling ability will provide a powerful tool in obtaining this goal. In this paper, a continuum mechanical...... approach is presented by showing initial results from 2-d simulations of the empirical test methods slump flow and L-box. This method assumes a homogeneous material, which is expected to correspond to particle suspensions e.g. concrete, when it remains stable. The simulations have been carried out when...

  19. Evaluation of the international reference methods NF EN ISO 11290-1 and 11290-2 and an in-house method for the isolation of Listeria monocytogenes from retail seafood products in france.

    Science.gov (United States)

    Midelet-Bourdin, Graziella; Leleu, Guylaine; Malle, Pierre

    2007-04-01

    Retail seafood products were analyzed on their use-by date using the international reference methods NF EN ISO 11290-1 and 11290-2 (collectively method R) or an in-house method (method B) for the isolation of Listeria monocytogenes. The sensitivity of the methods was about 78%. Method R detected more positive samples of smoked salmon and herb-flavored slices of smoked salmon than did method B, whereas the reverse was true for samples of carpaccio-like salmon, herb-flavored slices of raw salmon, and smoked trout. Most products produced a positive result after the first of two enrichments, and little difference was observed after changing the isolation medium (Listeria selective agar, L. monocytogenes blood agar, agar for Listeria according to Ottaviani and Agosti, Oxford agar, and Palcam agar). L. monocytogenes was isolated from 151 (27.8%) of the 543 samples, with concentrations mostly below 100 CFU/g. The pathogen prevalence and concentration in these seafood products varied greatly depending on the producer and the nature of the product. In certain cases, these differences could be explained by problems in cleaning and disinfection operations in the food-processing environment. The identities of L. monocytogenes isolates were confirmed by PCR, and isolates were characterized by random amplification of polymorphic DNA and pulsed-field gel electrophoresis (PFGE). PFGE patterns obtained with the enzymes Apal and AscI produced 26 different pulsotypes. In general, different pulsotypes were present in the different categories of seafood products and were not specific to one producer. The genetic diversity observed in the products was not related to the prevalence found at the manufacturing site. It is therefore important for producers to determine the source(s) of contamination of their product so the risks linked to the presence of L. monocytogenes can be reduced.

  20. Self-test Monte Carlo method

    International Nuclear Information System (INIS)

    Ohta, Shigemi

    1996-01-01

    The Self-Test Monte Carlo (STMC) method resolves the main problems in using algebraic pseudo-random numbers for Monte Carlo (MC) calculations: that they can interfere with MC algorithms and lead to erroneous results, and that such an error often cannot be detected without known exact solution. STMC is based on good randomness of about 10 10 bits available from physical noise or transcendental numbers like π = 3.14---. Various bit modifiers are available to get more bits for applications that demands more than 10 10 random bits such as lattice quantum chromodynamics (QCD). These modifiers are designed so that a) each of them gives a bit sequence comparable in randomness as the original if used separately from each other, and b) their mutual interference when used jointly in a single MC calculation is adjustable. Intermediate data of the MC calculation itself are used to quantitatively test and adjust the mutual interference of the modifiers in respect of the MC algorithm. STMC is free of systematic error and gives reliable statistical error. Also it can be easily implemented on vector and parallel supercomputers. (author)

  1. A Method to Test Model Calibration Techniques

    Energy Technology Data Exchange (ETDEWEB)

    Judkoff, Ron; Polly, Ben; Neymark, Joel

    2016-08-26

    This paper describes a method for testing model calibration techniques. Calibration is commonly used in conjunction with energy retrofit audit models. An audit is conducted to gather information about the building needed to assemble an input file for a building energy modeling tool. A calibration technique is used to reconcile model predictions with utility data, and then the 'calibrated model' is used to predict energy savings from a variety of retrofit measures and combinations thereof. Current standards and guidelines such as BPI-2400 and ASHRAE-14 set criteria for 'goodness of fit' and assume that if the criteria are met, then the calibration technique is acceptable. While it is logical to use the actual performance data of the building to tune the model, it is not certain that a good fit will result in a model that better predicts post-retrofit energy savings. Therefore, the basic idea here is that the simulation program (intended for use with the calibration technique) is used to generate surrogate utility bill data and retrofit energy savings data against which the calibration technique can be tested. This provides three figures of merit for testing a calibration technique, 1) accuracy of the post-retrofit energy savings prediction, 2) closure on the 'true' input parameter values, and 3) goodness of fit to the utility bill data. The paper will also discuss the pros and cons of using this synthetic surrogate data approach versus trying to use real data sets of actual buildings.

  2. 40 CFR 63.1161 - Performance testing and test methods.

    Science.gov (United States)

    2010-07-01

    ... parameter values for the minimum scrubber makeup water flow rate and, for scrubbers that operate with recirculation, the minimum recirculation water flow rate. During the emission test, each operating parameter...

  3. Non-Destructive Testing Methods: A Comparative Complitation Work

    OpenAIRE

    KARA, Okan; ERDAL, Hasan; ÇELİK, Hasan Hüseyin

    2017-01-01

    In thisstudy, nondestructive testing methods, which sustain safe material usage areanalyzed by doing defect analysis of material. Method that is used innondestructive testing process, need to be applicable on testing material interms of working conditions. For instance; eddy currents method can testnonferrous metals while it cannot test ferromagnetic metals because of workingconditions. Considering these conditions, defective material parts areidentified by examining chosen testing method and...

  4. 40 CFR 60.547 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... hour. Instrument calibration shall be performed by the procedure given in Method 25A using the single... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Test methods and procedures. 60.547... Manufacturing Industry § 60.547 Test methods and procedures. (a) The test methods in appendix A to this part...

  5. Lubricant Test Methods for Sheet Metal Forming

    DEFF Research Database (Denmark)

    Bay, Niels; Olsson, David Dam; Andreasen, Jan Lasson

    2008-01-01

    Sheet metal forming of tribologically difficult materials such as stainless steel, Al-alloys and Ti-alloys or forming in tribologically difficult operations like ironing, punching or deep drawing of thick plate requires often use of environmentally hazardous lubricants such as chlorinated paraffin...... oils in order to avoid galling. The present paper describes a systematic research in the development of new, environmentally harmless lubricants focusing on the lubricant testing aspects. A system of laboratory tests has been developed to study the lubricant performance under the very varied conditions...... appearing in different sheet forming operations such as stretch forming, deep drawing, ironing and punching. The laboratory tests have been especially designed to model the conditions in industrial production. Application of the tests for evaluating new lubricants before introducing them in production has...

  6. Leak test method and test device for iodine filter

    International Nuclear Information System (INIS)

    Fukasawa, Tetsuo; Funabashi, Kiyomi; Miura, Noboru; Miura, Eiichi.

    1995-01-01

    An air introduction device which can change a humidity is disposed upstream of an iodine filter to be tested, and a humidity measuring device is disposed downstream of the iodine filter respectively. At first, dried air reduced with humidity is flown from the air introduction device to the iodine filter, to remove moisture content from an iodine adsorber in the iodine filter. Next, air at an increased humidity is supplied to the iodine filter. The difference between the time starting the supply of the highly humid air and the time detecting the high humidity at the humidity measuring device is measured. When the time difference is smaller than the time difference measured previously in a normal iodine filter, it shows the presence of leak in the iodine filter to be tested. With such procedures, leakage in the iodine filter which removes radioactive iodine from off-gases discharged from the radioactive material handling facilities can be detected easily by using water (steams), namely, a naturally present material. (I.N.)

  7. Antimicrobial Testing Methods & Procedures Developed by EPA's Microbiology Laboratory

    Science.gov (United States)

    We develop antimicrobial testing methods and standard operating procedures to measure the effectiveness of hard surface disinfectants against a variety of microorganisms. Find methods and procedures for antimicrobial testing.

  8. Testing and building theories: mixed methods synthesis

    OpenAIRE

    Harden, Angela

    2008-01-01

    Presentation on use of mixed methods in diverse study types, which combines the findings of ‘qualitative’ and ‘quantitative’ studies within a single systematic review, in order to address the same, overlapping or complementary review questions.

  9. Multi-frequency eddy current testing method

    International Nuclear Information System (INIS)

    Levy, R.; Gallet, G.

    1980-01-01

    Monitoring by multi-frequency eddy currents has been used since 1975 in French nuclear stations; this method applies perfectly to examinations in non-irradiated surroundings. The restrictions connected with operations in controlled zones (radioactivity) have led to the development of a delayed analysis device which in no way changes the principle of the method, but allows greater flexibility of use by reducing the volume of equipment needed and by limiting the intervention of personnel to a strict minimum [fr

  10. Systematic evaluation of nondestructive testing methods

    International Nuclear Information System (INIS)

    Segal, Y.; Notea, A.; Segal, E.

    1977-01-01

    The main task of an NDT engineer is to select the best method, considering the cost-benefit value of different available systems and taking into account the special existing constraints. The aim of the paper is to suggest a tool that will enable characterization of measuring systems. The derivation of the characterization parameters and functions has to be general, i.e., suitable for all possible measuring methods, independent of their principle of operation. Quite often the properties measured during the NDT procedure are not the wanted ones, but there must be a correlation between the measured property and the performance of the product. One has to bear in mind that the ultimate choice between systems is not, in practice, just based on the mathematical optimization approach that is presented. Factors like cost-benefit, availability of trained manpower, service, real-time information, weight, volume, etc., may be crucial problems, and they may well dictate the final selection

  11. Corrosion Control Test Method for Avionic Components

    Science.gov (United States)

    1981-09-25

    IFIED S• ’ECLASSIFICATION "’O14GRAOINU SC4 EMU LE 14 JJS’f’•UUr1N S AT& ME7N ’at .efil pot) Approved for public release; distribucion unlimited 17...Battery Output Increased Gradually as Compared to Normal Fog Effect S0 On 4,4 Took 25 min fur Battery Output to Stabilize S02 Off 2.2 1.8 ’Average...produced by carrier exposure except that there were localized areas where the normally white corrosion produces had a greenish tinge. Since these test

  12. Efficiency Test Method for Electric Vehicle Chargers

    DEFF Research Database (Denmark)

    Kieldsen, Andreas; Thingvad, Andreas; Martinenas, Sergejus

    2016-01-01

    This paper investigates different methods for measuring the charger efficiency of mass produced electric vehicles (EVs), in order to compare the different models. The consumers have low attention to the loss in the charger though the impact on the driving cost is high. It is not a high priority...... above the state of the art power converters. This is an unnecessary high consumption of electrical energy during charging, which not only affects the consumer financially, but also creates unnecessary load on the grid....

  13. Standard Test Method for Testing Nonmetallic Seal Materials by Immersion in a Simulated Geothermal Test Fluid

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1985-01-01

    1.1 This test method covers a procedure for a laboratory test for performing an initial evaluation (screening) of nonmetallic seal materials by immersion in a simulated geothermal test fluid. 1.2 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. For specific precautionary statements, see Section 6 and 11.7.

  14. Test equating, scaling, and linking methods and practices

    CERN Document Server

    Kolen, Michael J

    2014-01-01

    This book provides an introduction to test equating, scaling, and linking, including those concepts and practical issues that are critical for developers and all other testing professionals.  In addition to statistical procedures, successful equating, scaling, and linking involves many aspects of testing, including procedures to develop tests, to administer and score tests, and to interpret scores earned on tests. Test equating methods are used with many standardized tests in education and psychology to ensure that scores from multiple test forms can be used interchangeably.  Test scaling is the process of developing score scales that are used when scores on standardized tests are reported. In test linking, scores from two or more tests are related to one another. Linking has received much recent attention, due largely to investigations of linking similarly named tests from different test publishers or tests constructed for different purposes. In recent years, researchers from the education, psychology, and...

  15. Testing method for ceramic armour and bare ceramic tiles

    NARCIS (Netherlands)

    Carton, E.P.; Roebroeks, G.H.J.J.

    2016-01-01

    TNO developed an alternative, more configuration independent ceramic test method than the Depth-of-Penetration test method. In this alternative test ceramic tiles and ceramic based armour are evaluated as target without a semi-infinite backing layer. An energy approach is chosen to evaluate and rank

  16. Testing method for ceramic armor and bare ceramic tiles

    NARCIS (Netherlands)

    Carton, E.P.; Roebroeks, G.H.J.J.

    2014-01-01

    TNO has developed an alternative, more configuration independent ceramic test method than the standard Depth-of-Penetration test method. In this test ceramic tiles and ceramic based armor are evaluated as target without a semi-infinite backing layer. An energy approach is chosen to evaluate and rank

  17. 16 CFR 1500.40 - Method of testing toxic substances.

    Science.gov (United States)

    2010-01-01

    ... multiple animal holder. Selected doses of liquids and solutions are introduced under the sleeve. If there... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Method of testing toxic substances. 1500.40... testing toxic substances. The method of testing the toxic substances referred to in § 1500.3(c) (1)(ii)(C...

  18. Integrated Data Collection Analysis (IDCA) Program - SSST Testing Methods

    Energy Technology Data Exchange (ETDEWEB)

    Sandstrom, Mary M. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Brown, Geoffrey W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Preston, Daniel N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Pollard, Colin J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Warner, Kirstin F. [Naval Surface Warfare Center (NSWC), Indian Head, MD (United States). Indian Head Division; Remmers, Daniel L. [Naval Surface Warfare Center (NSWC), Indian Head, MD (United States). Indian Head Division; Sorensen, Daniel N. [Naval Surface Warfare Center (NSWC), Indian Head, MD (United States). Indian Head Division; Whinnery, LeRoy L. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Phillips, Jason J. [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Shelley, Timothy J. [Bureau of Alcohol, Tobacco and Firearms (ATF), Huntsville, AL (United States); Reyes, Jose A. [Applied Research Associates, Tyndall AFB, FL (United States); Hsu, Peter C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Reynolds, John G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2013-03-25

    The Integrated Data Collection Analysis (IDCA) program is conducting a proficiency study for Small- Scale Safety and Thermal (SSST) testing of homemade explosives (HMEs). Described here are the methods used for impact, friction, electrostatic discharge, and differential scanning calorimetry analysis during the IDCA program. These methods changed throughout the Proficiency Test and the reasons for these changes are documented in this report. The most significant modifications in standard testing methods are: 1) including one specified sandpaper in impact testing among all the participants, 2) diversifying liquid test methods for selected participants, and 3) including sealed sample holders for thermal testing by at least one participant. This effort, funded by the Department of Homeland Security (DHS), is putting the issues of safe handling of these materials in perspective with standard military explosives. The study is adding SSST testing results for a broad suite of different HMEs to the literature. Ultimately the study will suggest new guidelines and methods and possibly establish the SSST testing accuracies needed to develop safe handling practices for HMEs. Each participating testing laboratory uses identical test materials and preparation methods wherever possible. The testing performers involved are Lawrence Livermore National Laboratory (LLNL), Los Alamos National Laboratory (LANL), Indian Head Division, Naval Surface Warfare Center, (NSWC IHD), Sandia National Laboratories (SNL), and Air Force Research Laboratory (AFRL/RXQL). These tests are conducted as a proficiency study in order to establish some consistency in test protocols, procedures, and experiments and to compare results when these testing variables cannot be made consistent.

  19. 40 CFR 63.905 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... secured in the closed position. (3) The detection instrument shall meet the performance criteria of Method... 40 Protection of Environment 10 2010-07-01 2010-07-01 false Test methods and procedures. 63.905...) National Emission Standards for Tanks-Level 1 § 63.905 Test methods and procedures. (a) Procedure for...

  20. 40 CFR 63.945 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... criteria of Method 21 of 40 CFR part 60, appendix A, except the instrument response factor criteria in... 40 Protection of Environment 10 2010-07-01 2010-07-01 false Test methods and procedures. 63.945...) National Emission Standards for Surface Impoundments § 63.945 Test methods and procedures. (a) Procedure...

  1. 40 CFR 63.925 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... secured in the closed position. (3) The detection instrument shall meet the performance criteria of Method... 40 Protection of Environment 10 2010-07-01 2010-07-01 false Test methods and procedures. 63.925...) National Emission Standards for Containers § 63.925 Test methods and procedures. (a) Procedures for...

  2. Standard test methods for arsenic in uranium hexafluoride

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 These test methods are applicable to the determination of total arsenic in uranium hexafluoride (UF6) by atomic absorption spectrometry. Two test methods are given: Test Method A—Arsine Generation-Atomic Absorption (Sections 5-10), and Test Method B—Graphite Furnace Atomic Absorption (Appendix X1). 1.2 The test methods are equivalent. The limit of detection for each test method is 0.1 μg As/g U when using a sample containing 0.5 to 1.0 g U. Test Method B does not have the complete collection details for precision and bias data thus the method appears as an appendix. 1.3 Test Method A covers the measurement of arsenic in uranyl fluoride (UO2F2) solutions by converting arsenic to arsine and measuring the arsine vapor by flame atomic absorption spectrometry. 1.4 Test Method B utilizes a solvent extraction to remove the uranium from the UO2F2 solution prior to measurement of the arsenic by graphite furnace atomic absorption spectrometry. 1.5 Both insoluble and soluble arsenic are measured when UF6 is...

  3. ASTM test methods for composite characterization and evaluation

    Science.gov (United States)

    Masters, John E.

    1994-01-01

    A discussion of the American Society for Testing and Materials is given. Under the topic of composite materials characterization and evaluation, general industry practice and test methods for textile composites are presented.

  4. Usability testing: using “think aloud” method in testing cartographic ...

    African Journals Online (AJOL)

    The test method in which the paper seeks to address is the 'think aloud' method. The paper addresses how usability testing was conducted using the 'think aloud' method in testing a prototype application developed for real estate agents in visualizing buildings in 3D environment (using Virtual Reality). Journal of Science ...

  5. Standard test method for liquid impingement erosion using rotating apparatus

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers tests in which solid specimens are eroded or otherwise damaged by repeated discrete impacts of liquid drops or jets. Among the collateral forms of damage considered are degradation of optical properties of window materials, and penetration, separation, or destruction of coatings. The objective of the tests may be to determine the resistance to erosion or other damage of the materials or coatings under test, or to investigate the damage mechanisms and the effect of test variables. Because of the specialized nature of these tests and the desire in many cases to simulate to some degree the expected service environment, the specification of a standard apparatus is not deemed practicable. This test method gives guidance in setting up a test, and specifies test and analysis procedures and reporting requirements that can be followed even with quite widely differing materials, test facilities, and test conditions. It also provides a standardized scale of erosion resistance numbers applicab...

  6. Conceptual Approaches to Alternate Methods in Toxicological Testing

    OpenAIRE

    Alan M. Goldberg; Andrew N. Rowan

    1987-01-01

    Due to public pressure, in vivo methods of toxicity testing is being attempted to be replaced by in vitro methods, such as cell and organ culture, computer modelling and modified LD50 tests using lesser number of animals. Specifically in the case of Draize eye irritancy test using rabbits, a number of refinements have been incorporated by different workers, mainly use of a local anaesthetic which will reduce animal distress without vitiating the test results. The author recommends exploration...

  7. Status and applications of echinoid (phylum echinodermata) toxicity test methods

    Energy Technology Data Exchange (ETDEWEB)

    Bay, S.; Burgess, R.; Nacci, D.

    1993-01-01

    The use of echinoderms for toxicity testing has focused primarily on sea urchins and sand dollars (Strongylocentrotus purpuratus, Arbacia punctulata, Lytechinus pictus, and Dendraster excentricus, for example). The status and relative sensitivity of various test methods are described. The most frequently used test methods consist of short-term exposures of sea urchin sperm or embryos; these tests can be easily conducted at all times of the year by using species with complementary spawning cycles or laboratory conditioned populations of a single species. Data from reference toxicant and effluent toxicity tests are summarized. Information on the precision and sensitivity of echinoid test methods are limited and preclude rigorous comparisons with other test methods. The available data indicate that the sensitivity and precision of these methods are comparable to short-term chronic methods for other marine invertebrates and fish. Recent application of the sperm test in toxicity identification evaluations (TIEs) and studies of effluent toxicity decay and sediment toxicity illustrate the versatility of this rapid (10 to 60 min exposure) test method. Embryo tests typically use a 48 to 96 h exposure period and measure the occurrence of embryo malformations. Most recent applications of the embryo test have been for the assessment of sediment elutriate toxicity. Adult echinoderms are not frequently used to assess effluent or receiving water toxicity. Recent studies have had success in using the adult life stage of urchins and sand dollars to assess the effects of contaminated sediment on growth, behavior, and bioaccumulation.

  8. A Method of Partly Automated Testing of Software

    Science.gov (United States)

    Lowry, Mike; Visser, Willem; Washington, Rich; Artho, Cyrille; Goldberg, Allen; Haveland, Klaus; Pasareanu, Corina; Khurshid, Sarfraz; Roflu, Grigore

    2007-01-01

    A method of automated testing of software has been developed that provides an alternative to the conventional mostly manual approach for software testing. The method combines (1) automated generation of test cases on the basis of systematic exploration of the input domain of the software to be tested with (2) run-time analysis in which execution traces are monitored, verified against temporal-logic specifications, and analyzed by concurrency-error-detection algorithms. In this new method, the user only needs to provide the temporal logic specifications against which the software will be tested and the abstract description of the input domain.

  9. Comparison of System Identification Methods using Ambient Bridge Test Data

    DEFF Research Database (Denmark)

    Andersen, P.; Brincker, Rune; Peeters, B.

    1999-01-01

    In this paper the performance of four different system identification methods is compared using operational data obtained from an ambient vibration test of the Swiss Z24 highway bridge. The four methods are the frequency domain based peak-picking methods, the polyreference LSCE method, the stocha...

  10. Development and Validation of a Dissolution Test Method for ...

    African Journals Online (AJOL)

    Purpose: To develop and validate a dissolution test method for dissolution release of artemether and lumefantrine from tablets. Methods: A single dissolution method for evaluating the in vitro release of artemether and lumefantrine from tablets was developed and validated. The method comprised of a dissolution medium of ...

  11. Generating and testing methods for consumer-oriented product development

    International Nuclear Information System (INIS)

    2001-10-01

    In order to obtain a good insight into various design methods that can be used by product developers to enable them to develop and test useful domotics products (domotics: intelligent systems for the home), an inventory has been made of the methods used in the Netherlands. The inventory is directed at two categories of methods: (1) Methods of getting better acquainted with the user and/or the problem, and of generating novel solutions: generative methods; and (2) Methods of assessing solutions (through various phases of the designing process): testing methods. The first category of methods concentrates on the designing process. In other words: how can the designer realise as much as possible of the workability of (domotics) products during the designing process? The second category aims at testing a design (in whatever shape: drawing, prototype, functional computer animation, etc.) through its users. These are methods of assessing a design at various stages of the designing process [nl

  12. Comparison of test methods for mould growth in buildings

    DEFF Research Database (Denmark)

    Bonderup, Sirid; Gunnarsen, Lars Bo; Knudsen, Sofie Marie

    2016-01-01

    The purpose of this work is to compare a range of test methods and kits for assessing whether a building structure is infested by mould fungi. A further purpose of this work is to evaluate whether air-based methods for sampling fungal emissions provide information qualifying decisions concerning...... renovation needs. This is of importance when hidden surface testing would require destructive measures and subsequent renovation. After identifying available methods on the Danish market for assessing mould growth in dwellings, a case study was conducted to test the usefulness of the methods in four...... methods measure different aspects relating to mould growth and vary in selectivity and precision. The two types of air samples indicated low levels of mould growth, even where the results of the other methods indicated high to moderate growth. With methods based on culture and DNA testing some differences...

  13. Comparative study of fracture mechanical test methods for concrete

    DEFF Research Database (Denmark)

    Østergaard, Lennart; Olesen, John Forbes

    2004-01-01

    and the interpretation, i.e. the analysis needed to extract the stress-crack opening relationship, the fracture energy etc. Experiments are carried out with each test configuration using mature, high performance concrete. The results show that the UTT is a highly complicated test, which only under very well controlled...... circumstances will yield the true fracture mechanical properties. It is also shown that both the three point bending test and the WST are well-suited substitutes for the uniaxial tension test.......This paper describes and compares three different fracture mechanical test methods; the uniaxial tension test (UTT), the three point bending test (TPBT) and the wedge splitting test (WST). Potentials and problems with the test methods will be described with regard to the experiment...

  14. Comparison of Quantitative Antifungal Testing Methods for Textile Fabrics.

    Science.gov (United States)

    Imoto, Yasuo; Seino, Satoshi; Nakagawa, Takashi; Yamamoto, Takao A

    2017-01-01

     Quantitative antifungal testing methods for textile fabrics under growth-supportive conditions were studied. Fungal growth activities on unfinished textile fabrics and textile fabrics modified with Ag nanoparticles were investigated using the colony counting method and the luminescence method. Morphological changes of the fungi during incubation were investigated by microscopic observation. Comparison of the results indicated that the fungal growth activity values obtained with the colony counting method depended on the morphological state of the fungi on textile fabrics, whereas those obtained with the luminescence method did not. Our findings indicated that unique characteristics of each testing method must be taken into account for the proper evaluation of antifungal activity.

  15. Methods of Usability Testing in Libraries Web Sites

    Directory of Open Access Journals (Sweden)

    Eman Fawzy

    2006-03-01

    Full Text Available A Study about libraries' web sites evaluation, that is the Usability, the study talking about methods of usability testing and define it, and its important in web sites evaluation, then details the methods of usability: questionnaire, core groups, testing experimental model, cards arrangement, and composed evaluation.

  16. Downregulation of NF-ΚB1 enhances the radiosensitivity of renal cell carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Ikegami, Amanda; Silva, Luiz Felipe Teixeira da; Bellini, Maria Helena [Instituto De Pesquisas Energéticas e Nucleares (IPEN/CNEN-SP), São Paulo, SP (Brazil)

    2017-07-01

    Full text: Introduction: Clear cell renal cell carcinoma (ccRCC) accounts for ∼80% of all renal cell carcinomas (RCC) and has the Von Hippel-Lindau (VHL) tumor suppressor gene mutated. The lack of VHL protein leads to a constitutionally active Hypoxia Inducible Factor (HIF) pathway that confers both chemoresistance and radioresistance for renal tumor. HIF pathway is known to interact with the transcription factor nuclear factor kappa B (NF-kB). Increased NF-κB activity is associated with the development and progression of RCC (IKEGAMI A, TEIXEIRA LF. BRAGA MS et al. The American Society for Cell Biology 2016; 26: 3948-3955). Objective: Evaluate the synergistic effect of NF-kB1 knockdown and ionizing radiation in murine renal adenocarcinoma cell line. Methods: The murine renal adenocarcinoma cell line (Renca cells) (ATCC, USA) was cultured in RPMI 1640 supplemented with 10% FBS and penicillin/streptomycin. Lentiviral shRNA vector was used to knockdown of NF-KB1 gene in Renca cells, as described previously (1). In the clonogenic cell survival assay, the cells were irradiated by {sup 60}Co source in the range from 0 to 10 Gy, using the GammaCell 220 – Irradiation Unit of Canadian-Atomic Energy Commision Ltd. (CTR-IPEN). After 10-14 days of culture, cell colonies were fixed and stained with formaldehyde 4% and rhodamine B 2% and counted. To assess cell viability, tetrazolium [3-(4,5-dimethylthiazol-2-yl)-5- (3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-MTS] was performed within 24 hours after irradiation at a dose of 10Gy. The survival variables α e β were fitted according to the linear quadratic equation (SF=exp[-αD-βD2]); SF=survival fraction, D=dose of irradiation and P value was determined by F test. Multiple comparisons were assessed by One-way ANOVA followed by Bonferroni´s tests with GraphPad Prism version 6.0 software. P< 0.05 was considered statistically significant. Data are shown as the mean ± SD. Results: The Renca-shRNA-NF-kB1 cells were found

  17. Application of Bayesian Methods for Detecting Fraudulent Behavior on Tests

    Science.gov (United States)

    Sinharay, Sandip

    2018-01-01

    Producers and consumers of test scores are increasingly concerned about fraudulent behavior before and during the test. There exist several statistical or psychometric methods for detecting fraudulent behavior on tests. This paper provides a review of the Bayesian approaches among them. Four hitherto-unpublished real data examples are provided to…

  18. Test methods for protective footwear against AP mine blast

    NARCIS (Netherlands)

    Cronin, D.S.; Williams, K.; Bass, C.R.; Magnan, P.; Dosquet, F.; Bergeron, D.M.; Bree, J.L.M.J. van

    2003-01-01

    The testing and development of protective footwear for anti-personnel landmine blast threats is of great importance to civilian and military deminers, and peacekeepers. This study will review the wide range of test methods that have been developed by NATO countries to test footwear against the

  19. Evaluation of methods to leak test sealed radiation sources

    International Nuclear Information System (INIS)

    Arbeau, N.D.; Scott, C.K.

    1987-04-01

    The methods for the leak testing of sealed radiation sources were reviewed. One hundred and thirty-one equipment vendors were surveyed to identify commercially available leak test instruments. The equipment is summarized in tabular form by radiation type and detector type for easy reference. The radiation characteristics of the licensed sources were reviewed and summarized in a format that can be used to select the most suitable detection method. A test kit is proposed for use by inspectors when verifying a licensee's test procedures. The general elements of leak test procedures are discussed

  20. A verification system survival probability assessment model test methods

    International Nuclear Information System (INIS)

    Jia Rui; Wu Qiang; Fu Jiwei; Cao Leituan; Zhang Junnan

    2014-01-01

    Subject to the limitations of funding and test conditions, the number of sub-samples of large complex system test less often. Under the single sample conditions, how to make an accurate evaluation of the performance, it is important for reinforcement of complex systems. It will be able to significantly improve the technical maturity of the assessment model, if that can experimental validation and evaluation model. In this paper, a verification system survival probability assessment model test method, the method by the test system sample test results, verify the correctness of the assessment model and a priori information. (authors)

  1. Test Methods for Characterising Ore Comminution Behavior in Geometallurgy

    OpenAIRE

    Mwanga, Abdul

    2014-01-01

    Comminution test methods used within mineral processing have mainly been developed for selecting the most appropriate comminution technology for a given ore, designing a grinding circuit as well as sizing the equipment needed. Existing test methods usually require comparatively large sample amounts and are time-consuming to conduct. This makes comprehensive testing of ore comminution behavior – as required in the geometallurgical context – quite expensive. Currently the main interest in the c...

  2. High Expression of Stromal Cell-Derived Factor 1 (SDF-1) and NF-κB Predicts Poor Prognosis in Cervical Cancer.

    Science.gov (United States)

    Song, Zhiwang; Zhang, Xia; Ye, Xiaojuan; Feng, Chan; Yang, Guang; Lu, Yonglin; Lin, Yun; Dong, Chunyan

    2017-01-11

    BACKGROUND SDF-1 and NF-κB are associated with the prognosis of a wide range of cancers, but their value in cervical cancer remains controversial. The aim of this study was to investigate the expression of SDF-1and NF-κB in cervical cancer and their significance in clinical prognosis. MATERIAL AND METHODS The expression of SDF-1and NF-κB in 105 formalin-fixed, paraffin-embedded cervical cancer tissues and the adjacent tissues was examined by immunohistochemistry (IHC). The results were semi-quantitatively scored and analyzed by chi-square test. The overall survival times (OS) were collected by follow-up and analyzed by Kaplan-Meier analysis. RESULTS The expression level of both SDF-1and NF-κB in cervical cancer are higher than that in the adjacent tissues (PSDF-1 expression are correlated with tumor size and FIGO histology grade (PSDF-1or NF-κB tended to have much shorter survival time than patients with negative expression. In addition, multivariate Cox regression analysis demonstrated that SDF-1 expression and lymph node metastasis are independent predictors of the OS in cervical cancer patients. CONCLUSIONS The expression of SDF-1 is significantly associated with tumor size and FIGO histology grade. The expression of NF-κB is significantly associated with tumor size, FIGO histology grade, and lymph node metastasis. The positive SDF-1or NF-κB expression is significantly correlated with poor prognosis. These may be valuable biomarkers for the prognosis and the potential therapeutic targets of cervical cancer.

  3. Methods for testing of geometrical down-scaled rotor blades

    DEFF Research Database (Denmark)

    Branner, Kim; Berring, Peter

    as requirements for experimental facilities are very demanding and furthermore the time for performing the experimental test campaign and the cost are not well suitable for most research projects. This report deals with the advantages, disadvantages and open questions of using down-scaled testing on wind turbine......Full scale fatigue test is an important part of the development and design of wind turbine blades. Testing is also needed for the approval of the blades in order for them to be used on large wind turbines. Fatigue test of wind turbine blades was started in the beginning of the 1980s and has been...... further developed since then. Structures in composite materials are generally difficult and time consuming to test for fatigue resistance. Therefore, several methods for testing of blades have been developed and exist today. Those methods are presented in [1]. Current experimental test performed on full...

  4. Test methods for protective footwear against AP mine blast

    OpenAIRE

    Cronin, D.S.; Williams, K.; Bass, C.R.; Magnan, P.; Dosquet, F.; Bergeron, D.M.; Bree, J.L.M.J. van

    2003-01-01

    The testing and development of protective footwear for anti-personnel landmine blast threats is of great importance to civilian and military deminers, and peacekeepers. This study will review the wide range of test methods that have been developed by NATO countries to test footwear against the effects of anti-personnel blast mines. Experimental testing requires the definition of a threat and a means of assessing the expected trauma to the human leg. The latter is accomplished with various phy...

  5. Evaluation of snubber functional test methods: Tier 1

    International Nuclear Information System (INIS)

    Brown, D.P.

    1993-07-01

    The objective of the research is to establish technical bases in support of efforts on the part of the Snubber Utility Group (SNUG) and the Subsection ISTD Working Group of the ASME O ampersand M Code in developing guidelines and methodologies for snubber functional testing to ensure that snubbers are tested in a manner that ensures reliable and meaningful test results. The methodology used in this research includes both a review of available industry information as well as the testing of different snubber models using various test machines. Information is provided pertaining to current industry practices in regard to snubber testing including recommended test procedures, technical description of various test machines, and the number and types of snubbers used in the nuclear power industry. A review of previous test methodology research conducted by the Snubber Utility Group is also included. The effects of variations in controllable test parameters on snubber test results are discussed. Also included are the results of confirmatory tests in which various snubber models were tested using various test machines. Recommendations are provided for standard test methods to be included in Subsection ISTD of the ASME O ampersand M Code [4]. General information and recommendations are provided that may be used by utility personnel in specifying snubber test equipment that is most suited for plant-specific needs as well as information that may be effectively used in the review and interpretation of test results

  6. 40 CFR 264.1063 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... CFR part 60. (2) The detection instrument shall meet the performance criteria of Reference Method 21... determined as set forth in Reference Method 21. (3) The instrument probe shall be traversed around all... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Test methods and procedures. 264.1063...

  7. Evaluation of Test Method for Solar Collector Efficiency

    DEFF Research Database (Denmark)

    Fan, Jianhua; Shah, Louise Jivan; Furbo, Simon

    on these efficiencies, an efficiency equation is determined by regression analysis. In the test method, there are no requirements on the ambient air temperature and the sky temperature. The paper will present an evaluation of the test method for a 12.5 m² flat plate solar collector panel from Arcon Solvarme A....../S. The solar collector panel investigated has 16 parallel connected horizontal absorber fins. CFD (Computational Fluid Dynamics) simulations, calculations with a solar collector simulation program SOLEFF (Rasmussen and Svendsen, 1996) and thermal experiments are carried out in the investigation......The test method of the standard EN12975-2 (European Committee for Standardization, 2004) is used by European test laboratories to determine the efficiency of solar collectors. In the test methods the mean solar collector fluid temperature in the solar collector, Tm is determined by the approximated...

  8. New methods of testing nonlinear hypothesis using iterative NLLS estimator

    Science.gov (United States)

    Mahaboob, B.; Venkateswarlu, B.; Mokeshrayalu, G.; Balasiddamuni, P.

    2017-11-01

    This research paper discusses the method of testing nonlinear hypothesis using iterative Nonlinear Least Squares (NLLS) estimator. Takeshi Amemiya [1] explained this method. However in the present research paper, a modified Wald test statistic due to Engle, Robert [6] is proposed to test the nonlinear hypothesis using iterative NLLS estimator. An alternative method for testing nonlinear hypothesis using iterative NLLS estimator based on nonlinear hypothesis using iterative NLLS estimator based on nonlinear studentized residuals has been proposed. In this research article an innovative method of testing nonlinear hypothesis using iterative restricted NLLS estimator is derived. Pesaran and Deaton [10] explained the methods of testing nonlinear hypothesis. This paper uses asymptotic properties of nonlinear least squares estimator proposed by Jenrich [8]. The main purpose of this paper is to provide very innovative methods of testing nonlinear hypothesis using iterative NLLS estimator, iterative NLLS estimator based on nonlinear studentized residuals and iterative restricted NLLS estimator. Eakambaram et al. [12] discussed least absolute deviation estimations versus nonlinear regression model with heteroscedastic errors and also they studied the problem of heteroscedasticity with reference to nonlinear regression models with suitable illustration. William Grene [13] examined the interaction effect in nonlinear models disused by Ai and Norton [14] and suggested ways to examine the effects that do not involve statistical testing. Peter [15] provided guidelines for identifying composite hypothesis and addressing the probability of false rejection for multiple hypotheses.

  9. The Iosipescu shear test method as used for testing polymers and composite materials

    Science.gov (United States)

    Adams, Donald F.

    1990-01-01

    This paper describes a shear test method for polymers and composite materials, based on the Iosipescu (1967) shear test which was originally developed for use with homogeneous isotropic metals. Special attention is given to the loading fixture for the test, the standard specimen design and shear stress measurements. The range of the test applications is indicated. The method is in the final stages of being accepted as an ASTM standard.

  10. The influence of technical testing methods on perceptions of constructions

    International Nuclear Information System (INIS)

    Oestberg, Gustaf

    2002-01-01

    In principle, methods of testing the reliability and safety of constructions are designed with the aim of representing critical conditions for their use. Because of variations within technical systems, including the one for which a certain test was once developed, the validity of the method also varies. The adoption of a standardized test for different applications had to be based on the assumption that the test deals adequately with a real situation. As a consequence of this acceptance of a trustworthy relationship between test and reality, an imprint of the former on the latter occurs. This effect may even cause the perception of a reality to be defined by the corresponding test. Examples of such an influence may be found in the field of materials testing. Related phenomena can be dealt with by reference to current concepts of cognitive science and psychology of the perception of images

  11. Accelerated Test Method for Corrosion Protective Coatings Project

    Science.gov (United States)

    Falker, John; Zeitlin, Nancy; Calle, Luz

    2015-01-01

    This project seeks to develop a new accelerated corrosion test method that predicts the long-term corrosion protection performance of spaceport structure coatings as accurately and reliably as current long-term atmospheric exposure tests. This new accelerated test method will shorten the time needed to evaluate the corrosion protection performance of coatings for NASA's critical ground support structures. Lifetime prediction for spaceport structure coatings has a 5-year qualification cycle using atmospheric exposure. Current accelerated corrosion tests often provide false positives and negatives for coating performance, do not correlate to atmospheric corrosion exposure results, and do not correlate with atmospheric exposure timescales for lifetime prediction.

  12. Alternative methods for ocular toxicology testing: validation, applications and troubleshooting.

    Science.gov (United States)

    Dholakiya, Sanjay L; Barile, Frank A

    2013-06-01

    Humanitarian concern, scientific progress and legislative action have lead to the development, validation and regulatory acceptance of alternative in vitro ocular models. However, to date not a single in vitro alternative ocular toxicity test has been validated as a full replacement for the in vivo Draize rabbit eye test for all classes of chemicals across whole irritancy ranges. Since the 1990s, ocular alternative methods have been validated but few have been accepted for regulatory purposes. These assays include: organotypic models, such as the bovine corneal opacity and permeability (BCOP) assay, the isolated chicken eye (ICE) test method and cell function-based in vitro assays, such as the cytosensor microphysiometer (CM) and the fluorescein leakage (FL) test methods. Some refinements to in vivo testing methods have been accepted by regulatory agencies, including humane endpoints to avoid or minimize pain and distress. The authors provide a review of the background, protocol overview, applications and their validation status of the tier-testing approach. Furthermore, the authors provide expert analysis and provide their perspective on this approach and potential future developments. In the search for a battery of methods that replaces the in vivo Draize test, it is necessary to prioritize techniques, define related mechanisms and justify statistical approaches. Overall, only when the reliability and relevance of a method is unequivocally supported will any technique be ready for regulatory acceptance.

  13. Comparison of high efficiency particulate filter testing methods

    International Nuclear Information System (INIS)

    1985-01-01

    High Efficiency Particulate Air (HEPA) filters are used for the removal of submicron size particulates from air streams. In nuclear industry they are used as an important engineering safeguard to prevent the release of air borne radioactive particulates to the environment. HEPA filters used in the nuclear industry should therefore be manufactured and operated under strict quality control. There are three levels of testing HEPA filters: i) testing of the filter media; ii) testing of the assembled filter including filter media and filter housing; and iii) on site testing of the complete filter installation before putting into operation and later for the purpose of periodic control. A co-ordinated research programme on particulate filter testing methods was taken up by the Agency and contracts were awarded to the Member Countries, Belgium, German Democratic Republic, India and Hungary. The investigations carried out by the participants of the present co-ordinated research programme include the results of the nowadays most frequently used HEPA filter testing methods both for filter medium test, rig test and in-situ test purposes. Most of the experiments were carried out at ambient temperature and humidity, but indications were given to extend the investigations to elevated temperature and humidity in the future for the purpose of testing the performance of HEPA filter under severe conditions. A major conclusion of the co-ordinated research programme was that it was not possible to recommend one method as a reference method for in situ testing of high efficiency particulate air filters. Most of the present conventional methods are adequate for current requirements. The reasons why no method is to be recommended were multiple, ranging from economical aspects, through incompatibility of materials to national regulations

  14. Standard Test Method for Saltwater Pressure Immersion and Temperature Testing of Photovoltaic Modules for Marine Environments

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method provides a procedure for determining the ability of photovoltaic modules to withstand repeated immersion or splash exposure by seawater as might be encountered when installed in a marine environment, such as a floating aid-to-navigation. A combined environmental cycling exposure with modules repeatedly submerged in simulated saltwater at varying temperatures and under repetitive pressurization provides an accelerated basis for evaluation of aging effects of a marine environment on module materials and construction. 1.2 This test method defines photovoltaic module test specimens and requirements for positioning modules for test, references suitable methods for determining changes in electrical performance and characteristics, and specifies parameters which must be recorded and reported. 1.3 This test method does not establish pass or fail levels. The determination of acceptable or unacceptable results is beyond the scope of this test method. 1.4 The values stated in SI units are to be ...

  15. In Silico Toxicology – Non-Testing Methods

    Science.gov (United States)

    Raunio, Hannu

    2011-01-01

    In silico toxicology in its broadest sense means “anything that we can do with a computer in toxicology.” Many different types of in silico methods have been developed to characterize and predict toxic outcomes in humans and environment. The term non-testing methods denote grouping approaches, structure–activity relationship, and expert systems. These methods are already used for regulatory purposes and it is anticipated that their role will be much more prominent in the near future. This Perspective will delineate the basic principles of non-testing methods and evaluate their role in current and future risk assessment of chemical compounds. PMID:21772821

  16. A role for NF-κB activity in skin hyperplasia and the development of keratoacanthomata in mice.

    Directory of Open Access Journals (Sweden)

    Brian Poligone

    Full Text Available BACKGROUND: Previous studies have implicated NF-κB signaling in both cutaneous development and oncogenesis. However, these studies have been limited in part by the lethality that results from extreme over- or under-expression of NF-κB in available mouse models. Even cre-driven tissue specific expression of transgenes, or targeted deletion of NF-κB can cause cell death. Therefore, the present study was undertaken to evaluate a novel mouse model of enhanced NF-κB activity in the skin. METHODS: A knock-in homologous recombination technique was utilized to develop a mouse model (referred to as PD mice with increased NF-κB activity. RESULTS: The data show that increased NF-κB activity leads to hyperproliferation and dysplasia of the mouse epidermis. Chemical carcinogenesis in the context of enhanced NF-κB activity promotes the development of keratoacanthomata. CONCLUSION: Our findings support an important role for NF-κB in keratinocyte dysplasia. We have found that enhanced NF-κB activity renders keratinocytes susceptible to hyperproliferation and keratoacanthoma (KA development but is not sufficient for transformation and SCC development. We therefore propose that NF-κB activation in the absence of additional oncogenic events can promote TNF-dependent, actinic keratosis-like dysplasia and TNF-independent, KAs upon chemical carcinogensis. These studies suggest that resolution of KA cannot occur when NF-κB activation is constitutively enforced.

  17. Methods and characteristics of assembly language software testing

    International Nuclear Information System (INIS)

    Wang Lingfang

    2001-01-01

    Single chip micro-controllers are widely implemented to the controlling and testing products in industrial controlling and national defence embedded controlling systems. The invalidation of the source programs could lead to the unreliability of the whole systems, even to cause fatal results. Therefore, software testing is the necessary measures to reduce the mistakes and to improve the quality of the software. In the paper, the development of the software testing is presented. The distinctions between the assembly language testing and those of the high level languages is introduced. And the essential flow and methods of software testing are discussed in detail

  18. Review of Artificial Abrasion Test Methods for PV Module Technology

    Energy Technology Data Exchange (ETDEWEB)

    Miller, David C. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Muller, Matt T. [National Renewable Energy Lab. (NREL), Golden, CO (United States); Simpson, Lin J. [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-08-01

    This review is intended to identify the method or methods--and the basic details of those methods--that might be used to develop an artificial abrasion test. Methods used in the PV literature were compared with their closest implementation in existing standards. Also, meetings of the International PV Quality Assurance Task Force Task Group 12-3 (TG12-3, which is concerned with coated glass) were used to identify established test methods. Feedback from the group, which included many of the authors from the PV literature, included insights not explored within the literature itself. The combined experience and examples from the literature are intended to provide an assessment of the present industry practices and an informed path forward. Recommendations toward artificial abrasion test methods are then identified based on the experiences in the literature and feedback from the PV community. The review here is strictly focused on abrasion. Assessment methods, including optical performance (e.g., transmittance or reflectance), surface energy, and verification of chemical composition were not examined. Methods of artificially soiling PV modules or other specimens were not examined. The weathering of artificial or naturally soiled specimens (which may ultimately include combined temperature and humidity, thermal cycling and ultraviolet light) were also not examined. A sense of the purpose or application of an abrasion test method within the PV industry should, however, be evident from the literature.

  19. Two micro fatigue test methods for irradiated materials

    International Nuclear Information System (INIS)

    Nunomura, Shigetomo; Noguchi, Shinji; Okamura, Yuichi; Kumai, Shinji

    1993-01-01

    This paper demonstrates two miniature fatigue test methods in response to the requirements of the fusion reactor wall materials development program. It is known that the fatigue strength evaluated by the axial loading test is independent of the specimen size, while that evaluated by the bend test or torsion test is dependent upon the size of specimen. The new type of gripping system for the axial, tension-tension, fatigue testing of TEM disk-size specimens that has been developed is described in this paper. An alignment tool assists in gripping the miniature specimen. The miniature tension-tension fatigue test method seems to provide reliable S-N curves for SUS304 and SUS316L stainless steels. An indentation method has also been developed to determine fatigue properties. A hard steel ball or ceramic ball was used for cyclically loading the specimen, and an S-N curve was subsequently obtained. The merit of this method is primarily simple handling. S-N curves obtained from four materials by this indentation method compared well with those obtained from the rotary bend fatigue test employing a standard-size specimen

  20. Methodical approaches to solving special problems of testing. Seminar papers

    International Nuclear Information System (INIS)

    1996-01-01

    This Seminar volume introduces concepts and applications from different areas of application of ultrasonic testing and other non-destructive test methods in 18 lectures, in order to give an idea of new trends in development and stimuli for special solutions to problems. 3 articles were recorded separately for the ENERGY data bank. (orig./MM) [de

  1. Fatigue testing of materials under extremal conditions by acoustic method

    NARCIS (Netherlands)

    Baranov, VM; Bibilashvili, YK; Karasevich, VA; Sarychev, GA

    2004-01-01

    Increasing fuel cycle time requires fatigue testing of the fuel clad materials for nuclear reactors. The standard high-temperature fatigue tests are complicated and tedious. Solving this task is facilitated by the proposed acoustic method, which ensures observation of the material damage dynamics,

  2. Cone Penetration Testing: A Sound Method for Urban Archaeological Prospection

    NARCIS (Netherlands)

    Koster, K.

    2015-01-01

    Cone Penetration Testing (CPT) is a geotechnical in situ site investigation method and is widely applied in urbanized areas of the Netherlands. Approximately 20,000 CPTs are conducted in the Netherlands each year. The frequency of such testing, and the presence of archaeological deposits within the

  3. An Analytical Procedure for the Equipercentile Method of Equating Tests.

    Science.gov (United States)

    Lindsay, Carl A.; Prichard, Mark A.

    Prior use of the equipercentile method of test equating was based on a graphic procedure which is tedious, subject to smoothing errors, and non-analytical. Recognition of the equipercentile method as a curve-fitting procedure for two cumulative percentage distributions leads to a proposed analytical solution to the problem through use of linear…

  4. Comparison of Methods for Estimating and Testing Latent Variable Interactions.

    Science.gov (United States)

    Moulder, Bradley C.; Algina, James

    2002-01-01

    Used simulation to compare structural equation modeling methods for estimating and testing hypotheses about an interaction between continuous variables. Findings indicate that the two-stage least squares procedure exhibited more bias and lower power than the other methods. The Jaccard-Wan procedure (J. Jaccard and C. Wan, 1995) and maximum…

  5. Test Method for Spalling of Fire Exposed Concrete

    DEFF Research Database (Denmark)

    Hertz, Kristian Dahl; Sørensen, Lars Schiøtt

    2005-01-01

    A new material test method is presented for determining whether or not an actual concrete may suffer from explosive spalling at a specified moisture level. The method takes into account the effect of stresses from hindered thermal expansion at the fire-exposed surface. Cylinders are used, which...

  6. Test method for spalling of fire exposed concrete

    DEFF Research Database (Denmark)

    Sørensen, Lars Schiøtt

    2005-01-01

    A new material test method is presented for determining whether or not an actual concrete may suffer from explosive spalling at a specified moisture level. The method takes into account the effect of stresses from hindered thermal expansion at the fire-exposed surface. Cylinders are used, which...

  7. 40 CFR 60.46 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... material balance over the steam generating system shall be used to confirm the rate. (d) The owner or...-Fired Steam Generators for Which Construction Is Commenced After August 17, 1971 § 60.46 Test methods... D2015, or D5865 (solid fuels), D240 (liquid fuels), or D1826 (gaseous fuels) (all of these methods are...

  8. Solubility tests and the peripheral blood film method for screening ...

    African Journals Online (AJOL)

    Objective. To determine the cost benefit of screening for sicklecell disease among infants at district health centres in Uganda using sickling, solubility tests and the peripheral blood film method. Methods. Pilot screening services were established at district health centres. Cost benefit analysis (CBA) was performed in four ...

  9. Study on method of data standardization in interferometric testing

    Science.gov (United States)

    Chen, Wei

    2010-10-01

    As a rule, Interferometers are used to test the figure in the polishing phase of optical component, it could provide advance tutor suggestion for manufacturing. It is unable to get the whole wave-front interferogram usually because phase-shift Interferometry is sensitive to environment vibration, so the exactly interference data of the optical surface could not be obtained. Various spatial point on the tested optical component will be given by calculation method about arithmetic average value of equal accuracy is provied. This paper describes the testing results of optical components in size Φ1200mm, it is proved the method could eliminate the vibration effectively and get the standardization data.

  10. Method and apparatus for tensile testing of metal foil

    Science.gov (United States)

    Wade, O. W. (Inventor)

    1976-01-01

    A method for obtaining accurate and reproducible results in the tensile testing of metal foils in tensile testing machines is described. Before the test specimen are placed in the machine, foil side edges are worked until they are parallel and flaw free. The specimen are also aligned between and secured to grip end members. An aligning apparatus employed in the method is comprised of an alignment box with a longitudinal bottom wall and two upright side walls, first and second removable grip end members at each end of the box, and a means for securing the grip end members within the box.

  11. Standard test methods for rockwell hardness of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 These test methods cover the determination of the Rockwell hardness and the Rockwell superficial hardness of metallic materials by the Rockwell indentation hardness principle. This standard provides the requirements for Rockwell hardness machines and the procedures for performing Rockwell hardness tests. 1.2 This standard includes additional requirements in annexes: Verification of Rockwell Hardness Testing Machines Annex A1 Rockwell Hardness Standardizing Machines Annex A2 Standardization of Rockwell Indenters Annex A3 Standardization of Rockwell Hardness Test Blocks Annex A4 Guidelines for Determining the Minimum Thickness of a Test Piece Annex A5 Hardness Value Corrections When Testing on Convex Cylindrical Surfaces Annex A6 1.3 This standard includes nonmandatory information in appendixes which relates to the Rockwell hardness test. List of ASTM Standards Giving Hardness Values Corresponding to Tensile Strength Appendix X1 Examples of Procedures for Determining Rockwell Hardness Uncertainty Appendix X...

  12. Standard test methods for rockwell hardness of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2011-01-01

    1.1 These test methods cover the determination of the Rockwell hardness and the Rockwell superficial hardness of metallic materials by the Rockwell indentation hardness principle. This standard provides the requirements for Rockwell hardness machines and the procedures for performing Rockwell hardness tests. 1.2 This standard includes additional requirements in annexes: Verification of Rockwell Hardness Testing Machines Annex A1 Rockwell Hardness Standardizing Machines Annex A2 Standardization of Rockwell Indenters Annex A3 Standardization of Rockwell Hardness Test Blocks Annex A4 Guidelines for Determining the Minimum Thickness of a Test Piece Annex A5 Hardness Value Corrections When Testing on Convex Cylindrical Surfaces Annex A6 1.3 This standard includes nonmandatory information in appendixes which relates to the Rockwell hardness test. List of ASTM Standards Giving Hardness Values Corresponding to Tensile Strength Appendix X1 Examples of Procedures for Determining Rockwell Hardness Uncertainty Appendix X...

  13. A new method for aerodynamic test of high altitude propellers

    Directory of Open Access Journals (Sweden)

    Xiying Gong

    Full Text Available A ground test system is designed for aerodynamic performance tests of high altitude propellers. The system is consisted of stable power supply, servo motors, two-component balance constructed by tension-compression sensors, ultrasonic anemometer, data acquisition module. It is loaded on a truck to simulate propellers’ wind-tunnel test for different wind velocities at low density circumstance. The graphical programming language LABVIEW for developing virtual instrument is used to realize the test system control and data acquisition. Aerodynamic performance test of a propeller with 6.8 m diameter was completed by using this system. The results verify the feasibility of the ground test method. Keywords: High altitude propeller, Ground test, Virtual instrument control system

  14. Standard Test Method for Contamination Outgassing Characteristics of Spacecraft Materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This test method covers a technique for generating data to characterize the kinetics of the release of outgassing products from materials. This technique will determine both the total mass flux evolved by a material when exposed to a vacuum environment and the deposition of this flux on surfaces held at various specified temperatures. 1.2 This test method describes the test apparatus and related operating procedures for evaluating the total mass flux that is evolved from a material being subjected to temperatures that are between 298 and 398 K. Pressures external to the sample effusion cell are less than 7 × 10−3 Pa (5 × 10−5 torr). Deposition rates are measured during material outgassing tests. A test procedure for collecting data and a test method for processing and presenting the collected data are included. 1.3 This test method can be used to produce the data necessary to support mathematical models used for the prediction of molecular contaminant generation, migration, and deposition. 1.4 Al...

  15. Alternative methods for the replacement of eye irritation testing.

    Science.gov (United States)

    Lotz, Christian; Schmid, Freia F; Rossi, Angela; Kurdyn, Szymon; Kampik, Daniel; De Wever, Bart; Walles, Heike; Groeber, Florian K

    2016-01-01

    In the last decades significant regulatory attempts were made to replace, refine and reduce animal testing to assess the risk of consumer products for the human eye. As the original in vivo Draize eye test has been criticized for limited predictivity, costs and ethical issues, several animal-free test methods have been developed to categorize substances according to the global harmonized system (GHS) for eye irritation.This review summarizes the progress of alternative test methods for the assessment of eye irritation. Based on the corneal anatomy and the current knowledge of the mechanisms causing eye irritation, different ex vivo and in vitro methods will be presented and discussed in regard of possible limitations and their status of regulatory acceptance. In addition to established in vitro models, this review will also highlight emerging, full thickness cornea models that might be applicable to predict all GHS categories.

  16. Standard test methods for notched bar impact testing of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2007-01-01

    1.1 These test methods describe notched-bar impact testing of metallic materials by the Charpy (simple-beam) test and the Izod (cantilever-beam) test. They give the requirements for: test specimens, test procedures, test reports, test machines (see Annex A1) verifying Charpy impact machines (see Annex A2), optional test specimen configurations (see Annex A3), precracking Charpy V-notch specimens (see Annex A4), designation of test specimen orientation (see Annex A5), and determining the percent of shear fracture on the surface of broken impact specimens (see Annex A6). In addition, information is provided on the significance of notched-bar impact testing (see Appendix X2), methods of measuring the center of strike (see Appendix X2). 1.2 These test methods do not address the problems associated with impact testing at temperatures below -196 C (-320 F, 77 K). 1.3 The values stated in SI units are to be regarded as the standard. Inch-pound units are provided for information only. This standard does not purpor...

  17. Testing methods of steel wi re ropes at the anchor

    Directory of Open Access Journals (Sweden)

    Stanislav Kropuch

    2012-12-01

    Full Text Available The present paper introduces an application of the acoustic andthermographic method in the defectoscopic testing of immobilesteel wire ropes at the most critical point, the anchor. Firstmeasurements and their results by these new defectoscopic methodsare shown. In defectoscopic tests at the anchor, the widelyused magnetic method gives unreliable results, and therefore presentsa problem for steel wire defectoscopy. Application of the two new methods in the steel wire defectoscopy at the anchor point will enableincreased safety measures at the anchor of steel wire ropes in bridge, roof, tower and aerial cable lift constructions.

  18. Qualitative theory testing as mixed-method research

    OpenAIRE

    Piper, Stewart

    2006-01-01

    While the concept of mixed-methods research is more usually associated with combining\\ud quantitative and qualitative approaches, this paper outlines a study that mixed methods by\\ud undertaking qualitative theory testing and derivation when examining the relationship between\\ud health promotion theory and hospital nursing practice. Thus, it is concerned with relating the\\ud metatheoretical aspects of the debate and not with the pragmatic aspects of the research and\\ud concomitant methods. A ...

  19. NNWSI waste form test method for unsaturated disposal conditions

    International Nuclear Information System (INIS)

    Bates, J.K.; Gerding, T.J.

    1985-03-01

    A test method has been developed to measure the release of radionuclides from the waste package under simulated NNWSI repository conditions, and to provide information concerning materials interactions that may occur in the repository. Data are presented from Unsaturated testing of simulated Savannah River Laboratory 165 glass completed through 26 weeks. The relationship between these results and those from parametric and analog testing are described. The data indicate that the waste form test is capable of producing consistent, reproducible results that will be useful in evaluating the role of the waste package in the long-term performance of the repository. 6 refs., 7 figs., 5 tabs

  20. Interesting Developments in Testing Methods Applied to Foundation Piles

    Science.gov (United States)

    Sobala, Dariusz; Tkaczyński, Grzegorz

    2017-10-01

    Both: piling technologies and pile testing methods are a subject of current development. New technologies, providing larger diameters or using in-situ materials, are very demanding in terms of providing proper quality of execution of works. That concerns the material quality and continuity which define the integral strength of pile. On the other side we have the capacity of the ground around the pile and its ability to carry the loads transferred by shaft and pile base. Inhomogeneous nature of soils and a relatively small amount of tested piles imposes very good understanding of small amount of results. In some special cases the capacity test itself form an important cost in the piling contract. This work presents a brief description of selected testing methods and authors remarks based on cooperation with Universities constantly developing new ideas. Paper presents some experience based remarks on integrity testing by means of low energy impact (low strain) and introduces selected (Polish) developments in the field of closed-end pipe piles testing based on bi-directional loading, similar to Osterberg idea, but without sacrificial hydraulic jack. Such test is suitable especially when steel piles are used for temporary support in the rivers, where constructing of conventional testing appliance with anchor piles or kentledge meets technical problems. According to the author’s experience, such tests were not yet used on the building site but they bring a real potential especially, when the displacement control can be provided from the river bank using surveying techniques.

  1. Bupleurum chinense Roots: a Bioactivity-Guided Approach toward Saponin-Type NF-κB Inhibitors.

    Science.gov (United States)

    Liu, Xin; Latkolik, Simone; Atanasov, Atanas G; Kunert, Olaf; Pferschy-Wenzig, Eva-Maria; Heiss, Elke H; Malainer, Clemens; Schinkovitz, Andreas; Kollroser, Manfred; Dirsch, Verena M; Bauer, Rudolf

    2017-10-01

    The roots of Bupleurum chinense have a long history in traditional medicine to treat infectious diseases and inflammatory disorders. Two major compounds, saikosaponins A and D, were reported to exert potent anti-inflammatory activity by inhibiting NF- κ B. In the present study, we isolated new saikosaponin analogues from the roots of B. chinese interfering with NF- κ B activity in vitro . The methanol-soluble fraction of the dichloromethane extract of Radix Bupleuri was subjected to activity-guided isolation yielding 18 compounds, including triterpenoids and polyacetylenes. Their structures were determined by spectroscopic methods as saikogenin D ( 1 ), prosaikogenin D ( 2 ), saikosaponins B 2 ( 3 ), W ( 4 ), B 1 ( 5 ), Y ( 6 ), D ( 7 ), A ( 8 ), E ( 9 ), B 4 ( 10 ), B 3 ( 11 ), and T ( 12 ), saikodiyne A ( 13 ), D ( 14 ), E ( 15 ) and F ( 16 ), falcarindiol ( 17 ), and 1-linoleoyl-sn-glycero-3-phosphorylcholine ( 18 ). Among them, 4, 15 , and 16 are new compounds, whereas 6, previously described as a semi-synthetic compound, is isolated from a natural source for the first time, and 13 - 17 are the first reports of polyacetylenes from this plant. Nine saponins/triterpenoids were tested for inhibition of NF- κ B signaling in a cell-based NF- κ B-dependent luciferase reporter gene model in vitro . Five of them ( 1, 2, 4, 6 , and 8 ) showed strong (> 50%, at 30 µM) NF- κ B inhibition, but also varying degrees of cytotoxicity, with compounds 1 and 4 (showing no significant cytotoxicity) presenting IC 50 values of 14.0 µM and 14.1 µM in the cell-based assay, respectively. Georg Thieme Verlag KG Stuttgart · New York.

  2. Bootstrap method of interior-branch test for phylogenetic trees.

    Science.gov (United States)

    Sitnikova, T

    1996-04-01

    Statistical properties of the bootstrap test of interior branch lengths of phylogenetic trees have been studied and compared with those of the standard interior-branch test in computer simulations. Examination of the properties of the tests under the null hypothesis showed that both tests for an interior branch of a predetermined topology are quite reliable when the distribution of the branch length estimate approaches a normal distribution. Unlike the standard interior-branch test, the bootstrap test appears to retain this property even when the substitution rate varies among sites. In this case, the distribution of the branch length estimate deviates from a normal distribution, and the standard interior-branch test gives conservative confidence probability values. A simple correction method was developed for both interior-branch tests to be applied for testing the reliability of tree topologies estimated from sequence data. This correction for the standard interior-branch test appears to be as effective as that obtained in our previous study, though it is much simpler. The bootstrap and standard interior-branch tests for estimated topologies become conservative as the number of sequence groups in a star-like tree increases.

  3. Verification methods for treaties limiting and banning nuclear tests

    International Nuclear Information System (INIS)

    Voloshin, N.P.

    1998-01-01

    Treaty on limitation of underground nuclear weapon tests and treaty on world banning of nuclear tests contribute to and accompany the process of nuclear disarmament. Test ban in three (Moscow treaty of 1963) as well as the Threshold Test Ban up to 1991 was controlled only with national means. But since 1991 nuclear test threshold of 150 kt has been measured with hydrodynamic and tele seismic methods and checked by the inspection. Distinctive feature of this control is that control is that it is bilateral. This conforms to Treaty on limitation of underground nuclear weapon tests signed by two countries - USA and USSR. The inspection at the place of tests requires monitoring of the test site of the party conducting a test and geological information of rock in the area of explosion. In the treaty of the World Nuclear Test Ban the following ways of international control are provided for: - seismologic measurements; - radionuclide measurements; - hydro-acoustics measurements; - infra-sound measurements; - inspection at the place of the tests conduction

  4. Standard test method for conducting erosion tests by solid particle impingement using gas jets

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2007-01-01

    1.1 This test method covers the determination of material loss by gas-entrained solid particle impingement erosion with jetnozzle type erosion equipment. This test method may be used in the laboratory to measure the solid particle erosion of different materials and has been used as a screening test for ranking solid particle erosion rates of materials in simulated service environments (1,2 ). Actual erosion service involves particle sizes, velocities, attack angles, environments, and so forth, that will vary over a wide range (3-5). Hence, any single laboratory test may not be sufficient to evaluate expected service performance. This test method describes one well characterized procedure for solid particle impingement erosion measurement for which interlaboratory test results are available. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determi...

  5. Standard Test Method for Cavitation Erosion Using Vibratory Apparatus

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers the production of cavitation damage on the face of a specimen vibrated at high frequency while immersed in a liquid. The vibration induces the formation and collapse of cavities in the liquid, and the collapsing cavities produce the damage to and erosion (material loss) of the specimen. 1.2 Although the mechanism for generating fluid cavitation in this method differs from that occurring in flowing systems and hydraulic machines (see 5.1), the nature of the material damage mechanism is believed to be basically similar. The method therefore offers a small-scale, relatively simple and controllable test that can be used to compare the cavitation erosion resistance of different materials, to study in detail the nature and progress of damage in a given material, or—by varying some of the test conditions—to study the effect of test variables on the damage produced. 1.3 This test method specifies standard test conditions covering the diameter, vibratory amplitude and frequency of the...

  6. Comparative study of durability test methods for pellets and briquettes

    Energy Technology Data Exchange (ETDEWEB)

    Temmerman, Michaeel; Rabier, Fabienne [Centre wallon de Recherches agronomiques (CRA-W), 146, chaussee de Namur, B-5030, Gembloux (Belgium); Jensen, Peter Daugbjerg [Forest and Landscape, The Royal Veterinary and Agricultural University, Rolighedsvej 23, DK-1958 Frederiksberg C (Denmark); Hartmann, Hans; Boehm, Thorsten [Technologie- und Foerderzentrum fuer Nachwachsende Rohstoffe-TFZ, Schulgasse 18, D-94315 Straubing (Germany)

    2006-11-15

    Different methods for the determination of the mechanical durability (DU) of pellets and briquettes were compared by international round robin tests including different laboratories. The DUs of five briquette and 26 pellet types were determined. For briquettes, different rotation numbers of a prototype tumbler and a calculated DU index are compared. For pellets testing, the study compares two standard methods, a tumbling device according to ASAE S 269.4, the Lignotester according to ONORM M 7135 and a second tumbling method with a prototype tumbler. For the tested methods, the repeatability, the reproducibility and the required minimum number of replications to achieve given accuracy levels were calculated. Additionally, this study evaluates the relation between DU and particle density. The results show for both pellets and briquettes, that the measured DU values and their variability are influenced by the applied method. Moreover, the variability of the results depend on the biofuel itself. For briquettes of DU above 90%, five replications lead to an accuracy of 2%, while 39 replications are needed to achieve an accuracy of 10%, when briquettes of DU below 90% are tested. For pellets, the tumbling device described by the ASAE standard allows to reach acceptable accuracy levels (1%) with a limited number of replications. Finally, for the tested pellets and briquettes no relation between DU and particle density was found. (author)

  7. Standard Test Methods for Determining Mechanical Integrity of Photovoltaic Modules

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 These test methods cover procedures for determining the ability of photovoltaic modules to withstand the mechanical loads, stresses and deflections used to simulate, on an accelerated basis, high wind conditions, heavy snow and ice accumulation, and non-planar installation effects. 1.1.1 A static load test to 2400 Pa is used to simulate wind loads on both module surfaces 1.1.2 A static load test to 5400 Pa is used to simulate heavy snow and ice accumulation on the module front surface. 1.1.3 A twist test is used to simulate the non-planar mounting of a photovoltaic module by subjecting it to a twist angle of 1.2°. 1.1.4 A cyclic load test of 10 000 cycles duration and peak loading to 1440 Pa is used to simulate dynamic wind or other flexural loading. Such loading might occur during shipment or after installation at a particular location. 1.2 These test methods define photovoltaic test specimens and mounting methods, and specify parameters that must be recorded and reported. 1.3 Any individual mech...

  8. Standard Test Methods for Constituent Content of Composite Materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 These test methods determine the constituent content of composite materials by one of two approaches. Method I physically removes the matrix by digestion or ignition by one of seven procedures, leaving the reinforcement essentially unaffected and thus allowing calculation of reinforcement or matrix content (by weight or volume) as well as percent void volume. Method II, applicable only to laminate materials of known fiber areal weight, calculates reinforcement or matrix content (by weight or volume), and the cured ply thickness, based on the measured thickness of the laminate. Method II is not applicable to the measurement of void volume. 1.1.1 These test methods are primarily intended for two-part composite material systems. However, special provisions can be made to extend these test methods to filled material systems with more than two constituents, though not all test results can be determined in every case. 1.1.2 The procedures contained within have been designed to be particularly effective for ce...

  9. A novel test tube method of screening for hemoglobin E.

    Science.gov (United States)

    Tatu, T; Kasinrerk, W

    2012-02-01

    Hemoglobin (Hb) E is a β-structural variant common worldwide. This Hb disorder can form a compound heterozygous state with the β-thalassemia gene, leading to life-threatening hereditary hemolytic anemia, HbE/β-thalassemia. Screening of HbE has proven to be a challenging practice in prevention and control of the HbE/β-thalassemia. A novel test tube method for HbE screening using diethyl aminoethyl (DEAE)-cellulose resin was described. With the developed system, HbE/A(2) did not bind to the resin and remained dissolved in the supernatant, whereas other Hbs completely bound to the resin. The red color of the supernatant observed in the test tube indicated the presence of HbE. Colorless or markedly pale color of the supernatant indicates the absence of HbE. Accuracy and efficiency of the established method in detecting HbE was comparable with the standard cellulose acetate electrophoresis method. The developed method is cheap and simple with no requirement of sophisticated equipment. The reagent could be stored at 4 °C for up to 5 months. Hemolysate samples aged up to 5 months were still suitable for this test. The described novel test tube method could be an alternative method of mass population screening for HbE, particularly in small health care facilities. © 2011 Blackwell Publishing Ltd.

  10. Cautionary notes on the use of NF-κB p65 and p50 antibodies for CNS studies

    Directory of Open Access Journals (Sweden)

    Listwak Samuel J

    2011-10-01

    Full Text Available Abstract Background The characterization and cellular localization of transcription factors like NF-κB requires the use of antibodies for western blots and immunohistochemistry. However, if target protein levels are low and the antibodies not well characterized, false positive data can result. In studies of NF-κB activity in the CNS, antibodies detecting NF-κB proteins have been used to support the finding that NF-κB is constitutively active in neurons, and activity levels are further increased by neurotoxic treatments, glutamate stimulation, or elevated synaptic activity. The specificity of the antibodies used was analyzed in this study. Methods Selectivity and nonselectivity of commonly used commercial and non-commercial p50 and p65 antibodies were demonstrated in western blot assays conducted in tissues from mutant gene knockout mice lacking the target proteins. Results A few antibodies for p50 and p65 each mark a single band at the appropriate molecular weight in gels containing proteins from wildtype tissue, and this band is absent in proteins from knockout tissues. Several antibodies mark proteins that are present in knockout tissues, indicating that they are nonspecific. These include antibodies raised against the peptide sequence containing the nuclear localization signals of p65 (MAB3026; Chemicon and p50 (sc-114; Santa Cruz. Some antibodies that recognize target proteins at the correct molecular weight still fail in western blot analysis because they also mark additional proteins and inconsistently so. We show that the criterion for validation by use of blocking peptides can still fail the test of specificity, as demonstrated for several antibodies raised against p65 phosphorylated at serine 276. Finally, even antibodies that show specificity in western blots produce nonspecific neuronal staining by immunohistochemistry. Conclusions We note that many of the findings in the literature about neuronal NF-κB are based on data garnered

  11. Antimicrobial resistance in campylobacter: susceptibility testing methods and resistance trends.

    Science.gov (United States)

    Ge, Beilei; Wang, Fei; Sjölund-Karlsson, Maria; McDermott, Patrick F

    2013-10-01

    Most Campylobacter infections are self-limiting but antimicrobial treatment (e.g., macrolides, fluoroquinolones) is necessary in severe or prolonged cases. Susceptibility testing continues to play a critical role in guiding therapy and epidemiological monitoring of resistance. The methods of choice for Campylobacter recommended by the Clinical and Laboratory Standards Institute (CLSI) are agar dilution and broth microdilution, while a disk diffusion method was recently standardized by the European Committee on Antimicrobial Susceptibility Testing (EUCAST). Macrolides, quinolones, and tetracyclines are among the common antimicrobials recommended for testing. Molecular determination of Campylobacter resistance via DNA sequencing or PCR-based methods has been performed. High levels of resistance to tetracycline and ciprofloxacin are frequently reported by many national surveillance programs, but resistance to erythromycin and gentamicin in Campylobacter jejuni remains low. Nonetheless, variations in susceptibility observed over time underscore the need for continued public health monitoring of Campylobacter resistance from humans, animals, and food. Published by Elsevier B.V.

  12. A New Static and Fatigue Compression Test Method for Composites

    DEFF Research Database (Denmark)

    Bech, Jakob Ilsted; Goutianos, Stergios; Løgstrup Andersen, Tom

    2011-01-01

    A new test method to determine the compressive properties of composite materials under both static and fatigue loading was developed. The novel fixture is based on the concept of transmitting the load by a fixed ratio of end-to-shear loading. The end-to-shear load ratio is kept fixed during...... the test through a mechanical mechanism, which automatically maintains the gripping pressure. The combined loading method has proven very efficient in static loading and is used in the new fixture which is specially designed for fatigue testing. Optimum gripping (shear loading) and alignment of the test...... coupon are achieved throughout the fatigue life. The fatigue strength obtained is more reliable because bending of the specimen due to poor gripping and alignment is minimised. The application of the new fixture to static and fatigue compression is demonstrated by using unidirectional carbon...

  13. NF-κB in Hematological Malignancies

    Directory of Open Access Journals (Sweden)

    Véronique Imbert

    2017-05-01

    Full Text Available NF-κB (Nuclear Factor Κ-light-chain-enhancer of activated B cells transcription factors are critical regulators of immunity, stress response, apoptosis, and differentiation. Molecular defects promoting the constitutive activation of canonical and non-canonical NF-κB signaling pathways contribute to many diseases, including cancer, diabetes, chronic inflammation, and autoimmunity. In the present review, we focus our attention on the mechanisms of NF-κB deregulation in hematological malignancies. Key positive regulators of NF-κB signaling can act as oncogenes that are often prone to chromosomal translocation, amplifications, or activating mutations. Negative regulators of NF-κB have tumor suppressor functions, and are frequently inactivated either by genomic deletions or point mutations. NF-κB activation in tumoral cells is also driven by the microenvironment or chronic signaling that does not rely on genetic alterations.

  14. NF-κB in Hematological Malignancies.

    Science.gov (United States)

    Imbert, Véronique; Peyron, Jean-François

    2017-05-31

    NF-κB (Nuclear Factor Κ-light-chain-enhancer of activated B cells) transcription factors are critical regulators of immunity, stress response, apoptosis, and differentiation. Molecular defects promoting the constitutive activation of canonical and non-canonical NF-κB signaling pathways contribute to many diseases, including cancer, diabetes, chronic inflammation, and autoimmunity. In the present review, we focus our attention on the mechanisms of NF-κB deregulation in hematological malignancies. Key positive regulators of NF-κB signaling can act as oncogenes that are often prone to chromosomal translocation, amplifications, or activating mutations. Negative regulators of NF-κB have tumor suppressor functions, and are frequently inactivated either by genomic deletions or point mutations. NF-κB activation in tumoral cells is also driven by the microenvironment or chronic signaling that does not rely on genetic alterations.

  15. A method for testing bullets at reduced velocity

    OpenAIRE

    Courtney, Michael; Courtney, Amy

    2008-01-01

    Reconstruction of shooting events occasionally requires testing of bullets at velocities significantly below the typical muzzle velocity of cartridge arms. Trajectory, drag, and terminal performance depend strongly on velocity, and realistic results require accurately reconstructing the velocity. A method is presented for testing bullets at reduced velocities by loading the bullet into a sabot and firing from a muzzle loading rifle with a suitably reduced powder charge. Powder charges can be ...

  16. Recommended methods for purification of solvents and tests for impurities

    CERN Document Server

    Coetzee, J F

    1982-01-01

    Recommended Methods for Purification of Solvents and Tests for Impurities is a compilation of recommended procedures for purification of solvents and tests for solvent impurities. Ten solvents are covered: acetonitrile, sulfolane, propylene carbonate, dimethyl sulfoxide, dimethylformamide, hexamethylphosphoramide, pyridine, ethylenediamine, N-methylacetamide, and N-methylpropionamide. This book is comprised of 12 chapters and opens with an introduction to general aspects of impurity effects. The rationale for the selection of solvent is explained, and the relative reactivities of solutes in di

  17. A Model Based Security Testing Method for Protocol Implementation

    Directory of Open Access Journals (Sweden)

    Yu Long Fu

    2014-01-01

    Full Text Available The security of protocol implementation is important and hard to be verified. Since the penetration testing is usually based on the experience of the security tester and the specific protocol specifications, a formal and automatic verification method is always required. In this paper, we propose an extended model of IOLTS to describe the legal roles and intruders of security protocol implementations, and then combine them together to generate the suitable test cases to verify the security of protocol implementation.

  18. A DESCRIPTIVE REVIEW OF DIFFERENT PENETRATION TESTING TOOLS AND METHODS

    OpenAIRE

    Swarnjeet Kaur; Harmandeep Singh

    2016-01-01

    The penetration testing is to authenticate a recently discovered and approachable applications and networks, structure that are vulnerable to a certainty harm ,expose to danger and security risk which could reveal unauthorized access to resources. Penetration testing is a series of actions or steps to reproduce all methods taken by attackers to obtain a system. A penetration tester is the attested , programmed and effective technique used to find the vulnerabilities in an at...

  19. Standard Test Method for Normal Spectral Emittance at Elevated Temperatures

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1972-01-01

    1.1 This test method describes a highly accurate technique for measuring the normal spectral emittance of electrically conducting materials or materials with electrically conducting substrates, in the temperature range from 600 to 1400 K, and at wavelengths from 1 to 35 μm. 1.2 The test method requires expensive equipment and rather elaborate precautions, but produces data that are accurate to within a few percent. It is suitable for research laboratories where the highest precision and accuracy are desired, but is not recommended for routine production or acceptance testing. However, because of its high accuracy this test method can be used as a referee method to be applied to production and acceptance testing in cases of dispute. 1.3 The values stated in SI units are to be regarded as the standard. The values in parentheses are for information only. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this stan...

  20. Standard Test Method for Measuring Binocular Disparity in Transparent Parts

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This test method covers the amount of binocular disparity that is induced by transparent parts such as aircraft windscreens, canopies, HUD combining glasses, visors, or goggles. This test method may be applied to parts of any size, shape, or thickness, individually or in combination, so as to determine the contribution of each transparent part to the overall binocular disparity present in the total “viewing system” being used by a human operator. 1.2 This test method represents one of several techniques that are available for measuring binocular disparity, but is the only technique that yields a quantitative figure of merit that can be related to operator visual performance. 1.3 This test method employs apparatus currently being used in the measurement of optical angular deviation under Method F 801. 1.4 The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not con...

  1. Antimycobacterial susceptibility testing methods for natural products research

    Directory of Open Access Journals (Sweden)

    Juan Gabriel Bueno Sánchez

    2010-06-01

    Full Text Available The emergence of multidrug-resistant strains of Mycobacterium tuberculosis underscores the need of continuous developments on new and efficient methods to determine the susceptibility of isolates of M. tuberculosis in the search for novel antimicrobial agents. Natural products constitute an important source of new drugs, but design and implementation of antimycobacterial susceptibility testing methods are necessary for evaluate the different extracts and compounds. A number of biological assay methodologies are in current use, ranging from the classical disk diffusion and broth dilution assay format, to radiorespirometric (BACTEC, dye-based, and fluorescent/luminescence reporter assays. This review presents an analysis on the in vitro susceptibility testing methods developed for determinate antitubercular activity in natural products and related compounds (semi-synthetic natural products and natural products-derived compounds and the criteria to select the adequate method for determination of biological activity of new natural products.

  2. Application of the X-in-the-Loop Testing Method in the FCV Hybrid Degree Test

    Directory of Open Access Journals (Sweden)

    Haiyu Gao

    2018-02-01

    Full Text Available With the development of fuel cell vehicle technology, an effective testing method that can be applied to develop and verify the fuel cell vehicle powertrain system is urgently required. This paper presents the X-in-the-Loop (XiL testing method in the fuel cell vehicle (FCV hybrid degree test to resolve the first and key issues for the powertrain system design, and the test process and scenarios were designed. The hybrid degree is redefined into the static hybrid degree for system architecture design and the dynamic hybrid degree for vehicle control strategy design, and an integrated testing platform was introduced and a testing application was implemented by following the designed testing flowchart with two loops. Experimental validations show that the sizing of the FCE (Fuel Cell Engine, battery pack, and traction motor with the powertrain architecture can be determined, the control strategy can be evaluated seamlessly, and a systematic powertrain testing solution can be achieved through the whole development process. This research has developed a new testing platform and proposed a novel testing method on the fuel cell vehicle powertrain system, which will be a contribution to fuel cell vehicle technology and its industrialization.

  3. Truncated Product Methods for Panel Unit Root Tests*

    Science.gov (United States)

    SHENG, XUGUANG; YANG, JINGYUN

    2012-01-01

    This paper proposes two new panel unit root tests based on Zaykin et al. (2002)’s truncated product method. The first one assumes constant correlation between p-values and the second one uses sieve bootstrap to allow for general forms of cross-section dependence in the panel units. Monte Carlo simulation shows that both tests have reasonably good size and are powerful in cases of some very large p-values. The proposed tests are applied to a panel of real GDP and inflation density forecasts, resulting in evidence that professional forecasters may not update their forecast precision in an optimal Bayesian way. PMID:23869116

  4. Truncated Product Methods for Panel Unit Root Tests.

    Science.gov (United States)

    Sheng, Xuguang; Yang, Jingyun

    2013-08-01

    This paper proposes two new panel unit root tests based on Zaykin et al. (2002)'s truncated product method. The first one assumes constant correlation between p -values and the second one uses sieve bootstrap to allow for general forms of cross-section dependence in the panel units. Monte Carlo simulation shows that both tests have reasonably good size and are powerful in cases of some very large p -values. The proposed tests are applied to a panel of real GDP and inflation density forecasts, resulting in evidence that professional forecasters may not update their forecast precision in an optimal Bayesian way.

  5. Accelerated aging of IG units : North American test methods

    International Nuclear Information System (INIS)

    Elmahdy, H.

    2002-01-01

    Both Canadian and American standards have been in place for decades to determine argon gas concentration in insulating glass (IG) units. Efforts are underway to harmonize the IG standards to have acceptable test methods for the durability of IG units and to implement a single certification program for both Canada and the United States. One way to test the durability and integrity of the edge seal on IG units is to subject them to accelerated aging cycles in a controlled environment. This paper summarizes the Canadian, American and the harmonized test methods used in testing the integrity of the seal and the determination of argon gas in IG units. The Canadian standard (CAN/CGSB 12.8) encompasses the following tests: initial seal of units, initial dew point, initial argon concentration, failure analysis (water immersion test), weather cycling, volatile fogging (UV), dew point measurement after weather cycling, high humidity cycling, and final argon concentration. American ASTM E773 and ASTM E774 differ from the Canadian standard in the sequence of testing and the rating of IG units, creating problems for certification of units being shipped across the border. It was noted that adopting a single certification program for Canada and the United States would bring economic benefits to both consumers and manufacturers. 7 refs., 5 figs

  6. Discrete Spectral Local Measurement Method for Testing Solar Concentrators

    Directory of Open Access Journals (Sweden)

    Huifu Zhao

    2012-01-01

    Full Text Available In order to compensate for the inconvenience and instability of outdoor photovoltaic concentration test system which are caused by the weather changes, we design an indoor concentration test system with a large caliber and a high parallelism, and then verify its feasibility and scientificity. Furthermore, we propose a new concentration test method: the discrete spectral local measurement method. A two-stage Fresnel concentration system is selected as the test object. The indoor and the outdoor concentration experiments are compared. The results show that the outdoor concentration efficiency of the two-stage Fresnel concentration system is 85.56%, while the indoor is 85.45%. The two experimental results are so close that we can verify the scientificity and feasibility of the indoor concentration test system. The light divergence angle of the indoor concentration test system is 0.267° which also matches with sunlight divergence angle. The indoor concentration test system with large diameter (145 mm, simple structure, and low cost will have broad applications in solar concentration field.

  7. Standard test method for measurement of fatigue crack growth rates

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2015-01-01

    1.1 This test method covers the determination of fatigue crack growth rates from near-threshold to Kmax controlled instability. Results are expressed in terms of the crack-tip stress-intensity factor range (ΔK), defined by the theory of linear elasticity. 1.2 Several different test procedures are provided, the optimum test procedure being primarily dependent on the magnitude of the fatigue crack growth rate to be measured. 1.3 Materials that can be tested by this test method are not limited by thickness or by strength so long as specimens are of sufficient thickness to preclude buckling and of sufficient planar size to remain predominantly elastic during testing. 1.4 A range of specimen sizes with proportional planar dimensions is provided, but size is variable to be adjusted for yield strength and applied force. Specimen thickness may be varied independent of planar size. 1.5 The details of the various specimens and test configurations are shown in Annex A1-Annex A3. Specimen configurations other than t...

  8. Proposal for a Brazilian centre on alternative test methods.

    Science.gov (United States)

    Eskes, Chantra; Sá-Rocha, Vanessa de Moura; Nunes, Jadir; Presgrave, Octavio; de Carvalho, Dermeval; Masson, Philippe; Rivera, Ekaterina; Coecke, Sandra; Kreysa, Joachim; Hartung, Thomas

    2009-01-01

    Several initiatives have recently taken place in Brazil in order to foster the creation of centers dedicated to alternatives to animal testing. In 2008, Vanessa Sá-Rocha organized a meeting with Brazilian regulatory authorities and the major stakeholders in the field of testing to foster discussions on the process of funding, development, and validation of alternative methods in Brazil. Octavio Presgrave published a scientific article on "The Need for the Establishment of a Brazilian Centre for the Validation of Alternative Methods." Also in 2008, Jadir Nunes, together with Dermeval de Carvalho, prepared and presented a proposal to the Brazilian National Agency of Health Surveillance (ANVISA) for the creation of a Centre for the Validation of Alternative Methods. ECVAM and other European stakeholders have been involved in the initiatives. Furthermore, also in 2008, a new legislation has been adopted in Brazil regarding the use of animals for scientific purposes ("lei Arouca"). The legislation establishes, among other provisions, the task of monitoring and evaluating the introduction of alternative methods. However, the legislation does not provide for promotion of or information about, existing alternative methods to the larger Brazilian scientific community. In order to streamline the different activities, Chantra Eskes acted as a facilitator by establishing a new joint proposal with the current Brazilian stakeholders, aimed at setting up a Brazilian Center on Alternative Test Methods.

  9. Linear shrinkage test: justification for its reintroduction as a standard South African test method

    CSIR Research Space (South Africa)

    Sampson, LR

    2009-06-04

    Full Text Available Several problems with the linear shrinkage test specified in Method A4 of the THM 1 1979 were addressed as part of this investigation in an effort to improve the alleged poor reproducibility of the test and justify its reintroduction into THM 1. A...

  10. A Probe-Compensated Helicoidal NF-FF Transformation for Aperture Antennas Using a Prolate Spheroidal Expansion

    Directory of Open Access Journals (Sweden)

    Amedeo Capozzoli

    2012-01-01

    Full Text Available A new probe-compensated near-field-far-field (NF-FF transformation for aperture antennas in a cylindrical scanning geometry is presented. Such a technique takes the advantage of the NF data acquisition made according to a very efficient sampling strategy along a helix and exploits a proper aperture field expansion based on the use of the prolate spheroidal wave functions (PSWFs, accounting for the a priori information on shape and size of the antenna under test. The unknown aperture field expansion coefficients of the PSWFs are evaluated from the acquired voltage samples by an inversion process using a regularized version of the singular value decomposition method. Experimental results on connected and disconnected radiating aperture antennas, including sum and difference patterns, show the effectiveness of the approach and, in particular, how it enables a serious reduction of the measurement points without impairing the FF estimation accuracy.

  11. Field Testing of Compartmentalization Methods for Multifamily Construction

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, K. [Building Science Corporation, Westford, MA (United States); Lstiburek, J. [Building Science Corporation, Westford, MA (United States)

    2015-03-01

    The 2012 IECC has an airtightness requirement of 3 air changes per hour at 50 Pascals test pressure for both single-family and multifamily construction in Climate Zones 3-8. Other programs (LEED, ASHRAE 189, ASHRAE 62.2) have similar or tighter compartmentalization requirements, driving the need for easier and more effective methods of compartmentalization in multifamily buildings. Builders and practitioners have found that fire-resistance rated wall assemblies are a major source of difficulty in air sealing/compartmentalization, particularly in townhouse construction. This problem is exacerbated when garages are “tucked in” to the units and living space is located over the garages. In this project, Building Science Corporation examined the taping of exterior sheathing details to improve air sealing results in townhouse and multifamily construction, when coupled with a better understanding of air leakage pathways. Current approaches are cumbersome, expensive, time consuming, and ineffective; these details were proposed as a more effective and efficient method. The effectiveness of these air sealing methods was tested with blower door testing, including “nulled” or “guarded” testing (adjacent units run at equal test pressure to null out inter-unit air leakage, or “pressure neutralization”). Pressure diagnostics were used to evaluate unit-to-unit connections and series leakage pathways (i.e., air leakage from exterior, into the fire-resistance rated wall assembly, and to the interior).

  12. The new null testing method for the special optical window

    Science.gov (United States)

    Huang, Changchun

    2009-07-01

    The high speed, high precision and wide range specifications are requirement for the modern aircraft, which the traditional hemispherical dome can't achieve now, and the novel conformal window instead can enhance the aerodynamic performance of the aircraft obviously. To reduce the aerodynamic drag and radar cross-section, the window geometry is generally aspheric in shape. As a result, the involved fabrication and testing processes are much more challenging than that of conventional optics and must be mastered before these windows and systems can be implemented at an acceptable cost and risk. Metrology is one of the critical areas required to advance the conformal window technology. But as the surface of these conformal windows is not the traditional sphere lens, the measurement method for it is infeasible with the conventional optics measurement processes. This paper we express the development of testing technology for the special conformal windows in brief, and emphatically introduces one available novel testing method- a new null testing, and here based on the theory of compensation methods, The principle of Offner's refractive null lens has been extended to test the transmission wavefront through conformal window optics and provide feedback during surface fabrication. a compensator system for the was designed for the conformal window is given which parameters are 100mm for its aperture and two parabolic surface as conformal window, the final residual wavefront error(RMS) of which is less than 1/20λ(λ=632.8nm).

  13. Heart rate-based lactate minimum test: a reproducible method.

    NARCIS (Netherlands)

    Strupler, M.; Muller, G.; Perret, C.

    2009-01-01

    OBJECTIVE: To find the individual intensity for aerobic endurance training, the lactate minimum test (LMT) seems to be a promising method. LMTs described in the literature consist of speed or work rate-based protocols, but for training prescription in daily practice mostly heart rate is used. The

  14. Report on the Standardization Project "Formal Methods in Conformance Testing"

    NARCIS (Netherlands)

    Baumgarten, B.; Hogrefe, D.; Heymer, S.; Burkhardt, H.-J.; Giessler, A.; Tretmans, G.J.

    1996-01-01

    This paper presents the latest developments in the “Formal Methods in Conformance Testing��? (FMCT) project of ISO and ITU–T. The project has been initiated to study the role of formal description techniques in the conformance testing process. The goal is to develop a standard that defines the

  15. Alternative methods for eye and skin irritation tests: an overview.

    Science.gov (United States)

    Vinardell, M P; Mitjans, M

    2008-01-01

    The evaluation of eye and skin irritation potential is essential to ensuring the safety of individuals in contact with a wide variety of substances designed for industrial, pharmaceutical or cosmetic use. The Draize rabbit eye and skin irritancy tests have been used for 60 years to attempt to predict the human ocular and dermal irritation of such products. The Draize test has been the standard for ocular and dermal safety assessments for decades. However, several aspects of the test have been criticised. These include: the subjectivity of the method; the overestimation of human responses; and the method's cruelty. The inadequacies of the Draize test have led to several laboratories over the last 20 years making efforts to develop in vitro assays to replace it. Protocols that use different types of cell cultures and other methods have been devised to study eye and skin irritation. Different commercial kits have also been developed to study eye and skin irritation, based on the action of chemicals on these tissues. This article presents a review of the main alternatives developed to replace the use of animals in the study of chemical irritation. Particular attention is paid to the reproducibility of each method. (c) 2007 Wiley-Liss, Inc.

  16. Critical wall shear stress for the EHEDG test method

    DEFF Research Database (Denmark)

    Jensen, Bo Boye Busk; Friis, Alan

    2004-01-01

    In order to simulate the results of practical cleaning tests on closed processing equipment, based on wall shear stress predicted by computational fluid dynamics, a critical wall shear stress is required for that particular cleaning method. This work presents investigations that provide a critical...

  17. Test method for measuring insulation values of cryogenic pipes

    NARCIS (Netherlands)

    Velthuis, J.F.M.; Blokland, H.; Klaver, B.W.; Beld, C. van de

    2010-01-01

    In this paper a large-area heat flux and temperature sensor (HFT) is used for the evaluation of the insulation value of cryogenic pipes. The HFT is flexible and clamp-on. The test method is relatively simple and can be used in-situ. The HFT makes it possible to monitor insulation performance over

  18. Field test of a new Australian method of rangeland monitoring

    Science.gov (United States)

    Suzanne Mayne; Neil West

    2001-01-01

    Managers need more efficient means of monitoring changes on the lands they manage. Accordingly, a new Australian approach was field tested and compared to the Daubenmire method of assessing plant cover, litter, and bare soil. The study area was a 2 mile wide by 30.15 mile long strip, mostly covered by salt desert shrub ecosystem types, centered along the SE boundary of...

  19. 40 CFR 63.365 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... for Volatile Alcohols in Water By Direct Aqueous-Injection Gas Chromatography, (incorporated by... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Test methods and procedures. 63.365 Section 63.365 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS...

  20. Comparative study of heuristic evaluation and usability testing methods.

    Science.gov (United States)

    Thyvalikakath, Thankam Paul; Monaco, Valerie; Thambuganipalle, Himabindu; Schleyer, Titus

    2009-01-01

    Usability methods, such as heuristic evaluation, cognitive walk-throughs and user testing, are increasingly used to evaluate and improve the design of clinical software applications. There is still some uncertainty, however, as to how those methods can be used to support the development process and evaluation in the most meaningful manner. In this study, we compared the results of a heuristic evaluation with those of formal user tests in order to determine which usability problems were detected by both methods. We conducted heuristic evaluation and usability testing on four major commercial dental computer-based patient records (CPRs), which together cover 80% of the market for chairside computer systems among general dentists. Both methods yielded strong evidence that the dental CPRs have significant usability problems. An average of 50% of empirically-determined usability problems were identified by the preceding heuristic evaluation. Some statements of heuristic violations were specific enough to precisely identify the actual usability problem that study participants encountered. Other violations were less specific, but still manifested themselves in usability problems and poor task outcomes. In this study, heuristic evaluation identified a significant portion of problems found during usability testing. While we make no assumptions about the generalizability of the results to other domains and software systems, heuristic evaluation may, under certain circumstances, be a useful tool to determine design problems early in the development cycle.

  1. Test results judgment method based on BIT faults

    Directory of Open Access Journals (Sweden)

    Wang Gang

    2015-12-01

    Full Text Available Built-in-test (BIT is responsible for equipment fault detection, so the test data correctness directly influences diagnosis results. Equipment suffers all kinds of environment stresses, such as temperature, vibration, and electromagnetic stress. As embedded testing facility, BIT also suffers from these stresses and the interferences/faults are caused, so that the test course is influenced, resulting in incredible results. Therefore it is necessary to monitor test data and judge test failures. Stress monitor and BIT self-diagnosis would redound to BIT reliability, but the existing anti-jamming researches are mainly safeguard design and signal process. This paper focuses on test results monitor and BIT equipment (BITE failure judge, and a series of improved approaches is proposed. Firstly the stress influences on components are illustrated and the effects on the diagnosis results are summarized. Secondly a composite BIT program is proposed with information integration, and a stress monitor program is given. Thirdly, based on the detailed analysis of system faults and forms of BIT results, the test sequence control method is proposed. It assists BITE failure judge and reduces error probability. Finally the validation cases prove that these approaches enhance credibility.

  2. Standard test methods for conducting time-for-rupture notch tension tests of materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 These test methods cover the determination of the time for rupture of notched specimens under conditions of constant load and temperature. These test methods also includes the essential requirements for testing equipment. 1.2 The values stated in inch-pound units are to be regarded as the standard. The units in parentheses are for information only. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  3. Methicillin Resistant Staphylococcus aureus: Inconsistencies in Vancomycin Susceptibility Testing Methods, Limitations and Advantages of each Method.

    Science.gov (United States)

    Himani; Agrawal, Charu; Madan, Molly; Pandey, Anita; Thakuria, Bhaskar

    2015-10-01

    Vancomycin may be ineffective against an increasing proportion of methicillin resistant Staphylococcus aureus (MRSA) with minimum inhibitory concentrations (MICs) well within the susceptible range. On the other hand it is common knowledge that determination of vancomycin MICs is method dependent. Therefore, given the apparent variability in vancomycin MIC results obtained with the different methods, the use of the vancomycin MIC to predict the outcome of serious S. aureus infections needs to take into account the method used and the results of studies using that particular method. Comparative study was carried out to evaluate the MICs obtained by BMD method, E-test, and Vitek 2 method and to detect inconsistencies in these vancomycin for 66 MRSA isolates obtained from various samples of patients attending the OPDs & IPDs within a period of one year. A comparative study was carried out to evaluate the MICs obtained by BMD method, E-test, and Vitek 2 method to detect vancomycin susceptibility in 66 clinical isolates of MRSA obtained from various samples of patients attending the OPDs & IPDs within a period of one year. The study was conducted in Department of Microbiology, Subharti Medical College, Meerut from January to December 2012. On determination of MICs for vancomycin for the MRSA isolates, all were identified as VSSA by BMD, E-Test & Vitek 2 methods. However, the vancomycin MIC values obtained by E-test correlated better with BMD method (correlation factor= 0.6727) than Vitek 2 (correlation factor=0.5316), indicating E-Test to be a better method for determination of vancomycin MICs as compared to Vitek 2. MRSA isolates with higher vancomycin MICs, even within the susceptibility range, are being observed more frequently which result in treatment failures with vancomycin. Because of the discrepancy that exists in vancomycin MIC results from different methods, the prediction of outcome of serious S.aureus infections should take into account the method used

  4. Falsification Testing of Instrumental Variables Methods for Comparative Effectiveness Research.

    Science.gov (United States)

    Pizer, Steven D

    2016-04-01

    To demonstrate how falsification tests can be used to evaluate instrumental variables methods applicable to a wide variety of comparative effectiveness research questions. Brief conceptual review of instrumental variables and falsification testing principles and techniques accompanied by an empirical application. Sample STATA code related to the empirical application is provided in the Appendix. Comparative long-term risks of sulfonylureas and thiazolidinediones for management of type 2 diabetes. Outcomes include mortality and hospitalization for an ambulatory care-sensitive condition. Prescribing pattern variations are used as instrumental variables. Falsification testing is an easily computed and powerful way to evaluate the validity of the key assumption underlying instrumental variables analysis. If falsification tests are used, instrumental variables techniques can help answer a multitude of important clinical questions. © Health Research and Educational Trust.

  5. Standard test method for tension testing of structural alloys in liquid helium

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 This test method describes procedures for the tension testing of structural alloys in liquid helium. The format is similar to that of other ASTM tension test standards, but the contents include modifications for cryogenic testing which requires special apparatus, smaller specimens, and concern for serrated yielding, adiabatic heating, and strain-rate effects. 1.2 To conduct a tension test by this standard, the specimen in a cryostat is fully submerged in normal liquid helium (He I) and tested using crosshead displacement control at a nominal strain rate of 10−3 s−1 or less. Tests using force control or high strain rates are not considered. 1.3 This standard specifies methods for the measurement of yield strength, tensile strength, elongation, and reduction of area. The determination of the elastic modulus is treated in Test Method E 111. Note 1—The boiling point of normal liquid helium (He I) at sea level is 4.2 K (−269°C or −452.1°F or 7.6°R). It decreases with geographic elevation and is...

  6. Standard test method for laboratory evaluation of magnesium sacrificial anode test specimens for underground applications

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1997-01-01

    1.1 This test method covers a laboratory procedure that measures the two fundamental performance properties of magnesium sacrificial anode test specimens operating in a saturated calcium sulfate, saturated magnesium hydroxide environment. The two fundamental properties are electrode (oxidation potential) and ampere hours (Ah) obtained per unit mass of specimen consumed. Magnesium anodes installed underground are usually surrounded by a backfill material that typically consists of 75 % gypsum (CaSO4·2H2O), 20 % bentonite clay, and 5 % sodium sulfate (Na2SO4). The calcium sulfate, magnesium hydroxide test electrolyte simulates the long term environment around an anode installed in the gypsum-bentonite-sodium sulfate backfill. 1.2 This test method is intended to be used for quality assurance by anode manufacturers or anode users. However, long term field performance properties may not be identical to property measurements obtained using this laboratory test. Note 1—Refer to Terminology G 15 for terms used ...

  7. Nondestructive testing method for a new generation of electronics

    Directory of Open Access Journals (Sweden)

    Azin Anton

    2018-01-01

    Full Text Available The implementation of the Smart City system needs reliable and smoothly operating electronic equipment. The study is aimed at developing a nondestructive testing method for electronic equipment and its components. This method can be used to identify critical design defects of printed circuit boards (PCB and to predict their service life, taking into account the nature of probable operating loads. The study uses an acoustic emission method to identify and localize critical design defects of printed circuit boards. Geometric dimensions of detected critical defects can be determined by the X-ray tomography method. Based on the results of the study, a method combining acoustic emission and X-ray tomography was developed for nondestructive testing of printed circuit boards. The stress-strain state of solder joints containing detected defects was analyzed. This paper gives an example of using the developed method for estimating the degree of damage to joints between PCB components and predicting the service life of the entire PCB.

  8. Hydrocoin level 3 - Testing methods for sensitivity/uncertainty analysis

    International Nuclear Information System (INIS)

    Grundfelt, B.; Lindbom, B.; Larsson, A.; Andersson, K.

    1991-01-01

    The HYDROCOIN study is an international cooperative project for testing groundwater hydrology modelling strategies for performance assessment of nuclear waste disposal. The study was initiated in 1984 by the Swedish Nuclear Power Inspectorate and the technical work was finalised in 1987. The participating organisations are regulatory authorities as well as implementing organisations in 10 countries. The study has been performed at three levels aimed at studying computer code verification, model validation and sensitivity/uncertainty analysis respectively. The results from the first two levels, code verification and model validation, have been published in reports in 1988 and 1990 respectively. This paper focuses on some aspects of the results from Level 3, sensitivity/uncertainty analysis, for which a final report is planned to be published during 1990. For Level 3, seven test cases were defined. Some of these aimed at exploring the uncertainty associated with the modelling results by simply varying parameter values and conceptual assumptions. In other test cases statistical sampling methods were applied. One of the test cases dealt with particle tracking and the uncertainty introduced by this type of post processing. The amount of results available is substantial although unevenly spread over the test cases. It has not been possible to cover all aspects of the results in this paper. Instead, the different methods applied will be illustrated by some typical analyses. 4 figs., 9 refs

  9. A well test analysis method accounting for pre-testoperations

    Energy Technology Data Exchange (ETDEWEB)

    Silin, D.B.; Tsang, C.-F.

    2003-06-13

    We propose to use regular monitoring data from a productionor injection well for estimating the formation hydraulic properties inthe vicinity of the wellbore without interrupting the operations. In ourapproach, we select a portion of the pumping data over a certain timeinterval and then derive our conclusions from analysis of these data. Adistinctive feature of the proposed approach differing it formconventional methods is in the introduction of an additional parameter,an effective pre-test pumping rate. The additional parameter is derivedbased on a rigorous asymptotic analysis of the flow model. Thus, weaccount for the non-uniform pressure distribution at the beginning oftesting time interval caused by pre-test operations at the well. Bysynthetic and field examples, we demonstrate that deviation of thematching curve from the data that is usually attributed to skin andwellbore storage effects, can also be interpreted through this newparameter. Moreover, with our method, the data curve is matched equallywell and the results of the analysis remain stable when the analyzed datainterval is perturbed, whereas traditional methods are sensitive to thechoice of the data interval. A special efficient minimization procedurehas been developed for searching the best fitting parameters. We enhancedour analysis above with a procedure of estimating ambient reservoirpressure and dimensionless wellbore radius. The methods reported herehave been implemented in code ODA (Operations Data Analysis). A betaversion of the code is available for free testing and evaluation tointerested parties.

  10. Comparison of a New and Rapid Method: Brucella Coombs Gel Test With Other Diagnostic Tests.

    Science.gov (United States)

    Kalem, Fatma; Ergün, Ayşe Gül; Durmaz, Süleyman; Doğan, Metin; Ertuğrul, Ömür; Gündem, Seval

    2016-09-01

    The aim of this study was to detect reliability of Brucella Coombs gel test (BCGT) by comparing with with ELISA (IgG + IgM), Standard agglutination test, and Brucella immunocapture agglutination methods in serological diagnosis of brucellosis. Brucella Coombs gel test (BCGT), Brucella ELISA (IgG + IgM), Standard agglutination test, and Brucella immunocapture agglutination tests of 78 patients with presumptive diagnosis of brucellosis which were sent to Microbiology Laboratory of Konya Numune Hospital from various regions of Konya were studied. Of 78 patients with ELISA IgG and IgM, STA, BICA and BCGT; 26, 21, 10, 12 and 12 were positive. When compared with BICA, the sensitivity and specifity of BCGT were 100% and 100%, respectively. According to results BCGT can be used as a diagnostic test in routine laboratories after more comprehensive studies in control groups and patients. © 2016 Wiley Periodicals, Inc.

  11. Computerized method of visual acuity testing: adaptation of the amblyopia treatment study visual acuity testing protocol.

    Science.gov (United States)

    Moke, P S; Turpin, A H; Beck, R W; Holmes, J M; Repka, M X; Birch, E E; Hertle, R W; Kraker, R T; Miller, J M; Johnson, C A

    2001-12-01

    To report a computerized method for determining visual acuity in children using the Amblyopia Treatment Study visual acuity testing protocol. A computerized visual acuity tester was developed that uses a programmed handheld device that uses the Palm operating system (Palm, Inc, Santa Clara, California). The handheld device communicates with a personal computer running a Linux operating system and 17-inch monitor. At a test distance of 3 m, single letters can be displayed from 20/800 to 20/12. A C program on the handheld device runs the Amblyopia Treatment Study visual acuity testing protocol. Using this method, visual acuity was tested in both the right and left eyes, and then the testing was repeated in 156 children age 3 to 7 years at four clinical sites. Test-retest reliability was high (r =.92 and 0.95 for and right and left eyes, respectively), with 88% of right eye retests and 94% of left eye retests within 0.1 logarithm of minimal angle of resolution (logMAR) units of the initial test. The 95% confidence interval for an acuity score was calculated to be the score +/- 0.13 logMAR units. For a change between two acuity scores, the 95% confidence interval was the difference +/- 0.19 logMAR units. We have developed a computerized method for measurement of visual acuity. Automation of the Amblyopia Treatment Study visual acuity testing protocol is an effective method of testing visual acuity in children 3 to 7 years of age.

  12. Effects of returning NF concentrate on the MBR-NF process treating antibiotic production wastewater.

    Science.gov (United States)

    Li, Kun; Cheng, Yutao; Wang, Jianxing; Zhang, Junya; Liu, Jibao; Yu, Dawei; Li, Mingyue; Wei, Yuansong

    2016-07-01

    The optimization of the nanofiltration (NF) concentrate backflow ratio (R cb) and the influence of the NF concentrate on the performance of membrane bioreactor-nanofiltration (MBR-NF) process treating antibiotic production wastewater were investigated on a laboratory scale. The R cb was optimized at 60 % based on the removal rates of chemical oxygen demand (COD) and NH4 (+)-N by MBR. Data analyses indicated that salinity brought by NF concentrate is the major driver leading to the decrease of sludge activity, especially at a high R cb. EPS analysis showed that electric conductivity (EC), proteins in soluble microbial products (SMP), and SMP brought by NF concentrate are the dominant factors causing the severe membrane fouling in MBR. Furthermore, undegradable substances including fulvic acid-like and humic acid-like compounds accumulated in NF concentrate showed significant influence on fouling of NF. MBR could well degrade small MW compounds in NF concentrate, which confirmed the enhancement of organic removal efficiency by recycling the NF concentrate to MBR. The MBR-NF process showed a relatively stable performance at the R cb of 60 % (volume reduction factor (VRF) = 5), and the NF permeate could satisfy the water quality standard for fermentation process with a water recovery rate of 90.9 %.

  13. NF45 and NF90 Bind HIV-1 RNA and Modulate HIV Gene Expression

    Directory of Open Access Journals (Sweden)

    Yan Li

    2016-02-01

    Full Text Available A previous proteomic screen in our laboratory identified nuclear factor 45 (NF45 and nuclear factor 90 (NF90 as potential cellular factors involved in human immunodeficiency virus type 1 (HIV-1 replication. Both are RNA binding proteins that regulate gene expression; and NF90 has been shown to regulate the expression of cyclin T1 which is required for Tat-dependent trans-activation of viral gene expression. In this study the roles of NF45 and NF90 in HIV replication were investigated through overexpression studies. Ectopic expression of either factor potentiated HIV infection, gene expression, and virus production. Deletion of the RNA binding domains of NF45 and NF90 diminished the enhancement of HIV infection and gene expression. Both proteins were found to interact with the HIV RNA. RNA decay assays demonstrated that NF90, but not NF45, increased the half-life of the HIV RNA. Overall, these studies indicate that both NF45 and NF90 potentiate HIV infection through their RNA binding domains.

  14. Increased expression of NF-AT3 and NF-AT4 in the atria correlates with procollagen I carboxyl terminal peptide and TGF-β1 levels in serum of patients with atrial fibrillation.

    Science.gov (United States)

    Zhao, Fei; Zhang, ShiJiang; Chen, YiJiang; Gu, WeiDong; Ni, BuQing; Shao, YongFeng; Wu, YanHu; Qin, JianWei

    2014-11-25

    Atrial fibrillation (AF) is the most common cardiac arrhythmia in clinical practice. Unfortunately, the precise mechanisms and sensitive serum biomarkers of atrial remodeling in AF remain unclear. The aim of this study was to determine whether the expression of the transcription factors NF-AT3 and NF-AT4 correlate with atrial structural remodeling of atrial fibrillation and serum markers for collagen I and III synthesis. Right and left atrial specimens were obtained from 90 patients undergoing valve replacement surgery. The patients were divided into sinus rhythm (n = 30), paroxysmal atrial fibrillation (n = 30), and persistent atrial fibrillation (n = 30) groups. NF-AT3, NF-AT4, and collagen I and III mRNA and protein expression in atria were measured. We also tested the levels of the carboxyl-terminal peptide from pro-collagen I, the N-terminal type I procollagen propeptides, the N-terminal type III procollagen propeptides, and TGF-β1 in serum using an enzyme immunosorbent assay. NF-AT3 and NF-AT4 mRNA and protein expression were increased in the AF groups, especially in the left atrium. NF-AT3 and NF-AT4 expression in the right atrium was increased in the persistent atrial fibrillation group compared the sinus rhythm group with similar valvular disease. In patients with AF, the expression levels of nuclear NF-AT3 and NF-AT4 correlated with those of collagens I and III in the atria and with PICP and TGF-β1 in blood. These data support the hypothesis that nuclear NF-AT3 and NF-AT4 participates in atrial structural remodeling, and that PICP and TGF-β1 levels may be sensitive serum biomarkers to estimate atrial structural remodeling with atrial fibrillation.

  15. An improved brine shrimp larvae lethality microwell test method.

    Science.gov (United States)

    Zhang, Yi; Mu, Jun; Han, Jinyuan; Gu, Xiaojie

    2012-01-01

    This article described an improved brine shrimp larvae lethality microwell test method. A simply designed connecting vessel with alternative photoperiod was used to culture and collect high yield of active Artemia parthenogenetica nauplii for brine shrimp larvae lethality microwell test. Using this method, pure A. parthenogenetica nauplii suspension was easily cultured and harvested with high density about 100-150 larvae per milliliter and the natural mortality was reduced to near zero by elimination of unnecessary artificial disturbance. And its sensitivity was validated by determination of LC(50)-24 h of different reference toxicants including five antitumor agents, two pesticides, three organic pollutants, and four heavy metals salts, most of which exhibited LC(50)-24 h between 0.07 and 58.43 mg/L except for bleomycin and mitomycin C with LC(50)-24 h over 300 mg/L.

  16. Standard test method for conducting potentiodynamic polarization resistance measurements

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1997-01-01

    1.1 This test method covers an experimental procedure for polarization resistance measurements which can be used for the calibration of equipment and verification of experimental technique. The test method can provide reproducible corrosion potentials and potentiodynamic polarization resistance measurements. 1.2 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  17. Standard Test Method for Environmental Resistance of Aerospace Transparencies

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers determination of the effects of exposure to thermal shock, condensing humidity, and simulated weather on aerospace transparent enclosures. 1.2 This test method is not recommended for quality control nor is it intended to provide a correlation to actual service life. 1.3 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.3.1 Exceptions—Certain inch-pound units are furnished in parentheses (not mandatory) and certain temperatures in Fahrenheit associated with other standards are also furnished. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  18. Development of advanced test methods for cleanroom garments

    International Nuclear Information System (INIS)

    Liu, B.Y.H.; Pui, D.Y.H.; Ye, Yan

    1993-01-01

    The performance of a cleanroom garment in the operating environment of a semiconductor fabrication facility is determined by the properties of the garment fabric and the garment design. Ideally, the garment fabric should be highly permeable to water vapor and essentially impermeable to particles. The design of the garment should minimize the discharge of particles generated by the wearer into the cleanroom air. This paper describes a three-part test method for cleanroom garments to determine water vapor transmission through the garment fabric, particle penetration through the garment fabric under specified conditions of pressure drop and velocity, and the reduction in particle generation and discharge into the cleanroom by the garment. The performance of some typical cleanroom garments as measured by this test method is described and compared

  19. Imaging MOSS tomographic system for H-1NF

    International Nuclear Information System (INIS)

    Glass, F.; Howard, J.

    1999-01-01

    A tomographic diagnostic utilising the Modulated Optical Solid-State spectrometer (MOSS) is planned for the H-1NF stellarator at the ANU. It is designed to create two-dimensional temperature or velocity maps of a poloidal cross-section of the high temperature plasma of H-1NF. The introduction of the MOSS spectrometers has enabled the development of several diagnostics to be used on the H-1NF stellerator. The MOSS spectrometer allows calculations of the plasma temperature and bulk velocity based on a line-integrated measurement of light emitted from electronic transitions within the plasma. A tomographic system utilising a rotatable multi-view ring apparatus and spatial multiplexing through a MOSS spectrometer is currently being developed. The ring apparatus is placed inside the H-1NF vessel and encircles the plasma. Multiple line-of-sight views collect light through a poloidal cross-section of the plasma and the emitted light is coupled into large core optical fibres. The transmitted light, via the optical fibre bundle, is then imaged through a large aperture MOSS spectrometer and onto another optical fibre array. Each fibre is then fed into a photomultiplier tube for signal detection. Characterisation of the properties of the lithium niobate (LiNbO 3 ) crystal used for modulation in the MOSS spectrometer is being undertaken to account for ray divergence in the imaging system. Tomographic techniques enable the construction of a temperature or velocity map of the poloidal cross-section. Rotating the ring apparatus to a new viewing position for the next pulse of plasma should allow an accurate picture to be built up based on the reproducibility of the plasma pulses. It is expected that initial testing of the system will begin in May when H-1NF begins operations at 0.5 Telsa field strength

  20. Testing of Heuristic Methods: A Case Study of Greedy Algorithm

    OpenAIRE

    Barus, A.,; Chen, T.,; Grant, D.; Kuo, F.,; Lau, M.,

    2008-01-01

    Part 8: Quality; International audience; Algorithms which seek global optima are computationally expensive. Alternatively, heuristic methods have been proposed to find approximate solutions. Because heuristic algorithms do not always deliver exact solutions it is difficult to verify the computed solutions. Such a problem is known as the oracle problem. In this paper, we propose to apply Metamorphic Testing (MT) in such situations because MT is designed to alleviate the oracle problem and can ...

  1. The virtual fields method applied to spalling tests on concrete

    Directory of Open Access Journals (Sweden)

    Forquin P.

    2012-08-01

    Full Text Available For one decade spalling techniques based on the use of a metallic Hopkinson bar put in contact with a concrete sample have been widely employed to characterize the dynamic tensile strength of concrete at strain-rates ranging from a few tens to two hundreds of s−1. However, the processing method mainly based on the use of the velocity profile measured on the rear free surface of the sample (Novikov formula remains quite basic and an identification of the whole softening behaviour of the concrete is out of reach. In the present paper a new processing method is proposed based on the use of the Virtual Fields Method (VFM. First, a digital high speed camera is used to record the pictures of a grid glued on the specimen. Next, full-field measurements are used to obtain the axial displacement field at the surface of the specimen. Finally, a specific virtual field has been defined in the VFM equation to use the acceleration map as an alternative ‘load cell’. This method applied to three spalling tests allowed to identify Young’s modulus during the test. It was shown that this modulus is constant during the initial compressive part of the test and decreases in the tensile part when micro-damage exists. It was also shown that in such a simple inertial test, it was possible to reconstruct average axial stress profiles using only the acceleration data. Then, it was possible to construct local stress-strain curves and derive a tensile strength value.

  2. Performing Allen's test in immobile hand: The Esmarch bandage method

    Directory of Open Access Journals (Sweden)

    Nebil Yesiloglu

    2015-12-01

    Full Text Available In this study, an alternative method of assessing hand vascular flow using a modification of Allen's test is presented. This technique may be helpful for patients who have immobile hands due to severe trauma, patients scheduled for free tissue transfer reconstruction, patients under general anesthesia in intensive care units that require serial arterial blood gas analyses, and emergency coronary by-pass candidates who decided to receive radial arterial grafts. [Hand Microsurg 2015; 4(3.000: 83-85

  3. Quick corrosion cracking test methods for high strength stainless steels

    International Nuclear Information System (INIS)

    Gurnich, L.Ya.; Shubadeeva, L.I.; Erofeeva, V.L.; Lashchevskij, V.B.

    1994-01-01

    Quicks method for testing high strength stainless steels during 10h under atmospheric and sea conditions has been developed. It is shown that (NH 4 ) 2 Se 2 O 8 - 13.5+-1 g/l, NaCl - 40+-2g/l, H 2 SO 4 -5g/l solution at 50+-2 C temperature is recommended for quick tests for tendency to corrosion cracking during. Development of steels and technologies of their treatment. Tests of steels of 08Kh15N5D2T, 07Kh16N6, 20Kh13, 40Kh13, 13Kh15N4AMD and other types can be performed in boiling solutions: H 2 SO 4 (55 ml/l)+CuSO 4 (110 g/l) or MgCl 2 (200 g/l hexahydrate)

  4. Fluorescence And Alternative Methods In Urine Drug Testing

    Science.gov (United States)

    Jain, Naresh C.

    1988-04-01

    Drug abuse has become-one of the most compelling realities _ ot contemporary society. It has penetrated every segment ot our population: trom schools to sports and trom organized crime to board rooms . Drugs in tie w9rkplace allegedly cost government agencies and business millions ot dollars each year in increased absenteeism,. poor work performance, thefts,accidents andwastedtime. The President's Commission on Organized Crime and the federal government are in tavor ot urine drug testing. In fact many employers are now resorting to urine drug testing on current and prospective employees. This presep.tation discusses different laboratory methods used in urine drug.testing, including immunoassays, fluorescence polarization, thin layer chromatography, high pressure liquid chromatography, gas chromatography and gas-chromatography-mass spectrometry.

  5. Hepatitis A virus: a test method for virucidal activity.

    Science.gov (United States)

    Wolff, M H; Schmitt, J; Rahaus, M; König, A

    2001-08-01

    Hepatitis A virus (HAV) is closely related to the genus enterovirus. HAV is very stable and resistant to acid pH and elevated temperature, as well as to chemicals and environmental influences. Human poliovirus is still one of the model viruses for testing disinfectants but there are discussions about changing to hepatitis A virus. The purpose of this study was to develop a method for using adapted hepatitis A virus to test hand disinfectants. Using HAV strains HM175/24a and FRhK-4 cytopathic effects were visible rarely, and not before 14 days. To verify virus growth in cells a RT-PCR was developed. Two disinfectants tested did not show the required virucidal activity to satisfy current German guidelines.

  6. Platelet function testing: methods of assessment and clinical utility.

    LENUS (Irish Health Repository)

    Mylotte, Darren

    2012-02-01

    Platelets play a central role in the regulation of both thrombosis and haemostasis yet tests of platelet function have, until recently, been exclusively used in the diagnosis and management of bleeding disorders. Recent advances have demonstrated the clinical utility of platelet function testing in patients with cardiovascular disease. The ex vivo measurement of response to antiplatelet therapies (aspirin and clopidogrel), by an ever-increasing array of platelet function tests, is with some assays, predictive of adverse clinical events and thus, represents an emerging area of interest for both the clinician and basic scientist. This review article will describe the advantages and disadvantages of the currently available methods of measuring platelet function and discuss both the limitations and emerging data supporting the role of platelet function studies in clinical practice.

  7. Platelet function testing: methods of assessment and clinical utility.

    LENUS (Irish Health Repository)

    Mylotte, Darren

    2011-01-01

    Platelets play a central role in the regulation of both thrombosis and haemostasis yet tests of platelet function have, until recently, been exclusively used in the diagnosis and management of bleeding disorders. Recent advances have demonstrated the clinical utility of platelet function testing in patients with cardiovascular disease. The ex vivo measurement of response to antiplatelet therapies (aspirin and clopidogrel), by an ever-increasing array of platelet function tests, is with some assays, predictive of adverse clinical events and thus, represents an emerging area of interest for both the clinician and basic scientist. This review article will describe the advantages and disadvantages of the currently available methods of measuring platelet function and discuss both the limitations and emerging data supporting the role of platelet function studies in clinical practice.

  8. A new method for testing Newton's gravitational law

    International Nuclear Information System (INIS)

    Schurr, J.; Klein, N.; Meyer, H.; Piel, H.; Walesch, H.

    1991-01-01

    A new experimental method is reported for determining the gravitational force of a laboratory test mass on a Fabry-Perot microwave resonator. The resonator consists of two Fabry-Perot mirrors suspended as pendulums. Changes of 2·10 -11 m in the pendulum separation can be resolved as a shift of the resonance frequency of the resonator. This limit corresponds to an acceleration of 7·10 -11 m s -2 of one mirror with respect to the other. In a first experiment, the gravitational acceleration generated by a 125 kg test mass was measured as a function of distance in the range of 10 to 15 cm and tested Newton's gravitational law with an accuracy of 1%. No deviation is found. Furthermore, the gravitational constant G is determined with similar precision. (author) 5 refs., 2 figs

  9. State of the art in non-animal approaches for skin sensitization testing: from individual test methods towards testing strategies.

    Science.gov (United States)

    Ezendam, Janine; Braakhuis, Hedwig M; Vandebriel, Rob J

    2016-12-01

    The hazard assessment of skin sensitizers relies mainly on animal testing, but much progress is made in the development, validation and regulatory acceptance and implementation of non-animal predictive approaches. In this review, we provide an update on the available computational tools and animal-free test methods for the prediction of skin sensitization hazard. These individual test methods address mostly one mechanistic step of the process of skin sensitization induction. The adverse outcome pathway (AOP) for skin sensitization describes the key events (KEs) that lead to skin sensitization. In our review, we have clustered the available test methods according to the KE they inform: the molecular initiating event (MIE/KE1)-protein binding, KE2-keratinocyte activation, KE3-dendritic cell activation and KE4-T cell activation and proliferation. In recent years, most progress has been made in the development and validation of in vitro assays that address KE2 and KE3. No standardized in vitro assays for T cell activation are available; thus, KE4 cannot be measured in vitro. Three non-animal test methods, addressing either the MIE, KE2 or KE3, are accepted as OECD test guidelines, and this has accelerated the development of integrated or defined approaches for testing and assessment (e.g. testing strategies). The majority of these approaches are mechanism-based, since they combine results from multiple test methods and/or computational tools that address different KEs of the AOP to estimate skin sensitization potential and sometimes potency. Other approaches are based on statistical tools. Until now, eleven different testing strategies have been published, the majority using the same individual information sources. Our review shows that some of the defined approaches to testing and assessment are able to accurately predict skin sensitization hazard, sometimes even more accurate than the currently used animal test. A few defined approaches are developed to provide an

  10. Applications of Automation Methods for Nonlinear Fracture Test Analysis

    Science.gov (United States)

    Allen, Phillip A.; Wells, Douglas N.

    2013-01-01

    Using automated and standardized computer tools to calculate the pertinent test result values has several advantages such as: 1. allowing high-fidelity solutions to complex nonlinear phenomena that would be impractical to express in written equation form, 2. eliminating errors associated with the interpretation and programing of analysis procedures from the text of test standards, 3. lessening the need for expertise in the areas of solid mechanics, fracture mechanics, numerical methods, and/or finite element modeling, to achieve sound results, 4. and providing one computer tool and/or one set of solutions for all users for a more "standardized" answer. In summary, this approach allows a non-expert with rudimentary training to get the best practical solution based on the latest understanding with minimum difficulty.Other existing ASTM standards that cover complicated phenomena use standard computer programs: 1. ASTM C1340/C1340M-10- Standard Practice for Estimation of Heat Gain or Loss Through Ceilings Under Attics Containing Radiant Barriers by Use of a Computer Program 2. ASTM F 2815 - Standard Practice for Chemical Permeation through Protective Clothing Materials: Testing Data Analysis by Use of a Computer Program 3. ASTM E2807 - Standard Specification for 3D Imaging Data Exchange, Version 1.0 The verification, validation, and round-robin processes required of a computer tool closely parallel the methods that are used to ensure the solution validity for equations included in test standard. The use of automated analysis tools allows the creation and practical implementation of advanced fracture mechanics test standards that capture the physics of a nonlinear fracture mechanics problem without adding undue burden or expense to the user. The presented approach forms a bridge between the equation-based fracture testing standards of today and the next generation of standards solving complex problems through analysis automation.

  11. Well test imaging - a new method for determination of boundaries from well test data

    Energy Technology Data Exchange (ETDEWEB)

    Slevinsky, B.A.

    1997-08-01

    A new method has been developed for analysis of well test data, which allows the direct calculation of the location of arbitrary reservoir boundaries which are detected during a well test. The method is based on elements of ray tracing and information theory, and is centered on the calculation of an instantaneous {open_quote}angle of view{close_quote} of the reservoir boundaries. In the absence of other information, the relative reservoir shape and boundary distances are retrievable in the form of a Diagnostic Image. If other reservoir information, such as 3-D seismic, is available; the full shape and orientation of arbitrary (non-straight line or circular arc) boundaries can be determined in the form of a Reservoir Image. The well test imaging method can be used to greatly enhance the information available from well tests and other geological data, and provides a method to integrate data from multiple disciplines to improve reservoir characterization. This paper covers the derivation of the analytical technique of well test imaging and shows examples of application of the technique to a number of reservoirs.

  12. Standard test methods for bend testing of metallic flat materials for spring applications involving static loading

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This standard describes three test methods for determining the modulus of elasticity in bending and the bending strength of metallic strips or sheets intended for the use in flat springs: 1.1.1 Test Method A—a cantilever beam, 1.1.2 Test Method B—a three-point loaded beam (that is, a beam resting on two supports and centrally loaded), and 1.1.3 Test Method C—a four-point loaded beam (that is, a beam resting on two supports and loaded at two points equally spaced from each support). 1.2 The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. 6.1 This test me...

  13. Standard test method for measuring pH of soil for use in corrosion testing

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1995-01-01

    1.1 This test method covers a procedure for determining the pH of a soil in corrosion testing. The principle use of the test is to supplement soil resistivity measurements and thereby identify conditions under which the corrosion of metals in soil may be accentuated (see G 57 - 78 (1984)). 1.2 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  14. New engine method for biodiesel cetane number testing

    Directory of Open Access Journals (Sweden)

    Pešić Radivoje B.

    2008-01-01

    Full Text Available Substitution of fossil fuels with fuels that come from part renewable sources has been a subject of many studies and researches in the past decade. Considering the higher cost and limits of production resources, a special attention is focused on raising the energy efficiency of biofuel usage, mainly through optimization of the combustion process. Consequently, in biofuel applications, there is a need for determination of auto-ignition quality expressed by cetane number as a dominant characteristic that influences combustion parameters. The fact that the method for cetane number determination is comparative in nature has led us to try to develop substitute engine method for cetane number determination, by the use of the available laboratory equipment and serial, mono-cylinder engine with direct injection, DMB LDA 450. Description of the method, results of optimization of engine’s working parameters for conduction of the test and method’s Accuracy estimation are given in the paper. The paper also presents the results of domestic biodiesel fuels cetane number testing with the application of described engine method, developed at the Laboratory for internal combustion engines and fuels and lubricants of the Faculty of Mechanical Engineering from Kragujevac, Serbia.

  15. Integrated circuit test-port architecture and method and apparatus of test-port generation

    Science.gov (United States)

    Teifel, John

    2016-04-12

    A method and apparatus are provided for generating RTL code for a test-port interface of an integrated circuit. In an embodiment, a test-port table is provided as input data. A computer automatically parses the test-port table into data structures and analyzes it to determine input, output, local, and output-enable port names. The computer generates address-detect and test-enable logic constructed from combinational functions. The computer generates one-hot multiplexer logic for at least some of the output ports. The one-hot multiplexer logic for each port is generated so as to enable the port to toggle between data signals and test signals. The computer then completes the generation of the RTL code.

  16. Neuronal RING finger protein 11 (RNF11 regulates canonical NF-κB signaling

    Directory of Open Access Journals (Sweden)

    Pranski Elaine L

    2012-04-01

    Full Text Available Abstract Background The RING domain-containing protein RING finger protein 11 (RNF11 is a member of the A20 ubiquitin-editing protein complex and modulates peripheral NF-κB signaling. RNF11 is robustly expressed in neurons and colocalizes with a population of α-synuclein-positive Lewy bodies and neurites in Parkinson disease patients. The NF-κB pathway has an important role in the vertebrate nervous system, where the absence of NF-κB activity during development can result in learning and memory deficits, whereas chronic NF-κB activation is associated with persistent neuroinflammation. We examined the functional role of RNF11 with respect to canonical NF-κB signaling in neurons to gain understanding of the tight association of inflammatory pathways, including NF-κB, with the pathogenesis of neurodegenerative diseases. Methods and results Luciferase assays were employed to assess NF-κB activity under targeted short hairpin RNA (shRNA knockdown of RNF11 in human neuroblastoma cells and murine primary neurons, which suggested that RNF11 acts as a negative regulator of canonical neuronal NF-κB signaling. These results were further supported by analyses of p65 translocation to the nucleus following depletion of RNF11. Coimmunoprecipitation experiments indicated that RNF11 associates with members of the A20 ubiquitin-editing protein complex in neurons. Site-directed mutagenesis of the myristoylation domain, which is necessary for endosomal targeting of RNF11, altered the impact of RNF11 on NF-κB signaling and abrogated RNF11’s association with the A20 ubiquitin-editing protein complex. A partial effect on canonical NF-κB signaling and an association with the A20 ubiquitin-editing protein complex was observed with mutagenesis of the PPxY motif, a proline-rich region involved in Nedd4-like protein interactions. Last, shRNA-mediated reduction of RNF11 in neurons and neuronal cell lines elevated levels of monocyte chemoattractant protein 1 and

  17. Finite test sets development method for test execution of safety critical software

    International Nuclear Information System (INIS)

    Shin, Sung Min; Kim, Hee Eun; Kang, Hyun Gook; Lee, Sung Jiun

    2014-01-01

    The V and V method has been utilized for this safety critical software, while SRGM has difficulties because of lack of failure occurrence data on developing phase. For the safety critical software, however, failure data cannot be gathered after installation in real plant when we consider the severe consequence. Therefore, to complement the V and V method, the test-based method need to be developed. Some studies on test-based reliability quantification method for safety critical software have been conducted in nuclear field. These studies provide useful guidance on generating test sets. An important concept of the guidance is that the test sets represent 'trajectories' (a series of successive values for the input variables of a program that occur during the operation of the software over time) in the space of inputs to the software.. Actually, the inputs to the software depends on the state of plant at that time, and these inputs form a new internal state of the software by changing values of some variables. In other words, internal state of the software at specific timing depends on the history of past inputs. Here the internal state of the software which can be changed by past inputs is named as Context of Software (CoS). In a certain CoS, a software failure occurs when a fault is triggered by some inputs. To cover the failure occurrence mechanism of a software, preceding researches insist that the inputs should be a trajectory form. However, in this approach, there are two critical problems. One is the length of the trajectory input. Input trajectory should long enough to cover failure mechanism, but the enough length is not clear. What is worse, to cover some accident scenario, one set of input should represent dozen hours of successive values. The other problem is number of tests needed. To satisfy a target reliability with reasonable confidence level, very large number of test sets are required. Development of this number of test sets is a herculean

  18. Test Methods for Evaluating Solid Waste, Physical/Chemical Methods. First Update. (3rd edition)

    International Nuclear Information System (INIS)

    Friedman; Sellers.

    1988-01-01

    The proposed Update is for Test Methods for Evaluating Solid Waste, Physical/Chemical Methods, SW-846, Third Edition. Attached to the report is a list of methods included in the proposed update indicating whether the method is a new method, a partially revised method, or a totally revised method. Do not discard or replace any of the current pages in the SW-846 manual until the proposed update I package is promulgated. Until promulgation of the update package, the methods in the update package are not officially part of the SW-846 manual and thus do not carry the status of EPA-approved methods. In addition to the proposed Update, six finalized methods are included for immediate inclusion into the Third Edition of SW-846. Four methods, originally proposed October 1, 1984, will be finalized in a soon to be released rulemaking. They are, however, being submitted to subscribers for the first time in the update. These methods are 7211, 7381, 7461, and 7951. Two other methods were finalized in the 2nd Edition of SW-846. They were inadvertantly omitted from the 3rd Edition and are not being proposed as new. These methods are 7081 and 7761

  19. Phototoxicity: Its Mechanism and Animal Alternative Test Methods

    Science.gov (United States)

    Park, Hyeonji; Lim, Kyung-Min

    2015-01-01

    The skin exposure to solar irradiation and photoreactive xenobiotics may produce abnormal skin reaction, phototoxicity. Phototoxicity is an acute light-induced response, which occurs when photoreacive chemicals are activated by solar lights and transformed into products cytotoxic against the skin cells. Multifarious symptoms of phototoxicity are identified, skin irritation, erythema, pruritis, and edema that are similar to those of the exaggerated sunburn. Diverse organic chemicals, especially drugs, are known to induce phototoxicity, which is probably from the common possession of UV-absorbing benzene or heterocyclic rings in their molecular structures. Both UVB (290~320 nm) and UVA (320~400 nm) are responsible for the manifestation of phototoxicity. Absorption of photons and absorbed energy (hv) by photoactive chemicals results in molecular changes or generates reactive oxygen species and depending on the way how endogenous molecules are affected by phototoxicants, mechanisms of phototoxcity is categorized into two modes of action: Direct when unstable species from excited state directly react with the endogenous molecules, and indirect when endogeneous molecules react with secondary photoproducts. In order to identify phototoxic potential of a chemical, various test methods have been introduced. Focus is given to animal alternative test methods, i.e., in vitro, and in chemico assays as well as in vivo. 3T3 neutral red uptake assay, erythrocyte photohemolysis test, and phototoxicity test using human 3-dimensional (3D) epidermis model are examples of in vitro assays. In chemico methods evaluate the generation of reactive oxygen species or DNA strand break activity employing plasmid for chemicals, or drugs with phototoxic potential. PMID:26191378

  20. NiO-NF/MWCNT nanocomposite catalyst as a counter electrode for high performance dye-sensitized solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Raissan Al-bahrani, Majid [Center for Nanoscale Characterization & Devices (CNCD), Wuhan National Laboratory for Optoelectronics (WNLO)-School of Physics, Huazhong University of Science and Technology - HUST, Luoyu Road 1037, Wuhan 430074 (China); Faculty of Science, Thi-Qar University, Nassiriya (Iraq); Liu, Linfeng [Michael Grätzel Center for Mesoscopic Solar Cells, Wuhan National Laboratory for Optoelectronics, Huazhong University of Science and Technology, 1037 Luoyu Road, Wuhan 430074 (China); Ahmad, Waqar; Tao, Jiayou; Tu, Fanfan [Center for Nanoscale Characterization & Devices (CNCD), Wuhan National Laboratory for Optoelectronics (WNLO)-School of Physics, Huazhong University of Science and Technology - HUST, Luoyu Road 1037, Wuhan 430074 (China); Cheng, Ze [School of Physics, Huazhong University of Science and Technology (HUST), Luoyu Road 1037, Wuhan 430074 (China); Gao, Yihua, E-mail: gaoyihua@hust.edu.cn [Center for Nanoscale Characterization & Devices (CNCD), Wuhan National Laboratory for Optoelectronics (WNLO)-School of Physics, Huazhong University of Science and Technology - HUST, Luoyu Road 1037, Wuhan 430074 (China)

    2015-03-15

    Highlights: • High-performance NiO-NF/MWCNT CE was incorporated in a Pt-CE in DSSCs. • NiO-NF/MWCNT CE exhibits a high power conversion efficiency (PCE) of 7.63%. • NiO-NF/MWCNT composite has a high catalytic activity for the reduction of I{sub 3}{sup −}. • NiO-NF/MWCNT composite has a low R{sub ct} on the electrolyte/CE interface. - Abstract: In this paper, we fabricated nickel oxide nanofilament/multiwall carbon nanotubes (NiO-NF/MWCNT) nanocomposite by a simple hydrothermal synthesis method as a counter- electrode (CE) in a dye-sensitized solar cell (DSSC). Transmission electron microscopy, scanning electron microscopy images and X-ray diffraction analysis clearly indicated the formation of NiO-NF/MWCNT nanocomposite. The electro-chemical properties of NiO-NF/MWCNT CE are studied by cyclic voltammetry and electrochemical impedance spectroscopy. In particular, current-voltage measurements indicated superior power conversion efficiency (PCE) of 7.63% of the NiO-NF/MWCNT CE compared to 6.72% for the platinum (Pt). The superior photovoltaic performance and low cost of the NiO-NF/MWCNT nanocomposite can be potentially exploited as a new counter-electrode in DSSCs.

  1. NiO-NF/MWCNT nanocomposite catalyst as a counter electrode for high performance dye-sensitized solar cells

    International Nuclear Information System (INIS)

    Raissan Al-bahrani, Majid; Liu, Linfeng; Ahmad, Waqar; Tao, Jiayou; Tu, Fanfan; Cheng, Ze; Gao, Yihua

    2015-01-01

    Highlights: • High-performance NiO-NF/MWCNT CE was incorporated in a Pt-CE in DSSCs. • NiO-NF/MWCNT CE exhibits a high power conversion efficiency (PCE) of 7.63%. • NiO-NF/MWCNT composite has a high catalytic activity for the reduction of I 3 − . • NiO-NF/MWCNT composite has a low R ct on the electrolyte/CE interface. - Abstract: In this paper, we fabricated nickel oxide nanofilament/multiwall carbon nanotubes (NiO-NF/MWCNT) nanocomposite by a simple hydrothermal synthesis method as a counter- electrode (CE) in a dye-sensitized solar cell (DSSC). Transmission electron microscopy, scanning electron microscopy images and X-ray diffraction analysis clearly indicated the formation of NiO-NF/MWCNT nanocomposite. The electro-chemical properties of NiO-NF/MWCNT CE are studied by cyclic voltammetry and electrochemical impedance spectroscopy. In particular, current-voltage measurements indicated superior power conversion efficiency (PCE) of 7.63% of the NiO-NF/MWCNT CE compared to 6.72% for the platinum (Pt). The superior photovoltaic performance and low cost of the NiO-NF/MWCNT nanocomposite can be potentially exploited as a new counter-electrode in DSSCs

  2. A Test Method for Monitoring Modulus Changes during Durability Tests on Building Joint Sealants

    Science.gov (United States)

    Christopher C. White; Donald L. Hunston; Kar Tean Tan; Gregory T. Schueneman

    2012-01-01

    The durability of building joint sealants is generally assessed using a descriptive methodology involving visual inspection of exposed specimens for defects. It is widely known that this methodology has inherent limitations, including that the results are qualitative. A new test method is proposed that provides more fundamental and quantitative information about...

  3. Standard test method for electrochemical critical pitting temperature testing of stainless steels

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1999-01-01

    1.1 This test method covers a procedure for the evaluation of the resistance of stainless steel and related alloys to pitting corrosion based on the concept of the determination of a potential independent critical pitting temperature (CPT). 1.2 This test methods applies to wrought and cast products including but not restricted to plate, sheet, tubing, bar, forgings, and welds, (see Note 1). Note 1—Examples of CPT measurements on sheet, plate, tubing, and welded specimens for various stainless steels can be found in Ref (1). See the research reports (Section 14). 1.3 The standard parameters recommended in this test method are suitable for characterizing the CPT of austenitic stainless steels and other related alloys with a corrosion resistance ranging from that corresponding to solution annealed UNS S31600 (Type 316 stainless steel) to solution annealed UNS S31254 (6 % Mo stainless steel). 1.4 This test method may be extended to stainless steels and other alloys related to stainless steel that have a CPT...

  4. 40 CFR 60.1300 - What test methods must I use to stack test?

    Science.gov (United States)

    2010-07-01

    ...) to calculate emission levels at 7 percent oxygen (or an equivalent carbon dioxide basis), the percent... subpart. (c) Obtain an oxygen (or carbon dioxide) measurement at the same time as your pollutant... 40 Protection of Environment 6 2010-07-01 2010-07-01 false What test methods must I use to stack...

  5. 40 CFR 62.15245 - What test methods must I use to stack test?

    Science.gov (United States)

    2010-07-01

    ... emission limits in tables 2 and 4 of this subpart. (c) Obtain an oxygen (or carbon dioxide) measurement at... equivalent carbon dioxide basis), the percent reduction in potential hydrogen chloride emissions, and the... 40 Protection of Environment 8 2010-07-01 2010-07-01 false What test methods must I use to stack...

  6. A well test analysis method accounting for pre-test operations

    International Nuclear Information System (INIS)

    Silin, D.B.; Tsang, C.-F.

    2003-01-01

    We propose to use regular monitoring data from a production or injection well for estimating the formation hydraulic properties in the vicinity of the wellbore without interrupting the operations. In our approach, we select a portion of the pumping data over a certain time interval and then derive our conclusions from analysis of these data. A distinctive feature of the proposed approach differing it form conventional methods is in the introduction of an additional parameter, an effective pre-test pumping rate. The additional parameter is derived based on a rigorous asymptotic analysis of the flow model. Thus, we account for the non-uniform pressure distribution at the beginning of testing time interval caused by pre-test operations at the well. By synthetic and field examples, we demonstrate that deviation of the matching curve from the data that is usually attributed to skin and wellbore storage effects, can also be interpreted through this new parameter. Moreover, with our method, the data curve is matched equally well and the results of the analysis remain stable when the analyzed data interval is perturbed, whereas traditional methods are sensitive to the choice of the data interval. A special efficient minimization procedure has been developed for searching the best fitting parameters. We enhanced our analysis above with a procedure of estimating ambient reservoir pressure and dimensionless wellbore radius. The methods reported here have been implemented in code ODA (Operations Data Analysis). A beta version of the code is available for free testing and evaluation to interested parties

  7. Standard Test Method for Hot Spot Protection Testing of Photovoltaic Modules

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This test method provides a procedure to determine the ability of a photovoltaic (PV) module to endure the long-term effects of periodic “hot spot” heating associated with common fault conditions such as severely cracked or mismatched cells, single-point open circuit failures (for example, interconnect failures), partial (or non-uniform) shadowing or soiling. Such effects typically include solder melting or deterioration of the encapsulation, but in severe cases could progress to combustion of the PV module and surrounding materials. 1.2 There are two ways that cells can cause a hot spot problem; either by having a high resistance so that there is a large resistance in the circuit, or by having a low resistance area (shunt) such that there is a high-current flow in a localized region. This test method selects cells of both types to be stressed. 1.3 This test method does not establish pass or fail levels. The determination of acceptable or unacceptable results is beyond the scope of this test method....

  8. Standard test method for K-R curve determination

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers the determination of the resistance to fracture of metallic materials under Mode I loading at static rates using either of the following notched and precracked specimens: the middle-cracked tension M(T) specimen or the compact tension C(T) specimen. A K-R curve is a continuous record of toughness development (resistance to crack extension) in terms of KR plotted against crack extension in the specimen as a crack is driven under an increasing stress intensity factor, K. 1.2 Materials that can be tested for K-R curve development are not limited by strength, thickness, or toughness, so long as specimens are of sufficient size to remain predominantly elastic to the effective crack extension value of interest. 1.3 Specimens of standard proportions are required, but size is variable, to be adjusted for yield strength and toughness of the materials. 1.4 Only two of the many possible specimen types that could be used to develop K-R curves are covered in this method. 1.5 The test is app...

  9. Mycobacteria: laboratory methods for testing drug sensitivity and resistance

    Science.gov (United States)

    Canetti, G.; Froman, S.; Grosset, J.; Hauduroy, P.; Langerová, Miloslava; Mahler, H. T.; Meissner, Gertrud; Mitchison, D. A.; Šula, L.

    1963-01-01

    In its seventh report, published in 1960, the WHO Expert Committee on Tuberculosis “noted the need for international standards for the definition and determination of drug resistance which will permit comparisons to be made from one area to another, and recommended that the World Health Organization take appropriate steps to establish such standards”.10 Acting on this recommendation, WHO took the first step towards standardization by convening in Geneva, in December 1961, an informal international meeting of specialists in the bacteriology of tuberculosis. At this meeting an attempt was made to formulate prerequisites for reliable sensitivity tests and to specify the technical procedures for them. The first part of the present paper is a joint contribution by the participants in the meeting, summarizing the general conclusions reached and recommendations made with regard to tests of sensitivity to the three main antituberculosis drugs—isoniazid, streptomycin and p-aminosalicylic acid. The other three parts describe, in turn, three different tests for determining drug sensitivity—the absolute-concentration method, the resistance-ratio method and the proportion method—that are generally considered to give reasonably accurate results. PMID:14102034

  10. A SPICE Blind Test to Benchmark Global Tomographic Methods

    Science.gov (United States)

    Qin, Y.; Capdeville, Y.; Maupin, V.; Montagner, J.

    2006-12-01

    The different existing global tomographic methods result in different models of the Earth. In order to test how current imaging techniques are limited by approximations in theory and the inadequacy of data quality and coverage, we are undertaking a blind test of global inversion algorithms using complete 3D synthetic seismograms within SPICE (Seismic wave Propagation and Imaging in Complex media: a European network). First, a complex global anisotropic anelastic model has been constructed by summing the 1D reference model, deterministic and random anomalies and anisotropic crystal. This model includes 3D heterogeneities in velocity, anisotropy and attenuation at different scales in the whole mantle, as well as topography and crustal structure. In addition, the rotation and ellipticity are also included. Synthetic seismograms were generated using the Coupling Spectral Element Method with a minimum period of 32s, for a realistic distribution of 29 events and 256 stations. The synthetic seismograms have been made available to the scientific community worldwide at the IPGP website http://www.ipgp.jussieu.fr/~qyl/. Any group willing to test his tomographic technique is encouraged to download the synthetic dataset.g

  11. Harmonic Adaptability Remote Testing Method for Offshore Wind Turbines

    Directory of Open Access Journals (Sweden)

    Zimin Jiang

    2017-11-01

    Full Text Available Harmonic adaptability (HA capability is required for large-scale onshore and offshore wind turbines (WTs connected to the grid. To ensure that the distortion of the harmonic voltage at the grid access point generated by grid simulator is in accordance with the required value, this paper proposes an on-site HA remote testing method for offshore WTs to eliminate submarine cable effects. The deviation compensation method detects the integer harmonic voltage distortion based on instantaneous reactive power theory, and the deviation from the required value is compensated by series active power filter. In order to further reduce the capacity of the designed device, integer harmonics close to the resonant frequency are suppressed by the selective harmonic damping (SHD method initially. Owing to the attenuation of extreme amplification, the deviation determining the equipment capacity is decreased correspondingly. As a small synthesized impedance working for the selected frequency can suppress the amplification significantly, a low power ratings design for the SHD method can be achieved, and undesired resonance can be avoided. Simulation results indicate that the proposed method can make the harmonic distortion within the error tolerance.

  12. Standard test method for measurement of soil resistivity using the two-electrode soil box method

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers the equipment and a procedure for the measurement of soil resistivity, for samples removed from the ground, for use in the control of corrosion of buried structures. 1.2 Procedures allow for this test method to be used n the field or in the laboratory. 1.3 The test method procedures are for the resistivity measurement of soil samples in the saturated condition and in the as-received condition. 1.4 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information only. Soil resistivity values are reported in ohm-centimeter. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and to determine the applicability of regulatory limitations prior to use.

  13. Parametric effects on glass reaction in the unsaturated test method

    Energy Technology Data Exchange (ETDEWEB)

    Woodland, A.B.; Bates, J.K.; Gerding, T.J.

    1991-12-01

    The Unsaturated Test Method has been applied to study glass reaction under conditions that may be present at the potential Yucca Mountain site, currently under evaluation for storage of reprocessed high-level nuclear waste. The results from five separate sets of parametric experiments are presented wherein test parameters ranging from water contact volume to sensitization of metal in contact with the glass were examined. The most significant effect was observed when the volume of water, as controlled by the water inject volume and interval period, was such to allow exfoliation of reacted glass to occur. The extent of reaction was also influenced to a lesser extent by the degree of sensitization of the 304L stainless steel. For each experiment, the release of cations from the glass and alteration of the glass were examined. The major alteration product is a smectite clay that forms both from precipitation from solution and from in-situ alteration of the glass itself. It is this clay that undergoes exfoliation as water drips from the glass. A comparison is made between the results of the parametric experiments with those of static leach tests. In the static tests the rates of release become progressively reduced through 39 weeks while, in contrast, they remain relatively constant in the parametric experiments for at least 300 weeks. This differing behavior may be attributable to the dripping water environment where fresh water is periodically added and where evaporation can occur.

  14. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  15. Method and data analysis example of fatigue tests

    International Nuclear Information System (INIS)

    Nogami, Shuhei

    2015-01-01

    In the design and operation of a nuclear fusion reactor, it is important to accurately assess the fatigue life. Fatigue life is evaluated by preparing a database on the relationship between the added stress / strain amplitude and the number of cycles to failure based on the fatigue tests on standard specimens, and by comparing this relationship with the generated stress / strain of the actual constructions. This paper mainly chooses low-cycle fatigue as an object, and explains standard test methods, fatigue limit, life prediction formula and the like. Using reduced-activation ferrite steel F82H as a material, strain controlled low-cycle fatigue test was performed under room temperature atmosphere. From these results, the relationship between strain and the number of cycles to failure was analyzed. It was found that the relationship is asymptotic to the formula of Coffin-Manson Law under high-strain (low-cycle condition), and asymptotic to the formula of Basquin Law under low-strain (high-cycle condition). For F82H to be used for the blanket of a nuclear fusion prototype reactor, the arrangement of fatigue life data up to about 700°C and the establishment of optimal fatigue design curves are urgent tasks. As for fusion reactor structural materials, the evaluation of neutron irradiation effect on fatigue damage behavior and life is indispensable. For this purpose, it is necessary to establish standardized testing techniques when applied to small specimens. (A.O.)

  16. An improved method/setup for extended testing after the Cigre, Method II

    DEFF Research Database (Denmark)

    Henriksen, Mogens; Holbøll, Joachim; Rygal, Roman

    1992-01-01

    protection of the different test objects, and the sample production and preparation, among others, were of the utmost importance for the end results of this test. Results of using the system on epoxy with and without fillers are presented. Based on these results, the critical points of the method...... are discussed. The application of the system showed typical behavior of the discharges and lifetimes that was strongly dependent on the filler type...

  17. Standard Test Method for Laboratory Aging of Sandwich Constructions

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1999-01-01

    1.1 This test method covers the determination of the resistance of sandwich panels to severe exposure conditions as measured by the change in selected properties of the material after exposure. The exposure cycle to which the specimen is subjected is an arbitrary test having no correlation with natural weathering conditions. 1.2 The values stated in SI units are to be regarded as the standard. The inch-pound units given may be approximate. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  18. Mice with missense and nonsense NF1 mutations display divergent phenotypes compared with human neurofibromatosis type I

    Directory of Open Access Journals (Sweden)

    Kairong Li

    2016-07-01

    Full Text Available Neurofibromatosis type 1 (NF1 is a common genetic disorder characterized by the occurrence of nerve sheath tumors and considerable clinical heterogeneity. Some translational studies have been limited by the lack of animal models available for assessing patient-specific mutations. In order to test therapeutic approaches that might restore function to the mutated gene or gene product, we developed mice harboring NF1 patient-specific mutations including a nonsense mutation (c.2041C>T; p.Arg681* and a missense mutation (c.2542G>C; p.Gly848Arg. The latter is associated with the development of multiple plexiform neurofibromas along spinal nerve roots. We demonstrate that the human nonsense NF1Arg681* and missense NF1Gly848Arg mutations have different effects on neurofibromin expression in the mouse and each recapitulates unique aspects of the NF1 phenotype, depending upon the genetic context when assessed in the homozygous state or when paired with a conditional knockout allele. Whereas the missense Nf1Gly848Arg mutation fails to produce an overt phenotype in the mouse, animals homozygous for the nonsense Nf1Arg681* mutation are not viable. Mice with one Nf1Arg681* allele in combination with a conditional floxed Nf1 allele and the DhhCre transgene (Nf14F/Arg681*; DhhCre display disorganized nonmyelinating axons and neurofibromas along the spinal column, which leads to compression of the spinal cord and paralysis. This model will be valuable for preclinical testing of novel nonsense suppression therapies using drugs to target in-frame point mutations that create premature termination codons in individuals with NF1.

  19. Alternative Testing Methods for Predicting Health Risk from Environmental Exposures

    Directory of Open Access Journals (Sweden)

    Annamaria Colacci

    2014-08-01

    Full Text Available Alternative methods to animal testing are considered as promising tools to support the prediction of toxicological risks from environmental exposure. Among the alternative testing methods, the cell transformation assay (CTA appears to be one of the most appropriate approaches to predict the carcinogenic properties of single chemicals, complex mixtures and environmental pollutants. The BALB/c 3T3 CTA shows a good degree of concordance with the in vivo rodent carcinogenesis tests. Whole-genome transcriptomic profiling is performed to identify genes that are transcriptionally regulated by different kinds of exposures. Its use in cell models representative of target organs may help in understanding the mode of action and predicting the risk for human health. Aiming at associating the environmental exposure to health-adverse outcomes, we used an integrated approach including the 3T3 CTA and transcriptomics on target cells, in order to evaluate the effects of airborne particulate matter (PM on toxicological complex endpoints. Organic extracts obtained from PM2.5 and PM1 samples were evaluated in the 3T3 CTA in order to identify effects possibly associated with different aerodynamic diameters or airborne chemical components. The effects of the PM2.5 extracts on human health were assessed by using whole-genome 44 K oligo-microarray slides. Statistical analysis by GeneSpring GX identified genes whose expression was modulated in response to the cell treatment. Then, modulated genes were associated with pathways, biological processes and diseases through an extensive biological analysis. Data derived from in vitro methods and omics techniques could be valuable for monitoring the exposure to toxicants, understanding the modes of action via exposure-associated gene expression patterns and to highlight the role of genes in key events related to adversity.

  20. Standard Test Method for Abrasive Wear Resistance of Cemented

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers the determination of abrasive wear resistance of cemented carbides. 1.2 The values stated in inch-pound units are to be regarded as the standard. The SI equivalents of inch-pound units are in parentheses and may be approximate. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  1. Method of monitoring, inspecting or testing conveyor belts

    International Nuclear Information System (INIS)

    Van der Walt, A.J.

    1985-01-01

    An invention is discussed which provides a method, installation and kit for monitoring, inspecting or testing a conveyor belt. Provision is made to transmit penetrating rays such as X-rays through a moving conveyor belt, forming a visible moving image from rays transmitted through the belt, and visually inspecting such moving image, after recording it if desired, to ascertain the condition of the interior of the belt. Typically an X-ray tube head is used to transmit the rays through the belt to a fluorescent screen which forms the image. The moving image can be recorded by means of a video camera

  2. Field Testing of Compartmentalization Methods for Multifamily Construction

    Energy Technology Data Exchange (ETDEWEB)

    Ueno, K. [Building Science Corporation, Westford, MA (United States); Lstiburek, J. W. [Building Science Corporation, Westford, MA (United States)

    2015-03-01

    The 2012 International Energy Conservation Code (IECC) has an airtightness requirement of 3 air changes per hour at 50 Pascals test pressure (3 ACH50) for single-family and multifamily construction (in climate zones 3–8). The Leadership in Energy & Environmental Design certification program and ASHRAE Standard 189 have comparable compartmentalization requirements. ASHRAE Standard 62.2 will soon be responsible for all multifamily ventilation requirements (low rise and high rise); it has an exceptionally stringent compartmentalization requirement. These code and program requirements are driving the need for easier and more effective methods of compartmentalization in multifamily buildings.

  3. Standard Test Method for Measured Speed of Oil Diffusion Pumps

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1982-01-01

    1.1 This test method covers the determination of the measured speed (volumetric flow rate) of oil diffusion pumps. 1.2 The values stated in inch-pound units are to be regarded as the standard. The metric equivalents of inch-pound units may be approximate. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  4. Standard Test Method for Determining Poisson's Ratio of Honeycomb Cores

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 This test method covers the determination of the honeycomb Poisson's ratio from the anticlastic curvature radii, see . 1.2 The values stated in SI units are to be regarded as the standard. The inch-pound units given may be approximate. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  5. Standard Test Method for Shear Fatigue of Sandwich Core Materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2000-01-01

    1.1 This test method covers determination of the effect of repeated shear loads on sandwich core materials. 1.2 The values stated in SI units are to be regarded as the standard. The inch-pound units given may be approximate. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  6. Standard Test Method for Dimensional Stability of Sandwich Core Materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 This test method covers the determination of the sandwich core dimensional stability in the two plan dimensions. 1.2 The values stated in SI units are to be regarded as the standard. The inch-pound units given may be approximate. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  7. Conceptual framework for the thermal distribution method of test

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, J.W.

    1994-11-01

    A Standard Method of Test for residential thermal distribution efficiency is being developed under the auspices of the American Society of Heating, Refrigerating, and Air-Conditioning Engineers (ASHRAE). Thermal distribution systems are the ductwork, piping, or other means used to transport heat or cooling effect from the equipment that produces this thermal energy to the building spaces that need it. Because thermal distribution systems are embedded in and interact with the larger building system as a whole, a new set of parameters has been developed to describe these systems. This paper was written to fill a perceived need for a concise introduction to this terminology.

  8. Standard test method for distribution coefficients of inorganic species by the batch method

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers the determination of distribution coefficients of chemical species to quantify uptake onto solid materials by a batch sorption technique. It is a laboratory method primarily intended to assess sorption of dissolved ionic species subject to migration through pores and interstices of site specific geomedia. It may also be applied to other materials such as manufactured adsorption media and construction materials. Application of the results to long-term field behavior is not addressed in this method. Distribution coefficients for radionuclides in selected geomedia are commonly determined for the purpose of assessing potential migratory behavior of contaminants in the subsurface of contaminated sites and waste disposal facilities. This test method is also applicable to studies for parametric studies of the variables and mechanisms which contribute to the measured distribution coefficient. 1.2 The values stated in SI units are to be regarded as standard. No other units of measurement a...

  9. Collection and cultivation methods of Acartia tonsa for toxicity testing

    Energy Technology Data Exchange (ETDEWEB)

    Hood, C.A. [Baker Hughes INTEQ, Houston, TX (United States); Mayo, R.R. [ENSR Environmental Toxicology Lab., Houston, TX (United States)

    1995-12-31

    Acartia tonsa were located and collected from Galveston Bay, Texas in June 1995, using plankton nets and transported to the laboratory for culture. After literature searching and laboratory experimentation. A simple reliable method was designed to culture A. tonsa. This method requires a minimum of glassware and supplies. Adult A. tonsa are placed in one gallon bell jars filled with natural seawater. The jars are then maintained in a water bath at a constant temperature. Water changes are conducted twice weekly and organisms are fed daily with a mixture of algae, Skeletonema costatum, isocrysis galbana, and Thalassiosira sp. Gravid females are then isolated in generators for 24 hours to obtain known age neonates. The neonates are maintained up to a specific age and then are used in toxicity tests such as the ``Determination of the Acute Lethal Toxicity to Marine Copepods,`` required in the United Kingdom for all chemicals used for offshore drilling fluid applications.

  10. Extended Method of Digital Modulation Recognition and Its Testing

    Directory of Open Access Journals (Sweden)

    A. Kubankova

    2011-04-01

    Full Text Available The paper describes a new method for the classification of digital modulations. ASK, 2FSK, 4FSK, MSK, BPSK, QPSK, 8PSK and 16QAM were chosen for recognition as best known digital modulations used in modern communication technologies. The maximum value of the spectral power density of the normalized-centered instantaneous amplitude of the received signal is used to discriminate between frequency modulations (2FSK, 4FSK and MSK on one hand and amplitude and phase modulations (ASK, BPSK, QPSK, 8PSK and 16QAM on the other hand. Then the 2FSK, 4FSK and MSK modulations are classified by means of spectrums. The histograms of the instantaneous phase are used to discriminate between ASK, BPSK, QPSK, 8PSK and 16QAM. The method designed was tested with simulated and measured signals corrupted by white Gaussian noise.

  11. Collection and cultivation methods of Acartia tonsa for toxicity testing

    International Nuclear Information System (INIS)

    Hood, C.A.; Mayo, R.R.

    1995-01-01

    Acartia tonsa were located and collected from Galveston Bay, Texas in June 1995, using plankton nets and transported to the laboratory for culture. After literature searching and laboratory experimentation. A simple reliable method was designed to culture A. tonsa. This method requires a minimum of glassware and supplies. Adult A. tonsa are placed in one gallon bell jars filled with natural seawater. The jars are then maintained in a water bath at a constant temperature. Water changes are conducted twice weekly and organisms are fed daily with a mixture of algae, Skeletonema costatum, isocrysis galbana, and Thalassiosira sp. Gravid females are then isolated in generators for 24 hours to obtain known age neonates. The neonates are maintained up to a specific age and then are used in toxicity tests such as the ''Determination of the Acute Lethal Toxicity to Marine Copepods,'' required in the United Kingdom for all chemicals used for offshore drilling fluid applications

  12. Development of a vacuum leak test method for large-scale superconducting magnet test facilities

    International Nuclear Information System (INIS)

    Kawano, Katsumi; Hamada, Kazuya; Okuno, Kiyoshi; Kato, Takashi

    2006-01-01

    Japan Atomic Energy Agency (JAEA) has developed leak detection technology for liquid helium temperature experiments in large-scale superconducting magnet test facilities. In JAEA, a cryosorption pump that uses an absorbent cooled by liquid nitrogen with a conventional helium leak detector, is used to detect helium gas that is leaking from pressurized welded joints of pipes and valves in a vacuum chamber. The cryosorption pump plays the role of decreasing aerial components, such as water, nitrogen and oxygen, to increase the sensitivity of helium leak detection. The established detection sensitivity for helium leak testing is 10 -10 to 10 -9 Pam 3 /s. A total of 850 welded and mechanical joints inside the cryogenic test facility for the ITER Central Solenoid Model Coil (CSMC) experiments have been tested. In the test facility, 73 units of glass fiber-reinforced plastic (GFRP) insulation break are used. The amount of helium permeation through the GFRP was recorded during helium leak testing. To distinguish helium leaks from insulation-break permeation, the helium permeation characteristic of the GFRP part was measured as a function of the time of helium charging. Helium permeation was absorbed at 6 h after helium charging, and the detected permeation is around 10 -7 Pam 3 /s. Using the helium leak test method developed, CSMC experiments have been successfully completed. (author)

  13. Bee venom ameliorates lipopolysaccharide-induced memory loss by preventing NF-kappaB pathway

    OpenAIRE

    Gu, Sun Mi; Park, Mi Hee; Hwang, Chul Ju; Song, Ho Sueb; Lee, Ung Soo; Han, Sang Bae; Oh, Ki Wan; Ham, Young Wan; Song, Min Jong; Son, Dong Ju; Hong, Jin Tae

    2015-01-01

    Background Accumulation of beta-amyloid and neuroinflammation trigger Alzheimer?s disease. We previously found that lipopolysaccharide (LPS) caused neuroinflammation with concomitant accumulation of beta-amyloid peptides leading to memory loss. A variety of anti-inflammatory compounds inhibiting nuclear factor kappaB (NF-?B) activation have showed efficacy to hinder neuroinflammation and amyloidogenesis. We also found that bee venom (BV) inhibits NF-?B. Methods A mouse model of LPS-induced me...

  14. Standard Test Method for Oxyacetylene Ablation Testing of Thermal Insulation Materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This test method covers the screening of ablative materials to determine the relative thermal insulation effectiveness when tested as a flat panel in an environment of a steady flow of hot gas provided by an oxyacetylene burner. 1.2 This test method should be used to measure and describe the properties of materials, products, or assemblies in response to heat and flame under controlled laboratory conditions and should not be used to describe or appraise the fire hazard of materials, products, or assemblies under actual fire conditions. However, results of this test method may be used as elements of a fire risk assessment which takes into account all of the factors which are pertinent to an assessment of the fire hazard of a particular end use. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limi...

  15. Functional conservation of rice OsNF-YB/YC and Arabidopsis AtNF-YB/YC proteins in the regulation of flowering time

    KAUST Repository

    Hwang, Yoon-Hyung

    2016-01-11

    Plant NUCLEAR FACTOR Y (NF-Y) transcription factors play important roles in plant development and abiotic stress. In Arabidopsis thaliana, two NF-YB (AtNF-YB2 and AtNF-YB3) and five NF-YC (AtNF-YC1, AtNF-YC2, AtNF-YC3, AtNF-YC4, and AtNF-YC9) genes regulate photoperiodic flowering by interacting with other AtNF-Y subunit proteins. Three rice NF-YB (OsNF-YB8, OsNF-YB10, and OsNF-YB11) and five rice OsNF-YC (OsNF-YC1, OsNF-YC2, OsNF-YC4, OsNF-YC6, and OsNF-YC7) genes are clustered with two AtNF-YB and five AtNF-YC genes, respectively. To investigate the functional conservation of these NF-YB and NF-YC genes in rice and Arabidopsis, we analyzed the flowering phenotypes of transgenic plants overexpressing the respective OsNF-YB and OsNF-YC genes in Arabidopsis mutants. Overexpression of OsNF-YB8/10/11 and OsNF-YC2 complemented the late flowering phenotype of Arabidopsis nf-yb2 nf-yb3 and nf-yc3 nf-yc4 nf-yc9 mutants, respectively. The rescued phenotype of 35S::OsNF-YC2 nf-yc3 nf-yc4 nf-yc9 plants was attributed to the upregulation of FLOWERING LOCUS T (FT) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1). In vitro and in planta protein–protein analyses revealed that OsNF-YB8/10/11 and OsNF-YC1/2/4/6/7 interact with AtNF-YC3/4/9 and AtNF-YB2/3, respectively. Our data indicate that some OsNF-YB and OsNF-YC genes are functional equivalents of AtNF-YB2/3 and AtNF-YC3/4/9 genes, respectively, and suggest functional conservation of Arabidopsis and rice NF-Y genes in the control of flowering time.

  16. Application of reliability analysis method to fusion component testing

    International Nuclear Information System (INIS)

    Ying, A.Y.; Abdou, M.A.

    1994-01-01

    The term reliability here implies that a component satisfies a set of performance criteria while under specified conditions of use over a specified period of time. For fusion nuclear technology, the reliability goal to be pursued is the development of a mean time between failures (MTBF) for a component which is longer than its lifetime goal. While the component lifetime is mainly determined by the fluence limitation (i.e., damage level) which leads to performance degradation or failure, the MTBF represents an arithmetic average life of all units in a population. One method of assessing the reliability goal involves determining component availability needs to meet the goal plant availability, defining a test-analyze-fix development program to improve component reliability, and quantifying both test times and the number of test articles that would be required to ensure that a specified target MTBF is met. Statistically, constant failure rates and exponential life distributions are assumed for analyses and blanket component development is used as an example. However, as data are collected the probability distribution of the parameter of interest can be updated in a Bayesian fashion. The nuclear component testing program will be structured such that reliability requirements for DEMO can be achieved. The program shall not exclude the practice of a good design (such as reducing the complexity of the system to the minimum essential for the required operation), the execution of high quality manufacturing and inspection processes, and the implication of quality assurance and control for component development. In fact, the assurance of a high quality testing/development program is essential so that there is no question left for reliability

  17. An improved dynamic test method for solar collectors

    DEFF Research Database (Denmark)

    Kong, Weiqiang; Wang, Zhifeng; Fan, Jianhua

    2012-01-01

    A comprehensive improvement of the mathematical model for the so called transfer function method is presented in this study. This improved transfer function method can estimate the traditional solar collector parameters such as zero loss coefficient and heat loss coefficient. Two new collector...... parameters t and mfCf are obtained. t is a time scale parameter which can indicate the heat transfer ability of the solar collector. mfCf can be used to calculate the fluid volume content in the solar collector or to validate the regression process by comparing it to the physical fluid volume content...... for the second-order differential term with 6–9min as the best averaging time interval. The measured and predicted collector power output of the solar collector are compared during a test of 13days continuously both for the ITF method and the QDT method. The maximum and averaging error is 53.87W/m2 and 5.22W/m2...

  18. Novel method for pairing wood samples in choice tests.

    Directory of Open Access Journals (Sweden)

    Sebastian Oberst

    Full Text Available Choice tests are a standard method to determine preferences in bio-assays, e.g. for food types and food additives such as bait attractants and toxicants. Choice between food additives can be determined only when the food substrate is sufficiently homogeneous. This is difficult to achieve for wood eating organisms as wood is a highly variable biological material, even within a tree species due to the age of the tree (e.g. sapwood vs. heartwood, and components therein (sugar, starch, cellulose and lignin. The current practice to minimise variation is to use wood from the same tree, yet the variation can still be large and the quantity of wood from one tree may be insufficient. We used wood samples of identical volume from multiple sources, measured three physical properties (dry weight, moisture absorption and reflected light intensity, then ranked and clustered the samples using fuzzy c-means clustering. A reverse analysis of the clustered samples found a high correlation between their physical properties and their source of origin. This suggested approach allows a quantifiable, consistent, repeatable, simple and quick method to maximize control over similarity of wood used in choice tests.

  19. Testing System Encryption-Decryption Method to RSA Security Documents

    International Nuclear Information System (INIS)

    Supriyono

    2008-01-01

    A model of document protection which was tested as one of the instruments, especially text document. The principle of the document protection was how the system was able to protect the document storage and transfer processes. Firstly, the text-formed document was encrypted; therefore, the document cannot be read for the text was transformed into random letters. The letter-randomized text was then unfolded by the description in order that the document owner was able to read it. In the recent research, the method adopted was RSA method, in which it used complicated mathematics calculation and equipped with initial protection key (with either private key or public key), thus, it was more difficult to be attacked by hackers. The system was developed by using the software of Borland Delphi 7. The results indicated that the system was capable to save and transfer the document, both via internet and intranet in the form of encrypted letter and put it back to the initial form of document by way of description. The research also tested for encrypted and decrypted process for various memory size documents. (author)

  20. Data processing device test apparatus and method therefor

    Science.gov (United States)

    Wilcox, Richard Jacob; Mulig, Jason D.; Eppes, David; Bruce, Michael R.; Bruce, Victoria J.; Ring, Rosalinda M.; Cole, Jr., Edward I.; Tangyunyong, Paiboon; Hawkins, Charles F.; Louie, Arnold Y.

    2003-04-08

    A method and apparatus mechanism for testing data processing devices are implemented. The test mechanism isolates critical paths by correlating a scanning microscope image with a selected speed path failure. A trigger signal having a preselected value is generated at the start of each pattern vector. The sweep of the scanning microscope is controlled by a computer, which also receives and processes the image signals returned from the microscope. The value of the trigger signal is correlated with a set of pattern lines being driven on the DUT. The trigger is either asserted or negated depending the detection of a pattern line failure and the particular line that failed. In response to the detection of the particular speed path failure being characterized, and the trigger signal, the control computer overlays a mask on the image of the device under test (DUT). The overlaid image provides a visual correlation of the failure with the structural elements of the DUT at the level of resolution of the microscope itself.

  1. Teaching Analytical Method Transfer through Developing and Validating Then Transferring Dissolution Testing Methods for Pharmaceuticals

    Science.gov (United States)

    Kimaru, Irene; Koether, Marina; Chichester, Kimberly; Eaton, Lafayette

    2017-01-01

    Analytical method transfer (AMT) and dissolution testing are important topics required in industry that should be taught in analytical chemistry courses. Undergraduate students in senior level analytical chemistry laboratory courses at Kennesaw State University (KSU) and St. John Fisher College (SJFC) participated in development, validation, and…

  2. VALIDATION OF THE ASSR TEST THROUGH COMPLEMENTARY AUDIOLOGYICAL METHODS

    Directory of Open Access Journals (Sweden)

    C. Mârtu

    2016-04-01

    Full Text Available Introduction: Auditory Steady State Response (ASSR is an objective method for determining the auditive threshold, applicable and necessary especially in children. The test is extremely important for recommending cochlear implant in children. The aim of the study was to compare pure tone audiometry responses and auditory steady-state thresholds. Materials and method: The study was performed on a group including both patients with normal hearing and with hearing loss. The main inclusion criteria accepted only patients with normal otomicroscopic aspect, normal tympanogram, capable to respond to pure tone audiometry, and with ear conduction thresholds between 0 and 80 dB NHL. The patients with suppurative otic processes or ear malformations were excluded. The research protocol was followed, the tests being performed in soundproofed rooms, starting with pure tone audiometry followed, after a pause, by ASSR determinations at frequencies of 0.5, 1.2 and 4 KHz. The audiological instruments were provided by a single manufacturer. ASSR was recorded at least two times for both borderline intensities, namely the one defining the auditory threshold and the first no-response intensity. The recorded responses were stored in a database and further processed in Excel. Discussion: The differences observed between pure tone audiometry and ASSR thresholds are important at 500 Hz and insignificant at the other frequencies. When approaching the PTA-ASSR relation, whatever the main characteristic between the PTA and ASSR thresholds in one ear, the profile of the lines gap maintains the same shape on the opposite ear. Conclusions: ASSR is a confident objective test, maintaining attention to low frequencies, where some differences might occur.

  3. ADM guidance-Ceramics: Fracture toughness testing and method selection.

    Science.gov (United States)

    Cesar, Paulo Francisco; Della Bona, Alvaro; Scherrer, Susanne S; Tholey, Michael; van Noort, Richard; Vichi, Alessandro; Kelly, Robert; Lohbauer, Ulrich

    2017-06-01

    The objective is within the scope of the Academy of Dental Materials Guidance Project, which is to provide dental materials researchers with a critical analysis of fracture toughness (FT) tests such that the assessment of the FT of dental ceramics is conducted in a reliable, repeatable and reproducible way. Fracture mechanics theory and FT methodologies were critically reviewed to introduce basic fracture principles and determine the main advantages and disadvantages of existing FT methods from the standpoint of the dental researcher. The recommended methods for FT determination of dental ceramics were the Single Edge "V" Notch Beam (SEVNB), Single Edge Precracked Beam (SEPB), Chevron Notch Beam (CNB), and Surface Crack in Flexure (SCF). SEVNB's main advantage is the ease of producing the notch via a cutting disk, SEPB allows for production of an atomically sharp crack generated by a specific precracking device, CNB is technically difficult, but based on solid fracture mechanics solutions, and SCF involves fracture from a clinically sized precrack. The IF test should be avoided due to heavy criticism that has arisen in the engineering field regarding the empirical nature of the calculations used for FT determination. Dental researchers interested in FT measurement of dental ceramics should start with a broad review of fracture mechanics theory to understand the underlying principles involved in fast fracture of ceramics. The choice of FT methodology should be based on the pros and cons of each test, as described in this literature review. Copyright © 2017 The Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  4. Standard test method for pin-type bearing test of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1984-01-01

    1.1 This test method covers a pin-type bearing test of metallic materials to determine bearing yield strength and bearing strength. Note 1—The presence of incidental lubricants on the bearing surfaces may significantly lower the value of bearing yield strength obtained by this method. 1.2 Units—The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  5. Standard Test Method for Preparing Aircraft Cleaning Compounds, Liquid Type, Water Base, for Storage Stability Testing

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 This test method covers the determination of the stability in storage, of liquid, water-base chemical cleaning compounds, used to clean the exterior surfaces of aircraft. 1.2 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  6. Validation and Verification (V and V) Testing on Midscale Flame Resistant (FR) Test Method

    Science.gov (United States)

    2016-12-16

    person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB control ...roughly equally over the body surface, excluding the hands and feet. The F1930 test method requires a minimum of 100 sensors [1]. If copper slug ...copper slug . In fact, though a large number of sensors is employed, a comparison with the total sensor area with typical numbers for body surface area

  7. Functional Analysis of Drosophila NF1

    National Research Council Canada - National Science Library

    Bernards, Andre

    2005-01-01

    ...) for Ras, yet homozygous loss of a highly conserved Drosophila NF1 ortholog results in several phenotypes that are insensitive to manipulating Ras signal transduction, but rescued by increasing...

  8. Standard Test Method for Hydrophobic Surface Films by the Water-Break Test

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 This test method covers the detection of the presence of hydrophobic (nonwetting) films on surfaces and the presence of hydrophobic organic materials in processing ambients. When properly conducted, the test will enable detection of molecular layers of hydrophobic organic contaminants. On very rough or porous surfaces, the sensitivity of the test may be significantly decreased. 1.2 The values stated in SI units are to be regarded as the standard. The inch-pound values given in parentheses are for information only. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  9. Standard Test Method for Hydrophobic Surface Films by the Atomizer Test

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1965-01-01

    1.1 This test method covers the detection of the presence of hydrophobic (nonwetting) films on surfaces and the presence of hydrophobic organic materials in processing ambients. When properly conducted, the test will enable detection of fractional molecular layers of hydrophobic organic contaminants. On very rough or porous surfaces the sensitivity of the test may be significantly decreased. 1.2 The values stated in inch-pound units are to be regarded as the standard. The values given in parentheses are for information only. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  10. Specific binding-adsorbent assay method and test means

    International Nuclear Information System (INIS)

    1981-01-01

    A description is given of an improved specific binding assay method and test means employing a nonspecific adsorbent for the substance to be determined, particularly hepatitis B surface (HBsub(s)) antigen, in its free state or additionally in the form of its immune complex. The invention is illustrated by 1) the radioimmunoadsorbent assay for HBsub(s) antigen, 2) the radioimmunoadsorbent assay for HBsub(s) antigen in the form of immune complex with antibody, 3) a study of adsorption characteristics of various anion exchange materials for HBsub(s) antigen, 4) the use of hydrophobic adsorbents in a radioimmunoadsorbent assay for HBsub(s) antigen and 5) the radioimmunoadsorbent assay for antibody to HBsub(s) antigen. The advantages of the present method for detecting HBsub(s) antigen compared to previous methods include the manufacturing advantages of eliminating the need for insolubilised anti-HBsub(s) and the advantages of a single incubation step, fewer manipulations, storability of adsorbent materials, increased sensitivity and versatility of detecting HBsub(s) antigen in the form of its immune complex if desired. (U.K.)

  11. Standard test method for measuring waste glass or glass ceramic durability by vapor hydration test

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 The vapor hydration test method can be used to study the corrosion of a waste forms such as glasses and glass ceramics upon exposure to water vapor at elevated temperatures. In addition, the alteration phases that form can be used as indicators of those phases that may form under repository conditions. These tests; which allow altering of glass at high surface area to solution volume ratio; provide useful information regarding the alteration phases that are formed, the disposition of radioactive and hazardous components, and the alteration kinetics under the specific test conditions. This information may be used in performance assessment (McGrail et al, 2002 (1) for example). 1.2 This test method must be performed in accordance with all quality assurance requirements for acceptance of the data. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practice...

  12. Standard test method for guided bend test for ductility of welds

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 This test method covers a guided bend test for the determination of soundness and ductility of welds in ferrous and nonferrous products. Defects, not shown by X rays, may appear in the surface of a specimen when it is subjected to progressive localized overstressing. This guided bend test has been developed primarily for plates and is not intended to be substituted for other methods of bend testing. 1.2 The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. Note 1—For additional information see Terminology E 6, and American Welding Society Standard D 1.1. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  13. NF1 Signal Transduction and Vascular Dysfunction

    Science.gov (United States)

    2014-05-01

    the effects of losing a second allele of NF1 in the vascular endothelium of the adult mouse. This will be the first model of NF1 loss in the... adult endothelium and can serve as a model system for investigation of both cardiovascular effects and the tumor microenvironment. Body: Aim 1...would be to try and determine if there were defects in TGF-b signaling (Smad activation/EndMT) prior to doing a wholesale catalog of all the

  14. Standard Test Method for Thermal Oxidative Resistance of Carbon Fibers

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1982-01-01

    1.1 This test method covers the apparatus and procedure for the determination of the weight loss of carbon fibers, exposed to ambient hot air, as a means of characterizing their oxidative resistance. 1.2 The values stated in SI units are to be regarded as standard. The values given in parentheses are mathematical conversions to inch-pound units which are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. For specific hazard information, see Section 8.

  15. Standard test method for macroetching metals and alloys

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2000-01-01

    1.1 These test procedures describe the methods of macro- etching metals and alloys to reveal their macrostructure. 1.2 The values stated in inch-pound units are to be regarded as the standard. The SI equivalents of inch-pound units may be approximate. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. For specific warning statements, see 6.2, 7.1, 8.1.3, 8.2.1, 8.8.3, 8.10.1.1, and 8.13.2.

  16. Time Triggered Ethernet System Testing Means and Method

    Science.gov (United States)

    Smithgall, William Todd (Inventor); Hall, Brendan (Inventor); Varadarajan, Srivatsan (Inventor)

    2014-01-01

    Methods and apparatus are provided for evaluating the performance of a Time Triggered Ethernet (TTE) system employing Time Triggered (TT) communication. A real TTE system under test (SUT) having real input elements communicating using TT messages with output elements via one or more first TTE switches during a first time interval schedule established for the SUT. A simulation system is also provided having input simulators that communicate using TT messages via one or more second TTE switches with the same output elements during a second time interval schedule established for the simulation system. The first and second time interval schedules are off-set slightly so that messages from the input simulators, when present, arrive at the output elements prior to messages from the analogous real inputs, thereby having priority over messages from the real inputs and causing the system to operate based on the simulated inputs when present.

  17. Leak test fixture and method for using same

    Science.gov (United States)

    Hawk, Lawrence S.

    1976-01-01

    A method and apparatus are provided which are especially useful for leak testing seams such as an end closure or joint in an article. The test does not require an enclosed pressurized volume within the article or joint section to be leak checked. A flexible impervious membrane is disposed over an area of the seamed surfaces to be leak checked and sealed around the outer edges. A preselected vacuum is applied through an opening in the membrane to evacuate the area between the membrane and the surface being leak checked to essentially collapse the membrane to conform to the article surface or joined adjacent surfaces. A pressure differential is concentrated at the seam bounded by the membrane and only the seam experiences a pressure differential as air or helium molecules are drawn into the vacuum system through a leak in the seam. A helium detector may be placed in a vacuum exhaust line from the membrane to detect the helium. Alternatively, the vacuum system may be isolated at a preselected pressure and leaks may be detected by a subsequent pressure increase in the vacuum system.

  18. A Biochar Classification System and Associated Test Methods

    Energy Technology Data Exchange (ETDEWEB)

    Camps-Arbestain, Marta; Amonette, James E.; Singh, Balwant; Wang, Tao; Schmidt, Hans-Peter

    2015-02-18

    In this chapter, a biochar classification system related to its use as soil amendment is proposed. This document builds upon previous work and constrains its scope to materials with properties that satisfy the criteria for biochar as defined by either the International Biochar Initiative (IBI) Biochar Standards or the European Biochar Community (EBC) Standards, and it is intended to minimise the need for testing in addition to those required according to the above-mentioned standards. The classification system envisions enabling stakeholders and commercial entities to (i) identify the most suitable biochar to fulfil the requirements for a particular soil and/or land-use, and (ii) distinguish the application of biochar for specific niches (e.g., soilless agriculture). It is based on the best current knowledge and the intention is to periodically review and update the document based on new data and knowledge that become available in the scientific literature. The main thrust of this classification system is based on the direct or indirect beneficial effects that biochar provides from its application to soil. We have classified the potential beneficial effects of biochar application to soils into five categories with their corresponding classes, where applicable: (i) carbon (C) storage value, (ii) fertiliser value, (iii) liming value, (iv) particle-size, and (v) use in soil-less agriculture. A summary of recommended test methods is provided at the end of the chapter.

  19. Latency in Visionic Systems: Test Methods and Requirements

    Science.gov (United States)

    Bailey, Randall E.; Arthur, J. J., III; Williams, Steven P.; Kramer, Lynda J.

    2005-01-01

    A visionics device creates a pictorial representation of the external scene for the pilot. The ultimate objective of these systems may be to electronically generate a form of Visual Meteorological Conditions (VMC) to eliminate weather or time-of-day as an operational constraint and provide enhancement over actual visual conditions where eye-limiting resolution may be a limiting factor. Empirical evidence has shown that the total system delays or latencies including the imaging sensors and display systems, can critically degrade their utility, usability, and acceptability. Definitions and measurement techniques are offered herein as common test and evaluation methods for latency testing in visionics device applications. Based upon available data, very different latency requirements are indicated based upon the piloting task, the role in which the visionics device is used in this task, and the characteristics of the visionics cockpit display device including its resolution, field-of-regard, and field-of-view. The least stringent latency requirements will involve Head-Up Display (HUD) applications, where the visionics imagery provides situational information as a supplement to symbology guidance and command information. Conversely, the visionics system latency requirement for a large field-of-view Head-Worn Display application, providing a Virtual-VMC capability from which the pilot will derive visual guidance, will be the most stringent, having a value as low as 20 msec.

  20. A Method to Test Model Calibration Techniques: Preprint

    Energy Technology Data Exchange (ETDEWEB)

    Judkoff, Ron; Polly, Ben; Neymark, Joel

    2016-09-01

    This paper describes a method for testing model calibration techniques. Calibration is commonly used in conjunction with energy retrofit audit models. An audit is conducted to gather information about the building needed to assemble an input file for a building energy modeling tool. A calibration technique is used to reconcile model predictions with utility data, and then the 'calibrated model' is used to predict energy savings from a variety of retrofit measures and combinations thereof. Current standards and guidelines such as BPI-2400 and ASHRAE-14 set criteria for 'goodness of fit' and assume that if the criteria are met, then the calibration technique is acceptable. While it is logical to use the actual performance data of the building to tune the model, it is not certain that a good fit will result in a model that better predicts post-retrofit energy savings. Therefore, the basic idea here is that the simulation program (intended for use with the calibration technique) is used to generate surrogate utility bill data and retrofit energy savings data against which the calibration technique can be tested. This provides three figures of merit for testing a calibration technique, 1) accuracy of the post-retrofit energy savings prediction, 2) closure on the 'true' input parameter values, and 3) goodness of fit to the utility bill data. The paper will also discuss the pros and cons of using this synthetic surrogate data approach versus trying to use real data sets of actual buildings.

  1. Test method to assess interface adhesion in composite bonding

    NARCIS (Netherlands)

    Teixeira de Freitas, S.; Sinke, J.

    2015-01-01

    This paper introduces a new type of peel tests dedicated to composite bonding: Composite Peel Tests. This test is inspired on the standard floating roller peel test widely used for metal bonding. The aim of this study is to investigate the potential of the Composite Peel Test to assess interface

  2. Polygraph Test Results Assessment by Regression Analysis Methods

    Directory of Open Access Journals (Sweden)

    K. A. Leontiev

    2014-01-01

    Full Text Available The paper considers a problem of defining the importance of asked questions for the examinee under judicial and psychophysiological polygraph examination by methods of mathematical statistics. It offers the classification algorithm based on the logistic regression as an optimum Bayesian classifier, considering weight coefficients of information for the polygraph-recorded physiological parameters with no condition for independence of the measured signs.Actually, binary classification is executed by results of polygraph examination with preliminary normalization and standardization of primary results, with check of a hypothesis that distribution of obtained data is normal, as well as with calculation of coefficients of linear regression between input values and responses by method of maximum likelihood. Further, the logistic curve divided signs into two classes of the "significant" and "insignificant" type.Efficiency of model is estimated by means of the ROC analysis (Receiver Operator Characteristics. It is shown that necessary minimum sample has to contain results of 45 measurements at least. This approach ensures a reliable result provided that an expert-polygraphologist possesses sufficient qualification and follows testing techniques.

  3. Standard test method for atom percent fission in uranium and plutonium fuel (Neodymium-148 Method)

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1996-01-01

    1.1 This test method covers the determination of stable fission product 148Nd in irradiated uranium (U) fuel (with initial plutonium (Pu) content from 0 to 50 %) as a measure of fuel burnup (1-3). 1.2 It is possible to obtain additional information about the uranium and plutonium concentrations and isotopic abundances on the same sample taken for burnup analysis. If this additional information is desired, it can be obtained by precisely measuring the spike and sample volumes and following the instructions in Test Method E267. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  4. Effects of Forsythia suspensa on expression of NF-κB and Foxp3 during liver injury in rats with severe acute pancreatitis

    Directory of Open Access Journals (Sweden)

    FAN Xiaobin

    2013-07-01

    Full Text Available ObjectiveTo investigate the roles of nuclear factor-kappa B (NF-κB and forkhead box P3 (Foxp3 during liver injury in rats with severe acute pancreatitis (SAP and the effects of Forsythia suspensa on their expression. MethodsEighty male Wistar rats were randomly allocated into sham operation (SO group, SAP group, and intervention group. The intervention group was further divided into high-dose, middle-dose, and low-dose Forsythia suspensa subgroups and positive control (PDTC subgroup. A rat model was induced by injecting sodium taurocholate into the bile-pancreatic duct. The rats in SO and SAP groups were sacrificed at 3, 6, and 12 h after operation, and those in intervention group were sacrificed at 12 h after operation. The serum levels of amylase (Amy, alanine aminotransferase (ALT, and tumor necrosis factor (TNFα were measured. The endotoxin content in plasma was determined using a limulus reagent. The percentage of Treg cells among peripheral blood lymphocytes was measured by flow cytometry. The pathological examination and scoring of the liver and pancreas were performed. The mRNA expression levels of NF-κB and Foxp3 in liver tissue were measured by RT-PCR. One-way analysis of variance was used for comparison among groups; multiple comparison was performed by LSD test; the indices were subjected to linear correlation analysis. ResultsCompared with those in the SO group, all the indices in the SAP group increased over time and reached the peak levels at 12 h after operation. Compared with the rats in SAP group that were sacrificed at 12 h after operation, the intervention group (mortality = 0 had significantly decreased mRNA expression of NF-κB and Foxp3 in liver tissue (P<0.01. The NF-κB mRNA level was positively correlated with the percentage of Treg cells (r=0.738, P<0.01. As the dose of Forsythia suspensa rose, Amy, ALT, and TNFα levels decreased significantly, and the inflammation of liver and pancreas was significantly

  5. Targeting the NF-κB Pathway as a Combination Therapy for Advanced Thyroid Cancer.

    Directory of Open Access Journals (Sweden)

    Nikita Pozdeyev

    Full Text Available NF-κB signaling plays an important role in tumor cell proliferation, cell survival, angiogenesis, invasion, metastasis and drug/radiation resistance. Combination therapy involving NF-κB pathway inhibition is an attractive strategy for the treatment of advanced forms of thyroid cancer. This study was designed to test the efficacy of NF-κB pathway inhibition in combination with cytotoxic chemotherapy, using docetaxel and ionizing radiation in in vitro models of thyroid cancer. We found that while both docetaxel and ionizing radiation activated NF-κB signaling in thyroid cancer cells, there was no synergistic effect on cell proliferation and/or programmed cell death with either genetic (transduction of a dominant negative mutant form of IκBα or pharmacologic (proteasome inhibitor bortezomib and IKKβ inhibitor GO-Y030 inhibition of the NF-κB pathway in thyroid cancer cell lines BCPAP, 8505C, THJ16T and SW1736. Docetaxel plus bortezomib synergistically decreased in vitro invasion of 8505C cells, but not in the other cell lines. Screening of a panel of clinically relevant targeted therapies for synergy with genetic NF-κB inhibition in a proliferation/cytotoxicity assay identified the histone deacetylase (HDAC inhibitor suberoylanilide hydroxamic acid (SAHA as a potential candidate. However, the synergistic effect was confirmed only in the BCPAP cells. These results indicate that NF-κB inhibitors are unlikely to be beneficial as combination therapy with taxane cytotoxic chemotherapy, external radiation therapy or radioiodine therapy. There may be unique circumstances where NF-κB inhibitors may be considered in combination with docetaxel to reduce tumor invasion or in combination with HDAC inhibitors to reduce tumor growth, but this does not appear to be a combination therapy that could be broadly applied to patients with advanced thyroid cancer. Further research may identify which subsets of patients/tumors may respond to this therapeutic

  6. Reduction Methods for Real-time Simulations in Hybrid Testing

    DEFF Research Database (Denmark)

    Andersen, Sebastian

    2016-01-01

    is to divide a structure into a physical substructure and a numerical substructure, and couple these in a test. If the test is conducted in real-time it is referred to as real time hybrid testing. The hybrid testing concept has developed significantly since its introduction in the 1960', both with respect...... is performed on a glass fibre reinforced polymer composite box girder. The test serves as a pilot test for prospective real-time tests on a wind turbine blade. The Taylor basis is implemented in the test, used to perform the numerical simulations. Despite of a number of introduced errors in the real...

  7. New test methods for BIPV. Results from IP performance

    International Nuclear Information System (INIS)

    Jol, J.C.; Van Kampen, B.J.M.; De Boer, B.J.; Reil, F.; Geyer, D.

    2009-11-01

    Within the Performance project new test procedures for PV building products and the building performance as a whole when PV is applied in buildings have been drafted. It has resulted in a first draft of new test procedures for PV building products and proposals for tests for novel BIPV technology like thin film. The test proposed are a module breakage test for BIPV products, a fire safety test for BIPV products and a dynamic load test for BIPV products. Furthermore first proposals of how flexible PV modules could be tested in an appropriate way to ensure long time quality and safety of these new products are presented.

  8. NF-κB p50 subunit knockout impairs late LTP and alters long term memory in the mouse hippocampus

    Directory of Open Access Journals (Sweden)

    Oikawa Kensuke

    2012-07-01

    Full Text Available Abstract Background Nuclear factor kappa B (NF-κB is a transcription factor typically expressed with two specific subunits (p50, p65. Investigators have reported that NF-κB is activated during the induction of in vitro long term potentiation (LTP, a paradigm of synaptic plasticity and correlate of memory, suggesting that NF-κB may be necessary for some aspects of memory encoding. Furthermore, NF-κB has been implicated as a potential requirement in behavioral tests of memory. Unfortunately, very little work has been done to explore the effects of deleting specific NF-κB subunits on memory. Studies have shown that NF-κB p50 subunit deletion (p50−/− leads to memory deficits, however some recent studies suggest the contrary where p50−/− mice show enhanced memory in the Morris water maze (MWM. To more critically explore the role of the NF-κB p50 subunit in synaptic plasticity and memory, we assessed long term spatial memory in vivo using the MWM, and synaptic plasticity in vitro utilizing high frequency stimuli capable of eliciting LTP in slices from the hippocampus of NF-κB p50−/− versus their controls (p50+/+. Results We found that the lack of the NF-κB p50 subunit led to significant decreases in late LTP and in selective but significant alterations in MWM tests (i.e., some improvements during acquisition, but deficits during retention. Conclusions These results support the hypothesis that the NF-κ p50 subunit is required in long term spatial memory in the hippocampus.

  9. Using Response Surface Methods to Correlate the Modal Test of an Inflatable Test Article

    Science.gov (United States)

    Gupta, Anju

    2013-01-01

    This paper presents a practical application of response surface methods (RSM) to correlate a finite element model of a structural modal test. The test article is a quasi-cylindrical inflatable structure which primarily consists of a fabric weave, with an internal bladder and metallic bulkheads on either end. To mitigate model size, the fabric weave was simplified by representing it with shell elements. The task at hand is to represent the material behavior of the weave. The success of the model correlation is measured by comparing the four major modal frequencies of the analysis model to the four major modal frequencies of the test article. Given that only individual strap material properties were provided and material properties of the overall weave were not available, defining the material properties of the finite element model became very complex. First it was necessary to determine which material properties (modulus of elasticity in the hoop and longitudinal directions, shear modulus, Poisson's ratio, etc.) affected the modal frequencies. Then a Latin Hypercube of the parameter space was created to form an efficiently distributed finite case set. Each case was then analyzed with the results input into RSM. In the resulting response surface it was possible to see how each material parameter affected the modal frequencies of the analysis model. If the modal frequencies of the analysis model and its corresponding parameters match the test with acceptable accuracy, it can be said that the model correlation is successful.

  10. Inter-instrumental method transfer of chiral capillary electrophoretic methods using robustness test information.

    Science.gov (United States)

    De Cock, Bart; Borsuk, Agnieszka; Dejaegher, Bieke; Stiens, Johan; Mangelings, Debby; Vander Heyden, Yvan

    2014-08-01

    Capillary electrophoresis (CE) is an electrodriven separation technique that is often used for the separation of chiral molecules. Advantages of CE are its flexibility, low cost and efficiency. On the other hand, the precision and transfer of CE methods are well-known problems of the technique. Reasons for the more complicated method transfer are the more diverse instrumental differences, such as total capillary lengths and capillary cooling systems; and the higher response variability of CE methods compared to other techniques, such as liquid chromatography (HPLC). Therefore, a larger systematic change in peak resolutions, migration times and peak areas, with a loss of separation and efficiency may be seen when a CE method is transferred to another laboratory or another type of instrument. A swift and successful method transfer is required because development and routine use of analytical methods are usually not performed in the same laboratory and/or on the same type of equipment. The aim of our study was to develop transfer rules to facilitate CE method transfers between different laboratories and instruments. In our case study, three β-blockers were chirally separated and inter-instrumental transfers were performed. The first step of our study was to optimise the precision of the chiral CE method. Next, a robustness test was performed to identify the instrumental and experimental parameters that were most influencing the considered responses. The precision- and the robustness study results were used to adapt instrumental and/or method settings to improve the transfer between different instruments. Finally, the comparison of adapted and non-adapted transfers allowed deriving some rules to facilitate CE method transfers. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Finite test sets development method for test execution of safety critical software

    International Nuclear Information System (INIS)

    El-Bordany Ayman; Yun, Won Young

    2014-01-01

    It reads inputs, computes new states, and updates output for each scan cycle. Korea Nuclear Instrumentation and Control System (KNICS) has recently developed a fully digitalized Reactor Protection System (RPS) based on PLD. As a digital system, this RPS is equipped with a dedicated software. The Reliability of this software is crucial to NPPs safety where its malfunction may cause irreversible consequences and affect the whole system as a Common Cause Failure (CCF). To guarantee the reliability of the whole system, the reliability of this software needs to be quantified. There are three representative methods for software reliability quantification, namely the Verification and Validation (V and V) quality-based method, the Software Reliability Growth Model (SRGM), and the test-based method. An important concept of the guidance is that the test sets represent 'trajectories' (a series of successive values for the input variables of a program that occur during the operation of the software over time) in the space of inputs to the software.. Actually, the inputs to the software depends on the state of plant at that time, and these inputs form a new internal state of the software by changing values of some variables. In other words, internal state of the software at specific timing depends on the history of past inputs. Here the internal state of the software which can be changed by past inputs is named as Context of Software (CoS). In a certain CoS, a software failure occurs when a fault is triggered by some inputs. To cover the failure occurrence mechanism of a software, preceding researches insist that the inputs should be a trajectory form. However, in this approach, there are two critical problems. One is the length of the trajectory input. Input trajectory should long enough to cover failure mechanism, but the enough length is not clear. What is worse, to cover some accident scenario, one set of input should represent dozen hours of successive values

  12. Role and molecular mechanism of HO-1-mediated NF-κB modulation in fibrosis progression of nonalcoholic steatohepatitis

    Directory of Open Access Journals (Sweden)

    NAN Yuemin

    2013-05-01

    Full Text Available ObjectiveTo investigate the potential effects and molecular mechanisms of heme oxygenase-1 (HO-1-mediated modulation of nuclear factor-kappa B (NF-κB, and its downstream activation of intercellular adhesion molecule 1 (ICAM-1 and platelet derived growth factor (PDGF, in fibrosis progression of non-alcoholic steatohepatitis (NASH using the methionine and choline deficient (MCD mouse model of NASH. Methods Forty C57BL/6J male mice (18-20 g were randomly divided into four groups (n=10 each: NASH model group, administered the MCD diet; HO-1 agonist group, administered the MCD diet with intraperitoneal (ip injections of hemin (30 μmol/kg every other day; HO-1 inhibitor group, administered the MCD diet with ip injections of zinc protoporphyrin (ZnPP-IX; 20 μmol/kg every other day; and control group, administered a methionine and choline sufficient (MCS diet, without agonist nor inhibitor injections. After eight weeks, the mice were sacrificed and resected liver tissues used to assess successful model establishment by histological analysis (hematoxylin-eosin and Masson staining and the differential mRNA expression of HO-1, NF-κB, ICAM-1, and PDGF by real-time quantitative PCR (GAPDH normalized and protein expression of HO-1 and PDGF by western blotting ( β-actin normalized. Significance of an intergroup difference was assessed by single-factor analysis of variance test, and the Student-Newman-Keuls test was used for pairwise comparisons. ResultsThe NASH model group showed the appropriate histologic features of hepatic steatosis, necroinflammation and fibrogenesis, while the control group showed normal lobular architecture. In addition, the NASH model group showed significantly higher expression of HO-1, NF-κB, ICAM-1 and PDGF mRNA (all P<0.05, and concomitant increases in HO-1 and PDGF protein. The group treated with HO-1 agonist showed significant down-regulation of the NASH-induced NF-κB, ICAM-1 and PDGF expressions, while the opposite

  13. NiO-NF/MWCNT nanocomposite catalyst as a counter electrode for high performance dye-sensitized solar cells

    Science.gov (United States)

    Raissan Al-bahrani, Majid; Liu, Linfeng; Ahmad, Waqar; Tao, Jiayou; Tu, Fanfan; Cheng, Ze; Gao, Yihua

    2015-03-01

    In this paper, we fabricated nickel oxide nanofilament/multiwall carbon nanotubes (NiO-NF/MWCNT) nanocomposite by a simple hydrothermal synthesis method as a counter- electrode (CE) in a dye-sensitized solar cell (DSSC). Transmission electron microscopy, scanning electron microscopy images and X-ray diffraction analysis clearly indicated the formation of NiO-NF/MWCNT nanocomposite. The electro-chemical properties of NiO-NF/MWCNT CE are studied by cyclic voltammetry and electrochemical impedance spectroscopy. In particular, current-voltage measurements indicated superior power conversion efficiency (PCE) of 7.63% of the NiO-NF/MWCNT CE compared to 6.72% for the platinum (Pt). The superior photovoltaic performance and low cost of the NiO-NF/MWCNT nanocomposite can be potentially exploited as a new counter-electrode in DSSCs.

  14. Standard test method for wear testing with a pin-on-disk apparatus

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers a laboratory procedure for determining the wear of materials during sliding using a pin-on-disk apparatus. Materials are tested in pairs under nominally non-abrasive conditions. The principal areas of experimental attention in using this type of apparatus to measure wear are described. The coefficient of friction may also be determined. 1.2 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  15. Standard Test Method for Bird Impact Testing of Aerospace Transparent Enclosures

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers conducting bird impact tests under a standard set of conditions by firing a packaged bird at a stationary transparency mounted in a support structure. 1.2 The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. For specific hazard statements, see Section 8.

  16. Standard test methods for elevated temperature tension tests of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2009-01-01

    1.1 These test methods cover procedure and equipment for the determination of tensile strength, yield strength, elongation, and reduction of area of metallic materials at elevated temperatures. 1.2 Determination of modulus of elasticity and proportional limit are not included. 1.3 Tension tests under conditions of rapid heating or rapid strain rates are not included. 1.4 The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. 1.5 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  17. Towards continuous global measurements and optimal emission estimates of NF3

    Science.gov (United States)

    Arnold, T.; Muhle, J.; Salameh, P.; Harth, C.; Ivy, D. J.; Weiss, R. F.

    2011-12-01

    We present an analytical method for the continuous in situ measurement of nitrogen trifluoride (NF3) - an anthropogenic gas with a global warming potential of ~16800 over a 100 year time horizon. NF3 is not included in national reporting emissions inventories under the United Nations Framework Convention on Climate Change (UNFCCC). However, it is a rapidly emerging greenhouse gas due to emission from a growing number of manufacturing facilities with increasing output and modern end-use applications, namely in microcircuit etching, and in production of flat panel displays and thin-film photovoltaic cells. Despite success in measuring the most volatile long lived halogenated species such as CF4, the Medusa preconcentration GC/MS system of Miller et al. (2008) is unable to detect NF3 under remote operation. Using altered techniques of gas separation and chromatography after initial preconcentration, we are now able to make continuous atmospheric measurements of NF3 with average precisions NF3 produced. Emission factors are shown to have reduced over the last decade; however, rising production and end-use have caused the average global atmospheric concentration to double between 2005 and 2011 i.e. half the atmospheric NF3 present today originates from emissions after 2005. Finally we show the first continuous in situ measurements from La Jolla, California, illustrating how global deployment of our technique could improve the temporal and spatial scale of NF3 'top-down' emission estimates over the coming years. These measurements will be important for independent verification of emissions should NF3 be regulated under a new climate treaty.

  18. Standard test method for determining residual stresses by the hole-drilling strain-gage method

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 Residual Stress Determination: 1.1.1 This test method specifies a hole-drilling procedure for determining residual stress profiles near the surface of an isotropic linearly elastic material. The test method is applicable to residual stress profile determinations where in-plane stress gradients are small. The stresses may remain approximately constant with depth (“uniform” stresses) or they may vary significantly with depth (“non-uniform” stresses). The measured workpiece may be “thin” with thickness much less than the diameter of the drilled hole or “thick” with thickness much greater than the diameter of the drilled hole. Only uniform stress measurements are specified for thin workpieces, while both uniform and non-uniform stress measurements are specified for thick workpieces. 1.2 Stress Measurement Range: 1.2.1 The hole-drilling method can identify in-plane residual stresses near the measured surface of the workpiece material. The method gives localized measurements that indicate the...

  19. Geophysical Methods for Non-Destructive Testing in Civil Engineering

    Science.gov (United States)

    Niederleithinger, E.

    2013-12-01

    Many non-destructive testing (NDT) methods for civil engineering (e. g. ultrasonics, radar) are similar to geophysical techniques. They just differ in scale, material under investigation and vocabulary used. In spite of the fact that the same principles of physics and mathematics apply to both fields, exchange has been limited in the past. But since a few years more and more geophysical knowledge is used in civil engineering. One of the focal points in research is to improve ultrasonic testing of concrete to be able to image the inside even of large, complex structures and to detect any deterioration as early as possible. One of the main issues is the heterogeneity of concrete, including aggregates, reinforcement, cracks and many other features. Our current research focuses on three points. One is the application of state of the art geophysical migration techniques as Reverse Time Migration (RTM) to image vertical faces or the backside of voids and ducts in thick concrete structures, which isn't possible with conventional techniques used in NDT. Second, we have started to use seismic interferometric techniques to interpolate ultrasonic traces, which can't be measured directly for technical reasons. Third, we are using coda wave interferometry to detect concrete degradation due to load, fatigue, temperature or other influences as early as possible. Practical examples of the application of these techniques are given and potential future research directions will be discussed. It will be shown, how a subset of these techniques can be used for innovative monitoring systems for civil infrastructure. Imaging the interior of a concrete body by ultrasonics and reverse time migration(simulated data).

  20. Development and testing of improved statistical wind power forecasting methods.

    Energy Technology Data Exchange (ETDEWEB)

    Mendes, J.; Bessa, R.J.; Keko, H.; Sumaili, J.; Miranda, V.; Ferreira, C.; Gama, J.; Botterud, A.; Zhou, Z.; Wang, J. (Decision and Information Sciences); (INESC Porto)

    2011-12-06

    (with spatial and/or temporal dependence). Statistical approaches to uncertainty forecasting basically consist of estimating the uncertainty based on observed forecasting errors. Quantile regression (QR) is currently a commonly used approach in uncertainty forecasting. In Chapter 3, we propose new statistical approaches to the uncertainty estimation problem by employing kernel density forecast (KDF) methods. We use two estimators in both offline and time-adaptive modes, namely, the Nadaraya-Watson (NW) and Quantilecopula (QC) estimators. We conduct detailed tests of the new approaches using QR as a benchmark. One of the major issues in wind power generation are sudden and large changes of wind power output over a short period of time, namely ramping events. In Chapter 4, we perform a comparative study of existing definitions and methodologies for ramp forecasting. We also introduce a new probabilistic method for ramp event detection. The method starts with a stochastic algorithm that generates wind power scenarios, which are passed through a high-pass filter for ramp detection and estimation of the likelihood of ramp events to happen. The report is organized as follows: Chapter 2 presents the results of the application of ITL training criteria to deterministic WPF; Chapter 3 reports the study on probabilistic WPF, including new contributions to wind power uncertainty forecasting; Chapter 4 presents a new method to predict and visualize ramp events, comparing it with state-of-the-art methodologies; Chapter 5 briefly summarizes the main findings and contributions of this report.

  1. Adverse reactions to cosmetics and methods of testing.

    Science.gov (United States)

    Nigam, P K

    2009-01-01

    Untoward reactions to cosmetics, toiletries, and topical applications are the commonest single reason for hospital referrals with allergic contact dermatitis. In most cases, these are only mild or transient and most reactions being irritant rather than allergic in nature. Various adverse effects may occur in the form of acute toxicity, percutaneous absorption, skin irritation, eye irritation, skin sensitization and photosensitization, subchronic toxicity, mutagenicity/genotoxicity, and phototoxicity/photoirritation. The safety assessment of a cosmetic product clearly depends upon how it is used, since it determines the amount of substance which may be ingested, inhaled, or absorbed through the skin or mucous membranes. Concentration of ingredients used in the different products is also important. Various test procedures include in vivo animal models and in vitro models, such as open or closed patch test, in vivo skin irritation test, skin corrosivity potential tests (rat skin transcutaneous electrical resistance test, Episkin test), eye irritation tests (in vivo eye irritancy test and Draize eye irritancy test), mutagenicity/genotoxicity tests (in vitro bacterial reverse mutation test and in vitro mammalian cell chromosome aberration test), and phototoxicity/photoirritation test (3T3 neutral red uptake phototoxicity test). Finished cosmetic products are usually tested in small populations to confirm the skin and mucous membrane compatibility, and to assess their cosmetic acceptability.

  2. Adverse reactions to cosmetics and methods of testing

    Directory of Open Access Journals (Sweden)

    Nigam P

    2009-01-01

    Full Text Available Untoward reactions to cosmetics, toiletries, and topical applications are the commonest single reason for hospital referrals with allergic contact dermatitis. In most cases, these are only mild or transient and most reactions being irritant rather than allergic in nature. Various adverse effects may occur in the form of acute toxicity, percutaneous absorption, skin irritation, eye irritation, skin sensitization and photosensitization, subchronic toxicity, mutagenicity/genotoxicity, and phototoxicity/photoirritation. The safety assessment of a cosmetic product clearly depends upon how it is used, since it determines the amount of substance which may be ingested, inhaled, or absorbed through the skin or mucous membranes. Concentration of ingredients used in the different products is also important. Various test procedures include in vivo animal models and in vitro models, such as open or closed patch test, in vivo skin irritation test, skin corrosivity potential tests (rat skin transcutaneous electrical resistance test, Episkin test, eye irritation tests (in vivo eye irritancy test and Draize eye irritancy test, mutagenicity/genotoxicity tests (in vitro bacterial reverse mutation test and in vitro mammalian cell chromosome aberration test, and phototoxicity/photoirritation test (3T3 neutral red uptake phototoxicity test. Finished cosmetic products are usually tested in small populations to confirm the skin and mucous membrane compatibility, and to assess their cosmetic acceptability.

  3. Demonstration recommendations for accelerated testing of concrete decontamination methods

    Energy Technology Data Exchange (ETDEWEB)

    Dickerson, K.S.; Ally, M.R.; Brown, C.H.; Morris, M.I.; Wilson-Nichols, M.J.

    1995-12-01

    A large number of aging US Department of Energy (DOE) surplus facilities located throughout the US require deactivation, decontamination, and decommissioning. Although several technologies are available commercially for concrete decontamination, emerging technologies with potential to reduce secondary waste and minimize the impact and risk to workers and the environment are needed. In response to these needs, the Accelerated Testing of Concrete Decontamination Methods project team described the nature and extent of contaminated concrete within the DOE complex and identified applicable emerging technologies. Existing information used to describe the nature and extent of contaminated concrete indicates that the most frequently occurring radiological contaminants are {sup 137}Cs, {sup 238}U (and its daughters), {sup 60}Co, {sup 90}Sr, and tritium. The total area of radionuclide-contaminated concrete within the DOE complex is estimated to be in the range of 7.9 {times} 10{sup 8} ft{sup 2}or approximately 18,000 acres. Concrete decontamination problems were matched with emerging technologies to recommend demonstrations considered to provide the most benefit to decontamination of concrete within the DOE complex. Emerging technologies with the most potential benefit were biological decontamination, electro-hydraulic scabbling, electrokinetics, and microwave scabbling.

  4. Demonstration recommendations for accelerated testing of concrete decontamination methods

    International Nuclear Information System (INIS)

    Dickerson, K.S.; Ally, M.R.; Brown, C.H.; Morris, M.I.; Wilson-Nichols, M.J.

    1995-12-01

    A large number of aging US Department of Energy (DOE) surplus facilities located throughout the US require deactivation, decontamination, and decommissioning. Although several technologies are available commercially for concrete decontamination, emerging technologies with potential to reduce secondary waste and minimize the impact and risk to workers and the environment are needed. In response to these needs, the Accelerated Testing of Concrete Decontamination Methods project team described the nature and extent of contaminated concrete within the DOE complex and identified applicable emerging technologies. Existing information used to describe the nature and extent of contaminated concrete indicates that the most frequently occurring radiological contaminants are 137 Cs, 238 U (and its daughters), 60 Co, 90 Sr, and tritium. The total area of radionuclide-contaminated concrete within the DOE complex is estimated to be in the range of 7.9 x 10 8 ft 2 or approximately 18,000 acres. Concrete decontamination problems were matched with emerging technologies to recommend demonstrations considered to provide the most benefit to decontamination of concrete within the DOE complex. Emerging technologies with the most potential benefit were biological decontamination, electro-hydraulic scabbling, electrokinetics, and microwave scabbling

  5. The methods of formaldehyde emission testing of engine: A review

    Science.gov (United States)

    Zhang, Chunhui; Geng, Peng; Cao, Erming; Wei, Lijiang

    2015-12-01

    A number of measurements have been provided to detect formaldehyde in the atmosphere, but there are no clear unified standards in engine exhaust. Nowadays, formaldehyde, an unregulated emission from methanol engine, has been attracting increasing attention by researchers. This paper presents the detection techniques for formaldehyde emitted from the engines applied in recent market, introducing the approaches in terms of unregulated emission tests of formaldehyde, which involved gas chromatography, liquid chromatography, chromatography-mass spectrometry, chromatography-spectrum, Fourier infrared spectroscopy and spectrophotometry. The author also introduces the comparison regarding to the advantages of the existing detection techniques based on the principle, to compare with engine exhaust sampling method, the treatment in advance of detection, obtaining approaches accessing to the qualitative and quantitative analysis of chromatograms or spectra. The accuratest result obtained was chromatography though it cannot be used continuously. It also can be utilized to develop high requirements of emissions and other regulations. Fourier infrared spectroscopy has the advantage of continuous detection for a variety of unregulated emissions and can be applied to the bench in variable condition. However, its accuracy is not as good as chromatography. As the conclusion, a detection technique is chosen based on different requirements.

  6. Mathematical methods for quantification and comparison of dissolution testing data.

    Science.gov (United States)

    Vranić, Edina; Mehmedagić, Aida; Hadzović, Sabira

    2002-12-01

    In recent years, drug release/dissolution from solid dosage forms has been the subject of intense and profitable scientific developments. Whenever a new solid dosage form is developed or produced, it is necessary to ensure that drug dissolution occurs in an appropriate manner. The pharmaceutical industry and the registration authorities do focus, nowadays, on drug dissolution studies. The quantitative analysis of the values obtained in dissolution/release tests is easier when mathematical formulas that express the dissolution results as a function of some of the dosage forms characteristics are used. This work discusses the analysis of data obtained for dissolution profiles under different media pH conditions using mathematical methods of analysis described by Moore and Flanner. These authors have described difference factor (f1) and similarity factor (f2), which can be used to characterise drug dissolution/release profiles. In this work we have used these formulas for evaluation of dissolution profiles of the conventional tablets in different pH of dissolution medium (range of physiological variations).

  7. High expression of nuclear factor 90 (NF90 leads to mitochondrial degradation in skeletal and cardiac muscles.

    Directory of Open Access Journals (Sweden)

    Takuma Higuchi

    Full Text Available While NF90 has been known to participate in transcription, translation and microRNA biogenesis, physiological functions of this protein still remain unclear. To uncover this, we generated transgenic (Tg mice using NF90 cDNA under the control of β-actin promoter. The NF90 Tg mice exhibited a reduction in body weight compared with wild-type mice, and a robust expression of NF90 was detected in skeletal muscle, heart and eye of the Tg mice. To evaluate the NF90 overexpression-induced physiological changes in the tissues, we performed a number of analyses including CT-analysis and hemodynamic test, revealing that the NF90 Tg mice developed skeletal muscular atrophy and heart failure. To explore causes of the abnormalities in the NF90 Tg mice, we performed histological and biochemical analyses for the skeletal and cardiac muscles of the Tg mice. Surprisingly, these analyses demonstrated that mitochondria in those muscular tissues of the Tg mice were degenerated by autophagy. To gain further insight into the cause for the mitochondrial degeneration, we identified NF90-associated factors by peptide mass fingerprinting. Of note, approximately half of the NF90-associated complexes were ribosome-related proteins. Interestingly, protein synthesis rate was significantly suppressed by high-expression of NF90. These observations suggest that NF90 would negatively regulate the function of ribosome via its interaction with the factors involved in the ribosome function. Furthermore, we found that the translations or protein stabilities of PGC-1 and NRF-1, which are critical transcription factors for expression of mitochondrial genes, were significantly depressed in the skeletal muscles of the NF90 Tg mice. Taken together, these findings suggest that the mitochondrial degeneration engaged in the skeletal muscle atrophy and the heart failure in the NF90 Tg mice may be caused by NF90-induced posttranscriptional repression of transcription factors such as PGC-1 and

  8. Repeat patient testing shows promise as a quality control method for veterinary hematology testing.

    Science.gov (United States)

    Flatland, Bente; Freeman, Kathleen P

    2018-03-05

    Repeat patient testing-based quality control (RPT-QC) is a potential method for veterinary laboratories (eg, that have a limited budget for quality commercial control material [QCM] or that wish to use material with a species-specific matrix). To determine whether total error (TE a ), probability of error detection (Ped), and probability of false rejection (Pfr) similar to that achievable with QC materials can be controlled using RPT-QC METHODS: Control limits (WBC, RBC, HGB, HCT, MCV, and PLT) for the Advia 120 (n = 23) and scil Vet ABC (n = 22) were calculated using data from normal canine specimens from a routine caseload. Specimens were measured at accession and again after 24 hours. Control limits were validated using 23 additional canine specimens tested similarly. Achievable TEa, Ped, and Pfr were investigated using the Westgard EZRules3 and compared to those achievable with commercial QCM. Theoretical performance of RPT-QC and commercial QCM-QC are similar for 1-3s with both n = 1 and 1-3s with n = 2 for all measurands and both instruments. Achievable TE a values for RPT-QC were close to ASVCP recommendations for most measurands; exceptions were PLT (both instruments) and WBC (scil Vet ABC). Repeat patient testing-based quality control advantages include a species-specific matrix, low-cost, and absence of QC material deterioration over time (since a fresh specimen is used each day). A potential disadvantage is daily access to normal canine specimens. A challenge is determining control limits, which has a subjective element. Further study is needed to confirm actual RPT-QC performance and to determine if RPT-QC with abnormal patient specimens is feasible. © 2018 American Society for Veterinary Clinical Pathology.

  9. Squid Giant Axons Synthesize NF Proteins.

    Science.gov (United States)

    Crispino, Marianna; Chun, Jong Tai; Giuditta, Antonio

    2018-04-01

    Squid giant axon has been an excellent model system for studying fundamental topics in neurobiology such as neuronal signaling. It has been also useful in addressing the questions of local protein synthesis in the axons. Incubation of isolated squid giant axons with [ 35 S]methionine followed by immunoprecipitation with a rabbit antibody against all squid neurofilament (NF) proteins demonstrates the local synthesis of a major 180 kDa NF protein and of several NF proteins of lower molecular weights. Their identification as NF proteins is based on their absence in the preimmune precipitates. Immunoprecipitates washed with more stringent buffers confirmed these results. Our data are at variance with a recent study based on the same experimental procedure that failed to visualize the local synthesis of NF proteins by the giant axon and thereby suggested their exclusive derivation from nerve cell bodies (as reported by Gainer et al. in Cell Mol Neurobiol 37:475-486, 2017). By reviewing the pertinent literature, we confute the claims that mRNA translation is absent in mature axons because of a putative translation block and that most proteins of mature axons are synthesized in the surrounding glial cells. Given the intrinsic axonal capacity to synthesize proteins, we stress the glial derivation of axonal and presynaptic RNAs and the related proposal that these neuronal domains are endowed with largely independent gene expression systems (as reported by Giuditta et al. in Physiol Rev 88:515-555, 2008).

  10. The Case History Method of Testing Students in Gross Anatomy.

    Science.gov (United States)

    Cruise, Leon J.

    1980-01-01

    The use of case histories to test a student's knowledge of the previous weeks' dissection in gross anatomy class is discussed. The test is seen as a way to integrate other basic sciences. An example of this type of test is provided. (MLW)

  11. Standard test method for determining atmospheric chloride deposition rate by wet candle method

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2002-01-01

    1.1 This test method covers a wet candle device and its use in measuring atmospheric chloride deposition (amount of chloride salts deposited from the atmosphere on a given area per unit time). 1.2 Data on atmospheric chloride deposition can be useful in classifying the corrosivity of a specific area, such as an atmospheric test site. Caution must be exercised, however, to take into consideration the season because airborne chlorides vary widely between seasons. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  12. 40 CFR 63.694 - Testing methods and procedures.

    Science.gov (United States)

    2010-07-01

    .... The averaging period can represent any time interval that the owner or operator determines is... any more recent, updated version of Method 8260 approved by the EPA. For the purpose of using Method..., updated version of Method 8270 approved by the EPA. For the purpose of using Method 8270 to comply with...

  13. RAPID TEST METHOD FOR EVALUATION OF ANTIFREEZE ADDITIVE EFFICIENCY

    Directory of Open Access Journals (Sweden)

    S. V. Gushchin

    2015-01-01

    Full Text Available Usage of chemical additives while executing concrete works at negative temperatures is considered as a convenient and economical method. Range of the used antifreeze additives is rather wide. A great number of new additives are advertised but their characteristics have not been practically studied. Evaluation of the antifreeze additive efficiency is unfortunately rather long process and it does not provide comprehensive data on concrete structure formation processes. Due to this development of rapid and comprehensive methodology for construction companies is urgently required.Freezing processes of antifreeze additive aqueous solutions and hardening of cement paste with them have been investigated in the paper. The paper proposes a methodology for determination of freezing point for aqueous solutions of chemical additives of various applications. Identity of  freezing point for a chemical additive aqueous solution and cement paste with an equal concentration of the additive in the paste pore fluid has been determined while taking  calcium nitrate and sodium formate additives as an example. The paper demonstrates the possibility to evaluate efficiency of antifreeze additive action on the basis of kinetics in temperature changes of the cement paste with additives by its consecutive freezing and defrosting.  A methodology for operational evaluation in the field of chemical additive application for concreting items at negative temperatures has been offered in the paper.  The methodology does not require  deficient and expensive test-equipment. It can be applied at ordinary construction companies and it is comprehensible for personnel of low-qualification.  The paper shows the possibility to develop an original methodology for designing concrete structure which is based on operating efficiency determinations  for single and integrated antifreeze additives.

  14. Evaluation of full-scope simulator testing methods

    International Nuclear Information System (INIS)

    Feher, M.P.; Moray, N.; Senders, J.W.; Biron, K.

    1995-03-01

    This report discusses the use of full scope nuclear power plant simulators in licensing examinations for Unit First Operators of CANDU reactors. The existing literature is reviewed, and an annotated bibliography of the more important sources provided. Since existing methods are judged inadequate, conceptual bases for designing a system for licensing are discussed, and a method proposed which would make use of objective scoring methods based on data collection in full-scope simulators. A field trial of such a method is described. The practicality of such a method is critically discussed and possible advantages of subjective methods of evaluation considered. (author). 32 refs., 1 tab., 4 figs

  15. Energy-momentum tensor correlation function in Nf = 2 + 1 full QCD at finite temperature

    Directory of Open Access Journals (Sweden)

    Taniguchi Yusuke

    2018-01-01

    Full Text Available We measure correlation functions of the nonperturbatively renormalized energy-momentum tensor in Nf = 2 + 1 full QCD at finite temperature by applying the gradient flow method both to the gauge and quark fields. Our main interest is to study the conservation law of the energy-momentum tensor and to test whether the linear response relation is properly realized for the entropy density. By using the linear response relation we calculate the specific heat from the correlation function. We adopt the nonperturba-tively improved Wilson fermion and Iwasaki gauge action at a fine lattice spacing = 0:07 fm. In this paper the temperature is limited to a single value T ≃ 232 MeV. The u, d quark mass is rather heavy with mπ=mρ ≃ 0:63 while the s quark mass is set to approximately its physical value.

  16. Evaluation of Test/Analysis Correlation Methods for Crash Applications

    Science.gov (United States)

    Lyle, Karen H.; Bark, Lindley W.; Jackson, Karen E.

    2001-01-01

    A project has been initiated to improve crash test and analysis correlation. The work in this paper concentrated on the test and simulation results for a fuselage section. Two drop tests of the section were conducted. The first test was designed to excite the linear structural response for comparison with finite element modal analysis results. The second test was designed to provide data for correlation with crash simulations. An MSC.Dytran model was developed to generate nonlinear transient dynamic results. Following minor modifications, the same model was executed in MSC.Nastran to generate modal analysis results. The results presented in this paper concentrate on evaluation of correlation methodologies for crash test data and finite element simulation results.

  17. Test methods for evaluating hot cracking: Review and perspective

    International Nuclear Information System (INIS)

    Goodwin, G.M.

    1990-01-01

    The phenomenon of hot cracking is described and discussed, and criteria for tests to assess hot cracking are elucidated. The historical development of hot cracking tests is traced from the 1930s to present, with categorization of tests into several types. It is noted that the number of tests developed continues to increase dramatically. The number of literature citations also increases with time, with few popular tests receiving a major share of interest. Predominant countries of origin of both tests and citations shift with time, and a few journals account for most of the published information. Reviews of hot cracking are reviewed, and it is predicted that modeling and other developing analytical techniques will contribute greatly to an increase in our understanding of hot cracking. 30 refs., 10 figs., 1 tab

  18. Simulation and Verificaiton of Flow in Test Methods

    DEFF Research Database (Denmark)

    Thrane, Lars Nyholm; Szabo, Peter; Geiker, Mette Rica

    2005-01-01

    Simulations and experimental results of L-box and slump flow test of a self-compacting mortar and a self-compacting concrete are compared. The simulations are based on a single fluid approach and assume an ideal Bingham behavior. It is possible to simulate the experimental results of both tests f...... for a given set of rheological parameters. However, it is important to include boundary conditions related to the lifting procedure in the two tests....

  19. Diagnostic tests in obstetrics: a method for improved evaluation.

    Science.gov (United States)

    Richardson, D K; Schwartz, J S; Weinbaum, P J; Gabbe, S G

    1985-07-15

    With the proliferation of diagnostic tests in obstetrics, several recurrent questions arise. How does one determine whether one diagnostic test is superior to another available test? What test cutoff value best separates diseased from nondiseased patients? How much does performance of additional tests assist in arriving at a correct diagnosis? This article reviews a simple yet sophisticated analytic technique, the receiver operating characteristic curve, and demonstrates its application to several obstetric diagnostic tests. Receiver operating characteristic curve analysis is used to select a cutoff value for the 1-hour glucose tolerance test, to compare amniotic fluid tests of fetal lung maturity, and to determine the optimal combinations of factors and overall performance of the fetal biophysical profile. The value of receiver operating characteristic curve analysis lies in providing a clear graphic analysis of the performance of diagnostic tests over their entire range of values. It also provides the starting point for evaluating the costs and benefits of alternative cutoff points in differing clinical settings.

  20. Appropriate statistical methods are required to assess diagnostic tests for replacement, add-on, and triage

    NARCIS (Netherlands)

    Hayen, Andrew; Macaskill, Petra; Irwig, Les; Bossuyt, Patrick

    2010-01-01

    To explain which measures of accuracy and which statistical methods should be used in studies to assess the value of a new binary test as a replacement test, an add-on test, or a triage test. Selection and explanation of statistical methods, illustrated with examples. Statistical methods for

  1. Validation of laboratory-scale recycling test method of paper PSA label products

    Science.gov (United States)

    Carl Houtman; Karen Scallon; Richard Oldack

    2008-01-01

    Starting with test methods and a specification developed by the U.S. Postal Service (USPS) Environmentally Benign Pressure Sensitive Adhesive Postage Stamp Program, a laboratory-scale test method and a specification were developed and validated for pressure-sensitive adhesive labels, By comparing results from this new test method and pilot-scale tests, which have been...

  2. 40 CFR 265.1063 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... Method 21 in 40 CFR part 60. (2) The detection instrument shall meet the performance criteria of Reference Method 21. (3) The instrument shall be calibrated before use on each day of its use by the... background level shall be determined, as set forth in Reference Method 21. (3) The instrument probe shall be...

  3. 40 CFR 63.805 - Performance test methods.

    Science.gov (United States)

    2010-07-01

    ... determine the VHAP content of the liquid coating. Formulation data shall be used to identify VHAP present in... Collection of Coating and Ink Samples for VOC Content Analysis by Reference Method 24 and Reference Method..., appendix A) shall be used to measure the moisture in the stack gas. (6) The EPA Methods 2, 2A, 2C, 2D, 3...

  4. Generation and quenching of NF(a) and NF(b) molecules

    International Nuclear Information System (INIS)

    Setser, D.W.; Cha, H.; Quinones, E.; Du, K.

    1987-01-01

    The Ar( 3 Po,2) + NF 2 and 2F + HN 3 reactions have been developed as sources of NF(b 1 Σ + ) and NF(a 1 Δ) molecules, respectively, in a flow reactor. The decay kinetics for these molecules in the presence of added reagent can be studied using standard flow reactor techniques. Room temperature quenching rate constants for both molecules are reported for several reagents and compared to results for the isoelectronic O 2 (a) and O 2 (b) molecules

  5. 40 CFR 60.474 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... product is shingle or mineral-surfaced roll roofing, the tests shall be conducted while 106.6-kg (235-lb) shingle is being produced. (2) If the final product is saturated felt or smooth-surfaced roll roofing, the... fiberglass shingle, the test shall be conducted while a nominal 100-kg (220-lb) shingle is being produced. (b...

  6. MIMO Device Performance Testing with the Wireless Cable Method

    DEFF Research Database (Denmark)

    Fan, Wei; Kyösti, Pekka; Hentilä, Lassi

    2018-01-01

    Conducted cable testing has been dominantly utilized in the industry to evaluate multiple-input multiple-output (MIMO) capable mobile terminals. Desired testing signals can be guided directly to the antenna ports on the mobile terminal by radio frequency (RF) coaxial cables in the conducted cable...

  7. European wind turbine procedure development blade test methods and techniques

    Energy Technology Data Exchange (ETDEWEB)

    Bulder, B.H.; Dam, J.J.D. van; Delft, D.R.V. van [and others

    1999-03-01

    In this paper the preliminary results obtained by performing the second task of the `European Wind Turbine Testing Procedure Development` project are presented. This project is performed within and with financial support of the Standards, Measurements and Testing programme of the European Commission. (au)

  8. Statistical tests for equal predictive ability across multiple forecasting methods

    DEFF Research Database (Denmark)

    Borup, Daniel; Thyrsgaard, Martin

    We develop a multivariate generalization of the Giacomini-White tests for equal conditional predictive ability. The tests are applicable to a mixture of nested and non-nested models, incorporate estimation uncertainty explicitly, and allow for misspecification of the forecasting model as well as ...

  9. Improving the Traditional Testing Methods in Learning Foreign Languages

    DEFF Research Database (Denmark)

    Pachovski, Veno; Dimova, Slobodanka; Vaneva, Marjana

    2012-01-01

    A model for gathering oral answers as part of testing the speaker skills (i.e. command of language, native or foreign) is presented, as well as the software used in the experimentation. The research presented here is a result of more than six (6) months’ work with TESOL experts, based on 60 test ...

  10. Applications of Automation Methods for Nonlinear Fracture Test Analysis

    Science.gov (United States)

    Allen, Phillip A.; Wells, Douglas N.

    2013-01-01

    As fracture mechanics material testing evolves, the governing test standards continue to be refined to better reflect the latest understanding of the physics of the fracture processes involved. The traditional format of ASTM fracture testing standards, utilizing equations expressed directly in the text of the standard to assess the experimental result, is self-limiting in the complexity that can be reasonably captured. The use of automated analysis techniques to draw upon a rich, detailed solution database for assessing fracture mechanics tests provides a foundation for a new approach to testing standards that enables routine users to obtain highly reliable assessments of tests involving complex, non-linear fracture behavior. Herein, the case for automating the analysis of tests of surface cracks in tension in the elastic-plastic regime is utilized as an example of how such a database can be generated and implemented for use in the ASTM standards framework. The presented approach forms a bridge between the equation-based fracture testing standards of today and the next generation of standards solving complex problems through analysis automation.

  11. Methods for testing the logical structure of plant procedure documents

    International Nuclear Information System (INIS)

    Horne, C.P.; Colley, R.; Fahley, J.M.

    1990-01-01

    This paper describes an ongoing EPRI project to investigate computer based methods to improve the development, maintenance, and verification of plant operating procedures. This project began as an evaluation of the applicability of structured software analysis methods to operating procedures. It was found that these methods offer benefits, if procedures are transformed to a structured representation to make them amenable to computer analysis. The next task was to investigate methods to transform procedures into a structured representation. The use of natural language techniques to read and compile the procedure documents appears to be viable for this purpose and supports conformity to guidelines. The final task was to consider possibilities of automated verification methods for procedures. Methods to help verify procedures were defined and information requirements specified. These methods take the structured representation of procedures as input. The software system being constructed in this project is called PASS, standing for Procedures Analysis Software System

  12. New methods for the safety testing of transgenic food

    DEFF Research Database (Denmark)

    Knudsen, Ib; Poulsen, Morten; Kledal, S. T.

    2004-01-01

    Background This project proposal deals with the development of a sensitive and specific animal test which is necessary for safety analysis of genetically modified plants according to the Opinion of the Scientific Committee for Food on the assessment of novels foods. The test will be based...... on the OECD 90 day rodent study supplemented with sensitive and specific markers for potential toxicity of the products encode by the inserted genes in the tested food item, the use of a semisynthetic diet with interchangeable constituents and the extensive use of initial chemical and in-vitro testing...... for guiding the precise design of the animal study. The genetically modified food plants to be used for this test development will be 3 transgenic rice varieties (2 types of lectins and the Bt toxin). Objectives The overall objective of this project is to develop and validate the scientific methodology which...

  13. The limits of genome-wide methods for pharmacogenomic testing.

    Science.gov (United States)

    Gamazon, Eric R; Skol, Andrew D; Perera, Minoli A

    2012-04-01

    technologies' ability to survey fully the variation in genes of particular interest to the pharmacogenetics community. Our findings demonstrate the limitations of genome-wide methods and the challenges of implementing pharmacogenomic tests into the clinical context.

  14. A Functional Genomic Analysis of NF1-Associated Learning Disabilities

    National Research Council Canada - National Science Library

    Tang, Shao-Jun

    2008-01-01

    Learning disabilities severely deteriorate the life of many NF1 patients. However, the pathogenic process for NF1-associated learning disabilities has not been fully understood and an effective therapy is not available...

  15. A Functional Genomic Analysis of NF1-Associated Learning Disabilities

    National Research Council Canada - National Science Library

    Tang, Shao-Jun

    2007-01-01

    Learning disabilities severely deteriorate the life of many NF1 patients. However, the pathogenic process for NF1-associated learning disabilities has not been fully understood and an effective therapy is not available...

  16. Comments on Thermal Physical Properties Testing Methods of Phase Change Materials

    Directory of Open Access Journals (Sweden)

    Jingchao Xie

    2013-01-01

    Full Text Available There is no standard testing method of the thermal physical properties of phase change materials (PCM. This paper has shown advancements in this field. Developments and achievements in thermal physical properties testing methods of PCM were commented, including differential scanning calorimetry, T-history measurement, the water bath method, and differential thermal analysis. Testing principles, advantages and disadvantages, and important points for attention of each method were discussed. A foundation for standardized testing methods for PCM was made.

  17. What Happened to Remote Usability Testing? An Empirical Study of Three Methods

    DEFF Research Database (Denmark)

    Stage, Jan; Andreasen, M. S.; Nielsen, H. V.

    2007-01-01

    The idea of conducting usability tests remotely emerged ten years ago. Since then, it has been studied empirically, and some software organizations employ remote methods. Yet there are still few comparisons involving more than one remote method. This paper presents results from a systematic...... empirical comparison of three methods for remote usability testing and a conventional laboratorybased think-aloud method. The three remote methods are a remote synchronous condition, where testing is conducted in real time but the test monitor is separated spatially from the test subjects, and two remote...... asynchronous conditions, where the test monitor and the test subjects are separated both spatially and temporally....

  18. Comparison of E-test with other conventional susceptibility testing methods for ciprofloxacin and gentamicin against gram negative enteric bacilli.

    Science.gov (United States)

    Ogbolu, D O; Terry-Alli, O A; Daini, O A; Olabiyi, F A; Igharo, E A

    2012-06-01

    Increasing antibiotic resistance in Gram negative bacteria has led to the need for a faster and reliable method for determining antimicrobial susceptibility testing. In a resource poor setting like ours, it's also important to look for methods that will be clinically and economically beneficial to the patient. This study was aimed at evaluating the Epsilometer test (E-test) and conventional methods for determining antimicrobial susceptibility of isolates of Gram-negative enteric bacteria to ciprofloxacin and gentamicin. Disc diffusion, E-test, broth dilution and agar dilution methods were performed on 54 bacterial isolates. Using the E-test, 88.9% of bacterial isolates were resistant to ciprofloxacin, 92.6% were resistant using broth microdilution, 96.3% were resistant using agar dilution and 72.2% were resistant using disc diffusion. Minimum inhibitory concentration (MIC50) of isolates for gentamicin showed significant difference for all the techniques (p 0.05). Both E-test and broth dilution methods showed high levels of agreement (p > 0.05), there were low levels of agreement between E-test and agar dilution method (p < 0.05), especially at MIC50. The E-test can therefore be considered a reliable method to determine antimicrobial susceptibility testing and it gives results which are at least as accurate as those obtained by the broth dilution method.

  19. Mammalian cell HPRT gene mutation assay: test methods.

    Science.gov (United States)

    Johnson, George E

    2012-01-01

    Using the combination of bacterial gene mutation assay and chromosomal aberrations test in mammalian cells may not detect a small proportion of mammalian specific mutagenic agents. Therefore, at the current time a third assay should be used, except for compounds for which there is little or no exposure (DOH (2000) Department of Health Guidance for the testing of chemicals for Mutagenicity. Committee on Mutagenicity of Chemicals in Food, Consumer Products and the Environment). The hypoxanthine phosphorybosyl transferase (HPRT) gene is on the X chromosome of mammalian cells, and it is used as a model gene to investigate gene mutations in mammalian cell lines. The assay can detect a wide range of chemicals capable of causing DNA damage that leads to gene mutation. The test follows a very similar methodology to the thymidine kinase (TK) mouse lymphoma assay (MLA), and both are included in the guidelines for mammalian gene mutation tests (OECD (1997) Organisation for Economic Co-operation and Development. Ninth addendum to the OECD Guidelines for the Testing of Chemicals. In Vitro Mammalian Cell Gene Mutation Test: 476). The HPRT methodology is such that mutations which destroy the functionality of the HPRT gene and or/protein are detected by positive selection using a toxic analogue, and HPRT ( - ) mutants are seen as viable colonies. Unlike bacterial reverse mutation assays, mammalian gene mutation assays respond to a broad spectrum of mutagens, since any mutation resulting in the ablation of gene expression/function produces a HPRT ( - ) mutant. Human cells are readily used, and mechanistic studies using the HPRT test methodology with modifications, such as knock-out cell lines for DNA repair, can provide details of the mode of action (MOA) of the test compound (24).This chapter provides the methodology for carrying out the assay in different cell lines in the presence and absence of metabolism with technical information and general advice on how to carry out the

  20. Improved method for testing susceptibility of Mycobacterium tuberculosis to pyrazinamide.

    OpenAIRE

    Butler, W R; Kilburn, J O

    1982-01-01

    The acid medium required to test susceptibility of Mycobacterium tuberculosis to pyrazinamide (PZA) is a major problem in obtaining reliable test results. Satisfactory growth is usually obtained on Middlebrook and Cohn 7H10 medium at pH 5.5 if albumin-dextrose-catalase (ADC) supplement rather than oleic acid-albumin-dextrose-catalase is used; however, some lots of ADC supplement still fail to support growth at this low pH. A rapid turbidimetric test was developed to determine the growth-suppo...

  1. Targeting of NF-κB to Dendritic Spines Is Required for Synaptic Signaling and Spine Development.

    Science.gov (United States)

    Dresselhaus, Erica C; Boersma, Matthew C H; Meffert, Mollie K

    2018-04-25

    Long-term forms of brain plasticity share a requirement for changes in gene expression induced by neuronal activity. Mechanisms that determine how the distinct and overlapping functions of multiple activity-responsive transcription factors, including nuclear factor κB (NF-κB), give rise to stimulus-appropriate neuronal responses remain unclear. We report that the p65/RelA subunit of NF-κB confers subcellular enrichment at neuronal dendritic spines and engineer a p65 mutant that lacks spine enrichment (p65ΔSE) but retains inherent transcriptional activity equivalent to wild-type p65. Wild-type p65 or p65ΔSE both rescue NF-κB-dependent gene expression in p65-deficient murine hippocampal neurons responding to diffuse (PMA/ionomycin) stimulation. In contrast, neurons lacking spine-enriched NF-κB are selectively impaired in NF-κB-dependent gene expression induced by elevated excitatory synaptic stimulation (bicuculline or glycine). We used the setting of excitatory synaptic activity during development that produces NF-κB-dependent growth of dendritic spines to test physiological function of spine-enriched NF-κB in an activity-dependent response. Expression of wild-type p65, but not p65ΔSE, is capable of rescuing spine density to normal levels in p65-deficient pyramidal neurons. Collectively, these data reveal that spatial localization in dendritic spines contributes unique capacities to the NF-κB transcription factor in synaptic activity-dependent responses. SIGNIFICANCE STATEMENT Extensive research has established a model in which the regulation of neuronal gene expression enables enduring forms of plasticity and learning. However, mechanisms imparting stimulus specificity to gene regulation, ensuring biologically appropriate responses, remain incompletely understood. NF-κB is a potent transcription factor with evolutionarily conserved functions in learning and the growth of excitatory synaptic contacts. Neuronal NF-κB is localized in both synapse and

  2. NF-{kappa}B p65 represses {beta}-catenin-activated transcription of cyclin D1

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Injoo; Choi, Yong Seok; Jeon, Mi-Ya [National Research Lab for RNA Cell Biology, BK21 Graduate Program for RNA Biology, Institute of Nanosensor and Biotechnology and Department of Molecular Biology, Dankook University, Gyeonggi-do 448-701 (Korea, Republic of); Jeong, Sunjoo, E-mail: sjsj@dankook.ac.kr [National Research Lab for RNA Cell Biology, BK21 Graduate Program for RNA Biology, Institute of Nanosensor and Biotechnology and Department of Molecular Biology, Dankook University, Gyeonggi-do 448-701 (Korea, Republic of)

    2010-12-03

    Research highlights: {yields} Cyclin D1 transcription is directly activated by {beta}-catenin; however, {beta}-catenin-induced cyclin D1 transcription is reduced by NF-{kappa}B p65. {yields} Protein-protein interaction between NF-{kappa}B p65 and {beta}-catenin might be responsible for p65-mediated repression of cyclin D1. {yields} One of five putative binding sites, located further upstream of other sites, is the major {beta}-catenin binding site in the cyclin D1 promoter. {yields} NF-{kappa}B binding site in cyclin D1 is occupied not only by p65 but also by {beta}-catenin, which is dynamically regulated by the signal. -- Abstract: Signaling crosstalk between the {beta}-catenin and NF-{kappa}B pathways represents a functional network. To test whether the crosstalk also occurs on their common target genes, the cyclin D1 promoter was used as a model because it contains binding sites for both proteins. {beta}-catenin activated transcription from the cyclin D1 promoter, while co-expression of NF-{kappa}B p65 reduced {beta}-catenin-induced transcription. Chromatin immunoprecipitation revealed lithium chloride-induced binding of {beta}-catenin on one of the T-cell activating factor binding sites. More interestingly, {beta}-catenin binding was greatly reduced by NF-{kappa}B p65, possibly by the protein-protein interaction between the two proteins. Such a dynamic and complex binding of {beta}-catenin and NF-{kappa}B on promoters might contribute to the regulated expression of their target genes.

  3. Characterizing Myeloid Cell Activation in NF1 Vasculopathy

    Science.gov (United States)

    2016-07-01

    mechanistic insight and develop therapeutic targets for the prevention/ treatment of neurofibromatosis type 1 (NF1) related cardiovascular disease...effectors of NF1 arterial stenosis, and that pharmacologic inhibition of CCR2 activation is a viable therapeutic option for the prevention and/or treatment ...formation in Nf1 heterozygous mice. 15. SUBJECT TERMS neurofibromatosis, NF1, aneurysm, stenosis, smooth muscle, macrophages, MCP1, CCR2, ROS 16. SECURITY

  4. Research on Generating Method of Embedded Software Test Document Based on Dynamic Model

    Science.gov (United States)

    Qu, MingCheng; Wu, XiangHu; Tao, YongChao; Liu, Ying

    2018-03-01

    This paper provides a dynamic model-based test document generation method for embedded software that provides automatic generation of two documents: test requirements specification documentation and configuration item test documentation. This method enables dynamic test requirements to be implemented in dynamic models, enabling dynamic test demand tracking to be easily generated; able to automatically generate standardized, standardized test requirements and test documentation, improved document-related content inconsistency and lack of integrity And other issues, improve the efficiency.

  5. An Evaluation of Blood Cholinesterase Testing Methods for Military Health

    Science.gov (United States)

    2008-05-01

    Cryptosporidium parvum Dengue Fever Virus Enterococcus faecalis /faecium E. coli 0157 Hepatitis B virus Hepatitis C virus Helicobacter pylori...Staphylococcus (including MRSA) Streptococcus pyogenes Syphilis (Treponema pallidum) Trichomonas vaginalis West Nile Virus. Manufacturers of Tests

  6. Correlation of geotextile puncture test methods : research brief.

    Science.gov (United States)

    2017-05-01

    Geotextiles are commonly used in pavements, earth retaining structures, landfills and other geotechnical contexts. Various tests are conducted to evaluate and classify geotextiles to determine their suitability for each of these applications. The AST...

  7. Development of a new test method for Mineral Based Composites

    DEFF Research Database (Denmark)

    Täljsten, Björn; Orosz, Katalin

    2008-01-01

    CFRP grids are externally bonded to the concrete surface by means of cementitious bonding agents. Crack development, crack patterns, crack opening displacement (COD) versus splitting load and fracture energy are investigated and evaluated. Development of a suitable test specimen and test setup has been...... to the refined grain structure, the bridging effect of the embedded fibres working against crack opening and via direct mechanical interlock with the grid...

  8. Test of two methods for determining herbaceous yield and botanical ...

    African Journals Online (AJOL)

    Above-ground herbaceous yield was estimated using the comparative yield method to win + 10% (p < 0,05) of the harvested mean using 150 harvested and 600 rated quadrats of 50 x 50 cm. The number of quadrats can be substantially reduced by improved observer rating. Using the dry mass rank method and 240 ...

  9. A numerical test of the collective coordinate method

    International Nuclear Information System (INIS)

    Dobrowolski, T.; Tatrocki, P.

    2008-01-01

    The purpose of this Letter is to compare the dynamics of the kink interacting with the imperfection which follows from the collective coordinate method with the numerical results obtained on the ground of the field theoretical model. We showed that for weekly interacting kinks the collective coordinate method works similarly well for low and extremely large speeds

  10. Ultrasonic and advanced methods for nondestructive testing and material characterization

    National Research Council Canada - National Science Library

    Chen, C. H

    2007-01-01

    ... and physics among others. There are at least two dozen NDT methods in use. In fact any sensor that can examine the inside of material nondestructively is useful for NDT. However the ultrasonic methods are still most popular because of its capability, flexibility, and relative cost effectiveness. For this reason this book places a heavy emphasis...

  11. Effect of testing methods on the bond strength of resin to zirconia-alumina ceramic : microtensile versus shear test

    NARCIS (Netherlands)

    Valandro, Luiz F.; Ozcan, Mutlu; Amaral, Regina; Vanderlei, Aleska; Bottino, Marco A.

    2008-01-01

    This study tested the bond strength of a resin cement to a glass-infiltrated zirconia-alumina ceramic after three conditioning methods and using two test methods (shear-SBS versus microtensile-MTBS). Ceramic blocks for MTBS and ceramic disks for SBS were fabricated. Three surface conditioning (SC)

  12. NF1 Signal Transduction and Vascular Dysfunction

    Science.gov (United States)

    2015-05-01

    malformations, aneurysms, and hypertension . Consequently there is a markedly elevated risk of cerbrovascular accidents(Friedman et al., 2002). NF1...the endothelium seems to trigger a rapid leukemic crisis . This observation is quite unexpected but consistent with the notion that the endothelial

  13. Effects of radiation on tumor hemodynamics and NF-kappaB in breast tumors

    Science.gov (United States)

    Stantz, Keith M.; Cao, Ning; Liu, Bo; Cao, Minsong; Chin-Sinex, Helen; Mendonca, Marc; Li, Jian Jian

    2010-02-01

    Purpose: The purpose of this study is to monitor in vivo the IR dose dependent response of NF-κB and tumor hemodynamics as a function of time. Material and Methods: An MDA-231 breast cancer cell line was stably transfected with a firefly luciferase gene within the NF-kappaB promoter. Tumors on the right flank irradiated with a single fractionated dose of 5Gy or 10Gy. Over two weeks, photoacoustic spectroscopy (PCT-S), bioluminescence imaging (BLI), and dynamic contrast enhanced CT (DCE-CT) was used to monitor hemoglobin status, NF-kappaB expression, and physiology, respectively. Results: From the BLI, an increase in NF-kappaB expression was observed in both the right (irradiation) and left (nonirradiated) tumors, which peaked at 8-12 hours, returned to basal levels after 24 hours, and increased a second time from 3 to 7 days. This data identifies both a radiation-induced bystander effect and a bimodal longitudinal response associated with NF-κB-controlled luciferase promoter. The physiological results from DCE-CT measured an increase in perfusion (26%) two days after radiation and both a decrease in perfusion and an increase in fp by week 1 (10Gy cohort). PCT-S measured increased levels of oxygen saturation two days post IR, which did not change after 1 week. Initially, NF-κB would modify hemodynamics to increase oxygen delivery after IR insult. The secondary response appears to modulate tumor angiogenesis. Conclusions: A bimodal response to radiation was detected with NF-kappaB-controlled luciferase reporter with a concomitant hemodynamic response associated with tumor hypoxia. Experiments are being performed to increase statistics.

  14. A statistical comparison of accelerated concrete testing methods

    Directory of Open Access Journals (Sweden)

    Denny Meyer

    1997-01-01

    Full Text Available Accelerated curing results, obtained after only 24 hours, are used to predict the 28 day strength of concrete. Various accelerated curing methods are available. Two of these methods are compared in relation to the accuracy of their predictions and the stability of the relationship between their 24 hour and 28 day concrete strength. The results suggest that Warm Water accelerated curing is preferable to Hot Water accelerated curing of concrete. In addition, some other methods for improving the accuracy of predictions of 28 day strengths are suggested. In particular the frequency at which it is necessary to recalibrate the prediction equation is considered.

  15. Local tolerance testing under REACH: Accepted non-animal methods are not on equal footing with animal tests.

    Science.gov (United States)

    Sauer, Ursula G; Hill, Erin H; Curren, Rodger D; Raabe, Hans A; Kolle, Susanne N; Teubner, Wera; Mehling, Annette; Landsiedel, Robert

    2016-07-01

    In general, no single non-animal method can cover the complexity of any given animal test. Therefore, fixed sets of in vitro (and in chemico) methods have been combined into testing strategies for skin and eye irritation and skin sensitisation testing, with pre-defined prediction models for substance classification. Many of these methods have been adopted as OECD test guidelines. Various testing strategies have been successfully validated in extensive in-house and inter-laboratory studies, but they have not yet received formal acceptance for substance classification. Therefore, under the European REACH Regulation, data from testing strategies can, in general, only be used in so-called weight-of-evidence approaches. While animal testing data generated under the specific REACH information requirements are per se sufficient, the sufficiency of weight-of-evidence approaches can be questioned under the REACH system, and further animal testing can be required. This constitutes an imbalance between the regulatory acceptance of data from approved non-animal methods and animal tests that is not justified on scientific grounds. To ensure that testing strategies for local tolerance testing truly serve to replace animal testing for the REACH registration 2018 deadline (when the majority of existing chemicals have to be registered), clarity on their regulatory acceptance as complete replacements is urgently required. 2016 FRAME.

  16. Impact Strength of Natural Fibre Composites Measured by Different Test Methods: A Review

    Directory of Open Access Journals (Sweden)

    Navaranjan Namasivayam

    2017-01-01

    Full Text Available Different types of impact test methods have been used in recent years to measure the impact resistance of natural fibre composites (NFCs. After reviewing the literature, the impact resistance of flax, hemp, sisal, wood and jute fibre composites that were measured using different test methods have been compared and discussed. It has been learned that the test methods were selected for research interest, industry requirement or availability of test equipment. Each method had its own advantages and limitations. The result from a particular test could be compared but not with the result from other test methods. Most impact test methods were developed for testing ductile-brittle transition of metals. However, each NFC has a different morphology and cannot be comparable to metals in failure mode and energy absorption characteristic during an impact test. A post evaluation of morphology of an NFC sample after an impact test is important to characterise the material.

  17. Standard test methods for conducting creep, creep-rupture, and stress-rupture tests of metallic materials

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2006-01-01

    1.1 These test methods cover the determination of the amount of deformation as a function of time (creep test) and the measurement of the time for fracture to occur when sufficient force is present (rupture test) for materials when under constant tensile forces at constant temperature. It also includes the essential requirements for testing equipment. For information of assistance in determining the desirable number and duration of tests, reference should be made to the product specification. 1.2 These test methods list the information which should be included in reports of tests. The intention is to ensure that all useful and readily available information is transmitted to interested parties. Reports receive special attention for the following reasons: (1) results from different, recognized procedures vary significantly; therefore, identification of methods used is important; (2) later studies to establish important variables are often hampered by the lack of detailed information in published reports; (3) t...

  18. Development of Fracture Toughness Evaluation Method for Composite Materials by Non-Destructive Testing Method

    International Nuclear Information System (INIS)

    Lee, Y. T.; Kim, K. S.

    1998-01-01

    Fracture process of continuous fiber reinforced composites is very complex because various fracture mechanisms such as matrix cracking, debonding, delamination and fiber breaking occur simultaneously during crack growth. If fibers cause crack bridging during crack growth, the stable crack growth and unstable crack growth appear repeatedly. Therefore, it is very difficult to exactly determine tile starting point of crack growth and the fracture toughness at the critical crack length in composites. In this research, fracture toughness test for CFRP was accomplished by using acoustic emission(AE) and recording of tile fracture process in real time by video-microscope. The starting point of crack growth, pop-in point and the point of unstable crack growth can be exactly determined. Each fracture mechanism can be classified by analyzing the fracture process through AE and video-microscope. The more reliable method is the fracture toughness measurement of composite materials was proposed by using the combination of R-curve method, AE and video microscope

  19. 7 CFR 58.337 - Official test methods.

    Science.gov (United States)

    2010-01-01

    ... of Analysis of the Association of Official Analytical Chemists, published by the Association of Official Analytical Chemists, the Official and Tentative Methods of the American Oil Chemists Society or...

  20. 40 CFR 61.164 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... 3 for gas analysis. (D) For sources equipped with positive pressure fabric filters, use Section 8.0... analysis. (D) For sources equipped with positive pressure fabric filters, use Section 8.0 of Method 5D to...

  1. Testing an Automated Accuracy Assessment Method on Bibliographic Data

    Directory of Open Access Journals (Sweden)

    Marlies Olensky

    2014-12-01

    Full Text Available This study investigates automated data accuracy assessment as described in data quality literature for its suitability to assess bibliographic data. The data samples comprise the publications of two Nobel Prize winners in the field of Chemistry for a 10-year-publication period retrieved from the two bibliometric data sources, Web of Science and Scopus. The bibliographic records are assessed against the original publication (gold standard and an automatic assessment method is compared to a manual one. The results show that the manual assessment method reflects truer accuracy scores. The automated assessment method would need to be extended by additional rules that reflect specific characteristics of bibliographic data. Both data sources had higher accuracy scores per field than accumulated per record. This study contributes to the research on finding a standardized assessment method of bibliographic data accuracy as well as defining the impact of data accuracy on the citation matching process.

  2. Isentropic Bulk Modulus: Development of a Federal Test Method

    Science.gov (United States)

    2016-01-01

    bulk modulus space from synthetic iso -paraffinic fuels to petroleum-based diesel fuels. The test fuels are identified in Table 1. A testing order and...10 20 30 40 50 60 70 80 0 2 4 6 8 10 12 14 16 Pressure (psi) Thousands Speed -of-Sound (m/s) r R 0 5000 10000 15000 20000 25000 30000 35000 0 2 4 6 8...Thousands Speed -of-Sound (m/s) r R 0 5000 10000 15000 20000 25000 30000 35000 0 2 4 6 8 10 12 14 16 Pressure (psi) Thousands Bulk Modulus (psi) r R

  3. Test-particle method in kinetic theory of a plasma.

    Science.gov (United States)

    Matsuda, K.

    1971-01-01

    The introduction of a test particle into a system is considered. The system may be described by the Born-Bogoliubov-Green-Kirkwood-Yvon hierarchy. The field particles form a cloud which surrounds the test particle. The cloud is described by a conditional probability function which satisfies a certain equation. A generalization of the superposition principle reported by Rostoker (1964) to higher order correlation functions is discussed. Kinetic equations with the generalized Lenard-Balescu term are obtained, taking into account also diffusion by waves. The characteristics regarding the absorption or emission of waves by particles can be calculated.

  4. Three IQs of AI Systems and their Testing Methods

    OpenAIRE

    Liu, Feng; Shi, Yong; Liu, Ying

    2017-01-01

    The rapid development of artificial intelligence has brought the artificial intelligence threat theory as well as the problem about how to evaluate the intelligence level of intelligent products. Both need to find a quantitative method to evaluate the intelligence level of intelligence systems, including human intelligence. Based on the standard intelligence system and the extended Von Neumann architecture, this paper proposes General IQ, Service IQ and Value IQ evaluation methods for intelli...

  5. Test Methods for Telemetry Systems and Subsystems. Volume 5: Test Methods for Digital Recorder/Reproducer Systems and Recorder Memory Modules

    Science.gov (United States)

    2016-09-26

    REPRODUCER SYSTEMS AND RECORDER MEMORY MODULES ABERDEEN TEST CENTER DUGWAY PROVING GROUND REAGAN TEST SITE WHITE SANDS MISSILE RANGE YUMA...ARNOLD ENGINEERING DEVELOPMENT COMPLEX NATIONAL AERONAUTICS AND SPACE ADMINISTRATION DISTRIBUTION A: APPROVED FOR PUBLIC RELEASE; DISTRIBUTION...AND SUBSYSTEMS VOLUME V TEST METHODS FOR DIGITAL RECORDER/REPRODUCER SYSTEMS AND RECORDER MEMORY MODULES September 2016

  6. Methods of testing HEPA filters with short upstream approaches

    International Nuclear Information System (INIS)

    Kirk, G.Q.; Childress, C.E.; Schmoyer, D.D.

    1989-01-01

    The design of an air cleaning system to be used in a high gamma radiation field presented unique problems for in-place Dioctyl phthalate (DOP) leak testing. The design required remotely changeable HEPA (High Efficiency Particulate Air) filters in a disposable, stainless steel housing, located underground in a stainless steel-lined concrete pit. The conventional approach of providing ten duct diameters of upstream mixing for the dispersion of the challenge aerosol was not a viable solution to the necessity of testing the second filter stage in the system. To establish aerosol (DOP) injection ports that could provide mixing in accordance with ANSI N510-80, a full-scale housing was built. The housing and components were built of Plexiglas to view the DOP streams. A series of tests was designed in which the following factors were varied: (1) aerosol distributors, (2) aerosol distributor locations, (3) baffle design, and (4) baffle location. DOP concentration measurements were taken immediately upstream of the filters. The uniformity score, as determined by ANSI N510-80, was defined as the larger of maximum minus average values of DOP concentration. Three tests met the uniformity score requirement of 0.20, but all three had ten duct diameters of upstream mixing. The type of aerosol distributor, duct length, and flow rate were found to most affect the uniformity score

  7. Material characterization models and test methods for historic building materials

    DEFF Research Database (Denmark)

    Hansen, Tessa Kvist; Peuhkuri, Ruut Hannele; Møller, Eva B.

    2017-01-01

    Predictions of long term hygrothermal performance can be assessed by dynamic hygrothermal simulations, in which material parameters are crucial input. Material parameters for especially historic materials are often unknown; therefore, there is a need to determine important parameters, and simple...... decisive parameters through simple testing of interrelated parameters that are easier to determine....

  8. State-of-the-art methods for testing materials outdoors

    Science.gov (United States)

    R. Sam Williams

    2004-01-01

    In recent years, computers, sensors, microelectronics, and communication technologies have made it possible to automate the way materials are tested in the field. It is now possible to purchase monitoring equipment to measure weather and materials properties. The measurement of materials response often requires innovative approaches and added expense, but the...

  9. A revised simplex method for test construction problems

    NARCIS (Netherlands)

    Adema, Jos J.; Adema, J.J.

    1990-01-01

    Linear programming models with 0-1 variables are useful for the construction of tests from an item bank. Most solution strategies for these models start with solving the relaxed 0-1 linear programming model, allowing the 0-1 variables to take on values between 0 and 1. Then, a 0-1 solution is found

  10. Small-Item Contact Test Method, FY11 Release

    Science.gov (United States)

    2012-07-01

    developmental and operational testing (DT/OT) activities , technology readiness assessments (TRA) to determine technology readiness level (TRL...or gas phase ( fumigants , including aerosols). decontamination process: The process of making any person, object, or area safe by absorbing...item. • For vaporous decontaminants: injection rate, flow rate, fumigant concentration, temperature, and relative humidity. • For liquid

  11. An Improved Ground Vibration Test Method. Volume 1. Research Report

    Science.gov (United States)

    1980-09-01

    peak value with very short duration. This causes the force to overdrive (i.e., excite the nonlinearities) the system while putting very little total...Stiffness and Mass Matrices from Experimental Vibration Modes" Ross , R. G., Jr. SAE Paper No. 710787 19/1, 9 pp. 177. "Vibroacoustic Testing of Space

  12. Formal Methods for Conformance Testing: Theory Can Be Practical!

    NARCIS (Netherlands)

    Brinksma, Hendrik; Halbwachs, N.; Peled, D.

    Although testing is the most widely used technique to control the quality of software systems, it is a topic that, until relatively recently, has received scant attention from the computer research community. Although some pioneering work was already done a considerable time ago

  13. Heuristic Constraint Management Methods in Multidimensional Adaptive Testing

    Science.gov (United States)

    Born, Sebastian; Frey, Andreas

    2017-01-01

    Although multidimensional adaptive testing (MAT) has been proven to be highly advantageous with regard to measurement efficiency when several highly correlated dimensions are measured, there are few operational assessments that use MAT. This may be due to issues of constraint management, which is more complex in MAT than it is in unidimensional…

  14. 49 CFR 230.45 - Method of testing.

    Science.gov (United States)

    2010-10-01

    ..., DEPARTMENT OF TRANSPORTATION STEAM LOCOMOTIVE INSPECTION AND MAINTENANCE STANDARDS Boilers and Appurtenances... dead weight tester. While under test load at the MAWP of the boiler to which the gauge will be applied, the gauge shall be set to read that pressure as accurately as the physical limitations of the gauge...

  15. 40 CFR 63.180 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... pressure shall be measured using a pressure measurement device (gauge, manometer, or equivalent) which has... § 63.11(b)(8), as appropriate. (f) The following procedures shall be used to pressure test batch product-process equipment for pressure or vacuum loss to demonstrate compliance with the requirements of...

  16. 40 CFR 61.304 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ...) Calibrate and install a pressure measurement device (liquid manometer, magnehelic gauge, or equivalent... pressured to during the most recent vapor-tightness test. (2) Connect the pressure measurement device to a pressure tap in the affected facility's vapor collection system, located as close as possible to the...

  17. Evaluation of methods to test chemicals suitability for umbilical applications

    Energy Technology Data Exchange (ETDEWEB)

    Allenson, S. J.; Lindeman, O. E.; Cenegy, L. M.

    2006-03-15

    Offshore deep-water projects are increasingly deploying chemicals to sub-sea wellheads through umbilical lines. There is no margin for error in umbilical chemical treatment programs since any flow blockage in a sub-sea line would result in a multi-million dollar problem. Chemicals for umbilical delivery must also meet strict requirements in their performance and especially their handling properties. Umbilical delivery must be effective at low concentrations in preventing corrosion, scale, hydrates, asphaltenes, paraffin and a host of other problems. Chemical transiting an umbilical can experience pressures as high as 15,000 psi and temperatures ranging from near 0 deg C to greater than 120 deg C. Since some umbilicals are as long as 80 km, a week or more can elapse from the time the chemical is injected at the platform until it reaches the sub-sea well. Therefore, the chemical must not only be stable under all temperature and pressure conditions that it may experience in the umbilical line, it must also be stable under these conditions for a long period of time. Since many umbilical lines actually terminate into sub-sea valves and connectors that are only a few hundred microns in diameter, it is critical that the injected chemical have a low viscosity at sub-sea temperatures and pressures and that it be completely free of particles. These issues present substantial challenges in formulating and manufacturing chemicals for umbilical applications that must be addressed prior to approval of a product for use. Each of these challenges was taken into consideration and a series of tests were developed to assure reliable chemical pump ability through an umbilical line. The tests developed included enhanced formulation stability tests under umbilical temperature and pressure conditions, NAS Class rating, extensive material compatibility testing to include all metals and elastomers that may be used in umbilical injection systems and comprehensive physical property testing

  18. Implementation of a Biaxial Resonant Fatigue Test Method on a Large Wind Turbine Blade

    Energy Technology Data Exchange (ETDEWEB)

    Snowberg, D.; Dana, S.; Hughes, S.; Berling, P.

    2014-09-01

    A biaxial resonant test method was utilized to simultaneously fatigue test a wind turbine blade in the flap and edge (lead-lag) direction. Biaxial resonant blade fatigue testing is an accelerated life test method utilizing oscillating masses on the blade; each mass is independently oscillated at the respective flap and edge blade resonant frequency. The flap and edge resonant frequency were not controlled, nor were they constant for this demonstrated test method. This biaxial resonant test method presented surmountable challenges in test setup simulation, control and data processing. Biaxial resonant testing has the potential to complete test projects faster than single-axis testing. The load modulation during a biaxial resonant test may necessitate periodic load application above targets or higher applied test cycles.

  19. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  20. 46 CFR 57.06-3 - Method of performing production testing.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Method of performing production testing. 57.06-3 Section... AND BRAZING Production Tests § 57.06-3 Method of performing production testing. (a) Except as... the weld metal deposited in the groove of the longitudinal joint. As an alternate method, the marine...

  1. [Draize test and alternative methods for evaluating irritation from chemical substances].

    Science.gov (United States)

    Moskalewski, S; Mystkowska, E T; Kiss, E

    1995-01-01

    The eye irritancy test in rabbits (Draize test) is currently the method used to evaluate the hazard or safety of chemical substances. To reduce the need for animal testing some new procedures as alternative were elaborated. We present a review of method used as well as evaluation of sensitivity and repeatability of alternative tests applied in laboratories of European Economic Communities.

  2. Revised reference broth microdilution method for testing telavancin: effect on MIC results and correlation with other testing methodologies.

    Science.gov (United States)

    Farrell, David J; Mendes, Rodrigo E; Rhomberg, Paul R; Jones, Ronald N

    2014-09-01

    The reference broth microdilution (BMD) antimicrobial susceptibility testing method for telavancin was revised to include dimethyl sulfoxide (DMSO) as a solvent and diluent for frozen-form panel preparation, following the CLSI recommendations for water-insoluble agents. Polysorbate 80 (P-80) was also added to the test medium to minimize proven drug losses associated with binding to plastic surfaces. Four hundred sixty-two Gram-positive isolates, including a challenge set of organisms with reduced susceptibilities to comparator agents, were selected and tested using the revised method for telavancin, and the MIC results were compared with those tested by the previously established method and several Sensititre dry-form BMD panel formulations. The revised method provided MIC results 2- to 8-fold lower than the previous method when tested against staphylococci and enterococci, resulting in MIC50 values of 0.03 to 0.06 μg/ml for staphylococci and 0.03 and 0.12 μg/ml for Enterococcus faecium and Enterococcus faecalis, respectively. Less-significant MIC decreases (1 to 2 log2 dilution steps) were observed when testing streptococci in broth supplemented with blood, which showed similar MIC50 values for both methods. However, Streptococcus pneumoniae had MIC50 results of 0.008 and 0.03 μg/ml when tested by the revised and previous methods, respectively. Highest essential agreement rates (≥94.0%) were noted for one candidate dry-form panel formulation compared to the revised test. The revised BMD method provides lower MIC results for telavancin, especially when tested against staphylococci and enterococci. This is secondary to the use of DMSO for panel production and the presence of P-80, which ensure the proper telavancin testing concentration and result in a more accurate MIC determination. Moreover, earlier studies where the previous method was applied underestimated the in vitro drug potency. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Reduction Method for Real-Time Simulations in Hybrid Testing

    DEFF Research Database (Denmark)

    Andersen, Sebastian; Poulsen, Peter Noe

    2014-01-01

    assembling of the internal forces element by element at each equilibrium point and a strict requirement for small time steps to maintain accuracy and stability often prevents real time execution. Thus, enhanced numerical capacity is required. In the present study a basis reduction method is used...... to reformulate kinematic nonlinear equations of motion into a sum of constant matrices each multiplied by a reduced coordinate decreasing the assembling time. Furthermore the method allows for cutting off some of the higher frequency content not representing real physics decreasing the stability requirement...... of choosing a sufficient basis a composite beam and a cantilever beam including kinematic nonlinearities and exposed to harmonic loadings are analyzed. To reduce locking modes with higher order terms are included. From the analysis it is concluded that the method exhibits encouraging potential with respect...

  4. Standard method of test for radioactive cesium in water

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    Concentrations of radioactive Cs greater than 1 μCi/l in water were determined by gamma counting after separation by extraction. The method is limited to 134 Cs, 136 Cs, 137 Cs, and 138 Cs. The radioactive Cs is extracted at pH 7.0 as cesium tetraphenylborate in amyl acetate with EDTA present to prevent the extraction of undesirable fission products. The γ activity of a sample of the organic phase is determined by γ spectroscopy. Large amounts of Na + , K + , Cs + , Rb + , NH 4 + , Ag + , and free acid interfere with the separation process in the procedure. The overall precision of the method is +-5 percent

  5. METHOD OF TESTING THERMAL NEUTRON FISSIONABLE MATERIAL FOR PURITY

    Science.gov (United States)

    Fermi, E.; Anderson, H.L.

    1961-01-24

    A process is given for determining the neutronic purity of fissionable material by the so-called shotgun test. The effect of a standard neutron absorber of known characteristics and amounts on a neutronic field also of known characteristics is measured and compared with the effect which the impurities derived from a known quantity of fissionable material has on the same neutronic field. The two readings are then made the basis of calculation from which the amount of impurities can be computed.

  6. New methods of testing Lorentz violation in electrodynamics

    OpenAIRE

    Tobar, Michael E.; Wolf, Peter; Fowler, Alison; Hartnett, John G.

    2004-01-01

    We investigate experiments that are sensitive to the scalar and parity-odd coefficients for Lorentz violation in the photon sector of the Standard Model Extension (SME). We show that of the classic tests of special relativity, Ives-Stilwell (IS) experiments are sensitive to the scalar coefficient, but at only parts in 10^5 for the state-of-the-art experiment. We then propose asymmetric Mach-Zehnder interferometers with different electromagnetic properties in the two arms, including recycling ...

  7. Small-Item Vapor Test Method, FY11 Release

    Science.gov (United States)

    2012-07-01

    technology (S&T), T&E, and developmental and operational testing (DT/OT) activities , technology readiness assessments (TRA) to determine technology...powders, wipes), or gas-phase ( fumigants , including aerosols). decontamination process: The process of making any person, object, or area safe by...delivered to item. ■ Vaporous decontaminants: injection rate, flow rate, fumigant concentration, temperature, and relative humidity. ■ Liquid

  8. 1-g model loading tests: methods and results

    Czech Academy of Sciences Publication Activity Database

    Feda, Jaroslav

    1999-01-01

    Roč. 2, č. 4 (1999), s. 371-381 ISSN 1436-6517. [Int.Conf. on Soil - Structure Interaction in Urban Civ. Engineering. Darmstadt, 08.10.1999-09.10.1999] R&D Projects: GA MŠk OC C7.10 Keywords : shallow foundation * model tests * sandy subsoil * bearing capacity * subsoil failure * volume deformation Subject RIV: JM - Building Engineering

  9. GMI Instrument Spin Balance Method, Optimization, Calibration, and Test

    Science.gov (United States)

    Ayari, Laoucet; Kubitschek, Michael; Ashton, Gunnar; Johnston, Steve; Debevec, Dave; Newell, David; Pellicciotti, Joseph

    2014-01-01

    The Global Microwave Imager (GMI) instrument must spin at a constant rate of 32 rpm continuously for the 3 year mission life. Therefore, GMI must be very precisely balanced about the spin axis and CG to maintain stable scan pointing and to minimize disturbances imparted to the spacecraft and attitude control on-orbit. The GMI instrument is part of the core Global Precipitation Measurement (GPM) spacecraft and is used to make calibrated radiometric measurements at multiple microwave frequencies and polarizations. The GPM mission is an international effort managed by the National Aeronautics and Space Administration (NASA) to improve climate, weather, and hydro-meteorological predictions through more accurate and frequent precipitation measurements. Ball Aerospace and Technologies Corporation (BATC) was selected by NASA Goddard Space Flight Center to design, build, and test the GMI instrument. The GMI design has to meet a challenging set of spin balance requirements and had to be brought into simultaneous static and dynamic spin balance after the entire instrument was already assembled and before environmental tests began. The focus of this contribution is on the analytical and test activities undertaken to meet the challenging spin balance requirements of the GMI instrument. The novel process of measuring the residual static and dynamic imbalances with a very high level of accuracy and precision is presented together with the prediction of the optimal balance masses and their locations.

  10. Comparison of Statistical Methods for Detector Testing Programs

    Energy Technology Data Exchange (ETDEWEB)

    Rennie, John Alan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Abhold, Mark [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-10-14

    A typical goal for any detector testing program is to ascertain not only the performance of the detector systems under test, but also the confidence that systems accepted using that testing program’s acceptance criteria will exceed a minimum acceptable performance (which is usually expressed as the minimum acceptable success probability, p). A similar problem often arises in statistics, where we would like to ascertain the fraction, p, of a population of items that possess a property that may take one of two possible values. Typically, the problem is approached by drawing a fixed sample of size n, with the number of items out of n that possess the desired property, x, being termed successes. The sample mean gives an estimate of the population mean p ≈ x/n, although usually it is desirable to accompany such an estimate with a statement concerning the range within which p may fall and the confidence associated with that range. Procedures for establishing such ranges and confidence limits are described in detail by Clopper, Brown, and Agresti for two-sided symmetric confidence intervals.

  11. BENDING OF REINFORCING BARS TESTING METHOD AND INFLUENCE ON STRUCTURES

    Directory of Open Access Journals (Sweden)

    Hari Warsianto

    2012-02-01

    Full Text Available Reinforcing bars in concrete elements functions as the component carrying tensile stresses after concretecracking. This is due to that fact that concrete exhibit very high compression strength combined with avery low tensile capacity. The tensile stressed are transferred to the bars by the bond between thereinforcement and the concrete.Bars are generally produced in strands 6 to 12 meter in length so that bending for transportation andhandling purposes becomes necessary. At the site bars are straightened, and then sometimes re-bent forassembling purposes. This process will result in a loading and re-loading of steel.The ASTM E-290 mandated that bars have to pass the bending test, whereas reinforcing steel bars arebend to almost 1800 to ensure material ductility. In the past five years the Construction and MaterialLaboratory, Diponegoro University has been questioned with the issue as to how far this bending andstraightening influences the quality and what the significance of testing is.This paper will evaluate theinfluence of bending and straightening and the testing procedure involved.

  12. A retrospective approach to testing the DNA barcoding method.

    Directory of Open Access Journals (Sweden)

    David G Chapple

    Full Text Available A decade ago, DNA barcoding was proposed as a standardised method for identifying existing species and speeding the discovery of new species. Yet, despite its numerous successes across a range of taxa, its frequent failures have brought into question its accuracy as a short-cut taxonomic method. We use a retrospective approach, applying the method to the classification of New Zealand skinks as it stood in 1977 (primarily based upon morphological characters, and compare it to the current taxonomy reached using both morphological and molecular approaches. For the 1977 dataset, DNA barcoding had moderate-high success in identifying specimens (78-98%, and correctly flagging specimens that have since been confirmed as distinct taxa (77-100%. But most matching methods failed to detect the species complexes that were present in 1977. For the current dataset, there was moderate-high success in identifying specimens (53-99%. For both datasets, the capacity to discover new species was dependent on the methodological approach used. Species delimitation in New Zealand skinks was hindered by the absence of either a local or global barcoding gap, a result of recent speciation events and hybridisation. Whilst DNA barcoding is potentially useful for specimen identification and species discovery in New Zealand skinks, its error rate could hinder the progress of documenting biodiversity in this group. We suggest that integrated taxonomic approaches are more effective at discovering and describing biodiversity.

  13. 40 CFR 75.22 - Reference test methods.

    Science.gov (United States)

    2010-07-01

    ... tester may also opt to use the sample recovery and preparation procedures in ASTM D6784-02 (incorporated... 75.22 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... site and sample traverses. (2) Method 2 or its allowable alternatives, as provided in appendix A to...

  14. On estimation methods and test for proportional hazards ...

    African Journals Online (AJOL)

    These methods were described and applied to two datasets, a clinical dataset on breast cancer patients and a dataset on duration of labour before delivery. We also checked for proportional hazards assumptions on some of the covariates used in the analysis. Using Akaike Information Criterion (AIC) for overall model ...

  15. 40 CFR 60.106 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... is to be used to determine particulate matter emissions and associated moisture content from affected... (Qr). (ii) The emission correction factor, integrated sampling and analysis procedure of Method 3B... shall be used to determine opacity. (c) If auxiliary liquid or solid fossil-fuels are burned in an...

  16. A Hybrid Positioning Method Based on Hypothesis Testing

    DEFF Research Database (Denmark)

    Amiot, Nicolas; Pedersen, Troels; Laaraiedh, Mohamed

    2012-01-01

    We consider positioning in the scenario where only two reliable range estimates, and few less reliable power observations are available. Such situations are difficult to handle with numerical maximum likelihood methods which require a very accurate initialization to avoid being stuck into local...

  17. An entrepreneurial physics method and its experimental test

    Science.gov (United States)

    Brown, Robert

    2012-02-01

    As faculty in a master's program for entrepreneurial physics and in an applied physics PhD program, I have advised upwards of 40 master and doctoral theses in industrial physics. I have been closely involved with four robust start-up manufacturing companies focused on physics high-technology and I have spent 30 years collaborating with industrial physicists on research and development. Thus I am in a position to reflect on many articles and advice columns centered on entrepreneurship. What about the goals, strategies, resources, skills, and the 10,000 hours needed to be an entrepreneur? What about business plans, partners, financing, patents, networking, salesmanship and regulatory affairs? What about learning new technology, how to solve problems and, in fact, learning innovation itself? At this point, I have my own method to propose to physicists in academia for incorporating entrepreneurship into their research lives. With this method, we do not start with a major invention or discovery, or even with a search for one. The method is based on the training we have, and the teaching we do (even quantum electrodynamics!), as physicists. It is based on the networking we build by 1) providing courses of continuing education for people working in industry and 2) through our undergraduate as well as graduate students who have gone on to work in industry. In fact, if we were to be limited to two words to describe the method, they are ``former students.'' Data from local and international medical imaging manufacturing industry are presented.

  18. 40 CFR 63.827 - Performance test methods.

    Science.gov (United States)

    2010-07-01

    ... compounds as carbon, ppmv. 12.0 = Molecular weight of carbon. 0.0416 = Conversion factor for molar volume... monitors for determining total organic volatile matter concentration and the volumetric gas flow rate, and... 2D of 40 CFR part 60, appendix A is used to determine gas volumetric flow rate. (iii) Method 3 of 40...

  19. Test results for cables used in nuclear power plants by a new environmental testing method

    International Nuclear Information System (INIS)

    Handa, Katsue; Fujimura, Shun-ichi; Hayashi, Toshiyasu; Takano, Keiji; Oya, Shingo

    1982-01-01

    In the nuclear power plants using PWRs or BWRs in Japan, environmental tests are provided, in which simulated LOCA conditions are considered so as to conform with Japanese conditions, and many cables which passed these tests are presently employed. Lately, the new environmental testing, in which a credible accident called MSLB (main steam line breakage) is taken into account, is investigated in PWR nuclear power plants, besides LOCA. This paper reports on the results of evaluating some PWR cables for this new environmental testing conditions. The several cables tested were selected out of PH cables (fire-retardant, ethylene propylene rubber insulated, chlorosulfonated polyethylene sheathed cables) as the cables for safety protecting circuits and to be used in containment vessels where the cables are to be exposed to severe environmental test conditions of 2 x 10 8 Rad γ-irradiation and simulated LOCA. All these cables have been accepted after the vertical tray burning test provided in the IEEE Standard 383. The new testing was carried out by sequentially applying thermal deterioration, γ-irradiation, and the exposure to steam (twice 300 s exposures to 190 deg C superheated steam). After completing each step, tensile strength, elongation, insulation resistance and breakdown voltage were measured, respectively. Every cable tested showed satisfactory breakdown voltage after the exposure to steam, thus it was decided to be acceptable. In future, it is required to investigate the influence of the rate of temperature rise on the cable to be tested in MSLB simulation. (Wakatsuki, Y.)

  20. DESAIN DAN SINTESIS SENYAWA ACES (ANALOG CURCUMIN SERIES DENGAN METODE SOLID PHASE REACTION SEBAGAI SENYAWA ANTIKANKER POTEN DENGAN MEKANISME MENGHAMBAT PROTEIN NF-kB

    Directory of Open Access Journals (Sweden)

    Monica Sabrina Widiapranolo

    2016-04-01

    Full Text Available Abstract: Analog of curcumin in forms of enone and dienone aromatic is known for their activity as an NF-κB inhibitor. In this study, will be synthesize 2-(4'-N, N-dimethylamino benzilidine cyclohexane-1,3-dione as an analog that predicted has an activity as an NF-κB inhibitor. This research was conducted based on the crossed aldol condensation reaction by reacting 3 mmole pN,N-dimethylamino benzaldehide and 6 mmole cyclohexane-1,3-dione with hydrochloric acid as the catalyst using solid phase reaction method. Based on computational analysis, 2-(4'-N,Ndimethylamino benzilidine cyclohexane-1,3-dione showed a better interaction with NF-κB protein with PLANTSPLP score was -69,7895. The outcome of the reaction was yellow colored powder, no odor and soluble in hydrochloric acid 3N. The yield value was 78.8%. Liquid chromatography showed 100% purity. The melting point range was 237.5-240.3°C. The results of structure elucidation by 1H-NMR, infrared and mass spectroscopy tests indicated the compound was 2-(4-(dimetilaminobenzilidena-4-(3-oksosiklohex-1-enil sikloheksana-1,3-dion. Key words: 2-(4'-N, N-dimethylamino benzilidine cyclohexane-1,3-dione, crossed aldol condensation, solid phase reaction.

  1. The Regulation of NF-κB Subunits by Phosphorylation

    Directory of Open Access Journals (Sweden)

    Frank Christian

    2016-03-01

    Full Text Available The NF-κB transcription factor is the master regulator of the inflammatory response and is essential for the homeostasis of the immune system. NF-κB regulates the transcription of genes that control inflammation, immune cell development, cell cycle, proliferation, and cell death. The fundamental role that NF-κB plays in key physiological processes makes it an important factor in determining health and disease. The importance of NF-κB in tissue homeostasis and immunity has frustrated therapeutic approaches aimed at inhibiting NF-κB activation. However, significant research efforts have revealed the crucial contribution of NF-κB phosphorylation to controlling NF-κB directed transactivation. Importantly, NF-κB phosphorylation controls transcription in a gene-specific manner, offering new opportunities to selectively target NF-κB for therapeutic benefit. This review will focus on the phosphorylation of the NF-κB subunits and the impact on NF-κB function.

  2. Removing Fe, Zn and Mn from steel making plant wastewater using RO and NF membranes

    Directory of Open Access Journals (Sweden)

    Seyed Ahmad Mirbagheri

    2016-12-01

    Full Text Available Background and purpose: Excessive amount of heavy metals in industrial wastewater is a seriously crucial issue and requires efficient methods to be introduced and dealt with. Meanwhile, steel making plants as productive units in every country release large amounts of fluid into surface and underground sources. Typically, this wastewater contains heavy metals in minor amounts, while this amount could cause severe damages to the living organisms. Materials and methods: In this study, removing iron, manganese, zinc and total dissolved solid in a typical wastewater resulted from steel making plant was considered using reverse osmosis (RO and nanofiltration (NF membranes. At first, different pH values and operating pressures were applied to the wastewater. Then, these parameters were evaluated for a wastewater only containing iron to compare the interaction of other elements in iron removal. Results: The results indicated that RO and NF membranes could successfully treat industrial wastewater containing several heavy metals with high concentrations of Fe, Zn and Mn, especially at optimum pH and pressure. Moreover, the interaction of other heavy metals and components in the influent decreased the efficiency of RO but improved the NF efficiency to remove iron. To have a better image, a formula was proposed for each method to represent the influence of the parameters on removal rates. Finally, cost estimation for both procedures showed that RO was not economically-technically efficient in comparison with NF. Conclusion: NF showed an acceptable performance with high water flow which made it more suitable for industries. At the end, the relative cost analysis showed that even if the initial price of NF is high, the energy consumption and total cost of RO will be higher.

  3. 40 CFR Appendix B to Part 80 - Test Methods for Lead in Gasoline

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Test Methods for Lead in Gasoline B... in Gasoline Method 1—Standard Method Test for Lead in Gasoline by Atomic Absorption Spectrometry 1. Scope. 1.1. This method covers the determination of the total lead content of gasoline. The procedure's...

  4. Testing device for pipeline groups and control method for testing device

    International Nuclear Information System (INIS)

    Naito, Shinji; Kajiyama, Shigeru; Takahashi, Fuminobu; Tsuchida, Kenji; Tachibana, Yukio; Shigehiro, Katsuya; Mahara, Yoichi.

    1995-01-01

    The device of the present invention comprises a testing device main body disposed to a rail, a movable mechanism positioning from a reference point, a circumferential direction scanning mechanism, an axial direction scanning mechanism, a posture control mechanism, and a testing probe. Upon testing of pipelines, the detection device main body and auxiliary members are moved from a reference point previously set on a rail for numerical control toward pipelines to be tested in a state where the axial direction scanning mechanism and the testing probe are suspended in the axial direction. The testing is conducted by controlling the position of the testing probe in the axial direction of the pipeline by means of the axial direction scanning mechanism, and scanning the testing probe to the outer circumference of the pipeline along the circumferential track by way of the circumferential direction scanning mechanism. The device can be extremely reduced in the thickness, and can be moved with no interference with pipelines and other obstacles by remote operation even under such undesired condition as the pipelines being crowded, so that non-destructive testing can be conducted accurately. (N.H.)

  5. Method and apparatus for testing electrochemical energy conversion devices

    Science.gov (United States)

    Cisar, Alan J. (Inventor); Murphy, Oliver J. (Inventor)

    1996-01-01

    A system for testing electrochemical energy conversion and storage devices includes means for sensing the current from the storage device and varying the load across the storage device in response to the current sensed. The system is equally adaptable to batteries and fuel cells. Means is also provided to sense system parameters from a plurality of locations within the system. Certain parameters are then stored in digital form for archive purposes and certain other parameters are used to develop control signals in a host processor.

  6. Testing the QA Method for Calculating Jet v_{2}

    CERN Document Server

    Mueller, Jason

    2014-01-01

    For the summer, I was assigned to work on the ALICE experiment with Alice Ohlson. I wrote several programs throughout the summer that were used to calculate jet v 2 using a non-standard method described by my supervisor in her Ph.D. thesis. Though the project is not yet complete, significant progress has been made, and the results so far seem promising.

  7. Biological Aerosol Test Method and Personal Protective Equipment (PPE) Decon

    Science.gov (United States)

    2011-05-01

    bioaerosol , decontamination, FFR, filter, H5N1, influenza, respiratory protection, reuse U U U UU 33 Joe Wander Reset i Distribution A: Approved...describes protocols and the apparatus for applying viral bioaerosols to FFRs, and subsequent laboratory operations used to quantitatively assesses...3.3.4.2 Droplet Characteristics The droplets generated for this method were measured by AFRL to have a NMAD of ~40 µm. This was established

  8. 40 CFR 60.85 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ... operator shall determine compliance with the SO2 acid mist, and visible emission standards in §§ 60.82 and 60.83 as follows: (1) The emission rate (E) of acid mist or SO2 shall be computed for each run using... (ton/hr). K=conversion factor, 1000 g/kg (1.0 lb/lb). (2) Method 8 shall be used to determine the acid...

  9. Development of a Chronic Toxicity Testing Method for Daphnia pulex

    Science.gov (United States)

    2015-08-01

    of a potentially harmful substance on an organism • Brood-batch of neonates (young) released from the brood pouch at the same time • Chronic...first four days of exposure to 1 L beakers • This method was employed since neonates were sensitive to handling during transfer via wide bore plastic ...species sensitivity. Environmental Pollution 136: 145-154. Canton, J. H. and D. M. Adema. 1978. Reproducibility of short-term and reproduction toxicity

  10. 40 CFR 61.245 - Test methods and procedures.

    Science.gov (United States)

    2010-07-01

    ...: EC15NO91.055 Where: HT = Net heating value of the sample, MJ/scm (BTU/scf); where the net enthalpy per mole....740 × 10 7 (g-mole) (MJ)/(ppm-scm-kcal) (metric units); or 4.674 × 108 ((g-mole) (Btu)/(ppm-scf-kcal)) (English units) Ci = Concentration of sample component “i” in ppm, as measured by Method 18 of appendix A...

  11. Study on the system-level test method of digital metering in smart substation

    Science.gov (United States)

    Zhang, Xiang; Yang, Min; Hu, Juan; Li, Fuchao; Luo, Ruixi; Li, Jinsong; Ai, Bing

    2017-03-01

    Nowadays, the test methods of digital metering system in smart substation are used to test and evaluate the performance of a single device, but these methods can only effectively guarantee the accuracy and reliability of the measurement results of a digital metering device in a single run, it does not completely reflect the performance when each device constitutes a complete system. This paper introduced the shortages of the existing test methods. A system-level test method of digital metering in smart substation was proposed, and the feasibility of the method was proved by the actual test.

  12. Design of an NF-kB Activation-Coupled Apoptotic Molecule for Prostate Cancer Therapy

    National Research Council Canada - National Science Library

    Yang, Wannian

    2008-01-01

    ...), that couples activation of NF-kB to activation of Caspase-3, thus to apoptosis. During the eighteen months, we constructed 32 plasmids for testing the function of NACAM and determined the expression of the plasmids in HEK293 cells...

  13. Validation of a an analysis method of Marine Bio toxins Type Saxitoxin based on test coupled receptor (RBA) with Radiochemical Detection with liquid scintillation

    International Nuclear Information System (INIS)

    Selmi, Zied

    2009-01-01

    The saxitoxin s are bio toxins belonging to the family of toxins of the type PSP. They are paralysing toxins secreted by marine micro-organisms, phytoplankton, called Alexandrium. They constitute a risk for the human health in the event of their consumption in contaminated food. The acceptable maximum limit of these bio toxins in molluscs and shellfish is fixed to 800 μg /kg of meat of molluscs or shellfish. It proves, thus, that it is essential to develop and validate analytical methods for the level monitoring of contamination of the marine resources by these species in order to found a program of their monitoring and to guarantee an acceptable level of the food safety of the products available on the national and international markets. The present work allowed the validation of the quantification method of these toxins which is based on the use of the Receptor Binding Assay (RBA) with liquid scintillation nuclear technique detection using tritium as radiotracer and while proceeding by the different statistical tests of validation (Standard Nf XP T 90-210). The field of linearity ranged from 0 to 20 n M and the limit of detection was found to be 1 n M. The validation of this method will allow the reinforcement of the analytical means of analysis of marine bi toxins type SXT and to set up, in the near future, a monitoring and surveillance routine program for these bio toxins at the national, regional and African scales. (Author)

  14. Optical Methods For Automatic Rating Of Engine Test Components

    Science.gov (United States)

    Pritchard, James R.; Moss, Brian C.

    1989-03-01

    In recent years, increasing commercial and legislative pressure on automotive engine manufacturers, including increased oil drain intervals, cleaner exhaust emissions and high specific power outputs, have led to increasing demands on lubricating oil performance. Lubricant performance is defined by bench engine tests run under closely controlled conditions. After test, engines are dismantled and the parts rated for wear and accumulation of deposit. This rating must be consistently carried out in laboratories throughout the world in order to ensure lubricant quality meeting the specified standards. To this end, rating technicians evaluate components, following closely defined procedures. This process is time consuming, inaccurate and subject to drift, requiring regular recalibration of raters by means of international rating workshops. This paper describes two instruments for automatic rating of engine parts. The first uses a laser to determine the degree of polishing of the engine cylinder bore, caused by the reciprocating action of piston. This instrument has been developed to prototype stage by the NDT Centre at Harwell under contract to Exxon Chemical, and is planned for production within the next twelve months. The second instrument uses red and green filtered light to determine the type, quality and position of deposit formed on the piston surfaces. The latter device has undergone feasibility study, but no prototype exists.

  15. Microbiological methods for testing disinfectant efficiency on Pseudomonas biofilm.

    Science.gov (United States)

    Wirtanen; Salo; Helander; Mattila-Sandholm

    2001-01-15

    Biofilms of the Gram-negative bacteria Pseudomonas aeruginosa and Pseudomonas fragi were grown on stainless steel surfaces (AISI 304, 2B) for 4 days in slime broth. These biofilms were treated with four commercial disinfectants. The disinfectants were alcohol-based, tenside-based, peroxide-based and chlorine-based products, covering most disinfectant types used in the food industry. The effects of the disinfectants on the bacterial cells were first investigated in suspension using the permeabilisation test, which is based on fluorescence assessment of hydrophobic 1-N-phenyl-naphtylamine (NPN). The surfaces covered with disinfectant-treated biofilms were investigated using conventional cultivation, impedimetry and epifluorescence microscopy in combination with image analysis of preparations stained with the DNA-stain acridine orange and with the metabolic indicator system CTC-DAPI. The results showed that the tenside-based and peroxide-based disinfectants permeabilised the cells in suspension. The overall biofilm results showed that of the agents tested, the peroxide-based and chlorine-based disinfectants acted most effectively on cells in biofilms.

  16. Tests of Measurement Invariance without Subgroups: A Generalization of Classical Methods

    Science.gov (United States)

    Merkle, Edgar C.; Zeileis, Achim

    2013-01-01

    The issue of measurement invariance commonly arises in factor-analytic contexts, with methods for assessment including likelihood ratio tests, Lagrange multiplier tests, and Wald tests. These tests all require advance definition of the number of groups, group membership, and offending model parameters. In this paper, we study tests of measurement…

  17. Human adipocytes are highly sensitive to intermittent hypoxia induced NF-kappaB activity and subsequent inflammatory gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, Cormac T. [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Kent, Brian D.; Crinion, Sophie J.; McNicholas, Walter T. [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Pulmonary and Sleep Disorders Unit, St. Vincent’s University Hospital, Dublin (Ireland); Ryan, Silke, E-mail: silke.ryan@ucd.ie [School of Medicine and Medical Science, The Conway Institute, University College Dublin (Ireland); Pulmonary and Sleep Disorders Unit, St. Vincent’s University Hospital, Dublin (Ireland)

    2014-05-16

    Highlights: • Intermittent hypoxia (IH) leads to NF-κB activation in human primary adipocytes. • Adipocytes bear higher pro-inflammatory potential than other human primary cells. • IH leads to upregulation of multiple pro-inflammatory genes in human adipocytes. - Abstract: Introduction: Intermittent hypoxia (IH)-induced activation of pro-inflammatory pathways is a major contributing factor to the cardiovascular pathophysiology associated with obstructive sleep apnea (OSA). Obesity is commonly associated with OSA although it remains unknown whether adipose tissue is a major source of inflammatory mediators in response to IH. The aim of this study was to test the hypothesis that IH leads to augmented inflammatory responses in human adipocytes when compared to cells of non-adipocyte lineages. Methods and results: Human primary subcutaneous and visceral adipocytes, human primary microvascular pulmonary endothelial cells (HUMEC-L) and human primary small airway epithelial cells (SAEC) were exposed to 0, 6 or 12 cycles of IH or stimulated with tumor necrosis factor (TNF)-α. IH led to a robust increase in NF-κB DNA-binding activity in adipocytes compared with normoxic controls regardless of whether the source of adipocytes was visceral or subcutaneous. Notably, the NF-κB response of adipocytes to both IH and TNF-α was significantly greater than that in HUMEC-L and SAEC. Western blotting confirmed enhanced nuclear translocation of p65 in adipocytes in response to IH, accompanied by phosphorylation of I-κB. Parallel to p65 activation, we observed a significant increase in secretion of the adipokines interleukin (IL)-8, IL-6 and TNF-α with IH in adipocytes accompanied by significant upregulation of mRNA expression. PCR-array suggested profound influence of IH on pro-inflammatory gene expression in adipocytes. Conclusion: Human adipocytes demonstrate strong sensitivity to inflammatory gene expression in response to acute IH and hence, adipose tissue may be a key

  18. Human adipocytes are highly sensitive to intermittent hypoxia induced NF-kappaB activity and subsequent inflammatory gene expression

    International Nuclear Information System (INIS)

    Taylor, Cormac T.; Kent, Brian D.; Crinion, Sophie J.; McNicholas, Walter T.; Ryan, Silke

    2014-01-01

    Highlights: • Intermittent hypoxia (IH) leads to NF-κB activation in human primary adipocytes. • Adipocytes bear higher pro-inflammatory potential than other human primary cells. • IH leads to upregulation of multiple pro-inflammatory genes in human adipocytes. - Abstract: Introduction: Intermittent hypoxia (IH)-induced activation of pro-inflammatory pathways is a major contributing factor to the cardiovascular pathophysiology associated with obstructive sleep apnea (OSA). Obesity is commonly associated with OSA although it remains unknown whether adipose tissue is a major source of inflammatory mediators in response to IH. The aim of this study was to test the hypothesis that IH leads to augmented inflammatory responses in human adipocytes when compared to cells of non-adipocyte lineages. Methods and results: Human primary subcutaneous and visceral adipocytes, human primary microvascular pulmonary endothelial cells (HUMEC-L) and human primary small airway epithelial cells (SAEC) were exposed to 0, 6 or 12 cycles of IH or stimulated with tumor necrosis factor (TNF)-α. IH led to a robust increase in NF-κB DNA-binding activity in adipocytes compared with normoxic controls regardless of whether the source of adipocytes was visceral or subcutaneous. Notably, the NF-κB response of adipocytes to both IH and TNF-α was significantly greater than that in HUMEC-L and SAEC. Western blotting confirmed enhanced nuclear translocation of p65 in adipocytes in response to IH, accompanied by phosphorylation of I-κB. Parallel to p65 activation, we observed a significant increase in secretion of the adipokines interleukin (IL)-8, IL-6 and TNF-α with IH in adipocytes accompanied by significant upregulation of mRNA expression. PCR-array suggested profound influence of IH on pro-inflammatory gene expression in adipocytes. Conclusion: Human adipocytes demonstrate strong sensitivity to inflammatory gene expression in response to acute IH and hence, adipose tissue may be a key

  19. 40 CFR 63.344 - Performance test requirements and test methods.

    Science.gov (United States)

    2010-07-01

    ... be made available to the Administrator prior to the testing, if requested. (1) A brief process... this part, was used to demonstrate the performance of a control technique are not acceptable. (c) Test... chromium emissions. For the purposes of this standard, sources using chromic acid baths can demonstrate...

  20. Development of laboratory test methods to replace the simulated high-temperature grout fluidity test.

    Science.gov (United States)

    2014-06-01

    This report contains a summary of the research performed to develop a replacement for the high-temperature grout : fluidity (HTGF) test. The HTGF test was employed in the past by FDOT to qualify post-tensioning (PT) grouts for use in : post-tensioned...

  1. Test method research on weakening interface strength of steel - concrete under cyclic loading

    Science.gov (United States)

    Liu, Ming-wei; Zhang, Fang-hua; Su, Guang-quan

    2018-02-01

    The mechanical properties of steel - concrete interface under cyclic loading are the key factors affecting the rule of horizontal load transfer, the calculation of bearing capacity and cumulative horizontal deformation. Cyclic shear test is an effective method to study the strength reduction of steel - concrete interface. A test system composed of large repeated direct shear test instrument, hydraulic servo system, data acquisition system, test control software system and so on is independently designed, and a set of test method, including the specimen preparation, the instrument preparation, the loading method and so on, is put forward. By listing a set of test results, the validity of the test method is verified. The test system and the test method based on it provide a reference for the experimental study on mechanical properties of steel - concrete interface.

  2. Testing methods of gaseous admixtures in HLMC circuits

    International Nuclear Information System (INIS)

    Shelemet'ev, V.M.; Martynov, P.N.; Askhadullin, R.Sh.; Storozhenko, A.N.; Sadovnichij, R.P.; Ivanov, I.I.

    2014-01-01

    Control of gas phase is the effective method for state diagnostics of circuit of nuclear power facilities with heavy liquid metal coolants. Use of developing in IPPE solid electrolyte and conductometric oxygen and hydrogen sensors, which are set directly in gas system of the primary circuit, allows to maintain continuously control of oxygen and hydrogen content as well as operational efficiency and accuracy of these parameters determination under various situations related with oxygen and hydrogen insertion into circuit. Sensors ensure long-term safe operation under extreme conditions of high temperatures, pressures, humidity, etc., and are advanced devices for application in nuclear power facilities with heavy liquid metal coolants [ru

  3. Glaucocalyxin B Alleviates Lipopolysaccharide-Induced Parkinson’s Disease by Inhibiting TLR/NF-κB and Activating Nrf2/HO-1 Pathway

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2017-12-01

    Full Text Available Background/Aims: Parkinson’s disease (PD is a common neurodegenerative disease in the old population, characterized by dopaminergic neuron loss, inflammation and oxidative stress injury in the substantia nigra. Glaucocalyxin B (GLB, an ent-kauranoid diterpenoid isolated from Rabdosia japonica, has anti-inflammation and anti-tumor effects. However, its effects on PD remain unclear. Methods: PD was introduced in rats via injection of lipopolysaccharide (LPS into cerebral corpus striatum, and GLB was given intracerebroventricularly to these rats. Their walking, climbing and sensory states were detected by Stepping, Whisker and Cylinder Tests. The expression of tyrosine hydroxylase (TH, glial fibrillary acidic protein (GFAP, CD11b and ionized calcium binding adaptor molecule (IBA-1 were detected by immunohischemical staining. The levels of a series of inflammatory factors, oxidative stress-related factors and apoptosis-related factors were measured by real-time PCR, immunoblotting and ELISA. In addition, Toll-like receptor (TLR/nuclear factor kappa B (NF-κB and nuclear factor erythroid 2-related factor 2 (Nrf2/heme oxygenase (HO-1 pathways were investigated to illustrate the underlying mechanism. In vitro, microglial cells exposed to LPS were treated with GLB. Results: The injection of LPS caused walking, climbing and sensory disturbances in rats, induced inflammation, oxidative stress response and apoptosis, and activated TLR/NF-κB and Nrf2/ HO-1 pathways in the cerebral tissue. GLB administration attenuated LPS-induced alterations. The TLR/NF-κB pathway was deactivated and Nrf2/HO-1 was activated after application of GLB. In vitro, cytotoxic effects induced by the conditioned medium derived from microglial cells exposed to LPS in PC12 cells were attenuated by GLB. Conclusion: GLB suppresses LPS-induced PD symptoms by modification of TLR/NF-κB and Nrf2/HO-1 pathways in vivo and in vitro.

  4. Test Methods for Telemetry Systems and Subsystems. Volume 2: Test Methods for Telemetry Radio Frequency (RF) Subsystems

    Science.gov (United States)

    2012-09-01

    xvi PCM pulse code modulation PM phase modulation p/s pulse per second RCC Range Commanders Council RCP right circular polarization RF...to be tested at a variety of environmental conditions such as temperature, humidity, vibration , and shock. The user needs to determine the...Figure 1-6. Ensure the bore sight source antenna is facing the telemetry (TM)-tracking antenna directly RCP Rx Tracking Error Demod. Voltmeter

  5. Standard Test Method for Determining the Linearity of a Photovoltaic Device Parameter with Respect To a Test Parameter

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method determines the degree of linearity of a photovoltaic device parameter with respect to a test parameter, for example, short-circuit current with respect to irradiance. 1.2 The linearity determined by this test method applies only at the time of testing, and implies no past or future performance level. 1.3 This test method applies only to non-concentrator terrestrial photovoltaic devices. 1.4 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.5 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  6. CONSTOR registered V/TC drop tests. Pre-test analysis by finite element method

    International Nuclear Information System (INIS)

    Voelzer, W.; Koenig, S.; Klein, K.; Tso, C.F.; Owen, S.; Monk, C.

    2004-01-01

    The CONSTOR registered family of steel-concrete-steel sandwich cask designs have been developed to fulfil both the internationally valid IAEA criteria for transportation and the requirements for long-term intermediate storage in the US and various European countries. A comprehensive drop testing programme using a full-scale prototype test cask (CONSTOR registered V/TC) has been developed as part of the application for a transport license in both Germany and the US. The drop tests using the full-scale cask will be performed by BAM at test facilities in Horstwalde. The tests will include five different 9m drops onto flat unyielding targets and seven different 1m drops onto a punch. The first drop test, a 9m side drop, will be performed during PATRAM 2004. The other drop tests will take place during the following year. The development of the cask design and the formulation of the drop test programme has been supported by an extensive series of finite element analyses. The objectives of the finite element analyses were; to provide an intermediate step in demonstrating the performance of the CONSTOR registered in fulfilling the requirements of 10 CFR 71 and the IAEA transport regulations. To justify the selection of drop tests. To predict the performance of V/TC during the drop tests. To estimate the strain and acceleration time histories at measuring points on the test cask and to aid in the setting up of the test instrumentation. To develop an analysis model that can be used in future safety analyses for transport and storage license applications and which can confidently be used to demonstrate the performance of the package. This paper presents an overview of the analyses performed, including a summary of all the different drop orientations that were considered. The major assumptions employed during the analyses are also discussed, as are the specifics of the modelling techniques that were employed. At the end of the paper, the key results obtained from the analyses

  7. Testing the numerical method for one-dimensional shock treatment

    International Nuclear Information System (INIS)

    Horvat, A.

    1998-01-01

    In the early 80's the SMUP computer code was developed at the Jozef Stefan Institute for simulation of two-phase flow in steam generators. It was suitable only for steady-state problems and was unable to simulate transient behavior. In this paper, efforts are presented to find suitable numerical method to renew the old SMUP computer code. The obsolete numerical code has to be replaced with a more efficient one that would be able to treat time-dependent problems. It also has to ensure accurate solution during shock propagation. One-dimensional shock propagation in a tube were studied at zero viscosity. To simplify the equation of state the ideal gas was chosen as a working fluid. Stability margins in the form of transport matrix eigenvalues were calculated. Results were found to be close to those already published.(author)

  8. Study on identification method of auto refurbishment test

    Science.gov (United States)

    Jiang, Zhenfei; Feng, Qingfu; Wang, Zhengyu; Jiang, Suqin; Chen, Xing; Zheng, Shaoyuan; Li, Bokui

    2018-04-01

    In recent years, a large number of refurbished cars inflow into the market as new cars. The traditional methods to identify refurbished cars are mostly based on experience, the subjectivity is too high and the credibility is low. In the production of automobile, the state and the automobile industry set clear standards for the thickness of the automobile paint. There is a big difference between the thickness of machine spraying and manual spraying. By studying this difference and combining with the standard, it can be identified accurately whether the car has been renovated; during the second assembly process, the surface of some parts (such as bolts) will have obvious signs of wear and tear due to the regular assembly and disassembly, it can also be identified accurately through the study of these assembly traces.

  9. A test method for analysing disturbed ethernet data streams

    Science.gov (United States)

    Kreitlow, M.; Sabath, F.; Garbe, H.

    2015-11-01

    Ethernet connections, which are widely used in many computer networks, can suffer from electromagnetic interference. Typically, a degradation of the data transmission rate can be perceived as electromagnetic disturbances lead to corruption of data frames on the network media. In this paper a software-based measuring method is presented, which allows a direct assessment of the effects on the link layer. The results can directly be linked to the physical interaction without the influence of software related effects on higher protocol layers. This gives a simple tool for a quantitative analysis of the disturbance of an Ethernet connection based on time domain data. An example is shown, how the data can be used for further investigation of mechanisms and detection of intentional electromagnetic attacks.

  10. Reveal Salmonella 2.0 test for detection of Salmonella spp. in foods and environmental samples. Performance Tested Method 960801.

    Science.gov (United States)

    Hoerner, Rebecca; Feldpausch, Jill; Gray, R Lucas; Curry, Stephanie; Islam, Zahidul; Goldy, Tim; Klein, Frank; Tadese, Theodros; Rice, Jennifer; Mozola, Mark

    2011-01-01

    Reveal Salmonella 2.0 is an improved version of the original Reveal Salmonella lateral flow immunoassay and is applicable to the detection of Salmonella enterica serogroups A-E in a variety of food and environmental samples. A Performance Tested Method validation study was conducted to compare performance of the Reveal 2.0 method with that of the U.S. Department of Agriculture-Food Safety and Inspection Service or U.S. Food and Drug Administration/Bacteriological Analytical Manual reference culture methods for detection of Salmonella spp. in chicken carcass rinse, raw ground turkey, raw ground beef, hot dogs, raw shrimp, a ready-to-eat meal product, dry pet food, ice cream, spinach, cantaloupe, peanut butter, stainless steel surface, and sprout irrigation water. In a total of 17 trials performed internally and four trials performed in an independent laboratory, there were no statistically significant differences in performance of the Reveal 2.0 and reference culture procedures as determined by Chi-square analysis, with the exception of one trial with stainless steel surface and one trial with sprout irrigation water where there were significantly more positive results by the Reveal 2.0 method. Considering all data generated in testing food samples using enrichment procedures specifically designed for the Reveal method, overall sensitivity of the Reveal method relative to the reference culture methods was 99%. In testing environmental samples, sensitivity of the Reveal method relative to the reference culture method was 164%. For select foods, use of the Reveal test in conjunction with reference method enrichment resulted in overall sensitivity of 92%. There were no unconfirmed positive results on uninoculated control samples in any trials for specificity of 100%. In inclusivity testing, 102 different Salmonella serovars belonging to serogroups A-E were tested and 99 were consistently positive in the Reveal test. In exclusivity testing of 33 strains of non

  11. Rsf-1 Influences the Sensitivity of Non-Small Cell Lung Cancer to Paclitaxel by Regulating NF-κB Pathway and Its Downstream Proteins

    Directory of Open Access Journals (Sweden)

    Xitao Chen

    2017-12-01

    Full Text Available Background/Aims: The therapeutic efficacy of paclitaxel is hampered by chemotherapeutic resistance in non-small cell lung cancer (NSCLC. Rsf-1 enhanced paclitaxel resistance via nuclear factor-κB (NF-κB in ovarian cancer cells and nasopharyngeal carcinoma. This study assessed the function of Rsf-1 in the modulation of the sensitivity of NSCLC to paclitaxel via the NF-κB pathway. Methods: The mRNA and protein levels of the related genes were quantified by RT-PCR and Western blotting. Rsf-1 silencing was achieved with CRISPR/Cas9 gene editing. Cell cycle, migration and proliferation were tested with flow cytometry, transwell test and CCK8 test. Cell apoptosis was analyzed with flow cytometry and quantification of C-capase3. The parameters of the tumors were measured in H460 cell xenograft mice. Results: Rsf-1 was highly expressed in H460 and H1299 cells. Rsf-1 knockout caused cell arrest at the G1 phase, increased cell apoptosis, and decreased migration and cell proliferation. Rsf-1 knockout increased the inhibition of cell proliferation, the reduction in cell migration and the augment in cell apoptosis in paclitaxel treated H460 and H1299 cells. Rsf-1 knockout further enhanced the paclitaxel-mediated decrease in the volume and weight of the tumors in H460 cell xenograft mice. Helenalin and Rsf-1 knockout decreased the protein levels of p-P65, BcL2, CFLAR, and XIAP; hSNF2H knockout decreased the protein level of NF-κB p-P65 without altering Rsf-1 and p65 protein levels, while Rsf-1 and hSNF2H double knockout decreased the level of NF-κB p-P65, in H1299 and H460 cells. Conclusion: These results demonstrate that Rsf-1 influences the sensitivity of NSCLC to paclitaxel via regulation of the NF-κB pathway and its downstream genes.

  12. The overlay tester (OT) : comparison with other crack test methods and recommendations for surrogate crack tests.

    Science.gov (United States)

    2012-10-01

    Presently, one of the principal performance concerns of hot-mix asphalt (HMA) pavements is premature : cracking, particularly of HMA surfacing mixes. Regrettably, however, while many USA transportation agencies have : implemented design-level tests t...

  13. Neutron activation analysis method - international ring test for proficiency assessment

    International Nuclear Information System (INIS)

    Barbos, D.; Bucsa, A. F.

    2016-01-01

    The main objective of this test is to assess the quality control of analytical procedures for soils and plants which is of utmost importance to produce reliable and reproducible analytical data. For this purpose first, second, and third line quality control measures are taken in analytical laboratories. For first line control certified reference materials (CRM's) are preferred. However, the number and matrix variation in CRM's for environmental analytical research is still very limited. For second line control internal reference samples are often used, but again here the values for many element and parameter concentrations are questionable since almost no check versus CRM's is possible. For third line control participation in laboratory-evaluating exchange programs is recommended. This article contains the results achieved by our neutron activation analysis laboratory after irradiation experiment of soil and vegetation samples in TRIGA Reactor. All the samples were irradiated in the same location of the reactor in roughly similar conditions. (authors)

  14. Testing the local spacetime dynamics by heliospheric radiocommunication methods

    Directory of Open Access Journals (Sweden)

    H.-J. Fahr

    2008-05-01

    Full Text Available According to general relativistic theories, cosmological spacetime is dynamic. This prediction is in excellent agreement with the huge majority of astronomical observations on large cosmic scales, especially the observations of cosmological redshifts of distant galaxies. However, on scales of heliospheric distances, verifications of general relativistic effects are based on Schwarzschild metric tests or kinetical corrections, such as the perihelion motion of Mercury, photon deflection at the Sun and gravitational photon redshifts in central gravity fields. As we will show in this paper, there is, however, a chance to detect new cosmologically relevant features on heliospheric scales by careful study of photon propagations in the local spacetime metrics, based on red- or blueshifts as a clear, but up to now overlooked, signature of the local spacetime dynamics. Thus, we propose the challenging possibility of carrying out experiments of cosmological relevance by simply using high-precision radio tracking of heliospheric spaceprobes, as already practised in cases like Pioneer-10/11, Galileo and Ulysses.

  15. A testing procedure for triaxial tests and a numerical method for the calculation of powder flow properties

    NARCIS (Netherlands)

    Eelkman Rooda, J.; Haaker, G.

    1977-01-01

    A testing procedure for measuring flow properties of powders is developed which makes it possible to use results from triaxial tests in the Jenike bin theory. For the elaboration of the results a numerical method is used, based upon the Warren Spring equation (τ/C)N = (σ + T)/T. In this equation σ

  16. Method of case hardening depth testing by using multifunctional ultrasonic testing instrument

    International Nuclear Information System (INIS)

    Salchak, Y A; Sednev, D A; Ardashkin, I B; Kroening, M

    2015-01-01

    The paper describes usability of ultrasonic case hardening depth control applying standard instrument of ultrasonic inspections. The ultrasonic method of measuring the depth of the hardened layer is proposed. Experimental series within the specified and multifunctional ultrasonic equipment are performed. The obtained results are compared with the results of a referent method of analysis. (paper)

  17. Cephalometry in adults and children with neurofibromatosis type 1: Implications for the pathogenesis of sphenoid wing dysplasia and the "NF1 facies".

    Science.gov (United States)

    Cung, Winnie; Freedman, Laura A; Khan, Nicholas E; Romberg, Elaine; Gardner, Pamela J; Bassim, Carol W; Baldwin, Andrea M; Widemann, Brigitte C; Stewart, Douglas R

    2015-11-01

    Neurofibromatosis type 1 (NF1) is a common, autosomal dominant tumor-predisposition disorder that arises secondary to mutations in the tumor suppressor gene NF1. Cephalometry is an inexpensive, readily available and non-invasive technique that is under-utilized in studying the NF1 craniofacial phenotype. An analysis of NF1 cephalometry was first published by Heervä et al. in 2011. We expand here on that first investigation with a larger cohort of adult and pediatric patients affected with NF1 and sought objective insight into the NF1 facies, said to feature hypertelorism and a broad nasal base, from cephalometric analysis. We obtained cephalograms from 101 patients with NF1 (78 adults and 23 children) from two NF1 protocols at the National Institutes of Health. Each subject had an age-, gender- and ethnicity-matched control. We used Dolphin software to make the cephalometric measurements. We assessed the normality of differences between paired samples using the Shapiro-Wilk test and evaluated the significance of mean differences using paired t-tests and adjusted for multiple testing. We explored the relationship between the cephalometric measurements and height, head circumference and interpupillary distance. In this dataset of American whites with NF1, we confirmed in a modestly larger sample many of the findings found by Heerva et al. in an NF1 Finnish cohort. We found a shorter maxilla, mandible, cranial base, (especially anteriorly, p = 0.0001) and diminished facial height in adults, but not children, with NF1. Only one adult exhibited hypertelorism. The cephalometric differences in adults arise in part from cranial base shortening and thus result in a shorter face, mid-face hypoplasia, reduced facial projection, smaller jaw, and increased braincase globularity. In addition, we suggest that NF1 sphenoid bone shortening, a common event, is consistent with an intrinsic NF1 bone cell defect, which renders the bone more vulnerable to a random "second hit" in

  18. Usability Testing as a Method to Refine a Health Sciences Library Website.

    Science.gov (United States)

    Denton, Andrea H; Moody, David A; Bennett, Jason C

    2016-01-01

    User testing, a method of assessing website usability, can be a cost-effective and easily administered process to collect information about a website's effectiveness. A user experience (UX) team at an academic health sciences library has employed user testing for over three years to help refine the library's home page. Test methodology used in-person testers using the "think aloud" method to complete tasks on the home page. Review of test results revealed problem areas of the design and redesign; further testing was effective in refining the page. User testing has proved to be a valuable method to engage users and provide feedback to continually improve the library's home page.

  19. Recommendations for Developing Alternative Test Methods for Screening and Prioritization of Chemicals for Developmental Neurotoxicity

    Science.gov (United States)

    Developmental neurotoxicity testing (DNT) is perceived by many stakeholders to be an area in critical need of alternative methods to current animal testing protocols and gUidelines. An immediate goal is to develop test methods that are capable of screening large numbers of chemic...

  20. Improved sensitivity testing of explosives using transformed Up-Down methods

    International Nuclear Information System (INIS)

    Brown, Geoffrey W

    2014-01-01

    Sensitivity tests provide data that help establish guidelines for the safe handling of explosives. Any sensitivity test is based on assumptions to simplify the method or reduce the number of individual sample evaluations. Two common assumptions that are not typically checked after testing are 1) explosive response follows a normal distribution as a function of the applied stimulus levels and 2) the chosen test level spacing is close to the standard deviation of the explosive response function (for Bruceton Up-Down testing for example). These assumptions and other limitations of traditional explosive sensitivity testing can be addressed using Transformed Up-Down (TUD) test methods. TUD methods have been developed extensively for psychometric testing over the past 50 years and generally use multiple tests at a given level to determine how to adjust the applied stimulus. In the context of explosive sensitivity we can use TUD methods that concentrate testing around useful probability levels. Here, these methods are explained and compared to Bruceton Up-Down testing using computer simulation. The results show that the TUD methods are more useful for many cases but that they do require more tests as a consequence. For non-normal distributions, however, the TUD methods may be the only accurate assessment method.

  1. A new Laplace transformation method for dynamic testing of solar collectors

    DEFF Research Database (Denmark)

    Kong, Weiqiang; Perers, Bengt; Fan, Jianhua

    2015-01-01

    A new dynamic method for solar collector testing is developed. It is characterized by using the Laplace transformation technique to solve the differential governing equation. The new method was inspired by the so called New Dynamic Method (NDM) (Amer E. et al (1999) [1]) but totally different....... By integration of the Laplace transformation technique with the Quasi Dynamic Test (QDT) model (Fischer S. et al (2004) [2]), the Laplace – QDT (L-QDT) model is derived. Two experimental methods are then introduced. One is the shielding method which needs to shield and un-shield solar collector continuously...... and the natural experimental method. The identified collector parameters are then compared and analyzed with those obtained by the steady state test method and the QDT test method. The results comparison shows that the L-QDT method and the natural experimental method are also valid. It can be concluded...

  2. Quality-control analytical methods: endotoxins: essential testing for pyrogens in the compounding laboratory, part 3: a simplified endotoxin test method for compounded sterile preparations.

    Science.gov (United States)

    Cooper, James F

    2011-01-01

    The first two parts of the IJPC series on endotoxin testing explained the nature of pyrogenic contamination and described various Limulus amebocyte lysate methods for detecting and measuring endotoxin levels with the bacterial endotoxin test described in the United States Pharmacopeia. This third article in that series describes the endotoxin test that is simplest to permorm for pharmacists who prefer to conduct an endotoxin assa at the time of compounding in the pharmacy setting.

  3. Bmi-1 promotes the aggressiveness of glioma via activating the NF-kappaB/MMP-9 signaling pathway

    International Nuclear Information System (INIS)

    Jiang, Lili; Wu, Jueheng; Yang, Yi; Liu, Liping; Song, Libing; Li, Jun; Li, Mengfeng

    2012-01-01

    The prognosis of human glioma is poor, and the highly invasive nature of the disease represents a major impediment to current therapeutic modalities. The oncoprotein B-cell-specific Moloney murine leukemia virus integration site 1 protein (Bmi-1) has been linked to the development and progression of glioma; however, the biological role of Bmi-1 in the invasion of glioma remains unclear. A172 and LN229 glioma cells were engineered to overexpress Bmi-1 via stable transfection or to be silenced for Bmi-1 expression using RNA interfering method. Migration and invasiveness of the engineered cells were assessed using wound healing assay, Transwell migration assay, Transwell matrix penetration assay and 3-D spheroid invasion assay. MMP-9 expression and activity were measured using real-time PCR, ELISA and the gelatin zymography methods. Expression of NF-kappaB target genes was quantified using real-time PCR. NF-kappaB transcriptional activity was assessed using an NF-kappaB luciferase reporter system. Expression of Bmi-1 and MMP-9 in clinical specimens was analyzed using immunohistochemical assay. Ectopic overexpression of Bmi-1 dramatically increased, whereas knockdown of endogenous Bmi-1 reduced, the invasiveness and migration of glioma cells. NF-kappaB transcriptional activity and MMP-9 expression and activity were significantly increased in Bmi-1-overexpressing but reduced in Bmi-1-silenced cells. The reporter luciferase activity driven by MMP-9 promoter in Bmi-1-overexpressing cells was dependent on the presence of a functional NF-kappaB binding site, and blockade of NF-kappaB signaling inhibited the upregulation of MMP-9 in Bmi-1 overexpressing cells. Furthermore, expression of Bmi-1 correlated with NF-kappaB nuclear translocation as well as MMP-9 expression in clinical glioma samples. Bmi-1 may play an important role in the development of aggressive phenotype of glioma via activating the NF-kappaB/MMP-9 pathway and therefore might represent a novel therapeutic

  4. Test-based approach to cable tray support system analysis and design: Behavior and test methods

    Energy Technology Data Exchange (ETDEWEB)

    Reigles, Damon G., E-mail: dreigles@engnovex.com [engNoveX, Inc., 19C Trolley Square, Wilmington, DE 19806 (United States); Brachmann, Ingo; Johnson, William H. [Bechtel Nuclear, Security & Environmental, 12011 Sunset Hills Rd, Suite 110, Reston, VA 20190 (United States); Gürbüz, Orhan [Tobolski Watkins Engineering, Inc., 4125 Sorrento Valley Blvd, Suite B, San Diego, CA 92121 (United States)

    2016-06-15

    Highlights: • Describes dynamic response behavior of unistrut type cable tray supports. • Summarizes observations from past full-scale shake table test programs. • Outlines testing methodologies necessary to identify key system parameters. - Abstract: Nuclear power plant safety-related cable tray support systems subjected to seismic loadings were originally understood and designed to behave as linear elastic systems. This behavioral paradigm persisted until the early 1980s when, due to evolution of regulatory criteria, some as-installed systems needed to be qualified to higher seismic motions than originally designed for. This requirement prompted a more in-depth consideration of the true seismic response behavior of support systems. Several utilities initiated extensive test programs, which demonstrated that trapeze strut-type cable tray support systems exhibited inelastic and nonlinear response behaviors with plastic hinging at the connections together with high damping due to bouncing of cables in the trays. These observations were used to demonstrate and justify the seismic adequacy of the aforementioned as-installed systems. However, no formalized design methodology or criteria were ever established to facilitate use of these test data for future evaluations. This paper assimilates and reviews the various test data and conclusions for the purpose of developing a design methodology for the seismic qualification of safety-related cable tray support systems.

  5. A critical comparison of respirometric biodegradation tests based on OECD 301 and related test methods.

    Science.gov (United States)

    Reuschenbach, Peter; Pagga, Udo; Strotmann, Uwe

    2003-04-01

    Biodegradation studies of organic compounds in the aquatic environment gain important information for the final fate of chemicals in the environment. A decisive role play tests for ready biodegradability (OECD 301) and in this context, the respirometric test (OECD 301F). Two different respirometric systems (Oxitop and Sapromat) were compared and in two of ten cases (diethylene glycol and 2-ethylhexylacrylate) differences were observed indicating that the test systems are not always equivalent. For 2-ethylhexylacrylate and cyclohexanone we could not state differences in the extent of biodegradation with a municipal and industrial inoculum whereas for cyclohexanone the degradation rate was faster with a municipal inoculum. Allylthiourea (ATU) proved to be an effective inhibitor of nitrification processes and did not affect the heterotrophic biodegradation activity. Modelling of biodegradation processes could be successfully performed with a first-order and a modified logistic plot. Copyright 2002 Elsevier Science Ltd.

  6. Standard test methods for analysis of sintered gadolinium oxide-uranium dioxide pellets

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2006-01-01

    1.1 These test methods cover procedures for the analysis of sintered gadolinium oxide-uranium dioxide pellets to determine compliance with specifications. 1.2 The analytical procedures appear in the following order: Section Carbon (Total) by Direct CombustionThermal Conductivity Method C1408 Test Method for Carbon (Total) in Uranium Oxide Powders and Pellets By Direct Combustion-Infrared Detection Method Chlorine and Fluorine by Pyrohydrolysis Ion-Selective Electrode Method C1502 Test Method for Determination of Total Chlorine and Fluorine in Uranium Dioxide and Gadolinium Oxide Gadolinia Content by Energy-Dispersive X-Ray Spectrometry C1456 Test Method for Determination of Uranium or Gadolinium, or Both, in Gadolinium Oxide-Uranium Oxide Pellets or by X-Ray Fluorescence (XRF) Hydrogen by Inert Gas Fusion C1457 Test Method for Determination of Total Hydrogen Content of Uranium Oxide Powders and Pellets by Carrier Gas Extraction Isotopic Uranium Composition by Multiple-Filament Surface-Ioni...

  7. Development of test practice requirements for a standard method on fracture toughness testing in the transition range

    International Nuclear Information System (INIS)

    McCabe, D.E.; Zerbst, U.; Heerens, J.

    1993-01-01

    This report covers the resolution of several issues that are relevant to the ductile to brittle transition range of structural steels. One of this issues was to compare a statistical-based weakest-link method to constraint data adjustment methods for modeling the specimen size effects on fracture toughness. Another was to explore the concept of a universal transition temperature curve shape (Master Curve). Data from a Materials Properties Council round robin activity were used to test the proposals empirically. The findings of this study are inclosed in an activity for the development of a draft standard test procedure ''Test Practice for Fracture Toughness in the Transition Range''. (orig.) [de

  8. Homogeneity tests for variances and mean test under heterogeneity conditions in a single way ANOVA method

    International Nuclear Information System (INIS)

    Morales P, J.R.; Avila P, P.

    1996-01-01

    If we have consider the maximum permissible levels showed for the case of oysters, it results forbidding to collect oysters at the four stations of the El Chijol Channel ( Veracruz, Mexico), as well as along the channel itself, because the metal concentrations studied exceed these limits. In this case the application of Welch tests were not necessary. For the water hyacinth the means of the treatments were unequal in Fe, Cu, Ni, and Zn. This case is more illustrative, for the conclusion has been reached through the application of the Welch tests to treatments with heterogeneous variances. (Author)

  9. 76 FR 9777 - Recent Postings of Broadly Applicable Alternative Test Methods

    Science.gov (United States)

    2011-02-22

    ... Performance for Method 16A Stationary Kraft Pulp wherein the Sources Mills. titration (Impinger analysis is... Applicable Alternative Test Methods AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of availability. SUMMARY: This notice announces the broadly applicable alternative test method approval decisions...

  10. Analysis using formal method and testing technique for the processor module for safety-critical application

    International Nuclear Information System (INIS)

    Choi, J. Y.; Choi, B. J.; Song, H. J.; Hwang, D. Y.; Song, G. H.; Lee, H.

    2008-06-01

    This research is on help develop nuclear power plant control system, through the requirement specification and verification method development. As the result of applying the test method, a test standard was obtain through test documentation writing support and a test document reflecting the standard test activities based on the test standard. The specification and verification of the pCOS system and the unified testing documentation and execution helps the entire project to progress and enable us to achieve necessary documents and technology to develop a safety critical system

  11. Analysis using formal method and testing technique for the processor module for safety-critical application

    Energy Technology Data Exchange (ETDEWEB)

    Choi, J. Y.; Choi, B. J.; Song, H. J.; Hwang, D. Y.; Song, G. H.; Lee, H. [Korea University, Seoul (Korea, Republic of)

    2008-06-15

    This research is on help develop nuclear power plant control system, through the requirement specification and verification method development. As the result of applying the test method, a test standard was obtain through test documentation writing support and a test document reflecting the standard test activities based on the test standard. The specification and verification of the pCOS system and the unified testing documentation and execution helps the entire project to progress and enable us to achieve necessary documents and technology to develop a safety critical system.

  12. Standard Test Method for Testing Polymeric Seal Materials for Geothermal and/or High Temperature Service Under Sealing Stress

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1985-01-01

    1.1 This test method covers the initial evaluation of (screening) polymeric materials for seals under static sealing stress and at elevated temperatures. 1.2 This test method applies to geothermal service only if used in conjunction with Test Method E 1068. 1.3 The test fluid is distilled water. 1.4 The values stated in SI units are to be regarded as the standard. The values in parentheses are for information only. 1.5 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  13. The color removal and fate of organic pollutants in a pilot-scale MBR-NF combined process treating textile wastewater with high water recovery.

    Science.gov (United States)

    Li, Kun; Jiang, Chao; Wang, Jianxing; Wei, Yuansong

    2016-01-01

    A combination of membrane bioreactor (MBR) and nanofiltration (NF) was tested at pilot-scale treating textile wastewater from the wastewater treatment station of a textile mill in Wuqing District of Tianjin (China). The MBR-NF process showed a much better treatment efficiency on the removal of the chemical oxygen demand, total organic carbon, color and turbidity in comparison with the conventional processes. The water recovery rate was enhanced to over 90% through the recycling of NF concentrate to the MBR, while the MBR-NF showed a stable permeate water quality that met with standards and could be directly discharged or further reused. The recycled NF concentrate caused an accumulation of refractory compounds in the MBR, which significantly influenced the treatment efficiency of the MBR. However, the sludge characteristics showed that the activated sludge activity was not obviously inhibited. The results of fluorescence spectra and molecular weight distribution indicated that those recalcitrant pollutants were mostly protein-like substances and a small amount of humic acid-like substances (650-6,000 Da), which contributed to membrane fouling of NF. Although the penetrated protein-like substances caused the residual color in NF permeate, the MBR-NF process was suitable for the advanced treatment and reclamation of textile wastewater under high water yield.

  14. Analytical control test plan and microbiological methods for the water recovery test

    Science.gov (United States)

    Traweek, M. S. (Editor); Tatara, J. D. (Editor)

    1994-01-01

    Qualitative and quantitative laboratory results are important to the decision-making process. In some cases, they may represent the only basis for deciding between two or more given options or processes. Therefore, it is essential that handling of laboratory samples and analytical operations employed are performed at a deliberate level of conscientious effort. Reporting erroneous results can lead to faulty interpretations and result in misinformed decisions. This document provides analytical control specifications which will govern future test procedures related to all Water Recovery Test (WRT) Phase 3 activities to be conducted at the National Aeronautics and Space Administration/Marshall Space Flight Center (NASA/MSFC). This document addresses the process which will be used to verify analytical data generated throughout the test period, and to identify responsibilities of key personnel and participating laboratories, the chains of communication to be followed, and ensure that approved methodology and procedures are used during WRT activities. This document does not outline specifics, but provides a minimum guideline by which sampling protocols, analysis methodologies, test site operations, and laboratory operations should be developed.

  15. Andrographolide Protects against LPS-Induced Acute Lung Injury by Inactivation of NF-κB

    Science.gov (United States)

    Zhu, Tao; Wang, Dao-xin; Zhang, Wei; Liao, Xiu-qing; Guan, Xian; Bo, Hong; Sun, Jia-yang; Huang, Ni-wen; He, Jing; Zhang, Yun-kun; Tong, Jing; Li, Chang-yi

    2013-01-01

    Background Nuclear factor-κB (NF-κB) is a central transcriptional factor and a pleiotropic regulator of many genes involved in acute lung injury. Andrographolide is found in the plant of Andrographis paniculata and widely used in Traditional Chinese Medicine, exhibiting potently anti-inflammatory property by inhibiting NF-κB activity. The purpose of our investigation was designed to reveal the effect of andrographolide on various aspects of LPS induced inflammation in vivo and in vitro. Methods and Results In vivo, BALB/C mice were subjected to LPS injection with or without andrographolide treatments to induce ALI model. In vitro, MLE-12 cells were stimulated with LPS in the presence and absence of andrographolide. In vivo, pulmonary inflammation, pulmonary edema, ultrastructure changes of type II alveolar epithelial cells, MPO activity, total cells, neutrophils, macrophages, TNF-α, IL-6 and IL-1β in BALF, along with the expression of VCAM-1 and VEGF were dose-dependently attenuated by andrographolide. Meanwhile, in vitro, the expression of VCAM-1 and VEGF was also reduced by andrographolide. Moreover, our data showed that andrographolide significantly inhibited the ratios of phospho-IKKβ/total IKKβ, phospho-IκBα/total IκBα and phospho-NF-κB p65/total NF-κB p65, and NF-κB p65 DNA binding activities, both in vivo and in vitro. Conclusions These results indicate that andrographolide dose-dependently suppressed the severity of LPS-induced ALI, more likely by virtue of andrographolide-mediated NF-κB inhibition at the level of IKKβ activation. These results suggest andrographolide may be considered as an effective and safe drug for the potential treatment of ALI. PMID:23437127

  16. [Study on using the hen's egg test-chorioallantoic membrane as an alternative method of draize eye irritation test].

    Science.gov (United States)

    Liao, Yan; Wang, Xue; Zhang, Lishi; Li, Guanmin

    2004-05-01

    To establish and study the hen's egg test-chorioallantoic membrane (HET-CAM) as an alternative method of Draize eye irritation test (Draize test). 14 cosmetic ingredients were tested by the Hen's egg test-chorioallantoic membrane score (HET-CAM score) and the chorioallantoic membrane-trypan blue staining (CAM-TB) methods. Showed that compared with two kinds of scores in Draize test, i.e. Maximum average Draize total score (MAS) and score of 24 h after application (S24), the correlation coefficient between HET-CAM score and MAS or S24 was 0.847 or 0.779, while that between CAB-TB and MAS or S24 was 0.862 or 0.831 respectively. The results also showed that CAM-TB had a higher correlation with Draize test than HET-CAM score, partly because it is objective and quantitative. Also, the results showed that HET-CAM score had the greatest correlation with conjunctivae score of the three components, and so did the CAM-TB with corneal score. It is suggested that the two types of HET-CAM can be used in a combined manner as an effective alternative method to Draize test.

  17. Kaempferol alleviates insulin resistance via hepatic IKK/NF-κB signal in type 2 diabetic rats.

    Science.gov (United States)

    Luo, Cheng; Yang, Hui; Tang, Chengyong; Yao, Gaoqiong; Kong, Lingxi; He, Haixia; Zhou, Yuanda

    2015-09-01

    Recent studies show that inflammation underlies the metabolic disorders of insulin resistance and type 2 diabetes mellitus. Since kaempferol, a naturally occurring flavonoid, has been described to have potent anti-inflammatory properties, we investigated whether kaempferol could ameliorate insulin resistance through inhibiting inflammatory responses. The model of diabetic rat was induced by 6-week high-fat diet plus streptozotocin. Animals were orally treated with kaempferol (50 or 150 mg/kg) and aspirin (100mg/kg) for 10 weeks. The results showed that kaempferol ameliorated blood lipids and insulin in an dose-dependent manner. Kaempferol effectively restored insulin resistance induced alteration of glucose disposal by using an insulin tolerance test and the euglycemic-hyperinsulinemic clamp method. Western blotting results showed that KPF inhibited the phosphorylation of insulin receptor substrate-1 (IRS-1), IkB kinase α (IKKα) and IkB kinase β (IKKβ). These effects were accompanied with reduction in nucleic and cytosol levels of nuclear factor kappa-β (NF-κB), and further tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) levels. Aspirin had similar effects. These results provide in vivo evidence that kaempferol-mediated down-regulation of IKK and subsequent inhibition of NF-κB pathway activation may be associated with the reduction of hepatic inflammatory lesions, which is contributing to the improvement of insulin signaling defect in diabetes. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Development of test bolus tracking method and usefulness in coronary CT angiography

    International Nuclear Information System (INIS)

    Yamaguchi, Takayoshi; Takahashi, Daichi

    2009-01-01

    The test bolus tracking (TBT) method is a new injection method of contrast medium that we developed. The TBT method is an injection technique that continuously performs the test bolus injection and the main bolus injection, such that the best acquisition of scan timing and the improvement of examination efficiency can be expected. We compared the TBT method and the test injection method by coronary CT angiography. The results demonstrated that the contrast enhancement of the coronary arteries was high and the variation of the CT value was also small in the TBT method. When the scan timing expected by the TI method and the TBT method were compared, it was different of two seconds or more by the case with 43%. However, the variation of CT value was small for the TBT method in these cases. Therefore, the TBT method is a very useful method for coronary CT angiography (CCTA). (author)

  19. Information-retrieval system for in-pile test methods and role of methodic information in planning investigations in the field of reactor materials testing

    International Nuclear Information System (INIS)

    Ivanov, V.B.; Lebedeva, E.E.; Markina, N.V.; Tsykanov, V.A.

    1990-01-01

    Particular role of methodic information in research planning and automatomization considered. It is shown that availability of methodic information makes it possible to justify the necessity for experimental equipment developing, to compare the possibilities created by different investigation methods and to carry out optimal choice of the experiment fulfilment place. Necessity for developing the information-retrieval system on in-pile test methods and the required set of data based is discussed. The information on the expert system realized on PC AT is presented. Advantages and usefulness of systematization and information acquisition on methodic developments are shown, practical recommendations on their use are given

  20. Test methods for determining the suitability of metal alloys for use in oxygen-enriched environments

    Science.gov (United States)

    Stoltzfus, Joel M.; Gunaji, Mohan V.

    1991-01-01

    Materials are more flammable in oxygen rich environments than in air. When the structural elements of a system containing oxygen ignite and burn, the results are often catastrophic, causing loss of equipment and perhaps even human lives. Therefore, selection of the proper metallic and non-metallic materials for use in oxygen systems is extremely important. While test methods for the selection of non-metallic materials have been available for years, test methods for the selection of alloys have not been available until recently. Presented here are several test methods that were developed recently at NASA's White Sands Test Facility (WSTF) to study the ignition and combustion of alloys, including the supersonic and subsonic speed particle impact tests, the frictional heating and coefficient of friction tests, and the promoted combustion test. These test methods are available for commercial use.

  1. Regulation of NF-κB oscillation by spatial parameters in true intracellular space (TiCS)

    Science.gov (United States)

    Ohshima, Daisuke; Sagara, Hiroshi; Ichikawa, Kazuhisa

    2013-10-01

    Transcription factor NF-κB is activated by cytokine stimulation, viral infection, or hypoxic environment leading to its translocation to the nucleus. The nuclear NF-κB is exported from the nucleus to the cytoplasm again, and by repetitive import and export, NF-κB shows damped oscillation with the period of 1.5-2.0 h. Oscillation pattern of NF-κB is thought to determine the gene expression profile. We published a report on a computational simulation for the oscillation of nuclear NF-κB in a 3D spherical cell, and showed the importance of spatial parameters such as diffusion coefficient and locus of translation for determining the oscillation pattern. Although the value of diffusion coefficient is inherent to protein species, its effective value can be modified by organelle crowding in intracellular space. Here we tested this possibility by computer simulation. The results indicate that the effective value of diffusion coefficient is significantly changed by the organelle crowding, and this alters the oscillation pattern of nuclear NF-κB.

  2. Direct evidence of central nervous system axonal damage in patients with postoperative delirium: A preliminary study of pNF-H as a promising serum biomarker.

    Science.gov (United States)

    Inoue, Reo; Sumitani, Masahiko; Ogata, Toru; Chikuda, Hirotaka; Matsubara, Takehiro; Kato, So; Shimojo, Nobutake; Uchida, Kanji; Yamada, Yoshitsugu

    2017-07-13

    Approximately 50-80% patients experience postoperative delirium, an acute cognitive dysfunction associated with prolonged hospitalization, increased mortality, excess healthcare costs, and persistent cognitive impairment. Elucidation of the mechanism of delirium and associated diagnostic and therapeutic measures are urgently required. Here we investigated the role of phosphorylated neurofilament heavy subunit (pNF-H), a major structural protein in axons, as a predictive maker of postoperative delirium. Twenty-three patients who underwent surgery for abdominal cancer were screened for postoperative delirium, and they were assessed for its severity using the memorial delirium assessment scale (MDAS) at and 48h after delirium onset. Serum pNF-H levels were also measured at both time points. The patients were divided into two groups according to the presence or absence of pNF-H. Clinical variables were compared between groups using the Mann-Whitney U test, and the relationship between pNF-H levels and delirium severity was analyzed using the exponential curve fitting. Fifteen of the 23 (65.2%) patients tested positive for pNF-H, and these patients exhibited significantly higher MDAS scores compared with the pNF-H-negative patients only at the onset of delirium. Although the MDAS score significantly improved over time in the positive group, pNF-H positivity persisted. There was a correlation between the maximum pNF-H level and maximum MDAS score (R 2 =0.31, p=0.013). More severe postoperative delirium was directly related to higher serum pNF-H levels, suggesting the potential application of pNF-H as a quantitative biomarker of neural damage in postoperative delirium. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Turmeric (Curcuma longa) inhibits inflammatory nuclear factor (NF)-κB and NF-κB-regulated gene products and induces death receptors leading to suppressed proliferation, induced chemosensitization, and suppressed osteoclastogenesis.

    Science.gov (United States)

    Kim, Ji H; Gupta, Subash C; Park, Byoungduck; Yadav, Vivek R; Aggarwal, Bharat B

    2012-03-01

    The incidence of cancer is significantly lower in regions where turmeric is heavily consumed. Whether lower cancer incidence is due to turmeric was investigated by examining its effects on tumor cell proliferation, on pro-inflammatory transcription factors NF-κB and STAT3, and on associated gene products. Cell proliferation and cell cytotoxicity were measured by the MTT method, NF-κB activity by EMSA, protein expression by Western blot analysis, ROS generation by FACS analysis, and osteoclastogenesis by TRAP assay. Turmeric inhibited NF-κB activation and down-regulated NF-κB-regulated gene products linked to survival (Bcl-2, cFLIP, XIAP, and cIAP1), proliferation (cyclin D1 and c-Myc), and metastasis (CXCR4) of cancer cells. The spice suppressed the activation of STAT3, and induced the death receptors (DR)4 and DR5. Turmeric enhanced the production of ROS, and suppressed the growth of tumor cell lines. Furthermore, turmeric sensitized the tumor cells to chemotherapeutic agents capecitabine and taxol. Turmeric was found to be more potent than pure curcumin for cell growth inhibition. Turmeric also inhibited NF-κB activation induced by RANKL that correlated with the suppression of osteoclastogenesis. Our results indicate that turmeric can effectively block the proliferation of tumor cells through the suppression of NF-κB and STAT3 pathways. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. A comprehensive review of regulatory test methods for endocrine adverse health effects.

    Science.gov (United States)

    Manibusan, M K; Touart, L W

    2017-07-01

    Development of new endocrine disruption-relevant test methods has been the subject of intensive research efforts for the past several decades, prompted in part by mandates in the 1996 Food Quality Protection Act (FQPA). While scientific understanding and test methods have advanced, questions remain on whether current scientific methods are capable of adequately addressing the complexities of the endocrine system for regulatory health and ecological risk assessments. The specific objective of this article is to perform a comprehensive, detailed evaluation of the adequacy of current test methods to inform regulatory risk assessments of whether a substance has the potential to perturb endocrine-related pathways resulting in human adverse effects. To that end,  approximately 42 existing test guidelines (TGs) were considered in the evaluation of coverage for endocrine-related adverse effects. In addition to evaluations of whether test methods are adequate to capture endocrine-related effects, considerations of further enhancements to current test methods, along with the need to develop novel test methods to address existing test method gaps are described. From this specific evaluation, up to 35 test methods are capable of informing whether a chemical substance perturbs known endocrine related biological pathways. Based on these findings, it can be concluded that current validated test methods are adequate to discern substances that may perturb the endocrine system, resulting in an adverse health effect. Together, these test methods predominantly form the core data requirements of a typical food-use pesticide registration submission. It is recognized, however, that the current state of science is rapidly advancing and there is a need to update current test methods to include added enhancements to ensure continued coverage and public health and environmental protection.

  5. Evaluation of rapid radiometric method for drug susceptibility testing of Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Siddiqi, S.H.; Libonati, J.P.; Middlebrook, G.

    1981-01-01

    A total of 106 isolates of Mycobacterium tuberculosis were tested for drug susceptibility by the conventional 7H11 plate method and by a new rapid radiometric method using special 7H12 liquid medium with 14 C-labeled substrate. Results obtained by the two methods were compared for rapidity, sensitivity, and specificity of the new test method. There was 98% overall agreement between the results obtained by the two methods. Of a total of 424 drug tests, only 8 drug results did not agree, mostly in the case of streptomycin. This new procedure was found to be rapid, with 87% of the tests results reportable within 4 days and 98% reportable within 5 days as compared to the usual 3 weeks required with the conventional indirect susceptibility test method. The results of this preliminary study indicate that the rapid radiometric method seems to have the potential for routine laboratory use and merits further investigations

  6. Standard test method for isotopic analysis of uranium hexafluoride by double standard single-collector gas mass spectrometer method

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This is a quantitative test method applicable to determining the mass percent of uranium isotopes in uranium hexafluoride (UF6) samples with 235U concentrations between 0.1 and 5.0 mass %. 1.2 This test method may be applicable for the entire range of 235U concentrations for which adequate standards are available. 1.3 This test method is for analysis by a gas magnetic sector mass spectrometer with a single collector using interpolation to determine the isotopic concentration of an unknown sample between two characterized UF6 standards. 1.4 This test method is to replace the existing test method currently published in Test Methods C761 and is used in the nuclear fuel cycle for UF6 isotopic analyses. 1.5 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.6 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appro...

  7. A method for charging a test carrier and a test carrier

    DEFF Research Database (Denmark)

    2014-01-01

    A method of charging a substrate with a plurality of through-going bores and a charged substrate, where the substrate is charged with a liquid comprising particles in a concentration resulting in a high percentage of bores charged with liquid with only a single particle therein....

  8. A mosaic pattern of INI1/SMARCB1 protein expression distinguishes Schwannomatosis and NF2-associated peripheral schwannomas from solitary peripheral schwannomas and NF2-associated vestibular schwannomas.

    Science.gov (United States)

    Caltabiano, Rosario; Magro, Gaetano; Polizzi, Agata; Praticò, Andrea Domenico; Ortensi, Andrea; D'Orazi, Valerio; Panunzi, Andrea; Milone, Pietro; Maiolino, Luigi; Nicita, Francesco; Capone, Gabriele Lorenzo; Sestini, Roberta; Paganini, Irene; Muglia, Mariella; Cavallaro, Sebastiano; Lanzafame, Salvatore; Papi, Laura; Ruggieri, Martino

    2017-06-01

    The INI1/SMARCB1 gene protein product has been implicated in the direct pathogenesis of schwannomas from patients with one form of schwannomatosis [SWNTS1; MIM # 162091] showing a mosaic pattern of loss of protein expression by immunohistochemistry [93% in familial vs. 55% in sporadic cases]. To verify whether such INI1/SMARCB1 mosaic pattern could be extended to all schwannomas arising in the sporadic and familial schwannomatoses [i.e. to SMARCB1-related (SWNTS1) or LZTR1-related (SWNTS2) schwannomatosis or to SMARCB1/LZTR1-negative schwannomatosis] and whether it could be involved in classical NF2 or solitary peripheral schwannomas METHODS: We blindly analysed schwannoma samples obtained from a total of 22 patients including (a) 2 patients (2 males; aged 38 and 55 years) affected by non-familial SMARCB1-associated schwannomatosis (SWTNS1); (b) 1 patient (1 female; aged 33 years) affected by familial schwannomatosis (SWTNS1/ SMARCB1 germ line mutations); (c) 5 patients (3 males, 2 females; aged 33 to 35 years) affected by non-familial (sporadic) LZTR1-associated schwannomatosis (SWNTS2); (d) 3 patients (3 males; aged 35 to 47 years) affected by familial schwannomatosis (SWTNS2/ LZTR1 germ line mutations); (e) 2 patients (1 male, 1 female; aged 63 and 49 years, respectively) affected by non-familial schwannomatosis (SWTNS, negative for SMARCB1, LZTR1 and NF2 gene mutations); (f) 4 patients (3 males, 1 females; aged 15 to 24 years) affected by classical NF2 (NF2: harbouring NF2 germ line mutations; and (g) 5 patients (3 males, 2 females; aged 33 to 68 years) who had solitary schwannomas. [follow-up = 15-30 years; negative for constitutional/somatic mutation analysis for the SMARCB1, LZTR1 and NF2 genes] were (blindly) analyzed. The INI1/SMARCB1 immunostaining pattern was regarded as (1) diffuse positive nuclear staining [= retained expression] or (2) mosaic pattern [mixed positive/negative nuclei = loss of expression in a subset of tumour cells]. All

  9. BRAF activated non-coding RNA (BANCR) promoting gastric cancer cells proliferation via regulation of NF-κB1

    International Nuclear Information System (INIS)

    Zhang, Zhi-Xin; Liu, Zhi-Qiang; Jiang, Biao; Lu, Xin-Yang; Ning, Xiao-Fei; Yuan, Chuan-Tao; Wang, Ai-Liang

    2015-01-01

    Background and objective: Long non-coding RNA, BANCR, has been demonstrated to contribute to the proliferation and migration of tumors. However, its molecular mechanism underlying gastric cancer is still unknown. In present study, we investigated whether BANCR was involved in the development of gastric cancer cells via regulation of NF-κB1. Methods: Human gastric cancer tissues were isolated as well as human gastric cell lines MGC803 and BGC823 were cultured to investigate the role of BANCR in gastric cancer. Results: BANCR expression was significantly up-regulated in gastric tumor tissues and gastric cell lines. Down-regulation of BANCR inhibited gastric cancer cell growth and promoted cell apoptosis, and it also contributed to a significant decrease of NF-κB1 (P50/105) expression and 3′UTR of NF-κB1 activity. Overexpression of NF-κB1 reversed the effect of BANCR on cancer cell growth and apoptosis. MiroRNA-9 (miR-9) targeted NF-κB1, and miR-9 inhibitor also reversed the effects of BANCR on gastric cancer cell growth and apoptosis. Conclusion: BANCR was highly expressed both in gastric tumor tissues and in cancer cells. NF-κB1 and miR-9 were involved in the role of BANCR in gastric cancer cell growth and apoptosis. - Highlights: • BANCR up-regulated in gastric cancer (GC) tissues and cell lines MGC803 and BGC823. • Down-regulation of BANCR inhibited GC cell growth and promoted cell apoptosis. • Down-regulation of BANCR contributed to decreased 3′UTR of NF-κB1 and its expression. • Overexpressed NF-κB1 reversed the effect of BANCR on GC cell growth. • miR-9 inhibitor reversed the effect of BANCR on cancer GC cell growth

  10. Persistent activation of NF-kappaB related to IkappaB's degradation profiles during early chemical hepatocarcinogenesis

    Directory of Open Access Journals (Sweden)

    García-Román Rebeca

    2007-04-01

    Full Text Available Abstract Background To define the NF-kappaB activation in early stages of hepatocarcinogenesis and its IkappaB's degradation profiles in comparison to sole liver regeneration. Methods Western-blot and EMSA analyses were performed for the NF-kappaB activation. The transcriptional activity of NF-kappaB was determined by RT-PCR of the IkappaB-α mRNA. The IkappaB's degradation proteins were determined by Western-blot assay. Results We demonstrated the persistent activation of NF-kappaB during early stages of hepatocarcinogenesis, which reached maximal level 30 min after partial hepatectomy. The DNA binding and transcriptional activity of NF-kappaB, were sustained during early steps of hepatocarcinogenesis in comparison to only partial hepatectomy, which displayed a transitory NF-kappaB activation. In early stages of hepatocarconogenesis, the IkappaB-α degradation turned out to be acute and transitory, but the low levels of IkappaB-β persisted even 15 days after partial hepatectomy. Interestingly, IkappaB-β degradation is not induced after sole partial hepatectomy. Conclusion We propose that during liver regeneration, the transitory stimulation of the transcription factor response, assures blockade of NF-kappaB until recovery of the total mass of the liver and the persistent NF-kappaB activation in early hepatocarcinogenesis may be due to IkappaB-β and IkappaB-α degradation, mainly IkappaB-β degradation, which contributes to gene transcription related to proliferation required for neoplasic progression.

  11. Characterizing Myeloid Cell Activation in NF1 Vasculopathy

    Science.gov (United States)

    2017-07-01

    recruited by the Indiana University NF1 Clinic at Riley Hospital for Children . All patients received a physical examination and a medical history was taken...Cerebrovascular abnormalities in a population of children with neurofibromatosis type 1, Neurology 64 (3) (2005) 553–555. [7] S.A. Rasmussen, J.M. Friedman, NF1...to oxidant species underlie NF1 arterial stenosis and provide a platform for designing novels therapies and interventions. & 2016 Elsevier Inc. All

  12. Rapid high temperature field test method for evaluation of geothermal calcite scale inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Asperger, R.G.

    1982-08-01

    A test method is described which allows the rapid field testing of calcite scale inhibitors in high- temperature geothermal brines. Five commercial formulations, chosen on the basis of laboratory screening tests, were tested in brines with low total dissolved solids at ca 500 F. Four were found to be effective; of these, 2 were found to be capable of removing recently deposited scale. One chemical was tested in the full-flow brine line for 6 wks. It was shown to stop a severe surface scaling problem at the well's control valve, thus proving the viability of the rapid test method. (12 refs.)

  13. Methods for Quantifying the Uncertainties of LSIT Test Parameters, Test Results, and Full-Scale Mixing Performance Using Models Developed from Scaled Test Data

    International Nuclear Information System (INIS)

    Piepel, Gregory F.; Cooley, Scott K.; Kuhn, William L.; Rector, David R.; Heredia-Langner, Alejandro

    2015-01-01

    This report discusses the statistical methods for quantifying uncertainties in 1) test responses and other parameters in the Large Scale Integrated Testing (LSIT), and 2) estimates of coefficients and predictions of mixing performance from models that relate test responses to test parameters. Testing at a larger scale has been committed to by Bechtel National, Inc. and the U.S. Department of Energy (DOE) to ''address uncertainties and increase confidence in the projected, full-scale mixing performance and operations'' in the Waste Treatment and Immobilization Plant (WTP).

  14. Methods for Quantifying the Uncertainties of LSIT Test Parameters, Test Results, and Full-Scale Mixing Performance Using Models Developed from Scaled Test Data

    Energy Technology Data Exchange (ETDEWEB)

    Piepel, Gregory F. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Cooley, Scott K. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Kuhn, William L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Rector, David R. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Heredia-Langner, Alejandro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2015-05-01

    This report discusses the statistical methods for quantifying uncertainties in 1) test responses and other parameters in the Large Scale Integrated Testing (LSIT), and 2) estimates of coefficients and predictions of mixing performance from models that relate test responses to test parameters. Testing at a larger scale has been committed to by Bechtel National, Inc. and the U.S. Department of Energy (DOE) to “address uncertainties and increase confidence in the projected, full-scale mixing performance and operations” in the Waste Treatment and Immobilization Plant (WTP).

  15. Analysis of small sample size studies using nonparametric bootstrap test with pooled resampling method.

    Science.gov (United States)

    Dwivedi, Alok Kumar; Mallawaarachchi, Indika; Alvarado, Luis A

    2017-06-30

    Experimental studies in biomedical research frequently pose analytical problems related to small sample size. In such studies, there are conflicting findings regarding the choice of parametric and nonparametric analysis, especially with non-normal data. In such instances, some methodologists questioned the validity of parametric tests and suggested nonparametric tests. In contrast, other methodologists found nonparametric tests to be too conservative and less powerful and thus preferred using parametric tests. Some researchers have recommended using a bootstrap test; however, this method also has small sample size limitation. We used a pooled method in nonparametric bootstrap test that may overcome the problem related with small samples in hypothesis testing. The present study compared nonparametric bootstrap test with pooled resampling method corresponding to parametric, nonparametric, and permutation tests through extensive simulations under various conditions and using real data examples. The nonparametric pooled bootstrap t-test provided equal or greater power for comparing two means as compared with unpaired t-test, Welch t-test, Wilcoxon rank sum test, and permutation test while maintaining type I error probability for any conditions except for Cauchy and extreme variable lognormal distributions. In such cases, we suggest using an exact Wilcoxon rank sum test. Nonparametric bootstrap paired t-test also provided better performance than other alternatives. Nonparametric bootstrap test provided benefit over exact Kruskal-Wallis test. We suggest using nonparametric bootstrap test with pooled resampling method for comparing paired or unpaired means and for validating the one way analysis of variance test results for non-normal data in small sample size studies. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  16. Disk Inoculum-Solid Medium Method To Test Carbon and Nitrogen Assimilation by Yeast Isolates

    OpenAIRE

    Moore, Kerry J.; Johnson, Michael G.; McClary, Shane P.

    1988-01-01

    Carbon and nitrogen assimilation for 50 yeasts isolated from White Riesling fermentation were tested by using a disk inoculum-solid medium method. This method was quicker and gave results comparable to the conventional liquid medium methods. Yeast characteristics (growth response, pigment production, morphology) could also be compared with this method.

  17. Correlating the EMC analysis and testing methods for space systems in MIL-STD-1541A

    Science.gov (United States)

    Perez, Reinaldo J.

    A study was conducted to improve the correlation between the electromagnetic compatibility (EMC) analysis models stated in MIL-STD-1541A and the suggested testing methods used for space systems. The test and analysis methods outlined in MIL-STD-1541A are described, and a comparative assessment of testing and analysis techniques as they relate to several EMC areas is presented. Suggestions on present analysis and test methods are introduced to harmonize and bring the analysis and testing tools in MIL-STD-1541A into closer agreement. It is suggested that test procedures in MIL-STD-1541A must be improved by providing alternatives to the present use of shielded enclosures as the primary site for such tests. In addition, the alternate use of anechoic chambers and open field test sites must be considered.

  18. Correlating the EMC analysis and testing methods for space systems in MIL-STD-1541A

    Science.gov (United States)

    Perez, Reinaldo J.

    1990-01-01

    A study was conducted to improve the correlation between the electromagnetic compatibility (EMC) analysis models stated in MIL-STD-1541A and the suggested testing methods used for space systems. The test and analysis methods outlined in MIL-STD-1541A are described, and a comparative assessment of testing and analysis techniques as they relate to several EMC areas is presented. Suggestions on present analysis and test methods are introduced to harmonize and bring the analysis and testing tools in MIL-STD-1541A into closer agreement. It is suggested that test procedures in MIL-STD-1541A must be improved by providing alternatives to the present use of shielded enclosures as the primary site for such tests. In addition, the alternate use of anechoic chambers and open field test sites must be considered.

  19. USING COMPUTER-BASED TESTING AS ALTERNATIVE ASSESSMENT METHOD OF STUDENT LEARNING IN DISTANCE EDUCATION

    Directory of Open Access Journals (Sweden)

    Amalia SAPRIATI

    2010-04-01

    Full Text Available This paper addresses the use of computer-based testing in distance education, based on the experience of Universitas Terbuka (UT, Indonesia. Computer-based testing has been developed at UT for reasons of meeting the specific needs of distance students as the following: Ø students’ inability to sit for the scheduled test, Ø conflicting test schedules, and Ø students’ flexibility to take examination to improve their grades. In 2004, UT initiated a pilot project in the development of system and program for computer-based testing method. Then in 2005 and 2006 tryouts in the use of computer-based testing methods were conducted in 7 Regional Offices that were considered as having sufficient supporting recourses. The results of the tryouts revealed that students were enthusiastic in taking computer-based tests and they expected that the test method would be provided by UT as alternative to the traditional paper and pencil test method. UT then implemented computer-based testing method in 6 and 12 Regional Offices in 2007 and 2008 respectively. The computer-based testing was administered in the city of the designated Regional Office and was supervised by the Regional Office staff. The development of the computer-based testing was initiated with conducting tests using computers in networked configuration. The system has been continually improved, and it currently uses devices linked to the internet or the World Wide Web. The construction of the test involves the generation and selection of the test items from the item bank collection of the UT Examination Center. Thus the combination of the selected items compromises the test specification. Currently UT has offered 250 courses involving the use of computer-based testing. Students expect that more courses are offered with computer-based testing in Regional Offices within easy access by students.

  20. The Ex Vivo Eye Irritation Test as an alternative test method for serious eye damage/eye irritation.

    Science.gov (United States)

    Spöler, Felix; Kray, Oya; Kray, Stefan; Panfil, Claudia; Schrage, Norbert F

    2015-07-01

    Ocular irritation testing is a common requirement for the classification, labelling and packaging of chemicals (substances and mixtures). The in vivo Draize rabbit eye test (OECD Test Guideline 405) is considered to be the regulatory reference method for the classification of chemicals according to their potential to induce eye injury. In the Draize test, chemicals are applied to rabbit eyes in vivo, and changes are monitored over time. If no damage is observed, the chemical is not categorised. Otherwise, the classification depends on the severity and reversibility of the damage. Alternative test methods have to be designed to match the classifications from the in vivo reference method. However, observation of damage reversibility is usually not possible in vitro. Within the present study, a new organotypic method based on rabbit corneas obtained from food production is demonstrated to close this gap. The Ex Vivo Eye Irritation Test (EVEIT) retains the full biochemical activity of the corneal epithelium, epithelial stem cells and endothelium. This permits the in-depth analysis of ocular chemical trauma beyond that achievable by using established in vitro methods. In particular, the EVEIT is the first test to permit the direct monitoring of recovery of all corneal layers after damage. To develop a prediction model for the EVEIT that is comparable to the GHS system, 37 reference chemicals were analysed. The experimental data were used to derive a three-level potency ranking of eye irritation and corrosion that best fits the GHS categorisation. In vivo data available in the literature were used for comparison. When compared with GHS classification predictions, the overall accuracy of the three-level potency ranking was 78%. The classification of chemicals as irritating versus non-irritating resulted in 96% sensitivity, 91% specificity and 95% accuracy. 2015 FRAME.